RU2804776C2 - AGENTS FOR RNAi, COMPOSITIONS AND METHODS OF THEIR USE FOR THE TREATMENT OF DISEASES ASSOCIATED WITH TRANSTHYRETIN (TTR) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions is described, including a double-stranded RNAi agent for inhibiting the expression of transthyretin (TTR) in a cell (variants), a pharmaceutical composition for inhibiting the expression of transthyretin (TTR), a method of inhibiting the expression of transthyretin (TTR) in a cell and a set for its implementation, a method of treating or preventing a TTR-associated disease in an individual, and a set for its implementation. In one embodiment, the double-stranded agent comprises a sense strand and an antisense strand with the following sequences of SEQ ID NO: 2211 and 2217, respectively.

EFFECT: invention expands the arsenal of agents for inhibiting the expression of transthyretin (TTR) in the cell.

58 cl, 15 dwg, 10 tbl, 51 ex

Description

Related applications

This application claims priority to Provisional U.S. Patent Application No. 61/561,710, filed November 18, 2011, Provisional U.S. Patent Application No. 61/615,618, filed March 26, 2012, and Provisional U.S. Patent Application No. 61/680,098, filed on 6 August 2012, the entire contents of each of which are incorporated herein by reference.

List of sequences

The present application contains a sequence listing that was submitted in ASCII format via EFS-Web and is therefore incorporated by reference in its entirety. The ASCII copy in question, created on November 13, 2012, is named 121301WO.txt and is 541508 bits in size.

BACKGROUND OF THE INVENTION

Transthyretin (TTR) (also known as prealbumin) is found in serum and cerebrospinal fluid (CSF). TTR transports retinol binding protein (RBP) and thyroxine (T4), and also acts as a carrier of retinol (vitamin A) through its association with RBP in the blood and CSF. Transthyretin is so named because it transports thyroxine and retinol. TTR also functions as a protease and can cleave proteins containing apoA-I (major HDL apolipoprotein), amyloid-β peptide, and neuropeptide Y. See Liz, M.A. et al., (2010) IUBMB Life, 62(6):429-435.

TTR is a tetramer of four identical 127 amino acid long subunits (monomers) in which a predominant beta sheet structure is observed. Each monomer contains two 4-stranded beta sheets and is shaped like a flattened ellipsoid. Antiparallel beta sheet interactions link monomers into dimers. A short loop of each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposing convex beta sheets of the dimers to form an internal channel.

The liver is the main site expressing TTR. Other significant sites of expression include the choroid plexus, retina (particularly the retinal pigment epithelium) and pancreas.

Transthyretin is one of at least 27 distinct types of proteins and is a precursor protein in the formation of amyloid fibrils. See Guan J. et al., (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am. J. Physiol. Heart Circ. Physiol., doi:10.1152/ajpheart.00815.2011. Extracellular deposition of amyloid fibrils in organs and tissues is a sign of amyloidosis. Amyloid fibrils are composed of misfolded protein aggregates that can result from overproduction or specific mutations in precursor proteins. The amyloidogenic potential of TTR may be related to its predominant beta-sheet structure, with X-ray crystallographic studies suggesting that certain amyloidogenic mutations reduce the stability of the protein's tetrameric structure. See, for example, Saraiva M.J.M., (2002) Expert Reviews in Molecular Medicine, 4(12): 1-11.

Amyloidosis is a general term for a group of amyloid-related diseases that are characterized by the deposition of amyloid. Amyloid-related diseases are classified based on their precursor protein, eg names starting with "A" for amyloid followed by an abbreviation for the precursor protein, eg ATTR for amyloid transthyretin, ibid .

There are a number of TTR-associated diseases, most of which are amyloid-related diseases. Normal sequence TTR is associated with cardiac amyloidosis in the elderly and is called senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA is typically accompanied by microscopic deposits in many other organs. TTR amyloidosis occurs in various forms. When the peripheral nervous system is mostly affected, the disease is called familial amyloidotic polyneuropathy (FAP). When the heart is affected but the nervous system is not affected, the disease is called familial amyloidotic cardiomyopathy (FAC). The third major type of TTR amyloidosis is leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or form VII amyloidosis. Mutations in TTR can also cause amyloidotic vitreous opacities, carpal tunnel syndrome, and euthyroid hyperthyroxinemia, which is a non-amyloidotic disorder thought to be secondary to increased association of thyroxine with TTR due to a mutant TTR molecule with increased affinity for thyroxine. See, for example, Moses et al., (1982) J. Clin. Invest., 86, 2025-2033.

Abnormal amyloidogenic proteins may be inherited or acquired as a result of somatic mutations. Guan J. et al., (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am. J. Physiol. Heart Circ. Physiol., doi:10.1152/ajpheart.00815.2011. Transthyretin-associated ATTR is the most common form of hereditary systemic amyloidosis. Lobato L (2003) J Nephrol 16:438–442. TTR mutations accelerate the process of TTR amyloid formation and represent the most important risk factor for the development of ATTR. More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis. TTR mutations typically lead to the formation of systemic amyloid deposits, particularly affecting the peripheral nervous system, although some mutations are associated with cardiomyopathy or vitreous opacities, ibid.

The V30M mutation is the most common TTR mutation. See, for example, Lobato L., (2003) J. Nephrol., 16:438-442. The V122I mutation is carried by 3.9% of the African American population and is the most common cause of FAC. Jacobson D.R. et al., (1997) N. Engl. J. Med., 336 (7): 466-73. SSA is estimated to affect more than 25% of the population over 80 years of age. Westermark P. et al., (1990) Proc. Natl. Acad. Sci. USA, 87 (7): 2843-5.

Thus, there is a need in the art for effective treatments for TTR-associated diseases.

The essence of the invention

The present invention relates to RNAi agents, for example, double-stranded RNAi agents targeting the transthyretin (TTR) gene. The present invention also provides methods for inhibiting TTR expression and methods for treating or preventing a TTR-associated disease in an individual using RNAi agents, such as the double-stranded RNAi agents of the invention. The present invention is based at least in part on the discovery that RNAi agents that contain specific chemical modifications have excellent ability to inhibit TTR expression. The present disclosure demonstrates that agents containing a specific pattern of chemical modifications (eg, an alternating pattern) and a ligand are effective in inhibiting TTR gene activity. In addition, agents containing one or more motifs of three identical modifications in three consecutive nucleotides containing one such motif at or near the agent's cleavage site have unexpectedly increased TTR gene suppression activity. When one such chemical motif is contained in the agent, it is preferably located in or near the cleavage region to enhance gene expression suppression activity. The cleavage region is the area surrounding the cleavage site, i.e. the site on the target mRNA where cleavage occurs.

Thus, in one aspect, the present invention provides RNAi agents, eg, double-stranded RNAi agents, for inhibiting transthyretin (TTR) expression. A double-stranded RNAi agent contains a sense strand complementary to the antisense strand. The antisense strand contains a region complementary to the region of the mRNA encoding transthyretin. Each strand contains from 14 to 30 nucleotides, and the double-stranded RNAi agent is represented by formula (III):

semantic chain: 5'n _p -N _a -(XXX) _i- N _b -YYY-N _b -(ZZZ) _j -N _a -n _q 3' antisense strand: 3'n _p '-N _a '-(X'X'X') _k -N _b '-Y'Y'Y'-N _b '-(Z'Z'Z') _l- N _a '-n _q '5' (III)

In Formula III, i, j, k and l are each independently 0 or 1; p, p', q and q' are each independently 0-6; each N _a and N _a ' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are modified or unmodified, or combinations thereof, where each sequence contains at least two differently modified nucleotides; each N _b and N _b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides that are modified or unmodified, or combinations thereof; n _p , n _p ', n _q and n _q ' are each independently an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications at three consecutive nucleotides; modifications in N _b are different from modifications in Y, and modifications in N _b ' are different from modifications in Y'. In some embodiments, the sense strand is conjugated to at least one ligand, such as at least one ligand attached to the 3' end of the sense strand. In other embodiments, the ligand may be conjugated to an antisense strand.

In some embodiments, i is 1; j is 1; or i and j are equal to 1.

In some embodiments, k is 1; l equals 1; or k and l are equal to 1.

In some embodiments, i is 0; j is equal to 1.

In some embodiments, i is 1; j is 0.

In some embodiments, k is 0; l is equal to 1.

In some embodiments, k is 1; l is 0.

In some embodiments, XXX is the complementary of X'X'X', YYY is the complementary of Y'Y'Y', and ZZZ is the complementary of Z'Z'Z'.

In some embodiments, the YYY motif is located at or near the sense strand cleavage site.

In some embodiments, the Y'Y'Y' motif is located at positions 11, 12, and 13 of the antisense strand from the 5' end.

In some embodiments, Y' is 2'-O-methyl.

In some embodiments, Y' is 2'-fluoro.

In some embodiments, formula (III) is represented as formula (IIIa):

semantic chain: 5'n _p -N _a -YYY-N _b -ZZZ-N _a -n _q 3' antisense strand: 3'n _p '-N _a '-Y'Y'Y'-N _b '-Z'Z'Z'-N _a 'n _q '5' (IIIa)

In formula IIIa, each N _b and N _b ' independently represents an oligonucleotide sequence containing 1-5 modified nucleotides.

In some embodiments, formula (III) is represented as formula (IIIb):

semantic chain: 5'n _p -N _a -XXX-N _b -YYY-N _a -n _q 3' antisense strand: 3'n _p '-N _a '-X'X'X'-N _b '-Y'Y'Y'-N _a '-n _q '5' (IIIb)

In formula IIIb, each N _b and N _b ' are independently an oligonucleotide sequence containing 1-5 modified nucleotides.

In some embodiments, formula (III) is represented as formula (IIIc):

semantic chain: 5'n _p -N _a -XXX-N _b -YYY-N _b -ZZZ-N _a -n _q 3' antisense strand: 3'n _p '-N _a '-X'X'X'-N _b '-Y'Y'Y'-N _b '-Z'Z'Z'-N _a '-n _q '5' (IIIc)

In Formula IIIc, N _b and -N _b ' are each independently an oligonucleotide sequence containing 1-5 modified nucleotides, and N _a and N _a ' are each independently an oligonucleotide sequence containing 2-10 modified nucleotides.

In many embodiments, the length of the duplex region is 15-30 base pairs. In some embodiments, the length of the duplex region is 17-23 bp, 17-25 bp, 23-27 bp, 19-21 bp, or 21-23 bp.

In certain embodiments, each strand contains 15-30 nucleotides.

In some embodiments, modifications to the nucleotides are selected from the group consisting of LNK, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl and combinations thereof. In some preferred embodiments, the modifications in the nucleotides are 2'-O-methyl or 2'-fluoro.

In some embodiments, the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives linked via a divalent or trivalent branched linker. In specific embodiments, the ligand is

In some embodiments, the ligand is attached to the 3' end of the sense strand.

In some embodiments, the RNAi agent is conjugated to a ligand, as demonstrated in the following schematic drawing

where X represents O or S.

In some embodiments, the RNAi agent is conjugated to a ligand, as demonstrated in the following schematic drawing

In some embodiments, the RNAi agent further comprises at least one thiophosphate or methylphosphonate internucleotide linkage. In some embodiments, the thiophosphate or methylphosphonate internucleotide linkage is at the 3' end of one strand. In some embodiments, the strand is an antisense strand. In other embodiments, the circuit is a semantic circuit.

In certain embodiments, the base pair at position 1 of the 5' end of the duplex is an AU base pair.

In some embodiments, the Y nucleotides contain a 2'-fluoro modification.

In some embodiments, the Y' nucleotides contain a 2'-O-methyl modification.

In some embodiments, p'>0. In some such embodiments, each n is complementary to the target mRNA. In other such embodiments, each n is not complementary to the target mRNA. In some embodiments, p, p', q, and q' are 1-6. In some preferred embodiments, p'=1 or 2. In some preferred embodiments, p'=2. In some such embodiments, q'=0, p=0, q=0, and the overhanging nucleotides p' are complementary to the target mRNA. In other such embodiments, q'=0, p=0, q=0, and the overhanging nucleotides p' are not complementary to the target mRNA.

In some embodiments, the sense strand contains a total of 21 nucleotides, and the antisense strand contains a total of 23 nucleotides.

In certain embodiments, the bonds between n _p ' include thiophosphate bonds. In some such embodiments, the bonds between n _p ' are thiophosphate bonds.

In some embodiments, the RNAi agent is selected from the group of agents listed in Table 1.

In preferred embodiments, the RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546 and AD-51547.

Even in a more preferred embodiment, the RNAi agent is AD-51547 with the following structure:

semantic chain: 5'-UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAfL96-3' (SEQ ID NO:2) antisense strand: 5'-uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3' (SEQ ID NO:3),

where the lowercase nucleotides (a, u, g, c) mean 2'-O-methyl nucleotides; Nf (eg Af) means 2'-fluoronucleotide; s means phosphothiorate bond; L96 stands for GalNAc ₃ ligand.

In another aspect, the present invention provides a cell containing an RNAi agent for inhibiting TTR expression.

In a further aspect, the present invention provides a pharmaceutical composition comprising an RNAi agent for inhibiting TTR expression. In some embodiments, the pharmaceutical composition is a solution containing an RNAi agent. In some embodiments, the solution containing the RNAi agent is an unbuffered solution, such as saline or water. In other embodiments, the solution is a buffered solution, such as phosphate buffered saline (PBS). In other embodiments, the pharmaceutical composition is a liposome or lipid formulation. In some embodiments, the lipid composition contains XTC or MC3.

In yet another aspect, the present invention provides methods for inhibiting the expression of transthyretin (TTR) in a cell. The methods include contacting a cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit TTR expression in the cell, thereby inhibiting TTR expression in the cell.

In some embodiments, TTR expression is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least by about 60%, by at least about 70%, by at least about 80%, or by at least about 90%.

In other embodiments, the cell is brought into contact in vitro with an RNAi agent. In other embodiments, the cell is contained in an individual. In preferred embodiments, the individual is a human.

In further embodiments, the individual is an individual suffering from a TTR-associated disease, and the effective amount is a therapeutically effective amount. In other embodiments, the individual is an individual at risk of developing a TTR-associated disease, and the effective amount is a prophylactically effective amount. In some embodiments, the individual at risk of developing a TTR-associated disease is an individual who carries a TTR gene mutation that is associated with the development of a TTR-associated disease.

In some embodiments, the TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), familial systemic amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/central nervous system (CNS) amyloidosis, and hyperthyroxinemia .

In some embodiments, the individual suffers from TTR-associated amyloidosis, and the method reduces TTR amyloid deposition in the individual.

In other embodiments, the RNAi agent is administered to an individual by routes of administration selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intra-arterial, lymphatic, cerebrospinal, and any combinations thereof. In certain embodiments, the RNAi agent is administered to an individual by subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to an individual by subcutaneous administration. In some such embodiments, subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot.

In some embodiments, the RNAi agent is administered to an individual such that the RNAi agent is delivered to a specific site in the individual. In some embodiments, the site is selected from the group consisting of liver, choroid plexus, retina, and pancreas. In preferred embodiments, the site is the liver. In some embodiments, delivery of the RNAi agent is mediated by the asialoglycoprotein receptor (ASGP-R) contained in hepatocytes.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg to about 50 mg/kg, such as about 0.25 mg/kg to about 0.5 mg/kg, about 0.25 mg /kg to approximately 1 mg/kg, approximately 0.25 mg/kg to approximately 5 mg/kg, approximately 0.25 mg/kg to approximately 10 mg/kg, approximately 1 mg/kg to approximately 10 mg/ kg, approximately 5 mg/kg to approximately 15 mg/kg, approximately 10 mg/kg to approximately 20 mg/kg, approximately 15 mg/kg to approximately 25 mg/kg, approximately 20 mg/kg to approximately 30 mg/kg, from about 25 mg/kg to about 35 mg/kg, or from about 40 mg/kg to about 50 mg/kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, approximately 5 mg/kg, approximately 6 mg/kg, approximately 7 mg/kg, approximately 8 mg/kg, approximately 9 mg/kg, approximately 10 mg/kg, approximately 11 mg/kg, approximately 12 mg/kg, approximately 13 mg/kg, approximately 14 mg/kg, approximately 15 mg/kg, approximately 16 mg/kg, approximately 17 mg/kg, approximately 18 mg/kg, approximately 19 mg/kg, approximately 20 mg/kg, approximately 21 mg/kg kg, approximately 22 mg/kg, approximately 23 mg/kg, approximately 24 mg/kg, approximately 25 mg/kg, approximately 26 mg/kg, approximately 27 mg/kg, approximately 28 mg/kg, approximately 29 mg/kg, 30 mg/kg, approximately 31 mg/kg, approximately 32 mg/kg, approximately 33 mg/kg, approximately 34 mg/kg, approximately 35 mg/kg, approximately 36 mg/kg, approximately 37 mg/kg, approximately 38 mg /kg, approximately 39 mg/kg, approximately 40 mg/kg, approximately 41 mg/kg, approximately 42 mg/kg, approximately 43 mg/kg, approximately 44 mg/kg, approximately 45 mg/kg, approximately 46 mg/kg , approximately 47 mg/kg, approximately 48 mg/kg, approximately 49 mg/kg, or approximately 50 mg/kg.

In some embodiments, the RNAi agent is administered in two or more doses. In specific embodiments, the RNAi agent is administered at intervals selected from the group consisting of once every about 2 hours, once every about 3 hours, once every about 4 hours, once every about 6 hours, once every about 8 hours hours, once every approximately 12 hours, once every approximately 24 hours, once every approximately 48 hours, once every approximately 72 hours, once every approximately 96 hours, once every approximately 120 hours, once every approximately 144 hours , once every approximately 168 hours, once every approximately 240 hours, once every approximately 336 hours, once every approximately 504 hours, once every approximately 672 hours and once every approximately 720 hours.

In other embodiments, the method further includes assessing the level of TTR mRNA expression or TTR protein expression in a sample obtained from the individual.

In preferred embodiments, administration of the RNAi agent does not result in an inflammatory response in the individual, as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12 (p70), IL1β, IL-1ra, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, TNFα and any combinations thereof, in a sample from an individual.

In some embodiments, the RNAi agent is administered using a pharmaceutical composition.

In preferred embodiments, the RNAi agent is administered in solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered with a buffer solution, such as an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer, or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

In another embodiment, the pharmaceutical composition is a liposome or lipid composition containing SNALP or XTC. In one embodiment, the lipid composition contains MC3.

In another aspect, the invention provides methods for treating or preventing a TTR-associated disease in an individual. The methods include administering to an individual a therapeutically effective amount or a prophylactically effective amount of an RNAi agent, for example, a double-stranded RNAi agent, thereby treating or preventing a TTR-associated disease in the individual.

In some embodiments, TTR expression in a sample obtained from an individual is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about by 50%, by at least about 60%, or by at least about 70%, by at least about 80%, or by at least about 90%.

In some embodiments, the individual is a human.

In some embodiments, the individual is an individual suffering from a TTR-associated disease. In other embodiments, the individual is an individual at risk of developing a TTR-associated disease.

In some embodiments, the individual is an individual who carries a TTR gene mutation that is associated with the development of a TTR-associated disease.

In some embodiments, the TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), familial systemic amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/central nervous system (CNS) amyloidosis, and hyperthyroxinemia .

In some embodiments, the individual suffers from TTR-associated amyloidosis, and the method reduces TTR amyloid deposition in the individual.

In some embodiments, the RNAi agent is administered to an individual by a route of administration selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intra-arterial, lymphatic, cerebrospinal, and any combinations thereof. In some embodiments, the RNAi agent is administered to an individual via subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to an individual by subcutaneous administration. In some such embodiments, subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot.

In some embodiments, the RNAi agent is administered to an individual such that the RNAi agent is delivered to a specific site in the individual. In some such embodiments, the site is selected from the group consisting of liver, choroid plexus, retina, and pancreas. In preferred embodiments, the site is the liver. In some embodiments, delivery of the RNAi agent is mediated by the asialoglycoprotein receptor (ASGP-R) contained in hepatocytes.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg to about 50 mg/kg, such as about 0.25 mg/kg to about 0.5 mg/kg, about 0.25 mg /kg to approximately 1 mg/kg, approximately 0.25 mg/kg to approximately 5 mg/kg, approximately 0.25 mg/kg to approximately 10 mg/kg, approximately 1 mg/kg to approximately 10 mg/ kg, approximately 5 mg/kg to approximately 15 mg/kg, approximately 10 mg/kg to approximately 20 mg/kg, approximately 15 mg/kg to approximately 25 mg/kg, approximately 20 mg/kg to approximately 30 mg/kg, from about 25 mg/kg to about 35 mg/kg, or from about 40 mg/kg to about 50 mg/kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, approximately 5 mg/kg, approximately 6 mg/kg, approximately 7 mg/kg, approximately 8 mg/kg, approximately 9 mg/kg, approximately 10 mg/kg, approximately 11 mg/kg, approximately 12 mg/kg, approximately 13 mg/kg, approximately 14 mg/kg, approximately 15 mg/kg, approximately 16 mg/kg, approximately 17 mg/kg, approximately 18 mg/kg, approximately 19 mg/kg, approximately 20 mg/kg, approximately 21 mg/kg kg, approximately 22 mg/kg, approximately 23 mg/kg, approximately 24 mg/kg, approximately 25 mg/kg, approximately 26 mg/kg, approximately 27 mg/kg, approximately 28 mg/kg, approximately 29 mg/kg, 30 mg/kg, approximately 31 mg/kg, approximately 32 mg/kg, approximately 33 mg/kg, approximately 34 mg/kg, approximately 35 mg/kg, approximately 36 mg/kg, approximately 37 mg/kg, approximately 38 mg /kg, approximately 39 mg/kg, approximately 40 mg/kg, approximately 41 mg/kg, approximately 42 mg/kg, approximately 43 mg/kg, approximately 44 mg/kg, approximately 45 mg/kg, approximately 46 mg/kg , approximately 47 mg/kg, approximately 48 mg/kg, approximately 49 mg/kg, or approximately 50 mg/kg.

In some embodiments, the RNAi agent is administered in two or more doses. In specific embodiments, the RNAi agent is administered at intervals selected from the group consisting of once every about 2 hours, once every about 3 hours, once every about 4 hours, once every about 6 hours, once every about 8 hours hours, once every approximately 12 hours, once every approximately 24 hours, once every approximately 48 hours, once every approximately 72 hours, once every approximately 96 hours, once every approximately 120 hours, once every approximately 144 hours , once every approximately 168 hours, once every approximately 240 hours, once every approximately 336 hours, once every approximately 504 hours, once every approximately 672 hours and once every approximately 720 hours.

In other embodiments, the method further includes assessing the level of TTR mRNA expression or TTR protein expression in a sample obtained from the individual.

In preferred embodiments, administration of the RNAi agent does not result in an inflammatory response in the individual, as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12 (p70), IL1β, IL-1ra, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, TNFα and any combinations thereof, in a sample from an individual.

In some embodiments, the RNAi agent is administered using a pharmaceutical composition, such as a liposome.

In some embodiments, the RNAi agent is administered in solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in saline or water. In other embodiments, the siRNA is administered in a buffer solution, such as an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer, or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

In another aspect, the present invention provides a method of inhibiting transthyretin (TTR) expression in a cell, comprising contacting the cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit TTR expression in the cell. In one aspect, the double-stranded RNAi agent is selected from the group of agents listed in Table 1, thereby inhibiting the expression of transthyretin (TTR) in a cell.

In another aspect, the present invention provides a method of inhibiting transthyretin (TTR) expression in a cell, comprising contacting the cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit TTR expression in the cell. In one aspect, the double-stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby inhibiting transthyretin (TTR) in a cell.

In a further aspect, the present invention provides a method of treating or preventing a TTR-associated disease in an individual, comprising administering to the individual a therapeutically effective amount or a prophylactically effective amount of an RNAi agent, for example, a double-stranded RNAi agent. In one aspect, the double-stranded RNAi agent is selected from the group of agents listed in Table 1, thereby providing treatment or prevention of a TTR-associated disease in an individual.

In yet another aspect, the present invention provides a method of treating or preventing a TTR-associated disease in an individual, comprising administering to the individual a therapeutically effective amount or a prophylactically effective amount of an RNAi agent, for example, a double-stranded RNAi agent. In one aspect, the double-stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby providing treatment or prevention of a TTR-associated disease in an individual.

In additional aspects, the invention relates to kits for carrying out the methods of the invention. In one aspect, the invention provides a kit for performing a method of inhibiting the expression of transthyretin (TTR) in a cell, comprising contacting the cell with an RNAi agent, e.g., a double-stranded RNAi agent, in an amount effective to inhibit expression of said TTR in said cell, thereby inhibiting TTR expression in the cell. The kit contains an RNAi agent and instructions for use and optionally a means for administering the RNAi agent to an individual.

The present invention is further illustrated by the following detailed description and drawings.

Brief description of drawings

Figure 1 is a graph depicting administration of a single subcutaneous dose of a GalNAc-conjugated TTR RNAi agent to mice resulting in dose-dependent suppression of TTR mRNA.

Figure 2 is a graph depicting administration of a single subcutaneous dose of 7.5 mg/kg or 30 mg/kg of a GalNAc-conjugated TTR RNAi agent to mice resulting in long-lasting suppression of TTR mRNA.

Figure 3 shows the human TTR mRNA sequence.

Figure 4 is a graph depicting the improved inhibitory activity of RNAi agents modified relative to the parent AD-45163.

Figure 5 is a graph depicting the improved inhibitory activity of RNAi agents modified relative to the parent AD-45165.

Figure 6 is a graph depicting the improved inhibition due to free uptake after 4 hours of incubation with RNAi agents modified from the parent AD-45163.

Figure 7 is a graph depicting the improved inhibition due to free uptake after 24 hours of incubation with RNAi agents modified from the parent AD-45163.

Figure 8 is a graph depicting the improved inhibition resulting from free uptake after 4 hours of incubation with RNAi agents modified from the parent AD-45165.

Figure 9 is a graph depicting the improved inhibition resulting from free uptake after 24 hours of incubation with RNAi agents modified from the parent AD-45165.

Figure 10 is a graph depicting the suppression of TTR mRNA expression in transgenic mice that express V30M hTTR after administration of a single subcutaneous dose of RNAi agents AD-51544, AD-51545, AD-45163, AD-51546, AD-51547, or AD-45165 .

Figure 11 is a graph depicting the suppression of TTR protein expression in transgenic mice that express V30M hTTR following administration of a single subcutaneous dose of 5 mg/kg or 1 mg/kg of RNAi agents AD-51544, AD-51545, or AD-45163.

Figure 12 is a graph depicting the suppression of TTR protein expression in transgenic mice that express V30M hTTR following administration of a single subcutaneous dose of 5 mg/kg or 1 mg/kg of RNAi agents AD-51546, AD-51547, or AD-45165.

Figure 13 demonstrates the post-dosing blood collection protocol for monkeys that received 5x5 mg/kg RNAi agent (top line) or 1x25 mg/kg RNAi agent (bottom line).

Figure 14 is a graph depicting the suppression of TTR protein expression in non-human primates following subcutaneous administration of five doses of 5 mg/kg (top panel) or a single dose of 25 mg/kg (bottom panel) AD-45163, AD-51544, AD- 51545, AD-51546 or AD-51547.

Figure 15 is a graph depicting the suppression of TTR protein expression in non-human primates following subcutaneous administration of AD-51547 at a dose of 2.5 mg/kg (white squares), 5 mg/kg (black squares), or 10 mg/kg (shaded squares). squares) or PBS injection as a negative control (gray squares).

Detailed Description of the Invention

The present invention relates to RNAi agents, eg, double-stranded RNAi agents, and compositions targeting the transthyretin (TTR) gene. The present invention also provides methods for inhibiting TTR expression and methods for treating or preventing a TTR-associated disease in an individual using the RNAi agents of the invention, for example, double-stranded RNAi agents. The present invention is based at least in part on the discovery that RNAi agents that contain specific chemical modifications have superior ability to inhibit TTR expression. The present disclosure demonstrates that agents containing a specific pattern of chemical modifications (eg, an alternating pattern) and a ligand are effective in inhibiting TTR gene activity. In addition, agents containing one or more motifs of three identical modifications in three consecutive nucleotides containing one such motif at or near the agent's cleavage site exhibit unexpectedly increased TTR gene suppression activity. When the agent contains one such chemical motif, it is preferably located in or near the cleavage region to enhance gene silencing activity. The cleavage region is the area surrounding the cleavage site, i.e. the site on the target mRNA where cleavage occurs.

I. Definitions

As used herein, each of the following terms has a meaning associated with the meaning in this section.

The term “including” is used herein to denote and is used interchangeably with the phrase “including, but not limited to.”

The term “or” is used herein to denote and is used interchangeably with the term “and/or” unless the context clearly indicates otherwise.

As used herein, “transthyretin” (“TTR”) refers to a well-known gene and protein. TTR is also known as prealbumin, HsT2651, PALB and TBPA. TTR functions as a transporter for retinol binding protein (RBP), thyroxine (T4) and retinol, and is also capable of acting as a protease. The liver secretes TTR into the blood, and the choroid plexus secretes TTR into the cerebrospinal fluid. TTR is also expressed in the pancreas and retinal pigment epithelium. The greatest clinical significance of TTR is that normal and mutant TTR protein can form amyloid fibrils, which aggregate into extracellular deposits causing amyloidosis. For a review, see, for example, Saraiva M.J.M., (2002) Expert Reviews in Molecular Medicine, 4(12): 1-11. The molecular cloning and nucleotide sequence of rat transthyretin, as well as the distribution of mRNA expression, are described by Dickson P.W. et al., (1985) J. Biol. Chem., 260(13)8214-8219. The X-ray crystal structure of human TTR is described by Blake C.C. et al., (1974) J. Mol. Biol., 88, 1-12. The human TTR mRNA transcript sequence can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371. The mouse TTR mRNA sequence can be found under RefSeq accession number NM_013697.2, and the rat TTR mRNA sequence can be found under RefSeq accession number NM_012681.1.

As used herein, a “target sequence” refers to the contiguous portion of the nucleotide sequence of an mRNA molecule produced during transcription of the TTR gene, including mRNA that is the RNA processing product of the primary transcription product.

As used herein, the term “chain containing sequence” refers to an oligonucleotide containing a chain of nucleotides that is described by a sequence designated using standard nucleotide nomenclature.

"G", "C", "A" and "U" generally each represent a nucleotide that contains guanine, cytosine, adenine and uracil as a base, respectively. "T" and "dT" are used interchangeably herein and means a deoxyribonucleotide where the nucleic acid base is thymine, for example deoxyribothymine, 2'-deoxythymidine or thymidine. However, it should be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" can also refer to a modified nucleotide, as described in more detail below, or a mimetic substituent group. One skilled in the art will appreciate that guanine, cytosine, adenine and uracil can be substituted with other groups without substantially changing the base pairing properties of the oligonucleotide containing the nucleotide bearing such substituent group. For example, without limitation, a nucleotide containing inosine as its base may pair with nucleotides containing adenine, cytosine or uracil. Thus, nucleotides containing uracil, guanine or adenine can be replaced in the nucleotide sequences according to the invention with a nucleotide containing, for example, inosine. Sequences containing such substituent groups are embodiments of the invention.

“Double-stranded RNAi agent,” a double-stranded RNA (dsRNA) molecule, also referred to as “dsRNA agent,” “dsRNA,” “siRNA,” “mRNA agent,” as used interchangeably herein, refers to a complex of molecules ribonucleic acid having a duplex structure containing two antiparallel and substantially complementary, as defined below, nucleic acid chains. Typically, the majority of the nucleotides on each strand are ribonucleotides, but as detailed herein, each or both strands may also contain one or more non-ribonucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. Additionally, as used herein, an “RNAi agent” may contain chemically modified ribonucleotides; an RNAi agent may contain significant modifications in many nucleotides. Such modifications may include all types of modifications described herein or known in the art. Any such modifications as used in the siRNA molecule are included within the term “RNAi agent” for purposes of the present description and claims.

In another embodiment, the RNAi agent may be a single-stranded siRNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to Argonaute 2 RISC, which has endonuclease activity, which then cleaves the target mRNA. Single-stranded siRNA typically contains 15-30 nucleotides and is chemically modified. Design and testing of single-stranded siRNA are described in US Pat. No. 8,101,348 and Lima et al., (2012) Cell, 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as single-stranded siRNA as described herein or as chemically modified by methods described in Lima et al., (2012) Cell, 150:883-894.

The two strands forming a duplex structure may represent different sections of a single larger RNA molecule, or they may represent separate RNA molecules. When two strands are part of one larger molecule, and are thus connected by a continuous chain of nucleotides between the 3' end of one strand and the 5' end of the corresponding other strand, forming a duplex structure, the connecting strand of RNA is referred to as a hairpin loop. . When two structures are covalently linked by a means other than a continuous chain of nucleotides between the 3' end of one strand and the 5' end of the corresponding other strand, forming a duplex structure, the connecting structure is referred to as a "linker". RNA chains can contain the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of dsRNA minus any overhanging nucleotides that are contained in the duplex. In addition to the duplex structure, the RNAi agent may contain one or more overhanging nucleotides. The term "siRNA" as used herein is also used to refer to an RNAi agent as described above.

In another aspect, the agent is a single-stranded antisense RNA molecule. An antisense RNA molecule is complementary to a sequence in the target mRNA. Antisense RNA can inhibit translation in a stoichiometric manner by base pairing with the mRNA and physically interfering with the translation machinery, see Dias N. et al., (2002) Mol. Cancer Ther., 1:347–355. An antisense RNA molecule may contain approximately 15-30 nucleotides that are complementary to the target mRNA. For example, an antisense RNA molecule may contain a sequence of at least 15, 16, 17, 18, 19, 20 or more contiguous nucleotides from one of the antisense sequences from Table 1.

As used herein, a “protruding nucleotide” refers to an unpaired nucleotide or nucleotides that protrude from the duplex structure of an RNAi agent when the 3' end of one RNAi agent strand extends beyond the 5' end of the other strand or vice versa. "Blunt" or "blunt end" means that there are no unpaired nucleotides at the end of the double-stranded RNAi agent, i.e. does not contain protruding nucleotides. A blunt-ended RNAi agent is a dsRNA that is double-stranded throughout its length, i.e. does not contain nucleotides protruding at either end of the molecule. The RNAi agents of the invention include RNAi agents where the nucleotide extends at one end (ie, means with one sticky end and one blunt end), or the nucleotide extends at both ends.

The term “antisense strand” refers to a strand of a double-stranded RNAi agent that contains a region that is substantially complementary to the target sequence (eg, human TTR mRNA). As used herein, the term “region complementary to a region of transthyretin-encoding mRNA” refers to a region on the antisense strand that is substantially complementary to a region of the TTR mRNA sequence. When the region of complementarity is not completely complementary to the target sequence, mismatches are most tolerant in terminal regions and, if present, are typically found in the terminal region or regions, for example, 6, 5, 4, 3 or 2 nucleotides 5' and/or or 3' ends.

The term "sense strand" as used herein refers to a standard dsRNA that contains a region that is substantially complementary to the antisense strand region.

As used herein, the term “cleavage region” refers to the region that is located immediately adjacent to the cleavage site. The cleavage site is the region in the target where cleavage occurs. In some embodiments, the cleavage region contains three bases at the end and immediately adjacent to the cleavage site. In some embodiments, the cleavage region comprises two bases at the end and immediately adjacent to the cleavage site. In some embodiments, the cleavage site is specifically located at the region linked by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12, and 13.

As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence with respect to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide containing a second nucleotide sequence, as will be understood by one skilled in the art. Such conditions may, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing. Other conditions may apply, such as those corresponding to physiological conditions, as may occur within the body. One skilled in the art can determine the set of conditions most suitable for testing the complementarity of two sequences in accordance with the end use of the nucleotides being hybridized.

Sequences may be “fully complementary” to each other when base pairing of nucleotides of a first nucleotide sequence occurs with nucleotides of a second nucleotide sequence over the entire length of the first and second nucleotide sequences. However, in the case where the first sequence is designated as "substantially complementary" to the second sequence in the present description, the two sequences may be completely complementary, or they may form one or more, but typically no more than 4, 3 or 2 mismatched base pairs during hybridization, while maintaining the ability to hybridize under conditions most appropriate for their end use. However, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches with respect to the determination of complementarity. For example, a dsRNA containing one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length, where the longer oligonucleotide contains a 21 nucleotide sequence that is completely complementary to the shorter oligonucleotide, may also be designated as "fully complementary" for the purposes described in this description.

“Complementary” sequences, as used herein, may also contain or be fully formed non-Watson-Crick base pairs and/or base pairs derived from non-natural and modified nucleotides, provided that the above requirements are met regarding their ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, ambiguous G:U or Hoogsteen base pairing.

The terms “complementary,” “fully complementary,” and “substantially complementary” as used herein can be used to refer to the base pair match between sense strand and antisense dsRNA strand, or antisense dsRNA strand and target sequence, as will be apparent from the context in which they are used. .

As used herein, a polynucleotide that is "substantially complementary to at least a portion" of messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous region of the mRNA of interest (e.g., mRNA encoding TTR), including the 5' -UTR, open reading frame (ORF) or 3'-UTR. For example, a polynucleotide is complementary to at least a portion of a TTR mRNA if the sequence is substantially complementary to a contiguous portion of the mRNA encoding the TTR.

The term "inhibition" as used herein is used interchangeably with "reduction", "suppression", "reduction", "attenuation" and other similar terms, and includes any level of inhibition.

The phrase “inhibiting TTR expression” as used herein includes inhibiting the expression of any TTR gene (such as, for example, a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene), as well as variants or mutants of the TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (such as a mutant TTR gene resulting in the formation of systemic amyloid deposition), or a transgenic TTR gene in relation to cells, a group of cells or an organism that has been genetically manipulated.

“Inhibition of TTR gene expression” includes any level of inhibition of the TTR gene, such as at least partial inhibition of TTR gene expression, such as at least about 5% inhibition, at least about 10% inhibition, at least about 15% inhibition , at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, according to at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

TTR gene expression can be assessed based on the level of any variable associated with TTR gene expression, for example, the level of TTR mRNA, the level of TTR protein, the level of retinol binding protein, the level of vitamin A, or the number or extent of amyloid deposits. Inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level can be any type of control level that is used in the art, for example, a baseline level before dosing or a level determined in the same individual, cell or sample that was not treated or treated with a control (such as, for example, buffer control only or inactive control).

The phrase "contacting a cell with an RNAi agent" as used herein includes contacting the cell in any manner possible. Contacting a cell with an RNAi agent, such as a double-stranded RNAi agent, includes contacting the cell in vitro with the RNAi agent or contacting the cell in vivo with the RNAi agent. Bringing into contact can be carried out directly or indirectly. Thus, for example, the RNAi agent can be brought into physical contact with a cell in a separately conducted manner or, alternatively, the RNAi agent can be created into a situation that allows or causes it to subsequently come into contact with the cell.

Cell contacting in vitro can be accomplished, for example, by incubating the cells with an RNAi agent. Contacting a cell in vivo can be accomplished, for example, by injecting an RNAi agent into or near the tissue where the cell is located, or by injecting an RNAi agent into another area, such as the bloodstream or subcutaneous space, such that the agent then it enters the tissue where the cell that needs to be contacted is located. For example, the RNAi agent may contain and/or be conjugated to a ligand, such as a GalNAc ₃ ligand, that directs the RNAi agent to a site of interest, such as the liver. Combinations of in vitro and in vivo methods are also possible. With respect to the methods of the invention, a cell can also be contacted in vitro with an RNAi agent and then transplanted into an individual.

"Patient" or "individual" as used herein is intended to include a human or non-human animal, preferably a mammal, such as a monkey. Most preferably, the individual or patient is a human.

"TTR-associated disease" as used herein is intended to include any disease associated with a TTR gene or protein. Such a disease may be caused, for example, by overproduction of the TTR protein, a mutation in the TTR gene, abnormal cleavage of the TTR protein, abnormal interactions between TTR and other proteins, or other endogenous or exogenous substances. “TTR-associated disease” includes any type of TTR amyloidosis (ATTR) where TTR plays a major role in the formation of abnormal extracellular amyloid aggregates or deposits. TTR-associated diseases include senile systemic amyloidosis (SSA), familial systemic amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/central nervous system (CNS) amyloidosis, amyloidotic vitreous opacities, carpal tunnel syndrome, and hyperthyroxinemia . Symptoms of TTR amyloidosis include sensory neuropathy (eg, paresthesia, hypoesthesia in the distal extremities), autonomic neuropathy (eg, gastrointestinal dysfunction such as gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, syndrome carpal tunnel, autonomic failure, cardiomyopathy, vitreous opacities, renal failure, nephropathy, significantly reduced mBMI (modified body mass index), cranial nerve dysfunction, and lattice corneal degeneration.

A "therapeutically effective amount" as used herein is intended to include an amount of an RNAi agent that, when administered to a patient to treat a TTR-associated disease, is sufficient to provide treatment for the disease (e.g., by attenuating, ameliorating, or maintaining an existing disease or one or more symptoms of the disease). The “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and history, age, weight, family history, gene profile, stage of the disease process mediated by TTR expression, types of prior or concomitant treatments in the presence of other individual characteristics of the patient being treated.

A "prophylactically effective amount" as used herein is intended to include an amount of an RNAi agent that, when administered to an individual who is not yet experiencing or exhibiting symptoms of a TTR-associated disease, but who may be predisposed to the disease, is sufficient to prevent or improve a disease or one or more symptoms of a disease. Symptoms that may be improved include sensory neuropathy (eg, paresthesia, hypoesthesia in the distal extremities), autonomic neuropathy (eg, gastrointestinal dysfunction such as gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic failure, cardiomyopathy, vitreous opacities, renal failure, nephropathy, significant reduction in mBMI (modified body mass index), cranial nerve dysfunction and lattice corneal degeneration. Improvement of a disease includes slowing the progression of a disease or reducing the severity of a later developing disease. The “prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, disease risk and history, age, weight, family history, gene profile, types of prior or concomitant treatments, if any, and other individual characteristics of the patient being treated. .

A “therapeutically effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable risk/benefit ratio applicable to any treatment. The RNAi agents used in the methods of the present invention can be administered in sufficient quantities to provide a reasonable risk/benefit ratio applicable to such treatment.

The term "sample" as used herein includes a collection of similar fluids, cells or tissues obtained from an individual, as well as fluids, cells or tissues contained in an individual. Examples of biological fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, intraocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs, or localized areas. For example, samples can be obtained from specific organs, parts of organs or fluids, or cells in such organs. In certain embodiments, samples can be obtained from the liver (for example, the whole liver or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes), the retina or parts of the retina (for example, the retinal pigment epithelium), the central nervous system, or parts of the central nervous system (such as the ventricles or choroid plexus) or the pancreas or certain types of cells or parts of the pancreas. In some embodiments, a “sample obtained from an individual” refers to cerebrospinal fluid obtained from an individual. In preferred embodiments, “sample obtained from an individual” refers to blood or plasma obtained from an individual. In further embodiments, “sample obtained from an individual” refers to liver tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) obtained from an individual.

II. RNAi Tools

The present invention provides RNAi agents with excellent gene expression silencing activity. The present specification and provisional patent application No. 61/561710 (on which priority is claimed in this application) demonstrate that superior results can be obtained by introducing one or more motifs of three identical modifications into three consecutive nucleotides in the sense and/or antisense strand. chains of the RNAi agent, particularly at or near the cleavage site. The sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of such motifs disrupts the modification patterns, if present, of the sense and/or antisense chain. The RNAi agent is also optionally conjugated to a GalNAc derivative ligand, for example on the sense strand. The resulting RNAi agents have excellent gene expression suppression activity.

The inventors have unexpectedly discovered that when the sense strand and antisense strand of an RNAi agent are completely modified to contain one or more motifs of three identical modifications at three consecutive nucleotides at or near the cleavage site of at least one RNAi agent strand, the gene expression silencing activity of an RNAi agent.

Thus, the invention relates to RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of a target gene (ie, the TTR gene) in vivo. The RNAi agent contains a sense strand and an antisense strand. The length of each strand of an RNAi agent can be in the range of 12-30 nucleotides. For example, the length of each chain can be 14-30 nucleotides, 17-30 nucleotides, 25-30 nucleotides, 27-30 nucleotides, 17-23 nucleotides, 17-21 nucleotides, 17-19 nucleotides, 19-25 nucleotides, 19-23 nucleotide, 19-21 nucleotide, 21-25 nucleotide or 21-23 nucleotide.

The sense strand and the antisense strand typically form duplex double-stranded RNA (“dsRNA”), also referred to herein as “RNAi agent.” The length of the duplex region of the RNAi agent can be 12-30 base pairs. For example, the length of the duplex region may be 14-30 bp, 17-30 bp, 27-30 bp, 17-23 bp, 17-21 bp, 17-19 bp, 19-25 bp, 19 -23 bp, 19-21 bp, 21-25 bp, or 21-23 bp. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 27.

In one embodiment, the RNAi agent may comprise one or more regions of overhangs and/or capping groups of the RNAi agent at the 3' end or the 5' end, or at both ends of the strand. The overhang can be 1-6 nucleotides, for example 2-6 nucleotides, 1-5 nucleotides, 2-5 nucleotides, 1-4 nucleotides, 2-4 nucleotides, 1-3 nucleotides, 2-3 nucleotides or 1-2 nucleotides . Sticky ends may be the result of one chain being longer than the other, or the result of two chains of the same length being subjected to a step break. The sticky end may mismatch the target mRNA, or it may be complementary to the targeting sequences of the gene, or it may be a different sequence. The first and second strands can also be connected, for example, by additional bases to form a hairpin, or by other non-base linkers.

The RNAi agents provided by the present invention include those with chemical modifications as described, for example, in US Provisional Application No. 61/561710, filed November 18, 2011, International Application No. PCT/US 2011/051597, filed September 15, 2010, and PCT publication WO 2009/073809, the entire contents of each of which are incorporated herein by reference.

In one embodiment, each nucleotide in the overhang region of the RNAi agent may independently be a modified or unmodified nucleotide, including, but not limited to, a modified 2'-sugar such as, 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo) or any combination thereof. For example, TT can be a sticky end sequence for any end of any chain. The sticky end may form a mismatch to the target mRNA, or it may be complementary to the targeting sequences of the gene, or it may be a different sequence.

The 5' or 3' overhanging ends on the sense strand, antisense strand, or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region comprises two nucleotides containing a thiophosphate between the two nucleotides, where the two nucleotides may be the same or different. In one embodiment, the sticky end is at the 3' end of the sense strand, the antisense strand, or both. In one embodiment, such a 3'-overhanging end is contained in the antisense strand. In one embodiment, such a 3' overhang is contained in the sense strand.

The RNAi agent may contain only one sticky end, which can enhance the RNAi interference activity without affecting its overall stability. For example, the single-stranded overhang is located at the 3' end of the sense strand or, alternatively, at the 3' end of the antisense strand. RNAi may also contain a blunt end located at the 5' end of the antisense strand (or 3' end of the sense strand) or vice versa. Typically, the antisense RNAi strand contains an overhanging nucleotide at the 3' end, and the 5' end is blunt. Although applicants are not bound by theory, the theoretical mechanism is that the asymmetric blunt end at the 5' end of the antisense strand and the 3' sticky end of the antisense strand cause the guide strand to undergo the RISC process.

In one embodiment, the RNAi agent is a double blunt-ended oligonucleotide of 19 nucleotides in length, where the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 7,8,9 from 5' -end. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In one embodiment, the RNAi agent is a 20 nucleotide long blunt-ended oligonucleotide where the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 8,9,10 from 5' -end. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In one embodiment, the RNAi agent is a double blunt-ended oligonucleotide of 21 nucleotides in length, where the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 9, 10, 11 from 5' -end. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In one embodiment, the RNAi agent comprises a sense strand of 21 nucleotides (nt) and an antisense strand of 23 nucleotides (nt), where the sense strand contains at least one motif of three 2'-F modifications at three consecutive nucleotides at positions 9 , 10, 11 from the 5'end; the antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, 13 from the 5' end, where one end of the RNAi agent is blunt while the other end contains a sticky end with 2 nucleotides. Preferably, the 2-nucleotide overhang is at the 3' end of the antisense strand. Optionally, the RNAi agent further contains a ligand (preferably GalNAc ₃ ).

In one embodiment, the RNAi agent comprises a sense and an antisense strand, where the length of the sense strand is 25-30 nucleotide residues, where starting from positions 1 to 23 of the 5'-terminal nucleotide (position 1) of the first strand, there are at least 8 ribonucleotides; the length of the antisense chain is 36-66 nucleotide residues and, starting from the 3'-terminal nucleotide, contains at least 8 ribonucleotides in positions paired with positions 1-23 of the sense strand to form a duplex; wherein at least the 3'-terminal nucleotide of the antisense strand is unpaired with the sense strand, and up to 6 consecutive 3'-terminal nucleotides are unpaired with the sense strand, thereby forming a single-stranded 3'-overhanging end of 1-6 nucleotides; wherein the 5' end of the antisense strand contains 10-30 consecutive nucleotides that are unpaired with the sense strand, thereby forming a single-stranded 5' overhanging end of 10-30 nucleotides in length; wherein at least the 5'-terminal and 3'-terminal nucleotides of the sense strand are paired with nucleotides of the antisense strand, wherein the sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplex region between the sense and antisense strands; and the antisense strand is sufficiently complementary to the target RNA for at least 19 ribonucleotides of the antisense strand to reduce expression of the target gene when the double-stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides, wherein at least one of the motifs is located at or near a cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides at or near the cleavage site.

In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand that is at least 25 and no more than 29 nucleotides in length and a second strand that is no more than 30 nucleotides in length, from to at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, 13 from the 5' end; wherein the 3' end of the first strand and the 5' end of the second strand form a blunt end, and the second strand is 1-4 nucleotides longer at its 3' end than the first strand, wherein a duplex region that is at least 25 nucleotides in length , and the second strand are sufficiently complementary to the target mRNA for at least 19 nucleotides of the second strand to reduce expression of the target gene when the RNAi agent is introduced into a mammalian cell, and wherein Dicer enzyme cleavage of the RNAi agent preferentially results in an siRNA containing 3 '-end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further contains a ligand.

In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications in three consecutive nucleotides, where one of the motifs is located at a cleavage site in the sense strand.

In one embodiment, the antisense strand of the RNAi agent may also contain at least one of three identical modification motifs in three consecutive nucleotides, where one of the motifs is located at or near a cleavage site in the antisense strand.

For an RNAi agent containing a duplex region of 17-23 nucleotides in length, the antisense strand cleavage site is typically located around positions 10, 11 and 12 from the 5' end. Thus, motifs from three identical modifications can be located in positions 9, 10, 11; positions 10, 11, 12; positions 11, 12, 13; positions 12, 13, 14 or positions 13, 14, 15 of the antisense strand, where numbering starts from the 1st nucleotide of the 5' end of the antisense strand, or numbering starts from the 1st paired nucleotide in the duplex region from the 5' end of the antisense strand . The cleavage site on the antisense strand can also vary depending on the length of the RNAi duplex region from the 5' end.

The sense strand of an RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site, and the antisense strand may contain at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site . When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand may be aligned such that one three-nucleotide motif of the sense strand and one three-nucleotide motif of the antisense strand contain at least one nucleotide overlap, i.e. . at least one of the three motif nucleotides in the sense strand forms a complementary base pair with at least one of the three motif nucleotides in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications in three consecutive nucleotides. The first motif must be located at or near the cleavage site of the chain, and other motifs may be wing modifications. The term “wing modification” as used herein refers to a motif located at another site on a chain that is separate from a motif at or near a cleavage site on the same chain. The wing modification is adjacent to or separated from the first motif by at least one or more nucleotides. When the motifs are directly adjacent to each other, the chemical structures of the motifs are different from each other, and when the motifs are separated by one or more nucleotides, the chemical structures may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are contained, each wing modification may be located at one end relative to the first motif that is located at or near the cleavage site, or on either side of the leader motif.

Similar to the sense strand, the antisense strand of an RNAi agent may contain at least two motifs of three identical modifications in three consecutive nucleotides, where at least one of the motifs is located at or near a cleavage site of the strand. Such an antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications contained in the sense strand.

In one embodiment, the wing modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

In another embodiment, the wing modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.

When the sense strand and the antisense strand of the RNAi agent contain at least one wing modification, the wing modifications may be at the same end of the duplex region and contain an overlap of one, two, or three nucleotides.

When the sense strand and antisense strand of an RNAi agent contain at least two wing modifications, the sense strand and antisense strand may be aligned such that two modifications, each from the same strand, are at one end of a duplex region with an overlap of one, two, or three nucleotides; two modifications, each from the same strand, are at the other end of the duplex region with an overlap of one, two or three nucleotides; two single-strand modifications are found on each side of the leader motif with an overlap of one, two, or three nucleotides in the duplex region.

In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent can be modified, including nucleotides that are part of the motifs. Each nucleotide can be modified with the same or different modifications, which may include one or more changes to one or both of the non-bonded phosphate oxygens and/or one or more bonded phosphate oxygens; changing a component of the ribose sugar, such as the 2'-hydroxyl in the ribose sugar; complete replacement of the phosphate group with “dephospho” linkers; modification or replacement of the natural base; and replacement or modification of the ribose phosphate backbone.

Due to the fact that nucleic acids are polymers of subunits, many modifications are at a position that is repeated in the nucleic acid, such as modification of a base or a phosphate group, or a non-O bonding phosphate group. In some cases the modification is found at all individual positions in the nucleic acid, but in many cases this is not the case. As an example, the modification may be only at the 3' or 5' terminal position, may be only in the terminal region, for example, at a position at the terminal nucleotide or in the last 2, 3, 4, 5 or 10 nucleotides of the chain. The modification may be located in the double strand region, the single strand region, or both. The modification may only be in the region of the double strand of RNA or may be only in the region of one strand of RNA. For example, the thiophosphate modification at the non-O linkage position may be at only one or both ends, may be only at the terminal region, such as at a position at the terminal nucleotide or the last 2, 3, 4, 5 or 10 nucleotides of the chain, or may located in the double-strand and single-strand regions, particularly at the ends. The 5' end or ends may be phosphorylated.

It is possible, for example, to increase stability, to introduce specific bases into the overhangs, or to introduce modified nucleotides or nucleotide mimics into the overhangs of one strand, for example, the 5' or 3' overhangs, or both strands. For example, it may be desirable to introduce purine nucleotides into the sticky ends. In some embodiments, all or some of the bases at the 3' or 5' overhang can be modified, for example, with a modification described herein. Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar with modifications that are known in the art, for example, the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro- (2'-F) or 2'-O -methyl-modified instead of the ribose sugar of the nucleic base, and modification in the phosphate group, for example, modification of thiophosphates. The sticky ends must be homologous to the target sequences.

In one embodiment, each sense strand and antisense strand residue is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy , 2'-hydroxyl or 2'-fluorine. Circuits may contain more than one modification. In one embodiment, each residue of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

At least two different modifications are typically contained in the sense strand and the antisense strand. Such two modifications may be 2'-O-methyl or 2'-fluoro modifications, or others.

In one embodiment, N _a and/or N _b comprise alternating pattern modifications. The term "alternating motif" as used herein refers to a motif containing one or more modifications, where each modification is located at alternating nucleotides on the same strand. An alternating nucleotide may refer to one every other nucleotide or one every three nucleotides or a similar pattern. For example, if A, B, and C each represent one type of nucleotide modification, the alternating motif may be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB..." or "ABCABCABCABC..." etc.

The type of modifications contained in the alternating motif may be the same or different. For example, if each A, B, C, D represents one type of modification in a nucleotide, the alternating pattern, i.e. modifications at each successive nucleotide may be the same, but each for the sense strand or antisense strand can be selected from several modification possibilities in an alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD..." or "CDCDCD...", etc. .d.

In one embodiment, the RNAi agent of the invention comprises a modification pattern for an alternating motif in the sense strand that is shifted relative to the modification pattern for an alternating motif in the antisense strand. The shift may be such that a modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand, when paired with an antisense strand in a dsRNA duplex, the alternating motif in the sense strand may begin with "ABABAB" from the 5'-3' strand, and the alternating motif in the antisense strand may begin with "BABABA" from the 5'- 3' chains in the duplex region. As another example, an alternating motif in the sense strand may begin with "AABBAABB" from the 5'-3' strand, and an alternating motif in the antisense strand may begin with "BBAABBAA" from the 5'-3' strand in the duplex region, thus that there is a complete or partial shift in the modification pattern between the sense strand and the antisense strand.

In one embodiment, the RNAi agent comprises a pattern of alternating 2'-O-methyl modification and 2'-F modification motif on the sense strand that is initially shifted relative to the pattern of alternating 2'-O-methyl modification and 2' -F modifications in the antisense strand, i.e. A 2'-O-methyl-modified nucleotide in the sense strand base pairs with a 2'-F-modified nucleotide in the antisense strand and vice versa. 1 position of the sense strand may begin with a 2'-F modification, and 1 position of the antisense strand may begin with a 2'-O-methyl modification.

The introduction of one or more motifs of three identical modifications at three consecutive nucleotides into the sense strand and/or antisense strand disrupts the original modification pattern contained in the sense strand and/or antisense strand. Such disruption of the sense and/or antisense strand modification pattern by introducing one or more of three identical modification motifs at three consecutive nucleotides into the sense and/or antisense strand unexpectedly enhances the suppression activity of the target gene.

In one embodiment, when a motif of three identical modifications at three consecutive nucleotides is introduced into any of the strands, the modification of the nucleotide following the motif is a different modification than the modification of the motif. For example, the sequence region containing the motif is "...N _a YYYN _b ...", where "Y" represents a modification of the motif of three identical modifications at three consecutive nucleotides, and "N _a " and "N _b " represent a modification at the nucleotide following the "YYY" motif, which is different from the Y modification, and where N _a and N _b may be the same or different modifications. Alternatively, N _a and/or N _b may or may not be present when the wing modification is contained.

The RNAi agent may further comprise at least one thiophosphate or methylphosphonate internucleotide linkage. The modification of the thiophosphate or methylphosphonate internucleotide bond can be at any nucleotide of the sense strand or the antisense strand or both at any position in the strand. For example, the internucleotide bond modification may be at any nucleotide in the sense strand or antisense strand; each internucleotide linkage modification may be in an alternating pattern on the sense strand or antisense strand, or the sense strand or antisense strand may contain internucleotide linkage modifications in an alternating pattern. The alternating pattern of internucleotide bond modification in the sense strand may be the same or different from the antisense strand, and the alternating pattern of internucleotide bond modification in the sense strand may comprise a shift relative to the alternating pattern of internucleotide bond modification in the antisense strand.

In one embodiment, the RNAi agent comprises a thiophosphate or methylphosphonate modification of the internucleotide linkage in the cohesive end region. For example, the cohesive end region may contain two nucleotides containing a thiophosphate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications can also be made to link overhanging nucleotides to the terminal paired nucleotides in the duplex region. For example, at least 2, 3, 4, or all of the overhanging nucleotides may be linked by a thiophosphate or methylphosphonate internucleotide linkage, and optionally additional thiophosphate or methylphosphonate internucleotide linkages may be present linking the overhanging nucleotide to a paired nucleotide that is next after the overhanging nucleotide. For example, there may be at least two thiophosphate internucleotide bonds between the terminal three nucleotides, in which two of the three nucleotides are overhanging nucleotides and the third is a paired nucleotide following the overhanging nucleotide. Preferably, these terminal three nucleotides may be at the 3' end of the antisense strand.

In one embodiment, the RNAi agent comprises target mismatch(es) in the duplex or combinations thereof. The mismatch may be in the sticky end region or the duplex region. A base pair can be classified based on its ability to promote dissociation or melting (e.g., with respect to the free energy of association or dissociation of a particular pairing, the simplest approach is that based on individual pairs regardless of neighbor, or a similar analysis can also be used). With respect to the potential to promote dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I = inosine). Mismatches, such as non-canonical or different from a canonical pairing (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings that contain a universal base are favored over the canonical pairing.

In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4 or 5 base pairs in duplex regions from the 5' end of the antisense strand, which can be independently selected from the group: A:U, G: U, I:C and mismatched pairs, such as non-canonical or non-canonical pairings or pairings that contain a universal base, to ensure dissociation of the antisense strand at the 5' end of the duplex.

In one embodiment, the nucleotide at position 1 in the duplex region from the 5' end in the antisense strand is selected from the group consisting of A, dA, dU, U and dT. Alternatively, at least one of the first 1, 2 or 3 base pairs in the duplex region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the duplex region from the 5' end of the antisense strand is an AU base pair.

In one embodiment, the sequence of the sense chain can be represented by formula (I):

5'n _p -N _a -(XXX) _i -N _b -YYY-N _b -(ZZZ) _j -N _a -n _q 3' , (I)

Where:

i and j are each independently 0 or 1;

p and q each independently represent 0-6;

each N _a independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, where each sequence contains at least two differently modified nucleotides;

each N _b independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

each n _p and n _q independently represents a protruding nucleotide;

XXX, YYY and ZZZ each independently represent one motif of three identical modifications at three consecutive nucleotides. Preferably, YYY is all 2'-F-modified nucleotides.

In one embodiment, N _a and/or N _b comprises alternating pattern modifications.

In one embodiment, the YYY motif is located at or near a sense strand cleavage site. For example, when the RNAi agent contains a duplex region of 17-23 nucleotides, the YYY motif may be located at or near the cleavage site (e.g., may be located at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) sense strand, where numbering starts from the 1st nucleotide from the 5' end, or optionally numbering starts from the 1st paired nucleotide in the duplex region from 5 '-end.

In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or i and j are 1. Thus, the semantic chain can be represented by the following formulas:

5'n _p -N _a -YYY-N _b -ZZZ-N _a -n _q 3' (Ia); 5'n _p -N _a -XXX-N _b -YYY-N _a -n _q 3' (Ib); or 5'n _p -N _a -XXX-N _b -YYY-N _b -ZZZ-N _a -n _q 3' (Ic).

When the sense strand is represented by formula (Ia), N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

When the sense strand is represented by formula (Ib), N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides . Each N _a can independently represent an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

When the sense strand is represented by formula (Ic), each N _b independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5 or 6. Each N _a can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Each of X, Y and Z may be the same or different from each other.

In one embodiment, the sequence of the RNAi antisense strand can be represented by formula (II):

5'n _q' -N _a '-(Z'Z'Z) _k -N _b '-Y'Y'Y'-N _b '(X'X'X) _l -N' _a -n _p '3 ' (II),

Where:

k and l are each independently 0 or 1;

p' and q' are each independently 0-6;

each N _a ' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, where each sequence contains at least two differently modified nucleotides;

each N _b ' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

each n _p ' and n _q ' independently represents a protruding nucleotide;

where N _b ' and Y' do not contain the same modification;

And

X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications at three consecutive nucleotides.

In one embodiment, N _a ' and/or N _b ' comprise a modification of the alternating pattern.

The Y'Y'Y' motif is located at or near the cleavage site of the antisense strand. For example, when the RNAi agent contains a duplex region of 17-23 nucleotides in length, the Y'Y'Y' motif may be at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 antisense strand, where numbering starts from the 1st nucleotide from the 5' end; or optionally numbering starts from the 1st paired nucleotide in the duplex region from the 5' end. Preferably, the Y'Y'Y' motif is at positions 11, 12, 13.

In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or k and l are 1.

Thus, the antisense chain can be represented by the following formulas:

5'n _q '-N _a '-Z'Z'Z'-N _b '-Y'Y'Y'-Na'-n _p '3' (IIa); 5'n _q '-N _a '-Y'Y'Y'-N _b '-X'X'X'-n _p '3' (IIb); or 5'n _q '-N _a '-Z'Z'Z'-N _b '-Y'Y'Y'-N _b '-X'X'X'-N _a '-n _p '3' (IIc).

When the antisense strand is represented by formula (IIa), N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a ' independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

When the antisense strand is represented by formula (IIb), N _b ' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a ' independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

When the antisense strand is represented by formula (IIc), each N _b ' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a ' independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5 or 6.

Each of X', Y' and Z' may be the same or different from each other.

Each nucleotide of the sense strand and antisense strand can be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, 2'- deoxy or 2'-fluorine. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. In particular, X, Y, Z, X', Y' and Z' may each be a 2'-O-methyl modification or a 2'-fluoro modification.

In one embodiment, the sense strand of the RNAi agent may comprise a YYY motif located at positions 9, 10, and 11 of the strand when the length of the duplex region is 21 nucleotides, where numbering begins at the 1st nucleotide from the 5' end, or optionally numbering starts at the 1st base pair in the duplex region from the 5' end, and Y is a 2'-F modification. The sense strand may further contain an XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region, and XXX and ZZZ are each independently a 2'-OMe modification or a 2'-F modification.

In one embodiment, the antisense strand may contain a Y'Y'Y' motif located at positions 11, 12, 13 of the strand, where numbering begins at the 1st nucleotide from the 5' end, or optionally numbering begins at the 1st nucleotide nucleotide in the duplex region from the 5' end, and Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region, and X'X'X' and Z'Z'Z' are each independently 2' -OMe modification or 2'-F modification.

The sense strand represented by any of the above formulas (Ia), (Ib) and (Ic) forms a duplex, where the antisense strand is represented by any of the above formulas (IIa), (IIb) and (IIc), respectively.

Thus, the RNAi agents of the invention may comprise a sense strand and an antisense strand, each strand containing from 14 to 30 nucleotides, an RNAi duplex represented by formula (III):

semantic chain: 5'n _p -N _a -(XXX) _i -N _b -YYY-N _b -(ZZZ) _j N _a -n _q 3 antisense strand: 3'n _p '-N _a '-(X'X'X') _k -N _b '-Y'Y'Y'-N _b '-(Z'Z'Z') _l -N _a '-n _q '5' (III),

Where:

i, j, k and l are each independently 0 or 1;

p, p'q and q' are each independently 0-6;

each N _a and N _a independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, where each sequence contains at least two differently modified nucleotides;

each N _b and N _b ' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides,

Where

each _np ', _np , _nq ' and _nq independently represents an overhanging nucleotide, and

XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications at three consecutive nucleotides.

In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or i and j are 1. In another embodiment, k is 1 and l is 0, k is 0 and l is 1, or k and l are equal to 1.

Exemplary combinations of sense strand and antisense strand forming an RNAi duplex include the following formulas:

5'n _p -N _a -YYY-N _b -ZZZ-N _a -n _q 3' 3'n _p '-N _a '-Y'Y'Y'-N _b '-Z'Z'Z'-N _a 'n _q '5' (IIIa) 5'n _p -N _a -XXX-N _b -YYY-N _a -n _q 3' 3'n _p '-N _a '-X'X'X'-N _b '-Y'Y'Y'-N _a '-n _q '5' (IIIb) 5'n _p -N _a -XXX-N _b -YYY-N _b -ZZZ-N _a -n _q 3' 3'n _p '-N _a '-X'X'X'-N _b '-Y'Y'Y'-N _b '-Z'Z'Z'-N _a -n _q '5' (IIIc)

Where the RNAi agent is represented by formula (IIIa), each N _b independently represents an oligonucleotide sequence containing 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N _a is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the RNAi agent is represented by formula (IIIb), each _Nb , _Nb ' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the RNAi agent is represented by formula (IIIc), each _Nb , _Nb ' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a , N _a independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Each of N _a , N _a ', Nb and Nb' independently contains modifications of the alternating pattern.

Each of X, Y and Z in formulas (III), (IIIa), (IIIb) and (IIIc) may be the same or different from each other.

When the RNAi agent is represented by formula (III), (IIIa), (IIIb) or (IIIc), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides are base paired with corresponding Y' nucleotides, or all three Y nucleotides are all base paired with corresponding Y' nucleotides.

When the RNAi agent is represented by formula (IIIa) or (IIIc), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides are base paired with corresponding Z' nucleotides, or all three Z nucleotides are all base paired with corresponding Z' nucleotides.

When the RNAi agent is represented by formula (IIIb) or (IIIc), at least one of the nucleotides X may form a base pair with one of the nucleotides X'. Alternatively, at least two of the X nucleotides are base paired with corresponding X' nucleotides, or all three X nucleotides are all base paired with corresponding X' nucleotides.

In one embodiment, the modification in nucleotide Y is different from the modification in nucleotide Y', the modification in nucleotide Z is different from the modification in nucleotide Z', and/or the modification in nucleotide X is different from the modification in nucleotide X'.

In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb) or (IIIc), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further contains a ligand. Each of the duplexes may act on the same gene or two different genes, or each of the duplexes may act on the same gene at two different target sites.

In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb) or (IIIc), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further contains a ligand. Each of the duplexes may act on the same gene or two different genes, or each of the duplexes may act on the same gene at two different target sites.

In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb) or (IIIc) are linked to each other at the 5' end, and one or both 3' ends are optionally conjugated to a ligand . Each of the agents may act on the same gene or on two different genes, or each of the agents may act on the same gene at two different target sites.

Multimeric RNAi agents have been described in various publications. Such publications include WO 2007/091269, US Patent No. 7858769, WO 2010/141511, WO 2007/117686, WO 2009/014887 and WO 2011/031520, the entire contents of which are therefore incorporated herein by reference.

The RNAi agent contains conjugations of one or more carbohydrate groups to the RNAi agent, which can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate group is associated with a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of the dsRNA agent can be replaced by other groups, for example, a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is substituted in this manner is referred to herein as a ribose replacement modification subunit (RRMS). The cyclic support may be a carbocyclic system, i.e. all ring atoms are carbon atoms, or a heterocyclic system, i.e. one or more ring atoms may be a heteroatom, eg nitrogen, oxygen, sulfur. The cyclic support may be a monocyclic system or may contain two or more rings, for example fused rings. The cyclic support may be a fully saturated cyclic system, or it may contain one or more double bonds.

The ligand may be linked to the polynucleotide via a carrier. The carriers comprise (i) at least one "backbone attachment point", preferably two "backbone attachment points" and (ii) at least one "link attachment point". A "backbone attachment point" as used herein refers to a functional group, for example a hydroxyl group, or generally an accessible linkage, and which is suitable for introducing a support into the backbone, for example a phosphate or a modified phosphate, e.g. the sulfur-containing backbone of ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a ring-containing cyclic support atom, such as a carbon atom or heteroatom (other than the atom that constitutes the backbone attachment point), that connects the selected group. The group may be, for example, a carbohydrate, such as a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected group is interconnected to the cyclic support. Thus, the cyclic support often contains a functional group, such as an amino group, or typically provides a linkage that is suitable for introducing or linking another chemical structure, such as a ligand to a ring component.

RNAi agents can be conjugated to a ligand via a carrier, where the carrier can be a cyclic group or an acyclic group; preferably the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from the serinol backbone or the diethanolamine backbone.

In certain specific embodiments, the RNAi agent of the invention is an agent selected from the group of agents listed in Table 1, consisting of:

These agents may further contain a ligand, such as a GalNAc ligand.

Ligands

The RNAi agents of the invention, for example, double-stranded RNAi agents, can optionally be conjugated to one or more ligands. The ligand can be attached to the sense strand, the antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, a ligand may be conjugated to a sense strand. In preferred embodiments, the ligand is conjugated to the 3' end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAc ₃ :

A wide range of compounds can be coupled to the RNAi agents of the present invention. Preferred molecules are ligands that are preferably covalently linked directly or indirectly through an intermediate bond.

In preferred embodiments, the ligand modifies the distribution, targeting, or lifetime of the molecule into which it is introduced. In preferred embodiments, the ligand provides increased affinity for a selected target, e.g., a molecule, cell or cell type, compartment, receptor, e.g., cell or organ compartment, tissue, organ, or body compartment, e.g., compared to no molecule, such as the ligand . Ligands that provide increased affinity for a selected target are also called targeting ligands.

Some ligands may have endosomolytic properties. Endosomolytic ligands promote lysis of endosomes and/or transport of the composition according to the invention or its components from endosomes into the cytoplasm of the cell. The endosomolytic ligand may be a polyanionic peptide or a peptidomimetic that exhibits pH-dependent membrane activity and fusion ability. In one embodiment, the endosomolytic ligand acquires its active conformation at endosomal pH. An "active" conformation is a conformation in which the endosomolytic ligand promotes endosome lysis and/or transport of the composition of the invention or its components from the endosome into the cytoplasm of the cell. Exemplary endosomolytic ligands include GALA peptide (Subbarao et al., Biochemistry, 1987, 26: 2964-2972), EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586) and the derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In one embodiment, the endosomolytic moiety may contain a chemical group (eg, an amino acid) that also undergoes a charge change or protonation in response to a change in pH. The endosomolytic component can be linear or branched.

Ligands can improve transport, hybridization and specific properties, and can also improve the nuclease resistance of the resulting natural or modified oligoribonucleotide or polymer molecule containing any combination of monomers described herein and/or natural or modified ribonucleotides.

Ligands may generally include therapeutic modifiers, eg to enhance uptake, diagnostic compounds or reporter groups, eg to monitor distribution, crosslinkers and nuclease resistance conferring groups. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetics.

Ligands may include a natural substance such as a protein (for example, human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL) or globulin), a carbohydrate (for example, dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) or lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, eg, a synthetic polyamino acid, oligonucleotide (eg, an aptamer). Examples of polyamino acids include polyamino acid, which is polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ester copolymer. maleic anhydride, N-(2-hydroxypropyl) methacrylamide (HMPA) copolymer, polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyutherane, poly(2-ethyl acrylic acid), N-isopropylacrylamide polymers, or polyphosphazine. Examples of polyamines include polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, peptidomimetic polyamine, dendrimeric polyamine, arginine, amidine, protamine, cationic lipid, cationic phorphyrin, polyamine quaternary salt, or alpha-helical peptide.

Ligands may also contain targeting moieties, such as cell or tissue targeting agents, such as a lectin, glycoprotein, lipid, or protein, such as an antibody, that binds to a specific cell type, such as kidney cells. The targeting group may be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, RGD peptide, RGD peptide mimetic or aptamer.

Other examples of ligands include dyes, intercalators (eg, acridines), cross-linkers (eg, psoralen, mitomycin C), porphyrins (TPPC4, texapirin, sapphirin), polycyclic aromatic hydrocarbons (eg, phenazine, dihydrophenazine), artificial endonucleases or chelator (eg , EDTA), lipophilic molecules, e.g. cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol , heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g. antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g. PEG-40K), MPEG, [MPEG] ₂ , polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption aids (e.g. aspirin, vitamin E , folic acid), synthetic ribonucleases (e.g. imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ tetraazamacrocycle complexes), dinitrophenyl, HRP or AP.

Ligands may be proteins, such as glycoproteins, or peptides, such as molecules with a specific affinity for a co-ligand, or antibodies, such as an antibody that binds to a specific cell type, such as a cancer cell, endothelial cell, or bone cell. Ligands may also contain hormones and hormone receptors. They may also contain non-peptide molecules such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose or aptamers. The ligand may be, for example, a lipopolysaccharide, a p38 MAP kinase activator, or an NF-kB activator.

The ligand may be a substance, eg a drug, that can enhance the entry of the mRNA agent into the cell, eg by disrupting the cell's cytoskeleton, eg by disrupting the cell's microtubules, microfilaments and/or intermediate microfilaments. The drug may be, for example, taxon, vincristine, vinblastine, cytochalasine, nocodazole, jasplakinolide, latrunculin A, phalloidin, swincholide A, indanocin or myoservin.

The ligand can increase the entry of the oligonucleotide into the cell, for example, by activating an inflammatory response. Exemplary ligands that have such an effect include tumor necrosis factor alpha (TNF-alpha), interleukin-1 beta, or interferon gamma.

In one aspect, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferentially binds to a serum protein, such as human serum albumin (HSA).

Binding of the ligand to HSA ensures distribution of the conjugate to the target tissue, for example, non-renal target tissue of the body. For example, the target tissue may be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, you can use naproxen or aspirin. The lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) enhance targeting or transport to the target cell or cell membrane, and/or (c) it can be used to regulate binding to serum protein, e.g. HSA.

The lipid-based ligand can be used to modulate, for example, control the binding of the conjugate to the target tissue. For example, a lipid or lipid-based ligand that binds more strongly to HSA is less likely to be targeted to the kidney, and thus less likely to be excreted from the body. A lipid or lipid-based ligand that binds weaker to HSA can be used to target the conjugate to the kidney.

In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, it binds to HSA with sufficient affinity such that the conjugate is preferentially distributed into non-renal tissue. However, it is preferable that the affinity is not so strong that HSA-ligand binding is irreversible.

In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA, such that the conjugate is preferentially distributed to the kidney. It is also possible to use other groups that provide targeted delivery to kidney cells, instead of or in addition to a lipid-based ligand.

In another aspect, the ligand is a molecule, such as a vitamin, that is taken up by a target cell, such as a proliferating cell. Such molecules are particularly useful for treating disorders characterized by unwanted cellular proliferation, eg of a malignant or non-malignant type, eg of malignant cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include B vitamins, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low-density lipoprotein (LDL), and high-density lipoprotein (HDL).

In another aspect, the ligand is a cell penetrating agent, preferably a helical cell penetrating agent. Preferably the agent is amphalipatic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified to include peptidyl mimetic, invertromers, non-peptide or pseudo-peptide linkages and the use of D-amino acids. The helical agent is preferably an alpha helical agent, which preferably contains a lipophilic and a lipophobic phase.

The ligand may be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a specific three-dimensional structure similar to a naturally occurring peptide. The length of a peptide or peptidomimetic molecule can be approximately 5-50 amino acids, such as approximately 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids. The peptide or peptidomimetic may be, for example, a cell penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, consisting predominantly of Tyr, Trp, or Phe). The peptide molecule may be a dendrimeric peptide, a peptide with limited conformational freedom, or a cross-linked peptide. In another alternative embodiment, the peptide molecule may contain a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF containing the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:4). An RFGF analogue (eg, amino acid sequence AALLPVLLAAP) (SEQ ID NO:5) containing a hydrophobic MTS may also be a targeting molecule. The peptide molecule may be a "transport" peptide that can transport large polar molecules, including peptides, oligonucleotides, and protein across cell membranes. For example, it was revealed that sequences from the HIV Tat protein (GRKKRRQRRRPPQ) (SEQ ID NO:6) andDrosophila Antennapedia(RQIKIWFQNRRMKWKK) (SEQ ID NO:7) can function as transport peptides. The peptide or peptidomimetic may be encoded by a random DNA sequence, such as a peptide identified in a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Preferably, the peptide or peptidomimetic linked to the mRNA agent via the integrated monomer unit is a cell-targeted peptide such as arginine glycine aspartic acid (RGD) peptide or an RGD mimic. The length of the peptide molecule can range from about 5 amino acids to about 40 amino acids. Peptide molecules may contain such a structural modification to increase stability or directly conformational properties. Any of the structural modifications described below can be used. The RGD peptide molecule can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). The RGD peptide can facilitate targeted delivery of an mRNA agent to tumors of various other tissues, including lung, kidney, spleen or liver (Aoki et al., Cancer Gene Therapy, 8:783-787, 2001). Preferably, the RGD peptide facilitates targeted delivery of the mRNA agent to the kidney. The RGD peptide may be linear or cyclic and may be modified, such as glycosylated or methylated, to facilitate targeted delivery to specific tissues. For example, a glycosylated RGD peptide can deliver an mRNA-based agent to a tumor cell expressing αvβ₃ (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). Peptides can be used that target markers that are abundant in proliferating cells. For example, RGD-containing peptides and peptidomimetics can be targeted to malignant cells, in particular cells that contain integrin. Thus, RGD peptides, cyclic peptides containing RGD, RGD peptides that contain D-amino acids, as well as synthetic RGD mimics can be used. In addition to RGD, other molecules that target the integrin ligand can be used. Typically, such ligands can be used to regulate proliferating cells and angiogenesis. Preferred conjugates of this type of ligand are directed to PECAM-1, VEGF or another cancer gene, for example, a cancer gene described herein.

A "cell penetrating peptide" is capable of penetrating a cell, for example, a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. The microbial cell penetrating peptide may be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two predominant amino acids (for example, PR-39 or indolicidin). The cell-penetrating peptide also contains a nuclear localization signal (NLS). For example, the cell penetrating peptide may be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res., 31:2717- 2724, 2003).

In one embodiment, the targeting peptide may be an amphipathic α-helical peptide. Exemplary amphipathic α-helical peptides include, but are not limited to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides, hagfish intestinal antimicrobial peptides (HFIAP), magainins , brevinins-2, dermaseptins, melittins, pleurocidin, H ₂ A peptides, Xenopus peptides, esculentins-1 and caerins. It is believed that a number of factors preferentially maintain the stability of the helix. For example, a maximum number of helix-stabilizing residues (eg leu, ala or lys) and a minimum number of destabilizing residues (eg proline or cyclic monomer units) are used. It is contemplated that a capping residue (eg, Gly is an exemplary N-capping residue) and/or C-terminal amidation may be used to provide an additional H bond to stabilize the helix. Stability can be provided by the formation of salt bridges between residues with opposite charges separated by positions i±3 or i±4. For example, cationic residues such as lysine, arginine, homoarginine, ornithine or histidine can form salt bridges with anionic glutamate or aspartate residues.

Peptide and peptidomimetic ligands include ligands containing natural or modified peptides, for example, D- or L-peptides, α-, β- or γ-peptides, N-methylpeptides, azapeptides, peptides containing one or more amides, i.e. e. a peptide with linkages replaced by one or more urea, thiourea, carbamate or sulfonylurea linkages, or cyclic peptides.

A targeting ligand can be any ligand that is capable of targeting a specific receptor. Examples are folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters such as a GalNAc cluster, a mannose cluster, a galactose cluster, or an aptamer. A cluster is a combination of two or more sugar units. Targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin receptor ligands, biotin, serotonin, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. Ligands can also be nucleic acid based, such as an aptamer. The aptamer may be unmodified or contain any combination of modifications described herein.

Endosomal release control agents include imidazoles, poly- or oligoimidazoles, PEI, peptides, fusion promoting peptides, polycarboxylates, polycations, masked oligos or polycations or polyanions, acetals, polyacetals, ketals/polyketals, orthoesters, polymers with shielded or unshielded cationic or anionic charges , dendrimers with shielded or unshielded cationic or anionic charges.

PK modulator means pharmacokinetic modulator. PK modulators include lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides that contain a number of thiophosphate linkages are known to bind to whey protein, so short oligonucleotides, e.g., oligonucleotides of approximately 5 bases, 10 bases, 15 bases, or 20 bases, containing many thiophosphate linkages in the backbone are also suitable for the present invention as ligands (eg, as PK modulating ligands).

In addition, also suitable for the present invention as PK modulating ligands are aptamers that bind to serum components (eg whey proteins).

Other ligand conjugates useful in the invention are described in US patent applications USSN: 10/916185, filed August 10, 2004, USSN: 10/946873, filed September 21, 2004, USSN: 10/833934, filed August 3, 2007, USSN : 11/115989, filed April 27, 2005, and USSN: 11/944227, filed November 21, 2007, incorporated by reference in their entirety for all purposes.

When two or more ligands are present, all ligands may have the same properties, all may have different properties, or some ligands may have the same properties while others have different properties. For example, the ligand may have targeting properties, have endosomolytic activity, or have PK modulating properties. In a preferred embodiment, all ligands have different properties.

Ligands can be attached to oligonucleotides at various locations, for example, at the 3' end, 5' end and/or in the internal region. In preferred embodiments, the ligand is attached to the oligonucleotides through an intermediate linkage, such as a carrier as described herein. The ligand or bound ligand may be contained in the monomer when the monomer is incorporated into the growing chain. In some embodiments, the ligand can be introduced by binding to a precursor monomer after the precursor monomer has been incorporated into the growing chain. For example, a monomer containing, for example, an amino-terminal bond (i.e. containing an unbound ligand), for example, TAP-(CH₂)_nN.H.₂, can be integrated into a growing oligonucleotide chain. At the subsequent stage, i.e. Once the precursor monomer has been incorporated into the chain, a ligand containing an electrophilic group, such as a pentafluorophenyl ester group or an aldehyde group, can then be attached to the precursor monomer by attaching the electrophilic group of the ligand to the terminal nucleophilic bond group of the precursor monomer.

In another example, a monomer containing a chemical group suitable for participation in a click chemistry reaction, such as an azide- or alkyne-terminated bond/linker, can be introduced. At the subsequent stage, i.e. After introducing the precursor monomer into the chain, a ligand containing a complementary chemical group, such as an alkyne or azide, can be attached to the precursor monomer by linking the alkyne and azide to each other.

For double-stranded oligonucleotides, ligands can be attached to one or both strands. In some embodiments, the double-stranded mRNA agent comprises a ligand conjugated to the sense strand. In other embodiments, the double-stranded mRNA agent comprises a ligand conjugated to an antisense strand.

In some embodiments, the ligand may be conjugated to nucleic acid bases, sugar groups, or internucleotide linkages of nucleic acid molecules. Conjugation with purine nucleobases or their derivatives can occur at any position, including endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-positions of the purine nucleic acid base are linked to the conjugate group. Conjugation with pyrimidine nucleic bases or derivatives thereof can also be in any position. In some embodiments, the 2-, 5-, and 6-positions of the pyrimidine nucleic acid base may be replaced by a conjugate group. Conjugation with sugar groups of nucleosides can occur at any carbon atom. Examples of sugar group carbon atoms that may be bonded to a conjugate group include the 2', 3' and 5' carbon atoms. The 1' position can also be attached to a conjugate group, such as in a residue with the nitrogenous bases removed. Internucleoside bonds can also carry conjugate groups. For phosphorus-containing bonds (eg, phosphodiesters, thiophosphate, phosphorodithioate, phosphoroamidate, etc.), the conjugate group can be attached directly to the phosphorus atom or to an O, N or S atom bonded to the phosphorus atom. For amine- or amide-containing internucleoside linkages (eg, PNA), the conjugate group can be attached to the amine or amide nitrogen atom or to an adjacent carbon atom.

Any suitable ligand in the field of RNA interference can be used, although the ligand is typically a carbohydrate, for example, a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.

Linkers that conjugate a ligand to a nucleic acid include the linkers described above. For example, the ligand may be one or more GalNAc (N-acetylglucosamine) derivatives linked via a divalent or trivalent branched linker.

In one embodiment, the dsRNA of the invention is conjugated to divalent and trivalent branched linkers containing structures represented in any of formulas (IV)-(VII):

Where:

q ^2A , q ^2B , q ^3A , q ^3B , q ^4A , q ^4B , q ^5A , q ^5B and q ^5C are independently in each case 0-20, and where the repeat units may be the same or different;

p ^2A , p ^2B , p ^3A , p ^3B , p ^4A , p ^4B , p ^5A , p ^5B , p ^5C , T ^2A , T ^2B , T ^3A , T ^3B , T ^4A , T ^4B , T ^5A , T ^5B , T ^5C each independently in each case absent, represent CO, NH, O, S, OC(O), NHC(O), CH ₂ , CH ₂ NH or CH ₂ O;

Q ^2A , Q ^2B , Q ^3A , Q ^3B , Q ^4A , Q ^4B , Q ^5A , Q ^5B , Q ^5C are independently absent in each case, are alkylene, substituted alkylene, where one or more methylenes may be interrupted or terminated by one or more of O, S, S(O), SO ₂ , N(R ^N ), C(R')=C(R''), C≡C or C(O);

R ^2A , R ^2B , R ^3A , R 3B , R ^4A , R ^4B , R ^5A , R ^5B , ^{R 5C each} independently absent for each case, represents NH, O, S, CH ₂ , C(O)O, C(O)NH, NHCH(R ^a )C(O), -C(O)-CH(R ^a )-, NH-, CO, CH=NO,

or heterocycle;

L ^2A , L ^2B , L ^3A , L ^3B , L ^4A , L ^4B , L ^5A , L ^5B and L ^5C are ligand, i.e. each independently in each case represents a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide or polysaccharide, and R ^a represents H or an amino acid side chain.

Trivalent GalNAc conjugation derivatives are particularly suitable for use with RNAi agents to inhibit target gene expression, such as derivatives of formula (VII):

where L ^5A , L ^5B and L ^5C represent a monosaccharide such as a GalNAc derivative.

Examples of suitable divalent and trivalent branched linker groups conjugating to GalNAc derivatives include, but are not limited to, the following compounds:

In other embodiments, the RNAi agent of the invention is an agent selected from the group consisting of AD-45163, AD-45165, AD-51544, AD-51545, AD-51546, and AD-51547.

III. Pharmaceutical compositions

The RNAi agents of the invention may be formulated for administration by any suitable route for use in human or veterinary medicine, in analogy with other pharmaceutical agents. Pharmaceutical compositions containing the RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.

In the methods of the invention, the RNAi agent can be administered in solution. The free RNAi agent can be administered in an unbuffered solution, such as saline or water. Alternatively, free siRNAs can also be administered in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted so that it is suitable for administration to the individual.

In some embodiments, the buffer solution further comprises means for adjusting the osmolarity of the solution so as to maintain the osmolarity at a desired value, for example, human plasma physiological values. Solutes that can be added to the buffer solution to adjust osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids or salts. In some embodiments, the agent for adjusting the osmolarity of the solution is a salt. In certain embodiments, the agent for adjusting the osmolarity of the solution is sodium chloride or potassium chloride.

In other embodiments, the RNAi agent is formulated as a composition that contains one or more RNAi agents and a pharmaceutically acceptable carrier. As used herein, the phrase "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersing media, coatings, antibacterial and antifungal agents, isotonic and absorption retarding agents, and the like, compatible with pharmaceutical administration. The use of such media and means for pharmaceutically active substances is well known in the art. Except in cases where any conventional medium or agent is incompatible with the active compound, its use in the compositions is provided. Additional active compounds may also be included in the composition.

In one embodiment, the RNAi agent formulation comprises at least a second therapeutic agent (eg, an agent other than RNA or DNA). For example, an RNAi agent composition for treating a TTR-associated disease, such as transthyretin-related hereditary amyloidosis (familial amyloid polyneuropathy, FAP), may contain a known drug for improving FAP, such as tafamidis (INN or Fx-1006A, or Vyndaqel ).

The formulated RNAi agent composition may be in various states. In some examples, the composition is at least partially crystalline, uniformly crystalline, and/or anhydrous (eg, it contains less than 80, 50, 30, 20, or 10% water). In another example, the RNAi agent is in an aqueous phase, such as a solution that contains water.

Aqueous phase or crystalline compositions can be incorporated into a carrier, for example a liposome (particularly for the aqueous phase) or particle (e.g. microparticle as may be suitable for a crystalline composition). Typically, the RNAi agent composition is formulated in such a way that it is compatible with the intended route of administration as described herein. For example, in specific embodiments, the composition is prepared by at least one of the following methods: spray drying, lyophilization, vacuum drying, evaporation, fluid bed drying, or a combination of these techniques, or sonication with lipid, freeze drying, condensation and other methods self-assembly.

An RNAi agent formulation may be formulated in combination with another agent, such as another therapeutic agent or an agent that stabilizes the RNAi agent, such as a protein that complexes with the RNAi agent to form mRNA. Still other agents include chelators such as EDTA (eg, to remove divalent cations such as Mg ²⁺ ), salts, RNase inhibitors (eg, a broad specific RNase inhibitor such as RNAsin), etc.

In one embodiment, the RNAi agent formulation comprises another siRNA compound, eg, a second RNAi agent, that can mediate RNAi to a second gene or to the same gene. Still another preparation may contain at least 3, 5, ten, twenty, fifty or one hundred or more different types of RNAi agents. Such RNAi agents can mediate RNAi against a similar number of different genes.

The mRNA-based agents of the invention can be formulated for pharmaceutical use. Pharmaceutically acceptable compositions contain a therapeutically or prophylactically effective amount of one or more dsRNA agents in any of the preceding embodiments, alone or formulated in conjunction with one or more pharmaceutically acceptable carriers, excipients and/or diluents.

Methods for preparing the pharmaceutical compositions of the invention include the step of contacting the RNAi agent of the present invention with a carrier and optionally one or more accessory ingredients. Typically, compositions are prepared by uniformly and uniformly contacting the RNAi agent of the present invention with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

Pharmaceutical compositions can be specifically formulated for administration in solid or liquid form, including forms adapted for the following: (1) oral administration, for example, impregnations (aqueous or non-aqueous solutions or suspensions), tablets, for example, tablets intended for buccal, sublingual and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection, for example, in the form of a sterile solution or suspension or sustained release formulation; (3) topical application, such as a cream, ointment, or controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, in the form of pessaries, cream or foam; (5) sublingually; (6) ocular; (7) transdermal or (8) nasal. Delivery using subcutaneous or intravenous routes may be particularly effective.

The phrase "pharmaceutically acceptable" is used herein to mean those compounds, substances, compositions and/or dosage forms that are medically suitable for use in contact with human and animal tissues without causing increased toxicity, irritation, allergic response or another problem or complication, in accordance with a reasonable benefit/risk ratio.

The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable substance, composition or carrier, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc, magnesium stearate, calcium stearate, or zinc or stearic acid) or a solvent-encapsulating substance involved in the transfer or transport of the compound in question from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the composition and not harmful to the patient. Some examples of substances that can serve as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients such as cocoa butter and suppository waxes; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols such as propylene glycol; (11) polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline solution; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) excipients such as polypeptides and amino acids; (23) a serum component such as serum albumin, HDL and LDL, and (22) other non-toxic compatible substances used in pharmaceutical compositions.

The compositions can be suitably provided in unit dosage form and can be prepared by any methods well known in the art of pharmacy. The amount of RNAi agent that can be combined with a carrier material to form a single dosage form varies depending on the host being treated and the particular route of administration. The RNAi agent that can be combined with a carrier material to form a single dosage form is typically an amount of the RNAi agent that produces the desired effect, such as a therapeutic or prophylactic effect. Typically, of one hundred percent, such amount will range from about 0.1 percent to about ninety-nine percent RNAi agent, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

In certain embodiments, the composition of the present invention contains an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle-forming agents, for example, bile acids, and polymeric carriers, for example, polyesters and polyanhydrides, and an RNAi agent of the present invention . In certain embodiments, the above composition provides an orally bioavailable RNAi agent of the present invention.

In some cases, in order to prolong the effect of an RNAi agent, it is desirable to slow the absorption of the agent from subcutaneous or intramuscular injection. This can be prepared using a liquid suspension of a crystalline or amorphous substance with poor solubility in water. The rate of absorption of the RNAi agent subsequently depends on its dissolution rate, which in turn may depend on the crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered RNAi agent can be achieved by dissolving or suspending the agent in an oily vehicle.

Liposomes

The RNAi agent of the invention can be formulated for delivery in a membrane-bound molecular unit, such as a liposome or micelle. As used herein, the term “liposome” refers to a vesicle consisting of amphiphilic lipids arranged in at least one bilayer, such as a single bilayer or a series of bilayers. Liposomes include single-layer and multilayer vesicles that contain a membrane formed from a lipophilic substance and an aqueous internal content. The aqueous portion contains an RNAi agent composition. The lipophilic substance isolates the aqueous internal content from the aqueous external content, which typically does not contain the RNAi agent composition, although in some examples it may. Liposomes are suitable for carrying and delivering active ingredients to the site of action. Because the liposomal membrane is structurally similar to a biological membrane, when liposomes are applied to tissue, the liposomal bilayer fuses with the cell membrane bilayer. As liposome-cell fusion progresses, the internal aqueous contents, which contain the RNAi agent, are delivered into the cell, where the RNAi agent can specifically bind to the target RNA and can mediate RNAi. In some cases, liposomes are also specifically targeted, for example to target delivery of an RNAi agent to specific cell types.

The liposome containing the RNAi agent can be produced in various ways. In one example, the lipid component of the liposome is dissolved in a detergent such that micelles with the lipid component are formed. For example, the lipid component may be an amphipathic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be non-ionic. Exemplary detergents include cholates, CHAPS, octyl glucoside, deoxycholate and lauroyl sarcosine. The RNAi drug formulation is then added to micelles that contain a lipid component. Cationic groups in the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example by dialysis, to obtain a liposomal preparation of the RNAi agent.

If necessary, a carrier compound that promotes condensation can be added during the condensation reaction, for example by controlled addition. For example, the carrier compound may be a polymer other than a nucleic acid (eg, spermine or spermidine). The pH can also be adjusted to promote condensation.

Methods for preparing stable polynucleotide delivery vehicles that contain a polynucleotide/cationic lipid complex as a structural component of the delivery vehicle are further described, for example, in WO 96/37194, the entire contents of which are incorporated herein by reference. Preparation of liposomes may also include one or more aspects of the illustrative methods described by Feigner P.L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; in US patent No. 4897355; US patent No. 5171678; in Bangham et al., M. Mol. Biol., 23:238, 1965; Olson et al., Biochim. Biophys. Acta 557:9, 1979; Szok, et al., Proc. Natl. Acad. Sci., 75: 4194, 1978; Mayhew et al., Biochim. Biophys. Acta, 775:169, 1984. Kim et al., Biochim. Biophys. Acta, 728:339, 1983, and Fukunaga et al., Endocrinol., 115:757, 1984. Widely used methods for preparing lipid aggregates of suitable size for use as delivery vehicles include sonication and freeze-drying plus extrusion (see, for example, Mayer et al., Biochim. Biophys. Acta, 858:161, 1986). Microfluidization can be used when comparable small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., Biochim. Biophys. Acta, 775:169, 1984). These methods can be easily adapted to package RNAi drug formulations into liposomes.

Liposomes, which are pH sensitive or negatively charged, trap nucleic acid molecules rather than complex with them. Due to the fact that the nucleic acid and lipid molecules are equally charged, repulsion occurs rather than complex formation. However, some nucleic acid molecules are retained in the aqueous interior of such liposomes. pH-sensitive liposomes were used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Exogenous gene expression was detected in target cells (Zhou et al., Journal of Controlled Release, 19, (1992) 269-274).

One general type of liposomal composition includes phospholipids other than naturally occurring phosphatidylcholine. Neutral liposome compositions, for example, can be prepared from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are typically prepared from dimyristoylphosphatidylglycerol, while fusion-promoting anionic liposomes are primarily prepared from dioleoylphosphatidylethanolamine (DOPE). Another type of liposomal composition is prepared from phosphatidylcholine (PC), such as, for example, soy PC and egg PC. Another type is made from a mixture of phospholipid and/or phosphatidylcholine and/or cholesterol.

Examples of other methods for introducing liposomes into cells in vitro and in vivo include US Patent No. 5283185, US Patent No. 5171678, WO 94/00569, WO 93/24640, WO 91/16024, Feigner J., Biol. Chem., 269:2550, 1994, Nabel, Proc. Natl. Acad. Sci., 90:11307, 1993, Nabel, Human Gene Ther., 3:649, 1992, Gershon, Biochem., 32:7143, 1993, and Strauss, EMBO J., 11:417, 1992.

In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage that they are able to fuse with the cell membrane. Noncationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver an RNAi agent to macrophages.

Additional benefits of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can contain a wide range of water- and lipid-soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff in "Pharmaceutical Dosage Forms", Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important factors considered when preparing liposome formulations are the surface charge of the lipids, the size of the vesicles and the aqueous volume of the liposome.

The positively charged synthetic cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to produce small liposomes that spontaneously react with nucleic acid to form lipid-nucleic acid complexes , which are capable of fusing with negatively charged lipids in the cell membranes of tissue culture cells, resulting in the delivery of an RNAi agent (for a description of DOTMA and its use with DNA, see, for example, Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987, and US Patent No. 4897355).

The DOTMA analogue 1,2-bis(oleoyloxy)-3-(trimethylammonium)propane (DOTAP) can be used in combination with a phospholipid to produce vesicles complexed with DNA. Lipofectin™ (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective means of delivering highly anionic nucleic acids to living tissue culture cells that contain positively charged DOTMA liposomes that spontaneously react with negatively charged polynucleotides to form complexes. When sufficiently positively charged liposomes are used, the net charge on the resulting complexes is also positive. The positively charged complexes thus produced spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonium)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Indiana) differs from DOTMA in that the oleoyl groups are linked by esters rather than ethers. connections.

Other cationic lipid reporter compounds include those that are conjugated to a number of molecules, including, for example, carboxyspermine, which is conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam™, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine-5-carboxyspermylamide ("DPPES") (see, for example, US Pat. No. 5,171,678).

Another cationic lipid conjugate includes a lipid-cholesterol derivative ("DC-Chol"), which is formulated into liposomes in combination with DOPE (see, Gao X. and Huang L., Biochim. Biophys. Res. Commun., 179:280, 1991). Lipopolysine, produced by conjugating polylysine with DOPE, has been reported to be effective for transfection in the presence of serum (Zhou X. et al. , Biochim. Biophys. Acta, 1065:8, 1991). For certain cell lines, such liposomes containing conjugated cationic lipids have been reported to exhibit lower toxicity and provide more efficient transfection compared to DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

In particular, liposomal formulations are being explored for topical administration, and liposomes provide several advantages over other formulations. Such advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to deliver the RNAi agent into the skin. In some embodiments, liposomes are used to deliver the RNAi agent to epidermal cells, as well as to enhance the penetration of the RNAi agent into dermal tissues, such as skin. For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been documented (see, for example, Weiner et al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18 , 1992, 259-265, Mannino R. J. and Fould-Fogerite S., Biotechniques 6:682-690, 1988, Itani T. et al., Gene, 56:267-276, 1987, Nicolau C. et al., Meth Enz., 149:157-176, 1987, Straubinger R. M. and Papahadjopoulos D., Meth. Enz., 101:512-527, 1983, Wang C. Y. and Huang L., Proc. Natl. Acad. Sci. USA, 84 :7851-7855, 1987).

Nonionic liposomal systems have also been studied to determine their suitability for drug delivery to the skin, particularly systems containing nonionic surfactant and cholesterol. Non-ionic liposomal formulations containing Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used for drug delivery into the dermis of mouse skin. Such RNAi agent formulations are useful for treating a dermatological disorder.

Liposomes that contain the RNAi agent can be prepared to be highly deformable. This deformability may cause liposomes to penetrate through a pore that is smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposome. Transfersomes can be prepared by adding interfacial activators, typically surfactants, to a standard liposomal formulation. Transfersomes that contain an RNAi agent can be delivered, for example, subcutaneously through infection to deliver the RNAi agent to keratinocytes in the skin. To pass through intact mammalian skin, lipid vesicles must pass through a series of small pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. In addition, due to the properties of lipids, such transfersomes can self-organize (adapt to the shape of pores, for example in the skin), self-repair and can often reach their targets without fragmentation and are often self-loading.

Other compositions useful in the present invention are described in US Provisional Patent Application Serial No. 61/018616, filed January 2, 2008, 61/018611, filed January 2, 2008, 61/039748, filed March 26, 2008, 61/ 047087, filed April 22, 2008, and 61/051528, filed May 8, 2008. PCT Application No. PCT/US 2007/080331, filed October 3, 2007, also describes compositions that are suitable for the present invention.

Surfactants

Surfactants are widely used in formulations such as emulsions (including microemulsions) and liposomes (see above). RNAi agent compositions (or a precursor, eg, a larger ds-mRNA that can be processed to siRNA, or DNA that encodes the siRNA or precursor) may contain a surfactant. In one embodiment, the siRNA is formulated as an emulsion that contains a surfactant. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is by using the hydrophilic/lipophilic balance (HLB). To categorize the various surfactants used in formulations, the most commonly used criterion is the nature of the hydrophilic group (Rieger, in "Pharmaceutical Dosage Forms", Marcel Dekker, Inc., New York, NY, 1988, p. 285).

If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants are widely used in pharmaceutical formulations and are useful over a wide range of pH values. Generally, their HLB values range from 2 to approximately 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glycerol esters, polyglycerol esters, sorbitan esters, sucrose esters and ethoxylated esters. This class also includes nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers. Polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

If a surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, amino acid acylamides, sulfuric acid esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and soaps.

If a surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used representatives of this class.

If a surfactant molecule has the ability to carry a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines and phospholipids.

The use of surfactants in drug products, formulations and emulsions is described in the literature (Rieger, in "Pharmaceutical Dosage Forms", Marcel Dekker, Inc., New York, NY, 1988, p. 285).

Micelles and other membrane compounds

The RNAi agents of the invention can also be provided in the form of micellar formulations. "Micelles" are defined herein as a specific type of molecular aggregate in which amphipathic molecules are arranged in a spherical structure such that all of the hydrophobic portions of the molecule are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The opposite arrangement exists if the environment is hydrophobic.

A mixed micellar formulation suitable for delivery through transdermal membranes can be prepared by mixing an aqueous solution of the siRNA composition, a C ₈ -C ₂₂ alkyl metal sulfate and a micelle-forming compound. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening primrose oil, menthol , trihydroxyoxocholanylglycine and its pharmaceutically acceptable salts, glycerin, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polydocanolalkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate and mixtures thereof. The micelle-forming compounds can be added simultaneously or after the addition of the alkali metal alkyl sulfate. Mixed micelles are formed by essentially any type of mixing of ingredients, but with vigorous mixing to produce micelles of smaller size.

In one method, a first micellar composition is prepared that contains a siRNA composition and at least an alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micelle-forming compounds to form a mixed micellar composition. In another method, a micellar composition is prepared by mixing the siRNA composition, an alkali metal alkyl sulfate and at least one of the micelle-forming compounds, followed by adding the remaining micelle-forming compounds with vigorous stirring.

Phenol and/or meta -cresol can be added to the mixed micellar composition to stabilize the composition and protect against bacterial growth. Alternatively, phenol and/or meta -cresol can be added with the micelle-forming ingredients. Once the mixed micellar composition has been prepared, an isotonicizing agent may also be added.

To deliver a micellar formulation as a spray, the formulation can be placed in an aerosol spray bottle and the spray bottle filled with propellant. The propellant, which is pressurized, is in liquid form in the atomizer. The ratios of the ingredients are adjusted so that the aqueous phase and the propellant phase become one, i.e. one phase was present. If there are two phases, the sprayer must be shaken before dispensing part of the contents, for example through a dosing valve. The nebulized dose of the pharmaceutical agent is dispensed from the metering valve in the form of a fine spray.

The propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) can be used.

Specific concentrations of the main ingredients can be determined by relatively simple experimentation. For oral absorption, it is generally desirable to increase, for example, at least doubling or tripling the dose by injection or gastrointestinal administration.

Particles

In another embodiment, the RNAi agent of the invention can be incorporated into a particle, for example a microparticle. Microparticles can be produced by spray drying and can also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

IV. Methods for Inhibiting TTR Expression

The present invention also provides methods for inhibiting the expression of transthyretin (TTR) in a cell. The methods include contacting a cell with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit TTR expression in the cell, thereby inhibiting TTR expression in the cell.

Contacting a cell with an RNAi agent, such as a double-stranded RNAi agent, can be done in vitro or in vivo . Contacting a cell in vivo with an RNAi agent involves bringing a cell or group of cells in an individual, for example a human individual, into contact with an RNAi agent. A combination of in vitro and in vivo cell contact methods is also possible. Bringing the cell into contact can be direct or indirect, as indicated above. In addition, bringing the cell into contact can be accomplished by directing a ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate group, for example a GalNAc ₃ ligand or any other ligand that targets the RNAi agent to a site of interest, for example the liver of an individual.

The term "inhibition" as used herein is used interchangeably with "reduction", "suppression", "reduction", "attenuation" and other similar terms, and includes any level of inhibition.

The phrase “inhibiting TTR expression” is intended to mean inhibiting the expression of any TTR gene (such as, for example, a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene), as well as variants or mutants of the TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (such as a mutant TTR gene causing amyloid deposition), or a transgenic TTR gene in relation to a genetically manipulated cell, group of cells or organism.

“Inhibition of TTR gene expression” includes any level of inhibition of the TTR gene, such as at least partial inhibition of TTR gene expression. TTR gene expression can be assessed based on the level or change in the level of any variable associated with TTR gene expression, for example, the level of TTR mRNA, the level of TTR protein, or the number or extent of amyloid deposits. This level can be assessed in an individual cell or in a group of cells, including, for example, a sample obtained from an individual.

Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables that are associated with TTR expression compared to control levels. The control level may be any type of control level that is used in the art, for example, a baseline level before dosing, or a level determined in a similar individual, cell, or sample that was not treated or treated with a control (such as, for example, a control buffer only or control with inactive agent only).

In some embodiments of the methods of the invention, TTR gene expression is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25% , at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, according to at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least by about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Inhibition of TTR gene expression may be manifested by a reduction in the amount of mRNA expressed by the first cell or group of cells (such cells may be contained, for example, in a sample obtained from an individual) in which the TTR gene is transcribed and which have been treated (for example, by bringing the cell or cells contacting an RNAi agent of the invention, or by administering an RNAi agent of the invention to an individual in which cells are or were present) such that expression of the TTR gene is inhibited relative to a second cell or group of cells substantially identical to the first cell or group cells, but which were not treated this way (like the control cell(s)). In preferred embodiments, inhibition is assessed by the level of mRNA expression in the treated cells as a percentage of the level of mRNA in control cells using the following formula:

Alternatively, inhibition of TTR gene expression can be assessed with respect to the reduction of a parameter that is functionally related to TTR gene expression, for example, TTR protein expression, retinol binding protein level, vitamin A level, or the presence of amyloid deposits containing TTR. Suppression of TTR gene expression can be determined in any cell expressing TTR, constitutively or as a result of genome engineering, and by any assay known in the art. The liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina, and pancreas.

Inhibition of TTR protein expression may result in a decrease in the level of TTR protein that is expressed by a cell or group of cells (eg, the level of protein expressed in a sample obtained from an individual). As explained above, to assess mRNA suppression, the inhibition of protein expression levels in the treated cells or group of cells can similarly be expressed as a percentage of the protein level in the control cell or group of cells. A control cell or group of cells that can be used to evaluate inhibition of TTR gene expression includes a cell or group of cells that has not yet been exposed to the RNAi agent of the invention. For example, a control cell or group of cells can be obtained from a single individual (eg, a human or animal individual) for treating the individual with an RNAi agent.

The level of TTR mRNA that is expressed by a cell or group of cells, or the level of circulating TTR mRNA, can be determined by any method known in the art to assess mRNA expression. In one embodiment, the level of TTR expression in a sample is determined by detecting a transcribed polynucleotide or portion thereof,For example, TTR gene mRNA. RNA can be isolated from a cell by RNA isolation methods including, for example, extraction using acidic phenol/guanidinium isothiocyanate (RNAzol B, Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats that use ribonucleic acid hybridization include isolated nuclear transcription assays, reverse transcription-PCR, RNase-protected assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, hybridizationin situ and micropanel analysis. Circulating TTR mRNA can be detected by methods described in PCT/US2012/043584, the entire contents of which are therefore incorporated herein by reference.

In one embodiment, the expression level of TTR is determined using a nucleic acid probe. The term "probe" as used herein refers to any molecule that is capable of selectively binding to a particular TTR. The probes can be synthesized by one skilled in the art, or they can be obtained from appropriate biological preparations. Probes can be specifically designed to be tagged. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies and organic molecules.

The isolated mRNA can be used in hybridization or amplification assays, which include, but are not limited to, Southern or Northern assays, polymerase chain reaction (PCR) assays, and probe assays. One method for determining mRNA levels involves contacting isolated mRNA with a nucleic acid molecule (probe) that can hybridize with TTR mRNA. In one embodiment, the mRNA is immobilized on a solid surface and brought into contact with a probe, for example, by electrophoresing the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is brought into contact with the probe(s), for example, in an Affymetrix gene chip assay. One skilled in the art can readily adapt known mRNA detection methods for use in determining TTR mRNA levels.

An alternative method for determining the level of TTR expression in a sample involves a process of amplification and/or reverse transcription of nucleic acid (to produce cDNA), such as mRNA, in the sample, such as real-time PCR (experimental embodiment reported in Mullis, 1987, US Pat. No. 4683202), ligase chain reaction (Barany, (1991) Proc. Natl. Acad. Sci. USA, 88:189-193), self-sustaining sequence replication (Guatelli et al., (1990) Proc. Natl. Acad. Sci. USA, 87:1874-1878), transcription-mediated amplification system (Kwoh et al., (1989) Proc. Natl. Acad. Sci. USA, 86:1173-1177), use of Q-beta replicase (Lizardi et al. , (1988) Bio/Technology, 6:1197), rolling circle replication (Lizardi et al., US Pat. No. 5,854,033), or any method for amplifying a nucleic acid followed by detection of the amplified molecules using methods well known to those skilled in the art technician. Such detection schemes are particularly suitable for the detection of nucleic acid molecules when such molecules are present in very small quantities. In certain aspects of the invention, the level of TTR expression is determined by quantitative real-time PCR using fluorogenic probes (ie, the TaqMan™ system).

TTR mRNA expression levels can be observed using a membrane blot (such as used in a hybridization assay such as Northern, Southern, Dot, etc.) or microwells, tubes, gels, beads or fibers (or any solid support containing bound nucleic acids). See US Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195, and 5,445,934, which are incorporated herein by reference. Determining the level of TTR expression may also involve the use of nucleic acid probes in solution.

In preferred embodiments, the level of mRNA expression is assessed by branched DNA (rDNA) assays or using real-time PCR (qPCR). The use of these methods is described and illustrated in the examples provided herein.

The level of TTR protein expression can be determined by any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, liquid or gel precipitation reactions, absorption spectroscopy, colorimetric assays, spectrometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA), immunofluorescence assays, electrochemiluminescent assays, etc.

In some embodiments, monitoring the effectiveness of the methods of the invention may be accomplished by detecting or monitoring a reduction in amyloid TTR deposition. Reducing amyloid TTR deposits, as used herein, includes any reduction in the size, number, or severity of TTR deposits, or refers to the prevention or reduction of the formation of TTR deposits in an organ or compartment in an individual, as may be assessedin vitro orin vivo by any method known in the art. For example, some methods for assessing amyloid deposits are described by Gertz M.A. & Rajukumar S.V., (Editors) (2010), Amyloidosis: Diagnosis and Treatment, New York: Humana Press. Methods for assessing amyloid deposits may include biochemical assays, as well as visual or computerized assessment of amyloid deposits, as may be visualized, for example, using immunohistochemical staining, fluorescent labeling, light microscopy, electron microscopy, fluorescence microscopy, or other types of microscopy. Invasive or non-invasive imaging techniques can be used to evaluate amyloid deposits, including, for example, CT, PET, or NMR/MRI imaging.

The methods of the invention can reduce TTR deposits in many tissues or compartments of the body, including, but not limited to, the heart, liver, spleen, esophagus, stomach, intestines (ileum, duodenum and colon), brain, sciatic nerve, dorsal root ganglion, kidney and retina.

The term “sample” as used herein refers to a collection of similar fluids, cells or tissues obtained from an individual, as well as fluids, cells or tissues contained in an individual. Examples of biological fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, saliva, intraocular fluids, and the like. Tissue samples may include samples from tissues, organs, or localized sites. For example, samples can be obtained from specific organs, parts of organs or fluids, or cells in these organs. In certain embodiments, samples can be obtained from the liver (for example, the whole liver or certain segments of the liver or certain types of cells in the liver, such as, for example, hepatocytes), the retina or parts of the retina (for example, the retinal pigment epithelium), the central nervous system or sections the central nervous system (such as the ventricles or choroid plexus), or the pancreas or certain cells or parts of the pancreas. In preferred embodiments, “sample obtained from an individual” refers to blood or plasma obtained from an individual. In further embodiments, “subject-derived sample” refers to liver tissue or retinal tissue obtained from an individual.

In some embodiments of the methods of the invention, the RNAi agent is administered to an individual such that the RNAi agent is delivered to a specific site in the individual. Inhibition of TTR expression can be assessed using measurements of the level or change in the level of TTR mRNA or TTR protein in a sample obtained from fluid or tissue from a specific site in an individual. In preferred embodiments, the site is selected from the group consisting of liver, choroid plexus, retina and pancreas. The site may also be a subdivision or subgroup of cells from any of the above regions (eg, hepatocytes or retinal pigment epithelium). The site may also include cells that express a particular type of receptor (eg, hepatocytes that express the asialoglycoprotein receptor).

V. Methods for treating or preventing TTR-associated disease

The present invention also provides methods for treating or preventing a TTR-associated disease in an individual. The methods include administering to an individual a therapeutically effective amount or a prophylactically effective amount of an RNAi agent of the invention.

As used herein, "individual" includes a human or non-human animal, preferably a vertebrate and more preferably a mammal. The individual may include a transgenic organism. Most preferably, the individual is a human, such as a human suffering from or susceptible to developing a TTR-associated disease.

In some embodiments, the individual suffers from a TTR-associated disease. In other embodiments, the individual is an individual at risk for developing a TTR-associated disease, for example, an individual with a TTR gene mutation that is associated with the development of a TTR-associated disease, an individual with a family history of a TTR-associated disease, or an individual who exhibits signs or symptoms , confirming the development of TTR amyloidosis.

“TTR-associated disease” as used herein includes any disease caused by or associated with the formation of amyloid deposits in which the fibril precursors consist of a wild-type TTR variant or protein. Mutant and wild-type TTR cause various forms of amyloid deposition (amyloidosis). Amyloidosis involves the formation and aggregation of misfolded proteins, leading to extracellular deposits that impair organ function. Clinical syndromes associated with TTR aggregation include, for example, senile systemic amyloidosis (SSA), familial systemic amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), and leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, amyloidosis central nervous system (CNS) or amyloidosis form VII.

In some embodiments of the methods of the invention, the RNAi agents of the invention are administered to individuals suffering from familial amyloidotic cardiomyopathy (FAC) and senile systemic amyloidosis (SSA). Normal sequence TTR causes cardiac amyloidosis in the elderly, which is called senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA is often accompanied by microscopic deposits in many other organs. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of clinically significant TTR amyloidosis (also called ATTR (amyloidosis-transthyretin type)). More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis.

In some embodiments of the methods of the invention, the RNAi agents of the invention are administered to individuals suffering from transthyretin (TTR)-related familial amyloidotic polyneuropathy (FAP). Such individuals may suffer from ophthalmic manifestations such as vitreous opacities and glaucoma. It is known to one skilled in the art that amyloidogenic transthyretin (ATTR), synthesized by the retinal pigment epithelium (RPE), plays an important role in the progression of ocular amyloidosis. Previous studies have shown that panretinal laser photocoagulation, which reduces the number of RPE cells, prevents the progression of vitreous amyloid deposition, suggesting that effective inhibition of ATTR expression in the RPE may be a new therapy for ocular amyloidosis (see, for example, Kawaji T. et al., Ophthalmology, (2010) 117: 552-555). The methods of the invention are useful for treating ophthalmic manifestations of TTR-associated FAP, for example, ocular amyloidosis. The RNAi agent can be delivered in a suitable manner for targeting to a specific tissue, such as the eye. Delivery models to the eye include retrobulbar, subcutaneous eyelid, subconjunctival, sub-Tenon's, anterior chamber, or intravitreal injection (or internal injection or infusion). Specific formulations for delivery to the eye include eye drops or ointments.

Another TTR-associated disorder is hyperthyroxinemia, also known as “distransthyretin hyperthyroxinemia” or “disprealbumin hyperthyroxinemia.” This type of hyperthyroxinemia may be secondary to increased association of thyroxine with TTR resulting from a mutant TTR molecule with increased affinity for thyroxine. See, for example, Moses et al., (1982) J. Clin. Invest., 86, 2025-2033.

The RNAi agents of the invention can be administered to an individual by any route of administration known in the art, including, but not limited to, subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof. In preferred embodiments, the agents are administered subcutaneously.

In some embodiments, administration is via depot injection. Depot injection can continuously release the RNAi agent over an extended period of time. Thus, depot injection may reduce the dosing frequency required to obtain the desired effect, for example, desired TTR inhibition, or therapeutic or prophylactic effect. Depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

In some embodiments, administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.

Other routes of administration include epidural, intracerebral, intracerebroventricular, nasal, intraarterial, intracardiac, intraosseous infusion, intrathecal and intravitreal, and pulmonary. The route of administration can be selected depending on whether local or systemic treatment is desired and depending on the area to be treated. The route and site of administration can be selected to enhance targeting.

In some embodiments, the RNAi agent is administered to an individual in an amount effective to inhibit expression of TTR in a cell of the individual. The amount effective to inhibit TTR expression in a cell in an individual can be assessed by the methods described above, including methods that involve assessing inhibition of TTR mRNA, TTR protein, or related variables such as amyloid deposition.

In some embodiments, the RNAi agent is administered to an individual in a therapeutically or prophylactically effective amount.

A "therapeutically effective amount" as used herein is intended to include an amount of an RNAi agent that, when administered to a patient to treat a TTR-associated disease, is sufficient to effectively treat the disease (e.g., by attenuating, ameliorating, or maintaining an existing disease or one or more symptoms of the disease). The “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and history, age, weight, family history, gene profile, stage of disease processes mediated by TTR expression, types of prior or concomitant therapy in the presence of other individual characteristics of the patient to be treated.

A "prophylactically effective amount" as used herein is intended to include an amount of an RNAi agent that, when administered to an individual who is not yet experiencing or exhibiting symptoms of a TTR-associated disease, but who may be predisposed to the disease, is sufficient to prevent or improvement of the disease or one or more symptoms of the disease. Symptoms that may be improved include sensory neuropathy (eg, paresthesia, hypoesthesia in the distal extremities), autonomic neuropathy (eg, gastrointestinal dysfunction such as gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic failure, cardiomyopathy, vitreous opacities, renal failure, nephropathy, significant reduction in mBMI (modified body mass index), cranial nerve dysfunction and lattice corneal degeneration. Improvement of a disease includes slowing the progression of a disease or reducing the severity of a later developing disease. The “prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, disease risk and history, age, weight, family history, gene profile, types of prior or concomitant treatments, if any, and other individual characteristics of the patient being treated. .

A “therapeutically effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that provides the desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. The RNAi agents used in the methods of the present invention can be administered in sufficient quantities to provide a reasonable benefit/risk ratio applicable to such treatment.

As used herein, the phrases “therapeutically effective amount” and “prophylactically effective amount” also include an amount that has a beneficial effect in treating, preventing, or managing disease processes or symptom(s) of disease processes mediated by TTR expression. Symptoms of TTR amyloidosis include sensory neuropathy (eg, paresthesia, hypoesthesia in the distal limbs), autonomic neuropathy (eg, gastrointestinal dysfunction such as gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic failure, cardiomyopathy, opacities vitreous, renal failure, nephropathy, significant reduction in mBMI (modified body mass index), cranial nerve dysfunction and lattice corneal degeneration.

The dose of RNAi agent administered to an individual can be adjusted to balance the risks and benefits of a particular dose, for example, to achieve a desired level of TTR gene suppression (as assessed, for example, by TTR mRNA suppression, TTR protein expression, or reduction in amyloid deposition, as defined above) or the desired therapeutic or prophylactic effect, while eliminating unwanted side effects.

In one embodiment, the RNAi agent is administered at a dose of about 0.25 mg/kg to about 50 mg/kg, such as about 0.25 mg/kg to about 0.5 mg/kg, about 0.25 mg/kg to about 1 mg/kg, about 0.25 mg/kg to about 5 mg/kg, about 0.25 mg/kg to about 10 mg/kg, about 1 mg/kg to about 10 mg /kg, approximately 5 mg/kg to approximately 15 mg/kg, approximately 10 mg/kg to approximately 20 mg/kg, approximately 15 mg/kg to approximately 25 mg/kg, approximately 20 mg/kg to approximately 30 mg/kg, about 25 mg/kg to about 35 mg/kg, or about 40 mg/kg to about 50 mg/kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, approximately 5 mg/kg, approximately 6 mg/kg, approximately 7 mg/kg, approximately 8 mg/kg, approximately 9 mg/kg, approximately 10 mg/kg, approximately 11 mg/kg, approximately 12 mg/kg, approximately 13 mg/kg, approximately 14 mg/kg, approximately 15 mg/kg, approximately 16 mg/kg, approximately 17 mg/kg, approximately 18 mg/kg, approximately 19 mg/kg, approximately 20 mg/kg, approximately 21 mg/kg kg, approximately 22 mg/kg, approximately 23 mg/kg, approximately 24 mg/kg, approximately 25 mg/kg, approximately 26 mg/kg, approximately 27 mg/kg, approximately 28 mg/kg, approximately 29 mg/kg, 30 mg/kg, approximately 31 mg/kg, approximately 32 mg/kg, approximately 33 mg/kg, approximately 34 mg/kg, approximately 35 mg/kg, approximately 36 mg/kg, approximately 37 mg/kg, approximately 38 mg /kg, approximately 39 mg/kg, approximately 40 mg/kg, approximately 41 mg/kg, approximately 42 mg/kg, approximately 43 mg/kg, approximately 44 mg/kg, approximately 45 mg/kg, approximately 46 mg/kg , approximately 47 mg/kg, approximately 48 mg/kg, approximately 49 mg/kg, or approximately 50 mg/kg.

In some embodiments, the RNAi agent is administered in two or more doses. If desired, implantation of a delivery device such as a pump, semi-permanent stent (eg, intravenous, intraperitoneal, intracisternal, or intracapsular) or reservoir may be recommended to facilitate repeated or frequent infusions. In some embodiments, the number or number of subsequent doses depends on obtaining the desired effect, e.g. suppression of the TTR gene, or obtaining a therapeutic or prophylactic effect, for example, reducing amyloid deposition or reducing a symptom of a TTR-associated disease. In some embodiments, the RNAi agent is administered according to an administration schedule. For example, the RNAi agent can be administered twice a week, three times a week, four times a week, or five times a week. In some embodiments, the administration schedule includes administration at regular intervals, for example, every hour, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 daily, weekly, biweekly or monthly. In other embodiments, the administration schedule includes administration at short intervals followed by a longer period during which no agent is administered. For example, the administration schedule may include an initial set of doses that are administered over a relatively short period of time (eg, about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours), followed by more an extended period of time (eg, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which no RNAi agent is administered. In one embodiment, the RNAi agent is initially administered every hour and then administered over a longer period of time (eg, daily, weekly, biweekly, or monthly). In another embodiment, the RNAi agent is initially administered daily and then administered over a longer period of time (eg, weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time, or is determined based on the desired effect being obtained. In a specific embodiment, the RNAi agent is administered once daily for the first week, followed by weekly dosing beginning on the eighth day of administration. In another specific embodiment, the RNAi agent is administered every other day during the first week, followed by weekly dosing starting on the eighth day of administration.

Any of these patterns may optionally be repeated for one or more cycles. The number of cycles may depend on obtaining a desired effect, for example, suppression of the TTR gene, retinol binding protein levels, vitamin A levels, and/or obtaining a therapeutic or prophylactic effect, for example, reducing amyloid deposition or reducing the symptom of a TTR-associated disease.

In some embodiments, the RNAi agent is administered in conjunction with other therapeutic agents or in accordance with other treatment regimens. For example, other agents or other treatment regimens suitable for treating TTR-associated disease may include liver transplantation, which can reduce levels of mutant TTR in the body, tafamidis (Vyndaqel), which kinetically stabilizes the TTR tetramer, preventing the dissociation required for TTR amyloidogenesis, and diuretics, which can be used, for example, to reduce swelling in TTR amyloidosis involving the heart.

In one embodiment, the individual is administered an initial dose and one or more maintenance doses of the RNAi agent. The maintenance dose or doses may be the same or lower than the initial dose, for example, half the initial dose. A maintenance treatment regimen may involve treating the individual with a dose or doses ranging from 0.01 mcg to 15 mg/kg body weight per day, e.g., 10 mg/kg, 1 mg/kg, 0.1 mg/kg, 0.01 mg /kg, 0.001 mg/kg or 0.00001 mg/kg body weight per day. Maintenance doses are administered, for example, no more than once every 2 days, once every 5 days, once every 7 days, once every 10 days, once every 14 days, once every 21 days or once every 30 days . In addition, the treatment regimen may last for a period of time, which varies depending on the nature of the particular disease, its severity and the general condition of the patient. In certain embodiments, dosing may be performed no more than once per day, for example, no more than once every 24, 36, 48 or more hours, for example, no more than once every 5 or 8 days. After treatment, the patient can be monitored for changes in his/her condition. The dose of the RNAi agent may be increased if the patient does not respond significantly to current dosing levels, or the dose may be decreased if symptoms of the disease condition are observed to improve, if the disease condition is resolved, or if unwanted side effects are observed.

VI. Sets

The present invention also relates to kits for carrying out any of the methods according to the invention. Such kits include one or more RNAi agents and instructions for use, e.g. instructions for inhibiting TTR expression in a cell by contacting the cell with an RNAi agent(s) in an amount effective to inhibit TTR expression. The kits may optionally further contain means for bringing the cell into contact with the RNAi agent (eg, an injection device) or means for measuring TTR inhibition (eg, means for measuring inhibition of TTR mRNA or TTR protein). Such means for measuring TTR inhibition may comprise means for obtaining a sample from an individual, such as, for example, a plasma sample. The kits of the invention may optionally further contain means for administering the RNAi agent(s) to an individual or means for determining a therapeutically effective or prophylactically effective amount.

The present invention is further illustrated by the following examples, which should not be interpreted as limiting. The contents of all references and published patents and patent applications cited throughout the application are therefore incorporated herein by reference.

EXAMPLES

Example 1: TTR Inhibition by TTR-GalNAc Conjugates

A single dose of AD-43527 TTR RNAi agent was administered subcutaneously to mice, and TTR mRNA levels were determined 72 hours after administration.

The mouse/rat cross-reacting GalNAc conjugate AD-43527 was selected to evaluate in vivo suppression of TTR mRNA expression in the liver of WT C57BL/6 mice. The sequence of each chain of AD-43527 is presented below.

Chain: s = semantic; as = antisense

The ligand used was GalNAc ₃ :

This GalNAc ₃ ligand was conjugated to the 3' end of the sense strand using a linker and bond as shown below:

The structure of the resulting GalNAc ₃ conjugated to the sense strand is shown in the following diagram:

Additional RNAi agents that target TTR and contain the following sequences and modifications were synthesized and evaluated.

TTR RNAi agents that cross-react in mouse/rat

TTR RNAi agents are cross-reactive in humans/cynomolgus monkeys; the original duplex is AD-18328 [containing the sense strand sequence 5'-3' GuAAccAAGAGuAuuccAudTdT (SEQ ID NO:12) and the antisense strand sequence 5'-3' AUGGAAuACUCUUGGUuACdTdT (SEQ ID NO:13) with the following modifications: 2' alternation F/2'OMe w/2 PS on AS.

L96=GalNAc ₃ ; lowercase nucleotides (a, u, g, c) represent 2'-O-methylnucleotides, Nf (i.e. Af) represents a 2'-fluoronucleotide; Q11 represents cholesterol; s is thiophosphate.

AD-43527 was administered to female C57BL/6 mice (6-10 weeks, 5 per group) via subcutaneous injection in a dose volume of 10 μl/g at a dose of 30, 15, 7.5, 3.5, 1.75, or 0.5 mg/kg AD-43527. Control animals received PBS via subcutaneous injection at the same dose volume.

Approximately seventy-two hours later, mice were anesthetized with 200 μl of ketamine and then bled through an incision in the right caudal artery. Liver tissue was collected, snap frozen and stored at -80°C until processing.

Treatment efficacy was assessed by measuring TTR mRNA in the liver 72 hours after dosing. TTR mRNA levels in the liver were assessed using branched DNA assays - QuantiGene 1.0 (Panomics). Briefly, mouse liver samples were minced and tissue lysates were prepared. Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volumes of nuclease-free water and 10 μl of proteinase-K/ml at a final concentration of 20 mg/ml) was incubated at 65°C for 35 minutes. 5 μl of liver lysate and 95 μl of a panel of working probes (TTR probe for the target gene and GAPDH probe for the endogenous control) were added to the capture plate. The capture plate was incubated at 53°C±1°C (approximately 16-20 hours). The next day, the capture plate was washed 3 times with 1X wash buffer (nuclease-free water, buffer component 1, and wash buffer component 2), then dried by centrifugation for 1 minute at 240 g. 100 μl per well of the probe amplification mixture was added to the capture plate, which was sealed with aluminum foil and incubated for 1 hour at 46°C ± 1°C. After incubation for 1 hour, the washing step was repeated, then 100 μl per well of the labeled probe mixture was added. Capture plates were incubated at 46°C ± 1°C for 1 hour. The plates were then washed with 1X wash buffer, dried, and added to the plates to capture 100 μL of substrate per well. Capture plates were incubated for 30 minutes at 46°C followed by incubation for 30 minutes at room temperature. After incubation, the plates were read using a SpectraMax luminometer. b-DNA data were analyzed by subtracting the mean background value from each replicate sample, averaging the replicate GAPDH (control probe) and TTR (experimental probe) values, and then calculating the ratio: (experimental probe - background value)/(control probe - background value) . For each group, the mean TTR mRNA level was calculated and normalized to the PBS group mean to obtain relative TTR mRNA as % of the PBS control group.

The results are presented in Figure 1. The GalNAc-conjugated RNAi agent targeting TTR had an ED _{50 of} approximately 5 mg/kg for TTR mRNA knockdown. These results demonstrate that GalNAc-conjugated RNAi agents targeting TTR are effective in inhibiting TTR mRNA expression.

Example 2: TTR Inhibition by TTR-GalNAc Conjugates is Persistent

Mice were administered a subcutaneous dose (7.5 or 30.0 mg/kg) of AD-43527, a GalNAc-conjugated TTR-targeting RNAi agent. Using the method described in Example 1, the level of TTR mRNA in the liver was assessed on days 1, 3, 5, 7, 10, 13, 15, 19, 26, 33 and 41 after dosing.

The results are shown in Figure 2. On day 19, administration of 30.0 mg/kg GalNAc-conjugated RNAi agents still exhibited approximately 50% inhibition. Complete restoration of expression occurred on day 41.

These results demonstrated that the inhibition provided by GalNAc-conjugated siRNA targeting TTR was persistent, lasting up to 3, 5, 7, 10, 13, 15, 19, 26, or 33 days after treatment.

Example 3. RNA synthesis and duplex annealing

1. Oligonucleotide synthesis

Oligonucleotides were synthesized on an AKTA Oligopilot synthesizer or an ABI 394 synthesizer. Unless otherwise specified, a commercially available solid glass support with controlled pore size (dT-CPG, 500Å, Prime Synthesis) and RNA phosphoramidites with standard 5'-O protecting groups were used to synthesize oligonucleotides -dimethoxytrityl-N6-benzoyl-2'- tert -butyldimethylsilyladenosine-3'-ON, N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'- tert -butyldimethylsilylcytidine-3'-ON ,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'- tert -butyldimethylsilylguanosine-3'-ON,N'-diisopropyl-2-cyanoethylphosphoramidite and 5'-O-dimethoxytrityl-2 ' -tert -butyldimethylsilyl uridin-3-ON,N'-diisopropyl-2-cyanoethyl phosphoramidite (Pierce Nucleic Acids Technologies). 2'-F-phosphoramidites, 5'-O-dimethoxytrityl-N4-acetyl-2'-fluorocytidine-3'-ON,N'-diisopropyl-2-cyanoethylphosphoramidite and 5'-O-dimethoxytrityl-2'-fluorouridine-3 '-ON,N'-diisopropyl-2-cyanoethyl phosphoramidite was purchased from Promega. All phosphoramidites were used at 0.2M in acetonitrile (CH ₃ CN) except guanosine, which was used at 0.2M in 10% THF/ANC (v/v). A binding/recycling time of 16 minutes was used. The activator was 5-ethylthiotetrazole (0.75M, American International Chemicals), iodine/water/pyridine was used for PO oxidation, and PADS (2%) in 2,6-lutidine/ACN (1:1 v/v) was used for PS oxidation. ./about.).

Ligand-conjugated chains were synthesized using a solid support containing the appropriate ligand. For example, the introduction of a carbohydrate group/ligand (eg, GalNAc) at the 3' end of the sequence was achieved by starting the synthesis with an appropriate carbohydrate solid support. Similarly, a cholesterol molecule was introduced at the 3' end by starting synthesis on a cholesterol-based support. Typically, the ligand molecule is coupled to trans -4-hydroxyprolinol through a bond selected as described in the previous examples to produce a hydroxyprolinol-ligand molecule. The hydroxyprolinol ligand molecule was then coupled to the solid support via a succinate linker or converted to phosphoramidite via standard phosphorylation conditions to produce the desired carbohydrate conjugate building blocks. Fluorophore-labeled siRNA was synthesized from the corresponding phosphoramidite or using a solid support purchased from Biosearch Technologies. The oleyl lithocholic acid (GalNAc) ₃ polymer substrate was prepared in the testing laboratory at a load of 38.6 µmol/gram. Mannose (Man) ₃ polymer support was also prepared in the testing laboratory at a load of 42.0 µmol/gram.

Conjugation of a ligand selected at the desired position, for example, at the 5' end of the sequence, was obtained by binding the appropriate phosphoramidite to the growing chain under standard phosphoramidite binding conditions unless otherwise noted. Long-term binding for 15 minutes of a 0.1 M solution of phosphoramidite in anhydrous CH ₃ CN in the presence of the activator 5-(ethylthio)-1H-tetrazole with an oligonucleotide bound to a solid support. Oxidation of internucleotide phosphite to phosphate was carried out using an iodine-water standard as published in Beaucage SL, (2008) Solid-phase synthesis of siRNA oligonucleotides, Curr. Opin. Drug Discov. Devel., 11, 203-216; Mueller S., Wolf J. and Ivanov S.A., (2004) Current Strategies for the Synthesis of RNA, Curr. Org. Synth., 1, 293-307; Xia J., Noronha A., Toudjarska I., Li F., Akinc A., Braich R., Frank-Kamenetsky M., Rajeev KG, Egli M. and Manoharan M., (2006) Gene Silencing Activity of siRNAs with a Ribo-difluorotoluyl Nucleotide, ACS Chem. Biol., 1, 176-183, or by treatment with tert -butyl hydroperoxide/acetonitrile/water (10:87:3) with a 10-minute oxidation time of the conjugated oligonucleotide. The thiophosphate was introduced by oxidizing the phosphite to thiophosphate using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS and/or Bocage's reagent. Cholesterol amidophosphite was synthesized in the testing laboratory and used at a concentration of 0.1 M in dichloromethane. The binding time for cholesterol phosphoramidite was 16 minutes.

2. Deprotection I (deprotection of the nucleic base)

After completion of the synthesis, the substrate was transferred to a 100 ml glass vial (VWR). The oligonucleotide was cleaved from the support while deprotecting the base and phosphate groups using 80 ml of ammonia ethanol solution [ammonia:ethanol (3:1)] for 6.5 hours at 55°C. The vials were quickly cooled on ice, and then the ethanol ammonia solution mixture was filtered into a new 250 mL vial. The CPG was washed in portions of 2×40 ml ethanol/water (1:1 v/v). Then the volume of the mixture was reduced to ~30 ml using a rotary vacuum evaporator. The mixture was then frozen on dry ice and vacuum dried using a SpeedVac.

3. Deprotection II (removal of 2'-TBDMS group)

The dry residue was resuspended in 26 ml of triethylamine, triethylamine trihydrofluoride (TEA.3HF) or pyridine-HF and DMSO (3:4:6) and heated at 60°C for 90 minutes to remove tert -butyldimethylsilyl (TBDMS) groups in 2'- position The reaction was then quenched with 50 ml of 20 mM sodium acetate and adjusted to pH 6.5, and stored in the freezer until purification.

4. Analysis

Oligonucleotides were analyzed by high performance liquid chromatography (HPLC) prior to purification, and the choice of buffer and column depended on the nature of the sequence and/or conjugated ligand.

5. HPLC Purification

Ligand-conjugated oligonucleotides were purified by reverse-phase preparative HPLC. Unconjugated oligonucleotides were purified by anion exchange HPLC on a TSK gel column filled in the testing laboratory. Buffers were 20 mM sodium phosphate (pH 8.5) in 10% CH ₃ CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH ₃ CN, 1 M NaBr (buffer B). Fractions containing full-length oligonucleotides were pooled, desalted, and lyophilized. At approximately 0.15 OD, desalted oligonucleotides were diluted in water to 150 μL and then pipetted into dedicated vials for CGE and LC/MS analysis. Compounds were ultimately analyzed by LC-ESMS and CGE.

6. Preparation of the RNAi agent

To prepare the RNAi agent, equimolar amounts of sense and antisense strand were heated in 1×PBS at 95°C for 5 minutes and slowly cooled to room temperature. The integrity of the duplex was confirmed by HPLC analysis. Table 1 below presents RNAi agents that target human or rodent TTR mRNA.

Example 4: In Vitro Screening of RNAi Agents

Cell culture and transfections

Human Hep3B cells or rat H.II.4.E cells (ATCC, Manassas, VA) were grown to near confluence at 37°C in 5% CO ₂ in RPMI (ATCC) supplemented with 10% FBS, streptomycin, and glutamine ( ATCC) before separation from the plate by trypsinization. Transfection was performed by adding 14.8 μl of Opti-MEM plus 0.2 μl of RNAiMax Lipofectamine per well (Invitrogen, Carlsbad CA. catalog no. 13778-150) to 5 μl of siRNA duplexes per well in a 96-well plate and incubated at room temperature in within 15 minutes. Then 80 μl of complete growth medium without antibiotic containing ~2×10 ⁴ Hep3B cells was added to the siRNA mixture. Before RNA purification, cells were incubated for 24 or 120 hours. Single dose experiments were performed at final duplex concentrations of 10 nM and 0.1 nM, and dose effect experiments were performed using 8.4 fold serial dilutions with a maximum dose of a final duplex concentration of 10 nM.

Total RNA Isolation using DYNABEADS mRNA Isolation Kit (Invitrogen, Lot No: 610-12)

Cells were collected and lysed in 150 μl of lysis/binding buffer, then mixed for 5 minutes at 850 rpm. using an Eppendorf thermomixer (mixing speed was the same throughout the entire process). Ten microliters of magnetic beads and 80 μl of lysis/binding buffer mixture were added to a round bottom plate and mixed for 1 minute. The magnetic beads were captured using a magnetic holder and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, the magnetic beads were washed 2 times with 150 μl of wash buffer A and mixed for 1 minute. The beads were recaptured and the supernatant was removed. The beads were then washed with 150 μl of wash buffer B, and the supernatant was collected and discarded. The beads were then washed with 150 μl of elution buffer, the supernatant was collected, and the supernatant was removed. The granules were left to dry for 2 minutes. After drying, 50 μl of elution buffer was added and stirred for 5 minutes at 70°C. The granules were captured with a magnet for 5 minutes. 40 μl of supernatant was removed and added to another 96-well plate.

cDNA synthesis using the ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, catalog no. 4368813)

To 5 µl of total RNA, a master mixture of 1 µl 10X buffer, 0.4 µl 25X dNTPs, 1 µl random primers, 0.5 µl reverse transcriptase, 0.5 µl RNase inhibitor and 1.6 µl H ₂ O was added per reaction. cDNA was prepared using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) using the following steps: 25°C 10 minutes, 37°C 120 minutes, 85°C 5 seconds, storage at 4°C.

Real-time PCR

2 µl of cDNA was added to a master mixture containing 0.5 µl GAPDH TaqMan Probe (Applied Biosystems catalog no. 4326317E (human), catalog no. 4308313 (rodent)), 0.5 µl TTR TaqMan probe (Applied Biosystems catalog no. HS00174914_m1 (human) , catalog no. Rn 00562124__m1 (rat)) and 5 µl of Lightcycler 480 probe master mix (Roche, catalog no. 04887301001) per well in a 384-well plate (Roche, catalog no. 04887301001). Real-time PCR was performed in a Roche LC 480 real-time PCR device (Roche). Each duplex was tested in at least two independent transfections, and each transfection was scored in duplicate unless otherwise noted.

To calculate the relative fold change, real-time data were analyzed by the ΔΔCt method and normalized to assays performed with cells transfected with 10 nM AD-1955 or mock-transfected cells. IC ₅₀ was calculated using a fitted 4-parameter model using XLFit and normalized to cells transfected with AD-1955 (sense sequence: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 2202), antisense sequence: UCGAAGuCUcAGCGuAAGdTsdT (SEQ ID NO: 2203)), or native cells in a similar dose range, or at their lowest dose. IC50 was calculated for each individual transfection, as well as in combination, where the individual _IC50 coincided with that of both transfections.

The gene silencing results of an exemplary siRNA duplex with various motif modifications of the invention are presented in Table 1 above.

Example 5: In Vitro Inhibition Activity of Chemically Modified TTR RNAi Agents

The following experiments demonstrated the beneficial effects of chemical modifications, including the introduction of triplet repeat motifs together with the GalNAc ₃ ligand, in inhibiting the activity of TTR-targeting RNAi agents. The sequences of the study agents are provided in Table 2 below. The TTR mRNA complementarity regions are as follows: the complementarity region of the RNAi agents AD-45165, AD-51546 and AD-51547 is GGATGGGATTTCATGTAACCAAGA (SEQ ID NO:2204) and the complementarity region of the RNAi agents AD-45163, AD -51544 and AD-51545 is TTCATGTAACCAAGAGTATTCCAT (SEQ ID NO: 2205).

Protocol for assessing IC ₅₀ in Hep3B cells

In Hep3B cells (a human hepatoma cell line), the IC ₅₀ for each modified siRNA was determined by standard transient transfection using Lipofectamine RNAiMax. Briefly, transient transfection was performed by adding 5 μl of Opti-MEM to 5 μl of siRNA duplex per well in a 96-well plate along with 10 μl of Opti-MEM plus 0.5 μl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA., catalog No. 13778-150) and incubation at room temperature for 15-20 minutes. After incubation, 100 μl of complete growth medium without antibiotic containing 12,000–15,000 Hep3B cells was then added to each well. Before lysis and analysis of TTR and GAPDH mRNA by rDNA assay (Quantigene), cells were incubated for 24 hours at 37°C in an atmosphere of 5% CO ₂ . To determine the IC _50, seven different siRNA concentrations ranging from 10 nM to 0.6 pM were assessed and TTR/GAPDH for siRNA-transfected cells was normalized to cells transfected with 10 nM Luc siRNA. The results are presented in Table 2.

Free Absorption IC ₅₀ Evaluation Protocol

After incubation with siRNAs targeting TTR for 4 hours or 24 hours, inhibition of free uptake in primary cynomolgus macaque hepatocytes was assessed. Suppression was measured at 24 hours from initial exposure. Briefly, 24 hours before the start of the experiment, 96-well culture plates were coated with 0.05%-0.1% collagen (Sigma C3867-1VL) at room temperature. On the day of analysis, siRNA was diluted in prewarmed seeding medium consisting of DMEM supplemented with GIBCO maintenance medium kit (serum-free, Life Technologies CM4000) and added to collagen-coated 96-well culture plates. Cryopreserved primary cynomolgus macaque hepatocytes were rapidly thawed in a 37°C water bath and immediately diluted in plating medium at a concentration of 360,000 cells/ml. A volume of cell suspension was gently pipetted onto the top of the pre-coated siRNA such that the final number of cells per well was 18,000 cells/well. The plate was gently rotated to mix and spread the cells even across the wells and placed in an incubator at 37°C, 5% CO ₂ for 24 hours before lysis and analysis of TTR and GAPDH mRNA by rDNA (Quantigene, Affymetrix). If incubated for 4 hours with siRNA, the medium was discarded after 4 hours of cell exposure and replaced with fresh plating medium for the remaining 20 hours of incubation. Downstream analysis of TTR and GAPDH mRNAs was as described above. For a representative dose-response curve, siRNA was titrated from 1 μM to 0.24 nM by 4-fold serial dilution.

Nucleotides in lowercase letters (a, u, g, c) indicate 2'-O-methylnucleotides; Nf (eg Af) means 2'-fluoronucleotide; s means phosphothiorate bond; L96 means GalNAc ₃ ligand; nucleotides in bold indicate changes relative to the corresponding parent drug. Each nucleotide in bold is located at the center of the triplet motif.

The results are provided in Table 2 and demonstrate that the modified RNAi agents targeting TTR provide enhanced silencing activity.

Results: Improved activity of modified RNAi agents

Initial RNAi agents with alternating chemical modifications and GalNAc ₃ ligand provided an IC ₅₀ in Hep3B cells of approximately 0.01 nM. As shown in Figures 4-5 and Table 2, agents modified from the parent agents, for example by adding one or more repeating triplets of 2'-fluoro- and 2'-O-methyl modifications, exhibited unexpectedly increased suppression activity, reaching IC ₅₀ values in Hep3B cells, which were 5-8 times better than the corresponding parent drug.

Results: IC ₅₀ free uptake in Hep3B cells

As shown in Table 2 and Figures 6-7, RNAi agents modified from the parent AD-45163 also exhibited increased inhibition of free uptake. The modified agents exhibited more than twice the parent compound inhibitory activity after an incubation period of 24 hours and approximately 10 times the parent compound inhibitory activity after a 4 hour incubation period.

As shown in Table 2 and Figures 8-9, RNAi agents modified from the parent AD-45165 also exhibited increased inhibition of free uptake. The modified agents exhibited 2-3 times greater inhibitory activity of the parent agent after an incubation period of 24 hours and 5-8 times greater inhibition activity of the parent compound after an incubation period of 4 hours.

Taken together, these results demonstrate that the modified RNAi agents provided herein, e.g., AD-51544, AD-51545, AD-51546, and AD-51547, all exhibit surprisingly good inhibition of TTR mRNA in in vitro silencing experiments.

Example 6: TTR RNA Suppression and TTR Protein Inhibition in Transgenic Mice

To evaluate the efficacy of the RNAi agents AD-45163, AD-51544, AD-51545, AD-45165, AD-51546, and AD-51547, the agents were administered to transgenic mice that expressed human transthyretin with the V30M mutation (see Santos SD., Fernaande , R. and Saraiva M.J., (2010) Neurobiology of Aging, 31, 280-289). The V30M mutation is known to cause familial amyloid polyneuropathy type I in humans. See, for example, Lobato L., (2003) J. Nephrol., 16(3):438-42.

RNAi agents (in PBS buffer) or PBS control were administered to mice (2 males and 2 females) aged 18-24 months at a single subcutaneous dose of 5 mg/kg or 1 mg/kg. Approximately 48 hours later, mice were anesthetized with 200 μl of ketamine and then bled by cutting the right caudal artery. Whole blood and plasma were isolated and stored at -80°C until analysis. Liver tissue was collected, snap frozen and stored at -80°C until processing.

Treatment efficacy was assessed by (i) measuring TTR mRNA in the liver 48 hours after dosing and (ii) measuring plasma TTR protein before drug administration and 48 hours after dosing. TTR mRNA levels in the liver were analyzed using branched DNA assays - QuantiGene 2.0 (Panomics, catalog no.: QS0011). Briefly, mouse liver samples were minced and tissue lysates were prepared. Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volumes of nuclease-free water and 10 μl of proteinase-K/ml to a final concentration of 20 mg/ml) was incubated at 65°C for 35 minutes. 20 μL of the working probe set (TTR probe for the target gene and GAPDH probe for the endogenous control) and 80 μL of tissue lysate were then added to the capture plate. Capture plates were incubated at 55°C±1°C (approximately 16-20 hours). The next day, capture plates were washed 3 times with 1X wash buffer (nuclease-free water, buffer component 1 and wash buffer component 2), then dried by centrifugation for 1 minute at 240 g. 100 μl of pre-amplified working reagents was added to the capture plate, which was sealed with aluminum foil and incubated for 1 hour at 55°C ± 1°C. After incubation for 1 hour, the washing step was repeated, then 100 μl of amplification working reagent was added. After 1 hour, the washing and drying steps were repeated and 100 μl of labeled probe was added. Capture plates were incubated at 50°C±1°C for 1 hour. The plate was then washed with 1X wash buffer, dried, and 100 μL of substrate was added. Capture plates were read using a SpectraMax luminometer after incubation for 5 to 15 minutes. rDNA data were analyzed by subtracting the mean background value from each triplicate sample, averaging the resulting values of the three replicates of GAPDH (control probe) and TTR (experimental probe), and then calculating the ratio: (experimental probe-background)/(control probe-background) meaning).

Plasma TTR levels were analyzed using the commercially available “AssayMax Human Prealbumin ELISA Kit” (AssayPro, St. Charles, MO, catalog no. EP3010-1) according to the manufacturer's instructions. Briefly, mouse plasma was diluted 1:10,000 in a 1X diluent mixture and added to precoated plates along with a set of standards and incubated for 2 hours at room temperature followed by 5X washes with the wash buffer provided in the kit. Fifty microliters of biotinylated anti-prealbumin antibody was added to each well and incubated for 1 hour at room temperature, followed by 5X washes with wash buffer. Fifty microliters of streptavidin-peroxidase conjugate was added to each well and the plates were incubated for 30 minutes at room temperature, followed by washing as previously described. The reaction was started by adding 50 μl/well of chromogen substrate and incubating for 10 minutes at room temperature, where the reaction was stopped by adding 50 μl/well stopping solution. Optical density at 450 nm was recorded on a Versamax microplate spectrophotometer (Molecular Devices, Sunnyvale, CA) and data analyzed using the Softmax 4.6 software package (Molecular Devices).

The results are presented in figures 10-12. Figure 10 demonstrates that the RNAi agents modified from the parent agent AD-45163 and AD-45165 exhibited RNA silencing activity that was similar to or greater than that of the parent compounds. Figure 11 demonstrates that AD-51544 and AD-51545 exhibited dose-dependent suppressive activity, and that the suppressive activity of these agents at a dose of 5 mg/kg was similar to the suppressive activity of the corresponding parent AD-45163. Figure 12 demonstrates that AD-51546 and AD-51547 also exhibited dose-dependent suppressive activity. In addition, the inhibitory activity of AD-51546 and AD-51547 at a dose of 5 mg/kg was similar to the inhibitory activity of the corresponding parent AD-45165.

Example 7: Pharmacokinetic Profiles of TTR-Targeting RNAi Agents in Mouse Serum and Liver

To evaluate the pharmacokinetic profiles of the RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547, these agents were administered in PBS buffer to C57BL/6 mice using a single bolus IV or subcutaneous (SC) route. introduction. Plasma concentrations and liver concentrations were assessed at various time points after administration.

Plasma pharmacokinetic parameters are presented in Tables 3 and 4 below. The mean plasma retention time (MRT) was approximately 0.2 hours after IV dosing and approximately 1 hour after SC dosing. At a dose of 25 mg/kg, AD-51544, AD-51545, AD-51546 and AD-51547 had similar pharmacokinetic properties in plasma. Each of these agents had more than 75% bioavailability from the subcutaneous space. Their bioavailability was superior to that of the parent drug AD-45163, which was administered at a higher dose of 30 mg/kg. The subcutaneous bioavailability of AD-51544 and AD-51547 was approximately 100%, whereas AD-51545 was 90% and the bioavailability of AD-51546 was 76%.

Table 3
Results of assessment of PK parameters in plasma after subcutaneous administration of TTR-GalNAc siRNA in mice Parameter 30 mg/kg AD-45163 (h/c TTR-GalNAc) 25 mg/kg AD-51544 (h/c TTR-GalNAc) 25 mg/kg AD-51545 (h/c TTR-GalNAc) 25 mg/kg AD-51546 (h/c TTR-GalNAc) 25 mg/kg AD-51547 (h/c TTR-GalNAc) Tmax in plasma (h) 0.25 1 0.5 1 0.5 Cmax in plasma (µg/ml) 9.6 11.7 10.9 11.7 12.1 AUC in plasma (h*µg/ml) 12.4 21.9 19.9 20.9 25.3 F _sc (%) 79 100 90.1 76.0 99.2

Table 4
Plasma miRNA PK parameters in mice following IV bolus or SC dosing of AD-51544, 51545, 51546, or 51547 at 25 mg/kg Test drug AD-51544 AD-51545 AD-51546 AD-51547 siRNA dose (mg/kg) 25 25 25 25 Routes of administration IV PC IV PC IV PC IV PC T _max (h) 0.083 1 0.083 0.5 0.083 1 0.083 0.5 C _max (µg/ml) 96.5a 11.7 108 ^a 10.9 128a 10.9 ^123a 12.1 AUC _0-last (h∙µg/ml) 21.6 21.9 22.1 19.9 27.5 20.9 25.5 25.3 MRT _0-last (h) 0.17 1.2 0.16 1.1 0.22 1.4 0.19 1.3 Apparent t _1/2β (h) ^b not defined not defined not defined 0.49 not defined 1.2 not defined 0.56 F _sc (%) ^s _ 102 _ 90.1 _ 76.0 _ 99.2 a: Concentration at the 1st sampling time (5 min) after IV dosing
b: The apparent elimination half-life (t _1/2β ) cannot be determined (ND) for all 4 tested drugs after IV dosing because The final phase of the concentration-time profiles was not determined because t _1/2β- related PK parameters (eg AUC _0-∞ , CL and Vss) were not described.
c: SC bioavailability, calculated as the percentage of AUC _0-last after SC and IV dosing at 25 mg/kg.

The results also indicated that the RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547 provided similar or higher hepatic concentrations when administered subcutaneously compared to IV bolus administration. Pharmacokinetic parameters for the liver are presented in Tables 5 and 6 below. Peak concentration ( _Cmax ) and area under the curve (AUC _0-last ) in the liver were two to three times higher after subcutaneous administration compared to intravenous administration of a similar drug at a similar dose. Liver concentrations were highest for AD-51547 and lowest for AD-51545. The mean retention time (MRT) and half-life were longer for AD-51546 and AD-51547 compared to AD-51544 and AD-51545. Following subcutaneous administration, the approximate MRTs were 40 hours for AD-51546 and 25 hours for AD-51547, while the MRTs for AD-51544 and AD-51545 were less (approximately 6-9 hours). The half-life of AD-51546 and AD-51547 was also higher (41-53 hours) than the half-life of AD-51544 and AD-51545 (6-10 hours).

Table 5
Results of assessment of PK parameters in the liver after subcutaneous administration of TTR-GalNAc siRNA in mice Parameter 30 mg/kg AD-45163 (h/c TTR-GalNAc) 25 mg/kg AD-51544 (h/c TTR-GalNAc) 25 mg/kg AD-51545 (h/c TTR-GalNAc) 25 mg/kg AD-51546 (h/c TTR-GalNAc) 25 mg/kg AD-51547 (h/c TR-GalNAc) Tmax in liver (h) 8 4 4 2 8 Cmax in liver (µg/g) 313 126 80 117 174 AUC in liver (h*mcg/g) 4519 1092 763 2131 4583

Table 6
PK miRNA parameters in the liver of mice following an IV bolus or SC dose of AD-51544, 51545, 51546, or 51547 at 25 mg/kg Test drug AD-51544 AD-51545 AD-51546 AD-51547 siRNA dose (mg/kg) 25 25 25 25 Routes of administration IV PC IV PC IV PC IV PC t _max (h) 1 4 1 4 4 2 2 8 C _max (µg/g) 67.9 126 37.0 80.5 35.3 117 73.8 174 AUC _0-last (h∙µg/g) 632 1092 324 763 984 2131 1429 4583 MRT _0-last (h) 8.7 6.5 5.9 8.5 45.7 40.2 29.4 25.3 Apparent t _1/2β (h) 8.1 8.2 5.7 10.0 51.1 45.3 41.1 52.7

Example 8: In Vitro Stability of RNAi Agents in Monkey Serum

The stability of the RNAi agents AD-51544, AD-51545, AD-51546, and AD-51547 in monkey serum was also assessed. The results demonstrated that the antisense and sense chains of AD-51544, AD-51545 and AD-51547 were stable in serum over a period of approximately 24 hours (data not shown).

Example 9: RNAi Agents Provide Long-lasting TTR Protein Suppression in Non-Human Primates

The RNA silencing activity of the RNAi agents AD-45163, AD-51544, AD-51545, AD-51546 and AD-51547 was assessed by measuring TTR protein silencing in the serum of cynomolgus monkeys following subcutaneous administration of five doses of 5 mg/kg (one dose every day for 5 days) or a single dose of 25 mg/kg. Pre-dose Pre-dose serum TTR protein levels were estimated by averaging the levels for 11 days before the first dose, 7 days before the first dose, and 1 day before the first dose. Post-dose serum TTR protein levels were assessed by determining serum levels starting on day 1 after the last dose (i.e., study day 5 in the 5 × 5 mg/kg group and study day 1 in the 1 × 25 mg/kg group ) until 49 days after the last dose (i.e. on the 53rd day of the study in the 5x5 mg/kg group and on the 49th day in the 1x25 mg/kg group). See figure 13.

TTR protein levels were assessed as described in Example 6. The results are presented in Figure 14 and Tables 7 and 8.

Maximum TTR protein suppression of approximately 50% was obtained in the group that received 25 mg/kg AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 8). The highest TTR protein suppression of approximately 70% was obtained in the groups that received 5x5 mg/kg AD-45163, AD-51544, AD-51546 and AD-51547 (see Table 7). AD-51545 provided less inhibition in both administration protocols. Significant suppression of approximately 20% or greater was maintained until 49 days after the last dose of AD-51546 and AD-51547 in both 1 x 25 mg/kg and 5 x 5 mg/kg protocols. Generally, better suppression was obtained with the 5 x 5 mg/kg protocol compared to the 1 x 25 mg/kg protocol.

Table 7
Transthyretin in the serum fraction relative to pre-dosing levels in cynomolgus monkeys
(5 mg/kg daily for 5 days) C-ll C-7 C-l C5 C7 C9 Cll C14 C18 C22 C26 C32 C39 C46 C53 AD-45163 0.98 0.99 1.03 0.71 0.52 0.40 0.34 0.27 0.31 0.39 0.48 0.64 0.68 0.81 0.88 AD-51544 1.02 0.99 0.99 0.60 0.47 0.37 0.35 0.39 0.48 0.58 0.66 0.74 0.83 0.91 0.92 AD-51545 1.03 0.97 1.00 0.73 0.65 0.63 0.69 0.68 0.78 0.87 0.97 1.00 1.03 1.06 1.09 AD-51546 1.01 0.97 1.02 0.59 0.42 0.35 0.30 0.32 0.43 0.58 0.66 0.77 0.92 0.93 0.97 AD-51547 0.99 0.99 1.02 0.74 0.54 0.41 0.34 0.34 0.39 0.49 0.51 0.53 0.65 0.70 0.77 Table 8
Transthyretin in the serum fraction relative to pre-dosing levels in cynomolgus monkeys (25 mg/kg) C-ll C-7 C-l Cl C3 C5 C7 C10 C14 C18 C22 C28 C35 C42 C49 AD-45163 1.04 1.01 0.95 0.99 0.84 0.67 0.57 0.44 0.45 0.51 0.58 0.66 0.72 0.78 0.85 AD-51544 1.01 1.04 0.95 0.92 0.69 0.57 0.49 0.48 0.56 0.65 0.69 0.77 0.83 0.87 0.94 AD-51545 0.98 1.02 0.99 0.87 0.77 0.69 0.71 0.72 0.84 0.90 0.92 0.99 1.00 1.00 1.00 AD-51546 1.04 1.03 0.93 0.89 0.71 0.62 0.53 0.50 0.55 0.70 0.70 0.69 0.72 0.79 0.84 AD-51547 0.96 1.03 1.01 1.19 0.90 0.70 0.54 0.48 0.50 0.50 0.52 0.58 0.62 0.70 0.72

Example 10: Tolerability of TTR-Targeting RNAi Agents

Evaluation of cytokines in whole blood analysis

To evaluate the tolerability of TTR-targeting RNAi agents (including AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547), each agent was tested in a whole blood assay using blood from three human donors. The agents were 300 nM transfected DOTAP or 1 μM non-transfected reagent (free siRNA). Less than a two-fold change was observed for the following cytokines/chemokines: G-CSF, IFN-γ, IL-10, IL-12 (p70), IL1β, IL-1ra, IL-6, IL-8, IP-10, MCP -1, MIP-1α, MIP-1β, TNFα. (Results not shown).

In vivo assessment

To assess in vivo tolerability, RNAi agents were injected subcutaneously into CD1 mice at a dose of 125 mg/kg. No cytokine induction was observed 2, 4, 6, 24, or 48 hours after subcutaneous injection of AD-45163. No significant cytokine induction was observed 6 or 24 hours after subcutaneous injection of AD-51544, AD-51545, AD-51546, or AD-51547.

To fully assess in vivo tolerability, a number of RNAi agents (including AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547) were tested by subcutaneous injection of 5 and 25 mg in non-human primates (cynomolgus monkeys) with volumes dose 1-2 ml per area. No erythema or swelling was observed at the injection sites.

Study of tolerability of a single subcutaneous dose in rats

To assess toxicity, rats were injected with a single subcutaneous dose of 100, 250, 500, or 750 mg/kg AD-45163 (see Table 9). The following assessments were performed: clinical signs of toxicity, body weight, complete blood count, clinical chemistry and coagulation, organ weights (liver and spleen), macroscopic and microscopic assessment (kidney, liver, lung, lymph node, spleen, testes, thymus, aorta, heart, intestines (small and thick).

Table 9
Single subcutaneous dose tolerability study in rats: 100, 250, 500 and 750 mg/kg AD-45163 in Sprague Dawley rats Group Dose level (mg/kg) Dose volume (ml/kg) Path and scheme of conduct Male Sprague Dawley rat no. Day of autopsy PBS 0 10 subcutaneous injection day 1 (2 sites) 7/group (5 toxicological animals, 2 TK animals) Day 4 AD-45163 original 100 250 500 750

The results demonstrate that there are no test drug-related clinical signs of toxicity, effects on body weight, organ weights, or clinical biochemistry. Histopathology of the heart, kidneys, testes, spleen, liver, and thymus was not observed. A non-adverse small test drug-related increase in WBC (↑68%, predominantly attributable to increases in NEUT and MONO) was observed at 750 mg/kg. These results suggest that a single dose of up to 750 mg/kg is well tolerated in rats.

Tolerance of repeated subcutaneous injections in rats

To assess the tolerability of repeated subcutaneous administrations of AD-45163, daily subcutaneous injections of 300 mg/kg were administered for 5 days and necropsy was performed on day 6. The study plan is presented in Table 10.

Table 10
Study of tolerability of repeated doses for five days in rats Group Dose level (kmg/kg) Concentration (mg/ml) No. toxicological animals After day 6 PBS 0 0 2M, 2F 2M, 2F AD-45163 300 150 2M, 2F 2M, 2F

The following output parameters were assessed: clinical signs, body weights, hematology, clinical biochemistry and coagulation, organ weights, macroscopic and microscopic evaluation (liver, spleen, kidney, heart, gastrointestinal tract and first and last injection site). The results demonstrated no test drug-related clinical signs, effects on body weight or organ mass, and no test drug-related clinical hematology or biochemistry data. There was a possible slight increase in activated partial thromboplastin time (APTT) on day 6 (20.4 versus 17.4 seconds). Histopathology revealed no drug-related findings in the liver, spleen, heart, or gastrointestinal tract. In the kidney, minimal to slight hypertrophy of the tubular epithelium was observed (not considered unfavorable). In the last area, a minimal multifocal mononuclear infiltrate was observed, which was not considered unfavorable. These results indicate that five daily doses of 300 mg/kg of the parent RNAi agent AD-45163 are well tolerated in rats.

Example 11: RNAi Agents Provide Long-lasting TTR Protein Suppression in Non-Human Primates

The RNA suppression activity of the RNAi agent AD-51547 was assessed by measuring TTR protein suppression in the serum of cynomolgus monkeys following subcutaneous administration of the "intensive phase" of the RNAi agent: five daily doses of 2.5 mg/kg, 5 mg/kg, or 10 mg/kg ( one dose every day for 5 days) followed by a “maintenance phase” of the RNAi agent: weekly dosing of 2.5 mg/kg, 5 mg/kg, or 10 mg/kg for 4 weeks. Pre-dosing serum TTR protein levels were assessed by averaging levels 11 days before the first dose, 7 days before the first dose, and 1 day before the first dose. Post-dose serum TTR protein levels were assessed by determining serum levels relative to the pre-dose period, starting 1 day after the intensive phase, ending at 40 days after the last dose of the maintenance phase (ie, day 70 of the study).

TTR protein levels were assessed as described in Example 6. The results are shown in Figure 15.

Maximum TTR protein suppression of approximately 80% was obtained in all groups that received 2.5 mg/kg, 5 mg/kg, or 10 mg/kg AD-51547. The lowest knockdown level was obtained in all groups at approximately day 14, and suppression was maintained at the lowest knockdown levels at weekly maintenance doses of 2.5 mg/kg, 5 mg/kg, or 10 mg/kg AD-51547. TTR levels did not return to baseline more than 40 days after the day of the last maintenance dose at the 5 and 2.5 mg/kg dosing levels.

Equivalents

Those skilled in the art will appreciate, or can ascertain by the use of routine experimentation alone, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be within the scope of the following claims.

--->

LIST OF SEQUENCES

<110> ALNYLAM PHARMACEUTICALS

<120> RNAi PRODUCTS, COMPOSITIONS AND METHODS OF THEIR APPLICATION

FOR THE TREATMENT OF DISEASES ASSOCIATED WITH TRANSHYRETHIN (TTR)

<130> 121301-00120

<140> New Application

<141> Concurrently Herewith

<150> 61/680,098

<151> 2012-08-06

<150> 61/615,618

<151> 2012-03-26

<150> 61/561,710

<151> 2011-11-18

<160> 2217

<170> Patent In version 3.5

<210> 1

<211> 614

<212> DNA

<213> Homo sapiens

<400> 1

cagaagtcca ctcattcttg gcaggatggc ttctcatcgt ctgctcctcc tctgccttgc 60

tggactggta tttgtgtctg aggctggccc tacgggcacc ggtgaatcca agtgtcctct 120

gatggtcaaa gttctagatg ctgtccgagg cagtcctgcc atcaatgtgg ccgtgcatgt 180

gttcagaaag gctgctgatg acacctggga gccatttgcc tctgggaaaa ccagtgagtc 240

tggagagctg catgggctca caactgagga ggaatttgta gaagggatat acaaagtgga 300

aatagacacc aaatcttact ggaaggcact tggcatctcc ccattccatg agcatgcaga 360

ggtggtattc acagccaacg actccggccc ccgccgctac accattgccg ccctgctgag 420

cccctactcc tattccacca cggctgtcgt caccaatccc aaggaatgag ggacttctcc 480

tccagtggac ctgaaggacg agggatggga tttcatgtaa ccaagagtat tccatttta 540

ctaaagcagt gttttcacct catatgctat gttagaagtc caggcagaga caataaaaca 600

ttcctgtgaa aggc 614

<210> 2

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2

ugggauuuca uguaaccaag a 21

<210> 3

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 3

ucuugguuac augaaauccc auc 23

<210> 4

<211> 16

<212> Protein

<213> Unknown

<220>

<223> Description of the unknown: Illustrative

hydrophobic peptide membrane translocation

<400> 4

Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro

1 5 10 15

<210> 5

<211> 11

<212> Protein

<213> Unknown

<220>

<223> Description of unknown: RFGF analogue peptide

<400> 5

Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro

1 5 10

<210> 6

<211> 13

<212> Protein

<213> Human immunodeficiency virus

<400> 6

Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln

1 5 10

<210> 7

<211> 16

<212> Protein

<213> Drosophila sp.

<400> 7

Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys

1 5 10 15

<210> 8

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 8

aacaguguuc uugcucuaua a 21

<210> 9

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 9

uuauagagca agaacacugu uuu 23

<210> 10

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 10

aacaguguuc uugcucuaua a 21

<210> 11

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 11

uuauagagca agaacacugu uuu 23

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 12

guaaccaaga guauuccaut t 21

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 13

auggaauaccu cuugguuact t 21

<210> 14

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 14

auguaaccaa gaguauucca u 21

<210> 15

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 15

auguaaccaa gaguauucca u 21

<210> 16

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 16

auggaauacu cuugguuaca uga 23

<210> 17

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 17

auggaauacu cuugguuaca uga 23

<210> 18

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 18

auguaaccaa gaguauucca u 21

<210> 19

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 19

auguaaccaa gaguauucca u 21

<210> 20

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 20

auguaaccaa gaguauucca u 21

<210> 21

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 21

auguaaccaa gaguauucca u 21

<210> 22

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 22

auguaaccca gaguauucca u 21

<210> 23

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 23

auguaaccaa gaguauucca u 21

<210> 24

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 24

auguaaccaa gaguauucca u 21

<210> 25

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 25

auguaaccaa gaguauucca u 21

<210> 26

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 26

auguaaccaa gaguauacga u 21

<210> 27

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 27

ugggauuuca uguaaccaag a 21

<210> 28

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 28

ugggauuuca uguaaccaag a 21

<210> 29

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 29

auguaaccaa gaguauucca u 21

<210> 30

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 30

ugggauuuca uguaaccaag a 21

<210> 31

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 31

auguaaccaa gaguauacga u 21

<210> 32

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 32

auguaaccaa gaguauucca u 21

<210> 33

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 33

auguaaccaa gagtatucca u 21

<210> 34

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 34

auguaaccaa gaguauucca u 21

<210> 35

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 35

ugggauuuca uguaaccaag a 21

<210> 36

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 36

auguaaccaa gaguauucca u 21

<210> 37

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 37

auguaaccaa gaguauucca u 21

<210> 38

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 38

auguaaccaa gaguauucca u 21

<210> 39

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 39

auguaaccaa gaguauucca u 21

<210> 40

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 40

tgggatuuca ugtaaccaag a 21

<210> 41

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 41

auguaaccaa gaguauucca u 21

<210> 42

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 42

ugggauuuca uguaaccaag a 21

<210> 43

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 43

ugggauuuca uguaaccaag a 21

<210> 44

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 44

ugggauuuca uguaaccaag a 21

<210> 45

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 45

ugggauuuca uguaaccaag a 21

<210> 46

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 46

atguaaccaa gagtautcca t 21

<210> 47

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 47

atgtaaccaa gagtatucca u 21

<210> 48

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 48

ugggauuuca uguaaccaag a 21

<210> 49

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 49

auguaaccaa gaguauucca u 21

<210> 50

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 50

auguaaccaa gaguauucca u 21

<210> 51

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 51

ugggauuuca uguaaccaag a 21

<210> 52

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 52

auguaaccaa gaguauucca u 21

<210> 53

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 53

ugggauuuca uguaaccaag a 21

<210> 54

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 54

ugggauuuca uguaaccaag a 21

<210> 55

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 55

ugggauuuca uguaaccaag a 21

<210> 56

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 56

ugggauuuca uguaaccaag a 21

<210> 57

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 57

auguaaccaa gaguauucca u 21

<210> 58

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 58

auguaaccaa gaguauucca u 21

<210> 59

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 59

auguaaccaa gaguauucca u 21

<210> 60

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 60

ugggauuuca uguaaccaag a 21

<210> 61

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 61

auguaaccaa gaguauucca u 21

<210> 62

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 62

auguaaccaa gaguauucca u 21

<210> 63

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 63

auguaaccaa gaggauucca u 21

<210> 64

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 64

auguaaccaa gaguauucca u 21

<210> 65

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 65

ugggauuuca uguaaccaag a 21

<210> 66

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 66

auguaaccaa gaguauucca u 21

<210> 67

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 67

auguaaccaa gaguauucca u 21

<210> 68

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 68

ugggauuuca uguaaccaag a 21

<210> 69

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 69

auguaaccaa gaguauucca u 21

<210> 70

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 70

auguaaccaa gagtatucca u 21

<210> 71

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 71

auguaaccaa gagtatucca u 21

<210> 72

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 72

auguaaccaa gagtauucca u 21

<210> 73

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 73

auguaaccaa gagtatucca u 21

<210> 74

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 74

auguaaccaa gaguauucca u 21

<210> 75

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 75

auguaaccaa gaguauucca u 21

<210> 76

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 76

auguaaccaa gaguauucca u 21

<210> 77

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 77

auguaaccaa gagtatucca u 21

<210> 78

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 78

atguaaccaa gagtatucca t 21

<210> 79

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 79

auguaaccaa gaguauucca u 21

<210> 80

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 80

auguaaccaa gagtatucca u 21

<210> 81

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 81

atguaaccca gagtauucca u 21

<210> 82

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 82

auguaaccaa gagtauucca u 21

<210> 83

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 83

auguaaccaa gagtatucca u 21

<210> 84

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 84

auguaaccaa gaguatucca u 21

<210> 85

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 85

auguaaccaa gagtatucca u 21

<210> 86

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 86

auguaaccaa gagtatucca u 21

<210> 87

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 87

auguaaccca gaguauucca u 21

<210> 88

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 88

auguaaccaa gaguauucca u 21

<210> 89

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 89

ugggauuuca uguaaccaag a 21

<210> 90

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 90

auguaaccaa gaguauucca u 21

<210> 91

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 91

auguaaccaa gagtatucca u 21

<210> 92

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 92

auguaaccaa gaguauucca u 21

<210> 93

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 93

auguaaccaa gaguauucca u 21

<210> 94

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 94

auguaaccaa gaguattcca u 21

<210> 95

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 95

auguaaccaa gaguauucca u 21

<210> 96

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 96

auguaaccaa gaguauucca u 21

<210> 97

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 97

auguaaccaa gagtatucca u 21

<210> 98

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 98

auguaaccaa gaguauucca u 21

<210> 99

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 99

auguaaccaa gaguauucca t 21

<210> 100

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 100

auguaaccaa gaguauucca u 21

<210> 101

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 101

auguaaccaa gaguauucca u 21

<210> 102

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 102

auguaaccaa gaguauucca u 21

<210> 103

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 103

auguaaccaa gaguauucca u 21

<210> 104

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 104

auguaaccaa gaguauucca u 21

<210> 105

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 105

auguaaccaa gaguauucca u 21

<210> 106

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 106

auguaaccaa gaguauucca u 21

<210> 107

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 107

auguaaccaa gaguauucca u 21

<210> 108

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 108

auguaaccaa gaguauucca u 21

<210> 109

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 109

auguaaccaa gagtatucca u 21

<210> 110

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 110

auguaaccaa gaguauucca u 21

<210> 111

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 111

auguaaccaa gaguauucca u 21

<210> 112

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 112

auguaaccaa gaguauucca u 21

<210> 113

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 113

auguaaccaa gaguauucca u 21

<210> 114

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 114

auguaaccaa gaguauucca u 21

<210> 115

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 115

auguaaccaa gaguauucca u 21

<210> 116

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 116

auguaaccaa gaguauucca u 21

<210> 117

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 117

auguaaccaa gaguauucca u 21

<210> 118

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 118

auguaaccaa gaguauucca u 21

<210> 119

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 119

auguaaccaa gaguauucca u 21

<210> 120

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 120

auguaaccaa gaguauucca u 21

<210> 121

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 121

auguaaccaa gaguauucca u 21

<210> 122

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 122

auguaaccaa gaguauucca u 21

<210> 123

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 123

auguaaccaa gaguauucca u 21

<210> 124

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 124

auguaaccaa gaguauucca u 21

<210> 125

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 125

auguaaccaa gaguauucca u 21

<210> 126

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 126

auguaaccaa gagtatucca u 21

<210> 127

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 127

auguaaccaa gaguauucca u 21

<210> 128

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 128

auguaaccaa gaguauucca u 21

<210> 129

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 129

auguaaccaa gaguauucca u 21

<210> 130

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 130

auguaaccaa gaguauucca u 21

<210> 131

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 131

auguaaccaa gaguauucca u 21

<210> 132

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 132

auguaaccaa gaguauucca u 21

<210> 133

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 133

auguaaccaa gaguauucca u 21

<210> 134

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 134

auguaaccaa gaguauucca u 21

<210> 135

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 135

auguaaccaa gaguauucca u 21

<210> 136

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 136

auguaaccaa gaguauucca u 21

<210> 137

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 137

auguaaccaa gaguauucca u 21

<210> 138

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 138

auguaaccaa gaguauucca u 21

<210> 139

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 139

auguaaccaa gaguauucca u 21

<210> 140

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 140

auguaaccaa gaguauucca u 21

<210> 141

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 141

auguaaccaa gaguauucca u 21

<210> 142

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 142

auguaaccaa gaguauucca u 21

<210> 143

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 143

auguaaccaa gaguauucca u 21

<210> 144

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 144

auguaaccaa gaguauucca u 21

<210> 145

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 145

auguaaccaa gaguauucca u 21

<210> 146

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 146

auguaaccaa gaguauucca u 21

<210> 147

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 147

auguaaccaa gaguauucca u 21

<210> 148

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 148

auguaaccaa gaguauucca u 21

<210> 149

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 149

auguaaccaa gaguauucca u 21

<210> 150

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 150

auguaaccaa gaguauucca u 21

<210> 151

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 151

auguaaccaa gaguauucca u 21

<210> 152

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 152

auguaaccaa gaguauucca u 21

<210> 153

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 153

auguaaccaa gaguauucca u 21

<210> 154

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 154

auguaaccaa gaguauucca u 21

<210> 155

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 155

auguaaccaa gaguauucca u 21

<210> 156

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 156

auguaaccaa gaguauucca u 21

<210> 157

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 157

auguaaccaa gaguauucca u 21

<210> 158

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 158

auguaaccaa gaguauucca u 21

<210> 159

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 159

auguaaccaa gaguauucca u 21

<210> 160

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 160

auguaaccaa gaguauucca u 21

<210> 161

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 161

auguaaccaa gaguauucca u 21

<210> 162

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 162

auguaaccaa gaguauucca u 21

<210> 163

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 163

auguaaccaa gaguauucca u 21

<210> 164

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 164

auguaaccaa gaguauucca u 21

<210> 165

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 165

auguaaccaa gaguauucca u 21

<210> 166

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 166

auguaaccaa gaguauucca u 21

<210> 167

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 167

auguaaccaa gaguauucca u 21

<210> 168

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 168

auguaaccaa gaguauucca u 21

<210> 169

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 169

auguaaccaa gaguauucca u 21

<210> 170

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 170

auguaaccaa gaguauucca u 21

<210> 171

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 171

auguaaccaa gaguauucca u 21

<210> 172

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 172

ugggauuuca uguaaccaag a 21

<210> 173

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 173

ugggauuuca uguaaccaag a 21

<210> 174

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 174

ugggauuuca uguaaccaag a 21

<210> 175

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 175

ugggauuuca uguaaccaag a 21

<210> 176

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 176

ugggauuuca uguaaccaag a 21

<210> 177

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 177

ugggauuuca uguaaccaag a 21

<210> 178

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 178

ugggauuuca uguaaccaag a 21

<210> 179

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 179

ugggauuuca uguaaccaag a 21

<210> 180

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 180

auguaaccaa gaguauucca u 21

<210> 181

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 181

auguaaccaa gaguauucca u 21

<210> 182

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 182

auguaaccaa gaguauucca u 21

<210> 183

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 183

auguaaccaa gaguauucca u 21

<210> 184

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 184

auguaaccaa gaguauucca u 21

<210> 185

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 185

auguaaccaa gaguauucca u 21

<210> 186

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 186

auguaaccaa gaguauucca u 21

<210> 187

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 187

auguaaccaa gaguauucca u 21

<210> 188

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 188

auguaaccaa gaguauucca u 21

<210> 189

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 189

auguaaccaa gaguauucca u 21

<210> 190

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 190

auguaaccaa gaguauucca u 21

<210> 191

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 191

auguaaccaa gaguauucca u 21

<210> 192

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 192

auguaaccaa gaguauucca u 21

<210> 193

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 193

auguaaccaa gaguauucca u 21

<210> 194

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 194

auguaaccaa gaguauucca u 21

<210> 195

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 195

auguaaccaa gaguauucca u 21

<210> 196

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 196

auguaaccaa gaguauucca u 21

<210> 197

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 197

auguaaccaa gaguauucca u 21

<210> 198

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 198

auguaaccaa gaguauucca u 21

<210> 199

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 199

auguaaccaa gaguauucca u 21

<210> 200

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 200

auguaaccaa gaguauucca u 21

<210> 201

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 201

auguaaccaa gaguauucca u 21

<210> 202

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 202

auguaaccaa gaguauucca u 21

<210> 203

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 203

auguaaccaa gaguauucca u 21

<210> 204

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 204

auguaaccaa gaguauucca u 21

<210> 205

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 205

auguaaccaa gaguauucca u 21

<210> 206

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 206

auguaaccaa gaguauucca u 21

<210> 207

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 207

auguaaccaa gaguauucca u 21

<210> 208

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 208

auguaaccaa gaguauucca u 21

<210> 209

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 209

auguaaccaa gaguauucca u 21

<210> 210

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 210

auguaaccaa gaguauucca u 21

<210> 211

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 211

auguaaccaa gaguauucca u 21

<210> 212

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 212

auguaaccaa gaguauucca u 21

<210> 213

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 213

auguaaccaa gaguauucca u 21

<210> 214

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 214

auguaaccaa gaguauucca u 21

<210> 215

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 215

auguaaccaa gaguauucca u 21

<210> 216

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 216

auguaaccaa gaguauucca u 21

<210> 217

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 217

auguaaccaa gaguauucca u 21

<210> 218

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 218

auguaaccaa gaguauucca u 21

<210> 219

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 219

auguaaccaa gaguauucca u 21

<210> 220

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 220

auguaaccaa gaguauucca u 21

<210> 221

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 221

auguaaccaa gaguauucca u 21

<210> 222

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 222

auguaaccaa gaguauucca u 21

<210> 223

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 223

auguaaccaa gagtattcca u 21

<210> 224

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 224

auguaaccaa gaguauucca u 21

<210> 225

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 225

auguaaccaa gaguauucca u 21

<210> 226

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 226

auguaaccaa gaguauucca u 21

<210> 227

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 227

auguaaccaa gaguauucca u 21

<210> 228

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 228

auguaaccaa gaguauucca u 21

<210> 229

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 229

auguaaccaa gaguauucca u 21

<210> 230

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 230

auguaaccaa gaguauucca u 21

<210> 231

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 231

auguaaccaa gaguautcca u 21

<210> 232

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 232

auguaaccaa gaguauucca u 21

<210> 233

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 233

auguaaccaa gaguattcca u 21

<210> 234

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 234

auguaaccaa gaguauucca u 21

<210> 235

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 235

auguaaccaa gaguauucca u 21

<210> 236

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 236

auguaaccaa gaguauucca u 21

<210> 237

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 237

auguaaccaa gaguauucca u 21

<210> 238

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 238

auguaaccaa gaguauucca u 21

<210> 239

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 239

auguaaccaa gaguauucca u 21

<210> 240

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 240

auguaaccaa gaguauucca u 21

<210> 241

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 241

auguaaccaa gaguauucca u 21

<210> 242

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 242

auguaaccaa gaguauucca u 21

<210> 243

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 243

auguaaccaa gaguauucca u 21

<210> 244

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 244

auguaaccaa gaguauucca u 21

<210> 245

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 245

auguaaccaa gaguauucca u 21

<210> 246

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 246

auguaaccaa gaguauucca u 21

<210> 247

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 247

auguaaccaa gaguauucca u 21

<210> 248

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 248

auguaaccaa gaguauucca u 21

<210> 249

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 249

auguaaccaa gaguauucca u 21

<210> 250

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 250

auguaaccaa gaguauucca u 21

<210> 251

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 251

auguaaccaa gaguauucca u 21

<210> 252

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 252

auguaaccaa gaguauucca u 21

<210> 253

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 253

auguaaccaa gaguauucca u 21

<210> 254

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 254

auguaaccaa gaguauucca u 21

<210> 255

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 255

auguaaccaa gaguauucca u 21

<210> 256

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 256

auguaaccaa gaguauucca u 21

<210> 257

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 257

auguaaccaa gaguauucca u 21

<210> 258

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 258

auguaaccaa gaguauucca u 21

<210> 259

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 259

auguaaccaa gaguauucca u 21

<210> 260

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 260

auguaaccaa gaguauucca u 21

<210> 261

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 261

auguaaccaa gaguauucca u 21

<210> 262

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 262

auguaaccaa gaguauucca u 21

<210> 263

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 263

auguaaccaa gaguauucca u 21

<210> 264

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 264

auguaaccaa gaguauucca u 21

<210> 265

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 265

auguaaccaa gaguauucca u 21

<210> 266

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 266

aacaauguuc uugcucuaua a 21

<210> 267

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 267

aacaguguuc uugcucuaua a 21

<210> 268

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 268

aacaguguuc uugcucuaua a 21

<210> 269

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 269

aacaguguuc uugcucuaua a 21

<210> 270

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 270

caguguucuu gcucuauaat t 21

<210> 271

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 271

aacaguguuc uugcucuaua a 21

<210> 272

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 272

aacaguguuc uugcucuaua a 21

<210> 273

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 273

aacaguguuc uugcucuaua a 21

<210> 274

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 274

aacaguguuc uugcucuaua a 21

<210> 275

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 275

aacaguguuc uugcucuaua a 21

<210> 276

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 276

aacaguguuc uugcucuaua a 21

<210> 277

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 277

aacaguguuc uugcucuaua a 21

<210> 278

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 278

aacaguguuc uugcucuaua a 21

<210> 279

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 279

aacaguguuc uugcucuaua a 21

<210> 280

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 280

aacaguguuc uugcucuaua a 21

<210> 281

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 281

caguguucuu gcucuauaat t 21

<210> 282

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 282

aacaguguuc uugcucuaua a 21

<210> 283

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 283

aacaguguuc uugcucuaua a 21

<210> 284

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 284

aacaguguuc uugcucuaua a 21

<210> 285

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 285

aacaauguuc uugcucuaua a 21

<210> 286

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 286

aacaguguuc uugcucuaua a 21

<210> 287

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 287

caguguucuu gcucuauaat t 21

<210> 288

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 288

aacaguguuc uugcucuaua a 21

<210> 289

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 289

aacaguguuc uugcucuaua a 21

<210> 290

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 290

caguguucuu gcucuauaat t 21

<210> 291

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 291

aacaguguuc uugcucuaua a 21

<210> 292

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 292

aacaguguuc uugcucuaua a 21

<210> 293

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 293

caguguucuu gcucuauaat t 21

<210> 294

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 294

aacaguguuc uugcucuaua a 21

<210> 295

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 295

aacaguguuc uugcucuaua a 21

<210> 296

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 296

aacaguguuc uugcucuaua a 21

<210> 297

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 297

caguguucuu gcucuauaat t 21

<210> 298

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 298

aacaguguuc uugcucuaua a 21

<210> 299

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 299

aacaguguuc uugcucuaua a 21

<210> 300

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 300

aacaguguuc uugcucuaua a 21

<210> 301

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 301

aacaguguuc uugcucuaua a 21

<210> 302

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 302

aacaguguuc uugcucuaua a 21

<210> 303

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 303

aacaguguuc uugcucuaua a 21

<210> 304

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 304

aacaguguuc uugcucuaua a 21

<210> 305

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 305

aacaguguuc uugcucuaua a 21

<210> 306

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 306

aacaguguuc uugcucuaua a 21

<210> 307

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 307

aacaguguuc uugcucuaua a 21

<210> 308

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 308

aacaguguuc uugcucuaua a 21

<210> 309

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 309

aacaguguuc uugcucuaua a 21

<210> 310

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 310

aacaguguuc uugcucuaua a 21

<210> 311

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 311

aacaguguuc uugcucuaua a 21

<210> 312

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 312

aacaguguuc uugcucuaua a 21

<210> 313

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 313

aacaguguuc uugcucuaua a 21

<210> 314

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 314

aacagtguuc tugctcuata a 21

<210> 315

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 315

aacaguguuc uugcucuaua a 21

<210> 316

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 316

aacaguguuc uugcucuaua a 21

<210> 317

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 317

aacaguguuc uugcucuaua a 21

<210> 318

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 318

aacaguguuc uugcucuaua a 21

<210> 319

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 319

aacaguguuc uugcucuaua a 21

<210> 320

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 320

aacaguguuc uugcucuaua a 21

<210> 321

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 321

aacaguguuc uugcucuaua a 21

<210> 322

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 322

aacaguguuc uugcucuaua a 21

<210> 323

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 323

aacagugtuc ttgctcuata a 21

<210> 324

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 324

aacaguguuc uugcucuaua a 21

<210> 325

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 325

aacaguguuc utgcucuaua a 21

<210> 326

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 326

aacaguguuc uugcucuaua a 21

<210> 327

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 327

aacaguguuc utgcucuaua a 21

<210> 328

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 328

aacaauguuc utgcucuaua a 21

<210> 329

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 329

aacaauguuc uugcucuata a 21

<210> 330

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 330

aacaguguuc uugcucuaua a 21

<210> 331

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 331

aacaguguuc uugcucuaua a 21

<210> 332

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 332

aacaguguuc uugcucuaua a 21

<210> 333

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 333

aacaguguuc uugcucuaua a 21

<210> 334

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 334

aacaguguuc uugcucuaua a 21

<210> 335

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 335

aacaguguuc uugcucuaua a 21

<210> 336

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 336

aacaguguuc uugcucuaua a 21

<210> 337

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 337

aacaguguuc uugcucuaua a 21

<210> 338

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 338

aacaguguuc uugcucuaua a 21

<210> 339

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 339

aacaguguuc uugcucuaua a 21

<210> 340

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 340

aacaguguuc uugcucuaua a 21

<210> 341

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 341

aacaguguuc uugcucuaua a 21

<210> 342

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 342

aacaguguuc uugcucuaua a 21

<210> 343

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 343

aacaguguuc uugcucuaua a 21

<210> 344

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 344

aacaguguuc uugcucuaua a 21

<210> 345

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 345

aacaguguuc uugcucuaua a 21

<210> 346

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 346

aacaguguuc uugcucuaua a 21

<210> 347

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 347

aacaguguuc uugcucuaua a 21

<210> 348

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 348

aacaguguuc uugcucuaua a 21

<210> 349

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 349

aacaguguuc uugcucuaua a 21

<210> 350

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 350

aacaguguuc uugcucuaua a 21

<210> 351

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 351

aacaguguuc uugcucuaua a 21

<210> 352

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 352

aacaguguuc uugcucuaua a 21

<210> 353

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 353

aacaguguuc uugcucuaua a 21

<210> 354

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 354

aacaguguuc uugcucuaua a 21

<210> 355

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 355

aacaguguuc uugcucuaua a 21

<210> 356

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 356

aacaguguuc uugcucuaua a 21

<210> 357

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 357

aacaguguuc uugcucuaua a 21

<210> 358

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 358

aacaguguuc uugcucuaua a 21

<210> 359

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 359

aacaguguuc uugcucuaua a 21

<210> 360

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 360

aacaguguuc uugcucuaua a 21

<210> 361

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 361

aacaguguuc uugcucuaua a 21

<210> 362

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 362

aacaguguuc uugcucuaua a 21

<210> 363

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 363

aacaguguuc uugcucuaua a 21

<210> 364

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 364

aacaguguuc uugcucuaua a 21

<210> 365

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 365

aacaguguuc uugcucuaua a 21

<210> 366

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 366

aacaguguuc uugcucuaua a 21

<210> 367

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 367

aacaguguuc uugcucuaua a 21

<210> 368

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 368

aacaguguuc uugcucuaua a 21

<210> 369

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 369

aacaguguuc uugcucuaua a 21

<210> 370

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 370

aacaguguuc uugcucuaua a 21

<210> 371

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 371

aacaguguuc uugcucuaua a 21

<210> 372

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 372

aacaguguuc uugcucuaua a 21

<210> 373

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 373

aacaguguuc uugcucuaua a 21

<210> 374

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 374

aacaguguuc uugcucuaua a 21

<210> 375

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 375

aacaguguuc uugcucuaua a 21

<210> 376

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 376

aacaguguuc uugcucuaua a 21

<210> 377

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 377

aacaguguuc uugcucuaua a 21

<210> 378

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 378

aacaguguuc uugcucuaua a 21

<210> 379

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 379

aacaguguuc uugcucuaua a 21

<210> 380

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 380

aacaguguuc uugcucuaua a 21

<210> 381

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 381

aacaguguuc uugcucuaua a 21

<210> 382

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 382

aacaguguuc uugcucuaua a 21

<210> 383

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 383

aacaguguuc uugcucuaua a 21

<210> 384

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 384

aacaguguuc uugcucuaua a 21

<210> 385

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 385

aacaguguuc uugcucuaua a 21

<210> 386

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 386

aacaguguuc uugcucuaua a 21

<210> 387

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 387

aacaguguuc uugcucuaua a 21

<210> 388

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 388

aacaguguuc uugcucuaua a 21

<210> 389

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 389

aacaguguuc uugcucuaua a 21

<210> 390

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 390

aacaguguuc uugcucuaua a 21

<210> 391

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 391

aacaguguuc uugcucuaua a 21

<210> 392

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 392

aacaguguuc uugcucuaua a 21

<210> 393

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 393

aacaguguuc uugcucuaua a 21

<210> 394

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 394

aacaguguuc uugcucuaua a 21

<210> 395

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 395

aacaguguuc uugcucuaua a 21

<210> 396

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 396

aacaguguuc uugcucuaua a 21

<210> 397

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 397

aacaguguuc uugcucuaua a 21

<210> 398

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 398

aacaguguuc uugcucuaua a 21

<210> 399

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 399

aacaguguuc uugcucuaua a 21

<210> 400

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 400

aacaguguuc uugcucuaua a 21

<210> 401

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 401

aacaguguuc uugcucuaua a 21

<210> 402

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 402

aacaguguuc uugcucuaua a 21

<210> 403

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 403

aacaguguuc uugcucuaua a 21

<210> 404

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 404

aacaguguuc uugcucuaua a 21

<210> 405

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 405

aacaguguuc uugcucuaua a 21

<210> 406

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 406

aacaguguuc uugcucuaua a 21

<210> 407

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 407

aacaguguuc uugcucuaua a 21

<210> 408

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 408

aacaguguuc uugcucuaua a 21

<210> 409

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 409

aacaguguuc tugctctata a 21

<210> 410

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 410

aacaguguuc uugcucuaua a 21

<210> 411

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 411

aacaguguuc uugcucuaua a 21

<210> 412

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 412

aacaguguuc uugcucuaua a 21

<210> 413

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 413

aacaguguuc uugcucuaua a 21

<210> 414

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 414

aacaguguuc uugcucuaua a 21

<210> 415

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 415

aacaauguuc uugcactaua a 21

<210> 416

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 416

aacaguguuc uugcucuaua a 21

<210> 417

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 417

aacagugutc uugcuctaua a 21

<210> 418

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 418

aacaauguuc uugcactaua a 21

<210> 419

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 419

aacaauguuc uugcacuaua a 21

<210> 420

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 420

aacaguguuc uugcucuaua a 21

<210> 421

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 421

aacaauguuc uugcacuata a 21

<210> 422

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 422

aacaguguuc uugcucuaua a 21

<210> 423

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 423

aacaguguuc uugcucuaua a 21

<210> 424

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 424

aacaauguuc uugcacuata a 21

<210> 425

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 425

aacaguguuc uugcucuaua a 21

<210> 426

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 426

aacaauguuc uugcactata a 21

<210> 427

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 427

aacaguguuc uugcucuaua a 21

<210> 428

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 428

aacaauguuc uugcactata a 21

<210> 429

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 429

aacaguguuc uugcucuaua a 21

<210> 430

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 430

aacagugtuc utgcucuaua a 21

<210> 431

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 431

aacaguguuc uugcucuaua a 21

<210> 432

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 432

aacaguguuc uugcucuaua a 21

<210> 433

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 433

aacaguguuc uugcucuaua a 21

<210> 434

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 434

aacaguguuc uugcucuaua a 21

<210> 435

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 435

aacaguguuc uugcucuaua a 21

<210> 436

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 436

aacaguguuc uugcucuaua a 21

<210> 437

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 437

aacaguguuc uugcucuaua a 21

<210> 438

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 438

gacuucuccu ccaguggacc u 21

<210> 439

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 439

gacuucuccu ccaguggacc u 21

<210> 440

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 440

acuucuccuc caguggaccu g 21

<210> 441

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 441

acuucuccuc caguggaccu g 21

<210> 442

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 442

cuucuccucc aguggaccug a 21

<210> 443

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 443

cuucuccucc aguggaccug a 21

<210> 444

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 444

uucuccucca guggaccuga a 21

<210> 445

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 445

uucuccucca guggaccuga a 21

<210> 446

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 446

ucuccuccag uggaccugaa g 21

<210> 447

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 447

ucuccuccag uggaccugaa g 21

<210> 448

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 448

cuccuccagu ggaccugaag g 21

<210> 449

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 449

cuccuccagu ggaccugaag g 21

<210> 450

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 450

uccuccagug gaccugaagg a 21

<210> 451

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 451

uccuccagug gaccugaagg a 21

<210> 452

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 452

ccuccagugg accugaagga from 21

<210> 453

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 453

ccuccagugg accugaagga from 21

<210> 454

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 454

cuccagugga ccugaaggac g 21

<210> 455

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 455

cuccagugga ccugaaggac g 21

<210> 456

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 456

uccaguggac cugaagggacg a 21

<210> 457

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 457

uccaguggac cugaagggacg a 21

<210> 458

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 458

ccaguggacc ugaaggacga g 21

<210> 459

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 459

ccaguggacc ugaaggacga g 21

<210> 460

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 460

caguggaccu gaaggacgag g 21

<210> 461

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 461

caguggaccu gaaggacgag g 21

<210> 462

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 462

aguggaccug aagggacgagg g 21

<210> 463

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 463

aguggaccug aagggacgagg g 21

<210> 464

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 464

guggaccuga aggacgagg a 21

<210> 465

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 465

guggaccuga aggacgagg a 21

<210> 466

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 466

uggaccugaa ggacgaggga u 21

<210> 467

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 467

uggaccugaa ggacgaggga u 21

<210> 468

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 468

ggaccugaag gacgagggau g 21

<210> 469

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 469

ggaccugaag gacgagggau g 21

<210> 470

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 470

gaccugaagg acgagggaug g 21

<210> 471

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 471

gaccugaagg acgagggaug g 21

<210> 472

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 472

accugaagga cgagggaugg g 21

<210> 473

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 473

accugaagga cgagggaugg g 21

<210> 474

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 474

ccugaaggac gagggauggg a 21

<210> 475

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 475

ccugaaggac gagggauggg a 21

<210> 476

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 476

cugaaggacg agggauggga u 21

<210> 477

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 477

cugaaggacg agggauggga u 21

<210> 478

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 478

ugaaggacga gggaugggau u 21

<210> 479

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 479

ugaaggacga gggaugggau u 21

<210> 480

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 480

gaaggacgag ggaugggauu u 21

<210> 481

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 481

gaaggacgag ggaugggauu u 21

<210> 482

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 482

aaggacgagg gaugggauuu from 21

<210> 483

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 483

aaggacgagg gaugggauuu from 21

<210> 484

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 484

aggacgaggg augggauuuc a 21

<210> 485

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 485

aggacgaggg augggauuuc a 21

<210> 486

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 486

ggacgaggga ugggauuuca u 21

<210> 487

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 487

ggacgaggga ugggauuuca u 21

<210> 488

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 488

gacgaggau gggauuucau g 21

<210> 489

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 489

gacgaggau gggauuucau g 21

<210> 490

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 490

acgagggaug ggauuucaug u 21

<210> 491

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 491

acgagggaug ggauuucaug u 21

<210> 492

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 492

cgagggaugg gauuucaugu a 21

<210> 493

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 493

cgagggaugg gauuucaugu a 21

<210> 494

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 494

gagggauggg auuucaugua a 21

<210> 495

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 495

gagggauggg auuucaugua a 21

<210> 496

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 496

agggauggga uuucauguaa from 21

<210> 497

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 497

agggauggga uuucauguaa from 21

<210> 498

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 498

gggaugggau uucauguaac from 21

<210> 499

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 499

gggaugggau uucauguaac from 21

<210> 500

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 500

ggaugggauu ucauguaacc a 21

<210> 501

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 501

ggaugggauu ucauguaacc a 21

<210> 502

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 502

gaugggauuu cauguaacca a 21

<210> 503

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 503

gaugggauuu cauguaacca a 21

<210> 504

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 504

augggauuuc auguaaccaa g 21

<210> 505

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 505

augggauuuc auguaaccaa g 21

<210> 506

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 506

ugggauuuca uguaaccaag a 21

<210> 507

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 507

ugggauuuca uguaaccaag a 21

<210> 508

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 508

gggauuucau guaaccaaga g 21

<210> 509

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 509

gggauuucau guaaccaaga g 21

<210> 510

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 510

ggauuucaug uaaccaagag u 21

<210> 511

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 511

ggauuucaug uaaccaagag u 21

<210> 512

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 512

gauuucaugu aaccaagagu a 21

<210> 513

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 513

gauuucaugu aaccaagagu a 21

<210> 514

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 514

auuucaugua accaagagua u 21

<210> 515

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 515

auuucaugua accaagagua u 21

<210> 516

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 516

uuucauguaa ccaagaguau u 21

<210> 517

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 517

uuucauguaa ccaagaguau u 21

<210> 518

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 518

uucauguaac caagaguauu from 21

<210> 519

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 519

uucauguaac caagaguauu from 21

<210> 520

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 520

ucauguaacc aagaguauuc from 21

<210> 521

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 521

ucauguaacc aagaguauuc from 21

<210> 522

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 522

cauguaacca agaguauucc a 21

<210> 523

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 523

cauguaacca agaguauucc a 21

<210> 524

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 524

auguaaccaa gaguauucca u 21

<210> 525

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 525

auguaaccaa gaguauucca u 21

<210> 526

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 526

uguaaccaag aguauuccau u 21

<210> 527

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 527

uguaaccaag aguauuccau u 21

<210> 528

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 528

guaaccaaga guauuccauu u 21

<210> 529

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 529

guaaccaaga guauuccauu u 21

<210> 530

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 530

uaaccaagag uauuccauuu u 21

<210> 531

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 531

uaaccaagag uauuccauuu u 21

<210> 532

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 532

aaccaagagu auuccauuuu u 21

<210> 533

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 533

aaccaagagu auuccauuuu u 21

<210> 534

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 534

accaagagua uuccauuuuu a 21

<210> 535

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 535

accaagagua uuccauuuuu a 21

<210> 536

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 536

ccaagaguau uccauuuuua from 21

<210> 537

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 537

ccaagaguau uccauuuuua from 21

<210> 538

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 538

caagaguauu ccauuuuuac u 21

<210> 539

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 539

caagaguauu ccauuuuuac u 21

<210> 540

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 540

aagaguauuc cauuuuuacu a 21

<210> 541

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 541

aagaguauuc cauuuuuacu a 21

<210> 542

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 542

agaguauucc auuuuuacua a 21

<210> 543

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 543

agaguauucc auuuuuacua a 21

<210> 544

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 544

gaguauucca uuuuuacuaa a 21

<210> 545

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 545

gaguauucca uuuuuacuaa a 21

<210> 546

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 546

aguauuccau uuuuacuaaa g 21

<210> 547

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 547

aguauuccau uuuuacuaaa g 21

<210> 548

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 548

guauuccauu uuuacuaaag from 21

<210> 549

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 549

guauuccauu uuuacuaaag from 21

<210> 550

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 550

uauuccauuu uuacuaaagc a 21

<210> 551

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 551

uauuccauuu uuacuaaagc a 21

<210> 552

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 552

auuccauuuu uacuaaagca g 21

<210> 553

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 553

auuccauuuu uacuaaagca g 21

<210> 554

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 554

uuccauuuuu acuaaagcag u 21

<210> 555

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 555

uuccauuuuu acuaaagcag u 21

<210> 556

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 556

uccauuuuua cuaaagcagu g 21

<210> 557

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 557

uccauuuuua cuaaagcagu g 21

<210> 558

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 558

ccauuuuuac uaaagcagug u 21

<210> 559

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 559

ccauuuuuac uaaagcagug u 21

<210> 560

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 560

cauuuuuacu aaagcagugu u 21

<210> 561

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 561

cauuuuuacu aaagcagugu u 21

<210> 562

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 562

auuuuuacua aagcaguguu u 21

<210> 563

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 563

auuuuuacua aagcaguguu u 21

<210> 564

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 564

uuuuuacuaa agcaguguuu u 21

<210> 565

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 565

uuuuuacuaa agcaguguuu u 21

<210> 566

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 566

uuuuacuaaa gcaguguuuu from 21

<210> 567

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 567

uuuuacuaaa gcaguguuuu from 21

<210> 568

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 568

uuuacuaaag caguguuuuc a 21

<210> 569

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 569

uuuacuaaag caguguuuuc a 21

<210> 570

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 570

uuacuaaagc aguguuuuca from 21

<210> 571

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 571

uuacuaaagc aguguuuuca from 21

<210> 572

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 572

uacuaaagca guguuuucac from 21

<210> 573

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 573

uacuaaagca guguuuucac from 21

<210> 574

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 574

acuaaagcag uguuuucacc u 21

<210> 575

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 575

acuaaagcag uguuuucacc u 21

<210> 576

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 576

cuaaagcagu guuuucaccu from 21

<210> 577

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 577

cuaaagcagu guuuucaccu from 21

<210> 578

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 578

uaaagcagug uuuucaccuc a 21

<210> 579

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 579

uaaagcagug uuuucaccuc a 21

<210> 580

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 580

aaagcagugu uuucaccuca u 21

<210> 581

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 581

aaagcagugu uuucaccuca u 21

<210> 582

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 582

aagcaguguu uucaccucau a 21

<210> 583

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 583

aagcaguguu uucaccucau a 21

<210> 584

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 584

agcaguguuu ucaccucaua u 21

<210> 585

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 585

agcaguguuu ucaccucaua u 21

<210> 586

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 586

gcaguguuuu caccucauau g 21

<210> 587

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 587

gcaguguuuu caccucauau g 21

<210> 588

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 588

caguguuuuc accucauaug from 21

<210> 589

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 589

caguguuuuc accucauaug from 21

<210> 590

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 590

aguguuuuca ccucauaugc u 21

<210> 591

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 591

aguguuuuca ccucauaugc u 21

<210> 592

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 592

guguuuucac cucauaugcu a 21

<210> 593

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 593

guguuuucac cucauaugcu a 21

<210> 594

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 594

uguuuucacc ucauaugcua u 21

<210> 595

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 595

uguuuucacc ucauaugcua u 21

<210> 596

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 596

guuuucaccu cauaugcuau g 21

<210> 597

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 597

guuuucaccu cauaugcuau g 21

<210> 598

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 598

uuuucaccuc auaugcuaug u 21

<210> 599

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 599

uuuucaccuc auaugcuaug u 21

<210> 600

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 600

uuucaccuca uaugcuaugu u 21

<210> 601

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 601

uuucaccuca uaugcuaugu u 21

<210> 602

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 602

uucaccucau augcuauguu a 21

<210> 603

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 603

uucaccucau augcuauguu a 21

<210> 604

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 604

ucaccucaua ugcuauguua g 21

<210> 605

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 605

ucaccucaua ugcuauguua g 21

<210> 606

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 606

caccucauau gcuauguuag a 21

<210> 607

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 607

caccucauau gcuauguuag a 21

<210> 608

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 608

accucauaug cuauguuaga a 21

<210> 609

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 609

accucauaug cuauguuaga a 21

<210> 610

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 610

ccucauaugc uauguuagaa g 21

<210> 611

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 611

ccucauaugc uauguuagaa g 21

<210> 612

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 612

cucauaugcu auguuagaag u 21

<210> 613

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 613

cucauaugcu auguuagaag u 21

<210> 614

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 614

ucauaugcua uguuagaagu from 21

<210> 615

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 615

ucauaugcua uguuagaagu from 21

<210> 616

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 616

cauaugcuau guuagaaguc from 21

<210> 617

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 617

cauaugcuau guuagaaguc from 21

<210> 618

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 618

auaugcuaug uuagaagucc a 21

<210> 619

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 619

auaugcuaug uuagaagucc a 21

<210> 620

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 620

uaugcuaugu uagaagucca g 21

<210> 621

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 621

uaugcuaugu uagaagucca g 21

<210> 622

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 622

augcuauguu agaaguccag g 21

<210> 623

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 623

augcuauguu agaaguccag g 21

<210> 624

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 624

ugcuauguua gaaguccagg from 21

<210> 625

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 625

ugcuauguua gaaguccagg from 21

<210> 626

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 626

gcuauguuag aaguccaggc a 21

<210> 627

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 627

gcuauguuag aaguccaggc a 21

<210> 628

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 628

cuauguuaga aguccaggca g 21

<210> 629

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 629

cuauguuaga aguccaggca g 21

<210> 630

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 630

uauguuagaa guccaggcag a 21

<210> 631

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 631

uauguuagaa guccaggcag a 21

<210> 632

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 632

auguuagaag uccaggcaga g 21

<210> 633

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 633

auguuagaag uccaggcaga g 21

<210> 634

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 634

uguuagaagu ccaggcagag a 21

<210> 635

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 635

uguuagaagu ccaggcagag a 21

<210> 636

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 636

guuagaaguc caggcagaga from 21

<210> 637

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 637

guuagaaguc caggcagaga from 21

<210> 638

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 638

uuagaagucc aggcagagac a 21

<210> 639

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 639

uuagaagucc aggcagagac a 21

<210> 640

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 640

uagaagucca ggcagagaca a 21

<210> 641

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 641

uagaagucca ggcagagaca a 21

<210> 642

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 642

agaaguccag gcagagacaa u 21

<210> 643

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 643

agaaguccag gcagagacaa u 21

<210> 644

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 644

gaaguccagg cagagacaau a 21

<210> 645

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 645

gaaguccagg cagagacaau a 21

<210> 646

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 646

aaguccaggc agagacaaua a 21

<210> 647

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 647

aaguccaggc agagacaaua a 21

<210> 648

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 648

aguccaggca gagacaauaa a 21

<210> 649

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 649

aguccaggca gagacaauaa a 21

<210> 650

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 650

guccaggcag agacaauaaa a 21

<210> 651

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 651

guccaggcag agacaauaaa a 21

<210> 652

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 652

uccaggcaga gacaauaaaa from 21

<210> 653

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 653

uccaggcaga gacaauaaaa from 21

<210> 654

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 654

ccaggcagag acaauaaaac a 21

<210> 655

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 655

ccaggcagag acaauaaaac a 21

<210> 656

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 656

caggcagaga caauaaaaca u 21

<210> 657

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 657

caggcagaga caauaaaaca u 21

<210> 658

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 658

aggcagagac aauaaaacau u 21

<210> 659

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 659

aggcagagac aauaaaacau u 21

<210> 660

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 660

ggcagagaca auaaaacauu from 21

<210> 661

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 661

ggcagagaca auaaaacauu from 21

<210> 662

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 662

gcagagacaa uaaaacauuc from 21

<210> 663

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 663

gcagagacaa uaaaacauuc from 21

<210> 664

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 664

cagagacaau aaaacauucc u 21

<210> 665

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 665

cagagacaau aaaacauucc u 21

<210> 666

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 666

agagacaaua aaacauuccu g 21

<210> 667

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 667

agagacaaua aaacauuccu g 21

<210> 668

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 668

gagacaauaa aacauuccug u 21

<210> 669

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 669

gagacaauaa aacauuccug u 21

<210> 670

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 670

agacaauaaa acauuccugu g 21

<210> 671

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 671

agacaauaaa acauuccugu g 21

<210> 672

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 672

gacaauaaaa cauuccugug a 21

<210> 673

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 673

gacaauaaaa cauuccugug a 21

<210> 674

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 674

acaauaaaac auuccuguga a 21

<210> 675

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 675

acaauaaaac auuccuguga a 21

<210> 676

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 676

caauaaaaca uuccugugaa a 21

<210> 677

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 677

caauaaaaca uuccugugaa a 21

<210> 678

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 678

aauaaaacau uccugugaaa g 21

<210> 679

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 679

aauaaaacau uccugugaaa g 21

<210> 680

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 680

auaaaacauu ccugugaaag g 21

<210> 681

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 681

auaaaacauu ccugugaaag g 21

<210> 682

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 682

uaaaacauuc cugugaaagg from 21

<210> 683

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 683

uaaaacauuc cugugaaagg from 21

<210> 684

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 684

aaaacauucc ugugaaaggc a 21

<210> 685

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 685

aaaacauucc ugugaaaggc a 21

<210> 686

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 686

aaacauuccu gugaaaggca from 21

<210> 687

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 687

aaacauuccu gugaaaggca from 21

<210> 688

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 688

aacauuccug ugaaaggcac u 21

<210> 689

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 689

aacauuccug ugaaaggcac u 21

<210> 690

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 690

acauuccugu gaaaggcacu u 21

<210> 691

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 691

acauuccugu gaaaggcacu u 21

<210> 692

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 692

cauuccugug aaaggcacuu u 21

<210> 693

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 693

cauuccugug aaaggcacuu u 21

<210> 694

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 694

auuccuguga aaggcacuuu u 21

<210> 695

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 695

auuccuguga aaggcacuuu u 21

<210> 696

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 696

uuccugugaa aggcacuuuu from 21

<210> 697

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 697

uuccugugaa aggcacuuuu from 21

<210> 698

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 698

uccugugaaa ggcacuuuuc a 21

<210> 699

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 699

uccugugaaa ggcacuuuuc a 21

<210> 700

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 700

ccugugaaag gcacuuuuca u 21

<210> 701

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 701

ccugugaaag gcacuuuuca u 21

<210> 702

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 702

cugugaaagg cacuuuucau u 21

<210> 703

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 703

cugugaaagg cacuuuucau u 21

<210> 704

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 704

ugugaaaggc acuuuucauu from 21

<210> 705

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 705

ugugaaaggc acuuuucauu from 21

<210> 706

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 706

gugaaaggca cuuuucauuc from 21

<210> 707

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 707

gugaaaggca cuuuucauuc from 21

<210> 708

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 708

ugaaaggcac uuuucauucc a 21

<210> 709

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 709

ugaaaggcac uuuucauucc a 21

<210> 710

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 710

gaaaggcacu uuucauucca from 21

<210> 711

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 711

gaaaggcacu uuucauucca from 21

<210> 712

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 712

aaaggcacuu uucauuccac u 21

<210> 713

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 713

aaaggcacuu uucauuccac u 21

<210> 714

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 714

aaggcacuuu ucauuccacu u 21

<210> 715

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 715

aaggcacuuu ucauuccacu u 21

<210> 716

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 716

aggcacuuuu cauuccacuu u 21

<210> 717

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 717

aggcacuuuu cauuccacuu u 21

<210> 718

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 718

ggcacuuuuc auuccacuuu a 21

<210> 719

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 719

ggcacuuuuc auuccacuuu a 21

<210> 720

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 720

gcacuuuuca uuccacuuua a 21

<210> 721

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 721

gcacuuuuca uuccacuuua a 21

<210> 722

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 722

cacuuuucau uccacuuuaa from 21

<210> 723

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 723

cacuuuucau uccacuuuaa from 21

<210> 724

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 724

acuuuucauu ccacuuuaac u 21

<210> 725

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 725

acuuuucauu ccacuuuaac u 21

<210> 726

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 726

cuuuucauuc cacuuuaacu u 21

<210> 727

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 727

cuuuucauuc cacuuuaacu u 21

<210> 728

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 728

uuuucauucc acuuuaacuu g 21

<210> 729

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 729

uuuucauucc acuuuaacuu g 21

<210> 730

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 730

uuucauucca cuuuaacuug a 21

<210> 731

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 731

uuucauucca cuuuaacuug a 21

<210> 732

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 732

uucauuccac uuuaacuuga u 21

<210> 733

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 733

uucauuccac uuuaacuuga u 21

<210> 734

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 734

ucauuccacu uuaacuugau u 21

<210> 735

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 735

ucauuccacu uuaacuugau u 21

<210> 736

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 736

cauuccacuu uaacuugauu u 21

<210> 737

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 737

cauuccacuu uaacuugauu u 21

<210> 738

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 738

auuccacuuu aacuugauuu u 21

<210> 739

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 739

auuccacuuu aacuugauuu u 21

<210> 740

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 740

uuccacuuua acuugauuuu u 21

<210> 741

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 741

uuccacuuua acuugauuuu u 21

<210> 742

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 742

uccacuuuaa cuugauuuuu u 21

<210> 743

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 743

uccacuuuaa cuugauuuuu u 21

<210> 744

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 744

ccacuuuaac uugauuuuuu a 21

<210> 745

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 745

ccacuuuaac uugauuuuuu a 21

<210> 746

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 746

cacuuuaacu ugauuuuuua a 21

<210> 747

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 747

cacuuuaacu ugauuuuuua a 21

<210> 748

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 748

acuuuaacuu gauuuuuuaa a 21

<210> 749

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 749

acuuuaacuu gauuuuuuaa a 21

<210> 750

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 750

cuuuaacuug auuuuuuaaa u 21

<210> 751

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 751

cuuuaacuug auuuuuuaaa u 21

<210> 752

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 752

uuuaacuuga uuuuuuaaau u 21

<210> 753

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 753

uuuaacuuga uuuuuuaaau u 21

<210> 754

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 754

uuaacuugau uuuuuaaauu from 21

<210> 755

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 755

uuaacuugau uuuuuaaauu from 21

<210> 756

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 756

uaacuugauu uuuuaauuc from 21

<210> 757

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 757

uaacuugauu uuuuaauuc from 21

<210> 758

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 758

aacuugauuu uuuaaauucc from 21

<210> 759

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 759

aacuugauuu uuuaaauucc from 21

<210> 760

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 760

acuugauuuu uuaaauuccc u 21

<210> 761

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 761

acuugauuuu uuaaauuccc u 21

<210> 762

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 762

cuugauuuuu uaaauucccu u 21

<210> 763

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 763

cuugauuuuu uaaauucccu u 21

<210> 764

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 764

uugauuuuuu aaauucccuu a 21

<210> 765

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 765

uugauuuuuu aaauucccuu a 21

<210> 766

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 766

ugauuuuuua aauucccuua u 21

<210> 767

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 767

ugauuuuuua aauucccuua u 21

<210> 768

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 768

gauuuuuuaa auucccuuau u 21

<210> 769

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 769

gauuuuuuaa auucccuuau u 21

<210> 770

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 770

auuuuuuaaa uucccuuauu g 21

<210> 771

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 771

auuuuuuaaa uucccuuauu g 21

<210> 772

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 772

uuuuuuaaau ucccuuauug u 21

<210> 773

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 773

uuuuuuaaau ucccuuauug u 21

<210> 774

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 774

uuuuuaaauu cccuuauugu from 21

<210> 775

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 775

uuuuuaaauu cccuuauugu from 21

<210> 776

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 776

uuuuaaauuc ccuuauuguc from 21

<210> 777

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 777

uuuuaaauuc ccuuauuguc from 21

<210> 778

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 778

uuuaaauucc cuuauugucc from 21

<210> 779

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 779

uuuaaauucc cuuauugucc from 21

<210> 780

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 780

uuaaauuccc uuauuguccc u 21

<210> 781

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 781

uuaaauuccc uuauuguccc u 21

<210> 782

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 782

uaaauucccu uauugucccu u 21

<210> 783

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 783

uaaauucccu uauugucccu u 21

<210> 784

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 784

aaauucccuu auugucccuu from 21

<210> 785

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 785

aaauucccuu auugucccuu from 21

<210> 786

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 786

aauucccuua uugucccuuc from 21

<210> 787

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 787

aauucccuua uugucccuuc from 21

<210> 788

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 788

auucccuuau ugucccuucc a 21

<210> 789

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 789

auucccuuau ugucccuucc a 21

<210> 790

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 790

uucccuuauu gucccuucca a 21

<210> 791

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 791

uucccuuauu gucccuucca a 21

<210> 792

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 792

ucccuuauug ucccuuccaa a 21

<210> 793

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 793

ucccuuauug ucccuuccaa a 21

<210> 794

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 794

cccuuauugu cccuuccaaa a 21

<210> 795

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 795

cccuuauugu cccuuccaaa a 21

<210> 796

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 796

ccuuauuguc ccuuccaaaa a 21

<210> 797

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 797

ccuuauuguc ccuuccaaaa a 21

<210> 798

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 798

cuuauugucc cuuccaaaaa a 21

<210> 799

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 799

cuuauugucc cuuccaaaaa a 21

<210> 800

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 800

uuauuguccc uuccaaaaaa a 21

<210> 801

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 801

uuauuguccc uuccaaaaaa a 21

<210> 802

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 802

uauugucccu uccaaaaaaa a 21

<210> 803

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 803

uauugucccu uccaaaaaaa a 21

<210> 804

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 804

auugucccuu ccaaaaaaaa g 21

<210> 805

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 805

auugucccuu ccaaaaaaaa g 21

<210> 806

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 806

uugucccuuc caaaaaaaag a 21

<210> 807

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 807

uugucccuuc caaaaaaaag a 21

<210> 808

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 808

ugucccuucc aaaaaaaaga g 21

<210> 809

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 809

ugucccuucc aaaaaaaaga g 21

<210> 810

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 810

gucccuucca aaaaaaagag a 21

<210> 811

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 811

gucccuucca aaaaaaagag a 21

<210> 812

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 812

ucccuuccaa aaaaaagaga a 21

<210> 813

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 813

ucccuuccaa aaaaaagaga a 21

<210> 814

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 814

cccuuccaaaaaaaagagaa u 21

<210> 815

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 815

cccuuccaaaaaaaagagaa u 21

<210> 816

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 816

ccuuccaaaaaaaagagaau from 21

<210> 817

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 817

ccuuccaaaaaaaagagaau from 21

<210> 818

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 818

cuuccaaaaa aaagagaauc a 21

<210> 819

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 819

cuuccaaaaa aaagagaauc a 21

<210> 820

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 820

uuccaaaaaa aagagaauca a 21

<210> 821

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 821

uuccaaaaaa aagagaauca a 21

<210> 822

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 822

uccaaaaaaa agagaaucaa a 21

<210> 823

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 823

uccaaaaaaa agagaaucaa a 21

<210> 824

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 824

ccaaaaaaaa gagaaucaaa a 21

<210> 825

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 825

ccaaaaaaaa gagaaucaaa a 21

<210> 826

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 826

caaaaaaaag agaaucaaaa u 21

<210> 827

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 827

caaaaaaaag agaaucaaaa u 21

<210> 828

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 828

aaaaaaaaga gaaucaaaau u 21

<210> 829

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 829

aaaaaaaaga gaaucaaaau u 21

<210> 830

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 830

aaaaaaagag aaucaaaauu u 21

<210> 831

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 831

aaaaaaagag aaucaaaauu u 21

<210> 832

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 832

aaaaaagaga aucaaaauuu u 21

<210> 833

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 833

aaaaaagaga aucaaaauuu u 21

<210> 834

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 834

aaaaagagaa ucaaaauuuu a 21

<210> 835

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 835

aaaaagagaa ucaaaauuuu a 21

<210> 836

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 836

aaaagagaau caaaauuuua from 21

<210> 837

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 837

aaaagagaau caaaauuuua from 21

<210> 838

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 838

aaagagaauc aaaauuuuac a 21

<210> 839

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 839

aaagagaauc aaaauuuuac a 21

<210> 840

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 840

aagagaauca aaauuuuaca a 21

<210> 841

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 841

aagagaauca aaauuuuaca a 21

<210> 842

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 842

agagaaucaa aauuuuacaa a 21

<210> 843

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 843

agagaaucaa aauuuuacaa a 21

<210> 844

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 844

gagaaucaaa auuuuacaaa g 21

<210> 845

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 845

gagaaucaaa auuuuacaaa g 21

<210> 846

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 846

agaaucaaaa uuuuacaaag a 21

<210> 847

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 847

agaaucaaaa uuuuacaaag a 21

<210> 848

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 848

gaaucaaaau uuuacaaaga a 21

<210> 849

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 849

gaaucaaaau uuuacaaaga a 21

<210> 850

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 850

aaucaaaauu uuacaaagaa u 21

<210> 851

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 851

aaucaaaauu uuacaaagaa u 21

<210> 852

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 852

aucaaaauuu uacaaagaau from 21

<210> 853

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 853

aucaaaauuu uacaaagaau from 21

<210> 854

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 854

ucaaaauuuu acaaagaauc a 21

<210> 855

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 855

ucaaaauuuu acaaagaauc a 21

<210> 856

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 856

caaaauuuua caaagaauca a 21

<210> 857

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 857

caaaauuuua caaagaauca a 21

<210> 858

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 858

aaaauuuuac aaagaaucaa a 21

<210> 859

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 859

aaaauuuuac aaagaaucaa a 21

<210> 860

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 860

aaauuuuaca aagaaucaaa g 21

<210> 861

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 861

aaauuuuaca aagaaucaaa g 21

<210> 862

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 862

aauuuuacaa agaaucaaag g 21

<210> 863

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 863

aauuuuacaa agaaucaaag g 21

<210> 864

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 864

auuuuacaaa gaaucaaagg a 21

<210> 865

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 865

auuuuacaaa gaaucaaagg a 21

<210> 866

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 866

uuuuacaaag aaucaaagga a 21

<210> 867

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 867

uuuuacaaag aaucaaagga a 21

<210> 868

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 868

uuuacaaaga aucaaaggaa u 21

<210> 869

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 869

uuuacaaaga aucaaaggaa u 21

<210> 870

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 870

uuacaaagaa ucaaaggaau u 21

<210> 871

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 871

uuacaaagaa ucaaaggaau u 21

<210> 872

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 872

uacaaagaau caaaggaauu from 21

<210> 873

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 873

uacaaagaau caaaggaauu from 21

<210> 874

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 874

acaaagaauc aaaggaauuc u 21

<210> 875

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 875

acaaagaauc aaaggaauuc u 21

<210> 876

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 876

caaagaauca aaggaauucu a 21

<210> 877

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 877

caaagaauca aaggaauucu a 21

<210> 878

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 878

aaagaaucaa aggaauucua g 21

<210> 879

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 879

aaagaaucaa aggaauucua g 21

<210> 880

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 880

aagaaucaaa ggaauucuag a 21

<210> 881

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 881

aagaaucaaa ggaauucuag a 21

<210> 882

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 882

agaaucaaag gaauucuaga a 21

<210> 883

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 883

agaaucaaag gaauucuaga a 21

<210> 884

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 884

gaaucaaagg aauucuagaa a 21

<210> 885

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 885

gaaucaaagg aauucuagaa a 21

<210> 886

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 886

aaucaaagga auucuagaaa g 21

<210> 887

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 887

aaucaaagga auucuagaaa g 21

<210> 888

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 888

aucaaaggaa uucuagaaag u 21

<210> 889

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 889

aucaaaggaa uucuagaaag u 21

<210> 890

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 890

ucaaaggaau ucuagaaagu a 21

<210> 891

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 891

ucaaaggaau ucuagaaagu a 21

<210> 892

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 892

caaaggaauu cuagaaagua u 21

<210> 893

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 893

caaaggaauu cuagaaagua u 21

<210> 894

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 894

aaaggaauuc uagaaaguau since 21

<210> 895

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 895

aaaggaauuc uagaaaguau since 21

<210> 896

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 896

aaggaauucu agaaaguauc u 21

<210> 897

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 897

aaggaauucu agaaaguauc u 21

<210> 898

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 898

aggaauucua gaaaguaucu g 21

<210> 899

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 899

aggaauucua gaaaguaucu g 21

<210> 900

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 900

ggaauucuag aaaguaucug g 21

<210> 901

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 901

ggaauucuag aaaguaucug g 21

<210> 902

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 902

gaauucuaga aaguaucugg g 21

<210> 903

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 903

gaauucuaga aaguaucugg g 21

<210> 904

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 904

aauucuagaa aguaucuggg from 21

<210> 905

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 905

aauucuagaa aguaucuggg from 21

<210> 906

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 906

auucuagaaa guaucugggc a 21

<210> 907

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 907

auucuagaaa guaucugggc a 21

<210> 908

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 908

uucuagaaag uaucugggca g 21

<210> 909

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 909

uucuagaaag uaucugggca g 21

<210> 910

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 910

ucuagaaagu aucugggcag a 21

<210> 911

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 911

ucuagaaagu aucugggcag a 21

<210> 912

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 912

cuagaaagua ucugggcaga a 21

<210> 913

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 913

cuagaaagua ucugggcaga a 21

<210> 914

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 914

uagaaaguau cugggcagaa from 21

<210> 915

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 915

uagaaaguau cugggcagaa from 21

<210> 916

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 916

agaaaguauc uggggcagaac g 21

<210> 917

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 917

agaaaguauc uggggcagaac g 21

<210> 918

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 918

gaaaguaucu gggcagaacg from 21

<210> 919

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 919

gaaaguaucu gggcagaacg from 21

<210> 920

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 920

aaaguaucug ggcagaacgc u 21

<210> 921

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 921

aaaguaucug ggcagaacgc u 21

<210> 922

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 922

aaguaucugg gcagaacgcu a 21

<210> 923

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 923

aaguaucugg gcagaacgcu a 21

<210> 924

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 924

aguaucuggg cagaacgcua g 21

<210> 925

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 925

aguaucuggg cagaacgcua g 21

<210> 926

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 926

guaucugggc agaacgcuag g 21

<210> 927

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 927

guaucugggc agaacgcuag g 21

<210> 928

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 928

uaucugggca gaacgcuagg a 21

<210> 929

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 929

uaucugggca gaacgcuagg a 21

<210> 930

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 930

aucugggcag aacgcuagga g 21

<210> 931

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 931

aucugggcag aacgcuagga g 21

<210> 932

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 932

ucugggcaga acgcuaggag a 21

<210> 933

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 933

ucugggcaga acgcuaggag a 21

<210> 934

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 934

cugggcagaa cgcuaggaga g 21

<210> 935

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 935

cugggcagaa cgcuaggaga g 21

<210> 936

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 936

uggggcagaac gcuagggagag a 21

<210> 937

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 937

uggggcagaac gcuagggagag a 21

<210> 938

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 938

gggcagaacg cuaggagaga u 21

<210> 939

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 939

gggcagaacg cuaggagaga u 21

<210> 940

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 940

ggcagaacgc uaggagau from 21

<210> 941

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 941

ggcagaacgc uaggagau from 21

<210> 942

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 942

gcagaacgcu aggagagauc from 21

<210> 943

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 943

gcagaacgcu aggagagauc from 21

<210> 944

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 944

cagaacgcua ggagagaucc a 21

<210> 945

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 945

cagaacgcua ggagagaucc a 21

<210> 946

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 946

agaacgcuag gagagaucca a 21

<210> 947

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 947

agaacgcuag gagagaucca a 21

<210> 948

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 948

gaacgcuagg agagauccaa a 21

<210> 949

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 949

gaacgcuagg agagauccaa a 21

<210> 950

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 950

aacgcuagga gagauccaaa u 21

<210> 951

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 951

aacgcuagga gagauccaaa u 21

<210> 952

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 952

acgcuaggag agauccaaau u 21

<210> 953

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 953

acgcuaggag agauccaaau u 21

<210> 954

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 954

cgcuaggaga gauccaaauu u 21

<210> 955

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 955

cgcuaggaga gauccaaauu u 21

<210> 956

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 956

gcuagggagag auccaaauuu from 21

<210> 957

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 957

gcuagggagag auccaaauuu from 21

<210> 958

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 958

cuaggagaga uccaaauuuc from 21

<210> 959

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 959

cuaggagaga uccaaauuuc from 21

<210> 960

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 960

uaggagagau ccaaauuucc a 21

<210> 961

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 961

uaggagagau ccaaauuucc a 21

<210> 962

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 962

aggagagauc caaauuucca u 21

<210> 963

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 963

aggagagauc caaauuucca u 21

<210> 964

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 964

ggagagaucc aaauuuccau u 21

<210> 965

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 965

ggagagaucc aaauuuccau u 21

<210> 966

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 966

gagagaucca aauuuccauu g 21

<210> 967

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 967

gagagaucca aauuuccauu g 21

<210> 968

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 968

agagauccaa auuuccauug u 21

<210> 969

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 969

agagauccaa auuuccauug u 21

<210> 970

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 970

gagauccaaa uuuccauugu from 21

<210> 971

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 971

gagauccaaa uuuccauugu from 21

<210> 972

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 972

agauccaaau uuccauuguc u 21

<210> 973

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 973

agauccaaau uuccauuguc u 21

<210> 974

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 974

gauccaaauu uccauugucu u 21

<210> 975

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 975

gauccaaauu uccauugucu u 21

<210> 976

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 976

auccaaauuu ccauugucuu g 21

<210> 977

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 977

auccaaauuu ccauugucuu g 21

<210> 978

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 978

uccaaauuuc cauugucuug from 21

<210> 979

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 979

uccaaauuuc cauugucuug from 21

<210> 980

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 980

ccaaauuucc auugucuugc a 21

<210> 981

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 981

ccaaauuucc auugucuugc a 21

<210> 982

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 982

caaauuucca uugucuugca a 21

<210> 983

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 983

caaauuucca uugucuugca a 21

<210> 984

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 984

aaauuuccau ugucuugcaa g 21

<210> 985

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 985

aaauuuccau ugucuugcaa g 21

<210> 986

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 986

aauuuccauu gucuugcaag from 21

<210> 987

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 987

aauuuccauu gucuugcaag from 21

<210> 988

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 988

auuuccauug ucuugcaagc a 21

<210> 989

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 989

auuuccauug ucuugcaagc a 21

<210> 990

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 990

uuuccauugu cuugcaagca a 21

<210> 991

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 991

uuuccauugu cuugcaagca a 21

<210> 992

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 992

uuccauuguc uugcaagcaa a 21

<210> 993

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 993

uuccauuguc uugcaagcaa a 21

<210> 994

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 994

uccauugucu ugcaagcaaa g 21

<210> 995

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 995

uccauugucu ugcaagcaaa g 21

<210> 996

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 996

ccaauugucuu gcaagcaaag from 21

<210> 997

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 997

ccaauugucuu gcaagcaaag from 21

<210> 998

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 998

cauugucuug caagcaaagc a 21

<210> 999

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 999

cauugucuug caagcaaagc a 21

<210> 1000

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1000

auugucuugc aagcaaagca from 21

<210> 1001

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1001

auugucuugc aagcaaagca from 21

<210> 1002

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1002

uugucuugca agcaaagcac g 21

<210> 1003

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1003

uugucuugca agcaaagcac g 21

<210> 1004

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1004

ugucuugcaa gcaaagcacg u 21

<210> 1005

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1005

ugucuugcaa gcaaagcacg u 21

<210> 1006

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1006

gucuugcaag caaagcacgu a 21

<210> 1007

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1007

gucuugcaag caaagcacgu a 21

<210> 1008

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1008

ucuugcaagc aaagcacgua u 21

<210> 1009

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1009

ucuugcaagc aaagcacgua u 21

<210> 1010

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1010

cuugcaagca aagcacguau u 21

<210> 1011

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1011

cuugcaagca aagcacguau u 21

<210> 1012

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1012

uugcaagcaa agcacguauu a 21

<210> 1013

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1013

uugcaagcaa agcacguauu a 21

<210> 1014

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1014

ugcaagcaaa gcacguauua a 21

<210> 1015

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1015

ugcaagcaaa gcacguauua a 21

<210> 1016

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1016

gcaagcaaag cacguauuaa a 21

<210> 1017

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1017

gcaagcaaag cacguauuaa a 21

<210> 1018

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1018

caagcaaagc acguauuaaa u 21

<210> 1019

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1019

caagcaaagc acguauuaaa u 21

<210> 1020

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1020

aagcaaagca cguauuaaau a 21

<210> 1021

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1021

aagcaaagca cguauuaaau a 21

<210> 1022

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1022

agcaaagcac guauuaaaua u 21

<210> 1023

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1023

agcaaagcac guauuaaaua u 21

<210> 1024

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1024

gcaaagcacg uauuaaauau g 21

<210> 1025

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1025

gcaaagcacg uauuaaauau g 21

<210> 1026

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1026

caaagcacgu auuaaauaug a 21

<210> 1027

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1027

caaagcacgu auuaaauaug a 21

<210> 1028

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1028

aaagcacgua uuaaauauga u 21

<210> 1029

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1029

aaagcacgua uuaaauauga u 21

<210> 1030

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1030

aagcacguau uaaauaugau from 21

<210> 1031

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1031

aagcacguau uaaauaugau from 21

<210> 1032

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1032

agcacguauu aaauaugauc u 21

<210> 1033

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1033

agcacguauu aaauaugauc u 21

<210> 1034

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1034

gcacguauua aauaugaucu g 21

<210> 1035

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1035

gcacguauua aauaugaucu g 21

<210> 1036

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1036

cacguauuaa auaugaucug from 21

<210> 1037

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1037

cacguauuaa auaugaucug from 21

<210> 1038

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1038

acguauuaaa uaugaucugc a 21

<210> 1039

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1039

acguauuaaa uaugaucugc a 21

<210> 1040

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1040

cguauuaaau augaucugca g 21

<210> 1041

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1041

cguauuaaau augaucugca g 21

<210> 1042

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1042

guauuaaaua ugaucugcag from 21

<210> 1043

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1043

guauuaaaua ugaucugcag from 21

<210> 1044

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1044

uauuaaauau gaucugcagc from 21

<210> 1045

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1045

uauuaaauau gaucugcagc from 21

<210> 1046

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1046

auuaaauaug aucugcagcc a 21

<210> 1047

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1047

auuaaauaug aucugcagcc a 21

<210> 1048

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1048

uuaaauauga ucugcagcca u 21

<210> 1049

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1049

uuaaauauga ucugcagcca u 21

<210> 1050

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1050

uaaauaugau cugcagccau u 21

<210> 1051

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1051

uaaauaugau cugcagccau u 21

<210> 1052

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1052

aaauaugauc ugcagccauu a 21

<210> 1053

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1053

aaauaugauc ugcagccauu a 21

<210> 1054

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1054

aauaugaucu gcagccaauua a 21

<210> 1055

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1055

aauaugaucu gcagccaauua a 21

<210> 1056

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1056

auaugaucug cagccauuaa a 21

<210> 1057

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1057

auaugaucug cagccauuaa a 21

<210> 1058

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1058

uaugaucugc agccauuaaa a 21

<210> 1059

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1059

uaugaucugc agccauuaaa a 21

<210> 1060

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1060

augaucugca gccauuaaaa a 21

<210> 1061

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1061

augaucugca gccauuaaaa a 21

<210> 1062

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1062

ugaucugcag ccauuaaaaa g 21

<210> 1063

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1063

ugaucugcag ccauuaaaaa g 21

<210> 1064

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1064

gaucugcagc cauuaaaaag a 21

<210> 1065

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1065

gaucugcagc cauuaaaaag a 21

<210> 1066

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1066

aucugcagcc auuaaaaaga from 21

<210> 1067

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1067

aucugcagcc auuaaaaaga from 21

<210> 1068

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1068

ucugcagcca uuaaaaagac a 21

<210> 1069

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1069

ucugcagcca uuaaaaagac a 21

<210> 1070

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1070

cugcagccau uaaaaagaca from 21

<210> 1071

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1071

cugcagccau uaaaaagaca from 21

<210> 1072

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1072

ugcagccauu aaaaagacac a 21

<210> 1073

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1073

ugcagccauu aaaaagacac a 21

<210> 1074

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1074

gcagccauua aaaagacaca u 21

<210> 1075

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1075

gcagccauua aaaagacaca u 21

<210> 1076

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1076

cagccauuaa aaagacacau u 21

<210> 1077

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1077

cagccauuaa aaagacacau u 21

<210> 1078

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1078

agccauuaaa aagacacauu from 21

<210> 1079

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1079

agccauuaaa aagacacauu from 21

<210> 1080

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1080

gccauuaaaa agacacauuc u 21

<210> 1081

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1081

gccauuaaaa agacacauuc u 21

<210> 1082

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1082

ccauuaaaaa gacacauucu g 21

<210> 1083

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1083

ccauuaaaaa gacacauucu g 21

<210> 1084

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1084

cauuaaaaag acacauucug u 21

<210> 1085

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1085

cauuaaaaag acacauucug u 21

<210> 1086

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1086

auuaaaaaga cacauucugu a 21

<210> 1087

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1087

auuaaaaaga cacauucugu a 21

<210> 1088

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1088

uuaaaaagac acauucugua a 21

<210> 1089

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1089

uuaaaaagac acauucugua a 21

<210> 1090

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1090

uaaaaagaca cauucuguaa a 21

<210> 1091

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1091

uaaaaagaca cauucuguaa a 21

<210> 1092

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1092

aaaaagacac auucuguaaa a 21

<210> 1093

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1093

aaaaagacac auucuguaaa a 21

<210> 1094

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1094

aaaagacaca uucuguaaaa a 21

<210> 1095

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1095

aaaagacaca uucuguaaaa a 21

<210> 1096

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1096

aaagacacau ucuguaaaaa a 21

<210> 1097

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1097

aaagacacau ucuguaaaaa a 21

<210> 1098

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1098

aagacacauu cuguaaaaaa a 21

<210> 1099

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1099

aagacacauu cuguaaaaaa a 21

<210> 1100

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1100

agacacauuc uguaaaaaaa a 21

<210> 1101

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1101

agacacauuc uguaaaaaaa a 21

<210> 1102

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1102

gacacauucu guaaaaaaaa a 21

<210> 1103

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1103

gacacauucu guaaaaaaaa a 21

<210> 1104

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1104

acacauucug uaaaaaaaaa a 21

<210> 1105

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1105

acacauucug uaaaaaaaaa a 21

<210> 1106

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1106

cacauucugu aaaaaaaaaa a 21

<210> 1107

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1107

cacauucugu aaaaaaaaaa a 21

<210> 1108

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1108

acauucugua aaaaaaaaaa a 21

<210> 1109

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1109

acauucugua aaaaaaaaaa a 21

<210> 1110

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1110

auggaauacu cuugguuaca uga 23

<210> 1111

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1111

auggaauacu cuugguuaca uga 23

<210> 1112

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1112

auggaauacu cuugguuaca uga 23

<210> 1113

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1113

auggaauacu cuugguuaca uga 23

<210> 1114

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1114

auggaauacu cuugguuaca uga 23

<210> 1115

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1115

auggaauacu cuugguuaca uga 23

<210> 1116

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1116

auggaauacu cuugguuaca uga 23

<210> 1117

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1117

auggaauacu cuugguuaca uga 23

<210> 1118

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1118

auggaauacu cuugguuaca uga 23

<210> 1119

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1119

ucuugguuac augaaauccc auc 23

<210> 1120

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1120

ucuugguuac augaaauccc auc 23

<210> 1121

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1121

auggaauacu cuugguuaca uga 23

<210> 1122

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1122

ucuugguuac augaaauccc auc 23

<210> 1123

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1123

auggaauacu cuuggutaca tga 23

<210> 1124

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1124

auggaauacu cuugguuaca uga 23

<210> 1125

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1125

auggaatacu cuugguuaca uga 23

<210> 1126

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1126

auggaauacu cuugguuaca uga 23

<210> 1127

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1127

ucuugguuac augaaauccc auc 23

<210> 1128

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1128

auggaauacu cuugguuaca uga 23

<210> 1129

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1129

auggaauacu cuugguuaca uga 23

<210> 1130

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1130

auggaauacu cuugguuaca uga 23

<210> 1131

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1131

auggaauacu cuugguuaca uga 23

<210> 1132

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1132

uctuggtuac augaaauccc atc 23

<210> 1133

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1133

auggaauacu cuugguuaca uga 23

<210> 1134

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1134

ucuugguuac augaaauccc auc 23

<210> 1135

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1135

ucuugguuac augaaauccc auc 23

<210> 1136

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1136

ucuugguuac augaaauccc auc 23

<210> 1137

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1137

ucuugguuac augaaauccc auc 23

<210> 1138

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1138

atggaatact cuugguuaca uga 23

<210> 1139

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1139

auggaatacu cutggutaca tga 23

<210> 1140

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1140

ucuugguuac augaaauccc auc 23

<210> 1141

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1141

auggaauacu cuugguuaca uga 23

<210> 1142

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1142

auggaauacu cuugguuaca uga 23

<210> 1143

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1143

ucuugguuac augaaauccc auc 23

<210> 1144

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1144

auggaauacu cuugguuaca uga 23

<210> 1145

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1145

ucuugguuac augaaauccc auc 23

<210> 1146

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1146

ucuugguuac augaaauccc auc 23

<210> 1147

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1147

ucuugguuac augaaauccc auc 23

<210> 1148

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1148

ucuugguuac augaaauccc auc 23

<210> 1149

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1149

auggaauacu cuugguuaca uga 23

<210> 1150

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1150

auggaauacu cuugguuaca uga 23

<210> 1151

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1151

auggaauacu cuugguuaca uga 23

<210> 1152

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1152

ucuugguuac augaaauccc auc 23

<210> 1153

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1153

auggaauacu cuugguuaca uga 23

<210> 1154

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1154

auggaauacu cuugguuaca uga 23

<210> 1155

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1155

auggaauacu cuugguuaca uga 23

<210> 1156

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1156

auggaauacu cuugguuaca uga 23

<210> 1157

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1157

ucuugguuac augaaauccc auc 23

<210> 1158

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1158

auggaauacu cuugguuaca uga 23

<210> 1159

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1159

auggaauacu cuugguuaca uga 23

<210> 1160

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1160

ucuugguuac augaaauccc auc 23

<210> 1161

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1161

auggaauact ctuggtuaca uga 23

<210> 1162

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1162

auggaauacu cuugguuaca uga 23

<210> 1163

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1163

auggaauacu cuugguuaca uga 23

<210> 1164

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1164

atggaauacu cuugguuaca uga 23

<210> 1165

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1165

auggaatacu cuugguuaca uga 23

<210> 1166

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1166

auggaauacu cuugguuaca uga 23

<210> 1167

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1167

auggaauacu cuugguuaca uga 23

<210> 1168

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1168

auggaauact ctuggtuaca uga 23

<210> 1169

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1169

auggaatacu cuugguuaca uga 23

<210> 1170

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1170

atggaatact cuugguuaca tga 23

<210> 1171

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1171

atggaauact cuugguuaca uga 23

<210> 1172

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1172

auggaauacu cuugguuaca uga 23

<210> 1173

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1173

atggaauact cutggutaca tga 23

<210> 1174

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1174

atggaatacu cuugguuaca uga 23

<210> 1175

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1175

auggaatacu cuugguuaca uga 23

<210> 1176

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1176

atggaatacu cuugguuaca uga 23

<210> 1177

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1177

auggaauacu cuugguuaca uga 23

<210> 1178

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1178

auggaauacu cuugguuaca uga 23

<210> 1179

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1179

auggaauacu cuugguuaca uga 23

<210> 1180

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1180

auggaauacu cuugguuaca uga 23

<210> 1181

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1181

ucuugguuac augaaauccc auc 23

<210> 1182

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1182

auggaauacu cuugguuaca uga 23

<210> 1183

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1183

auggaatacu cuugguuaca uga 23

<210> 1184

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1184

auggaauacu cuugguuaca uga 23

<210> 1185

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1185

auggaatacu cuugguuaca uga 23

<210> 1186

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1186

auggaatacu cuugguuaca uga 23

<210> 1187

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1187

auggaauacu cuugguuaca uga 23

<210> 1188

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1188

auggaatacu cuugguuaca uga 23

<210> 1189

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1189

auggaatacu cuugguuaca uga 23

<210> 1190

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1190

auggaauacu cuugguuaca uga 23

<210> 1191

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1191

atggaauacu cuugguuaca uga 23

<210> 1192

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1192

auggaauacu cuuggutaca uga 23

<210> 1193

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1193

atggaatacu cuugguuaca uga 23

<210> 1194

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1194

auggaauacu cuugguuaca uga 23

<210> 1195

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1195

auggaauacu cuugguuaca uga 23

<210> 1196

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1196

auggaauacu cuugguuaca uga 23

<210> 1197

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1197

auggaauacu cuugguuaca uga 23

<210> 1198

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1198

auggaauacu cuugguuaca uga 23

<210> 1199

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1199

auggaauacu cuugguuaca uga 23

<210> 1200

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1200

auggaauacu cuugguuaca uga 23

<210> 1201

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1201

auggaauacu cuugguuaca uga 23

<210> 1202

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1202

auggaauacu cuugguuaca uga 23

<210> 1203

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1203

auggaauacu cuugguuaca uga 23

<210> 1204

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1204

auggaauacu cuugguuaca uga 23

<210> 1205

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1205

auggaauacu cuugguuaca uga 23

<210> 1206

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1206

auggaauacu cuugguuaca uga 23

<210> 1207

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1207

auggaauacu cuugguuaca uga 23

<210> 1208

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1208

auggaauacu cuugguuaca uga 23

<210> 1209

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1209

auggaatacu cuugguuaca uga 23

<210> 1210

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1210

auggaauacu cuugguuaca uga 23

<210> 1211

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1211

auggaauacu cuugguuaca uga 23

<210> 1212

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1212

auggaauacu ctugguuaca uga 23

<210> 1213

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1213

auggaauacu cuugguuaca uga 23

<210> 1214

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1214

auggaauacu cuugguuaca uga 23

<210> 1215

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1215

auggaauacu cuugguuaca uga 23

<210> 1216

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1216

auggaauacu cuugguuaca uga 23

<210> 1217

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1217

auggaauacu cuugguuaca uga 23

<210> 1218

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1218

auggaauacu cuugguuaca uga 23

<210> 1219

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1219

auggaauacu cuugguuaca uga 23

<210> 1220

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1220

auggaauacu cuugguuaca uga 23

<210> 1221

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1221

auggaauacu cuugguuaca uga 23

<210> 1222

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1222

auggaauacu cuugguuaca uga 23

<210> 1223

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1223

auggaauacu cuugguuaca uga 23

<210> 1224

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1224

auggaauacu cuugguuaca uga 23

<210> 1225

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1225

auggaauacu cuugguuaca uga 23

<210> 1226

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1226

atggaatacu cuugguuaca uga 23

<210> 1227

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1227

auggaauacu cuugguuaca uga 23

<210> 1228

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1228

auggaauacu cuugguuaca uga 23

<210> 1229

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1229

auggaauacu cuugguuaca uga 23

<210> 1230

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1230

auggaauacu cuugguuaca uga 23

<210> 1231

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1231

auggaauacu cuugguuaca uga 23

<210> 1232

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1232

auggaauacu cuugguuaca uga 23

<210> 1233

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1233

auggaauacu cuugguuaca uga 23

<210> 1234

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1234

auggaauacu cuugguuaca uga 23

<210> 1235

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1235

auggaauacu cuugguuaca uga 23

<210> 1236

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1236

auggaauacu cuugguuaca uga 23

<210> 1237

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1237

auggaauacu cuugguuaca uga 23

<210> 1238

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1238

auggaauacu cuugguuaca uga 23

<210> 1239

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1239

auggaauacu cuugguuaca uga 23

<210> 1240

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1240

auggaauacu cuugguuaca uga 23

<210> 1241

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1241

auggaauacu cuugguuaca uga 23

<210> 1242

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1242

auggaauacu cuugguuaca uga 23

<210> 1243

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1243

auggaauacu cuugguuaca uga 23

<210> 1244

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1244

auggaauacu cuugguuaca uga 23

<210> 1245

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1245

auggaauacu cuugguuaca uga 23

<210> 1246

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1246

auggaauacu cuugguuaca uga 23

<210> 1247

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1247

auggaauacu cuugguuaca uga 23

<210> 1248

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1248

auggaauacu cuugguuaca uga 23

<210> 1249

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1249

auggaauacu cuugguuaca uga 23

<210> 1250

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1250

auggaauacu cuugguuaca uga 23

<210> 1251

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1251

auggaauacu cuugguuaca uga 23

<210> 1252

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1252

auggaauacu cuugguuaca uga 23

<210> 1253

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1253

auggaauacu cuugguuaca uga 23

<210> 1254

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1254

auggaauacu cuugguuaca uga 23

<210> 1255

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1255

auggaauacu cuugguuaca uga 23

<210> 1256

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1256

auggaauacu cuugguuaca uga 23

<210> 1257

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1257

auggaauacu cuugguuaca uga 23

<210> 1258

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1258

auggaauacu cuugguuaca uga 23

<210> 1259

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1259

auggaauacu cuugguuaca uga 23

<210> 1260

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1260

auggaauacu cuugguuaca uga 23

<210> 1261

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1261

auggaauacu cuugguuaca uga 23

<210> 1262

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1262

auggaauacu cuugguuaca uga 23

<210> 1263

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1263

auggaauacu cuugguuaca uga 23

<210> 1264

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1264

ucuugguuac augaaauccc auc 23

<210> 1265

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1265

ucuugguuac augaaauccc auc 23

<210> 1266

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1266

ucuugguuac augaaauccc auc 23

<210> 1267

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1267

ucuugguuac augaaauccc auc 23

<210> 1268

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1268

ucuugguuac augaaauccc auc 23

<210> 1269

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1269

ucuugguuac augaaauccc auc 23

<210> 1270

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1270

ucuugguuac augaaauccc auc 23

<210> 1271

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1271

ucuugguuac augaaauccc auc 23

<210> 1272

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1272

auggaauacu cuugguuaca uga 23

<210> 1273

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1273

auggaauacu cuugguuaca uga 23

<210> 1274

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1274

auggaauacu cuugguuaca uga 23

<210> 1275

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1275

auggaauacu cuugguuaca uga 23

<210> 1276

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1276

auggaauacu cuugguuaca uga 23

<210> 1277

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1277

auggaauacu cuugguuaca uga 23

<210> 1278

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1278

auggaauacu cuugguuaca uga 23

<210> 1279

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1279

auggaauacu cuugguuaca uga 23

<210> 1280

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1280

auggaauacu cuugguuaca uga 23

<210> 1281

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1281

auggaauacu cuugguuaca uga 23

<210> 1282

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1282

auggaauacu cuugguuaca uga 23

<210> 1283

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1283

auggaauacu cuugguuaca uga 23

<210> 1284

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1284

auggaauacu cuugguuaca uga 23

<210> 1285

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1285

auggaauacu cuugguuaca uga 23

<210> 1286

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1286

auggaauacu cuugguuaca uga 23

<210> 1287

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1287

auggaauacu cuugguuaca uga 23

<210> 1288

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1288

auggaauacu cuugguuaca uga 23

<210> 1289

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1289

auggaauacu cuugguuaca uga 23

<210> 1290

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1290

auggaauacu cuugguuaca uga 23

<210> 1291

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1291

auggaauacu cuugguuaca uga 23

<210> 1292

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1292

auggaauacu cuugguuaca uga 23

<210> 1293

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1293

auggaauacu cuugguuaca uga 23

<210> 1294

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1294

auggaauacu cuugguuaca uga 23

<210> 1295

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1295

auggaauacu cuugguuaca uga 23

<210> 1296

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1296

auggaauacu cuugguuaca uga 23

<210> 1297

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1297

auggaauacu cuugguuaca uga 23

<210> 1298

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1298

auggaauacu cuugguuaca uga 23

<210> 1299

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1299

auggaauacu cuugguuaca uga 23

<210> 1300

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1300

auggaauacu cuugguuaca uga 23

<210> 1301

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1301

auggaauacu cuuggutaca tga 23

<210> 1302

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1302

auggaauacu cuugguuaca uga 23

<210> 1303

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1303

auggaauacu cuugguuaca uga 23

<210> 1304

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1304

auggaauacu cuugguuaca uga 23

<210> 1305

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1305

auggaauacu cuugguuaca uga 23

<210> 1306

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1306

auggaauacu cuugguuaca uga 23

<210> 1307

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1307

auggaauacu cuugguuaca uga 23

<210> 1308

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1308

auggaauacu cuugguuaca uga 23

<210> 1309

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1309

auggaauacu cuugguuaca uga 23

<210> 1310

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1310

auggaauacu cuugguuaca uga 23

<210> 1311

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1311

auggaauacu cuugguuaca uga 23

<210> 1312

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1312

auggaauacu cuugguuaca uga 23

<210> 1313

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1313

auggaauacu cuugguuaca uga 23

<210> 1314

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1314

atggaauacu cuugguuaca uga 23

<210> 1315

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1315

auggaatacu cuugguuaca uga 23

<210> 1316

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1316

atggaauacu cuugguuaca uga 23

<210> 1317

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1317

atggaauact cuugguuaca uga 23

<210> 1318

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1318

auggaauacu cuugguuaca uga 23

<210> 1319

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1319

auggaauacu cuugguuaca uga 23

<210> 1320

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1320

auggaatacu cuugguuaca uga 23

<210> 1321

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1321

auggaatacu cuugguuaca uga 23

<210> 1322

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1322

auggaauacu cuuggutaca tga 23

<210> 1323

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1323

atggaauacu cuugguuaca uga 23

<210> 1324

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1324

auggaauacu cuugguuaca uga 23

<210> 1325

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1325

auggaauacu cuugguuaca uga 23

<210> 1326

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1326

auggaauacu cuugguuaca uga 23

<210> 1327

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1327

auggaauacu cuugguuaca uga 23

<210> 1328

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1328

auggaauacu cuugguuaca uga 23

<210> 1329

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1329

auggaauacu cuugguuaca uga 23

<210> 1330

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1330

auggaauacu cuugguuaca uga 23

<210> 1331

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1331

auggaauacu cuugguuaca uga 23

<210> 1332

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1332

auggaauacu cuugguuaca uga 23

<210> 1333

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1333

auggaauacu cuugguuaca aga 23

<210> 1334

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1334

auggaauacu cutgguuaca uga 23

<210> 1335

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1335

auggaauacu cuugguuaca uga 23

<210> 1336

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1336

auggaauacu ctugguuaca uga 23

<210> 1337

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1337

auggaauacu cuugguuaca uga 23

<210> 1338

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1338

auggaauacu cuugguuaca uga 23

<210> 1339

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1339

auggaauacu cuugguuaca uga 23

<210> 1340

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1340

auggaauacu cuugguuaca uga 23

<210> 1341

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1341

auggaauacu cuugguuaca uga 23

<210> 1342

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1342

auggaauacu cuugguuaca uga 23

<210> 1343

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1343

auggaauacu cuugguuaca uga 23

<210> 1344

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1344

auggaauacu cuugguuaca uga 23

<210> 1345

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1345

auggaauacu cuugguuaca uga 23

<210> 1346

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1346

auggaauacu cuugguuaca uga 23

<210> 1347

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1347

auggaauacu cuugguuaca uga 23

<210> 1348

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1348

auggaauacu cuugguuaca uga 23

<210> 1349

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1349

auggaauacu cuugguuaca uga 23

<210> 1350

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1350

auggaauacu cuugguuaca uga 23

<210> 1351

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1351

auggaauacu cuugguuaca uga 23

<210> 1352

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1352

auggaatacu cuugguuaca uga 23

<210> 1353

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1353

auggaauacu cuugguuaca uga 23

<210> 1354

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1354

auggaatacu cuugguuaca uga 23

<210> 1355

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1355

auggaauacu cuugguuaca uga 23

<210> 1356

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1356

auggaatacu cuugguuaca uga 23

<210> 1357

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1357

atggaauacu cuugguuaca uga 23

<210> 1358

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1358

tuauagagca agaacacugu uuu 23

<210> 1359

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1359

uuauagagca agaacacugu uuu 23

<210> 1360

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1360

uuauagagca agaacacugu uuu 23

<210> 1361

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1361

uuauagagca agaacacugu uuu 23

<210> 1362

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1362

uuauagagca agaacacugt t 21

<210> 1363

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1363

uuauagagca agaacacugu uuu 23

<210> 1364

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1364

uuauagagca agaacacugu uuu 23

<210> 1365

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1365

uuauagagca agaacacugu uuu 23

<210> 1366

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1366

uuauagagca agaacacugu uuu 23

<210> 1367

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1367

uuauagagca agaacacugu uuu 23

<210> 1368

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1368

uuauagagca agaacacugu uuu 23

<210> 1369

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1369

uuauagagca agaacacugu uuu 23

<210> 1370

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1370

uuauagagca agaacacugu uuu 23

<210> 1371

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1371

uuauagagca agaacacugu uuu 23

<210> 1372

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1372

uuauagagca agaacacugu uuu 23

<210> 1373

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1373

uuauagagca agaacacugt t 21

<210> 1374

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1374

uuauagagca agaacacugu uuu 23

<210> 1375

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1375

uuauagagca agaacacugu uuu 23

<210> 1376

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1376

uuauagagca agaacacugu uuu 23

<210> 1377

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1377

tuauagagca agaacacagu uuu 23

<210> 1378

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1378

uuauagagca agaacacugu uuu 23

<210> 1379

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1379

uuauagagca agaacacugt t 21

<210> 1380

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1380

uuauagagca agaacacugu uuu 23

<210> 1381

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1381

uuauagagca agaacacugu uuu 23

<210> 1382

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1382

uuauagagca agaacacugt t 21

<210> 1383

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1383

uuauagagca agaacacugu uuu 23

<210> 1384

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1384

uuauagagca agaacacugu uuu 23

<210> 1385

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1385

uuauagagca agaacacugt t 21

<210> 1386

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1386

uuauagagca agaacacugu uuu 23

<210> 1387

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1387

uuauagagca agaacacugu uuu 23

<210> 1388

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1388

uuauagagca agaacacugu uuu 23

<210> 1389

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1389

uuauagagca agaacacugt t 21

<210> 1390

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1390

uuauagagca agaacacugu uuu 23

<210> 1391

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1391

uuauagagca agaacacugu uuu 23

<210> 1392

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1392

uuauagagca agaacacugu uuu 23

<210> 1393

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1393

uuauagagca agaacacugu uuu 23

<210> 1394

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1394

uuauagagca agaacacugu uuu 23

<210> 1395

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1395

uuauagagca agaacacugu uuu 23

<210> 1396

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1396

uuauagagca agaacacugu uuu 23

<210> 1397

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1397

uuauagagca agaacacugu uuu 23

<210> 1398

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1398

uuauagagca agaacacugu uuu 23

<210> 1399

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1399

uuauagagca agaacacugu uuu 23

<210> 1400

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1400

uuauagagca agaacacugu uuu 23

<210> 1401

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1401

uuauagagca agaacacugu uuu 23

<210> 1402

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1402

uuauagagca agaacacugu uuu 23

<210> 1403

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1403

uuauagagca agaacacugu uuu 23

<210> 1404

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1404

uuauagagca agaacacugu uuu 23

<210> 1405

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1405

uuauagagca agaacacugu uuu 23

<210> 1406

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1406

ttauagagca agaacactgu ttu 23

<210> 1407

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1407

uuauagagca agaacacugu uuu 23

<210> 1408

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1408

uuauagagca agaacacugu uuu 23

<210> 1409

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1409

uuauagagca agaacacugu uuu 23

<210> 1410

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1410

uuauagagca agaacacugu uuu 23

<210> 1411

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1411

uuauagagca agaacacugu uuu 23

<210> 1412

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1412

uuauagagca agaacacugu uuu 23

<210> 1413

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1413

uuauagagca agaacacugu uuu 23

<210> 1414

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1414

uuauagagca agaacacugu uuu 23

<210> 1415

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1415

utatagagca agaacacugt tuu 23

<210> 1416

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1416

tuauagagca agaacacugu uuu 23

<210> 1417

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1417

tuauagagca agaacacugu uuu 23

<210> 1418

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1418

tuauagagca agaacacugu uuu 23

<210> 1419

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1419

tuauagagca agaacacugu uuu 23

<210> 1420

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1420

tuauagagca agaacacagu uuu 23

<210> 1421

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1421

ttatagagca agaacacagu uuu 23

<210> 1422

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1422

tuauagagca agaacacugu uuu 23

<210> 1423

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1423

uuauagagca agaacacugu uuu 23

<210> 1424

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1424

uuauagagca agaacacugu uuu 23

<210> 1425

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1425

uuauagagca agaacacugu uuu 23

<210> 1426

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1426

uuauagagca agaacacugu uuu 23

<210> 1427

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1427

uuauagagca agaacacugu uuu 23

<210> 1428

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1428

uuauagagca agaacacugu uuu 23

<210> 1429

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1429

uuauagagca agaacacugu uuu 23

<210> 1430

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1430

uuauagagca agaacacugu uuu 23

<210> 1431

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1431

uuauagagca agaacacugu uuu 23

<210> 1432

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1432

uuauagagca agaacacugu uuu 23

<210> 1433

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1433

uuauagagca agaacacugu uuu 23

<210> 1434

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1434

uuauagagca agaacacugu uuu 23

<210> 1435

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1435

uuauagagca agaacacugu uuu 23

<210> 1436

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1436

uuauagagca agaacacugu uuu 23

<210> 1437

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1437

uuauagagca agaacacugu uuu 23

<210> 1438

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1438

uuauagagca agaacacugu uuu 23

<210> 1439

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1439

uuauagagca agaacacugu uuu 23

<210> 1440

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1440

uuauagagca agaacacugu uuu 23

<210> 1441

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1441

uuauagagca agaacacugu uuu 23

<210> 1442

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1442

uuauagagca agaacacugu uuu 23

<210> 1443

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1443

uuauagagca agaacacugu uuu 23

<210> 1444

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1444

uuauagagca agaacacugu uuu 23

<210> 1445

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1445

uuauagagca agaacacugu uuu 23

<210> 1446

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1446

uuauagagca agaacacugu uuu 23

<210> 1447

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1447

uuauagagca agaacacugu uuu 23

<210> 1448

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1448

uuauagagca agaacacugu uuu 23

<210> 1449

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1449

uuauagagca agaacacugu uuu 23

<210> 1450

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1450

uuauagagca agaacacugu uuu 23

<210> 1451

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1451

uuauagagca agaacacugu uuu 23

<210> 1452

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1452

uuauagagca agaacacugu uuu 23

<210> 1453

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1453

uuauagagca agaacacugu uuu 23

<210> 1454

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1454

uuauagagca agaacacugu uuu 23

<210> 1455

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1455

uuauagagca agaacacugu uuu 23

<210> 1456

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1456

uuauagagca agaacacugu uuu 23

<210> 1457

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1457

uuauagagca agaacacugu uuu 23

<210> 1458

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1458

uuauagagca agaacacugu uuu 23

<210> 1459

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1459

uuauagagca agaacacugu uuu 23

<210> 1460

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1460

uuauagagca agaacacugu uuu 23

<210> 1461

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1461

uuauagagca agaacacugu uuu 23

<210> 1462

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1462

uuauagagca agaacacugu uuu 23

<210> 1463

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1463

uuauagagca agaacacugu uuu 23

<210> 1464

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1464

uuauagagca agaacacugu uuu 23

<210> 1465

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1465

uuauagagca agaacacugu uuu 23

<210> 1466

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1466

uuauagagca agaacacugu uuu 23

<210> 1467

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1467

uuauagagca agaacacugu uuu 23

<210> 1468

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1468

uuauagagca agaacacugu uuu 23

<210> 1469

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1469

uuauagagca agaacacugu uuu 23

<210> 1470

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1470

uuauagagca agaacacugu uuu 23

<210> 1471

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1471

uuauagagca agaacacugu uuu 23

<210> 1472

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1472

uuauagagca agaacacugu uuu 23

<210> 1473

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1473

uuauagagca agaacacugu uuu 23

<210> 1474

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1474

uuauagagca agaacacugu uuu 23

<210> 1475

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1475

uuauagagca agaacacugu uuu 23

<210> 1476

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1476

uuauagagca agaacacugu uuu 23

<210> 1477

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1477

uuauagagca agaacacugu uuu 23

<210> 1478

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1478

uuauagagca agaacacugu uuu 23

<210> 1479

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1479

uuauagagca agaacacugu uuu 23

<210> 1480

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1480

uuauagagca agaacacugu uuu 23

<210> 1481

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1481

uuauagagca agaacacugu uuu 23

<210> 1482

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1482

uuauagagca agaacacugu uuu 23

<210> 1483

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1483

uuauagagca agaacacugu uuu 23

<210> 1484

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1484

uuauagagca agaacacugu uuu 23

<210> 1485

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1485

uuauagagca agaacacugu uuu 23

<210> 1486

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1486

uuauagagca agaacacugu uuu 23

<210> 1487

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1487

uuauagagca agaacacugu uuu 23

<210> 1488

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1488

uuauagagca agaacacugu uuu 23

<210> 1489

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1489

uuauagagca agaacacugu uuu 23

<210> 1490

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1490

uuauagagca agaacacugu uuu 23

<210> 1491

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1491

uuauagagca agaacacugu uuu 23

<210> 1492

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1492

uuauagagca agaacacugu uuu 23

<210> 1493

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1493

uuauagagca agaacacugu uuu 23

<210> 1494

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1494

uuauagagca agaacacugu uuu 23

<210> 1495

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1495

uuauagagca agaacacugu uuu 23

<210> 1496

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1496

uuauagagca agaacacugt tuu 23

<210> 1497

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1497

uuauagagca agaacacugu uuu 23

<210> 1498

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1498

uuauagagca agaacacugu uuu 23

<210> 1499

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1499

uuauagagca agaacacugu uuu 23

<210> 1500

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1500

uuauagagca agaacacugu uuu 23

<210> 1501

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1501

uuauagagca agaacacugu tuu 23

<210> 1502

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1502

uuauagagca agaacacugu uuu 23

<210> 1503

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1503

uuauagagca agaacacugu uuu 23

<210> 1504

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1504

uuauagagca agaacacugu uuu 23

<210> 1505

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1505

uuauagagca agaacacugu uuu 23

<210> 1506

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1506

uuauagagca agaacacugu uuu 23

<210> 1507

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1507

uuatagagca agagcacagu uuu 23

<210> 1508

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1508

uuauagagca agaacacugu uuu 23

<210> 1509

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1509

utatagagca agaacactgt utu 23

<210> 1510

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1510

uuauagagca agagcacagu uuu 23

<210> 1511

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1511

uuauagagca agagcacagu uuu 23

<210> 1512

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1512

uuauagagca agaacacugu uuu 23

<210> 1513

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1513

utauagagca agagcacagu uuu 23

<210> 1514

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1514

uuauagagca agaacacugu uuu 23

<210> 1515

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1515

uuauagagca agaacacugu uuu 23

<210> 1516

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1516

utauagagca agagcacagu uuu 23

<210> 1517

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1517

uuauagagca agaacacugu uuu 23

<210> 1518

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1518

utatagagca agaacacagu uuu 23

<210> 1519

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1519

uuauagagca agaacacugu uuu 23

<210> 1520

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1520

utatagagca agagcacagu uuu 23

<210> 1521

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1521

uuauagagca agaacacugu uuu 23

<210> 1522

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 1522

utatagagca agaacacugt tuu 23

<210> 1523

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1523

uuauagagca agaacacugu uuu 23

<210> 1524

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1524

uuauagagca agaacacugu uuu 23

<210> 1525

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1525

uuauagagca agaacacugu uuu 23

<210> 1526

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1526

uuauagagca agaacacugu uuu 23

<210> 1527

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1527

uuauagagca agaacacugu uuu 23

<210> 1528

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1528

uuauagagca agaacacugu uuu 23

<210> 1529

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1529

uuauagagca agaacacugu uuu 23

<210> 1530

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1530

agguccacug gaggagaagu ccc 23

<210> 1531

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1531

agguccacug gaggagaagu ccc 23

<210> 1532

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1532

cagguccacu ggaggagaag ucc 23

<210> 1533

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1533

cagguccacu ggaggagaag ucc 23

<210> 1534

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1534

ucagguccac uggaggagaa guc 23

<210> 1535

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1535

ucagguccac uggaggagaa guc 23

<210> 1536

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1536

uucaggucca cuggaggaga agu 23

<210> 1537

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1537

uucaggucca cuggaggaga agu 23

<210> 1538

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1538

cuucaggucc acuggaggag aag 23

<210> 1539

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1539

cuucaggucc acuggaggag aag 23

<210> 1540

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1540

ccuucagguc cacuggagga gaa 23

<210> 1541

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1541

ccuucagguc cacuggagga gaa 23

<210> 1542

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1542

uccuucaggu ccacuggagg aga 23

<210> 1543

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1543

uccuucaggu ccacuggagg aga 23

<210> 1544

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1544

guccuucagg ucccacuggag gag 23

<210> 1545

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1545

guccuucagg ucccacuggag gag 23

<210> 1546

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1546

cguccuucag guccicugga gga 23

<210> 1547

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1547

cguccuucag guccicugga gga 23

<210> 1548

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1548

ucguccuuca ggucccacugg agg 23

<210> 1549

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1549

ucguccuuca ggucccacugg agg 23

<210> 1550

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1550

cucguccuuc agguccacug gag 23

<210> 1551

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1551

cucguccuuc agguccacug gag 23

<210> 1552

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1552

ccucguccuu cagguccacu gga 23

<210> 1553

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1553

ccucguccuu cagguccacu gga 23

<210> 1554

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1554

cccucguccu ucagguccac ugg 23

<210> 1555

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1555

cccucguccu ucagguccac ugg 23

<210> 1556

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1556

ucccucgucc uucaggucca cug 23

<210> 1557

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1557

ucccucgucc uucaggucca cug 23

<210> 1558

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1558

aucccucguc cuucaggucc acu 23

<210> 1559

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1559

aucccucguc cuucaggucc acu 23

<210> 1560

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1560

caucccucgu ccuucagguc cac 23

<210> 1561

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1561

caucccucgu ccuucagguc cac 23

<210> 1562

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1562

ccaucccucg uccuucaggu cca 23

<210> 1563

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1563

ccaucccucg uccuucaggu cca 23

<210> 1564

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1564

cccaucccuc guccuucagg ucc 23

<210> 1565

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1565

cccaucccuc guccuucagg ucc 23

<210> 1566

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1566

ucccaucccu cguccuucag guc 23

<210> 1567

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1567

ucccaucccu cguccuucag guc 23

<210> 1568

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1568

aucccauccc ucguccuuca ggu 23

<210> 1569

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1569

aucccauccc ucguccuuca ggu 23

<210> 1570

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1570

aaucccaucc cucguccuuc agg 23

<210> 1571

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1571

aaucccaucc cucguccuuc agg 23

<210> 1572

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1572

aaaucccauc cccucguccuu cag 23

<210> 1573

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1573

aaaucccauc cccucguccuu cag 23

<210> 1574

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1574

gaaaucccau cccucguccu uca 23

<210> 1575

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1575

gaaaucccau cccucguccu uca 23

<210> 1576

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1576

ugaaauccca ucccucgucc uuc 23

<210> 1577

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1577

ugaaauccca ucccucgucc uuc 23

<210> 1578

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1578

augaaauccc aucccucguc cuu 23

<210> 1579

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1579

augaaauccc aucccucguc cuu 23

<210> 1580

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1580

caugaaaucc caucccucgu ccu 23

<210> 1581

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1581

caugaaaucc caucccucgu ccu 23

<210> 1582

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1582

acaugaaauc ccaucccucg ucc 23

<210> 1583

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1583

acaugaaauc ccaucccucg ucc 23

<210> 1584

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1584

uacaugaaau cccaucccuc guc 23

<210> 1585

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1585

uacaugaaau cccaucccuc guc 23

<210> 1586

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1586

uuacaugaaa ucccaucccu cgu 23

<210> 1587

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1587

uuacaugaaa ucccaucccu cgu 23

<210> 1588

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1588

guuacaugaa aucccauccc ucg 23

<210> 1589

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1589

guuacaugaa aucccauccc ucg 23

<210> 1590

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1590

gguuacauga aaucccaucc cuc 23

<210> 1591

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1591

gguuacauga aaucccaucc cuc 23

<210> 1592

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1592

ugguuacaug aaaucccauc ccu 23

<210> 1593

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1593

ugguuacaug aaaucccauc ccu 23

<210> 1594

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1594

uugguuacau gaaaucccau ccc 23

<210> 1595

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1595

uugguuacau gaaaucccau ccc 23

<210> 1596

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1596

cuugguuaca ugaaauccca ucc 23

<210> 1597

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1597

cuugguuaca ugaaauccca ucc 23

<210> 1598

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1598

ucuugguuac augaaauccc auc 23

<210> 1599

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1599

ucuugguuac augaaauccc auc 23

<210> 1600

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1600

cucuugguua caugaaaucc cau 23

<210> 1601

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1601

cucuugguua caugaaaucc cau 23

<210> 1602

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1602

acucuugguu acaugaaauc cca 23

<210> 1603

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1603

acucuugguu acaugaaauc cca 23

<210> 1604

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1604

uacucuuggu uacaugaaau ccc 23

<210> 1605

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1605

uacucuuggu uacaugaaau ccc 23

<210> 1606

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1606

auacucuugg uuacaugaaa ucc 23

<210> 1607

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1607

auacucuugg uuacaugaaa ucc 23

<210> 1608

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1608

aauacucuug guuacaugaa auc 23

<210> 1609

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1609

aauacucuug guuacaugaa auc 23

<210> 1610

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1610

gaauacucuu gguuacauga aau 23

<210> 1611

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1611

gaauacucuu gguuacauga aau 23

<210> 1612

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1612

ggaauacucu ugguuacaug aaa 23

<210> 1613

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1613

ggaauacucu ugguuacaug aaa 23

<210> 1614

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1614

uggaauacuc uugguuacau gaa 23

<210> 1615

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1615

uggaauacuc uugguuacau gaa 23

<210> 1616

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1616

auggaauacu cuugguuaca uga 23

<210> 1617

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1617

auggaauacu cuugguuaca uga 23

<210> 1618

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1618

aauggaauac ucuugguuac Aug 23

<210> 1619

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1619

aauggaauac ucuugguuac Aug 23

<210> 1620

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1620

aaauggaaua cucuugguua cau 23

<210> 1621

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1621

aaauggaaua cucuugguua cau 23

<210> 1622

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1622

aaaauggaau acucuugguu aca 23

<210> 1623

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1623

aaaauggaau acucuugguu aca 23

<210> 1624

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1624

aaaaauggaa uacucuuggu uac 23

<210> 1625

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1625

aaaaauggaa uacucuuggu uac 23

<210> 1626

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1626

uaaaaaugga auacucuugg uua 23

<210> 1627

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1627

uaaaaaugga auacucuugg uua 23

<210> 1628

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1628

guaaaaaugg aauacucuug guu 23

<210> 1629

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1629

guaaaaaugg aauacucuug guu 23

<210> 1630

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1630

aguaaaaaug gaauacucuu ggu 23

<210> 1631

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1631

aguaaaaaug gaauacucuu ggu 23

<210> 1632

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1632

uaguaaaaau ggaauacucu ugg 23

<210> 1633

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1633

uaguaaaaau ggaauacucu ugg 23

<210> 1634

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1634

uuaguaaaaa uggaauacuc uug 23

<210> 1635

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1635

uuaguaaaaa uggaauacuc uug 23

<210> 1636

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1636

uuuaguaaaa auggaauacu cuu 23

<210> 1637

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1637

uuuaguaaaa auggaauacu cuu 23

<210> 1638

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1638

cuuuaguaaa aauggaauac ucu 23

<210> 1639

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1639

cuuuaguaaa aauggaauac ucu 23

<210> 1640

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1640

gcuuuaguaa aaauggaaua cuc 23

<210> 1641

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1641

gcuuuaguaa aaauggaaua cuc 23

<210> 1642

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1642

ugcuuuagua aaaauggaau acu 23

<210> 1643

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1643

ugcuuuagua aaaauggaau acu 23

<210> 1644

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1644

cugcuuuagu aaaaauggaa uac 23

<210> 1645

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1645

cugcuuuagu aaaaauggaa uac 23

<210> 1646

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1646

acugcuuuag uaaaaaugga aua 23

<210> 1647

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1647

acugcuuuag uaaaaaugga aua 23

<210> 1648

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1648

cacugcuuua guaaaaaugg aau 23

<210> 1649

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1649

cacugcuuua guaaaaaugg aau 23

<210> 1650

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1650

acacugcuuu aguaaaaaug gaa 23

<210> 1651

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1651

acacugcuuu aguaaaaaug gaa 23

<210> 1652

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1652

aacacugcuu uaguaaaaau gga 23

<210> 1653

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1653

aacacugcuu uaguaaaaau gga 23

<210> 1654

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1654

aaacacugcu uuaguaaaaa ugg 23

<210> 1655

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1655

aaacacugcu uuaguaaaaa ugg 23

<210> 1656

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1656

aaaacacugc uuuaguaaaa Aug 23

<210> 1657

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1657

aaaacacugc uuuaguaaaa Aug 23

<210> 1658

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1658

gaaaacacug cuuuaguaaa aau 23

<210> 1659

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1659

gaaaacacug cuuuaguaaa aau 23

<210> 1660

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1660

ugaaaacacu gcuuuaguaa aaa 23

<210> 1661

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1661

ugaaaacacu gcuuuaguaa aaa 23

<210> 1662

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1662

gugaaaacac ugcuuuagua aaa 23

<210> 1663

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1663

gugaaaacac ugcuuuagua aaa 23

<210> 1664

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1664

ggugaaaaca cugcuuuagu aaa 23

<210> 1665

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1665

ggugaaaaca cugcuuuagu aaa 23

<210> 1666

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1666

aggugaaaac acugcuuuag uaa 23

<210> 1667

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1667

aggugaaaac acugcuuuag uaa 23

<210> 1668

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1668

gaggugaaaa cacugcuuua gua 23

<210> 1669

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1669

gaggugaaaa cacugcuuua gua 23

<210> 1670

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1670

ugaggugaaa acacugcuuu agu 23

<210> 1671

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1671

ugaggugaaa acacugcuuu agu 23

<210> 1672

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1672

augaggugaa aacacugcuu uag 23

<210> 1673

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1673

augaggugaa aacacugcuu uag 23

<210> 1674

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1674

uaugagguga aaacacugcu uua 23

<210> 1675

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1675

uaugagguga aaacacugcu uua 23

<210> 1676

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1676

auaugaggug aaaacacugc uuu 23

<210> 1677

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1677

auaugaggug aaaacacugc uuu 23

<210> 1678

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1678

cauaugaggu gaaaacacug cuu 23

<210> 1679

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1679

cauaugaggu gaaaacacug cuu 23

<210> 1680

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1680

gcauaugagg ugaaaacacu gcu 23

<210> 1681

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1681

gcauaugagg ugaaaacacu gcu 23

<210> 1682

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1682

agcauaugag gugaaaacac ugc 23

<210> 1683

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1683

agcauaugag gugaaaacac ugc 23

<210> 1684

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1684

uagcauauga ggugaaaaca cug 23

<210> 1685

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1685

uagcauauga ggugaaaaca cug 23

<210> 1686

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1686

auagcauaug aggugaaaac acu 23

<210> 1687

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1687

auagcauaug aggugaaaac acu 23

<210> 1688

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1688

cauagcauau gaggugaaaa cac 23

<210> 1689

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1689

cauagcauau gaggugaaaa cac 23

<210> 1690

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1690

acauagcaua ugaggugaaa aca 23

<210> 1691

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1691

acauagcaua ugaggugaaa aca 23

<210> 1692

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1692

aacauagcau augaggugaa aac 23

<210> 1693

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1693

aacauagcau augaggugaa aac 23

<210> 1694

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1694

uaacauagca uaugagguga aaa 23

<210> 1695

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1695

uaacauagca uaugagguga aaa 23

<210> 1696

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1696

cuaacauagc auaugaggug aaa 23

<210> 1697

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1697

cuaacauagc auaugaggug aaa 23

<210> 1698

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1698

ucuaacauag cauaugaggu gaa 23

<210> 1699

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1699

ucuaacauag cauaugaggu gaa 23

<210> 1700

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1700

uucuaacaua gcauaugagg uga 23

<210> 1701

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1701

uucuaacaua gcauaugagg uga 23

<210> 1702

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1702

cuucuaacau agcauaugag gug 23

<210> 1703

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1703

cuucuaacau agcauaugag gug 23

<210> 1704

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1704

acuucuaaca uagcauauga ggu 23

<210> 1705

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1705

acuucuaaca uagcauauga ggu 23

<210> 1706

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1706

gacuucuaac auagcauaug agg 23

<210> 1707

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1707

gacuucuaac auagcauaug agg 23

<210> 1708

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1708

ggacuucuaa cauagcauau gag 23

<210> 1709

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1709

ggacuucuaa cauagcauau gag 23

<210> 1710

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1710

uggacuucua acauagcaua uga 23

<210> 1711

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1711

uggacuucua acauagcaua uga 23

<210> 1712

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1712

cuggacuucu aacauagcau Aug 23

<210> 1713

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1713

cuggacuucu aacauagcau Aug 23

<210> 1714

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1714

ccuggacuuc uaacauagca uau 23

<210> 1715

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1715

ccuggacuuc uaacauagca uau 23

<210> 1716

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1716

gccuggacuu cuaacauagc aua 23

<210> 1717

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1717

gccuggacuu cuaacauagc aua 23

<210> 1718

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1718

ugccuggacu ucuaacauag cau 23

<210> 1719

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1719

ugccuggacu ucuaacauag cau 23

<210> 1720

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1720

cugccuggac uucuaacaua gca 23

<210> 1721

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1721

cugccuggac uucuaacaua gca 23

<210> 1722

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1722

ucugccugga cuucuaacau agc 23

<210> 1723

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1723

ucugccugga cuucuaacau agc 23

<210> 1724

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1724

cucugccugg acuucuaaca uag 23

<210> 1725

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1725

cucugccugg acuucuaaca uag 23

<210> 1726

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1726

ucucugccug gacuucuaac aua 23

<210> 1727

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1727

ucucugccug gacuucuaac aua 23

<210> 1728

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1728

gucucugccu ggacuucuaa cau 23

<210> 1729

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1729

gucucugccu ggacuucuaa cau 23

<210> 1730

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1730

ugucucugcc uggacuucua aca 23

<210> 1731

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1731

ugucucugcc uggacuucua aca 23

<210> 1732

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1732

uugucucugc cuggacuucu aac 23

<210> 1733

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1733

uugucucugc cuggacuucu aac 23

<210> 1734

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1734

augucucug ccuggacuuc uaa 23

<210> 1735

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1735

augucucug ccuggacuuc uaa 23

<210> 1736

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1736

uauugucucu gccuggacuu cua 23

<210> 1737

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1737

uauugucucu gccuggacuu cua 23

<210> 1738

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1738

uuauugucuc ugccuggacu ucu 23

<210> 1739

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1739

uuauugucuc ugccuggacu ucu 23

<210> 1740

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1740

uuuauugucu cugccuggac uuc 23

<210> 1741

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1741

uuuauugucu cugccuggac uuc 23

<210> 1742

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1742

uuuuauuguc ucugccugga cuu 23

<210> 1743

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1743

uuuuauuguc ucugccugga cuu 23

<210> 1744

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1744

guuuuauugu cucugccugg acu 23

<210> 1745

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1745

guuuuauugu cucugccugg acu 23

<210> 1746

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1746

uguuuuauug ucucugccug gac 23

<210> 1747

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1747

uguuuuauug ucucugccug gac 23

<210> 1748

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1748

auguuuuauu gucucugccu gga 23

<210> 1749

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1749

auguuuuauu gucucugccu gga 23

<210> 1750

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1750

aauguuuuau ugucucugcc ugg 23

<210> 1751

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1751

aauguuuuau ugucucugcc ugg 23

<210> 1752

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1752

gaauguuuua uugucucugc cug 23

<210> 1753

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1753

gaauguuuua uugucucugc cug 23

<210> 1754

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1754

ggaauguuuu augucucug ccu 23

<210> 1755

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1755

ggaauguuuu augucucug ccu 23

<210> 1756

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1756

aggaauguuu uauugucucu gcc 23

<210> 1757

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1757

aggaauguuu uauugucucu gcc 23

<210> 1758

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1758

caggaauguu uuauugucuc ugc 23

<210> 1759

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1759

caggaauguu uuauugucuc ugc 23

<210> 1760

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1760

acaggaaugu uuuauugucu cug 23

<210> 1761

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1761

acaggaaugu uuuauugucu cug 23

<210> 1762

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1762

cacaggaaug uuuuauuguc ucu 23

<210> 1763

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1763

cacaggaaug uuuuauuguc ucu 23

<210> 1764

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1764

ucacaggaau guuuuauugu cuc 23

<210> 1765

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1765

ucacaggaau guuuuauugu cuc 23

<210> 1766

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1766

uucacaggaa uguuuuauug ucu 23

<210> 1767

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1767

uucacaggaa uguuuuauug ucu 23

<210> 1768

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1768

uuucacagga auguuuuauu guc 23

<210> 1769

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1769

uuucacagga auguuuuauu guc 23

<210> 1770

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1770

cuuucacagg aauguuuuau ugu 23

<210> 1771

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1771

cuuucacagg aauguuuuau ugu 23

<210> 1772

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1772

ccuuucacag gaauguuuua uug 23

<210> 1773

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1773

ccuuucacag gaauguuuua uug 23

<210> 1774

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1774

gccuuucaca ggaauguuuu auu 23

<210> 1775

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1775

gccuuucaca ggaauguuuu auu 23

<210> 1776

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1776

ugccuuucac aggaauguuu uau 23

<210> 1777

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1777

ugccuuucac aggaauguuu uau 23

<210> 1778

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1778

gugccuuuca caggaauguu uua 23

<210> 1779

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1779

gugccuuuca caggaauguu uua 23

<210> 1780

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1780

agugccuuuc acaggaaugu uuu 23

<210> 1781

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1781

agugccuuuc acaggaaugu uuu 23

<210> 1782

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1782

aagugccuuu cacaggaaug uuu 23

<210> 1783

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1783

aagugccuuu cacaggaaug uuu 23

<210> 1784

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1784

aaagugccuu ucacaggaau guu 23

<210> 1785

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1785

aaagugccuu ucacaggaau guu 23

<210> 1786

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1786

aaaagugccu uucacaggaa ugu 23

<210> 1787

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1787

aaaagugccu uucacaggaa ugu 23

<210> 1788

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1788

gaaaagugcc uuucacagga Aug 23

<210> 1789

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1789

gaaaagugcc uuucacagga Aug 23

<210> 1790

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1790

ugaaaagugc cuuucacagg aau 23

<210> 1791

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1791

ugaaaagugc cuuucacagg aau 23

<210> 1792

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1792

augaaaagug ccuuucacag gaa 23

<210> 1793

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1793

augaaaagug ccuuucacag gaa 23

<210> 1794

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1794

aaugaaaagu gccuuucaca gga 23

<210> 1795

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1795

aaugaaaagu gccuuucaca gga 23

<210> 1796

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1796

gaaugaaaag ugccuuucac agg 23

<210> 1797

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1797

gaaugaaaag ugccuuucac agg 23

<210> 1798

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1798

ggaaugaaaa gugccuuuca cag 23

<210> 1799

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1799

ggaaugaaaa gugccuuuca cag 23

<210> 1800

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1800

uggaaugaaa agugccuuuc aca 23

<210> 1801

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1801

uggaaugaaa agugccuuuc aca 23

<210> 1802

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1802

guggaaugaa aagugccuuu cac 23

<210> 1803

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1803

guggaaugaa aagugccuuu cac 23

<210> 1804

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1804

aguggaauga aaagugccuu uca 23

<210> 1805

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1805

aguggaauga aaagugccuu uca 23

<210> 1806

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1806

aaguggaaug aaaagugccu uuc 23

<210> 1807

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1807

aaguggaaug aaaagugccu uuc 23

<210> 1808

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1808

aaaguggaau gaaaagugcc uuu 23

<210> 1809

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1809

aaaguggaau gaaaagugcc uuu 23

<210> 1810

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1810

uaaaguggaa ugaaaagugc cuu 23

<210> 1811

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1811

uaaaguggaa ugaaaagugc cuu 23

<210> 1812

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1812

uuaaagugga augaaaagug ccu 23

<210> 1813

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1813

uuaaagugga augaaaagug ccu 23

<210> 1814

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1814

guuaaagugg aaugaaaagu gcc 23

<210> 1815

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1815

guuaaagugg aaugaaaagu gcc 23

<210> 1816

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1816

aguuaaagug gaaugaaaag ugc 23

<210> 1817

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1817

aguuaaagug gaaugaaaag ugc 23

<210> 1818

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1818

aaguuaaagu ggaaugaaaa gug 23

<210> 1819

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1819

aaguuaaagu ggaaugaaaa gug 23

<210> 1820

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1820

caaguuaaag uggaaugaaa agu 23

<210> 1821

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1821

caaguuaaag uggaaugaaa agu 23

<210> 1822

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1822

ucaaguuaaa guggaaugaa aag 23

<210> 1823

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1823

ucaaguuaaa guggaaugaa aag 23

<210> 1824

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1824

aucaaguuaa aguggaauga aaa 23

<210> 1825

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1825

aucaaguuaa aguggaauga aaa 23

<210> 1826

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1826

aaucaaguua aaguggaaug aaa 23

<210> 1827

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1827

aaucaaguua aaguggaaug aaa 23

<210> 1828

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1828

aaaucaaguu aaaguggaau gaa 23

<210> 1829

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1829

aaaucaaguu aaaguggaau gaa 23

<210> 1830

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1830

aaaaucaagu uaaaguggaa uga 23

<210> 1831

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1831

aaaaucaagu uaaaguggaa uga 23

<210> 1832

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1832

aaaaaucaag uuaaagugga Aug 23

<210> 1833

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1833

aaaaaucaag uuaaagugga Aug 23

<210> 1834

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1834

aaaaaaucaa guuaaagugg aau 23

<210> 1835

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1835

aaaaaaucaa guuaaagugg aau 23

<210> 1836

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1836

uaaaaaauca aguuaaagug gaa 23

<210> 1837

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1837

uaaaaaauca aguuaaagug gaa 23

<210> 1838

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1838

uuaaaaaauc aaguuaaagu gga 23

<210> 1839

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1839

uuaaaaaauc aaguuaaagu gga 23

<210> 1840

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1840

uuuaaaaaau caaguuaaag ugg 23

<210> 1841

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1841

uuuaaaaaau caaguuaaag ugg 23

<210> 1842

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1842

auuuaaaaaa ucaaguuaaa gug 23

<210> 1843

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1843

auuuaaaaaa ucaaguuaaa gug 23

<210> 1844

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1844

aauuuaaaaa aucaaguuaa agu 23

<210> 1845

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1845

aauuuaaaaa aucaaguuaa agu 23

<210> 1846

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1846

gaauuuaaaa aaucaaguua aag 23

<210> 1847

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1847

gaauuuaaaa aaucaaguua aag 23

<210> 1848

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1848

ggaauuuaaa aaaucaaguu aaa 23

<210> 1849

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1849

ggaauuuaaa aaaucaaguu aaa 23

<210> 1850

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1850

gggaauuuaa aaaaucaagu uaa 23

<210> 1851

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1851

gggaauuuaa aaaaucaagu uaa 23

<210> 1852

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1852

agggaauuua aaaaaucaag uua 23

<210> 1853

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1853

agggaauuua aaaaaucaag uua 23

<210> 1854

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1854

aagggaauuu aaaaaaucaa guu 23

<210> 1855

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1855

aagggaauuu aaaaaaucaa guu 23

<210> 1856

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1856

uaagggaauu uaaaaaauca agu 23

<210> 1857

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1857

uaagggaauu uaaaaaauca agu 23

<210> 1858

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1858

aaaagggaau uuaaaaaauc aag 23

<210> 1859

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1859

aaaagggaau uuaaaaaauc aag 23

<210> 1860

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1860

aauaagggaa uuuaaaaaau caa 23

<210> 1861

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1861

aauaagggaa uuuaaaaaau caa 23

<210> 1862

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1862

caauaaggga auuuaaaaaa uca 23

<210> 1863

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1863

caauaaggga auuuaaaaaa uca 23

<210> 1864

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1864

acaauaaggg aauuuaaaaa auc 23

<210> 1865

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1865

acaauaaggg aauuuaaaaa auc 23

<210> 1866

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1866

gacaauaagg gaauuuaaaa aau 23

<210> 1867

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1867

gacaauaagg gaauuuaaaa aau 23

<210> 1868

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1868

ggacaauaag ggaauuuaaa aaa 23

<210> 1869

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1869

ggacaauaag ggaauuuaaa aaa 23

<210> 1870

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1870

gggacaauaa gggaauuuaa aaa 23

<210> 1871

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1871

gggacaauaa gggaauuuaa aaa 23

<210> 1872

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1872

agggacaaua agggaauuua aaa 23

<210> 1873

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1873

agggacaaua agggaauuua aaa 23

<210> 1874

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1874

aagggacaau aagggaauuu aaa 23

<210> 1875

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1875

aagggacaau aagggaauuu aaa 23

<210> 1876

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1876

gaagggacaa uaagggaauu uaa 23

<210> 1877

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1877

gaagggacaa uaagggaauu uaa 23

<210> 1878

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1878

ggaagggaca auaagggaau uua 23

<210> 1879

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1879

ggaagggaca auaagggaau uua 23

<210> 1880

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1880

uggaagggac aauaagggaa uuu 23

<210> 1881

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1881

uggaagggac aauaagggaa uuu 23

<210> 1882

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1882

uuggaaggga caauaaggga auu 23

<210> 1883

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1883

uuggaaggga caauaaggga auu 23

<210> 1884

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1884

uuuggaaggg acaauaaggg aau 23

<210> 1885

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1885

uuuggaaggg acaauaaggg aau 23

<210> 1886

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1886

uuuuggaagg gacaauaagg gaa 23

<210> 1887

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1887

uuuuggaagg gacaauaagg gaa 23

<210> 1888

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1888

uuuuuggaag ggacaauaag gga 23

<210> 1889

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1889

uuuuuggaag ggacaauaag gga 23

<210> 1890

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1890

uuuuuuggaa gggacaauaa ggg 23

<210> 1891

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1891

uuuuuuggaa gggacaauaa ggg 23

<210> 1892

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1892

uuuuuuugga agggacaaua agg 23

<210> 1893

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1893

uuuuuuugga agggacaaua agg 23

<210> 1894

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1894

uuuuuuuugg aagggacaau aag 23

<210> 1895

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1895

uuuuuuuugg aagggacaau aag 23

<210> 1896

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1896

cuuuuuuuug gaagggacaa uaa 23

<210> 1897

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1897

cuuuuuuuug gaagggacaa uaa 23

<210> 1898

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1898

ucuuuuuuuu ggaagggaca aua 23

<210> 1899

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1899

ucuuuuuuuu ggaagggaca aua 23

<210> 1900

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1900

cucuuuuuuu uggaagggac aau 23

<210> 1901

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1901

cucuuuuuuu uggaagggac aau 23

<210> 1902

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1902

ucucuuuuuu uuggaaggga caa 23

<210> 1903

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1903

ucucuuuuuu uuggaaggga caa 23

<210> 1904

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1904

uucucuuuuu uuuggaaggg aca 23

<210> 1905

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1905

uucucuuuuu uuuggaaggg aca 23

<210> 1906

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1906

auucucuuuu uuuuggaagg gac 23

<210> 1907

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1907

auucucuuuu uuuuggaagg gac 23

<210> 1908

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1908

gauucucuuu uuuuuggaag gga 23

<210> 1909

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1909

gauucucuuu uuuuuggaag gga 23

<210> 1910

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1910

ugauucucuu uuuuuuggaa ggg 23

<210> 1911

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1911

ugauucucuu uuuuuuggaa ggg 23

<210> 1912

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1912

uugauucucu uuuuuuugga agg 23

<210> 1913

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1913

uugauucucu uuuuuuugga agg 23

<210> 1914

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1914

uuugauucuc uuuuuuuugg aag 23

<210> 1915

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1915

uuugauucuc uuuuuuuugg aag 23

<210> 1916

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1916

uuuugauucu cuuuuuuuug gaa 23

<210> 1917

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1917

uuuugauucu cuuuuuuuug gaa 23

<210> 1918

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1918

auuuugauuc ucuuuuuuuu gga 23

<210> 1919

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1919

auuuugauuc ucuuuuuuuu gga 23

<210> 1920

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1920

aauuuugauu cucuuuuuuu ugg 23

<210> 1921

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1921

aauuuugauu cucuuuuuuu ugg 23

<210> 1922

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1922

aaauuuugau ucucuuuuuu uug 23

<210> 1923

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1923

aaauuuugau ucucuuuuuu uug 23

<210> 1924

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1924

aaaauuuuga uucucuuuuu uuu 23

<210> 1925

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1925

aaaauuuuga uucucuuuuu uuu 23

<210> 1926

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1926

uaaaauuuug auucucuuuu uuu 23

<210> 1927

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1927

uaaaauuuug auucucuuuu uuu 23

<210> 1928

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1928

guaaaauuuu gauucucuuu uuu 23

<210> 1929

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1929

guaaaauuuu gauucucuuu uuu 23

<210> 1930

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1930

uguaaaauuu ugauucucuu uuu 23

<210> 1931

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1931

uguaaaauuu ugauucucuu uuu 23

<210> 1932

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1932

uuguaaaauu uugauucucu uuu 23

<210> 1933

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1933

uuguaaaauu uugauucucu uuu 23

<210> 1934

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1934

uuuguaaaau uuugauucuc uuu 23

<210> 1935

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1935

uuuguaaaau uuugauucuc uuu 23

<210> 1936

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1936

cuuuguaaaa uuuugauucu cuu 23

<210> 1937

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1937

cuuuguaaaa uuuugauucu cuu 23

<210> 1938

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1938

ucuuuguaaa auuuugauuc ucu 23

<210> 1939

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1939

ucuuuguaaa auuuugauuc ucu 23

<210> 1940

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1940

uucuuuguaa aauuuugauu cuc 23

<210> 1941

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1941

uucuuuguaa aauuuugauu cuc 23

<210> 1942

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1942

auucuuugua aaauuuugau ucu 23

<210> 1943

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1943

auucuuugua aaauuuugau ucu 23

<210> 1944

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1944

gauucuuugu aaaauuuuga uuc 23

<210> 1945

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1945

gauucuuugu aaaauuuuga uuc 23

<210> 1946

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1946

ugauucuuug uaaaauuuug auu 23

<210> 1947

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1947

ugauucuuug uaaaauuuug auu 23

<210> 1948

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1948

uugauucuuu guaaaauuuu gau 23

<210> 1949

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1949

uugauucuuu guaaaauuuu gau 23

<210> 1950

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1950

uuugauucuu uguaaaauuu uga 23

<210> 1951

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1951

uuugauucuu uguaaaauuu uga 23

<210> 1952

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1952

cuuugauucu uuguaaaauu uug 23

<210> 1953

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1953

cuuugauucu uuguaaaauu uug 23

<210> 1954

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1954

ccuuugauuc uuuguaaaau uuu 23

<210> 1955

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1955

ccuuugauuc uuuguaaaau uuu 23

<210> 1956

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1956

uccuuugauu cuuuguaaaa uuu 23

<210> 1957

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1957

uccuuugauu cuuuguaaaa uuu 23

<210> 1958

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1958

uuccuuugau ucuuuguaaa auu 23

<210> 1959

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1959

uuccuuugau ucuuuguaaa auu 23

<210> 1960

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1960

auuccuuuga uucuuuguaa aau 23

<210> 1961

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1961

auuccuuuga uucuuuguaa aau 23

<210> 1962

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1962

aauuccuuug aaucuuugua aaa 23

<210> 1963

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1963

aauuccuuug aaucuuugua aaa 23

<210> 1964

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1964

gaauuccuuu gauucuuugu aaa 23

<210> 1965

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1965

gaauuccuuu gauucuuugu aaa 23

<210> 1966

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1966

agaauuccuu ugauucuuug uaa 23

<210> 1967

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1967

agaauuccuu ugauucuuug uaa 23

<210> 1968

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1968

uagaauuccu uugauucuuu gua 23

<210> 1969

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1969

uagaauuccu uugauucuuu gua 23

<210> 1970

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1970

cuagaauucc uuugauucuu ugu 23

<210> 1971

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1971

cuagaauucc uuugauucuu ugu 23

<210> 1972

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1972

ucuagaauuc cuuugauucu uug 23

<210> 1973

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1973

ucuagaauuc cuuugauucu uug 23

<210> 1974

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1974

uucuagaauu ccuuugauuc uuu 23

<210> 1975

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1975

uucuagaauu ccuuugauuc uuu 23

<210> 1976

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1976

uuucuagaau uccuuugauu cuu 23

<210> 1977

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1977

uuucuagaau uccuuugauu cuu 23

<210> 1978

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1978

cuuucuagaa uuccuuugau ucu 23

<210> 1979

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1979

cuuucuagaa uuccuuugau ucu 23

<210> 1980

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1980

acuuucuaga auuccuuuga uuc 23

<210> 1981

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1981

acuuucuaga auuccuuuga uuc 23

<210> 1982

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1982

uacuuucuag aauuccuuug auu 23

<210> 1983

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1983

uacuuucuag aauuccuuug auu 23

<210> 1984

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1984

auacuuucua gaauuccuuu gau 23

<210> 1985

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1985

auacuuucua gaauuccuuu gau 23

<210> 1986

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1986

gauacuuucu agaauuccuu uga 23

<210> 1987

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1987

gauacuuucu agaauuccuu uga 23

<210> 1988

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1988

agauacuuuc uagaauuccu uug 23

<210> 1989

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1989

agauacuuuc uagaauuccu uug 23

<210> 1990

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1990

cagauacuuu cuagaauucc uuu 23

<210> 1991

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1991

cagauacuuu cuagaauucc uuu 23

<210> 1992

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1992

ccagauacuu ucuagaauuc cuu 23

<210> 1993

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1993

ccagauacuu ucuagaauuc cuu 23

<210> 1994

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1994

cccagauacu uucuagaauu ccu 23

<210> 1995

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1995

cccagauacu uucuagaauu ccu 23

<210> 1996

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1996

gccccagauac uuucuagaau ucc 23

<210> 1997

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1997

gccccagauac uuucuagaau ucc 23

<210> 1998

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1998

ugcccagaua cuuucuagaa uuc 23

<210> 1999

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 1999

ugcccagaua cuuucuagaa uuc 23

<210> 2000

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2000

cugcccagau acuuucuaga auu 23

<210> 2001

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2001

cugcccagau acuuucuaga auu 23

<210> 2002

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2002

ucugcccaga uacuuucuag aau 23

<210> 2003

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2003

ucugcccaga uacuuucuag aau 23

<210> 2004

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2004

uucugcccag auacuuucua gaa 23

<210> 2005

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2005

uucugcccag auacuuucua gaa 23

<210> 2006

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2006

guucugccca gauacuuucu aga 23

<210> 2007

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2007

guucugccca gauacuuucu aga 23

<210> 2008

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2008

cguucugccc agauacuuuc uag 23

<210> 2009

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2009

cguucugccc agauacuuuc uag 23

<210> 2010

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2010

gcguucugcc cagauacuuu cua 23

<210> 2011

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2011

gcguucugcc cagauacuuu cua 23

<210> 2012

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2012

agcguucugc ccagauacuu ucu 23

<210> 2013

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2013

agcguucugc ccagauacuu ucu 23

<210> 2014

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2014

uagcguucug cccagauacu uuc 23

<210> 2015

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2015

uagcguucug cccagauacu uuc 23

<210> 2016

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2016

cuagcguucu gccagauac uuu 23

<210> 2017

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2017

cuagcguucu gccagauac uuu 23

<210> 2018

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2018

ccuagcguuc ugcccagaua cuu 23

<210> 2019

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2019

ccuagcguuc ugcccagaua cuu 23

<210> 2020

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2020

uccuagcguu cugcccagau acu 23

<210> 2021

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2021

uccuagcguu cugcccagau acu 23

<210> 2022

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2022

cuccuagcgu ucugcccaga uac 23

<210> 2023

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2023

cuccuagcgu ucugcccaga uac 23

<210> 2024

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2024

ucuccuagcg uucugcccag aua 23

<210> 2025

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2025

ucuccuagcg uucugcccag aua 23

<210> 2026

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2026

cucuccuagc guucugccca gau 23

<210> 2027

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2027

cucuccuagc guucugccca gau 23

<210> 2028

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2028

ucucuccuag cguucugccc aga 23

<210> 2029

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2029

ucucuccuag cguucugccc aga 23

<210> 2030

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2030

aucucuccua gcguucugcc cag 23

<210> 2031

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2031

aucucuccua gcguucugcc cag 23

<210> 2032

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2032

gaucucuccu agcguucugc cca 23

<210> 2033

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2033

gaucucuccu agcguucugc cca 23

<210> 2034

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2034

ggaucucucc uagcguucug ccc 23

<210> 2035

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2035

ggaucucucc uagcguucug ccc 23

<210> 2036

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2036

uggaucucuc cuagcguucu gcc 23

<210> 2037

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2037

uggaucucuc cuagcguucu gcc 23

<210> 2038

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2038

uuggaucucu ccuagcguuc ugc 23

<210> 2039

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2039

uuggaucucu ccuagcguuc ugc 23

<210> 2040

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2040

uuuggaucuc uccuagcguu cug 23

<210> 2041

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2041

uuuggaucuc uccuagcguu cug 23

<210> 2042

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2042

auuuggaucu cuccuagcgu ucu 23

<210> 2043

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2043

auuuggaucu cuccuagcgu ucu 23

<210> 2044

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2044

aauuuggauc ucuccuagcg uuc 23

<210> 2045

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2045

aauuuggauc ucuccuagcg uuc 23

<210> 2046

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2046

aaauuuggau cucuccuagc guu 23

<210> 2047

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2047

aaauuuggau cucuccuagc guu 23

<210> 2048

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2048

gaaauuugga ucucuccuag cgu 23

<210> 2049

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2049

gaaauuugga ucucuccuag cgu 23

<210> 2050

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2050

ggaaauuugg aucucuccua gcg 23

<210> 2051

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2051

ggaaauuugg aucucuccua gcg 23

<210> 2052

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2052

uggaaauuug gaucucuccu agc 23

<210> 2053

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2053

uggaaauuug gaucucuccu agc 23

<210> 2054

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2054

auggaaauuu ggaucucucc uag 23

<210> 2055

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2055

auggaaauuu ggaucucucc uag 23

<210> 2056

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2056

aauggaaauu uggaucucuc cua 23

<210> 2057

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2057

aauggaaauu uggaucucuc cua 23

<210> 2058

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2058

caauggaaau uuggaucucu ccu 23

<210> 2059

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2059

caauggaaau uuggaucucu ccu 23

<210> 2060

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2060

acaauggaaa uuuggaucuc ucc 23

<210> 2061

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2061

acaauggaaa uuuggaucuc ucc 23

<210> 2062

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2062

gacaauggaa auuuggaucu cuc 23

<210> 2063

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2063

gacaauggaa auuuggaucu cuc 23

<210> 2064

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2064

agacaaugga aauuuggauc ucu 23

<210> 2065

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2065

agacaaugga aauuuggauc ucu 23

<210> 2066

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2066

aagacaaugg aaauuuggau cuc 23

<210> 2067

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2067

aagacaaugg aaauuuggau cuc 23

<210> 2068

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2068

caagacaaug gaaauuugga ucu 23

<210> 2069

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2069

caagacaaug gaaauuugga ucu 23

<210> 2070

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2070

gcaagacaau ggaaauuugg auc 23

<210> 2071

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2071

gcaagacaau ggaaauuugg auc 23

<210> 2072

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2072

ugcaagacaa uggaaauuug gau 23

<210> 2073

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2073

ugcaagacaa uggaaauuug gau 23

<210> 2074

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2074

uugcaagaca auggaaauuu gga 23

<210> 2075

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2075

uugcaagaca auggaaauuu gga 23

<210> 2076

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2076

cuugcaagac aauggaaauu ugg 23

<210> 2077

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2077

cuugcaagac aauggaaauu ugg 23

<210> 2078

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2078

gcuugcaaga caauggaaau uug 23

<210> 2079

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2079

gcuugcaaga caauggaaau uug 23

<210> 2080

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2080

ugcuugcaag acaauggaaa uuu 23

<210> 2081

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2081

ugcuugcaag acaauggaaa uuu 23

<210> 2082

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2082

uugcuugcaa gacaauggaa auu 23

<210> 2083

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2083

uugcuugcaa gacaauggaa auu 23

<210> 2084

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2084

uuugcuugca agacaaugga aau 23

<210> 2085

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2085

uuugcuugca agacaaugga aau 23

<210> 2086

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2086

cuuugcuugc aagacaaugg aaa 23

<210> 2087

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2087

cuuugcuugc aagacaaugg aaa 23

<210> 2088

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2088

gcuuugcuug caagacaaug gaa 23

<210> 2089

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2089

gcuuugcuug caagacaaug gaa 23

<210> 2090

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2090

ugcuuugcuu gcaagacaau gga 23

<210> 2091

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2091

ugcuuugcuu gcaagacaau gga 23

<210> 2092

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2092

gugcuuugcu ugcaagacaa ugg 23

<210> 2093

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2093

gugcuuugcu ugcaagacaa ugg 23

<210> 2094

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2094

cgugcuuugc uugcaagaca Aug 23

<210> 2095

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2095

cgugcuuugc uugcaagaca Aug 23

<210> 2096

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2096

acgugcuuug cuugcaagac aau 23

<210> 2097

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2097

acgugcuuug cuugcaagac aau 23

<210> 2098

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2098

uacgugcuuu gcuugcaaga caa 23

<210> 2099

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2099

uacgugcuuu gcuugcaaga caa 23

<210> 2100

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2100

auacgugcuu ugcuugcaag aca 23

<210> 2101

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2101

auacgugcuu ugcuugcaag aca 23

<210> 2102

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2102

aauacgugcu uugcuugcaa gac 23

<210> 2103

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2103

aauacgugcu uugcuugcaa gac 23

<210> 2104

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2104

uaauacgugc uuugcuugca aga 23

<210> 2105

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2105

uaauacgugc uuugcuugca aga 23

<210> 2106

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2106

uuaauacgug cuuugcuugc aag 23

<210> 2107

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2107

uuaauacgug cuuugcuugc aag 23

<210> 2108

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2108

uuuauacgu gcuuugcuug caa 23

<210> 2109

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2109

uuuauacgu gcuuugcuug caa 23

<210> 2110

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2110

auuuaauacg ugcuuugcuu gca 23

<210> 2111

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2111

auuuaauacg ugcuuugcuu gca 23

<210> 2112

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2112

uauuuauac gugcuuugcu ugc 23

<210> 2113

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2113

uauuuauac gugcuuugcu ugc 23

<210> 2114

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2114

auauuuaaua cgugcuuugc uug 23

<210> 2115

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2115

auauuuaaua cgugcuuugc uug 23

<210> 2116

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2116

cauauuuaau acgugcuuug cuu 23

<210> 2117

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2117

cauauuuaau acgugcuuug cuu 23

<210> 2118

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2118

ucauauuuaa uacgugcuuu gcu 23

<210> 2119

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2119

ucauauuuaa uacgugcuuu gcu 23

<210> 2120

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2120

aucauauuua auacgugcuu ugc 23

<210> 2121

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2121

aucauauuua auacgugcuu ugc 23

<210> 2122

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2122

gaucauauuu aauacgugcu uug 23

<210> 2123

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2123

gaucauauuu aauacgugcu uug 23

<210> 2124

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2124

agaucauauu uauacgugc uuu 23

<210> 2125

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2125

agaucauauu uauacgugc uuu 23

<210> 2126

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2126

cagaucauau uuaauacgug cuu 23

<210> 2127

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2127

cagaucauau uuaauacgug cuu 23

<210> 2128

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2128

gcagaucaua uuuaauacgu gcu 23

<210> 2129

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2129

gcagaucaua uuuaauacgu gcu 23

<210> 2130

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2130

ugcagaucau auuuaauacg ugc 23

<210> 2131

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2131

ugcagaucau auuuaauacg ugc 23

<210> 2132

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2132

cugcagauca uauuuauac gug 23

<210> 2133

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2133

cugcagauca uauuuauac gug 23

<210> 2134

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2134

gcugcagauc auauuuaaua cgu 23

<210> 2135

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2135

gcugcagauc auauuuaaua cgu 23

<210> 2136

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2136

ggcugcagau cauauuuauau acg 23

<210> 2137

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2137

ggcugcagau cauauuuauau acg 23

<210> 2138

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2138

uggcugcaga ucauauuuaa uac 23

<210> 2139

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2139

uggcugcaga ucauauuuaa uac 23

<210> 2140

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2140

auggcugcag aucauauuua aua 23

<210> 2141

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2141

auggcugcag aucauauuua aua 23

<210> 2142

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2142

aauggcugca gaucauauuu aau 23

<210> 2143

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2143

aauggcugca gaucauauuu aau 23

<210> 2144

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2144

uaauggcugc agaucauauu uaa 23

<210> 2145

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2145

uaauggcugc agaucauauu uaa 23

<210> 2146

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2146

uuaauggcug cagaucauau uua 23

<210> 2147

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2147

uuaauggcug cagaucauau uua 23

<210> 2148

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2148

uuuaauggcu gcagaucaua uuu 23

<210> 2149

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2149

uuuaauggcu gcagaucaua uuu 23

<210> 2150

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2150

uuuuaauggc ugcagaucau auu 23

<210> 2151

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2151

uuuuaauggc ugcagaucau auu 23

<210> 2152

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2152

uuuuuaaugg cugcagauca uau 23

<210> 2153

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2153

uuuuuaaugg cugcagauca uau 23

<210> 2154

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2154

cuuuuuaaug gcugcagauc aua 23

<210> 2155

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2155

cuuuuuaaug gcugcagauc aua 23

<210> 2156

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2156

ucuuuuuaau ggcugcagau cau 23

<210> 2157

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2157

ucuuuuuaau ggcugcagau cau 23

<210> 2158

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2158

gucuuuuuaa uggcugcaga uca 23

<210> 2159

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2159

gucuuuuuaa uggcugcaga uca 23

<210> 2160

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2160

ugucuuuuua auggcugcag auc 23

<210> 2161

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2161

ugucuuuuua auggcugcag auc 23

<210> 2162

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2162

gugucuuuuu aauggcugca gau 23

<210> 2163

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2163

gugucuuuuu aauggcugca gau 23

<210> 2164

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2164

ugugucuuuu uaauggcugc aga 23

<210> 2165

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2165

ugugucuuuu uaauggcugc aga 23

<210> 2166

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2166

augugucuuu uuaauggcug cag 23

<210> 2167

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2167

augugucuuu uuaauggcug cag 23

<210> 2168

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2168

aaugugucuu uuuaauggcu gca 23

<210> 2169

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2169

aaugugucuu uuuaauggcu gca 23

<210> 2170

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2170

gaaugugucu uuuuaauggc ugc 23

<210> 2171

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2171

gaaugugucu uuuuaauggc ugc 23

<210> 2172

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2172

agaauguguc uuuuuaaugg cug 23

<210> 2173

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2173

agaauguguc uuuuuaaugg cug 23

<210> 2174

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2174

cagaaugugu cuuuuuaaug gcu 23

<210> 2175

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2175

cagaaugugu cuuuuuaaug gcu 23

<210> 2176

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2176

acagaaugug ucuuuuuaau ggc 23

<210> 2177

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2177

acagaaugug ucuuuuuaau ggc 23

<210> 2178

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2178

uacagaaugu gucuuuuuaa ugg 23

<210> 2179

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2179

uacagaaugu gucuuuuuaa ugg 23

<210> 2180

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2180

uuacagaaug ugucuuuuua Aug 23

<210> 2181

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2181

uuacagaaug ugucuuuuua Aug 23

<210> 2182

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2182

uuuacagaau gugucuuuuu aau 23

<210> 2183

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2183

uuuacagaau gugucuuuuu aau 23

<210> 2184

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2184

uuuuacagaa ugugucuuuu uaa 23

<210> 2185

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2185

uuuuacagaa ugugucuuuu uaa 23

<210> 2186

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2186

uuuuuacaga augugucuuu uua 23

<210> 2187

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2187

uuuuuacaga augugucuuu uua 23

<210> 2188

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2188

uuuuuuacag aaugugucuu uuu 23

<210> 2189

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2189

uuuuuuacag aaugugucuu uuu 23

<210> 2190

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2190

uuuuuuuaca gaaugugucu uuu 23

<210> 2191

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2191

uuuuuuuaca gaaugugucu uuu 23

<210> 2192

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2192

uuuuuuuuac agaauguguc uuu 23

<210> 2193

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2193

uuuuuuuuac agaauguguc uuu 23

<210> 2194

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2194

uuuuuuuuua cagaaugugu cuu 23

<210> 2195

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2195

uuuuuuuuua cagaaugugu cuu 23

<210> 2196

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2196

uuuuuuuuuu acagaaugug ucu 23

<210> 2197

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2197

uuuuuuuuuu acagaaugug ucu 23

<210> 2198

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2198

uuuuuuuuuu uacagaaugu guc 23

<210> 2199

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2199

uuuuuuuuuu uacagaaugu guc 23

<210> 2200

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2200

uuuuuuuuuu uuacagaaug ugu 23

<210> 2201

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2201

uuuuuuuuuu uuacagaaug ugu 23

<210> 2202

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 2202

cuuacgcuga guacuucgat t 21

<210> 2203

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<220>

<223> Description of the combined DNA/RNA molecule:

synthetic oligonucleotide

<400> 2203

ucgaagucuc agcguaagtt 20

<210> 2204

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2204

ggatgggatt tcatgtaacc aaga 24

<210> 2205

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2205

ttcatgtaac caagagtatt ccat 24

<210> 2206

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2206

auguaaccaa gaguauucca u 21

<210> 2207

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2207

auguaaccaa gaguauucca u 21

<210> 2208

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2208

auguaaccaa gaguauucca u 21

<210> 2209

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2209

ugggauuuca uguaaccaag a 21

<210> 2210

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2210

ugggauuuca uguaaccaag a 21

<210> 2211

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2211

ugggauuuca uguaaccaag a 21

<210> 2212

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2212

auggaauacu cuugguuaca uga 23

<210> 2213

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2213

auggaauacu cuugguuaca uga 23

<210> 2214

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2214

auggaauacu cuugguuaca uga 23

<210> 2215

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2215

ucuugguuac augaaauccc auc 23

<210> 2216

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2216

ucuugguuac augaaauccc auc 23

<210> 2217

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence:

synthetic oligonucleotide

<400> 2217

ucuugguuac augaaauccc auc 23

<---

Claims (83)

1. A double-stranded RNAi agent for inhibiting transthyretin (TTR) expression in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand contains the nucleotide sequence 5'-UGGGAUUUCAUGUAACCAAGA 3' (SEQ ID NO: 2211 ), and the antisense strand contains the nucleotide sequence 5'-UCUUGGUUACAUGAAAUCCCAUC-3' (SEQ ID NO: 2217); where essentially all nucleotides of the specified sense chain contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; where essentially all nucleotides of the specified antisense chain contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; And wherein the sense strand is conjugated to at least one ligand. 2. An RNAi agent according to claim 1, wherein all nucleotides of the sense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification. 3. An RNAi agent according to claim 1, wherein all nucleotides of the antisense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification. 4. The RNAi agent according to claim 1, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification. 5. The RNAi agent according to claim 1, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker. 6. An RNAi agent according to claim 1, wherein the ligand is 7. An RNAi agent according to claim 1, wherein the ligand is attached to the 3' end of the sense strand. 8. The RNAi agent according to claim 7, wherein the RNAi agent is conjugated to a ligand as shown in the following diagram where X represents O or S. 9. The RNAi agent according to claim 8, wherein the RNAi agent is conjugated to a ligand as shown in the following diagram 10. The RNAi agent according to claim 1, further comprising at least one thiophosphate or methylphosphonate internucleotide linkage. 11. The RNAi agent according to claim 10, wherein the thiophosphate or methylphosphonate internucleotide linkage is located at the 3' end of one strand. 12. The RNAi agent according to claim 11, wherein said strand is an antisense strand. 13. The RNAi agent according to claim 11, wherein said strand is a sense strand. 14. The RNAi agent according to claim 1, wherein the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair. 15. The RNAi agent according to claim 1, wherein the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long. 16. An RNAi agent according to claim 1, wherein the RNAi agent is selected from the group consisting of a means containing a sense strand that contains the nucleotide sequence 5'-UfgGfGfAfuUfuCfAfUfgUfaAfcCfAfAfgAf-3', and an antisense strand that contains the nucleotide sequence 5'-uCfuugGfuUfaCfaugAfaAfuccCfasUfsc-3'; And a means containing a sense strand that contains the nucleotide sequence 5'-UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAf-3', and an antisense strand that contains the nucleotide sequence 5'-uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3', where a, g, c and u represent 2'-O-methyl (2'-OMe) A, G, C and U, respectively; Af, Gf, Cf and Uf represent the 2'-fluorine of A, G, C and U, respectively; and s represents a phosphorothioate bond. 17. An RNAi agent according to claim 1, wherein the sense strand contains the nucleotide sequence 5'-UGGGAUUUCAUGUAACCAAGA 3' (SEQ ID NO: 2211), and the antisense strand contains the nucleotide sequence 5'-UCUUGGUUACAUGAAAUCCCAUC-3' (SEQ ID NO: 2217) ; where essentially all nucleotides of the specified sense chain contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; where essentially all nucleotides of the specified antisense chain contain a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; And wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent, as shown in the following diagram: , where X represents O. 18. A double-stranded RNAi agent for inhibiting the expression of transthyretin (TTR) in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region; where the sense strand contains the nucleotide sequence 5'–UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAf-3', and the antisense strand contains the nucleotide sequence 5'-uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3', where a, g, c and u represent 2'-O-methyl (2'-OMe) A, G, C and U, respectively; Af, Gf, Cf and Uf represent the 2'-fluorine of A, G, C and U, respectively; and s represents a phosphorothioate bond; And wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent, as shown in the following diagram: , where X represents O. 19. Pharmaceutical composition for inhibiting the expression of transthyretin (TTR), containing an RNAi agent according to any one of claims 1 to 18. 20. The pharmaceutical composition according to claim 19, wherein said RNAi agent is administered in an unbuffered solution. 21. The pharmaceutical composition according to claim 20, wherein said unbuffered solution is saline or water. 22. The pharmaceutical composition according to claim 19, wherein said RNAi agent is administered with a buffer solution. 23. The pharmaceutical composition according to claim 22, wherein said buffer solution contains acetate, citrate, prolamine, carbonate or phosphate or any combination thereof. 24. The pharmaceutical composition according to claim 23, wherein said buffer solution is phosphate buffered saline (PBS). 25. The pharmaceutical composition according to claim 19, wherein said pharmaceutical composition is a liposome. 26. The pharmaceutical composition according to claim 19, wherein said pharmaceutical composition is a lipid composition. 27. A method of inhibiting the expression of transthyretin (TTR) in a cell, comprising contacting said cell with an RNAi agent according to any one of claims 1 to 18 or a pharmaceutical composition according to any one of claims 19 to 26 in an amount effective to inhibit the expression of the said TTR in said cell, thereby inhibiting the expression of said transthyretin (TTR) in said cell. 28. The method of claim 27, wherein the expression of said TTR is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. 29. The method of claim 27, wherein said cell is contacted with said in vitro RNAi agent. 30. A method of treating or preventing a TTR-associated disease in an individual, comprising administering to said individual a therapeutically effective amount or a prophylactically effective amount of an RNAi agent according to any one of claims 1 to 18 or a pharmaceutical composition according to any one of claims 19 to 26, wherein, thereby treating or preventing said TTR-associated disease in said individual. 31. The method of claim 30, wherein TTR expression in a sample obtained from said individual is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40 %, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. 32. The method of claim 30, wherein said individual is a human. 33. The method of claim 30, wherein said individual is an individual suffering from a TTR-associated disease. 34. The method of claim 30, wherein said individual is an individual at risk of developing a TTR-associated disease. 35. The method of claim 30, wherein said individual carries a mutation in the TTR gene that is associated with the development of a TTR-associated disease. 36. The method of claim 30, wherein said TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal amyloidosis of the central nervous system (CNS) and hyperthyroxinemia. 37. The method of claim 30, wherein said individual suffers from TTR-associated amyloidosis, and said method reduces TTR amyloid deposition in said individual. 38. The method of claim 30, wherein said RNAi agent is administered to said individual by means of administration selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intra-arterial, lymphatic, cerebrospinal, and any combination thereof. 39. The method of claim 30, wherein said RNAi agent is administered to said individual via subcutaneous, intramuscular or intravenous administration. 40. The method of claim 39, wherein said subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot. 41. The method of claim 30, wherein said RNAi agent is administered to said individual such that said RNAi agent is delivered to a specific site in said individual. 42. The method according to claim 41, wherein said area is selected from the group consisting of the liver, choroid plexus, retina and pancreas. 43. The method according to claim 41, wherein said site is the liver. 44. The method of claim 41, wherein delivery of said RNAi agent is mediated by the asialoglycoprotein receptor (ASGP-R) contained in hepatocytes. 45. The method according to claim 30, where the specified RNAi agent is administered at a dose of 0.05-50 mg/kg. 46. The method of claim 30, wherein said RNAi agent is administered in two or more doses. 47. The method of claim 46, wherein said RNAi agent is administered at intervals selected from the group consisting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours and once every approximately 96 hours. 48. The method of claim 30, further comprising assessing the level of TTR mRNA expression or TTR protein expression in a sample obtained from the individual. 49. The method of claim 30, wherein administration of said RNAi agent does not induce an inflammatory response in said individual, as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL -12 (p70), IL1β, IL-1ra, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, TNFα and any combinations thereof, in a sample from the specified individual. 50. The method of claim 30, wherein said RNAi agent is administered using a pharmaceutical composition. 51. The method of claim 50, wherein said siRNA is administered in an unbuffered solution. 52. The method of claim 51, wherein said unbuffered solution is saline or water. 53. The method according to claim 50, where the specified siRNA is administered with a buffer solution. 54. The method of claim 53, wherein said buffer solution contains acetate, citrate, prolamine, carbonate or phosphate or any combination thereof. 55. The method of claim 54, wherein said buffer solution is phosphate buffered saline (PBS). 56. The method according to claim 50, wherein said pharmaceutical composition is a liposome. 57. A kit for carrying out the method according to claim 27, containing: a) said RNAi agent according to any one of claims 1 to 18 and b) instructions for use. 58. A set for performing the method according to claim 30, containing: a) said RNAi agent according to any one of claims 1 to 18, b) instructions for use and c) optionally, a means for administering said RNAi agent to said individual.

Images