NZ624336B2 - Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases - Google Patents

Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases Download PDF

Info

Publication number
NZ624336B2
NZ624336B2 NZ624336A NZ62433612A NZ624336B2 NZ 624336 B2 NZ624336 B2 NZ 624336B2 NZ 624336 A NZ624336 A NZ 624336A NZ 62433612 A NZ62433612 A NZ 62433612A NZ 624336 B2 NZ624336 B2 NZ 624336B2
Authority
NZ
New Zealand
Prior art keywords
rnai agent
ttr
nucleotides
strand
ligand
Prior art date
Application number
NZ624336A
Other versions
NZ624336A (en
Inventor
Klaus Charisse
Satyanarayana Kuchimanchi
Martin Maier
Muthiah Manoharan
Kallanthottathil G Rajeev
Tracy Zimmermann
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Priority claimed from PCT/US2012/065691 external-priority patent/WO2013075035A1/en
Publication of NZ624336A publication Critical patent/NZ624336A/en
Publication of NZ624336B2 publication Critical patent/NZ624336B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/343—Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521—Methyl
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533—Halogen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications

Abstract

Disclosed are double stranded RNAi agents comprising a sense strand complementary to an antisense strand, wherein said antisense strand comprises a sequence that is complementary to nucleotides 504 to 526 of the transthyretin (TTR) gene (SEQ ID NO:1), wherein the sense strand is 21 nucleotides in length and 5 the antisense strand is 23 nucleotides in length and wherein said RNAi agents comprise one or more motifs of three identical modifications on three consecutive nucleotides in one or both strands, including one such motif at or near the cleavage site of the agents. The invention also provides for the use of said RNAi agents for the manufacture of a medicament for treating a TTR-associated disease in a subject. ngth and 5 the antisense strand is 23 nucleotides in length and wherein said RNAi agents comprise one or more motifs of three identical modifications on three consecutive nucleotides in one or both strands, including one such motif at or near the cleavage site of the agents. The invention also provides for the use of said RNAi agents for the manufacture of a medicament for treating a TTR-associated disease in a subject.

Description

RNAi AGENTS, COMPOSITIONS AND METHODS OF USE THEREOF FOR NG TRANSTHYRETIN {TTR} ASSOCIATED DISEASES Related Applications This ation claims priority to US. Provisional Application No. 61/561,710, filed on November 18, 2011, US. Provisional Application No. 61/615,618, filed on March 26, 2012, and US. ional Application No. ,098, filed on August 6, 2012, the entire contents of each of which are hereby orated herein by reference. 10 Seguence Listing The instant application contains a Sequence Listing which has been submitted in ASCII format Via EFS—Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 13, 2012, is named 121301WO.txt and is 541,508 bytes in size. 15 Background of the Invention Transthyretin (TTR) (also known as prealbumin) is found in serum and cerebrospinal fluid (CSF). TTR transports retinol—binding protein (RBP) and thyroxine (T4) and also acts as a carrier of retinol (vitamin A) through its association with RBP in 20 the blood and the CSF. Transthyretin is named for its transport of thyroxine and retinol. TTR also functions as a protease and can cleave proteins including apoA-I (the major HDL apolipoprotein), amyloid B—peptide, and neuropeptide Y. See Liz, MA. et al. (2010) IUBMB Life, 62(6):429—435.
TTR is a tetramer of four identical 127—amino acid subunits (monomers) that are 25 rich in beta sheet structure. Each r has two 4—stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta—sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer—dimer ction. These two pairs of loops te the opposed, convex heets of the dimers to form an internal channel.
W0 2013,:‘075035 PCT/U82012/065691 The liver is the major site of TTR sion. Other significant sites of expression include the choroid plexus, retina (particularly the l pigment epithelium) and pancreas.
Transthyretin is one of at least 27 distinct types of proteins that is a precursor protein in the formation of amyloid fibrils. See Guan, J. et al. (Nov. 4, 2011) Current perspectives on c amyloidosis, Am J Physiol Heart Circ Physiol, doi:10.1 152/ajpheart.00815.2011. Extracellular deposition of amyloid fibrils in organs and tissues is the hallmark of amyloidosis. Amyloid fibrils are composed of misfolded protein aggregates, which may result from either excess production of or specific 10 mutations in precursor proteins. The amyloidogenic potential of TTR may be related to its extensive beta sheet structure; X—ray crystallographic studies indicate that n amyloidogenic mutations destabilize the tetrameric structure of the n. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12):1—1 1.
Amyloidosis is a general term for the group of amyloid diseases that are 15 characterized by amyloid deposits. Amyloid diseases are classified based on their precursor protein; for example, the name starts with “A” for amyloid and is followed by an iation of the precursor protein, e.g., ATTR for ogenic transthyretin.
Ibid.
There are numerous TTR—associated diseases, most of which are d 20 diseases. Normal—sequence TTR is associated with cardiac amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by microscopic deposits in many other organs. TTR amyloidosis sts in various forms. When the peripheral nervous system is affected more prominently, the disease is termed familial 25 amyloidotic polyneuropathy (FAP). When the heart is primarily involved but the s system is not, the e is called familial amyloidotic cardiomyopathy (FAC).
A third major type of TTR amyloidosis is leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or dosis VII form. Mutations in TTR may also cause amyloidotic 30 vitreous opacities, carpal tunnel syndrome, and euthyroid hyperthyroxinemia, which is a yloidotic disease thought to be secondary to an increased association of W0 2013,:‘075035 PCT/U82012/065691 ine with TTR due to a mutant TTR molecule with increased affinity for thyroxine.
See, e.g., Moses et al. (1982) J. Clin. Invest, 86, 2025-2033.
Abnormal amyloidogenic proteins may be either inherited or acquired through somatic mutations. Guan, J. et al. (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am J Physiol Heart Circ Physiol, doi:10.l152/ajpheart.00815.2011.
Transthyretin associated ATTR is the most nt form of hereditary systemic amyloidosis. Lobato, L. (2003) J. Nephrol., 16:438—442. TTR mutations accelerate the process of TTR amyloid formation and are the mo st important risk factor for the development of ATTR. More than 85 dogenic TTR variants are known to cause 10 systemic familial amyloidosis. TTR mutations usually give rise to systemic amyloid tion, with particular involvement of the peripheral nervous system, although some mutations are associated with myopathy or Vitreous opacities. Ibid.
The V30M mutation is the most prevalent TTR mutation. See, e.3., Lobato, L. (2003) J Nephrol, 16:438—442. The V1221 mutation is carried by 3.9% of the African 15 American population and is the most common cause of FAC. Jacobson, D.R. et al. (1997) N. Engl. J. Med. 336 (7): 466—73. It is estimated that SSA affects more than 25% of the population over age 80. Westermark, P. et al. (1990) Proc. Natl. Acad. Sci. USA. 87 (7): 2843—5.
Accordingly, there is a need in the art for effective treatments for TTR—associated 20 diseases.
Summary of the Invention The t invention provides RNAi agents, e. g., double stranded RNAi agents, targeting the Transthyretin (TTR) gene. The present ion also provides methods of 25 inhibiting expression of TTR and methods of treating or preventing a TTR—associated disease in a subject using the RNAi agents, e. g. double ed RNAi agents, of the ion. The present invention is based, at least in part, on the discovery that RNAi agents that comprise particular chemical cations show a superior ability to inhibit expression of TTR. Agents including a certain pattern of chemical modifications (e. 57., 30 an alternating pattern) and a ligand are shown herein to be effective in ing the activity of the TTR gene. Furthermore, agents including one or more motifs of three W0 2013.:‘075035 PCT/U82012/065691 identical cations on three consecutive nucleotides, including one such motif at or near the cleavage site of the agents, show surprisingly enhanced TTR gene silencing activity. When a single such chemical motif is present in the agent, it is red to be at or near the cleavage region for enhancing of the gene silencing ty. ge region is the region surrounding the cleavage site, i.e., the site on the target mRNA at which cleavage occurs.
Accordingly, in one aspect, the t invention features RNAi agents, e. g., double stranded RNAi agents, for inhibiting expression of a transthyretin (TTR). The double ed RNAi agent includes a sense strand complementary to an antisense 10 strand. The antisense strand includes a region complementary to a part of an mRNA encoding transthyretin. Each strand has 14 to 30 nucleotides, and the double ed RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X) i-Nb -Y Y Y -Nb -(Z Z Z)j —Na — nCl 3' antisense: 3' np'—Na'—(X'X’X’)k—Nb’—Y'Y’Y’—Nb’—(Z’Z’Z’)1—Na'— nq' 5' 15 (III).
In Formula III, i, j, k, and 1 are each independently 0 or 1; p, p’, q, and q' are each independently 0—6; each Na and Na’ independently represents an oligonucleotide sequence including 0—25 nucleotides which are either modified or unmodified or combinations thereof, each sequence including at least two differently ed 20 nucleotides; each Nb and Nb’ independently represents an oligonucleotide sequence including 0—10 nucleotides which are either modified or unmodified or combinations thereof; each np, np', nq, and nq’ independently represents an ng nucleotide; XXX, YYY, ZZZ, X’X'X', Y'Y'Y', and Z'Z'Z’ each independently represents one motif of three identical modifications on three consecutive nucleotides; modifications on Nb differ 25 from the modification on Y and modifications on Nb’ differ from the modification on Y’.
In some embodiments, the sense strand is conjugated to at least one ligand, e.g., at least one ligand, e.g., at least one ligand attached to the 3’ end of the sense strand. In other embodiments, the ligand may be conjugated to the antisense strand.
In some embodiments, i is l;j is 1; or both i andj are 1. 30 In some embodiments, k is 1; 1 is 1; or both k and 1 are 1.
In some embodiments, i is 0; j is 1.
In some embodiments, i is 1, j is 0.
In some embodiments, k is 0; l is 1.
In some embodiments, k is 1; l is 0. 2F"KGE?"?E<G>CE?FLK&"777"CK"=GEHD?E?FL;JO"LG"7P7P7P&"888"CK"-" =GEHD?E?FL;JO"LG"8P8P8P&";F>"999"CK"=GEHD?E?FL;JO"LG"9P9P9P(" In some embodiments, the YYY motif occurs at or near the cleavage site of the sense strand. 2F"KGE?"?E<G>CE?FLK&"LB?"8P8P8P"EGLC@"G==MJK";L"LB?"**&"*+";F>"*,"HGKCLCGFK"G@" 10 the antisense strand from the 5'-end. 2F"KGE?"?E<G>CE?FLK&"LB?"8P"CK"+P'5'E?LBOD(" In some embodiments, the Y’ is 2’-fluoro.
In another aspect, the present invention es a double stranded RNAi agent comprising a sense strand complementary to an antisense strand, n said antisense 15 strand ses a sequence that is complementary to nucleotides 504 to 526 of the transthyretin (TTR) gene (SEQ ID NO:1), wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, wherein said double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X)i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' npP'4aP'$7P7P7P%k-NbP'8P8P8P'4bP'$9P9P9P%l-NaP'"FqP"-#"+)" (III) wherein: j = 1; and i, k, and l are 0; p’ is 2; p, q, and q’ are 0; each Na and NaP"CF>?H?F>?FLDO"J?HJ?K?FLK";F"GDCAGFM=D?GLC>?"K?IM?F=?"+-" sing 2-10 nucleotides which are modified nucleotides; each Nb and NbP"CF>?H?F>?FLDO"J?HJ?K?FLK";F"GDCAGFM=D?GLC>?"K?IM?F=?" comprising 0-7 nucleotides which are ed nucleotides; 5 npP"J?HJ?K?FLK";F"GN?JB;FA"FM=D?GLC>?." " 888&"999&";F>"8P8P8P&"?;=B"CF>?H?F>?FLDO"J?HJ?K?FL"GF?"EGLC@"G@"LBJ??" identical modifications on three utive nucleotides, wherein the Y nucleotides contain a 2’-fluoro modification, the Y’ nucleotides contain a 2’-O-methyl modification, 5 and the Z nucleotides contain a 2’-O-methyl cation; and wherein the sense strand is ated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
In some embodiments, a (III) is represented as formula (IIIa): 10 sense: 5' np -Na -Y Y Y -Nb -Z Z Z -Na-nq 3' antisense: 3' npP'4aP'8P8P8P'4bP'9P9P9P'4aPFqP"-#"" (IIIa).
In formula IIIa, each Nb and Nb" independently represents an oligonucleotide sequence ing 1-5 ed nucleotides. 15 In some embodiments, formula (III) is represented as formula (IIIb): sense: 5' np-Na-X X X -Nb-Y Y Y -Na-nq 3' antisense: 3' npP'4aP'7P7P7P'4bP'8P8P8P'4aP'FqP"-#" (IIIb).
In formula IIIb each Nb and NbP"CF>?H?F>?FLDO"J?HJ?K?FLK";F"GDCAGFM=D?GLC>?"K?IM?F=?" 20 including 1-5 modified nucleotides. 5A W0 ‘075035 PCT/U82012/065691 In some embodiments, formula (III) is represented as formula (IIIc): sense: 5' np-Na-X X X -Nb-Y Y Y -Nb-Z Z Z -Na-ncl 3' antisense: 3' np’—Na'-X'X'X'-Nb’-Y’Y’Y’—Nb’—Z’Z’Z’—Na’—nq’ 5' (IIIc).
In formula IIIc, each Nb and —Nb’ independently represents an oligonucleotide sequence including 1—5 modified nucleotides and each Na and Na’ independently represents an oligonucleotide sequence including 2—10 modified nucleotides.
In many embodiments, the duplex region is 15—30 nucleotide pairs in length. In some embodiments, the duplex region is 17—23 nucleotide pairs in length, 17—25 10 nucleotide pairs in length, 23—27 nucleotide pairs in length, 19-21 nucleotide pairs in , or 21-23 tide pairs in length.
In certain embodiments, each strand has 15—30 nucleotides.
In some ments, the modifications on the nucleotides are selected from the group ting of LNA, HNA, CeNA, 2’—methoxyethyl, 2’—O—alkyl, 2’—O—allyl, 2’—C— 15 allyl, ro, 2’—deoxy, 2’—hydroxyl, and combinations thereof. In some preferred embodiments, the modifications on the nucleotides are 2’—O—methyl or 2’-fluoro.
In some embodiments, the ligand is one or more N—acetylgalactosamine (GalNAc) derivatives attached through a bivalent or trivalent branched linker. In particular embodiments, the ligand is OH HO 0 H H HO O\/\/\n/N\/\/N O AcHN o OH : HO O O HO o H H AcHN \/\/\n/ \/\/ \n/\/0%“ O O OH HO 0 AcHN 03I2 20 W0 20132'075035 PCT/U82012/065691 In some embodiments, the ligand is ed to the 3’ end of the sense strand.
In some embodiments, the RNAi agent is ated to the ligand as shown in the following schematic 3. ”ammo? O=P—X OH 0 N o o o o o HO$0WE’HN’V‘N o AcHN H wherein X is O or S.
In some embodiments, the RNAi agent is conjugated to the ligand as shown in the following schematic In some embodiments, the RNAi agent further includes at least one 10 phosphorothioate or methylphosphonate internucleotide linkage. In some embodiments, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3’—terminal of one strand. In some embodiments, the strand is the antisense strand. In other embodiments, the strand is the sense strand.
W0 ‘075035 PCT/U82012/065691 In certain embodiments, the base pair at the 1 position of the 5’—end of the duplex is an AU base pair.
In some embodiments, the Y nucleotides n a 2’—fluoro modification.
In some embodiments, the Y’ nucleotides contain a 2’—O—methyl modification.
In some embodiments, p’>0. In some such embodiments, each n is complementary to the target mRNA. In other such embodiments, each n is non— complementary to the target mRNA. In some embodiments, p, p’, q and q’ are l—6. In some preferred embodiments, p’ = l or 2. In some preferred embodiments, p’=2. In some such embodiments, q’=0, p20, q=0, and p’ overhang nucleotides are 10 complementary to the target mRNA. In other such ments, q’=0, p=0, q=0, and p’ overhang nucleotides are non—complementary to the target mRNA.
In some embodiments, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.
In certain embodiments, linkages between np’ include phosphorothioate linkages. 15 In some such embodiments, the linkages between np’ are phosphorothioate linkages.
In some embodiments, the RNAi agent is selected from the group of agents listed in Table 1.
In preferred embodiments, the RNAi agent is selected from the group consisting of AD—5 1544, AD-5 1545, AD—5 1546, and AD—51547. 20 In an even more preferred embodiment, the RNAi agent is 47 having the following structure: sense: 5 ’— UngfgAqufquAfogUfaachaAngfL96—3’ (SEQ ID NO:2) nse: 5’— quuUngfoUfaCfaugAfaAfquchasUfsc—3’ (SEQ ID 25 NO:3) wherein lowercase nucleotides (a, u, g, c) indicate 2’-O-methyl nucleotides; Nf (e.g., Af) indicates a 2’-fluoro nucleotide; s indicates a phosphothiorate linkage; L96 indicates a GalNAc3 ligand.
In another aspect, the present invention features a double stranded RNAi agent, 5 comprising a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence 5’-UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAfL96-3’ (SEQ ID NO:2) and the antisense strand comprises the nucleotide sequence 5’- uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3’ (SEQ ID NO:3), wherein a, g, c, and u ;J?"+P'5'E?LBOD"$+P'53?%"/&"1&"0&";F>"6.""/@&"1@&"0@&";F>"6@";J?"+P'@DMGJG"/&"1&"0&";F>" 10 U; s is a phosphorothioate e; and L96 is a GalNAc3 ligand.
In another aspect, the present invention features a cell containing the RNAi agent for inhibiting expression of TTR.
In a further aspect, the present invention features a pharmaceutical ition sing an RNAi agent for inhibiting expression of TTR. In some embodiments, the 15 pharmaceutical composition is a solution comprising the RNAi agent. In some embodiments, the solution sing the RNAi agent is an unbuffered solution, e.g., saline solution or water. In other embodiments, the solution is a buffered solution, e.g., a solution of phosphate buffered saline (PBS). In other embodiments, the pharmaceutical composition is a liposome or a lipid formulation. In some 20 embodiments, the lipid formulation comprises a XTC or MC3.
In yet another aspect, the t invention features methods of inhibiting expression of transthyretin (TTR) in a cell. The methods include contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to t expression of TTR in the cell, thereby inhibiting expression of TTR in the cell. 25 In some embodiments, the sion of TTR is ted by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.
In other ments, the cell is contacted in vitro with the RNAi agent. In other embodiments, the cell is present within a subject. In preferred embodiments, the 30 subject is a human.
In further embodiments, the subject is a subject suffering from a TTR-associated disease and the effective amount is a eutically effective amount. In other 9 embodiments, the subject is a subject at risk for developing a sociated disease and the effective amount is a prophylactically effective amount. In some embodiments, 9A W0 2013,:‘075035 PCT/U82012/065691 a subject at risk for develping a TTR—associated disease is a subject who carries a TTR gene mutation that is associated with the development of a sociated disease.
In certain embodiments, the TTR—associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic al amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.
In some embodiments, the t has a TTR—associated amyloidosis and the method reduces an amyloid TTR deposit in the subject.
In other embodiments, the RNAi agent is stered to the t by an 10 administration means selected from the group ting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, eritoneal, intraarterial, tic, cerebrospinal, and any combinations thereof. In certain embodiments, the RNAi agent is administered to the subject via subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to the subject via subcutaneous 15 administration. In some such embodiments, the subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot.
In certain embodiments, the RNAi agent is administered to the subject such that the RNAi agent is delivered to a specific site within the subject. In some embodiments, the site is selected from the group consisting of liver, choroid , retina, and 20 pancreas. In preferred embodiments, the site is the liver. In some embodiments, the delivery of the RNAi agent is mediated by asialoglycoprotein or (ASGP—R) present in hepatocytes.
In some embodiments, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, 6.57., between about 0.25 mg/kg to about 0.5 25 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 10 W0 2013,:‘075035 PCT/US2012/065691 30 mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.
In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 11 mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, 10 about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg. 15 In some ments, the RNAi agent is administered in two or more doses. In particular embodiments, the RNAi agent is administered at intervals selected from the group consisting of once every about 2 hours, once every about 3 hours, once every about 4 hours, once every about 6 hours, once every about 8 hours, once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, 20 once every about 96 hours, once every about 120 hours, once every about 144 hours, once every about 168 hours, once every about 240 hours, once every about 336 hours, once every about 504 hours, once every about 672 hours and once every about 720 hours.
In other embodiments, the method further includes assessing the level of TTR 25 mRNA expression or TTR protein expression in a sample d from the subject.
In red embodiments, administering the RNAi agent does not result in an inflammatory response in the subject as assessed based on the level of a cytokine or chemokine selected from the group ting of G—CSF, IFN—y, IL—10, IL—12 (p70), ILlB, IL—lra, IL—6, IL—8, IP—10, MCP—l, MIP—lot, MIP—lB, TNFa, and any combinations 30 thereof, in a sample from the subject. 11 W0 2013,:‘075035 PCT/U82012/065691 In some embodiments, the RNAi agent is administered using a pharmaceutical composition In preferred embodiments, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in water. In other ments, the siRNA is administered with a buffer solution, such as an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer or any ation thereof.
In some embodiments, the buffer solution is phosphate buffered saline (PBS).
In another embodiment, the pharmaceutical ition is a liposome or a lipid 10 formulation comprising SNALP or XTC. In one embodiment, the lipid formulation comprises an MC3.
In another aspect, the invention provides s of ng or preventing a TTR—associated disease in a subject. The methods e administering to the subject a therapeutically ive amount or prophylactically effective amount of an RNAi agent, 15 e. g., a double ed RNAi agent, thereby treating or preventing the TTR—associated disease in the subject.
In some embodiments, TTR expression in a sample derived from the subject is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% or at least about 70% at least about 80%, or 20 at least about 90%.
In some ments, the subject is a human.
In some embodiments, the subject is a subject suffering from a TTR—associated disease. In other embodiments, the subject is a subject at risk for developing a TTR— associated disease. 25 In some embodiments, the subject is a subject who carries s a TTR gene mutation that is associated with the development of a TTR—associated disease. 12 W0 ‘075035 PCT/U82012/065691 In certain embodiments, the sociated disease is ed from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic myopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.
In some embodiments, the subject has a TTR—associated amyloidosis and the method reduces an amyloid TTR deposit in the subject.
In some embodiments, the RNAi agent is stered to the t by an administration means selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, 10 cerebrospinal, and any combinations thereof. In certain ments, the RNAi agent is administered to the subject via subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to the subject via subcutaneous administration. In some such embodiments, the subcutaneous stration includes administration via a subcutaneous pump or subcutaneous depot. 15 In certain embodiments, the RNAi agent is administered to the subject such that the RNAi agent is delivered to a specific site within the subject. In some such embodiments, the site is selected from the group consisting of liver, d plexus, retina, and as. In preferred embodiments, the site is the liver. In some embodiments, the delivery of the RNAi agent is mediated by asialoglycoprotein receptor 20 (ASGP-R) present in hepatocytes.
In some embodiments, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, 6.57., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 25 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 30 mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg. 13 W0 2013,:‘075035 PCT/US2012/065691 In some embodiments, the RNAi agent is stered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 11 mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, 10 about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg.
In some embodiments, the RNAi agent is administered in two or more doses. In particular embodiments, the RNAi agent is administered at intervals selected from the group consisting of once every about 2 hours, once every about 3 hours, once every 15 about 4 hours, once every about 6 hours, once every about 8 hours, once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, once every about 96 hours, once every about 120 hours, once every about 144 hours, once every about 168 hours, once every about 240 hours, once every about 336 hours, once every about 504 hours, once every about 672 hours and once every about 720 20 hours.
In other embodiments, the method further includes assessing the level of TTR mRNA sion or TTR protein expression in a sample derived from the subject.
In preferred embodiments, administering the RNAi agent does not result in an inflammatory response in the subject as assessed based on the level of a cytokine or 25 chemokine selected from the group consisting of G—CSF, IFN—y, IL—10, IL—12 (p70), ILIB, IL—lra, IL—6, IL—8, IP—10, MCP—l, MIP—la, , TNFu, and any combinations thereof, in a sample from the subject.
In some embodiments, the RNAi agent is administered using a pharmaceutical ition, e.g., a liposome. 14 W0 2013,:‘075035 PCT/U82012/065691 In some embodiments, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in an unbuffered on. In one embodiment, the siRNA is administered in saline or water. In other embodiments, the siRNA is administred with a buffer solution, such as an acetate buffer, a citrate buffer, a ine , a carbonate buffer, or a phosphate buffer or any combination thereof.
In some embodiments, the buffer solution is phosphate buffered saline (PBS).
In another aspect, the present invention es a method of inhibiting expression of transthyretin (TTR) in a cell, including contacting a cell with an RNAi agent, e. g., a double stranded RNAi agent, in an amount effective to inhibit expression 10 of TTR in the cell. In one aspect, the double ed RNAi agent is ed from the group of agents listed in Table 1, thereby inhibiting expression of transthyretin (TTR) in the cell.
In r , the present invention provides a method of inhibiting expression of transthyretin (TTR) in a cell, including contacting a cell with an RNAi 15 agent, e. g., a double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell. In one aspect, the double stranded RNAi agent is selected from the group consisting of AD—51544, AD—51545, AD—S 1546, and AD—51547, thereby inhibiting expression of transthyretin (TTR) in the cell.
In a further aspect, the present invention provides a method of treating or 20 preventing a TTR-associated disease in a subject, including administering to the subject a therapeutically ive amount or a prophylactically effective amount of an RNAi agent, e. g., a double stranded RNAi agent. In one aspect, the double stranded RNAi agent is ed from the group of agents listed in Table 1, thereby treating or preventing a TTR—associated disease in the subject. 25 In yet another aspect, the present invention provides a method of treating or preventing a TTR—associated e in a subject, including administering to the subject a therapeutically effective amount or a prophylactically ive amount of an RNAi agent, e. g., a double stranded RNAi agent. In one aspect, the double stranded RNAi 15 W0 ‘075035 PCT/U82012/065691 agent is selected from the group consisting of AD—51544, 45, 46, and AD-51547, y treating or preventing a TTR-associated disease in the subject.
In further aspects, the invention provides kits for performing the methods of the invention. In one aspect, the invention provides a kit for performing a method of inhibiting expression of transthyretin (TTR) in a cell comprising contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of said TTR in said cell, thereby inhibiting the expression of TTR in the cell.
The kit comprises an RNAi agent and instructions for use and, optionally, means for administering the RNAi agent to the subject. 10 The present ion is further illustrated by the following detailed description and drawins.
Brief Description of the Drawings Figure 1 is a graph ing that administering to mice a single subcutaneous dose of a GalNAc—conjugated RNAi agent targeting TTR resulted in dose—dependent 15 suppression of TTR mRNA.
Figure 2 is a graph depicting that administering to mice a single subcutaneous dose of 7.5 mg/kg or 30 mg/kg of a GalNAc conjugated RNAi agent targeting TTR resulted in long lasting suppression of TTR mRNA.
Figure 3 depicts the human TTR mRNA sequence. 20 Figure 4 is a graph depicting ed silencing activity of RNAi agents modified relative to the parent AD—45163.
Figure 5 is a graph depicting improved silencing activity of RNAi agents modified relative to the parent AD—45165.
Figure 6 is a graph depicting improved free uptake ing following 4 hour 25 incubation with RNAi agents modified relative to the parent AD-45163. 16 W0 2013,:‘075035 PCT/U82012/065691 Figure 7 is a graph depicting improved free uptake silencing following 24 hour incubation with RNAi agents ed relative to the parent AD-45163.
Figure 8 is a graph depicting improved free uptake silencing following 4 hour incubation with RNAi agents modified relative to the parent AD—45165.
Figure 9 is a graph depicting improved free uptake silencing following 24 hour incubation with RNAi agents modified relative to the parent AD—45165.
Figure 10 is a graph depicting silencing of TTR mRNA in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of RNAi agents AD—51544, 45, AD—45163, AD—51546, AD-51547, or AD—45165. 10 Figure 11 is a graph depicting TTR protein suppression in transgenic mice that s hTTR V30M following administration of a single subcutaneous dose of 5 mg/kg or 1mg/kg of RNAi agents AD—51544, AD—51545, or AD—45163.
Figure 12 is a graph depicting TTR protein suppression in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of 5 mg/kg 15 or ling/kg of RNAi agents AD—51546, AD—51547, or AD—45165.
Figure 13 depicts the protocol for post—dose blood draws in s that ed kg RNAi agent (top line) or 1x25mg/kg RNAi agent (bottom line).
Figure 14 is a graph ing suppression of TTR protein in non-human es following subcutaneous administration of five 5 mg/kg doses (top panel) or a 20 single 25mg/kg dose (bottom panel) of AD—45163, AD—51544, AD—51545, AD-51546, or AD—51547.
Figure 15 is a graph ing suppression of TTR protein in non—human primates ing subcutaneous administration of AD—51547 at 2.5 mg/kg (white squares), 5 mg/kg (black squares) or 10 mg/kg (patterned squares) per dose, or 25 administration of PBS as a negative control (gray squares). 17 W0 2013,:‘075035 PCT/U82012/065691 Detailed Description of the Invention The present invention provides RNAi agents, e. g., double stranded RNAi agents, and compositions targeting the Transthyretin (TTR) gene. The t invention also provides s of ting expression of TTR and methods of treating or preventing a TTR—associated disease in a subject using the RNAi agents, e. g., double stranded RNAi agents, of the invention. The present invention is based, at least in part, on the discovery that RNAi agents that comprise particular chemical modifications show a or y to inhibit expression of TTR. Agents including a certain pattern of chemical modifications (e.g., an alternating n) and a ligand are shown herein to be 10 effective in silencing the activity of the TTR gene. Furthermore, agents including one or more motifs of three identical modifications on three consecutive nucleotides, including one such motif at or near the ge site of the agents, show surprisingly enhanced TTR gene silencing activity. When a single such chemical motif is present in the agent, it is preferred to be at or near the cleavage region for enhancing 0f the gene silencing 15 activity. Cleavage region is the region surrounding the cleavage site, i.e., the site on the target mRNA at which cleavage occurs. 1. tions As used herein, each of the following terms has the meaning associated with it in 20 this section.
The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not d to".
The term "or" is used herein to mean, and is used interchangeably with, the term "and/0r," unless context clearly tes otherwise. 25 As used herein, a “transthyretin” (“TTR”) refers to the well known gene and protein. TTR is also known as prealbumin, HsT2651, PALB, and TBPA. TTR functions as a transporter of retinol—binding protein (RBP), thyroxine (T4) and retinol, and it also acts as a se. The liver secretes TTR into the blood, and the choroid plexus secretes TTR into the cerebrospinal fluid. TTR is also expressed in the pancreas 30 and the retinal pigment epithelium. The greatest clinical relevance of TTR is that both 18 W0 2013,:‘075035 PCT/U82012/065691 normal and mutant TTR protein can form amyloid fibrils that aggregate into extracellular ts, causing amyloidosis. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12):1—ll for a review. The molecular cloning and nucleotide sequence of rat hyretin, as well as the distribution of mRNA expression, was described by Dickson, P.W. et a1. (1985) J. Biol. Chem. 260(13)8214—8219. The X— ray crystal ure of human TTR was described in Blake, C.C. et al. (1974) J Mol Biol 88, 1—12. The sequence of a human TTR mRNA ript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371.
The sequence of mouse TTR mRNA can be found at RefSeq accession number 10 NM_013697.2, and the sequence of rat TTR mRNA can be found at RefSeq accession number 681.1 As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a TTR gene, including mRNA that is a product of RNA processing of a primary transcription product. 15 As used herein, the term d comprising a sequence” refers to an ucleotide comprising a chain of tides that is described by the sequence referred to using the standard nucleotide nomenclature.
"G," "C," "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, tively. “T” and “dT” are used 20 interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g., deoxyribothymine, 2’—deoxythymidine or thymidine. However, it will be understood that the term “ribonucleotide” or “nucleotide” or “deoxyribonucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may 25 be replaced by other moieties without substantially ng the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, t limitation, a nucleotide comprising inosine as its base may base pair with tides ning adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention 30 by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are ments of the invention. 19 W0 2013,:‘075035 2012/065691 A “double stranded RNAi agent,” double—stranded RNA (dsRNA) molecule, also referred to as “dsRNA ” “dsRNA”, “siRNA”, “iRNA agent,” as used interchangeably herein, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti—parallel and substantially complementary, as defined below, c acid strands. In general, the majority of nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non—ribonucleotides, e.g. a deoxyribonucleotide and/or a modified , tide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial 10 modifications at multiple nucleotides. Such modifications may include all types of modifications sed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.
In r embodiment, the RNAi agent may be a single—stranded siRNA that is 15 introduced into a cell or organism to inhibit a target mRNA. Single—stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single—stranded siRNAs are generally 15—30 nucleotides and are chemically modified. The design and testing of single—stranded siRNAs are described in US. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150: 883—894, the entire contents of each 20 of which are hereby incorporated herein by reference. Any of the antisense tide sequences described herein may be used as a single—stranded siRNA as described herein or as chemically modified by the methods bed in Lima er al, (2012) Cell 150;:883—894.
The two strands forming the duplex ure may be different portions of one 25 larger RNA le, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an rrupted chain of nucleotides n the 3’—end of one strand and the 5’—end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” Where the two strands are connected covalently by means other than an 30 uninterrupted chain of nucleotides between the 3’—end of one strand and the 5’—end of 20 W0 ‘075035 PCT/U82012/065691 the respective other strand forming the duplex structure, the connecting structure is ed to as a “linker.” The RNA strands may have the same or a ent number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi agent may comprise one or more nucleotide overhangs. The term ” is also used herein to refer to an RNAi agent as described above.
In another aspect, the agent is a —stranded antisense RNA molecule. An antisense RNA molecule is complementary to a sequence within the target mRNA. 10 Antisense RNA can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically cting the ation machinery, see Dias, N. et al., (2002) M0! Cancer Ther 1:347—355. The antisense RNA molecule may have about 15-30 nucleotides that are complementary to the target mRNA. For example, the antisense RNA molecule may have a sequence of at least 15, l6, 17, 18, 19, 20 or more 15 contiguous nucleotides from one of the antisense sequences of Table 1.
As used herein, a “nucleotide overhang” refers to the unpaired nucleotide or nucleotides that protrude from the duplex ure of an RNAi agent when a 3'—end of one strand of the RNAi agent extends beyond the 5'—end of the other strand, or vice versa. “Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of 20 the double stranded RNAi agent, i.e., no nucleotide overhang. A “blunt ended” RNAi agent is a dsRNA that is double—stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule. The RNAi agents of the ion include RNAi agents with nucleotide overhangs at one end (i. (3., agents with one overhang and one blunt end) or with tide overhangs at both ends. 25 The term “antisense strand” refers to the strand of a double stranded RNAi agent which includes a region that is substantially complementary to a target sequence (e.g. a , human TTR mRNA). As used herein, the term “region complementary to part of an mRNA encoding transthyretin” refers to a region on the antisense strand that is substantially complementary to part of a TTR mRNA sequence. Where the region of 30 complementarity is not fully complementary to the target sequence, the mismatches are 21 W0 2013,:‘075035 PCT/U82012/065691 most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5’ and/or 3’ terminus.
The term “sense strand,” as used , refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.
As used , the term “cleavage region” refers to a region that is located ately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and 10 immediately adjacent to, the cleavage site. In some embodiments, the ge site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides ll, 12 and 13.
As used , and unless otherwise ted, the term “complementary,” when used to describe a first nucleotide sequence in on to a second nucleotide sequence, 15 refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may e: 400 mM NaCl, 40 mM PIPES pH 20 6.4, 1 mM EDTA, 50°C or 70°C for 12—16 hours followed by g. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two ces in accordance with the te application of the hybridized nucleotides. 25 Sequences can be “fully complementary” with respect to each when there is base—pairing of the nucleotides of the first nucleotide sequence with the nucleotides of the second nucleotide sequence over the entire length of the first and second nucleotide sequences. However, where a first ce is referred to as “substantially complementary” with respect to a second sequence herein, the two ces can be 30 fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize 22 W0 ‘075035 PCT/U82012/065691 under the conditions most relevant to their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one ucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 tides that is fully complementary to the r oligonucleotide, may yet be referred to as “fully complementary” for the es described herein.
“Complementary” sequences, as used herein, may also include, or be formed 10 entirely from, non—Watson—Crick base pairs and/or base pairs formed from non—natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are led. Such non-Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.
The terms “complementary,” “fully complementary” and “substantially 15 complementary” herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.
As used herein, a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially 20 complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding TTR) including a 5’ UTR, an open g frame (ORF), or a 3’ UTR. For example, a polynucleotide is complementary to at least a part of a TTR mRNA if the sequence is substantially complementary to a non—interrupted portion of an mRNA encoding TTR. 25 The term iting,” as used herein, is used hangeably with “reducing,” “silencing,” “downregulating,77 4‘suppressing” and other similar terms, and includes any level of tion.
The phrase “inhibiting sion of a TTR,” as used herein, includes inhibition of expression of any TTR gene (such as, 6.57., a mouse TTR gene, a rat TTR gene, a 30 monkey TTR gene, or a human TTR gene) as well as variants or mutants of a TTR gene.
Thus, the TTR gene may be a wild—type TTR gene, a mutant TTR gene (such as a 23 W0 2013.:‘075035 PCT/US2012/065691 mutant TTR gene giving rise to systemic amyloid deposition), or a transgenic TTR gene in the context of a genetically manipulated cell, group of cells, or organism.
“Inhibiting sion of a TTR gene” includes any level of inhibition of a TTR gene, e.g., at least partial suppression of the expression of a TTR gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at 10 least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
The expression of a TTR gene may be assessed based on the level of any variable associated with TTR gene expression, e.g., TTR mRNA level, TTR protein level, l binding n level, vitamin A level, or the number or extent of amyloid 15 deposits. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre—dose baseline level, or a level ined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only l or inactive agent control). 20 The phrase cting a cell with an RNAi agent,” as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent, e. g., a double stranded RNAi agent, includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the 25 cell by the individual performing the , or alternatively, the RNAi agent may be put into a ion that will permit or cause it to subsequently come into contact with the cell.
Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in viva may be done, for example, by injecting the 30 RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the 24 W0 2013,:‘075035 PCT/U82012/065691 agent will subsequently reach the tissue where the cell to be ted is located. For example, the RNAi agent may contain and/or be coupled to a , e.g., a GalNA03 ligand, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in viva methods of contacting are also possible. In tion with the methods of the invention, a cell might also be ted in vitro with an RNAi agent and subsequently transplanted into a subject.
A "patient" or "subject," as used herein, is intended to e either a human or non—human animal, preferably a mammal, 6.57., a . Most preferably, the subject or t is a human. 10 A “TTR—associated disease,” as used herein, is ed to include any disease associated with the TTR gene or protein. Such a disease may be caused, for example, by excess production of the TTR protein, by TTR gene ons, by abnormal cleavage of the TTR protein, by abnormal interactions between TTR and other proteins or other endogenous or ous substances. A “TTR—associated disease” includes any type of 15 TTR amyloidosis (ATTR) wherein TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits. TTR—associated diseases include senile systemic amyloidosis (SSA), systemic familial dosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, amyloidotic Vitreous 20 opacities, carpal tunnel syndrome, and hyperthyroxinemia. Symptoms of TTR amyloidosis include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, 25 Vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy.
"Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a patient for treating a TTR associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, 30 rating or maintaining the existing disease or one or more symptoms of disease).
The "therapeutically effective amount" may vary depending on the RNAi agent, how the 25 W0 2013.:‘075035 PCT/U82012/065691 agent is administered, the e and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by TTR expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
“Prophylactically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject who does not yet experience or display symptoms of a TTR—associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Symptoms that may be ameliorated include sensory 10 neuropathy (e.g., paresthesia, hypesthesia in distal limbs), mic neuropathy (e.g., gastrointestinal dysfunction, such as c ulcer, or orthostatic nsion), motor neuropathy, seizures, dementia, athy, uropathy, carpal tunnel me, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, ntially reduced mBMI (modified Body Mass Index), cranial nerve 15 dysfunction, and corneal e phy. rating the disease includes slowing the course of the disease or reducing the severity of later—developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and 20 other individual characteristics of the patient to be treated.
A "therapeutically—effective amount" or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. RNAi gents employed in the methods of the present invention may be administered in a sufficient 25 amount to produce a reasonable benefit/risk ratio applicable to such treatment.
The term “sample,” as used herein, includes a collection of similar fluids, cells, or s isolated from a t, as well as fluids, cells, or s present within a subject. es of biological fluids include blood, serum and serosal fluids, plasma, ospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may 30 include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In 26 certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or n types of cells in the liver, such as, e.g., hepatocytes), the retina or parts of the retina (e.g., retinal pigment epithelium), the central nervous system or parts of the central nervous system (e.g., ventricles or choroid plexus), or the 5 pancreas or certain cells or parts of the pancreas. In some embodiments, a “sample derived from a subject” refers tocerebrospinal fluid obtained from the subject. In preferred embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a “sample derived from a t” refers to liver tissue (or subcomponents thereof) or retinal tissue (or subcomponents 10 f) derived from the subject.
Throughout this specification the word ise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. 15 Any discussion of documents, acts, materials, devices, articles or the like which has been included in the t specification is not to be taken as an admission that any or all of these s form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the ty date of each claim of this ation. 20 II. RNAi Agents The present invention provides RNAi agents with superior gene silencing activity. It is shown herein and in Provisional Application No. 61/561,710 (to which the present application claims priority) that a superior result may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides 25 into a sense strand and/or antisense strand of a RNAi agent, particularly at or near the cleavage site. The sense strand and antisense strand of the RNAi agent may ise be completely ed. The introduction of these motifs interrupts the modification pattern, if present, of the sense and/or antisense strand. The RNAi agent also optionally conjugates with a GalNAc derivative , for instance on the sense strand. The 30 resulting RNAi agents present superior gene ing activity.
The inventors surprisingly discovered that when the sense strand and antisense strand of the RNAi agent are completely modified, having one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at 27 least one strand of a RNAi agent superiorly enhanced the gene silencing acitivity of the RNAi agent.
Accordingly, the invention es RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of a target gene (i.e., a TTR gene) in vivo. 5 The RNAi agent comprises a sense strand and an antisense strand. Each strand of the 27A W0 2013,:‘075035 PCT/U82012/065691 RNAi agent can range from 12—30 nucleotides in . For example, each strand can be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27—30 nucleotides in length, 17—23 nucleotides in length, 17—21 nucleotides in length, 17—19 nucleotides in length, 19—25 nucleotides in length, 19—23 nucleotides in length, 19—21 nucleotides in length, 21—25 nucleotides in length, or 21—23 nucleotides in length.
The sense strand and antisense strand typically form a duplex double stranded RNA A”), also ed to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 12—30 nucleotide pairs in length. For example, the duplex region 10 can be between 14—30 nucleotide pairs in length, 17—30 nucleotide pairs in length, 27—30 nucleotide pairs in length, 17 — 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 tide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19— 21 nucleotide pairs in length, 21—25 nucleotide pairs in , or 21—23 nucleotide pairs in length. In another e, the duplex region is 15 selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27.
In one embodiment, the RNAi agent may n one or more overhang regions and/or capping groups of RNAi agent at , or 5’—end or both ends of a strand. The overhang can be 1—6 nucleotides in length, for instance 2—6 nucleotides in length, 1—5 nucleotides in length, 2—5 nucleotides in length, 1—4 nucleotides in , 2—4 20 nucleotides in length, 1—3 nucleotides in length, 2—3 nucleotides in length, or 1—2 nucleotides in length. The ngs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene ces being targeted or can be other sequence. The first and second strands can also 25 be joined, e.g., by additional bases to form a hairpin, or by other non—base linkers.
The RNAi agents provided by the present invention include agents with chemical modifications as disclosed, for example, in US. ional Application No. 61/561,710, filed on November 18, 2011, International Application No.
PCT/US2011/051597, filed on September 15, 2010, and PCT Publication WO 30 2009/073809, the entire contents of each of which are incorporated herein by reference. 28 W0 2013,:‘075035 PCT/U82012/065691 In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified tide including, but no limited to 2’—sugar ed, such as, 2—F, 2’—O—methyl, ine (T), 2‘—O—methoxyethyl—5— methyluridine (Teo), 2‘—O—methoxyethyladenosine (Aeo), 2‘—O—methoxyethy1—5— methylcytidine (mSCeo), and any combinations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.
The 5’— or 3’— overhangs at the sense strand, antisense strand or both strands of 10 the RNAi agent may be orylated. In some ments, the ng region contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one ment, the overhang is present at the 3’-end of the sense strand, antisense strand or both s. In one embodiment, this 3’—overhang is present in the antisense strand. In one embodiment, 15 this 3’—overhang is present in the sense strand.
The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang is located at the 3'—terminal end of the sense strand or, atively, at the 3'—terminal end of the antisense strand. The RNAi may also have a 20 blunt end, located at the 5’—end of the antisense strand (or the 3’-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3’-end, and the 5’-end is blunt. While the Applicants are not bound by theory, the theoretical mechanism is that the asymmetric blunt end at the 5’—end of the antisense strand and 3’—end overhang of the antisense strand favor the guide strand loading into 25 RISC s.
In one embodiment, the RNAi agent is a double ended bluntmer of 19 nt in length, wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive nucleotides at positions 7,8,9 from the 5’end. The antisense strand contains at least one motif of three 2’—O—methyl modifications on three utive 30 nucleotides at positions 11, 12, 13 from the S’end. 29 W0 2013,:‘075035 2012/065691 In one embodiment, the RNAi agent is a double ended bluntmer of 20 nt in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 8,9,10 from the S’end. The antisense strand contains at least one motif of three 2’—O—methyl modifications on three consecutive nucleotides at ons 11, 12, 13 from the 5’end.
In one embodiment, the RNAi agent is a double ended bluntmer of 21 nt in length, wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end. The antisense strand contains at least one motif of three 2’—O—methyl modifications on three 10 consecutive nucleotides at positions 11, 12, 13 from the 5’end.
In one embodiment, the RNAi agent comprises a 21 nucleotides (nt) sense strand and a 23 tides (nt) antisense strand, wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive tides at positions 9,10,11 from the 5’end; the nse strand contains at least one motif of three 2’—O—methyl 15 modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nt overhang. Preferably, the 2 nt overhang is at the 3’—end of the antisense. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc3).
In one embodiment, the RNAi agent ses a sense and an antisense strand, 20 wherein the sense strand is 25—30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1— 23 of sense strand to form a duplex; wherein at least 25 the 3 ' al nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are ed with sense strand, y forming a 3' single stranded overhang of 1—6 tides; wherein the 5' terminus of antisense strand comprises from 10—30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10—30 nucleotide single stranded 5' overhang; n at least the 30 sense strand 5' terminal and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum 30 W0 2013,:‘075035 PCT/U82012/065691 complementarity, thereby forming a ntially duplexed region between sense and antisense strands; and nse strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2’—F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2’—O—methyl modifications on three consecutive nucleotides at or near the cleavage site.
In one embodiment, the RNAi agent comprises sense and antisense strands, 10 wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 tides with at least one motif of three 2’-O-methy1 modifications on three consecutive nucleotides at on 11,12,13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 15 1—4 tides longer at its 3’ end than the first strand, n the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 nt of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3’ end of 20 the second strand, thereby reducing expression of the target gene in the mammal.
Optionally, the RNAi agent further comprises a .
In one embodiment, the sense strand of the RNAi agent ns at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand. 25 In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand For RNAi agent having a duplex region of 17—23 nt in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 ons from the 5 ’—end. 30 Thus, the motifs of three identical modifications may occur at the 9, 10, 11 ons; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the 31 W0 2013,:‘075035 PCT/U82012/065691 antisense strand, the count starting from the 1St nucleotide from the 5’—end of the nse strand, or, the count starting from the 1St paired nucleotide within the duplex region from the 5’— end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5’— end.
The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the ge site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. 10 When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i. e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the 15 antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.
In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif should occur at or near the cleavage site of the strand and the other motifs may be 20 wing modifications. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing cation is either adaj acent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other than the chemistry of the motifs are ct from each other and when 25 the motifs are ted by one or more nucleotide than the chemistries can be the same or different. Two or more wing cations may be present. For instance, when two wing modifications are t, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
Like the sense strand, the antisense strand of the RNAi agent may contain at least 30 two motifs of three identical modifications on three utive nucleotides, with at least one of the motifs occurring at or near the ge site of the strand. This antisense 32 W0 2013,:‘075035 2012/065691 strand may also contain one or more wing modifications in an alignment similar to the wing modifications that is t on the sense strand.
In one ment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3’—end, 5’—end or both ends of the strand.
In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3’—end, 5’—end or both ends of the strand.
When the sense strand and the antisense strand of the RNAi agent each contain at 10 least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having 15 an overlap of one, two or three tides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three tides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.
In one embodiment, every nucleotide in the sense strand and antisense strand of 20 the RNAi agent, including the nucleotides that are part of the motifs, may be modified.
Each nucleotide may be modified with the same or different cation which can include one or more tion of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar; wholesale replacement of the 25 phosphate moiety with “dephospho” linkers; modification or replacement of a naturally ing base; and replacement or modification of the ribose—phosphate backbone.
As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, 6.57., a modification of a base, or a phosphate moiety, or a non—linking O of a phosphate moiety. In some cases the 30 modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ 33 W0 2013,:‘075035 PCT/U82012/065691 terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand , or in both. A cation may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. For example, a phosphorothioate modification at a non—linking 0 position may only occur at one or both termini, may only occur in a terminal , e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini.
The 5’ end or ends can be phosphorylated. 10 It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to e modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a cation described herein. 15 Modifications can include, 6.57., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, or 2’—O—methyl modified instead of the ribosugar of the , 2’—deoxy—2’—fluoro (2’—F) nucleobase and modifications in the ate group, e.g., phosphorothioate , modifications. Overhangs need not be gous with the target sequence. 20 In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’- yl, 2’-O- allyl, 2’—C— allyl, 2’-deoxy, 2’—hydroxyl, or 2’—fluoro. The s can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2’— O—methyl or 2’—fluoro. 25 At least two different modifications are lly present on the sense strand and antisense strand. Those two modifications may be the 2’— O—methyl or 2’—fluoro modifications, or others.
In one embodiment, the Na and/or Nb comprise modifications of an alternating pattern. The term “alternating motif” as used herein refers to a motif having one or more 30 modifications, each modification occurring on alternating tides of one strand. The 34 W0 2013,:‘075035 PCT/U82012/065691 alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of cation to the nucleotide, the alternating motif can be “ABABABABABAB. . .,” ABBAABB. . .,” “AABAABAABAAB. . .,” “AAABAAABAAAB. . .,” “AAABBBAAABBB. . .,” or “ABCABCABCABC. . .,” etc.
The type of modifications contained in the ating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several 10 possibilities of modifications within the ating motif such as “ABABAB. . .”, “ACACAC...” “BDBDBD. . .” or “CDCDCD. . .,” etc.
In one embodiment, the RNAi agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is d. The shift may be such that the 15 modified group of nucleotides of the sense strand corresponds to a differently ed group of nucleotides of the antisense strand and Vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5’—3’ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 5’—3’of the 20 strand within the duplex . As r example, the alternating motif in the sense strand may start with “AABBAABB” from 5’—3’ of the strand and the alternating motif in the antisenese strand may start with “BBAABBAA” from 5’-3’ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense . 25 In one embodiment, the RNAi agent comprises the pattern of the alternating motif of 2'—O—methyl modification and 2’—F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'—O—methyl modification and 2’— F modification on the antisense strand initially, i.e. the ethyl modified nucleotide , on the sense strand base pairs with a 2'—F modified nucleotide on the antisense strand 30 and vice versa. The 1 position of the sense strand may start with the 2'—F modification, and the 1 on of the antisense strand may start with the 2'- O—methyl modification. 35 W0 2013,:‘075035 PCT/U82012/065691 The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand upts the initial modification pattern present in the sense strand and/or nse strand. This interruption of the cation pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive tides to the sense and/or antisense strand surprisingly enhances the gene silencing acitivty to the target gene.
In one embodiment, when the motif of three identical modifications on three utive nucleotides is introduced to any of the strands, the modification of the 10 nucleotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is “. . .NaYYYNb. . .,” where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and “Na” and “Nb” represent a modification to the nucleotide next to the motif “YYY” that is different than the 15 cation of Y, and where Na and Nb can be the same or different modifications.
Altnernatively, Na and/or Nb may be present or absent when there is a wing modification present.
The RNAi agent may further se at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or 20 methylphosphonate internucleotide linkage cation may occur on any nucleotide of the sense strand or antisense strand or both in any on of the strand. For instance, the internucleotide e modification may occur on every tide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or 25 antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the nse 30 strand. 36 W0 2013,:‘075035 PCT/U82012/065691 In one embodiment, the RNAi comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide e between the two nucleotides.
Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be onal phosphorothioate or methylphosphonate internucleotide linkages linking the ng 10 nucleotide with a paired tide that is next to the overhang nucleotide. For ce, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paried nucleotide next to the overhang nucleotide. Preferably, these terminal three nucleotides may be at the 3’—end of the antisense strand. 15 In one embodiment, the RNAi agent ses mismatch(es) with the target, within the duplex, or combinations f. The mistmatch can occur in the overhang region or the duplex region. The base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual 20 pair basis, though next neighbor or similar analysis can also be used). In terms of promoting iation: A:U is preferred over G:C; G:U is red over G:C; and LC is preferred over G:C (I=inosine). Mismatches, e.g., nonical or other than canonical pairings (as described elsewhere herein) are red over canonical (AzT, A:U, G:C) pairings; and pairings which include a sal base are preferred over 25 canonical pairings.
In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’— end of the antisense strand can be chosen independently from the group of: A:U, GzU, 1C, and mismatched pairs, e.g., non—canonical or other than canonical pairings or pairings which include a universal 30 base, to e the dissociation of the antisense strand at the 5’-end of the duplex. 37 W0 2013,:‘075035 PCT/US2012/065691 In one embodiment, the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’— end of the nse strand is an AU base pair. For example, the first base pair within the duplex region from the 5’— end of the antisense strand is an AU base pair.
In one embodiment, the sense strand sequence may be represented by formula (I): 5' np—Na-(X X X )i-Nb-Y Y Y -Nb-(Z Z Z )j-Na-nq 3' (I) 10 wherein: i and j are each independently 0 or 1; p and q are each independently 0-6; each Na independently represents an oligonucleotide sequence comprising 0—25 modified nucleotides, each sequence comprising at least two ently modified 15 nucleotides; each Nb independently represents an oligonucleotide ce comprising 0— 10 modified nucleotides; each tip and nq independently ent an overhang nucleotide; wherein Nb and Y do not have the same modification; and 20 XXX, YYY and ZZZ each ndently represent one motif of three cal modifications on three consecutive nucleotides. Preferably YYY is all 2’—F ed nucleotides.
In one embodiment, the Na and/or Nb comprise modifications of alternating pattern. 25 In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17—23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9,10, 9,10,11,10,11,12 or 11, 12, 13) of — the sense strand, the count starting from the 1St nucleotide, from the 5’—end; or 30 optionally, the count starting at the 1St paired nucleotide within the duplex region, from the 5’— end. 38 W0 2013,:‘075035 PCT/U82012/065691 In one ment, i is 1 andj is 0, or i is 0 andj is 1, or both i andj are 1. The sense strand can therefore be represented by the following formulas: 5' np—Na-YYY-Nb—ZZZ—Na—n01 3' (Ia); 5' np—Na—XXX—Nb—YYY—Na—nq 3' (lb); or 5' np—Na—XXX—Nb—YYY—Nb—ZZZ—Na—nq 3' (1c).
When the sense strand is ented by formula (Ia), Nb represents an oligonucleotide sequence comprising 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides.
Each Na independently can represent an oligonucleotide sequence comprising 2—20, 2— 15 or 2—10 modified nucleotides. , 10 When the sense strand is represented as formula (Ib), Nb represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 0-5, 0-4, 0—2 or 0 ed nucleotides. Each Na can independently represent an ucleotide sequence comprising 2—20, 2—15, or 2—10 ed nucleotides.
When the sense strand is represented as formula (1c), each Nb ndently 15 represents an oligonucleotide sequence comprising 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified nucleotides. Preferably, Nb is 0, l, 2, 3, 4, 5 or 6 Each Na can independently represent an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides.
Each of X, Y and Z may be the same or different from each other.
In one embodiment, the antisense strand sequence of the RNAi may be 20 represented by formula (II): 5' nq,—Na'—(Z’Z’Z’)k—Nb’—Y’Y’Y’—Nb’—(X’X’X’)1—N’a—np’ 3' (11) wherein: k and l are each independently 0 or 1; p’ and q’ are each independently 0—6; 25 each Na' independently represents an oligonucleotide sequence comprising 0—25 modified nucleotides, each sequence comprising at least two differently modified tides; each Nb’ independently ents an oligonucleotide sequence comprising 0— 10 d nucleotides; 30 each np’ and nq’ independently represent an overhang nucleotide; wherein Nb’ and Y’ do not have the same modification; 39 W0 2013,:‘075035 PCT/U82012/065691 and X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
In one ment, the Na’ and/or Nb’ comprise modifications of alternating pattern.
The Y'Y'Y' motif occurs at or near the cleavage site of the nse strand. For e, when the RNAi agent has a duplex region of 17—23 nt in length, the Y’Y’Y’ motifcan occur at positions 9, 10, 11;10, 11, 12; 11, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count ng from the 1St nucleotide, from the 5’—end; or 10 optionally, the count starting at the 1St paired nucleotide within the duplex region, from the 5’— end. Preferably, the Y’Y’Y’ motif occurs at positions 11, 12, 13.
In one embodiment, Y'Y'Y' motif is all 2’-OMe modified nucleotides.
In one ment, k is l and l is 0, or k is 0 and l is 1, or both k and 1 are l.
The antisense strand can therefore be represented by the ing formulas: 15 5' nq~—Na'-Z'Z'Z'-Nb’-Y’Y’Y’-Na’-np~ 3' (11a); 5' nq,-Na'-Y’Y’Y’-Nb’-X’X’X’-np~ 3' (IIb); or 5' nq,-Na’- Z’Z’Z’-Nb’-Y’Y’Y’-Nb’- X’X’X’-Na’-np~ 3' (IIc).
When the antisense strand is represented by formula (IIa), Nb, represents an oligonucleotide ce comprising 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified 20 nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2—15, or 2—10 modified nucleotides.
When the nse strand is represented as formula (IIb), Nb’ represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0—2 or 0 modified tides. Each Na’ independently represents an oligonucleotide sequence comprising 25 2—20, 2—15, or 2—10 modified nucleotides.
When the antisense strand is represented as formula (IIc), each Nb’ independently represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 0—5, 0—4, 0-2 or 0 modified nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides. 30 Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6.
Each of X', Y’ and 2’ may be the same or different from each other. 40 W0 2013,:‘075035 PCT/U82012/065691 Each nucleotide of the sense strand and antisense strand may be independently d with LNA, HNA, CeNA, hoxyethyl, 2’-O-methy1, lly1, 2’-C- allyl, 2’—hydroxy1, 2’—deoxy or 2’—fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2’—O—methy1 or 2’-fluoro.
Each X, Y, Z, X', Y' and Z’, in particular, may represent a 2’—O—methy1 modification or a 2’—fluoro modification.
In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1St nucleotide from the 5’—end, or optionally, the count starting at 10 the 18‘ paired tide within the duplex , from the 5’— end; and Y represents 2’— F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’—OMe modification or 2’—F modification.
In one embodiment the antisense strand may contain Y’Y'Y’ motif occurring at 15 positions 11, 12, 13 of the strand, the count starting from the 1St nucleotide from the 5’—end, or optionally, the count starting at the 1St paired nucleotide within the duplex region, from the 5’— end; and Y’ represents 2’—O—methy1 modification. The nse strand may additionally contain X’X’X’ motif or Z’Z’Z’ motifs as wing modifications at the te end of the duplex region; and X’X’X’ and Z’Z’Z’ each independently 20 represents a 2’—OMe modification or 2’—F cation.
The sense strand represented by any one of the above formulas (Ia), (1b) and (Ic) forms a duplex with a antisense strand being represented by any one of formulas (Ila), (IIb) and (IIc), respectively.
Accordingly, the RNAi agents of the invention may comprise a sense strand and 25 an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III): sense: 5' np —Na—(X X X), —Nb— Y Y Y —Nb —(Z Z Z)j—Na—nq 3' antisense: 3' npg—Nag—(X’X’X’)k—Nba—Y’Y’Y’—Nb’—(Z’Z’Z')1—Na’—nq, 5' (111) 30 wherein: i, j, k, and l are each independently 0 or 1; 41 W0 2013.:‘075035 PCT/U82012/065691 p, p', q, and q' are each independently 0-6; each Na and Na! independently represents an oligonucleotide sequence comprising 0—25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb and Nb, independently ents an oligonucleotide sequence comprising 0—10 modified nucleotides; wherein each np’, np, nq’, and nq independently ents an overhang nucleotide; and XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one 10 motif of three cal modifications on three consecutive nucleotides.
In one embodiment, i is 1 andj is 0; or i is 0 andj is 1; or both i andj are 1. In another embodiment, k is 1 and 1 is O; k is 0 and l is 1; or both k and l are 1.
Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex e the formulas below: 15 5' np —Na -Y Y Y -Nb -Z Z Z -Na-nq 3' 3' np,—Na'—Y’Y’Y’—Nb’—Z’Z’Z’—Nagnqg 5' (111a) 5' np-Na- X X X -Nb -Y Y Y - Na-nq 3' 3' npi—Nag—X’X’XCNbg—Y’Y’Y’—Na’—nq’ 5' 20 (IIIb) 5' np -Na -X X X -Nb-Y Y Y -Nb- Z Z Z 'Na'nq 3' 3' npi-Nai-X'X'X'-Nbi-Y'Y’Y’-Nbi-Z'Z’Z’-Na-nqs 5' (IIIc) When the RNAi agent is represented by formula (Illa), each Nb independently 25 ents an oligonucleotide sequence comprising 1—10, 1—7, 1—5 or 1—4 modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2—20, 2— 15, or 2—10 modified nucleotides.
When the RNAi agent is represented as formula (IIIb), each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0—10, 0—7, 0—10, 0—7, 30 0-5, 0—4, 0—2 or 0modified tides. Each Na independently represents an oligonucleotide sequence comprising 2—20, 2—15, or 2-10 modified nucleotides. 42 W0 2013,:‘075035 PCT/U82012/065691 When the RNAi agent is represented as formula (IIIc), each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0—5, 0—4, 0—2 or ied nucleotides. Each Na, Na, independently ents an oligonucleotide sequence comprising 2—20, 2—15, or 2—10 modified nucleotides. Each of Na, Na’, Nb and Nb, ndently comprises modifications of alternating pattern.
Each of X, Y and Z in as (III), (Illa), (IIIb) and (IIIc) may be the same or different from each other.
When the RNAi agent is represented by formula (III), (IIIa), (IIIb) or (IIIc), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. 10 Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y tides all form base pairs with the corresponding Y' tides.
When the RNAi agent is ented by formula (IIIa) or (1110), at least one of the Z nucleotides may form a base pair with one of the Z’ nucleotides. Alternatively, at 15 least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.
When the RNAi agent is represented as formula (IIIb) or (IIIc), at least one of the X nucleotides may form a base pair with one of the X’ nucleotides. atively, at least two of the X tides form base pairs with the corresponding X' nucleotides; or 20 all three of the X nucleotides all form base pairs with the corresponding X’ nucleotides.
In one embodiment, the modification on the Y nucleotide is different than the modification on the Y’ nucleotide, the modification on the Z nucleotide is different than the cation on the Z’ nucleotide, and/or the modification on the X nucleotide is different than the modification on the X’ nucleotide. 25 In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb) or (IIIc), wherein the duplexes are connected by a linker. The linker can be cleavable or non—cleavable. Optionally, the multimer further comprise a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target 30 sites. 43 W0 2013,:‘075035 PCT/US2012/065691 In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by a (III), , (IIIb) or , wherein the duplexes are connected by a linker. The linker can be cleavable or non—cleavable.
Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
In one embodiment, two RNAi agents represented by formula (III), , (IIIb) or (IIIc) are linked to each other at the 5’ end, and one or both of the 3’ ends of the are optionally ated to to a ligand. Each of the agents can target the same gene or two 10 different genes; or each of the agents can target same gene at two different target sites.
Various publications describe multimeric RNAi agents . Such publications e W02007/O91269, US Patent No. 7858769, W02010/141511, W02007/117686, W02009/014887 and W02011/031520 the entire contents of which are hereby incorporated herein by reference. 15 The RNAi agent that ns conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For e, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, 6.57., a non—carbohydrate (preferably cyclic) carrier to 20 which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, , sulfur. The cyclic carrier may be a 25 monocyclic ring system, or may contain two or more rings, 6.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
The ligand may be attached to the polynucleotide Via a r. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone 30 attachment point” as used herein refers to a functional group, 6.57. a hydroxyl group, or generally, a bond ble for, and that is suitable for oration of the carrier into 44 W0 2013,:‘075035 PCT/US2012/065691 the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering ment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a atom nct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, 6.57., a carbohydrate, ag. ccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is ted by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for oration or tethering 10 of another chemical entity, e.g., a ligand to the constituent ring.
The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, olidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, lidinyl, 15 isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.
In certain specific embodiments, the RNAi agent of the invention is an agent selected from the group of agents listed in Table 1 and consisting of D1000, D1001, 20 D1002, D1003, D1004, D1005, D1006, D1007, D1008, D1009, D1010, D1011, D1012, D1013, D1014, D1015, D1016, D1017, D1018, D1019, D1020, D1021, D1022, D1023, D1024, D1025, D1026, D1027, D1028, D1029, D1030, D1031, D1032, D1033, D1034, D1035, D1036, D1037, D1038, D1039, D1040, D1041, D1042, D1043, D1044, D1045, D1046, D1047, D1048, D1049, D1050, D1051, D1052, D1053, D1054, D1055, D1056, 25 D1057, D1058, D1059, D1060, D1061, D1062, D1063, D1064, D1065, D1066, D1067, D1068, D1069, D1070, D1071, D1072, D1073, D1074, D1075, D1076, D1077, D1078, D1079, D1080, D1081, D1082, D1083, D1084, D1085, D1086, D1087, D1088, D1089, D1090, D1091, D1092, D1093, D1094, D1095, D1096, D1097, D1098, D1099, D1100, D1101, D1102, D1103, D1104, D1105, D1106, D1107, D1108, D1109, D1110, D1111, 30 D1112, D1113, D1114, D1115, D1116, D1117, D1118, D1119, D1120, D1121, D1122, D1123, D1124, D1125, D1126, D1127, D1128, D1129, D1130, D1131, D1132, D1133, 45 W0 75035 PCT/US2012/065691 D1134, D1135, D1136, D1137, D1138, D1139, D1140, D1141, D1142, D1143, D1144, D1145, D1146, D1147, D1148, D1149, D1150, D1151, D1152, D1153, D1154, D1155, D1156, D1157, D1158, D1159, D1160, D1161, D1162, D1163, D1164, D1165, D1166, D1167, D1168, D1169, D1170, D1171, D1172, D1173, D1174, D1175, D1176, D1177, D1178, D1179, D1180, D1181, D1182, D1183, D1184, D1185, D1186, D1187, D1188, D1189, D1190, D1191, D1192, D1193, D1194, D1195, D1196, D1197, D1198, D1199, D1200, D1201, D1202, D1203, D1204, D1205, D1206, D1207, D1208, D1209, D1210, D1211, D1212, D1213, D1214, D1215, D1216, D1217, D1218, D1219, D1220, D1221, D1222, D1223, D1224, D1225, D1226, D1227, D1228, D1229, D1230, D1231, D1232, 10 D1233, D1234, D1235, D1236, D1237, D1238, D1239, D1240, D1241, D1242, D1243, D1244, D1245, D1246, D1247, D1248, D1249, D1250, D1251, D1252, D1253, D1254, D1255, D1256, D1257, D1258, D1259, D1260, D1261, D1262, D1263, D1264, D1265, D1266, D1267, D1268, D1269, D1270, D1271, D1272, D1273, D1274, D1275, D1276, D1277, D1278, D1279, D1280, D1281, D1282, D1283, D1284, D1285, D1286, D1287, 15 D1288, D1289, D1290, D1291, D1292, D1293, D1294, D1295, D1296, D1297, D1298, D1299, D1300, D1301, D1302, D1303, D1304, D1305, D1306, D1307, D1308, D1309, D1310, D1311, D1312, D1313, D1314, D1315, D1316, D1317, D1318, D1319, D1320, D1321, D1322, D1323, D1324, D1325, D1326, D1327, D1328, D1329, D1330, D1331, D1332, D1333, D1334, D1335, D1336, D1337, D1338, D1339, D1340, D1341, D1342, 20 D1343, D1344, D1345, D1346, D1347, D1348, D1349, D1350, D1351, D1352, D1353, D1354, D1355, D1356, D1357, D1358, D1359, D1360, D1361, D1362, D1363, D1364, D1365, D1366, D1367, D1368, D1369, D1370, D1371, D1372, D1373, D1374, D1375, D1376, D1377, D1378, D1379, D1380, D1381, D1382, D1383, D1384, D1385, D1386, D1387, D1388, D1389, D1390, D1391, D1392, D1393, D1394, D1395, D1396, D1397, 25 D1398, D1399, D1400, D1401, D1402, D1403, D1404, D1405, D1406, D1407, D1408, D1409, D1410, D1411, D1412, D1413, D1414, D1415, D1416, D1417, D1418, D1419, D1420, D1421, D1422, D1423, D1424, D1425, D1426, D1427, D1428, D1429, D1430, D1431, D1432, D1433, D1434, D1435, D1436, D1437, D1438, D1439, D1440, D1441, D1442, D1443, D1444, D1445, D1446, D1447, D1448, D1449, D1450, D1451, D1452, 30 D1453, D1454, D1455, D1456, D1457, D1458, D1459, D1460, D1461, D1462, D1463, D1464, D1465, D1466, D1467, D1468, D1469, D1470, D1471, D1472, D1473, D1474, 46 W0 75035 PCT/US2012/065691 D1475, D1476, D1477, D1478, D1479, D1480, D1481, D1482, D1483, D1484, D1485, D1486, D1487, D1488, D1489, D1490, D1491, D1492, D1493, D1494, D1495, D1496, D1497, D1498, D1499, . D1500, D1501, D1502, D1503, D1504, D1505, D1506, D1507, D1508, D1509, D1510, D1511, D1512, D1513, D1514, D1515, D1516, D1517, D1518, D1519, D1520, D1521, D1522, D1523, D1524, D1525, D1526, D1527, D1528, D1529, D1530, D1531, D1532, D1533, D1534, D1535, D1536, D1537, D1538, D1539, D1540, D1541, D1542, D1543, D1544, D1545, D1546, D1547, D1548, D1549, D1550, D1551, D1552, D1553, D1554, D1555, D1556, D1557, D1558, D1559, D1560, D1561, D1562, D1563, D1564, D1565, D1566, D1567, D1568, D1569, D1570, D1571, D1572, 10 D1573, D1574, D1575, D1576, D1577, D1578, D1579, D1580, D1581, D1582, D1583, D1584, D1585, D1586, D1587, D1588, D1589, D1590, D1591, D1592, D1593, D1594, D1595, D1596, D1597, D1598, D1599, D1600, D1601, D1602, D1603, D1604, D1605, D1606, D1607, D1608, D1609, D1610, D1611, D1612, D1613, D1614, D1615, D1616, D1617, D1618, D1619, D1620, D1621, D1622, D1623, D1624, D1625, D1626, D1627, 15 D1628, D1629, D1630, D1631, D1632, D1633, D1634, D1635, D1636, D1637, D1638, D1639, D1640, D1641, D1642, D1643, D1644, D1645, D1646, D1647, D1648, D1649, D1650, D1651, D1652, D1653, D1654, D1655, D1656, D1657, D1658, D1659, D1660, D1661, D1662, D1663, D1664, D1665, D1666, D1667, D1668, D1669, D1670, D1671, D1672, D1673, D1674, D1675, D1676, D1677, D1678, D1679, D1680, D1681, D1682, 20 D1683, D1684, D1685, D1686, D1687, D1688, D1689, D1690, D1691, D1692, D1693, D1694, D1695, D1696, D1697, D1698, D1699, D1700, D1701, D1702, D1703, D1704, D1705, D1706, D1707, D1708, D1709, D1710, D1711, D1712, D1713, D1714, D1715, D1716, D1717, D1718, D1719, D1720, D1721, D1722, D1723, D1724, D1725, D1726, D1727, D1728, D1729, D1730, D1731, D1732, D1733, D1734, D1735, D1736, D1737, 25 D1738, D1739, D1740, D1741, D1742, D1743, D1744, D1745, D1746, D1747, D1748, D1749, D1750, D1751, D1752, D1753, D1754, D1755, D1756, D1757, D1758, D1759, D1760, D1761, D1762, D1763, D1764, D1765, D1766, D1767, D1768, D1769, D1770, D1771, D1772, D1773, D1774, D1775, D1776, D1777, D1778, D1779, D1780, D1781, D1782, D1783, D1784, D1785, D1786, D1787, D1788, D1789, D1790, D1791, D1792, 30 D1793, D1794, D1795, D1796, D1797, D1798, D1799, D1800, D1801, D1802, D1803, D1804, D1805, D1806, D1807, D1808, D1809, D1810, D1811, D1812, D1813, D1814, 47 W0 75035 PCT/US2012/065691 D1815, D1816, D1817, D1818, D1819, D1820, D1821, D1822, D1823, D1824, D1825, D1826, D1827, D1828, D1829, D1830, D1831, D1832, D1833, D1834, D1835, D1836, D1837, D1838, D1839, D1840, D1841, D1842, D1843, D1844, D1845, D1846, D1847, D1848, D1849, D1850, D1851, D1852, D1853, D1854, D1855, D1856, D1857, D1858, D1859, D1860, D1861, D1862, D1863, D1864, D1865, D1866, D1867, D1868, D1869, D1870, D1871, D1872, D1873, D1874, D1875, D1876, D1877, D1878, D1879, D1880, D1881, D1882, D1883, D1884, D1885, D1886, D1887, D1888, D1889, D1890, D1891, D1892, D1893, D1894, D1895, D1896, D1897, D1898, D1899, D1900, D1901, D1902, D1903, D1904, D1905, D1906, D1907, D1908, D1909, D1910, D1911, D1912, D1913, 10 D1914, D1915, D1916, D1917, D1918, D1919, D1920, D1921, D1922, D1923, D1924, D1925, D1926, D1927, D1928, D1929, D1930, D1931, D1932, D1933, D1934, D1935, D1936, D1937, D1938, D1939, D1940, D1941, D1942, D1943, D1944, D1945, D1946, D1947, D1948, D1949, D1950, D1951, D1952, D1953, D1954, D1955, D1956, D1957, D1958, D1959, D1960, D1961, D1962, D1963, D1964, D1965, D1966, D1967, D1968, 15 D1969, D1970, D1971, D1972, D1973, D1974, D1975, D1976, D1977, D1978, D1979, D1980, D1981, D1982, D1983, D1984, D1985, D1986, D1987, D1988, D1989, D1990, D1991, D1992, D1993, D1994, D1995, D1996, D1997, D1998, D1999, D2000, D2001, D2002, D2003, D2004, D2005, D2006, D2007, D2008, D2009, D2010, D2011, D2012, D2013, D2014, D2015, D2016, D2017, D2018, D2019, D2020, D2021, D2022, D2023, 20 D2024, D2025, D2026, D2027, D2028, D2029, D2030, D2031, D2032, D2033, D2034, D2035, D2036, D2037, D2038, D2039, D2040, D2041, D2042, D2043, D2044, D2045, D2046, D2047, D2048, D2049, D2050, D2051, D2052, D2053, D2054, D2055, D2056, D2057, D2058, D2059, D2060, D2061, D2062, D2063, D2064, D2065, D2066, D2067, D2068, D2069, D2070, D2071, D2072, D2073, D2074, D2075, D2076, D2077, D2078, 25 D2079, D2080, D2081, D2082, D2083, D2084, D2085, D2086, D2087, D2088, D2089, D2090 and D2091.
These agents may further comprise a ligand, such as a GalNAc ligand.
Ligands 30 The RNAi agents of the invention, e.g., double stranded RNAi agents, may optionally be conjugated to one or more ligands. The ligand can be attached to the sense 48 W0 2013,:‘075035 PCT/U82012/065691 strand, antisense strand or both strands, at the , 5’-end or both ends. For instance, the ligand may be conjugated to the sense strand. In preferred embodiments, the ligand is conjgated to the 3’-end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAC3: OH HO HO \/\/ AcHN W OH K HO O O HO o H H ACHN \/\/\g/ \/\/ %“0 O o I HO O\/\/\n/N/\/\N o AcHN H H o A wide y of entities can be coupled to the RNAi agents of the present invention. red moieties are ligands, which are coupled, preferably covalently, either directly or indirectly via an intervening tether. 10 In preferred embodiments, a ligand alters the distribution, targeting or lifetime of the molecule into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, receptor e.g., a ar or organ compartment, , organ or region of the body, as, e.g., compared to a species absent such a ligand. Ligands providing enhanced affinity 15 for a selected target are also termed targeting ligands.
Some ligands can have molytic properties. The endosomolytic ligands promote the lysis of the endosome and/or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic ligand may be a polyanionic peptide or peptidomimetic which shows pH—dependent 20 membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand assumes its active conformation at endosomal pH. The “active” conformation is that conformation in which the endosomolytic ligand promotes lysis of the endosome and/or transport of the ition of the invention, or its components, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic s include the GALA peptide 49 W0 2013,:‘075035 PCT/U82012/065691 (Subbarao et (11., Biochemistry, 1987, 26: 972), the EALA peptide (V0gel et al., J.
Am. Chem. Soc., 1996, 118: 1581-1586), and their derivatives (Turk et (11., Biochem.
Biophys. Acta, 2002, 1559: 56—68). In one embodiment, the endosomolytic component may contain a chemical group (e.g., an amino acid) which Will undergo a change in charge or ation in response to a change in pH. The endosomolytic component may be linear or branched.
Ligands can improve transport, hybridization, and specificity properties and may also e nuclease resistance of the resultant natural or modified oligoribonucleotide, or a polymeric molecule comprising any combination of monomers described herein 10 and/or natural or modified ribonucleotides.
Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e. g., for monitoring distribution; cross-linking agents; and nuclease—resistance conferring moieties. l examples include lipids, steroids, vitamins, , proteins, peptides, polyamines, and peptide mimics. 15 Ligands can include a naturally occurring substance, such as a n (e.g., human serum albumin (HSA), nsity lipoprotein (LDL), high—density otein (HDL), or globulin); a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid, an 20 oligonucleotide (6.57., an aptamer). Examples of polyamino acids include polyamino acid is a sine (PLL), poly L—aspartic acid, poly L—glutamic acid, styrene—maleic acid anhydride copolymer, poly(L—lactide-co-glycolied) copolymer, l ether-maleic anhydride copolymer, N-(2—hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2—ethylacryllic 25 acid), N—isopropylacrylamide polymers, or osphazine. Example of polyamines e: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide—polyamine, peptidomimetic polyamine, dendrimer polyamine, ne, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical e. 30 Ligands can also include targeting groups, e.g., a cell or tissue ing agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified 50 W0 2013,:‘075035 PCT/U82012/065691 cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N—acetyl—galactosamine, N—acetyl—gulucosamine multivalent mannose, alent fucose, glycosylated polyaminoacids, multivalent galactose, errin, bisphosphonate, utamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer.
Other examples of ligands include dyes, intercalating agents (e.g., acridines), linkers (e.g., psoralene, cin C), porphyrins (TPPC4, texaphyrin, 10 Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or a chelator (e.g., EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, s—O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, bomeol, menthol, l,3—propanediol, heptadecyl group, palmitic acid, 15 ic acid,O3—(oleoyl)lithocholic acid, O3—(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating , phosphate, amino, mercapto, PEG (e.g., PEG—40K), MPEG, [MPEG]2, polyamino, alkyl, tuted alkyl, radiolabeled markers, s, haptens (e.g., biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), tic 20 ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine— imidazole ates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific ty for a co—ligand, or antibodies e.g., an antibody, that binds to a specified 25 cell type such as a cancer cell, elial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non—peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N—acetyl—galactosamine, N—acetyl—gulucosamine multivalent mannose, multivalent fucose, or aptamers. The ligand can be, for example, a lipopolysaccharide, 30 an activator of p38 MAP kinase, or an activator of NF-KB. 51 W0 2013,:‘075035 PCT/U82012/065691 The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, stine, stine, cytochalasin, zole, 5 japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
The ligand can increase the uptake of the oligonucleotide into the cell by, for example, activating an inflammatory response. Exemplary ligands that would have such an effect include tumor is factor alpha (TNFalpha), interleukin—1 beta, or gamma eron. 10 In one aspect, the ligand is a lipid or lipid—based molecule. Such a lipid or lipid— based molecule preferably binds a serum protein, e.g., human serum albumin (HSA).
An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non—kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be 15 used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid—based ligand can (a) increase resistance to degradation of the ate, (b) increase targeting or ort into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.
A lipid based ligand can be used to modulate, e.g., control the binding of the 20 conjugate to a target tissue. For example, a lipid or lipid—based ligand that binds to HSA more ly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it 25 binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non—kidney tissue. However, it is preferred that the affinity not be so strong that the HSA—ligand binding cannot be reversed.
In r preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the ate will be preferably distributed to the kidney. Other 30 moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand. 52 W0 2013,:‘075035 PCT/U82012/065691 In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non—malignant type, e.g., cancer cells. Exemplary vitamins include n A, E, and K. Other exemplary ns include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low density lipoprotein (LDL) and high—density lipoprotein (HDL).
In another aspect, the ligand is a cell—permeation agent, preferably a helical cell— permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a 10 peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non—peptide or —peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.
The ligand can be a e or peptidomimetic. A peptidomimetic (also referred 15 to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three—dimensional structure similar to a natural peptide. The peptide or omimetic moiety can be about 5—50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., 20 consisting primarily of Tyr, Trp or Phe). The e moiety can be a dendrimer e, ained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hobic ne translocation sequence (MTS). An exemplary hydrophobic MTS—containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:4). An RFGF analogue (e.g., amino 25 acid sequence AALLPVLLAAP) (SEQ ID NO:5) containing a hydrophobic MTS can also be a targeting . The peptide moiety can be a “delivery” peptide, which can carry large polar les including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ) (SEQ ID NO:6) and the Drosophila Antennapedia n (RQIKIWFQNRRMKWKK) 30 (SEQ ID NO:7) have been found to be e of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a 53 W0 2013,:‘075035 PCT/U82012/065691 peptide identified from a phage—display library, or one—bead-one-compound (OBOC) combinatorial library (Lam er al., Nature, 354:82-84, 1991). Preferably the peptide or peptidomimetic tethered to an iRNA agent via an incorporated r unit is a cell targeting peptide such as an arginine—glycine—aspartic acid (RGD)—peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural cation, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.An RGD peptide moiety can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell 10 (Zitzmann et al., Cancer Res., 62:5139—43, 2002). An RGD peptide can facilitate ing of an iRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001).
Preferably, the RGD peptide will facilitate targeting of an iRNA agent to the kidney.
The RGD peptide can be linear or cyclic, and can be modified, e. g., glycosylated or 15 methylated to facilitate ing to specific tissues. For example, a ylated RGD peptide can deliver an iRNA agent to a tumor cell sing (xx/133 (Haubner et al. , Joar.
Nucl. Med., 42:326—336, 2001). Peptides that target s ed in proliferating cells can be used. For example, RGD containing peptides and peptidomimetics can target cancer cells, in particular cells that exhibit an integrin. Thus, one could use RGD 20 peptides, cyclic es containing RGD, RGD peptides that include D—amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. lly, such ligands can be used to l proliferating cells and angiogeneis. Preferred conjugates of this type of ligand target PECAM—l, VEGF, or other cancer gene, e.g., a cancer gene bed herein. 25 A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell—perrneating peptide can be, for example, an (it—helical linear peptide (e.g., LL—37 or Ceropin P1), a disulfide bond—containing peptide (e. g., (x —defensin, B—defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., 30 PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic 54 W0 2013.:‘075035 PCT/U82012/065691 peptide, such as MPG, which is derived from the fusion peptide domain of HIV—1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717—2724, 2003).
In one embodiment, a targeting peptide can be an amphipathic cal peptide.
Exemplary amphipathic (X-hCllCal es include, but are not limited to, cecropins, xins, paradaxins, buforin, CPF, bombinin—like e (BLP), cathelicidins, ceratotoxins, S. clava es, h intestinal antimicrobial peptides (HFIAPs), magainines, brevinins—Z, eptins, ins, pleurocidin, H2A peptides, Xenopus peptides, esculentinis—l, and s. A number of factors will preferably be ered 10 to maintain the integrity of helix stability. For example, a maximum number of helix stabilization residues will be utilized (e.g., leu, ala, or lys), and a minimum number helix destabilization residues will be utilized (e.g., proline, or cyclic monomeric units. The capping e will be considered (for example Gly is an exemplary N—capping residue and/or C—terminal amidation can be used to e an extra H—bond to stabilize the 15 helix. Formation of salt bridges between es with te charges, separated by i i 3, or i i 4 positions can provide stability. For example, cationic residues such as lysine, arginine, homo—arginine, ornithine or histidine can form salt bridges with the anionic residues glutamate or aspartate.
Peptide and peptidomimetic ligands include those having naturally occurring or 20 modified peptides, 6.57., D or L peptides; or, B, or y peptides; N—methyl peptides; azapeptides; peptides having one or more amide, i.e., peptide, linkages replaced with one or more urea, thiourea, carbamate, or sulfonyl urea linkages; or cyclic peptides.
The targeting ligand can be any ligand that is capable of targeting a specific receptor. Examples are: folate, GalNAc, galactose, mannose, mannose—6P, clusters of 25 sugars such as GalNAc cluster, mannose cluster, galactose cluster, or an apatamer. A cluster is a combination of two or more sugar units. The targeting ligands also include integrin receptor ligands, Chemokine receptor s, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. The ligands can also be based on c acid, 6.57., an aptamer. The aptamer can be 30 unmodified or have any combination of modifications disclosed herein. 55 W0 2013,:‘075035 PCT/U82012/065691 Endosomal release agents include imidazoles, poly or oligoimidazoles, PEIs, peptides, fusogenic peptides, polycaboxylates, polyacations, masked oligo or poly cations or anions, acetals, polyacetals, ketals/polyketyals, sters, polymers with masked or unmasked cationic or anionic charges, dendrimers with masked or unmasked cationic or anionic s.
PK modulator stands for pharmacokinetic modulator. PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Examplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, 10 phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc.
Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short Oligonucleotides, e.g., Oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, sing le phosphorothioate linkages in the one are also amenable to the t invention as s (e.g., as PK 15 modulating ligands).
In addition, aptamers that bind serum components (e.g., serum proteins) are also amenable to the present invention as PK modulating ligands.
Other ligand conjugates amenable to the invention are described in US. Patent Applications USSN: 10/916,185, filed August 10, 2004; USSN: 10/946,873, filed 20 September 21, 2004; USSN: 10/833,934, filed August 3, 2007; USSN: 11/115,989 filed April 27, 2005 and USSN: 11/944,227 filed November 21, 2007, which are orated by reference in their entireties for all purposes.
When two or more s are present, the ligands can all have same properties, all have different properties or some ligands have the same properties while others have 25 ent ties. For example, a ligand can have targeting properties, have endosomolytic activity or have PK modulating properties. In a preferred ment, all the ligands have different properties.
Ligands can be coupled to the Oligonucleotides at various places, for example, 3’—end, 5’—end, and/or at an internal position. In preferred embodiments, the ligand is 30 attached to the Oligonucleotides via an intervening tether, e.g., a carrier described herein.
The ligand or tethered ligand may be t on a monomer when the monomer is 56 W0 2013,:‘075035 PCT/U82012/065691 incorporated into the growing strand. In some embodiments, the ligand may be incorporated via coupling to a “precursor” monomer after the “precursor” r has been incorporated into the growing strand. For example, a monomer having, e.g., an amino—terminated tether (i.e., having no associated ligand), e.g., TAP—(CH2)HNH2 may be incorporated into a growing oligonucelotide strand. In a uent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having an electrophilic group, 6.57., a uorophenyl ester or aldehyde group, can subsequently be ed to the precursor monomer by coupling the electrophilic group of the ligand with the terminal philic group of the precursor monomer’s tether. 10 In another example, a monomer having a chemical group le for taking part in Click try reaction may be incorporated, e. g., an azide or alkyne terminated tether/linker. In a subsequent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having complementary chemical group, e.g. an alkyne or azide can be attached to the precursor monomer by ng the alkyne and the azide 15 er.
For double— stranded oligonucleotides, s can be attached to one or both strands. In some embodiments, a double—stranded iRNA agent contains a ligand conjugated to the sense strand. In other embodiments, a double—stranded iRNA agent contains a ligand conjugated to the antisense strand. 20 In some ments, ligand can be conjugated to nucleobases, sugar moieties, or internucleosidic linkages of nucleic acid molecules. Conjugation to purine nucleobases or derivatives thereof can occur at any position including, endocyclic and exocyclic atoms. In some embodiments, the 2—, 6—, 7—, or 8—positions of a purine base are attached to a conjugate moiety. ation to pyrimidine nucleobases 25 or derivatives thereof can also occur at any position. In some ments, the 2—, 5—, and 6—positions of a pyrimidine nucleobase can be substituted with a conjugate moiety.
Conjugation to sugar moieties of nucleosides can occur at any carbon atom. Example carbon atoms of a sugar moiety that can be attached to a conjugate moiety include the 2', 3', and 5' carbon atoms. The 1' position can also be attached to a conjugate moiety, such 30 as in an abasic residue. Internucleosidic linkages can also bear conjugate moieties. For phosphorus—containing linkages (e.g., phosphodiester, phosphorothioate, 57 W0 2013,:‘075035 PCT/U82012/065691 phosphorodithiotate, phosphoroamidate, and the like), the conjugate moiety can be ed ly to the phosphorus atom or to an O, N, or S atom bound to the phosphorus atom. For amine— or amide—containing internucleosidic linkages (e.g., PNA), the conjugate moiety can be attached to the en atom of the amine or amide or to an adjacent carbon atom.
Any suitable ligand in the field of RNA interference may be used, although the ligand is typically a carbohydrate e.g. monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.
Linkers that conjugate the ligand to the nucleic acid include those discussed 10 above. For e, the ligand can be one or more GalNAc (N—acetylglucosamine) derivatives attached through a bivalent or trivalent branched linker.
In one embodiment, the dsRNA of the invention is conjugated to a bivalent and trivalent branched s include the structures shown in any of formula (IV) — (VII): PZA-QZA-RZA, A 2A q JP3A'Q3A'R3Al3—AT3A'L3Aq mN PZB-QZB-RZB ]?TZB_LZB \fP3B_Q3B_R3B]3TT3B_|—SB ‘1 q Formula (1V) Formula (V) P4A_Q4A_R4A]_T4A_L4A 4A q P4B-Q4B-R lWT4B 4B-L4B C1 Formula (VI) 15 or , P5A_Q5A_R5A I T5A_L5A 5A q P5B—Q513—R513 ]5—BT5B_L53 q PSC-QSC-RSC L5C q Formula (VII) wherein: 58 W0 2013,:‘075035 PCT/U82012/065691 qu, q2B 3A 4B and q5C represent independently for each , q , q3B, q4A, q , qSA, q5B ence 0-20 and wherein the repeating unit can be the same or different; PZA P213 P3A P313 P4A P413 PSA P513 Psc TZA T213 T3A T313 T4A T413 T4A T513 Tsc are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH or CHZO; QZA, QZB, Q3A, Q33, Q4A, Q43, QSA, Q53, Q5C are independently for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be upted or terminated by one or more of O, S, S(O), S02, N(RN), C(R’)=C(R”), CEC or C(O); 10 RZA, RZB, R3A, R33, R“, R43, RSA, R53, R5C are each independently for each occurrence absent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(Ra)C(O), —C(O)—CH(Ra)— O 0 HO 8—8 v“ ,CH=N-O,J~“NHi WM W><H, , 8—8 W \pi" 8—8 ,W Wor heterocyclyl; LZA, LZB, L3A, L33, L4A, L43, LSA, L513 and L5C represent the ligand; i. 6. each 15 independently for each occurrence a monosaccharide (such as GalNAc), haride, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R21 is H or amino acid side chain.
Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula 20 (VII): P5A_Q5A_R5A I T5A_L5A 5A q PSB-QSB-RSB iKTSB—LSB q PSC-QSC-RSC ]TTSC_L5C q Formula (VII) 9 - 5A 513 5c wherein L L and L . , represent a monosaccharide, such as GalNAc derivative.
Examples of le bivalent and trivalent ed linker groups conjugating GalNAc 25 derivatives include, but are not limited to, the following compounds: 59 WO 75035 PCT/U82012/065691 HO 60 W0 2013,:‘075035 PCT/U82012/065691 HO OH HO OH H O O HO OWN HO&/O\/\/\_O HO OH NHAc NHAC O HO OH /\/\_05§ NHACHO O O OH \/\/\n/ Ho&: 0 NHAc O NHAc , OH HO O 0 H O HO O\/\)J\N/\/\/\/N AcHN H \g/ O“ HO O o H HO AHN OMNWNTOC H O OH HO O AcHN H OH H OH HO 0 HO O\/\O/\/O\/\N O 5 AcHN H ,or HO OH O o H HO N T ACHN H O HO OH flOA H N O HO OH 61 W0 2013,:‘075035 PCT/U82012/065691 In other ments, the RNAi agent of the invention is an agent selected from the group consisting of AD-45163, AD-45165, AD-51544, AD-S 1545, AD-51546, and AD—S 1547.
III. Pharmaceutical Compositions The RNAi agents of the invention may be formulated for administration in any convenient way for use in human or veterinary medicine, by analogy with other pharmaceuticals. The pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions 10 containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.
In the methods of the invention, the RNAi agent may be administered in a solution. A free RNAi agent may be administered in an unbuffered solution, e.g., in 15 saline or in water. Alternatively, the free siRNA may also be administred in a suitable buffer solution. The buffer on may comprise acetate, e, ine, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer on containing the RNAi agent can be adjusted such that it is suitable for 20 administering to a subject.
In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma. Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, 25 es, amino acids, non—metabolized polymers, ns, ions, sugars, metabolites, organic acids, lipids, or salts. In some ments, the agent for controlling the osmolarity of the on is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium de.
In other embodiments, the RNAi agent is formulated as a composition that 30 includes one or more RNAi agents and a pharmaceutically acceptable r. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and 62 W0 2013,:‘075035 PCT/U82012/065691 all solvents, sion media, coatings, antibacterial and antifungal , isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
In one ment, the RNAi agent preparation includes at least a second therapeutic agent (e.g., an agent other than an RNA or a DNA). For example, an RNAi agent ition for the treatment of a sociated disease, e.g., a transthyretin— 10 related hereditary amyloidosis (familial amyloid polyneuropathy, FAP), may include a known drug for the amelioration of PAP, e.g., Tafamidis (INN, or Fx—1006A or Vyndaqel).
A formulated RNAi agent composition can assume a variety of states. In some examples, the composition is at least partially crystalline, uniformly crystalline, and/or 15 anhydrous (e.g., it contains less than 80, 50, 30, 20, or 10% of water). In another example, the RNAi agent is in an aqueous phase, 6.57., in a solution that includes water.
The aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, 6.57., a liposome (particularly for the aqueous phase) or a particle (e.g., a article as can be appropriate for a crystalline composition). Generally, the 20 RNAi agent composition is formulated in a manner that is compatible with the intended method of administration, as described herein. For example, in particular embodiments the composition is prepared by at least one of the following methods: spray drying, lyophilization, vacuum drying, evaporation, fluid bed drying, or a combination of these techniques; or sonication with a lipid, —drying, condensation and other self— 25 assembly.
An RNAi agent preparation can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that izes RNAi agent, e.g., a n that complexes with the RNAi agent to form an iRNP. Still other agents e chelators, e.g., EDTA (6.57., to remove nt cations such as Mg2+), salts, RNAse 30 inhibitors (e.g., a broad specificity RNAse inhibitor such as RNAsin) and so forth. 63 W0 2013,:‘075035 PCT/U82012/065691 In one ment, the RNAi agent preparation es another siRNA compound, e.g., a second RNAi agent that can mediate RNAi with respect to a second gene, or with respect to the same gene. Still other preparation can include at least 3, 5, ten, twenty, fifty, or a hundred or more different RNAi agent species. Such RNAi agents can mediate RNAi with respect to a similar number of different genes.
The iRNA agents of the invention may be formulated for pharmaceutical use.
Pharmaceutically acceptable compositions comprise a therapeutically—or prophylactically effective amount of one or more of the the dsRNA agents in any of the preceding ments, taken alone or formulated together with one or more 10 pharmaceutically acceptable carriers ives), ent and/or diluents.
Methods of ing pharmaceutical itions of the invention include the step of bringing into association an RNAi agent of the present invention with the carrier and, optionally, one or more accessory ingredients. In general, the compositionsare prepared by uniformly and intimately bringing into ation an RNAi agent of the 15 present invention with liquid carriers, or finely d solid carriers, or both, and then, if necessary, shaping the product.
The pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non—aqueous solutions or 20 suspensions), tablets, e. g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, enous or epidural injection as, for example, a sterile solution or suspension, or sustained—release ation; (3) topical application, for example, as a cream, ointment, or a controlled— 25 release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8) nasally. Delivery using subcutaneous or intravenous methods can be particularly advantageous.
The phrase "pharmaceutically able" is employed herein to refer to those 30 compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in t with the tissues of human beings and 64 W0 2013,:‘075035 PCT/U82012/065691 animals without excessive ty, irritation, allergic response, or other problem or complication, commensurate with a reasonable t/risk ratio.
The phrase "pharmaceutically—acceptable carrier" as used herein means a ceutically—acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e. g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being ible with the other ingredients of the compositionand not injurious to the patient. 10 Some examples of materials which can serve as pharmaceutically—acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) n; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; 15 (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (l3) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic 20 acid; (16) pyrogen—free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non—toxic ible substances employed in pharmaceuticalcompositions. 25 The compositions may conveniently be ted in unit dosage form and may be ed by any methods well known in the art of cy. The amount of RNAi agent which can be combined with a carrier material to produce a single dosage form will vary ing upon the host being treated, and the particular mode of administration. The RNAi agent which can be ed with a r material to 30 produce a single dosage form will generally be that amount of the RNAi agent which produces a d effect, e. g., therapeutic or prophylactic effect. Generally, out of one 65 W0 2013,:‘075035 PCT/U82012/065691 hundred per cent, this amount will range from about 0.1 per cent to about ninety—nine percent of RNAi agent, preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent.
In n embodiments, a composition of the present ion comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming , e.g., bile acids, and polymeric carriers, e.g., polyesters and polyanhydrides; and an RNAi agent of the present invention. In certain embodiments, an aforementioned composition renders orally bioavailable an RNAi agent of the present invention. 10 In some cases, in order to prolong the effect of an RNAi agent, it is desirable to slow the absorption of the agent from subcutaneous or intramuscular ion. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of tion of the RNAi agent then depends upon its rate of dissolution which, in turn, may depend upon crystal size and 15 lline form. atively, delayed tion of a parenterally—administered RNAi agent may be accomplished by dissolving or suspending the agent in an oil vehicle.
Liposomes An RNAi agent of the invention can be formulated for delivery in a membranous molecular assembly, 6.57., a liposome or a micelle. As used herein, the term “liposome” 20 refers to a vesicle composed of amphiphilic lipids arranged in at least one r, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a ne formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi agent composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not 25 include the RNAi agent composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ients to the site of action.
Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the me and cell progresses, the internal aqueous 30 ts that include the RNAi agent are delivered into the cell where the RNAi agent can specifically bind to a target RNA and can mediate RNAi. In some cases the 66 W0 2013,:‘075035 PCT/US2012/065691 liposomes are also specifically targeted, e.g., to direct the RNAi agent to particular cell types.
A liposome containing an RNAi agent can be prepared by a variety of methods.
In one example, the lipid component of a liposome is ved in a ent so that es are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle tration and may be nonionic. Exemplary detergents include e, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles that include the lipid ent. The cationic 10 groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.
If necessary a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier 15 compound can be a polymer other than a nucleic acid (e.g., ne or spermidine). pH can also be ed to favor condensation.
Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, 6.57., WO 96/37194, the entire contents of 20 which are incorporated herein by reference. Liposome formation can also include one or more s of ary methods described in Felgner, P. L. et LIL, Proc. Natl. Acad.
Sci., USA 8:7413-7417, 1987; US. Pat. No. 4,897,355; US. Pat. No. 5,171,678; Bangham, er al. M. Mol. Biol. 23:238, 1965; Olson, er al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew, et al. Biochim. 25 Biophys. Acta 775:169, 1984; Kim, et al. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze—thaw plus extrusion (see, e.g., Mayer, et al. Biochim. Biophys. Acta 858:161, 1986). uidization can be used when consistently small (50 to 200 nm) and 30 relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 67 W0 2013,:‘075035 PCT/US2012/065691 775: 169, 1984). These s are readily adapted to packaging RNAi agent ations into mes.
Liposomes that are pH—sensitive or negatively—charged entrap nucleic acid molecules rather than complex with them. Since both the nucleic acid les and the lipid are similarly charged, repulsion rather than complex formation occurs.
Nevertheless, some nucleic acid molecules are entrapped within the aqueous interior of these liposomes. pH—sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., l of Controlled Release, 19, (1992) 10 4).
One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed 15 from dimyristoyl atidylglycerol, while c fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol. 20 Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 678; WO 94/00569; WO 93/24640; W0 91/16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992. 25 In one embodiment, ic liposomes are used. Cationic mes possess the advantage of being able to fuse to the cell membrane. Non—cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by hages in vivo and can be used to deliver RNAi agents to macrophages.
Further advantages of liposomes include: liposomes obtained from natural 30 olipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents 68 W0 2013,:‘075035 PCT/U82012/065691 in their internal compartments from lism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," man, Rieger and Banker (Eds), 1988, volume 1, p. 245). ant considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
A positively charged tic cationic lipid, N—[l—(2,3—dioleyloxy)propyl]— N,N,N—trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid—nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Felgner, P. L. et al., Proc. 10 Natl. Acad. Sci., USA 8:7413—7417, 1987 and US. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).
A DOTMA analogue, 1,2-bis(oleoyloxy)(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA—complexing vesicles. LipofectinTM Bethesda Research Laboratories, Gaithersburg, Md.) is an 15 effective agent for the delivery of highly c nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact neously with vely charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive.
Positively charged complexes prepared in this way spontaneously attach to negatively 20 charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (“DOTAP”) (Boehringer im, Indianapolis, Indiana) differs from DOTMA in that the oleoyl es are linked by ester, rather than ether linkages. 25 Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties ing, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5— carboxyspermylglycine dioctaoleoylamide (“DOGS”) (TransfectamTM, Promega, n, Wisconsin) and itoylphosphatidylethanolamine 5—carboxyspermyl— 30 amide (“DPPES”) (see, 6.57., US. Pat. No. 5,171,678). 69 W0 2013,:‘075035 PCT/U82012/065691 r cationic lipid conjugate includes tization of the lipid with cholesterol (“DC-Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991).
Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. er al., Biochim. Biophys.
Acta 1065 :8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA—containing compositions. Other commercially available cationic lipid ts e DMRIE and DMRIE—HP (Vical, La Jolla, California) and 10 Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, nd). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.
Liposomal formulations are particularly suited for topical administration, liposomes present several ages over other formulations. Such advantages include 15 d side effects related to high systemic absorption of the administered drug, increased accumulation of the stered drug at the desired target, and the ability to administer RNAi agent into the skin. In some implementations, liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal s, e.g., into skin. For example, the liposomes can be applied 20 lly. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e. g., Weiner et al., Journal ofDrug Targeting, 1992, vol. 2,405—410 and du Plessis er al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and Fould- Fogerite, S., Biotechniques 6:682—690, 1988; Itani, T. et al. Gene 56:267—276. 1987; Nicolau, C. et al. Meth. Enz. 7—176, 1987; Straubinger, R. M. and 25 Papahadjopoulos, D. Meth. Enz. 101:512—527, 1983; Wang, C. Y. and Huang, L., Proc.
Natl. Acad. Sci. USA 84:7851—7855, 1987).
Non—ionic liposomal systems have also been ed to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic tant and cholesterol. Non—ionic liposomal formulations comprising Novasome I (glyceryl 30 dilaurate/cholesterol/polyoxyethylene—10—stearyl ether) and Novasome II (glyceryl distearate/ cholesterol/polyoxyethylene— lO—stearyl ether) were used to deliver a drug into 70 W0 2013,:‘075035 PCT/US2012/065691 the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.
Liposomes that e RNAi agent can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian 10 skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid ties, these transferosomes can be self-optimizing (adaptive to the shape of pores, 6.3., in the skin), self—repairing, and can frequently reach their targets t nting, and often self—loading. 15 Other formulations amenable to the present invention are described in United States provisional ation serial Nos. 61/018,616, filed y 2, 2008; 61/018,611, filed January 2, 2008; 61/039,748, filed March 26, 2008; 61/047,087, filed April 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no PCT/US2007/080331, filed October 3, 2007 also describes formulations that are amenable to the present 20 invention.
Surfactants Surfactants find wide application in formulations such as emulsions (including microemulsions) and mes (see above). RNAi agent (or a precursor, e.g., a larger dsiRNA which can be processed into a siRNA, or a DNA which encodes a siRNA or 25 precursor) compositions can include a surfactant. In one ment, the siRNA is formulated as an emulsion that es a surfactant. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile e (HLB). The nature of the hilic group provides the most useful means for categorizing the 30 different surfactants used in formulations (Rieger, in “Pharmaceutical Dosage Forms,” Marcel Dekker, Inc., New York, NY, 1988, p. 285). 71 W0 2013,:‘075035 PCT/US2012/065691 If the surfactant molecule is not ionized, it is classified as a nonionic surfactant.
Nonionic tants find wide application in pharmaceutical products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic tants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, an esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The yethylene surfactants are the most popular members of the nonionic surfactant 10 class.
If the surfactant le carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, ates such as alkyl 15 benzene sulfonates, acyl isethionates, acyl es and sulfosuccinates, and phosphates.
The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the tant is classified as cationic. Cationic surfactants include 20 quaternary ammonium salts and lated amines. The quaternary ammonium salts are the most used members of this class.
If the surfactant molecule has the ability to carry either a ve or negative , the surfactant is classified as eric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N—alkylbetaines and phosphatides. 25 The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in “Pharmaceutical Dosage Forms,” Marcel Dekker, Inc., New York, NY, 1988, p. 285).
Micelles and other Membranous Formulations The RNAi agents of the invention can also be provided as micellar formulations. 30 “Micelles” are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the 72 W0 2013,:‘075035 PCT/U82012/065691 hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
A mixed ar formulation suitable for ry through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA ition, an alkali metal C8 to C22 alkyl sulphate, and a micelle forming compound. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, ic acid, linolenic acid, monoolein, eates, 10 urates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, in, ycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof.
The micelle forming compounds may be added at the same time or after on of the 15 alkali metal alkyl sulphate. Mixed micelles will form with ntially any kind of mixing of the ingredients but vigorous mixing in order to provide r size micelles.
In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar 20 composition. In another method, the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.
Phenol and/or m—cresol may be added to the mixed micellar composition to 25 stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or m—cresol may be added with the micelle g ingredients. An ic agent such as glycerin may also be added after formation of the mixed micellar composition.
For ry of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is d with a propellant. The propellant, 30 which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one 73 W0 2013,:‘075035 PCT/U82012/065691 phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The sed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.
Propellants may include hydrogen—containing fluorocarbons, en— containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (l,l,l,2 tetrafluoroethane) may be used.
The ic concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often ble to increase, e.g., at least double or triple, the dosage for through injection 10 or administration h the gastrointestinal tract.
Particles In another embodiment, an RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by drying, but may also be produced by other methods including lyophilization, ation, fluid 15 bed drying, vacuum drying, or a combination of these techniques.
IV. Methods For Inhibiting TTR Expression The present invention also es methods of inhibiting expression of a transthyretin (TTR) in a cell. The methods include contacting a cell with an RNAi 20 agent, e. g., double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell, thereby inhibiting expression of TTR in the cell.
Contacting of a cell with an RNAi agent, e. g., a double stranded RNAi agent, may be done in vitro or in vivo. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi 25 agent. Combinations of in vitro and in viva methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate , e.g. a GalNAC3 ligand, or any other ligand that directs the RNAi , 30 agent to a site of interest, e.g., the liver of a subject. 74 W0 2013,:‘075035 2012/065691 The term iting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, essing”, and other similar terms, and includes any level of inhibition.
The phrase “inhibiting expression of a TTR” is intended to refer to inhibition of expression of any TTR gene (such as, e.g., a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene) as well as variants or s of a TTR gene.
Thus, the TTR gene may be a wild—type TTR gene, a mutant TTR gene (such as a mutant TTR gene giving rise to amyloid deposition), or a transgenic TTR gene in the context of a genetically manipulated cell, group of cells, or organism. 10 iting expression of a TTR gene” includes any level of inhibition of a TTR gene, e.g., at least partial suppression of the expression of a TTR gene. The expression of the TTR gene may be assessed based on the level, or the change in the level, of any variable associated with TTR gene expression, e.g., TTR mRNA level, TTR protein level, or the number or extent of amyloid deposits. This level may be assessed in an 15 individual cell or in a group of cells, including, for example, a sample derived from a subject.
Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with TTR expression compared with a control level.
The control level may be any type of control level that is utilized in the art, 6.57., a pre— 20 dose baseline level, or a level determined from a similar t, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
In some embodiments of the methods of the invention, expression of a TTR gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 25 20%, at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least 30 about 98%, or at least about 99%. 75 W0 2013,:‘075035 PCT/U82012/065691 Inhibition of the expression of a TTR gene may be manifested by a ion of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a TTR gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were present) such that the expression of a TTR gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)).
In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in 10 treated cells as a percentage of the level of mRNA in control cells, using the following formula: (mRNA in control cells) - (mRNA in d cells) 0100% (mRNA in control cells) Alternatively, inhibition of the expression of a TTR gene may be assessed in terms of a reduction of a parameter that is functionally linked to TTR gene expression, 15 e.g., TTR protein expression, retinol binding protein level, vitamin A level, or presence of amyloid deposits comprising TTR. TTR gene ing may be determined in any cell expressing TTR, either constitutively or by genomic ering, and by any assay known in the art. The liver is the major site of TTR expression. Other significant sites of expression include the d plexus, retina and pancreas. 20 Inhibition of the expression of a TTR protein may be manifested by a reduction in the level of the TTR protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample d from a subject). As explained above for the assessment of mRNA suppression, the inhibiton of protein expression levels in a treated cell or group of cells may rly be sed as a percentage of the level of protein 25 in a control cell or group of cells.
A control cell or group of cells that may be used to assess the inhibition of the expression of a TTR gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) 30 prior to treatment of the subject with an RNAi agent. 76 W0 2013,:‘075035 PCT/U82012/065691 The level of TTR mRNA that is expressed by a cell or group of cells, or the level of circulating TTR mRNA, may be ined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of TTR in a sample is determined by ing a transcribed polynucleotide, or portion thereof, e.g., mRNA of the TTR gene. RNA may be extracted from cells using RNA extraction ques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; esis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run—on assays, RT—PCR, RNase protection assays (Melton 10 er al., Nuc. Acids Res. 12:7035), rn blotting, in situ hybridization, and microarray analysis. Circulating TTR mRNA may be detected using methods the described in PCT/U82012/043584, the entire contents of which are hereby incorporated herein by reference.
In one embodiment, the level of expression of TTR is determined using a nucleic 15 acid probe. The term "probe", as used herein, refers to any molecule that is capable of selectively binding to a specific TTR. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. 20 Isolated mRNA can be used in hybridization or amplification assays that e, but are not limited to, Southern or Northern analyses, polymerase chain reaction (PCR) es and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TTR mRNA. In one embodiment, the mRNA is immobilized on a solid surface and 25 ted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the s) are lized on a solid surface and the mRNA is contacted with the s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the 30 level of TTR mRNA. 77 W0 ‘075035 PCT/U82012/065691 An alternative method for ining the level of expression of TTR in a sample involves the s of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT—PCR (the experimental embodiment set forth in Mullis, 1987, US. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189—193), self sustained ce replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874—1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173—1177), Q—Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., US. Pat. No. 5,854,033) or any other c acid 10 amplification method, ed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of TTR is determined by quantitative fluorogenic RT—PCR (i.e. the TaqManTM ). , 15 The expression levels of TTR mRNA may be red using a membrane blot (such as used in hybridization analysis such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See US. Pat. Nos. 5,770,722, 219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of TTR 20 expression level may also comprise using nucleic acid probes in solution.
In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the es presented herein.
The level of TTR protein expression may be determined using any method 25 known in the art for the measurement of n levels. Such methods include, for example, ophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion 30 (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), 78 W0 2013,:‘075035 PCT/U82012/065691 enzyme—linked immunosorbent assays (ELISAs), fluorescent assays, electrochemiluminescence assays, and the like.
In some embodiments, the efficacy of the methods of the invention can be monitored by detecting or monitoring a reduction in an amyloid TTR deposit. ng an amyloid TTR deposit, as used , includes any decrease in the size, number, or severity of TTR deposits, or to a tion or reduction in the formation of TTR deposits, within an organ or area of a subject, as may be assessed in vitro or in viva using any method known in the art. For example, some methods of assessing amyloid deposits are described in Gertz, M.A. & mar, S.V. (Editors) (2010), Amyloidosis: 10 Diagnosis and Treatment, New York: Humana Press. Methods of assessing amyloid deposits may include biochemical analyses, as well as visual or computerized assessment of d deposits, as made visible, e.g., using immunohistochemical ng, fluorescent labeling, light microscopy, on microscopy, fluorescence microscopy, or other types of microscopy. Invasive or noninvasive imaging ties, 15 including, e.g., CT, PET, or NMR/MRI g may be employed to assess amyloid deposits.
The methods of the invention may reduce TTR deposits in any number of tissues or regions of the body including but not limited to the heart, liver, spleen, esophagus, stomach, intestine (ileum, duodenum and colon), brain, sciatic nerve, dorsal root 20 ganglion, kidney and retina.
The term “sample” as used herein refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a t.
Examples of biological fluids include blood, serum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the like. Tissue samples may include 25 samples from s, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those s. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes), the retina or parts of the retina (e.g., retinal pigment epithelium), the central nervous system 30 or parts of the central nervous system (e.g., ventricles or choroid plexus), or the pancreas or certain cells or parts of the as. In preferred embodiments, a “sample derived 79 W0 2013,:‘075035 PCT/U82012/065691 from a subject” refers to blood or plasma drawn from the t. In further embodiments, a e d from a subject” refers to liver tissue or retinal tissue derived from the subject.
In some embodiments of the methods of the invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site within the subject. The inhibition of expression of TTR may be assessed using measurements of the level or change in the level of TTR mRNA or TTR protein in a sample derived from fluid or tissue from the specific site within the subject. In preferred embodiments, the site is selected from the group consisting of liver, choroid plexus, retina, and 10 as. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites (e.g., hepatocytes or retinal pigment epithelium). The site may also include cells that express a particular type of receptor (e.g., hepatocytes that express the asialogycloprotein receptor). 15 V. Methods for Treating or Preventing a TTR-Associated Disease The present invention also provides methods for treating or preventing a TTR— ated disease in a subject. The methods include administering to the t a therapeutically effective amount or lactically ive amount of an RNAi agent of the invention. 20 As used herein, a "subject" includes either a human or a non—human animal, preferably a vertebrate, and more preferably a mammal. A subject may include a transgenic organism. Most ably, the subject is a human, such as a human suffering from or predisposed to ping a TTR—associated disease.
In some embodiments, the subject is suffering from a TTR—associated disease. In 25 other embodiments, the subject is a subject at risk for developing a TTR—associated e, e.g., a subject with a TTR gene mutation that is associated with the development of a TTR associated disease, a subject with a family history of TTR—associated disease, or a subject who has signs or symptoms ting the development of TTR amyloidosis. 30 A ssociated disease,” as used herein, includes any disease caused by or associated with the formation of amyloid deposits in which the fibril precurosors consist 80 W0 2013,:‘075035 PCT/U82012/065691 of variant or wild—type TTR protein. Mutant and wild—type TTR give rise to various forms of amyloid deposition (amyloidosis). Amyloidosis involves the formation and aggregation of misfolded proteins, resulting in extracellular deposits that impair organ function. Climical syndromes associated with TTR aggregation e, for example, senile systemic amyloidosis (SSA); systemic familial dosis; familial amyloidotic polyneuropathy (FAP); familial amyloidotic cardiomyopathy (FAC); and leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) dosis, or amyloidosis VII form.
In some embodiments of the methods of the invention, RNAi agents of the 10 invention are stered to subjects suffering from familial amyloidotic cardiomyopathy (FAC) and senile systemic amyloidosis (SSA). Normal—sequence TTR causes c amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by microscopic deposits in many other . 15 TTR mutations accelerate the process of TTR d formation and are the most important risk factor for the development of clinically significant TTR amyloidosis (also called ATTR (amyloidosis—transthyretin type)). More than 85 dogenic TTR variants are known to cause systemic familial amyloidosis.
In some embodiments of the methods of the invention, RNAi agents of the 20 invention are administered to subjects suffering from transthyretin (TTR)—related familial amyloidotic polyneuropathy (FAP). Such subjects may suffer from ocular manifestations, such as vitreous opacity and glaucoma. It is known to one of skill in the art that amyloidogenic transthyretin (ATTR) synthesized by retinal pigment epithelium (RPE) plays important roles in the progression of ocular amyloidosis. Previous studies 25 have shown that panretinal laser photocoagulation, which reduced the RPE cells, prevented the progression of amyloid deposition in the vitreous, indicating that the effective ssion of ATTR expression in RPE may become a novel y for ocular amyloidosis (see, e.g., Kawaji, T., et al., Ophthalmology. (2010) 117: 552-555).
The methods of the invention are useful for ent of ocular manifestations of TTR 30 related FAP, e.g., ocular amyloidosis. The RNAi agent can be red in a manner suitable for targeting a ular , such as the eye. Modes of ocular delivery 81 W0 2013,:‘075035 PCT/U82012/065691 e retrobulbar, subcutaneous eyelid, subconjunctival, subtenon, anterior r or intravitreous ion (or internal injection or infusion). Specific formulations for ocular delivery include eye drops or ointments.
Another TTR—associated disease is hyperthyroxinemia, also known as “dystransthyretinemic hyperthyroxinemia” or “dysprealbuminemic hyroxinemia”.
This type of hyperthyroxinemia may be secondary to an increased association of thyroxine with TTR due to a mutant TTR le with increased affinity for thyroxine.
See, e.g., Moses et al. (1982) J. Clin. Invest, 86, 033.
The RNAi agents of the invention may be administered to a subject using any 10 mode of administration known in the art, ing, but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any ations thereof. In preferred embodiments, the agents are administered subcutaneously.
In some embodiments, the administration is Via a depot injection. A depot 15 injection may release the RNAi agent in a consistent way over a prolonged time period.
Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e. g., a desired inhibition of TTR, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include aneous ions or intramuscular injections. In preferred embodiments, 20 the depot injection is a subcutaneous injection.
In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, aneous, arterial, 25 or epidural infusions. In preferred embodiments, the infusion pump is a aneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.
Other modes of administration include epidural, intracerebral, intracerebroventricular, nasal administration, rterial, intracardiac, intraosseous 30 infusion, intrathecal, and intravitreal, and pulmonary. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the 82 W0 2013,:‘075035 PCT/U82012/065691 area to be treated. The route and site of administration may be chosen to enhance targeting.
In some embodiments, the RNAi agent is administered to a subject in an amount effective to inhibit TTR expression in a cell within the t. The amount effective to inhibit TTR expression in a cell within a subject may be assessed using methods discussed above, ing methods that involve assessment of the inhibition of TTR mRNA, TTR protein, or related variables, such as d deposits.
In some embodiments, the RNAi agent is administered to a subject in a therapeutically or prophylactically effective amount. 10 "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a patient for treating a TTR associated disease, is sufficient to effect ent of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease).
The peutically effective amount" may vary depending on the RNAi agent, how the 15 agent is administered, the disease and its ty and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by TTR sion, the types of preceding or concomitant treatments, if any, and other individual teristics of the patient to be treated.
“Prophylactically effective amount,” as used herein, is intended to e the 20 amount of an RNAi agent that, when administered to a subject who does not yet experience or y symptoms of a TTR—associated disease, but who may be posed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. ms that may be ameliorated e sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., 25 gastrointestinal dysfunction, such as gastric ulcer, or orthostatic nsion), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, pathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy. Ameliorating the disease includes slowing 30 the course of the disease or reducing the severity of later—developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the 83 W0 2013,:‘075035 PCT/U82012/065691 agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the t to be treated.
A "therapeutically—effective amount" or “prophylacticaly effective amount” also includes an amount of an RNAi agent that es some desired local or systemic effect at a able benefit/risk ratio applicable to any treatment. RNAi agents ed in the methods of the present invention may be administered in a ient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
As used herein, the phrases peutically effective amount” and 10 “prophylactically effective amount” also include an amount that provides a benefit in the treatment, prevention, or management of ogical processes or symptom(s) of pathological processes mediated by TTR expression. ms of TTR amyloidosis include sensory neuropathy (e.g. paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic 15 hypotension), motor neuropathy, seizures, dementia, athy, polyneuropathy, carpal tunnel syndrome, autonomic iciency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI ied Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy.
The dose of an RNAi agent that is administered to a subject may be tailored to 20 balance the risks and benefits of a particular dose, for example, to achieve a desired level of TTR gene suppression (as assessed, 6.57., based on TTR mRNA suppression, TTR protein expression, or a ion in an amyloid deposit, as defined above) or a desired therapeutic or prophylactic effect, while at the same time avoiding undesirable side effects. 25 In one embodiment, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, n about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 30 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 84 W0 2013,:‘075035 PCT/US2012/065691 30 mg/kg, n about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.
In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 11 mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, 10 about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg.
In some ments, the RNAi agent is stered in two or more doses. If 15 desired to facilitate repeated or nt infusions, implantation of a delivery device, e.g., a pump, semi—permanent stent (e.g., intravenous, intraperitoneal, intracistemal or intracapsular), or reservoir may be advisable. In some embodiments, the number or amount of subsequent doses is dependent on the achievement of a desired , 6.57., the suppression of a TTR gene, or the achievement of a therapeutic or prophylactic 2O effect, e. g., reducing an amyloid deposit or reducing a symptom of a TTR—associated disease. In some embodiments, the RNAi agent is administered according to a schedule.
For example, the RNAi agent may be administered twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced strations, e.g., hourly, every four hours, every six 25 hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In other embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g., about every 6 30 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 85 W0 2013,:‘075035 2012/065691 72 hours) followed by a longer time period (e.g., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the RNAi agent is not administered. In one embodiment, the RNAi agent is initially administered hourly and is later administered at a longer interval (e.g., daily, , biweekly, or monthly). In another embodiment, the RNAi agent is lly administered daily and is later administered at a longer interval (e.g., weekly, ly, or y). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a specific embodiment, the RNAi agent is administered once daily during a first week, followed by weekly dosing 10 starting on the eighth day of administration. In another specific embodiment, the RNAi agent is administered every other day during a first week ed by weekly dosing starting on the eighth day of stration.
Any of these schedules may optionally be repeated for one or more iterations.
The number of iterations may depend on the achievement of a desired , e.g., the 15 suppression of a TTR gene, retinol binding protein level, vitamin A level, and/or the achievement of a therapeutic or prophylactic effect, e.g., reducing an amyloid deposit or reducing a symptom of a TTR—associated disease.
In some embodiments, the RNAi agent is administered with other therapeutic agents or other therapeutic regimens. For example, other agents or other therapeutic 20 regimens suitable for treating a TTR—associated disease may include a liver transplant, which can reduce mutant TTR levels in the body; Tafamidis (Vyndaqel), which kinetically stabilizes the TTR er preventing tetramer dissociation required for TTR dogenesis; and diuretics, which may be employed, for example, to reduce edema in TTR amyloidosis with cardiac involvement. 25 In one embodiment, a subject is administered an initial dose and one or more maintenance doses of an RNAi agent. The maintenance dose or doses can be the same or lower than the initial dose, e.g., one—half of the initial dose. A maintenance regimen can include treating the subject with a dose or doses ranging from 0.01 ug to 15 mg/kg of body weight per day, e.g., 10 mg/kg, 1 mg/kg, 0.1 mg/kg, 0.01 mg/kg, 0.001 mg/kg, 30 or 0.00001 mg/kg of bodyweight per day. The maintenance doses are, for example, administered no more than once every 2 days, once every 5 days, once every 7 days, 86 W0 2013,:‘075035 PCT/U82012/065691 once every 10 days, once every 14 days, once every 21 days, or once every 30 days.
Further, the treatment regimen may last for a period of time which will vary depending upon the nature of the particular e, its severity and the overall condition of the patient. In certain ments the dosage may be delivered no more than once per day, e.g., no more than once per 24, 36, 48, or more hours, e.g., no more than once every 5 or 8 days. ing treatment, the patient can be monitored for changes in his/her condition. The dosage of the RNAi agent may either be increased in the event the patient does not d significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, if the 10 disease state has been ablated, or if undesired side—effects are ed.
VI. Kits The present invention also provides kits for performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g., 15 instructions for inhibiting expression of a TTR in a cell by contacting the cell with the RNAi agent(s) in an amount effective to inhibit expression of the TTR. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g. , an ion device), or means for measuring the inhibition of TTR (e.g., means for measuring the inhibition of TTR mRNA or TTR protein). Such means for measuring the 20 tion of TTR may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for ining the therapeutically effective or prophylactically effective amount. 25 This invention is further rated by the ing examples which should not be construed as limiting. The contents of all references and published patents and patent applications cited throughout the application are hereby incorporated herein by reference. 30 87 W0 2013,:‘075035 PCT/U82012/065691 EXAMPLES Example 1: Inhibition of TTR with lNAc conjugates A single dose of the TTR RNAi agent AD—43527 was administered to mice subcutaneously and TTR mRNA levels were determined 72 hours post administration. 5 The mouse/rat cross—reactive GalNAc—conjugate, AD—43527, was chosen for in viva evaluation in WT C57BL/6 mice for silencing of TTR mRNA in liver. The sequence of each strand of AD—43527 is shown below. : s: sense; as: antisense Duflex# Strand Oligo Sequence 5’ to 3’ AD—43527 A— AfaCfaGququfchquchchanaAfL96 (SEQ 89592 ID NO: A— uUfanaGfaGfcAfaGfaAchchngfusUfsu (SEQ 83989 ID NO: L96 = GalNAc3; lowercase nts (a,u,g,c) are 2’—O—methyl nucleotides, Nf (i.e., Af) is a 2’—fluoro nucleotide 10 The ligand used was GalNAC3: 15 This GalNAc3 ligand was conjugated to the 3’—end of the sense strand using the linker and tether as shown below: 88 W0 2013,:‘075035 PCT/U82012/065691 —0\P40 OH 90/6 \n‘“ < S N H N O O The structure of the resulting GalNAc3 conjugated sense strand is shown in the following schematic: onal RNAi agents that target TTR and have the following sequences and modifications were synthesized and assayed.
Mouse/rat cross reactive TTR RNAi agents Sense strand 5‘-3‘ Antisense strand 5‘-3‘ AD- AfaCfaGququchquchchfanaAfQl 1L96 GfachAfaGfaAchchngfusUfsu 43528 (SEQ ID NO: 10) (SEQ ID NO: 11) 10 Human/cyno cross reactive TTR RNAi agents; parent duplex is AD-18328 [having a sense strand 5’-3’ sequence of GuAAccAAGAGuAuuccAudeT (SEQ ID NO: 12) and antisense strand 5’ to 3’ sequence of AUGGAAuACUCUUGGUuACdeT (SEQ ID 15 NO: 13) with the following modifications: alternating 2'F/2'OMe w/2 PS on AS.
Sense strand 5‘-3‘ Antisense strand 5‘-3‘ angGfaAquchchqungquchfustsa 45163 (SEQ ID NO: 14) (SEQ ID NO: 16) AD- faCfcAfaGfaGququchfanQl 1L96 anngaAquchchqungquchfustsa 45164 (SEQ ID NO: 15) (SEQ ID NO: 17) L96 2 GalNAC3; lowercase nts (a,u,g,c) are 2’—O—methyl tides, Nf (i.e., Af) is a 2’— fluoro nucleotide; Q11 is cholesterol; 8 is phosphorothioate. 20 89 W0 2013,:‘075035 PCT/U82012/065691 AD—43527 was administered to female C57BL/6 mice (6-10 weeks, 5 per group) via subcutaneous injection at a dose volume of 10ul/g at a dose of 30, 15, 7.5, 3.5, 1.75 or 0.5 mg/kg of AD-43527. Control animals received PBS by subcutaneous injection at the same dose volume.
After approximately seventy two hours, mice were anesthetized with 200 ul of ketamine, and then exsanguinated by severing the right caudal artery. Liver tissue was collected, flash—frozen and stored at —80°C until processing.
Efficacy of treatment was evaluated by measurement of TTR mRNA in the liver at 72 hours post—dose. TTR liver mRNA levels were assayed utilizing the Branched 10 DNA assays— QuantiGene 1.0 (Panomics). Briefly, mouse liver samples were ground and tissue lysates were prepared. Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volume of nuclease-free water and 10111 of Proteinase-K/ml for a final concentration of 20mg/ml) was incubated at 65 °C for 35 minutes. 5 ul of liver lysate and 95 ul of working probe set (TTR probe for gene target and GAPDH for endogenous 15 control) were added into the Capture Plate. Capture Plates were incubated at 53 °C i1 °C (aprx. 16—20hrs). The next day, the Capture Plates were washed 3 times with 1X Wash Buffer (nuclease—free water, Buffer ent 1 and Wash Buffer Component 2), then dried by fuging for 1 minute at 240g. 100ul of ier Probe mix per well was added into the e Plate, which was sealed with aluminum foil and incubated 20 for 1 hour at 46°C i1°C. Following a 1 hour incubation, the wash step was repeated, then 100p] of Label Probe mix per well was added. Capture plates were ted at 46 °C i1 0C for 1 hour. The plates were then washed with 1X Wash Buffer, dried and 100ul substrate per well was added into the Capture . e Plates were incubated for 30 minutes at 46°C followed by incubation for 30 s at room 25 ature. Plates were read using the SpectraMax Luminometer following incubation. bDNA data were analyzed by subtracting the average background from each duplicate sample, averaging the resultant duplicate GAPDH (control probe) and TTR (experimental probe) values, and then ing the ratio: (experimental probe— background)/(control probe—background). The average TTR mRNA level was 30 calculated for each group and normalized to the PBS group average to give relative TTR mRNA as a % of the PBS control group. 90 W0 2013,:‘075035 PCT/US2012/065691 The results are shown in Figure 1. The GalNAc conjugated RNAi agent targeting TTR had an ED50 of approximately 5 mg/kg for TTR mRNA knockdown.
These results demonstrate that GalNAc conjugated RNAi agents that target TTR are effective at inhibiting expression of TTR mRNA.
Example 2: Inhibition of TTR with TTR-GalNAc conjugates is e Mice were administered a subcutaneous dose (either 7.5 or 30.0 mg/kg) of AD— 43527, a GalNAc conjugated RNAi agent that targets TTR. The TTR mRNA levels in the liver were evaluated at 1, 3, 5, 7, 10, 13, 15, 19, 26, 33, and 41 days post treatment 10 using the method described in Example 1.
The results are shown in Figure 2. At day 19, administration of 30.0 mg/kg GalNAc conjugated RNAi agents still showed about 50% silencing. Full recovery of expression ed at day 41.
These results demonstrated that the inhibition ed by GalNAc conjugated 15 siRNA ing TTR is durable, lasting up to 3, 5, 7, 10, 13, 15, 19, 26 or 33 days post treatment.
Example 3. RNA Synthesis and Duplex Annealing 20 1. Oligonucleotide Synthesis Oligonucleotides were synthesized on an AKTAoligopilot synthesizer or an ABI 394 synthsizer. Commercially available controlled pore glass solid support (dT-CPG, 500A, Prime Synthesis) and RNA phosphoramidites with standard protecting groups, 5’— thoxytrityl N6—benzoyl—2 ’ —t—butyldimethylsilyl—adenosine—3 ’ —O—N,N’ - 25 diisopropyl—2—cyanoethylphosphoramidite, 5 ’ ethoxytrityl—N4—acetyl—2’ —t— butyldimethylsilyl—cytidine—3 ’ —0—N,N’ —diisopropyl—2—cyanoethylphosphoramidite, 5 ’ —0— oxytrityl—N2——isobutryl—2’ —t—butyldimethylsilyl—guanosine—3 ’—0—N,N ’ —diisopropyl— 2—cyanoethy1phosphoramidite, and 5 ’ —0—dimethoxytrityl—2’ —t—butyldimethylsilyl—uridine— 3’—O—N,N’—diisopropyl—2—cyanoethylphosphoramidite (Pierce Nucleic Acids 30 Technologies) were used for the ucleotide synthesis unless otherwise specified.
The 2’—F phosphoramidites, 5 ’ — 0—dimethoxytrityl—N4—acetyl-2’ -fluro—cytidine—3 ’ — 0— 91 W0 2013.:‘075035 PCT/U82012/065691 N,N’—diisopropyl—2—cyanoethyl—phosphoramidite and 5’ dimethoxytrityl—2’—fluro— uridine-3’-O-N,N’-diisopropylcyanoethyl-phosphoramidite were purchased from (Promega). All phosphoramidites were used at a concentration of 0.2M in acetonitrile ) except for guanosine which was used at 0.2M concentration in 10% THF/ANC (v/v). Coupling/recycling time of 16 minutes was used. The activator was 5—ethyl thiotetrazole (0.75M, American International Chemicals), for the PO—oxidation Iodine/Water/Pyridine was used and the PS—oxidation PADS (2 %) in 2,6—lutidine/ACN (1:1 v/v) was used.
Ligand conjugated s were synthesized using a solid support containing the 10 corresponding ligand. For example, the introduction of a carbohydrate moiety/ligand (for e. g., GalNAc) at the 3’—end of a sequence was achieved by starting the synthesis with the corresponding carbohydrate solid support. Similarly a cholesterol moiety at the 3’—end was introduced by ng the synthesis on the cholesterol support. In general, the ligand moiety was tethered to trans—4—hydroxyprolinol via a tether of choice as 15 described in the previous examples to obtain a hydroxyprolinol—ligand moiety. The hydroxyprolinol—ligand moiety was then coupled to a solid t via a succinate linker or was converted to phosphoramidite via rd phosphitylation ions to obtain the desired carbohydrate conjugate building blocks. Fluorophore labeled siRNAs were synthesized from the ponding oramidite or solid support, purchased from 20 Biosearch Technologies. The oleyl lithocholic (GalNAc)3 polymer support made in house at a loading of 38.6 ram. The e (Man)3 polymer support was also made in house at a loading of 42.0 umol/gram.
Conjugation of the ligand of choice at the desired position, for example at the 5’— end of the sequence, was achieved by coupling of the corresponding phosphoramidite to 25 the growing chain under standard phosphoramidite coupling conditions unless otherwise specified. An extended 15 minute coupling of 0.1M solution of phosphoramidite in anhydrous CH3CN in the presence of 5—(ethylthio)—1H—tetrazole activator to a solid bound oligonucleotide. ion of the internucleotide phosphite to the phosphate was d out using standard —water as reported in Beaucage, S.L. (2008) Solid— 30 phase synthesis of siRNA oligonucleotides. Curr. Opin. Drug Discov. Devel., 11, 203— 216; Mueller, 8., Wolf, J. and Ivanov, SA. (2004) Current Strategies for the Synthesis 92 W0 2013,:‘075035 PCT/U82012/065691 of RNA. Curr. Org. Synth, 1, 293—307; Xia, J ., Noronha, A., Toudjarska, 1., Li, R, Akinc, A., Braich, R., Kamenetsky, M., Rajeev, K.G., Egli, M. and Manoharan, M. (2006) Gene Silencing Activity of siRNAs with a Ribo—difluorotoluyl Nucleotide.
ACS Chem. Biol., 1, 176—183 or by treatment with tert—butyl hydroperoxide/acetonitrile/water (10: 87: 3) with a 10 minute oxidation wait time ated oligonucleotide. Phosphorothioate was introduced by the oxidation of phosphite to phosphorothioate by using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS and or ge t The cholesterol phosphoramidite was sized in house, and used at a concentration of 0.1 M in 10 dichloromethane. Coupling time for the cholesterol phosphoramidite was 16 minutes. 2. ection- I (Nucleobase Deprotection) After completion of synthesis, the support was transferred to a 100 ml glass bottle (VWR). The ucleotide was cleaved from the support with simultaneous 15 deprotection of base and phosphate groups with 80 mL of a mixture of ethanolic ammonia [ammoniaz ethanol (3:1)] for 6.5h at 55°C. The bottle was cooled briefly on ice and then the ethanolic ammonia mixture was filtered into a new 250 m1 bottle. The CPG was washed with 2 x 40 mL portions of ethanol/water (1:1 v/v). The volume of the mixture was then reduced to ~ 30 ml by roto—vap. The mixture was then frozen on dry 20 ice and dried under vacuum on a speed vac. 3. Deprotection-II (Removal of 2’ TBDMS group) The dried residue was resuspended in 26 ml of triethylamine, triethylamine rofluoride (TEA.3HF) or pyridine—HF and DMSO (3:426) and heated at 60°C for 25 90 minutes to remove the tert—butyldimethylsilyl (TBDMS) groups at the 2’ position.
The reaction was then quenched with 50 ml of 20mM sodium acetate and pH adjusted to 6.5, and stored in freezer until purification. 93 W0 2013,:‘075035 PCT/U82012/065691 4. Analysis The oligonucleotides were analyzed by high-performance liquid chromatography (HPLC) prior to purification and selection of buffer and column depends on nature of the sequence and or conjugated ligand. 5. HPLC Purification The ligand conjugated oligonucleotides were purified by reverse phase preparative HPLC. The unconjugated oligonucleotides were purified by anion—exchange HPLC on a TSK gel column packed in house. The buffers were 20 mM sodium phosphate (pH 8.5) 10 in 10% CH3CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH3CN, 1M NaBr (buffer B). ons containing full—length oligonucleotides were pooled, desalted, and lyophilized. Approximately 0.15 OD of desalted ucleotidess were diluted in water to 150 pl and then pipetted in special Vials for CGE and LC/MS analysis. Compounds were finally ed by LC—ESMS and CGE. 15 6. RNAi Agent preparation For the ation of an RNAi agent, equimolar amounts of sense and antisense strand were heated in 1XPBS at 95°C for 5 minutes and slowly cooled to room temperature.
The integrity of the duplex was confirmed by HPLC analysis. Table 1 below reflects the 20 RNAi agents which target human or rodent TTR mRNA. 94 W0 2013f075035 PCT/U82012/065691 000.0 0000.0 M6000 mnood mood mm00.0 mm00.0 mm00.0 030.0 3030.0 3030.0 330.0 0330.0 330.0 m30.0 m30.0 m30.0 mmfiod 030.0 030.0 mmfiod Scarce/021500.; 00.0 _>_: 50.0 wmd mm.0 mm.0 $0.0 mm.0 om.0 mod mm.0 .vm.0 90.0 mmd Hmd 000.0 #50 30.0 5.0 50.0 0025000 0.0 _>_: 0.0 00.0 03.0 N30 m3.0 33.0 03.0 .30 33.0 .30 .30 03.0 m3.0 3.0 030 0.3.0 03.0 20.0 .30 N0 03.0 .008 3.00 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 00.0 0030020000500000 0205060850202000052 00500202050000850302250050 0000002020500608502022505m 00500202005000080002022.0005m 08038050003003000<<003< 0050020200500.608502022505m 005002020205085020205050 005002020005085020205050 005002020505050502020505m 0050000802020030053000300 0050500052020030053005300 0000.5820.32008502020505m 00500600032020:000055505300 000000800:0:00.000505022000505m 3000320255000:85020230050 $0003202300635008250200005% 3000520205000:850202000030 00508000002020:000002005200 02050000850202000050 0232900850202000050 0050020203000:85023002500500 G00 0_ ”OZ Ea «000 0000 0000 0000 0000 0000 0000 0000 0000 0000 «N00 0000 I0000 92 00002 00000< 00002 00002 00002 00002 00000< 00000< 00002 m0000< 00002 00000< 00002 EEEaEaEa mfisoobm 900.: 50000050230 5 no 0200033 can 0000020000000 0000005022000022000023002 3000000203.605220000230002 500000:02200522000023002 500000:02200522000023002 00080330038900.0030 500.00:020.60522000023002 500.605020.605228223002 0522000223002 =0800<00<0000000000000000m 200220002050520005025505 2002050205052835000505 5000005023006228223050 20020000005052.0005020505 0.088%0.0000008008000000m 5030053332,023020602 052320028020002 58000530030000035000.0005: 200238225052000.50.30055 5000005022000020300020002 50000050220000228023002 3000000203.600022000023032 000830 80 0_ HOZ 00 00 00 00 NN 00 «0 00 00 R 00 00 00 00 0». 00I00 22% 90 EEaa00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 MEMaHaHE "H 2an 0.6.000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 00000 95 WO 2013075035 PCT/U82012/065691 90.0 H300 mofiod wofiod 00.8.0 whaod wfiod wfiod wfiod nmfiod mfiod HN0.0 NHN0.0 oHNod NNN0.0 .vaod mmNod mmNod mN0.0 mN0.0 NmN0.0 mmNod NNOd ENQO wNod 0m0.0 .quod «0.0 «0.0 mod mud N50 No.0 No.0 mud nmd Nw.0 omd mud No.0 mud mm.0 om.0 050 no.0 mod de mmd mw.0 «N0 BNO 3.0 mN.0 wad 2.0 mad $0 R0 8.0 3.0 #0 0N0 000 3.0 3.0 Sud mm.0 .390 mad BNO BNO 3.0 0m.0 mN.0 mad :0 000 80 000 «00 30 H0 :0 m00 80 000 N00 3.0 m0.0 00.0 ways3023320:equge/EQDN 3.88080323002823800380: 30032023005:ESUZSZEGEDN 853003032020:525300520: 353002032020:303200520: 3535502020:330200520: Esmmbubszgm:3030290530: $00380%:SEBSEBSEEWoEE <0mofl0<00§00009000000050<<0800<0 8536832220:3095360530: $53202:3063992020225552 3532023506:85023225053 85365320205895550530: £99&0:seguesgfiagofl:m 855020022200NUNSEoWSEUJ UWSEUUEZNEWS3030300330: 3538802020:530300530: 3530.9000220230$550320: 3532022005:8502322505m 3532023006:8502:2390? 2532022005:8502333005: 350302032220:3033005303 30032023006:8502523005m fiomefizfiafio:85023230053 20$:£02:3900305502§05m 3006:SSUEEEoWSN 853008020205309200530: EaEaEaEa mm: 93 2: M3: 3: mm: 00: B: £82 £82 EEEaEaEaEaEaEaEaEaEa $32 $.32 $32 EaEaEaEaE5 382 $82 382 Swabs:NSWNWEEUEZJMSN <0mmm<88m<3003<80333000020 .53883230£2$<5£<20§< 02930262:320605 0302300225052695330605 03023000300526=5020505 03028023005262:020505 $3830:fluoumm<0<08<0<0380<0 023003050303050205093 03023003300526:325505 328:3220252282230=2 53ng3296flozzubgaoaé 025553035320505 550053230£o£<§$<aoa< 30230023005283020505 023005£030325505 2$005283:025505 20003053000283520055 525%322030225£3032 52852/36aofifibmzegé .5232.3230£9$§0£<20§< 002250520033320503 55005330302253<303< 550%3230£0§§0£<20§< 52855:NGGNMEEBEEJWSN 53830023039336£3032 0302300225053030025505 REEEggHagEgg!E aEI !EH £08 083 $08 088 088 £03 303 303 £08 088 GEEHagHagEggHagHagEggHagHagGEE $08 088 088 HagMagEggHagHag 308 $08 $08 96 WO 2013075035 PCT/US2012/065691 omod nmod mnmod 0<0.0 Nvod 30.0 55.0 95.0 0m0.0 Hmod mmod wmod omod mm0.0 mm0.0 «00.0 «00.0 000.0 000.0 0h0.0 Nnod «no.0 mnod nmhod Nwod mwod owod no.0 mud mud owd N50 mud 0.0 mod No.0 wwd 0.0 mud mod NWO mw.0 N50 N50 N00 «0.0 mud «0.0 mwd mud mud mN.0 mN.0 mud 3V0 NN.0 Hmd m¢.0 0N0 «N0 N¢.0 omd 0N0 50:0 .1010 0N0 Nm.0 «m0 mm.0 nmd mm.0 mwd N<.0 wN.0 mmd 2V0 8.0 00.0 N3 H0 H0 NS 000 30 NS :0 00 H0 NS NS 20 :0 :0 30 30 00.0 3.0 m0.0 3.0 3.0 3505:853<2<m505m 353282220+92282023225552 35380003222053030300330: $03202380003883323008m mflow33230000300502323003m my?e302329030053<a<<8000% my?3202300630050303230022 $53202300630050282000020 $036?00030000<=<800m mmama/:023290320302323905m £03202:800038830323003m $032023005300500282000020 $30830:30838080030200032 §0§§<30052380023230032 mmam3322005200502323005m 3038232000888022300820 m$03202303020200<EE<£00ER. 363202300530050282000020 m$03202300830053530£832.. mmam3523006300502323005m 303282322030203<3<<8000% £9582530558569220052 m$932023000303202323003m 85300803222053030200320: mmu,0030300333303003353803:m $532023006300503330£005m $53£02:39002050302855m Ea mm: I00HH mm: $8 8: 232 832 EEEaEaEEEaEaEEEaEaEaHEEaHEHEHEEaHEEaEaEEEa Nwofimd‘ $82 ES? 523050220egsfibmzaogz 328332302522822303< 20022602300533320505 525053<smmmmm8£<aoa< 338000852320£83??? 328000852320$532303: 528.8535000aoefiugaosé 32.8000852030335??? 03053308282302 538.5smaommafiueimg 53.0033230820323032 25320$532303: 8260030£00m0<0<08<0<0§0m SQBESEE00<0+0£<5£<303< 33800325320£33283: 2080830802080ER. 20:20£03<5£<303< 33800flufiaoeogsgsmg 2020m0oe<20m+<303< 3380030520303582303: 32.800BEanomzsgsmzz 3320:325030205235? 522005aémaofifigugaosz Emmaflufiaawseug330605 5030053.0393009396933032 S5033330ggefibfiéfi 5285533208228223052 no 0“ E E m E 8 mm mm E 00 a!! E308 0008 EEEEaEEaEaaaaEaEEaEEE3mnofim $03 $08 M308 $08 0008 808 808 9.08 8.08 3.08 0008 $.08 0008 308 0008 $08 $08 $08 308 0008 0008 $08 0008 808 088 :08 NNOHD $08 $08 97 WO 2013075035 PCT/U82012/065691 mwod mwod mmod mood mood mood moHd oofid moHd 0.3.0 ONHd 002.0 03.0 ONHd NNHd mNHd mNHd omad mmad NSWO 93.0 53.0 53.0 Hmfid Nde Nde wmfid N50 owd mod 0nd and mwd mwd <50 mmd mud mwd 5.0 mwd mwd n50 mod mwd 0nd mwd nwd mwd mwd N50 .36 mfid 010 de wmd N._V.o Bud .vmd mfid Nfid mfid md 3.0 mg 3.0 3.0 $0 $0 $0 3.0 2.0 3.0 wio wmd 00 3.0 00.0 3.0 00.0 :0 3.0 :0 00 8.0 :0 m0.0 :0 3.0 00 2.0 m0.0 8.0 2.0 3.0 3.0 my,mmefizeamfiesgé3332005m 392523505350535228005m 300320235053:05023230052 $03202300003005350280.00% meom3<£<3006=SUS£<§2000020 m53202300605082322605m m$0320230063030x<sém08320 $03285038035002203230?m m$03202EDEQSUSEEEEB30m £03202:30638502523005m $0320m3506200502523005m Sums$0203.90:Eusuzséaomsm 05063300$230052 30mESEEDmESSUSUZE/Eofl:m 35320205053028$23005m m$03202:505200502523005m mmu,0m9&0?05300505023230?m 0505050823230052 309520230062008223005m §0§§<303030£8£23905m 353202350530082323005m 30032023505338$22505m $6320m3:000300502022603m oszmGzSqué$0992 m$0m320230063038250280.3% ma0m3&0:30063005023230?m 353202300630082333205m $2 00: hm: 00: $32 0532 RS? $82 EEEaEaEaEaEaEaEaEaEaEaEaEaEafigEag5figEEEafigEaEa 525053<0G£o£§0£<aoe< 52502220Ewaogfigegz 3.30053<Eo£o£<5£<aoe< 550053<30£0£§0£<302< 32.8003032058308??? 52200:023026£§0£<an< 2<ao£o£§0£<aoa< SE85E<=mmmmm8£<aoa< SE85E<ao£o£§0£<aoa< SE8532030358223032 SE85:m30£0£§0£<553< 5500.5Egonflfifiuzzsflsm 050050255floafibmzaosé 55005Egogafibgaog ”5250.533.5.6floafibmzaosé 52.605smegoafibgagé 338%3052030355??? 3.305322930£<yo£<aoa< 52505eggsomzubgaosm 5285Esaugoafibgaogé 52505323025£<5£<303< 5.9.300:3320aoafiugaozz 0230£03<5£<§02< 58853230Eoefibmzawgz 522005Egogeiugag: 522005gameoflfiuaimg 52805022950£§0£<an< mm mo. ! 3 00H SH NS mg 00H mg 00H SH 00H 00H 0: H: N: m: 02 m: 0.88 088 Roam 088 aEEaaEaaaaa33aaaaaEHE5%EEfig $08 088 Rog $08 308 0008 308 $08 $08 £08 £08 0008 $08 0008 0008 0008 $08 808 $08 308 308 0008 308 0008 0008 0020 820 98 WO 2013075035 PCT/U82012/065691 N030 mead mead A030 05nd Hhfid mhfid 0wH.0 Nwfid mwfid mmfid HON.0 HON.0 <0N0 mONd wNNd m0m.0 mwd mod No.0 wwd H00 H H50 wwd 00.0 mwd mwd and N00 nwd mwd N50 .30 mod mad «0.0 mod No.0 mw.0 mwd 9V0 omd 930 mwd mm.0 m¢.0 N._V.0 M30 .30 .30 5‘0 N30 m0 mm.0 mod .30 .vmd H00 omd #50 0.0 No.0 3.0 3.0 3.0 3.0 3.0 3.0 00.0 00.0 3.0 00.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 ‘3 0 3.0 3.0 $6320m53020320302/2245005m mmam3202550038502323005m ma0320232203005092300.5m fi0m32023000.0300502022603m m53202550630082028005m 353202329030082323005m 0230063850232809:m $532:2006300502323205m ma0m32023090200562:$.60”? 3522823566350502028000% $532:3296200502323005m my,om3202350.6053202323005m 3.6$2<a<esm0030050$23005m m53262300530200$23005m $532023005050503330£832 my,03202550535050$23005m 30$0282.,22992205630225552 mmu,0m320220052850223005m mmu,0m320230052005022303:m my,0m3202£220300502323005m $.63823505350502323205m $005202:30538502323090m $532023006303002:$603m m$0320220039200302023005m 350630050232263:m $53262:30638502323005m $53 m023006335022,...505m 33 33 33 33 33 33 33 33 033 33 33 33 33 23 £3 R3 33 33 033 33 33 33 33 23 £3 R3 33 N032 832 2032 A”.032 0032 B32 0032 0032 0332 332 332 332 332 332 0332 332 332 332 0332 332 332 332 332 0332 0332 R32 332 SEES020338323002 5380532303026523032 5.9.300532563328323032 52200:3303033623032 53833229302533032 5220053229302823032 02.80030396969282022 2963025332032 5380552303092523032 5230.502203033823002 303028332032 5500.50230302523032 52.0053325025230:m 55005332502523032 5280502303033823002 52505332502523032 3823 $338333 230302523032 525053220302523032 52505220302823032 538532303033623052 5.9.300532303032522203 5500552303032522022 530033230302523032 52383230302523052 52200502203025223032 52200522363033823052 03 E N3 m3 «3 m3 03 33 03 03 03 33 N3 m3 33 #3 03 53 03 03 03 33 N3 m3 .3 03 03 N030 833 «03¢. 830 0030 B30 0030 0030 033 330 330 330 330 330 033 330 330 033 033 330 N33 «.33 333 033 033 R30 033 0030 830 2030 830 0030 B30 0030 0030 0330 330 330 330 330 330 0330 330 330 330 0330 330 330 330 330 0330 0330 R30 0330 99 WO 2013075035 PCTmS2012/065691 mod HQH nwd mo: wad Hmd Hmd wmd mod mwd mwd mod mod owd mwd mod wwd .36 «ad no.0 wmd mud mwd and «0.0 No wmd mwd mmd wmd .36 mod mud de .36 and #50 .36 de mod wmd No.0 mud mmd mmd m.o No.0 2.0 :0 :0 :0 2.0 0:0 :.0 0:0 0:0 :0 :0 :0 :0 0:0 :.0 20 :0 :.0 :0 :0 :0 2.0 :0 :0 :0 :0 $632023506:SUSUZJZNWWSm my,0032023505320502323005m £03202:30555303232305m $5320$505300502323003m m0003202300630030222960:m $53m022:06300562223005m $532:2:0630:20223005m :33032052223005m $53202:30628502028005m 2m”,om020230902005020230?m 3506220502023005m $532:3:05220502023005m $53202:00533582323005m $53202:500200502023005m mmu,om”,020220050505020230?m $.53m0235055”,00502023005m $5320m2:055”,00502023005m my,0m22622.030200502223005m 202£005300502023205m £0382£220300502023005m mm,00320230530303232253:m m$03202+05053850232309:m $63mas05903850232303:m $00520m300630§02223030m maom320230630050222399:m 850305323205£03036is8: 85058322205309200530: 0m: 02: 2: 2: 2: 3: 2: 2: 2: 2: 2: 00: 3: mm: 3: 20: mm: 00: B: mm: 3: 00: 3: N0: m0: $0: 2: 0::2 02:2 2:2 ::2 2:2 2m:2 2:2 3:2 3:2 2:2 2:2 02:2 2:2 2:2 2:2 3:2 2:2 2:2 3:2 2:2 2:2 00:2 3:2 3:2 3:2 20:2 00:2 ”5250053230:032523002 52505323202523032 0532303025229632 55005323030325£25622 50280332305825323092 52200532003032523052 52200532003025325532 SE850222025223032 32.5050296Ewe/25223002 SE8502203032523002 53.5052232025323052 SE852232025325502 52.00502003025223032 550053236flog/$823002 539605angmzubgaosm SE853230£0m§0323202 SE85a230£0m§0£<55=2 SE8522363025320002 528502203032523032 SE8502230328323052 5250:32303225223032 5.9.300532303032082363? 5880532303032533032 53003023053258235:m 52805323030325223002 30308005320505 030230022505manna/25505 D: 2: 0: 0: E N: mm: 2: mm: 0: B: mm: 0: 00: :0: N0: 3: 3: mo: 00: no: 00: 00: 0: E N: m: 0:: 0:: 8:0 mm:m 2:: 2:: 0:: 0:: 5:: 2:0 0:: 0:: 2:0 2:0 2:0 3:: 2:0 2:0 5:: 2:0 0:: 0:: 3:0 3:0 3:: «:3 0:: 0:8 02:0 8:0 N28 00:0 20:0 2:0 00:0 3:0 2:0 0:8 8:0 3:0 2:0 2:0 3:0 2:0 2:0 2:0 2:0 2:0 8:0 3:0 mm:0 3:0 2:8 3:0 100 WO 2013075035 2012/065691 mWo mWo HWO mWo on NOH H NQO HQO H HQO mWo on mQH on ONO HWO on HWO mfio wfio «W0 on <90 mWo mWo N50 wWo mWO mWo mWo 500 Do mWo oWo mWo on HWO mWo on #90 add on moH wfio mfio Nfio Hfio mflo mWo wflo NNO Nflo on mflo mflo Hflo mflo wQO nQo mflo No nQo No #50 mio nflo NWO 00 mfio 853580323sz om+3mm+u£UE<£<m5 $me 30m: 3033 3033 PG: 363 35380832223:39:63:96: 85£088:«28332366:Eu: 853563223:53:63:36: 85395532339389536335: mgamefizeafloSSySU$29695m 232902858?Emmusm mgamefiuassgssuog$29695m my,mme§<33m655§8<3Emmusm mmam326235»?BSUZJENGMSm mmu,ome§<=5$oes§5y§Emmusm mmam332:5»?DUSUZJENGMSm $5musuéuéesmuéesuusyasEmmusm mmu,omE<§F<esfloaaysa<=Emmusm 9.5mSEUEJSMGEDUSUZEEMMSm $5mafiuéesmmeDUSUEJEEGMSm 2522332350823396?m 52553028502:363% mmam32823530:SUSU”,<2<N%Sm 35393023sz385023230?m maem3523539505023226»:m maem3E?339033333<3<£om5m 3932025530EBSUEJZNMMBm maoaszuzeaflo385023230»:m mamm332enroEDUWDyF/«suégflsm mamm9&5eafloasysfiagomusm wan man owNH HwNH NwNH mwNH «wNH mwNH omNH nmmH omHHm< anHm< EEEEEEEEEEonHm< moHHm< ONHHm< HhHHm< NNHHm< thHm< «NHHm< thHm< oNHHm< NNHHm< mNHHm< thHm< EEE 2§<£§<£29330332909: 2&2382353396353253: 2&2382253:333<mu6m3 333302230335332365 2&2382253:53352355 2&2853295835329095 5m~b£33<§o£om§o£3532 SmEBSUPDUP/EofiomUP/E£3532 53505a<56mmmu€yo£<53< SEEDSUPEoeoNGU£3532 5:805agofiéegobeimg 550055236Mme/$693353: 5585geommflgbgfiosz 55855236mafifibgegm 55855236mafifibgsmsz 526853<3o£o£<5£<303m SmmbgazaoflopauouomZEosz <29<Gm§o£<3oa< 528055230await$3632 528653236£o£<5£<=m2< Sage:3<30£o£<5£<3m£ Sago:Egoaoafiogegz “—DmmeuwDPZEUmemuEuummam: 58585Egofioefibmmewg $3385322030336aims: 33852<Eo£o£<yo§3o=m u—Dmm+UUWDjw<3me+Ommuumm3m3 m m «2 m: o: EH m: E 8H m: an m: 3: an an R: mm: an 8H 2: NE m: z: 34 8H 3H m3 m3 com 32m Ram a3EEEEEEEEaaEE3EEEEEaEEaa omHHQ anHo meHo mmHHQ ooHHQ HoHHD NoHHD mmHHD QmHHD moHHD moHHD hmHHD meHo moHHo OhHHQ HhHHQ NNHHQ mmHHQ meHQ mmHHQ omHHQ NNHHQ wNHHQ thHD owHHD HwHHD NwHHD 101 WO 2013075035 PCTmS2012/065691 N50 <50 mWO N04 mWO w50 mWO NQO n50 mQO mQO mQO N50 00.0 R0 $0 00.0 2.0 3.0 w; $0 E woé N90 mWO wQO m50 00.0 NWO N90 50 H50 NWO mQO N90 #50 H50 20.0 2.0 20.0 2.0 N0 $50 3.0 m0 2.0 2.0 3.0 2N0 2.0 2.0 2.0 2.0 00.0 2.0 $0 2.0 EEEaEEa3EaEa mmu,0m352anaeaasfiefimflsm 353282300530050233000m ma0m320235303005023303:m ma0m02023000030053<3<£o$0m m$03202=50655£0£<2<m030m m53202550630050202300:m ma0m3&0:303030053<E<£oflsm ma0m9&0:303030053<E<£oflsm $02080£0:00028502023005m 8532020506220502020005m 85320232900503023250:m mmu,om9&0:05050505020205?m $5mass:£2.96EBSUZEEQWSm 8532020505050582020005m 9&0?EDEoSSUSUUFEEEom:m mm,om36205050505020205?m 3532020505050502520005m 3.63202:5082205022250:m mmu,0m35230052005022/23005m 3.62202:508300562023000m mm,em320235053005023303:m ma032023005338303380:; ma0m02022000.0350533222003m m$03202300605303<3<<0083% magma/2802300605020002023830,... m$03202300605050223000005m $5mesa:229005050332505m EEaaEEEEEaaEaaaEEEEEE 52280533203002802363: 32300533500303? 3008:32303033502363 5030053403me0800msmsm 50380503300060006032.5202 502805022005038023033 <EOEOE<UUE<EOE< :mmuusstMmMmmuummJMJm E<EOEOE<UUE<EOE< 5008903E<PGNME<UUE<EOE< 52300532300508502303? 30000330303025502303? 5009003E<EOEOE<UU£<EOE< 50096905E<=m£0£<£u£<s+ofi< 5029605E<Pémm£<£0£<303< 3.8053230 5228053030050205023033 502805E<sm£o£<£ufl<s+ofi< 3005053330 300205023900 52300530209602096023032 5030053<30£o£<80003m30 503005E<30£0£<£u£<303< Smfiufiukuififio£00280 050205023900 023032 5003053<30£0£<£0£<303< 5030050320960305023033 5030053<EOEOE<UUE<EOE< 339605003003??? 8N Ea mom 00m mom wow 8N mom 00m 02 22 2m 2m 02 2m 02 2m 02 2N 02 2N 02 02 mam RN E aEEaaEaaaaaaEaaEaafigfigaaEE3 meHQ #wHHQ meHQ emaao thHD wwHHD meHD omHHD HmHHD NmHHD mmHHD «mafia mmHHo omafio hmfifio meHQ mmafio 00NHQ HONHQ NONHQ MONHQ VONHQ mONHQ oONHD NONHD wONHD mONHD 102 WO 2013075035 012/065691 .vmd N50 :6 Hod nwd no.0 “OH moé «wd moé wwd Nwd H wwd nwd de wnmd wad Hmfié BOA HA #50 mod No.0 m.o mmd <50 mmd H50 no.0 nwd mud Nwd and mod wwd de and mKd and Nmmd DVOH mood m.o .wmd Hod de mod Ed Ed HNd de 3d wad dmd Rd mNd 3d Rd mNd Hmd NNd Hmd de mmd «mad Ed Hmwd :d 2d NNd Rd «md my,mm352edfioedsdafigguo$5m my,em352EDmGEDUSUEEEUsowsm uumédsduzgfiofldm mm63202EdmdoedgduziiuoneER maom3202edmdoedxduzagomusm mm525:2JSMEEBSUEEEU982:m $329235”?SSSEEomSm mama/:2339oEDUSUEJENGWSm $5352:erJEUSEQ/EWGSm 35323632336m323095m Emma/:23EoBEDUSUUF/E/Eofl:m Smarts:EoEEDUSUUF/E/Eofl:m mmdmafizsegdadadm323095m Ema/EOE:3.295058%Eofldm 8%3623oumgagddgéflofldm £3252522oedbauéagéflosm £325:goumskuaduuma/Eofl:m £952632353236525NEGWSN mm”,mmESE=53o2§§<2<£o§m mm”,omESE=53o3§§<2<£o§m mm,em352EDEwSSUSUEEEoWSm maex2523smdoédeduzgaowdz =5mme85023230332 medm3§<33$odeduzafimfidz Emma:533369332533£3032 Emma:533369359633£3032 Emma:533369362de£3532 deH 33 22 mm E3 mNmH £2 R2 £2 $2 dmmfi £2 Nmmfi $2 «m2 $2 32 R2 wmmfi $2 33 32 Sm $3 32 £2 $2 322 :32 222 232 322 SQ? 222 :22 232 232 832 :32 NNNHQ 332 «~32 $32 £32 RS? £32 232 9.32 3.22 SS2 $32 $.22 $.22 $.22 SE85Esoaoafibmzaogé SE853<ao£oe§d£<em3< 536053230memagma 5383.0:03<30£o£§d£<aoa< aggedzgdmé 53d8332<aoflogubmzaosé SE85figmammsmzaosé SE85E<=mmmmm8£<3oa< 52855seaomfl<UF<U2<UF<=fl2< SE85Endangmzagé SE85gammmmmsmzagé SE85gammmmmsmzagé ”59.9605E<=mamm8£<aoa< 55855fidmfiomzuxfi/Eosm SE85E<=mamm8£<aoa< Swab=3<=M<m£<§<§o=m smammsmzagé 32835szmmmbumfidmsm SE85egogafibgaog SE85egogafibgaog 525053<30£o£<5£<3o3< 3385Egoaoafigfiguzm 3.5053230£o£<§u£<aoa< 3583E<ao£o£§d£<awa< 325:5NSMEMEEUUENSWSN 325:5EDMEMEEUUUFEDWSN SE85Egoeogxdmzaog mm am dmN Ea mmN dmN mmN dmm RN wmm mmm 8N SN SN 3N 3N mg 3N SN E 3N 8N E NmN mmN «mN 088 3% 2N8 mHNHm ENS 3N3 3N3 ENS 2N8 2N8 dNNHm HNNS NNNS mNNHm «NS mNNHm dNNHm 8N8 Mama mNNHm 038 ENS. NmNHm mmmfim dmmfim mmNHm dmNHm 038 320 ~88 mama 3N8 23d ENS 5N8 2N8 ENS 830 HNNS NNNS mNNS «NS mNNS mafia 8N8 Mama ENS 098 ENS ~98 mmNS «28 mmNS dmNE 103 WO 2013075035 PCT/US2012/065691 Duood mood mood wood wood wood wood wood wood wood wood wood wood wood wood wood and wwd mwd woo who dwd nwd hmo mmo Duo mmo mwo mmo wio o._u.o o._u.o .36 mm.o 010 N10 nmd Hod no.0 wmo mod who mmo .36 who nmo oHo End End NHo mad Duo Sud NHo mad :6 mad mad mad $0 3.0 N0 £0 $0 000 2.0 2.0 NN.0 8.0 2.0 8.0 8.0 00.0 00.0 8.0 00.0 m0.0 $09,233:3205303025£0552 $0330303205303025020552 ma0§§<§m§3§0£§208020 ma03202350530053?2000020 ma03202300630300?2000020 mm5320205303850282000030 230§o§£0£<2<<825% 35m3200300638500282000020 mm,mm9&0:groggfisiuo25% mm,om0202350635058502000020 mm53202eswogesuzafi08320 0m53505020206£§o<um<0=<008 mSuZUZanfimflomS£95 0m53505020230£85963m5: 3.52;005020230£35253m5: 88000<u<<o<<uo<o<0<3 0m53505020230asuaamsm5: 3.52;00500<£<mm£§o£o£0£95 35mg00500<£<£o£§ommm5~55 353505020205$053030~55 50535050202303550095m5: 3m5350582028336£03:m5: 35mg00320230£36263:m3: 3m535553§<mm£§o£030m5: 3mus358302023£35830m3: 3m53505020230£052.63:m5: Fukuoou<u<<o<<uo<o<3<33 EafigEaEaEaEaEaEaEag5EafigfigEaEaEagaEa@Eg5EafigEaEaEaEa mnmfi momfim< 388:5QWEWZSUZNSWQ 385309020280230032 503005Egoaoafiugawsz 5220053<30£o£§0£<302< 530033<ao£o£§0£<awa< 522005Egoeoeiugagé 2<ao£o£§0£<aoa< SE85E<ao£o£§0£<aoa< SE85E<ao£o£§0£<aoa< SE85E<20m5£§0£<303< SE85E<ao£o£§0£<aoa< 02020808203005000283< 30505220530059630ng 23525050005059630ng 8505059630ng 88<<=<88038308<U 22532050030059630ng mmfiseaxaaoeabus9630ng mmfiseauSgoeaaa9630ng as:«505055505science/0 23532050538536300me 06sagaéozmgmz 285300863003suaozbmz 285£003063205302085 2E:£20505200520308? 2E:$8852359630ng Htkt<<3<susuwssusswsw<u am 9% RN Ea mmm 03 SN N3 mom SN mom mom 8~ mom mom 08 EN N8 mm 08 RN 08 RN 08 0% a aa3 EaaEaaaaaaaa3EaEaa3EEEamoNHm 830 0020 $20 0E8 £20 $30 $30 330 330 0:8 830 0030 0:8 0030 $30 $30 $20 $30 $30 330 820 $20 038 0020 830 $30 moNHD 104 WO 2013075035 PCT/US2012/065691 000.0 000.0 000.0 0000.0 000.0 000.0 000.0 000.0 000.0 mood 0.8.0 0.8.0 0.8.0 0.8.0 0.8.0 0.8.0 0H0.0 HH0.0 HH0.0 HH0.0 30.0 30.0 30.0 Nfiod NHOd 0m.0 wio Hmd w<.0 mmd 00.0 Hmd 5V0 0m.0 mwd mwd 2V0 mm.0 m<.0 wwd 0<.0 5V0 010 mad mad mad 3H0 3.0 3.0 mad NH.0 Sud mad mad 3.0 000 3.0 3.0 2.0 :0 8.0 000 :0 to CS 8.0 3.0 8.0 8.0 8.0 8.0 8.0 8.0 a0.535050202050200050525a 30.535050282000205£005053 35032050202060206060:05: 30535020202000020020302038 3050300502020002526£005: <<o<<uo<o<=<3 35055050202060205000505: 30.53505082060200250050.5: 8808<U<<0<<Uo<0<=<3 S0.5350508205$5505050.5: 30.535050202000055£0250.5: 8808<u<<0<<00<0<=<3 30.535050202000055£005253 30.5fifiSUEUZEoEEo000.50.5: 058§<00£<UG0.60.50.5: 88085<<o<<00<0<=<3 a:35050202000020530050.5.5 a0.53508202000020505050.5.5 350300502020502000000050.5: 02020000239300505: 3050320502023002303005053 3533050202300205300505: 3503003202000020003003233 303300502020000200000000505: 30535050202000020000000050.5: 353503020230080030050.5: 3.5330502023002000000050.5.5 32 0an 084 Eu 08H 080 000a 0.2 $32 0032 0022 8S2 0032 0022 08H? :22 figfigEaEaEaEafigEaEaEa@Efig@Eg5EaEEfigEaEa 0500523520300.60: 2005050505320530303002 200525050530053630802 020208082030033032802 28505086320520303002 88038305<U 2005320506300530303000 200505086350539203002 030<<=<880383030<U 20050505000350539203002 200508085320530300.60: 88<<=<880383030<U 2003050505320530300.60: 2005055520350530:00.60: 20050500803205303000002 88<<=<880383030<U 80505050003505303000002 $05£3505350530303002 200505055350530300.60: 200505085350530303002 200505050535053030802 2.9.05£83538530303022 28:£0050630303039<Ue< 285030300385203000002 2005050500350520300.60: 2003008800550530300.60: 0E:05050.63505303000022 N00 00m «00 000 000 80 000 000 000 00 000 000 000 000 000 80 000 000 000 80 000 000 000 000 80 000 308 0030 0020 8S0 0030 0020 083 :20 aaEaaEaaaaaaEaaEEaaE 308 0008 0008 808 0008 0008 088 :08 ~88 088 088 088 088 808 088 088 0008 008 0008 0008 0008 0008 0008 0008 0008 0008 0008 105 WO 2013075035 PCT/U82012/065691 mfioo mfioo mfiod .300 .300 330.0 ofioo mfioo wfioo 0N0.o HN0.0 HNoo NN0.0 mmoo m<0.0 Nmo Sud mmo 3V0 n._V.0 woo 0m.0 0m.0 0m.0 m._u.0 mio Hmo nwo owo .30 «mo wwo wmo mmo wwo «no .30 mmo mm.0 mmo .30 End 0H0 wad wfio Hmo mad nH.o 0H0 NHo nH.o Swo <N.o nN.o omo NNo mmo mHo mHo Swo 0m.0 mad wmo 0H0 mad 3.0 3.0 no.0 no.0 no.0 NH.0 woo no.0 noo mHo woo mHo no.0 no.0 0.00 .30 no.0 no.0 no.0 no.0 3953555830230 3953555830230 3m+3m3+3muFDu+<£<£0 :fl:35m5£<£<£0£<u 3 m5 ”Sm”,3305m958<£<mm£<£0£095m5: 3m5353929230NEUGEOEDm5: 3535m59m8<£0£35£0me£95 35mgamazon—4.30335£933 3&3359398280335£9.35 3m53+ouéu5um£<m534.803095 M5umu2£0£<£6£0£335 33353202923093953095 3m5mgomuFDuZoZmqu85303335 39539595082808.4553095 39533958302me853095 353395962933093863095 J33+DM+D£<£$<G93863095 3+3M+<o+<£<£mv 353533029230 3.53 $.35 30 mtu< 35028530£38030me 3m53593029230£406.30me 3m53593840330£<£OEOED 333559584023034963095 m5 :33593840230mzuuFOEOEDUEUS m3 m5 m5 m5 m5 m5 m5 m3 m5 m3 m5 3 3 3£533838<u<umm<3ummou<€mtflu 3 3 3 3 3 3 3 3 33m._._u._._um:0_o<vum<_uo_ummuuwnmm<ntumtus fl<u+0m+0<uo<n3nn £<u+0m+o<u3<n3nn fi<£0<nm<n3<n3nn Eo<um<uo<uonu 3&53+DM+<U+<£<£0£<UEU<Uw<U:Squu Ututu E<£0<um<u3<u3tu 3 3 3 3 3 aaaEEEEaaEEaaaaEEaaaaaEEEEE 235330580320530303093 235330503505303025 N35 Z35 “E35 u<33838033£3 235 303230 m: 338380338:30553034. 305803303303930mucq Ewan—Dmsuwofiwswouwo39353093 usunUUUMJFU0U33wrongs—Eva Emflofiougfio359530055893 w<mm3m5u5uu635uu5Egaoflomg 9595963585EQJMEUFE w<mm3m5u5£05u5u530303092 EwfloflofioumiofioEgaoflomg 33533958655853353092 Emma—3338580395953033532 33958635330303093 mm<_u._._umzu_utuum._.n._.nu:._.uwUsmfiuogm mm<Us<UDUUoUEOED£D:mEQmumucq UDUUoUEonEDU+Dsmfiwmumucq UDUUoUEOED£D:mEQmumucq mm<Us<UDUUDUEonEDU+Dsmfiwmumucq mm<Us<UJUUDUE0nEDU+Dsma+<mum+< m: am<Us<UDUUoUEOED£D$30834. “—4.3533058033033030£022 2w£3£3£3£033£320308093 Emflofiofiouwoiofio30303093 w<mm3m5u5u+033u530303093 £38396EDuSEQEOmum? mom 0?. Sm NH». 3». Sm 2m E Em mam 2». 0%. mm N». mmm «mm mmm omm Rm mm». am 8». mmm wmm mmm aaaaaEEaaaaaaEaaaEaaaaEEE5EEE HmNHQ NmNHQ maNHQ QmNHQ mmNHD omNHD nmNHD woman woman oomfio Homao Nomao momao «Oman momfio oomfio nomHQ womao momHQ onHQ HHmHQ NHmHQ mamao VHMHD mamao oHMHD nHMHD 106 WO 5035 PCTmS2012/065691 Hod mmd Hod wmd .vwd Nwd mud owd 05.0 mmd and and mod mmd mud «m6 nmd .wmd mmd nmd mod mwd mud de 0H6 0H6 Sud 9nd omd mNd wad HNd Hmd mad mad nmd .36 Duo mNd wad wmd omd mad 0N6 0H6 mad NNd mmd nmd omd 3.0 00.0 00.0 3.0 8.0 00.0 00.0 8.0 3.0 8.0 00.0 8.0 8.0 00.0 8.0 3.0 3.0 00.0 00.0 8.0 00.0 00.0 :0 3.0 00.0 a050305020020502050505~50 333505020230020003005~53 33350502023002053005£00 3050300502020502050003£0: 30503000000<£<£9$§o£005£0: a:0300502023002080525£0: 353303020230$55300505: 3533030202300205300505: 0053505020205£35050:05: 0053505020225$35050505: 35330502023002050505250 0053508202050205050505: 00535050202050205050523 005030050282060205050505: 35330502020000205052505: 0m53505082050205050505: 005030058202050205050505: a:35050202052205£00505: a0535050200050205050505: a0535050202050205050525a 3050305020200003053005~53 3050300500§<00£§o£00505: 30502005020200002060623£0: 3033005020020602060605£0: 35330502023022060.60.5£0: 305032030200300205300505: 3053503020230085050505: EaEaEaEaEaEaEaEafigEafigfigEaEaEaEaEaEaEaEaEaEaEaEaEaEaEa 2005050506350500303022 05053005303000002 2005300505300530302002 200500205530033030502 0306:8520303002 23508552005203050: 0505200530300822 2005£00505200530300822 2003250505300530303002 2E:050505050:30300802 222.£0050505053030082”,< 2E:£00505050530303002 +<$<S£00505300530303002 235050505300500300802 235m8505050530300833 Ema:050505300539203002 2005050505300530000802 2E:05050508530300802 200505050505055530£002 0505350520303002 2005050500300530303022 2005300505320530303002 20050850630033020502 20050303063005003000002 2E:£0050608520300822 2E:£0050520055530893 2005300505550:30300.60: 000 80 Ea 000 0.00 :0 90 000 30 £0 000 80 000 $0 000 $0 000 000 3.0 000 000 8.0 EE 000 000 ~00 Ea EEEEEEaaaaaaaEEaaaa EEEaE 088 220 0008 308 0008 0008 0020 0008 0008 808 0008 0008 0008 2.20 0020 0020 «008 0008 0008 808 0020 0008 0008 308 #08 $08 308 107 WO 2013075035 PCTmS2012/065691 mn.0 mwd wmd wwd de wmd dwd mod de mod and Hmd and H00 nw.0 Nm.0 .30 mod no.0 mod mm.0 mm.0 .vmd mwd mmd wmd .vm.0 N30 mwd HN.0 mmd mad Hmd mN.0 mad 0N0 mm.0 mad M30 nH.0 Sud wmd 3.0 0N0 mmd mad 8.0 mad wmd mad wad mad 3.0 :0 w0.0 Hmd w0.0 wad .290 n0.0 0.00 0H0 NN.0 0.00 .390 nod 0H0 0N.0 w0.0 no.0 mN.0 n0.0 3953+3M3£<£<£9<w<£0£095 395mgamazon—$30$405303: 3$3m35m5£<om£0£<£0£025 395$:395520330$963095 3m5m3+3m3§fi¥<30£<£0£0m5 3m5m3+DM+Dum£<£OUF<UF<UUFO£095 3m5359384035E<£OUF<UGED 3m535930383303.4863095 5m5m3+3msfi<fi<m+o93863095 3m5m3+3mu5u+<um£9<¥<£o£095 3953”,33202330m+<£0£0mu5 3m+3m3+3mu5£<£<m+0mm£o£9.35 395m5u5m5£<£<£0£<umm+0m5 3953+3M+38<£$<G£<£0flog 3m5m35m95£<£<£03.353033 m5£<bw<£0£<£030m: 3&339593840330£<umflg<u5 3&33593840330fl<umflg<5 m5 3m+3m35m95£<om£0£<£0£0m5+$3 3m5m3+3m5£<£<£0$305303: 3&33533929230mzumfloflafia 353+DM+D£<£<£9$<£O£095 m3 m5 m3 m5 m5 m5 m5 m5 m5 m5 m5 m5 m5 m3 m5 m5 m3 m5 m5 3 3 .5m5353392330$135303:£33 3mSmEDGSuZuEEOmmutu£095£33 353+333023803.3653095£33 +Dm5m3uFDmuFD£<uuF<flo$863033£33 +3m+3m35m5£<£<£0mw<um£0m3£33 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 aaEEEEEaaEaaEaaEEaaEaEEEEEE “—53:£3058033U+D3v63+9<¥0£< 2mm:«5058035055530£034. 335 “Em—£3 «58380350550630£0£4. 2853:0580350330302692 2853&38035822030£095 Emma:3383895595353m£0£< 3353383803595$302593 EmNSEDuuSuuG:353965963093 3933EDU3963595u5u635£0£< “—4.3533959655953035893 23953395863533965963093 “335mUSUUFDumPSuuSuSuGPG30m; 33959595803959530396935 33383963389553963093 5959535303093 335958380395u5u5963m£0£< “33539580559535303093 235338209635953530963 2509505353 “2&3: 3&3: meUVDumEDuS £90580: 3&5 3539.630 353530 303530 m2 m2 a? mmm3m3u3um33u33M3m8mm 333338205358330309634. 385338280330335303093. 285203580235$308093 m2 33598296359535353093 33598296359535303093 mom gm mom 8». $m mom mom Em Em NR mm Em mum Em Rm mum Em 0% Hmm Nmm mmm «mm mmm omm Sm mmm mmm Ea5aEEaaaEaaaaEEaaaEaEEEEEE mwmao o¢mHQ anHQ wvmao mfimao OmMHD HmMHD NmMHD mmmao Qmmfio mmmao ommao nmmao wmmfio mmmfio oomfio Homfio Nomao momao womao momHQ oomao nomao womao woman OnMHD HnMHD 108 WO 2013075035 PCTmS2012/065691 omo mwo «0.0 «0.0 no.0 mn.o wmo mwo «mo mn.o on.o No.0 ono Hwo mmo nm.0 004 wmo mn.o mn.0 mwo mHo Hmo HNo 0<.0 oio nH.o 0m.o «No Swo <m.0 wad wmo 0H0 0N.o omo mad Swo mHo nN.o omo nH.o mad woo wad nN.o Hmo «mo .30 mod mad mHo woo wad woo no.0 .30 mod Swo no.0 woo mNo woo woo woo woo wad no.0 no.0 0N0 0N.o mHo 3 3m5m3+3M+28<£<£0£<£0flog 339292253.353033 35355583023033530me 938<£<£9$<um£0m3 3m5m3Emu—Dozozflozzumflwm5 3m5m3+3m5£<£<w$03.3%”,me 3m5flaomguzuzgw938.0363 3m53533830230mucqumflwflo 3m535950293363380mmflo 5m5m3+3m58<£<m+0m+<u+0m+0m3 3m5SEEP—0284.30m+<um30m5 3m5m3+3m5£<£<m$om+<u+wmmflo 3m3mbo3OU3oUmUUm£0mw<£0m+o<U 3m53555929280£<um£0m5 353+3M+D£<£<£0w<w<£0£0m3 mu,Dm3+35+DU+<Uw<£9<UF<uuFOUF<¥D my, m5 3&33593850330$3803me 3&3353202093303.353me 3m+3m3u5+0+3uw<£<flo92803095 uFDmufiuzuzflwmzfio£935 3m5m+3+3msn¢<£<£0939630m5 3333393842.430£3535me ”5m5m3UFDM+D£<£<£OE<UUFOEOE: m3 m5 m3 m5 3&33593840330£<£Omm£2<u5 3m3m._._u._._u0U3oumuvmflom+<u+0m+o<u3.3953 m3 m5 m5 m3 m5 m5 m5 m3 m5 m5 m3 m3 D<P53 m5 3m53533925230335mmflo£33 m5 m3 m3 3&3m35va<£<£0£0£<£o<UOU<FEUm5 9&5 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 E5E5E5E5E5E5E5E3E5E5E5£5figgagaE5E5E3figEa£5figEaEafigEafig 23525058035953+03mflu£< 2&3: 2.9.3333058033053m3$0mu£< 28583898033053535£u£< 23533828033535353093 3333283533535359693 3&3: 3&3: 2&3: 3&3: 350335359693 EDUUSUUGEDUUS3M3+o£u£< 335333553333+03+0£0£< 33523959635953535963 95959635953+o3m£u£< 239595955535953m3096m? 23532058033u+33+03+0£0£< 396358335353093 £3959635953535893 mm<_u3m3u3u+035u33M3m8mm :38:9595553595353m£u£< EmEDSDUBUGEDE3+03+0£0£< 2&3:m3uu5uu635uu53+03+0£0£< 2&3:EDUEUGEDUS3535303 mmmHUmHUuHUuOU3HUU33M3Mmumm 23533828035u53+03+0mom+< 2.9.33320580353:3m3u6mu6m+< Ewan—2300580338335303092 £0u3£035£335353093 +<mw<w3mw3uu5303u5uu§EOEOmUfiE 0333333852383353%me 2339538033U¥D3M3+Omu£< 0% Eafig mom «mm mam gm 3m mam mam fig mg mg m8 83» mg o: H: N: m: o: a aEEa3aaaaaaaEaaaaaaEEaE3EE NanQ manQ wnmfio manQ onmao nnmao wnMHD mnmao owmfio meHD Nwmao mwmao woman mwmfio owmfio nwmfio wwmfio mwmao ommHQ HmmHQ NmmHQ mamao Qmmao mmmao woman nmmaD woman 109 WO 2013075035 2012/065691 N2 w; m3 8.0 Rd ONO “NO mWO mWO wWO wfio mQO «OH mQO mWO mWO ONO ONO EaEaEa :3 m3 moo 50 $6 3.0 HWO mWO mfiO wNO mfiO mWO nfiO ONO ONO wdo m; NflO NflO mWO NNO mflO ~50 mNO OWO HHO ONO nQO wQO wQO aEmflu%:8<83nmou<u<80u<8u£u<33 3mSSSMEe/‘egwmzu028223m5: 353550295393582825m5: 33$35m=§<§$oEgomwfism3: 35mfiamzozeoggxguow£333 333886238333S: 3m3m33o8<u<mo<<uo<om3<33 3mSmJSMEEUBEoNZUUon963333 3mamasmzumu<<Mm<OMmo<sm33 3$333320szEEBEQEEEB smsmbbm:u<um<0mm00mm<3m33 3aDSSMF/‘yzaofiéefiué823333 a:mu,22o96:59&62992325m5: 3msflfiuon528E<uou<u88u<um<3ufig 3m5SSMSUEUZNG$559695£95 3535338625$359695£95 352;aflsfiuzflogumfiofi:£95 3m3a2292839225226”,939$3255 3m+DmJ+DM+DUw<Uw<mw0mw<u+0m+0m3 38396 mewD a9595a$20§<2m£<bm£9<3~55 §§<£o$553095m5: ombmeamrfiwewmmmwoEuzbgawom 88mgDmEEomemmGEu80330m 30$382865sz NEH/Emmmmsgsaoméu oysmgeogmzmmeu565M696: Esaéfloflomzmmaugunman”? <32.mhuuzuoussuknsmsogugu +<mm5mhuuu<83033u536383638 3253.40.33.00358:303<£um+< $25mauSumSSuesasmO/Emm $<m<uhum50fiv<cu52335EOE<mU£< SE: usumssu: +<m<uhu<nkufi<3635u5 UF<m<vHu<anuE<u+o3535 mm<3m53um33us $32335 Dwam<umm <mm3m3u3u03833m:08m< 323353303235353,0333%? mmm5£3u5u+0353530303633 mmm3<3usuMJDOJJODMmO<m 363336 mm 363336 m+< m+< mmucqsm3+usum53u35m=m¥<umm msuusum._.usu3_.nm:m<uumm 3383803535553636m? 33383555333536363638 mmmsmsusum::u::m:m8mm 38233835358330363638 833285632329539;: +33:£3058035053639<U£< ©9580Samsmzubwaufinfis3636 om$3803905335358335363,0 845383330EEBDUUEOEDUE 34539839030396536363533 mmHDEUUEUUSUUSEU o3EH8525MB”2883858:36 E3E5E5E5E5E5 mg «S m9 mg EV mg mg 03 HQ N? m? «Q m? 03 aE55E533EEEEEE mmmao OOfiHQ HOVHQ NOVHQ MOVHD QOVHD mOdaD OOVHD Rowan wowfio mO¢HD OH¢HD HH¢HQ NH¢HQ mawfio <H¢HQ mfififio mafiao mafiao wfifiao mfififio ONVHQ HNfiHQ NNVHD mmdao QNVHD mmdfio 110 WO 2013075035 PCTmS2012/065691 3622335sem§§u§o$§3a 3mame§§o£om§§u33,553 mewa505665950 $330EomZmGBabuSmmmUeB “33533098852995528 me<mmu,<m6£om50§uEoMSSEUU m33559958053936355a mawmewmzflosbsyswo8955: $59659392836ng385m 932896ng385m £95965qu330555538 $99395quafloat:883% $6mEmeuEyo$355595?a wsufiubguy/E:38590: mafimfi96£85WWNUJSUUJEUSU $396Eufloaammmbassaoysu mmEmMSUUFEUEoWSS585E038 mgmgefiteommx:208E038 85308239550528 $625£85308355:3550 $5820835353385553053 ma:8253933338533896: 383805908:853055532 3flufiueamfiog3883098stm 8286359553853956523 8289536355SUSMUBUUJEU 33oNEEDBPGUUFPGUUSyou 022$3%mwoeézbysubaua: o323w38823032<U§5535 096$is333625389505 omdongUU303202596235 omdomzmwoauzmfiao£83535 oodomZEoSUyPEQSB£85536 oSZEomEmSU9665958385 2329a£39553995598385 oSbEomzmmsoagéuéao£855 oSb£93263§<§63o£855 $259230mmmUPDUUUP/‘UGMSMZUUEU o$82M.022$:UUUP<GWSH<5=U magmbflomfiuéEUUEWEJGEUUS 022mb9.962%Pououéfloaombys omdofiéuzmmgflagumayor/Eu 02559266muémusuobmuémusmzub ©25ngmmmZfloSUUZmEEomU o2633625?£588353oEu omdomfifloumfio339353095? magma£06290flsosubflomsmué 833%szgoflsaaeuuzmag 03233306gowfifiosbyamuéaa 035.2090mm£<m§$<m32u£om5 $35EomfiogouzflwzzwBUamps wmdoszflomNHuFQEEGEUUZMG wmdoszfiowozmb£99<£oa§<m5 modemsgongozfioagflsxum5 mfifi Add wvv omw Hmfi Nmfi mmfi «mfi mmfi omfi nmfi wmfi mmfi How Now mew mew E— 0N<HQ NNVHQ wmdao mNVHQ OMVHD HMVHD NMVHD MMVHD emwfio mmwao om¢ao hmfiao wm¢ao mmfifio o¢¢fio Hfififio Nwdfio mwfiao <<<HQ mwfiao o¢¢HQ medao wvfiao mfifiao omdfio Hmdfio defio 111 WO 2013075035 PCTmS2012/065691 mmofismageas285805you 0835ng3833030553580 3835ng3839388250 ezobsmUSUUUS£86: 35EoEBSUUJMUSES£86: 3$935353:?5532593m Ewazussbaamascot3862% $95gaspswouauoaafiuyo32m $63535596353:859;: $285eueafluayoasobusgm 330853302:gm EUSUFBUPGUBBUSmbuobafizm 3582:58:29am 85352330968JESUSPage: 35389530583383£96: 3538960558auguszgmsm 333628550:55333? abausmuoeoubg860523”,er 36353055:myoysmmaoefi 363623505matessamsmbm 883595285853<mmm5mbm éafiogufiefiuea£26302: omsmmbeueuifiuga£<mm3§<s 358552:m§§<£<65yams: 396395385883:2»:yams: magmaoyoefiugmzegafizssm magmacubefiu:$398232 $3 $32 0263:£990gouvavévégmusuuogm my/«$025330382 o$3939om2m§<6m2£w2§< 032909:mmmwomwobzflogmvseu o3<m6m§$om6£9FUUF<MBNUF<WEUU oSSEomG:aflomufiéuofloméflwau 935EoEoSEHogufioflogmfisb oSSEEom:EoMFoUF<UFox<Mo£<E3 345329965Eomfiéuéfiflogfl: @3535manna/$99390965g 025:5£965E<m§§<mb£ofl<£o gzmmmusEEEofiouzmfig 859533963:egoafiofiflog 0229535afloafiofimzmbflomz 0329522305afioamzmbflomé 025.535:wwoflafioflofiouzmfi 035flos$:”,3*<$omu,3u,<¥omu,oEouzmfi 028355:gm+o$oSUF<m+om+<mbflo 03636555NGWGSZWEWEWUNG 02533.5:32<m+o55£om5£ox< 035$:«855323965£05382 0323533:gamwowgogmfigmb 03230338:33399032332? @32ng833326633£0336 03233332635aséuémusgflwg 036.235:manaagéfloszflog oSUNZEQEESEDEGMGJZWEWE th Nn¢ mnq «Aw mhw ohw 55¢ whw mhw oww wa Nww mww www mww oww nww mmw mmw Hmfi qu mow IE IE mmfiao #mdfio mmdao omfiao hmfifio wmdfio mmdfio omdfio Howao Nowao mafiao emfifio mafiao oofifio hofifio wo¢fio medfio Ohfiao Hhfiao Nhfiao mn¢fio wndfio mnfiao ohfiao hhdfio whdfio mhdfio 112 WO 2013075035 PCT/U82012/065691 85 8583 3885 39389683 mmUmuU 8585 Stamps .8 8080: 853038083 FEED: m m3 ~23 mm 3285053330: 230 252: $235mCEDEGmJEUEUm: m5 30m 8588053008:m£<m58m530m 34089533032823396: 3888342005mmfloszuminmfis 858530983293338353095: 3.585388323339633695: 8063:6968:£<mm3<£<55muésu§u 39038 8530653???969555935: 853580323<mamUGmUSJMMSEUJ muuF<3u5u6u63u5u5u mo+<35mmsu5u5u E<£<mu5mum53965363an 3885:2933:moflsfiomsfiufium uNEDMGUSUSUSUEJ 8835£<£02<um35mu633593: fiSmUm32095853:m umbmé<£<m5£ug263333095m 8532963.48.4::mGEDUSUEPEm +<£03<£<s:mGEDusuZJEN fifiefifibe:smflaegabgmzm §<§<m5mb£3mm55833343 $2353<£<=5mmEDUSUV<3<£0M m$<m36320233333330m2<mu6m EDEoMJEUEUUESNEWS: 9:490: mflwm3<£<333633£D£<td<£033m 23 832 NUJSSZWGWSEoMG 55eueaazwowsemym omdfibmzsmzfiaaaawmfiszyo ©3208532033553£039sz 8538233:NUSUSE/EomSmG 3423822533NUSSJEWGMSNG omdoefiugséagous95mamas: 3535822962595asfioflosé $32»?ng95952895335$: $225990?NSMSEU95329095 8596938£3223535336 85963596£322559596MB 035358023295£35335 om::mZmEZUuEmSES533335 0229696managioafisssm5 omgefiafifib925535535m5 025fistmmmUafi<5m5535:2 025asfisozauasssms595:2 0253230mmmvayéséeéfifisas 025323930£<5”,<v,<2o3<y535 ©3835«SWNEEUUZNEWS9635 035:5eaozmzmbbzaamus9695 omduezeémao£<UU£<963<95 8:853320aofifiobgaoafis 032535NJM+<MUF<UF<UFUUUP<EDMD£U o32532$39<3<+<Ua<m5m5flu mod: £095 3 m 30 m”, 03:80 9330 E< 08 8m mom 8m mom 8m Sm mom mom 03 Sm NS m3 Sm m3. 0?. Em mg mm omm NNm mNm «S EE EaEaaaaaEEEEaaaaaE EEE owfiao deao Nwdao mwfiao fiwdfio mwdfio owdfio hwdao wwwao mwwao Omfifio Hmfiao Nmfiao mmfifio «mfifio mmfifio omdfio mafiao wmfiao mafiao OOmHQ HOmHQ NOmHQ momao QOmHD woman woman 113 WO 2013075035 PCTmS2012/065691 $0,930,523.43?:USEJNNGWSm $53833.53:BEUNSZEHEEN $23083333353:$33,: 32823590388232263:«Em 3e<§<35m53gauze/«ampsgm SUE:3593:8353£<§oa<£<m Samesemumssbafls£<mm2<£<m eBSUNEEEED923% 823599538$296?NEE/é masmguémussbsbm:muémuéuszmzmzs magmawflosbeug£<mu6=m£<£<= EsmfloeBSyégEomsuéfiuépsm EsmfloefisugEoflsmmgflsm 396mm”,336595mayosuézuamuaaom swamps5:695afloafimfiaaom mammaSuSgefimmS£22339? mammasusgefimw:gamflsmz: $53696£3£<mm9,<mv,<+<v,<ao£:3 $5265&3£<mm2<£<mmeom53 =9535£<E<£om= 3585£<3<£om3 £<£§E5$<35= «Rwy/«93%;: 3826m5£39:E<£<SGNSEB 3835336230:m£<£<smm338 85823233:mmmzaaozg95m 338232333mmmzmusmfisaum 36:5muéfloefimgaoufis955: 36:5£<m63<mm£<ao§95°53 omd: mod: mod: £08352 0353.480 035346555£39$9<£u£<m95m5 03533800: PS 345353289582039338233 :5 $353535 @3255 335 easy—<35 3423033 omd<£3£<z omd<fi<sbm3 omd<£<38<5 wmdumzfldcau @3220 3055 ED 3 3 £<m 3 3 a: 3: 3 30 3<UUED 333$ 8&5 34535323695 muuG :35 :5 :5 33 so; E 9&2qu 03 3<39$0£<£U 323625 £2.0sz 338655 £965 33963: 223005 332505 333555 3555 9330 9602 93qu 9396 m? 9692 E<u5u6m+0m+<u+u m+0m+<u+u EDEUSMEME :5 E< 33m; 9&3qu 96 m5 m2 m2 m+Uu+< wad/x353955296ED+<+DH<H<£UU+< mUuSSEEOEOmEuU om4*Um*Ds*D*D*Dm*UU*D+D+<:+Om*Om*<u+U EEU 345923555338655m+DmuF<muF<m+U 3<30mu6m+< omi<30£3fi¢333Eufi¢33<30£0£< $39293 o33£583352333825fififlzfl< JEEOEG 323030 035345533333520063333m: wodOEd‘EDUEED33320539533m: omgwumw<mw<sumeJWDWDWDmWUu+D:*<:*O 30 m5 omd<£0£<§¢3£<£3fid3E<£UEDED mNm omm Rm 03 Hmm Nmm mmm «mm mmm omm Rm wmm mmm 0% Sm Sm 2% 3% as. 2}. Sm 9% 03 aaE aEEEaHaaEaaEEaaaEE EE woman womHQ momao OHmHQ HHmHD NHmHD mamfio QHmHD mHmHo meHo hHmHo meHo mHmHo ONmHQ HNmHQ NNmHQ mmmfio wmmao mNmHQ onHQ NNmHQ wNmHQ mNmHQ ommao HmmHD NmmHD mmmHD 114 WO 5035 PCTmS2012/065691 82323meMENEDWESSJUWSU fi<§<£om5£<m£53,;3838 $5£sz33%NEEDSSUGEUN SSEEEEEE$533:865m 32353:£<£<9332959585 $33me£<£<§H<=583820 £<£<smm5EPGBEUNUN 8:3963<£<£<3m£3Enumsombm $995£<£<m5m§5PGUGSUZUEN $995£<£<m5m§5Pawns/62m mméma<£<£<3o§asyéusbmbgm mméma<£<£<ao$3358963% magmagismzssaumusbéyémzm masmngmusmz:EUWSUSENEN =$<m£<£<3om5ssxosuoébmzmzm =$<m£<£<3om5=8558£<£<m 52::UmSUEUZmZfio: mmzmflfiSmEe:BWSUZU$296: SEBWJU£U+<+<£<m5m 32m£<2o~5enumeufiuggflsm 32mg33<3338m§§<§<963% $235335Eumazuzmmaozom $235£338585&2??me $235m5engosaugmmwswom SSE/35.538BENZEGJEWEW $253:eumsumggmmaogm 35:535558939355963? EaEaEaEEE£32 figfigEaEaEaEaEaEHEEEEfigfigEa omdwmtmzmmeugSS3538532 oflaeomzzzsb£29535£8532 OSSWZQGNEfi<55§3<yoa§ 8:DmZeoEEBRSS3335635 $36308?£383,323,:£85 035:6£89<£<28<59535£85 wmdamsmzummzfl962:5353&5 omdamSmEbEmu,<mu,28<35953<yo $35Ewaosmzflfisuops95358 @2536393059258m595958 wagesmusmsué£2523595:2 o3:esmuéozxo£2523595:2 025=5soJMEUWEEEUNSJSED 025:52955powgéuasuofisasas om5EsaamsflfioZZmSUEE:35 026:5£205505223323535 smeofiouézgsbfisas 02295322036£u§<£<96m535 028.53533m+3$<§o£<£§<33 028.5322333955£38235 33022<U$<£<5£3 03525555sogofiumuzmvaeue: ©3555:35920206595qu $355555EDMSGUFEBEEEE $353823EDEPSGNUWEEEU 03638265anagsuépoggfiu 032955895aaoszuquZfi: Nmm mmm «mm mmm E Sm mmm mmm 08 35 Sm mom «om mom mom pom mom mom 03 Em NB mm Em mum E Km mum aaEammmfim EEEaEEEEaaEEaaaaaEEEEE «$8 088 ommfio News wmmS mmmHD OQmHD HQmHD Ndmao m¢mao wfimao mwmao mwmao hwmfio Mama 9E8 038 33o NBS mmma «$8 $30 0.38 330 wmmS 320 830 115 WO 5035 PCTmS2012/065691 3635235582223253 $235963820£23055ngm $235325920$233329:m $52:Daoeuenvwmmzwago£032: 85355533323339632: 3m5SUMSUZUZN$622023:95m EDSUMSUZUZN$52039:m5m 3585533223330253235 Ensuésbmbmzm35323235 56m»,320223203255£35m 3623233532? 35365£<£<mfi696523223 852532223323&on mmSSEUENEEo$329,225may? maame<e<£<£o332$:$592: 38mg£<£<m5mmm53$2§om5m 35mg223333022:853% Um¥<§<£<£o3wmmm5322632320 fi<§<£<£o£ommm5$383235 magmgflfiSfio33232653333 353223330«ms/2353533 226G2Sommmmsmmamm662 £26m 2 2 053230303233:533233 3232333030:$252552: 323293326:82053832: 33353034333msflumu3<u5¥<£<mu5u 8235369333NUMEJSZNSU EE #3 33 33 33 R3 $3 $3 83 3.3 I:ummmoH $3 E 33 0mg 33 $32 $32 332 332 R32 332 $32 832 $32 $32 $32 .332 332 ommfim< $32 02295526353555355323: 035338853220305ng 0353055205SSSGEuNUMENE 032320585335333322032 34232958852223339258/2 033338832055520:5ng 3::33382828355558m: 086855EDWSWEUG 3532:2655£955EDWSWEUG 333395828285953258 35$: 3:: «526382853596355 3:36:23Gusyouabasasflsg 3:85E<SZ§U§<UEDEDWSWE 969993533325 02232525558223333535 3:255:EESUUNUJSJSWS 3::«58052322296£35333: 353220955£825,553:qu 35325553355602053535 3:53:«Some/3265553535 3:33:£280323265336333: G 2 S:3:uMm 526 U 2 3sou: 3 2583:32263823335 032353:353252335835 wad/233332552253355535 $353330:35953596368333 35$:3922532259638205 Em 03 Imwm 2mm mmm omm am wmm am 0% 3mm Nam mam 2% 3m 3m Rm mmm 8m E 38 E moo E m8 aa EEEaaaaaaE33m 33m R3m fi3m 33m 83m $3m N33. mm3m 238 33m owmfim $3m $39 $39 vomao momfio ommao hmmao wmmHD mmmfio Ohmfio Human Nnmfio mhmfio «hmfio 33o 33o R3o 33o $39 83o $30 S30 $30 £30 $30 owmao $30 116 WO 2013075035 PCTmS2012/065691 mm+<mm5muéflwa<smonSEUmZEU: SZmMSEoeoszs85$:89353 25833523805: mmfiomgowzmsg$233233? meaéo3.032333:5229033 masmmuéfloszfifimfl:9629623 gammy/E:33.3%EEEESUSEUN 5,9933:EDNUMSEUUPEBSEUN Maggie/‘59EUNESUEBZW mawmmfiegzgm:59389583 $39:musgmuésmgpsbus530m m$<mmu5 m5 abuzz 3532328083 mu+< £33 36 flow mufl<3§5+3u+<mu63 Emmaéefifiaa893532396: $535fiumEeEmmSUSSU96950 $535$525252:830950 a$33358:£%§U35§<m550 auémefiofissommeueoumflofifi mmSmmUmEEEEBSSEGWSUUW gefifigaaJUNWWSUUW azsagambmza382553853 3:35m5eugasauzmmsbxu: mmbmmZefiZeB:53905538 amazefizfisgaufiomabmusu 85353339:823928596: 85:5flue/Eb:8230:8596: 33329338583033669523 mama $3 8: 8: 8: 82 8: 8: 8: B: M62 m2 E: mmmam< $32 832 8&2 $32 $32 332 $32 822 322 $22 HEHEEEEEEE 232 332 0323.435?m5u+0+2<3+<u5£u£u 053855233555 OSZNGNSSEEUQD£35282 032303220323803£33282 game/$2:JMSNSUBEEEBE wmdwngSSmSEDUEJEEESUU oSSWZEom:29325695£3036 omdsmzflozus36325895£39636 553mg?353325532335 35:6£<UGUF<=SHE<SU532355 omduy.:mu,<mm£:39323695£396 oSUUSMEEG95329336959596 $22535mmmzsusuéusmusxoa<3< o3369.932933295£35323: 025.595?floNSSEJZEUWSm5 3:302:5sz9555:2595m5 omdofifibsmNEE/555$:£3532 656£33953:£3532 omdumGNUUJE/EGZS35323695 omdumfiNUUSEEGZS3632595 032953535«252335£36 032953306anfiozéaws£85 8:06me80534363:£03296 fioszamzzbm3363395 $32956”SUEE<EH<JSMSm5 3535662529532359:m5 o36.5NUMMEUUSGENG£33632 E Be m8 03 HS NS m8 So 30 08 20 0% no NS me «S £0 0N0 Re mmm cm. E Nmo mmmfim 353 83m Ema N33 933 3.3m mama mama 33m mama aaaEEEEaa EH2.3m 3on wwmao $30 830 Ema N38 $30 <38 mama mama 329 Mama mmmao oomao H88 N88 83o «88 88o woman woman womao mooao OHOHQ HHoHD NHoHD 230 330 117 WO 2013075035 PCT/U82012/065691 giggingpagowssmsysu $528£3038$535555: .538$638336: 3$823855mmmSUUGSUSUSm 3282885sbmfiaxumsuusysm m8mmZ:Uazuzmmzuyésuosoaoa mauguéeueagmmsoao89696: 82:53:sbflomabflausgmusa £5335EUEomfiomSuaSmSa §<§ue§<flo=§o29569635m $226eBEMGBUB9683695m $58+3eueomussmusuusuésfls3&3 $585eufiéwssmsggms3&3 swamaagmfiaoumau965535m53 38352352836363mg:m5: 3.525£93§85£9§53295: 35mzbfiofiseuwsxaaams 3295: am5329628583636559595: 35325385:03036:$595: figmeomusubmSu8593523535m 35253883885MBsmesaam ogig€855.35ng3:963 omzmméeueoeu8303:93:30: 39335385ng325595»? mammmSeumSuSSmS9&335$:m 5333955536;: mammaueosbsbsmqrs95335;: 5gy5§<m5m5303< omimzmzummzubioNEE/$53: omd<m2m2§om25§oNEMZESMS 038.2030SfioauUSmEmGe:aw omdueoegfiuwo86593968336 omd<£<m2m863<§u963323: omd§<fl<§§ofl<§o35323: 632.3%mMEUHE/‘UUSH/Eofl: 8353936mu,um¥ou,<u,u£:fl<mu,om5 was£<UUF<M§<UU6§<UUEo93m: 8::$5.3Efiéxouéuayoaoyam: 0amaoagofimbxsméflo 85329025muémuouéuémuousgflo ©2295 £5mmEmZUEM/Euaomz 032$:£<§<m+<m+<§om+§u96m2 om¢<£<2<896m§<bm5muo§m+< omd<£<2<2696m§<uom5muo§m2 omd<£<m5mmx<mv,<u,ou,<uu,omu,<uu,u=+o o332$2$§<w<§<5fl<596 ofltfigéEEPEGNUWGNUUS OSUNZNZSZNU32303030385 ©2292ng£§<§<H<UGH<UU 25£§<§<$§ofl§u 035Eu£<$EEUEUFEEUWGNU 033m8£<§<a<m§$o£96968 oflsefizmme:£53335? 3453522295$823325? mmo qmo mmo 0mm mmo mmo :6 as £5 as :5 £5 0mm So Nmo $0 «we mmo omm Bo mmo mmo aaaE EE EEE a gE aaEaaEEEaE mfioao cacao NHOHQ wfioao mHoHD ONoHD HNoHD NNoHD mmoao «Noam mNmHo onHo thHo wNoHQ mNoHQ omOHQ HMOHQ NMOHQ mmoao wmoao mmoao omoao nmoao wmoao mmofio Odofio HQoHD 118 WO 2013075035 PCTmS2012/065691 maaabmusesgm:EESSSWSNEW mxamUUMSUSUSm:323::$593M 3836:Engaaozfiom 3885530303 UmbmmuSuSuSmS: fiammszzesesm: Enigmefiam umuOmEDUSUSmS:$53295£35m $535M: Ewan Emacsbeoeamszs29533095 :$9596:Eoflfi $580,353???EDMSEEWENUN WmSBSUSWSEEsasmSmmmeUm 3&353635953963225525 3838369533:JEoE<NWMF<U+<U 85853332353smusmzuéuémbmb: 8585333235:aflsmzmmmbgs 3839695anessmaamuégfifis3 383533395smegommxfiss $393853? UmSmmusengSm:£38535: 363595:539.EomZUZySEB 3635£33530:253385350 533235333:2330263338 magma/EDEDWS$303833? 35353:awefimwfisga386m 3535a:Eo3<mmm2£<§35ubm 32mgDEDWSNZMMNUNUSSE86: 3:35ezmsmzmmmbmbg285: 323%SUFEUFEPSUUWSW tmm£<gv,<v,<+uaomu,omu,um+m 038:5 ©9895 £8$<£<3$<Usoeoeumué 3%Efiafifizflfixao 8:853:82£<£2$§<3<H§w @3553:8£<£<§<£$£w5 3:883:25mu,<mu,<§<mb£om5mb 35385smuu,<mu,<u,<u,3mu,<y,<fl<m+< oodosbeasuéfigéus£52332 $35930:apogsééafiueoflo 840,339,895EUNUF<UF<UF<E<§G£0£0 @3636SUEZUZEENS£52m: 995£53323:£52m: 333333835muouauémuéafibflo 0333338535abuauégafibflo 022963638532529395£52 022529285E<UGUF<£<£3£§< om¢<£<m3m8§§<b£<£<E<mb omd<£<3205522<b£3338 omdwgaogmaoxavszyamuafi:m2 omdofi<£o§o5x22§<fl<33m2 om¢w$<£<msm55553%?ng o353330533555ragga: omdufiogmmegubws3329395 omdumfioefifiozoegasEEENENS maggomzmmmsgbba:yoga: oodfiomzzzflsflayo95303$: 038.20g39629285352m: m3 mom $0 mom 0% Em NR. me E who 0% Re who mum owe mm. «mo mmo owe E E aa agEEEEEaEEa aEEa Nwoao m¢oao «wean mvoao ofiofio NQoHD onHD onHD omofio Hmoao Nmmao mmmao «moan mmofio omofio Amman meHQ mmoao OOOHQ HOOHQ NOOHQ mooao vooao mooao woman woman woman 119 WO 2013075035 PCTmS2012/065691 $0535353252355:869% 3m52:5338.430momUEDSUuuGEOm 3535MB32583338532 353532322085328%ng 35363230320853589532 55E:£32883329969632 5525£92682:E8332 35325962335565532 3532535283552532 2532328535y655£<£<m 25323288:gasosmgfiam 32355265JBUHEEEEQ 323536295:38252230: $392552:38535223222 322632635385352335m Mammy/$55358$:m222fio32m $6222653583332£32m $25963552222229:2m $6285355222223:yam $23283355m:922253232 a 2 b 2 5 5 b 5 5 U 2mmmmzsosm.wm 2 2 265 2 2 E G $8283538532232?£230: 82853559:?EEGSZNGMSM 328953553323230:mmeSm SUSS3553mm2233223032 $635386322233$9632 2: om: 2m: N22 g $2 a: mm: 2: 32 mm: som:m~mm:mmmm: ImMJOOMH 82 82 82 82 82 $22 onofim< :22 N22 222 $22 $22 222 222 $22 222 $22 822 $22 $22 $22 322 222 2252928532°22 0359280?NEEEOSUUEDmquucq o35929662323:onBU95£22 245.5.5232$036385=22 6633996283=22 2::382022325533595mt 2::3325632EEEDWSUU95NU 2::35.5832225552:=2 §<UMB22535385=2 25:5EBnaugzzgflsxuas 25:535620592229:@3835 2:553:89696235636385 2:353296mbmuéufiéflosuésbxs 2459095:82552335935 2::NU£295020552293935 0253295:seugfifigfloaosb 5522855325355 25:53:ESEUGMEEMSWS 23:5«USS352669335? 2:85:28snaggflogflog 25 5o: 032 b 255 S 5s: S938:: 626 :62 E G 2 2 EMmmz 2ummm G 3 2208:5253:33620532325 25385:BSEQPGNUWBEEQ 253855205355689325 $3592535295522222 245925555222325922 $0 g $0 EE N8 mg mag So man con 22 N2 m2 «on m2 OE mom lmom a2 EEEE 32m ongm 22m N38 22m Ea a aa gmm2m «m2m 22m 22m $2m 22m mm2m 82m 82m 32m 22m 32m 22m $29 onwao :20 N20 22o dhmao mhmao ohmao human whoao mhmao owmao Hmmao NwOHQ mw2o $2o 22o 22o $29 22o $20 829 320 32o $20 320 220 120 WO 2013075035 PCTmS2012/065691 EsmesubmsmzmEwessomSmZm omSSSUUEDmZNEugmmmusmvém fiamgbeeegfimfl:afigoaogm zmsmgueoegfimfisgmmeomzm 3fl385$3mw<£<mm3<£905m¥<fl<3 3m389%sz£<mm3<£om§<£<= absuégeggm:gmfiéoefiss 56§o3o£<£<m=gflosmgflss UmbmmusméflgoaQEMSEZNZJSW Umbmmusmzmzfié:Eoflsmmgasm 35memu,<£<mu.:mmmu,o=u,o+<u,<mu,396m Emmawmzfiaflsmmmuéaommasaom Maggi/EuE<mmmu5m+<+<+<95m2m wasmm¥<£<£oa<mmm5m+<mmagma EoEEESflammeogESEwart =m§£<£<m5£<mm36£<§963$ m$<m£<£oE<m*wm:m+<mv,<+3¥3mu,<m+ua mafia?£o£<£om§<£<=393% $2535£<3o=m£<£2203§3m 32223223033$:smefiSm $28532«593%£<32$<mba<m $2me3<£um5mm£<33mmmb32m 32$: $£339$§3gm 82$:gmfioeommflagmmx:8% SESZMGWSWZN$3326E<£<m mawmzzfloflfizm$59€82<£<m magma/‘muéemumzm:aomébusgmzm 3.2 322 om405300mv0u:JW<U*D+D+D:+0mw0m*Om*< 035303000532055530 0353592835 035 35830535 083533053530 wz3*0wqc0UwD:+<¢0+D3033+0m*0M+0 omgw<mwzsw5umo;0:+3;<;0:+33+3u;<u*0 omd<m5=5w0+<£0 om.=0 $455 $353093: $353535 omd<m5 0353,43: so 3 035303.455 m”Gun,3“.FD“.F<U“.F3 om4+0mw<=*3+3+0m¥0u*3*3*<u+33*D:+0m+0 om4w5u*<m+333u+<u*0+3+3m+03*33*3u+< om4*Du*<m*3+303u+<u*0*3*3m*0:+33*3u+< 3+0 3+0 E02235 0353035002me £055 80“. 55 3+0vF<uF0u5 35+0+<u+0 su£<355+0 $359325 £09633 35938693 35938093 :5 :5 £030 EE<+03535£<£0 30 3“.395 £0 233530 305532233530 om4%ws*DU+<m33+Du+<+0+0:*3m*03*33+3 wnu*<+<+33+Du*<+0+03*3m*03+33*3 om40<m053+0mm:*33+0+<+0u+33*<u+33+3 om405mwwswbumm*33+D+0+<u*0:*3m+03*3 :5 m”F035 Hm”603.3035an om4+330<m*50500mw<3$5w5$0m+0u$33$<u+3 05mw0::u$<mw5w5w3u$<u*0s*3m*0 om4033*:mwowawauw<mw5+swsu+<UW0:03m+0 wmngswzsw<MJ:w0m*<*D*D:¥0m+0u*Ds+< 0353:3265augususaufiuysg 35838035 0N5 HNN NNN me «Nu me emu 5N5 wNw me Omw Hmw wa mmw wmn mmn emu hmn wmw amp 0.: cacao nmoao waoao mmoao OONHD HONHD NONHD monao VONHD monao woman woman wonao mONHQ OHNHQ Hanan NHNHQ MHNHQ wfimao mHmHQ OHNHQ NHNHQ wHNHQ mHhHD ONNHD HNNHD NNNHD 121 WO 2013075035 PCTmS2012/065691 meammuamfiemvgm:Eo£<8m+<£<m 3m+<mm+0m95m$<£<s3m$<£82<m+<fl<m §<§em5m2£<ssmzmbsmmzmzm mmzfiogogezsm£§2$<£<£<s $339633:3343523%;: mawmmusngeoymmbzfifiégmusa mmuémmszgsSmN962%$295a mammewgfloemummys93229395: mwémsuéfifisaomfi:£293953 masmmémzeamzsafifisafisasm $5mmuzgesmuésszmzm$535m 3532952.035:muémuéuéuaasszm 3532333535:£<£<§53<~ mafiagagflusmmu,<mu,<+<u,:=u,3mu,<m esfl<£u=mmuamuamgusmzm $235awe/USmmmvamvéuéssuaflom SEEDEofiESmma<£<33<£om mmzmafizgefi$23355£<m5m SESSMENUEE2:35a329% $536£§3£<mEESSZNEWGN <053<m§<333$5me figmmzmbszmzmfi:32$<m6m2m 3eammzmbszefimgg:23%;} £<£<m333226393? sawmflfisgflfime:aimmuémzs mafimbzzgefisEsgfifigfism “9,5903%?ngEQUEWWWZNSN mm: «mmfi mm: am: 5: 222 ¢N5Hm< mg? $22 R52 EEEaEaEaEaEafigEEEEfigEEfigfig 025:53525332253502535 omdDEDED:mm538$<3330m505 035=535523:522355505 0323535:303202333356 333535555328;52:025 wod<m5=5 @3333stst 0323.435: 3: 3 omd<fl<=555 333220 3339,96 ED ED omdme<m95u5u53u5 9&3: 9&3: PEUGSEU 36 EU $0 96 UzmSEDu: 305593953593 wan—33455:JEDE<+OUFDEUE<EDEU $333396 wan—33.4365:35352535839535 mod:3233395333525P5939535 omdUP—Dmgcqm:EDEDSEHDEUmEED 35359225DEEDSZHEUNEED 8595:2235EDSSNEJSUZNS 026953222353955963323: mmm533553<m553< 3553:223335553295:me $25885:2235553596382 om:3285523329535£03502 @3555;£<£235333<m55 035.5555EEDSSJSPEMBEU 8335583<£<§53535£w95 55323/55535959635 0353:5895£35353:32$: 03333389635£25333??? 2: E a: 3: E 0E :K mi 9R own Hm“ mm“ mmn $5 mmn om“ B“ ME mm“ 9: mmK E“ m3 9K R: mNDm #NDHm £5 £5 35 EEEEEEEEEEEEEaaEaEaEEEEE mafia wmnfio mmho 0E0 Rho thHD mNhHD OmnHD HMNHD NMNHD mmnao «mnao mmnao omhfio REG meo mmDo oES HES NEE mES SEQ mES 2R8 5R8 MES 950 122 WO 2013075035 PCTmS2012/065691 33.235 3 35332 own—333234334333 33233232 3323323235 332332353233.on 3335 3 3 33285 85 3323 332332 3323.33, 332333, 3 35 35 3353 3 3 3.335 32 332332 3323335 332335 33353335 323.3535 33233532 32 35332323235 32 332323235 323235 3S 35 323235 3535 35 3323,3235 3S 35 3Z3 3232323 3S 35 35 323533 323535 323535 32353233 323632 353323535323 3323535323 3323303235 3 3 3 3 323 3 3 3 3S 3 35 323233 m 3 3 3 3 3 3 3 33236333323233 323855 32366235 3 mwOm$0w<+<E<muG 3 3233336 323335 323332 323332 3: 3233633 33 3 32353332 323633 36336 35 3U 35 33E 36 3S 3U 336336 3 3363225 3 33335238 323 3 323 3 3 3228 323633323233 32362535 32 32323332 3555 3323633 3E 3S 3632,3335 336335035 3U 33336 3336 3:3 323 323 323 33333336 32323 32323 3363 3363 352232353 332353 33635 33635 32336 36333235 33235623633 336335 3S 3S 35 m 3 3 3 328235323 3336323 323 323 3363 353 3 3 3 3 3 3 3 om4w333<3wbuuu$b33<+<+<3+3333333m3w om4+333<333$030033sy<$<3<3333333+3m+0 035:5me38533223333353: ngEDEQDU£UEE<EEDEDEDE< 34593345:uUuSBEmEEDEDED wm4+3mwzsw<waDUWUUWDWD+<m+<3+D3*D:*D wm4*03*03w3m33+UUWUWDWDm*<m*DJ*DJ*D om4+u:*0333w<+3JWUUWU+D+Dm3<m333333+3 om4¥uU*Dm*D:mJWDUWU+03333<m+<3+DJ+D om4+Uu~Dm*D+D+<:+Du*U*U*D3+<m+<3+33*: $358030: 3 3436803055 E: E: 3363636 3363636 :35 :35 "3339533 "3339533 omeDU¥UU*Dm:3+<3+D*U*UU*D3+<m+<3+3 %Uu*D+O*D3+<3+3+U+Uu*333<m3<3+3 ©2:SU£E%ED£QDU£UED£<£D fiotzoaD£3t¢u£u€3£<£3 omAwostU+UUJM+D3+<*D*DU*UU+D33<m3< om4+0333quwU+DM+D3+<+D+DU*UU*D33<m+< omAwUU%D:wUuu:+03+D+<+D3+Uu*0333m*< om4+ouw3:waUVU:*0:+D+<+D3+0030333m+< om4$<9303$DUUU$Dm33333<3330+Uu+33+< om4+<oyu:wau$UUWDm$3$3w<smau$0u*33+< $UowDJUUwUJ$0$Dw3m$D:*Uu*UJFD omA$<meowaDw0u$usww+333mWDJWUu*U:*D mafia—£405::uUfiEQDPEEDuUuS om4+<m¥<u*uw3w3u*0u+3+o+33+<3+DU*UU+D omgw<mw<mw0uJJWUUWU+D+OJ*Dm33330u+u won 333 OR 3.33 3R mR 35 Rn ME 3R own an an $3 in mmn own an 3.33 83 NE 3.3 33 aaE EEEEEEEEEEHEEEE aE aEE ommao Hmnao Nmnao mmnao fimhfio mmhfio omhfio hthD wmhao mmhao OwNHo Hanan Nohao mohfio «ohfio woman ochfio momao woman momao ONNHQ HNNHQ NNNHQ mnnao QNNHD mhhfio ohhfio 123 WO 2013075035 PCTmS2012/065691 mm+<mm6m2m5£<uaway/EMS=5: “5&5e<3<mbm§os<§oa5353 mawmm6£<e<5mmm63&3:95: §<mmm2£o§a33:3: $9ng£32355»:9595: my,em£<3<£u£omm£§o§59595: mam323283039330:39595: $235£§<flomm£om5u§59595: $235£§<flom§om5§9595: $232yo309%@022953538 823253030$395:3538 magazuzwomfimmfls95559596: $5mm+<£<$o$<mmmu533=39596: =m+<mm+u£wwo~u.<mmes95559583 flogmmas3539523 uégfiwmses35559696: mm+<§<m53<£o¥ 353539696: mmbmeomafifios353555285: mmUEomeZmG:3233533523: fifimeEmeSg:SJSSUEUJSN é<§wfl<£om53353:8963? mm+emm5£<3o33:SSJSUSUSJEM fiefioefioeasJEDEBBSJZM meommEEoisSs335383530: 335:3558:5393 mawmmémaeaeaz3595633393: mawmmzmuéeaeas328333293: om5+<m%<mwuvuw53w0u+0+5+03+5m*5:+uU+u 03%qu £< omdo 3.76 omdw 035 3.4 wad/BE mode £0 egg—<30 mad: 098 mod/~05 @3230 £< @3295 30 E< ~28 0323.433qu wmd<£<£<8£538803035£530 omi<£<£<w<5u5 wmd<£<£<m om._u_<mu,<£<m omd<fl<$<m 333.4 ~22? £0 £<m$<m 30 £3 m+<m m+<m m £<m mob £<w$<u+u wmgw<mw<mw<mmmWUUWDWD+Uu+UJ+OJ+5n+5 gi<£<£$<§£0£255803035£5 m m m £<+<+< m omd<mw<3<+<+< m 352303022 m £<9<t3< mm 035323930 omd<wb£<mm 3225 35889535 35805535 $396+ 9396+ m? m2 m? m2 mucq m+< mch m2 m? a? m? m3 mm; 02m; ED ED 396630 95559595 95568595 £965 £965 5588595 5588595 $542.4 m??? 39696 39696 935535968595 935535968595 m+<uF<uGu5 m+<uF<uGu5 a??? 9&2? 9322 a??? 93:; F322 m? FE m2 m? 3< 3+< :5 3532803959685 39696 39696 m+<+<+<u+uP5uUuu5 $005 9605 €un 9296 £085 P586 39596 m5 8085 PO 39335 39335 E< E< 3035 3035 30 30 3686 3605 39596 3596 36 36 928635 928635 mmn 03 an 08 8m Now mow 8w mom mom Sm wow mom 0% Sm Nam mam Sm mg Sm Em 0% EEa EaEEEEaEEaEaEEEaaE g Amman wnnao annao Ownao Hwhfio Nwhfio mwhfio Qwhfio mwhao wwhao hwnao wwnao mmhao omhfio Hanan thfio mmhfio wmmao mmmHQ ommao mmNHQ wanao monao OOwHD Howfio NowHD mowHD 124 WO 2013075035 PCTmS2012/065691 $330633353333363695959695: $335333ng3336363330333 mm3mm53535353358353me:5: mm3mm§3333333358333333: aflommS3535353363335353:m mflomm33+335333:695mmEDEDm mflmeD3533350353355P533m mflmeD3535:539533m3+333m MW9.5395353536333963953:93m mflDmED9533:639596::3393m 3953535359593339555:393m 3953535359533395::3393m 395353336363396959559393: :muFDmEDEDP—UEUJJ 39535359595:mW+DEP539395m 395mg:359583:mMQFDEDJm9395m 3953536:635mm3535339330: 395mg:96:63:mMEDEDmmm3EO: 39535959533? 36363: £035: 3 3963963330333: 9635339393: 3535839533m3353339595: 35363635303333333330353 3536363530:3333333033: 35858333933::3m3353333u 3585833393::33m3m3m535u m5mu5: 33335595 96: 9393:?”536: 9333:mm3£29535u53 $2 3:2 023 o33330533333333 @9333 0339396“. mod: wad: 3453333833 3.7533 @3535 @3535 mad: @3535 @3335 3383 93 £33365 @3335 @36me @23me m6: 93m P533m 3333 35 3533 man—695:5 0238335 95 woe—093mb wmd<m3m3u m 3 3 3 0333303: m m :3 340: $33633 933395 033363355 023833555 3 3 355 m: omem3£U3S m mm33333 m m 3 m $0 333353 339353 85 96 363335 363335 93 93 :3 333336 33 33 3: 33 :5 9633 $033 3035 3035 93+ 93+ £365 9365 9336 3333 P533 93 93 93 93 93 93 93 93 03m3 03m3 96 96 93965396 365396 :3 933305 933395 333396 96 93 93 93 93 93 93 93 93 93 93 93u+3u33mu3mu3 33mu3mu3 939393 93 96 96 96 3396 mmd<£093mu9539533336 :3 9395 93 93 93 93 93 93 93 93 93 93mu3mu3 93mu3mu3 96 96 93m3m3 939393 3396 9695 9685 9396 9396 £6 96 96 93 93 93 93 93 93 93 9393 9393 93 93 93 93 95 95 9333 omd<mw<£<§<95JSUF<UF<£<US£<M< 3396 mg mmm «mm mmm Rm mg mNm 0mm Hmw wa mmw «mm mmw omw Rm wmm mmm 0% 2% 9% gm mg 9% 5% Mam agaE gaEEEEEEEaEEaEa aEEgga wowao mowHQ oOwHQ nowao wowfio mowfio OHwHD HHwHD NHwHD mawao «Hwfio meHo meHo hHmHQ wHwHQ meHQ ONwHQ HNwHQ NNwHQ mmwao #NWHQ meHQ omwao thHD wNwHD meHD omeD 125 WO 2013075035 PCTmS2012/065691 3535335:53m£<§5m35y53 35353o35352330553033m 3835@6353:mm£<3o§3u35m 8532MB353%EamSSSUSJEM 8532333534;3:is852% 353535eagmmzossufioaa96: ne/5963589596: 3:395353%???2995:2is 3gmisSsszmsmS35%3&5a $53595£<£<=m9529559695: $635Eageémassuos$595: $535gazes»:285529538 $535ENENSMJEBS$9533 3535 £<£<2o§539353538 35353???383%?538 353233333:853<§3355= 35mi<£<m5m5385333355: §DE<£<2033823$955385: aSE<£<Eo=S§S963385: a$<§<m5msssu329955535m §<m£<£3333833&5353% 3232393538:EosaSbuSszm 355:Eogaagnefi 223533385:$332522?” 3235333853333583533 £23535535mg:aubusagom 8:352:53:NMEDEUUJE<EFom $2 5:2 @225£35333,3”,2<£<£ue,<mué omdzgmzmszaaas£<£§3£< 035«Zyéfifizgaaa~23??? QSUEEommmUmSSSEggs: 333220228£2953293832 mmmzagsus3593355 93:65 waggafigggssEnigma 02253336mu,<m¥uu,<u,:=u,33u,<m¥<mu,u 032355www<£<§<=533£<£< o$<£§2<UF<MF<£823535gm: 025928:Ewafisopsasgg madmfizguégo£2895353$: mu,<mu,<u,<u,§<3535£< omdomZmEUSmuamuauauéegsasg mad/$59382<NUGUF<UF<NUNS95:2 $2233353239393969535:2 om¢<£w9<m§5£§<§x<3333 84255355£§<§e<3535 mad:«Emawagessémvambmuse: 035«REE/«2303225£96333: $353230?£§2$<9<£§<33 0353<£o§<£§2$<$<£§<35 @3835£<mm£<£uu52£o£83: 938:5 £<SS9593932: £39m£<p§§££m£<§£a wagging/«£58:9359,52 3:85efifiomuégbs£32930: mg 0% «mm mmm omm Rm wmw mmw 8m 2% New mow Sm mom mom Sm mom mom 03 mum Em mum aa gEaaaEaaEEEEaaaaE EaE Hmwao waHQ mmwao Qmwao mmwfio wmwfio hmwfio wmeD mmwao o¢wfio Hewao Nwwao mwwao ¢¢mfio mfiwfio ofiwfio wwwfio wwwao mwwao omwao Hmwfio waHQ mmwao fimwao mmeD wmwfio hmeD 126 WO 2013075035 PCTmS2012/065691 35$:335:2?35382223? “$333505zigzag:NEE/é 36353035393385523038 353553530338532638 $333533:3883:2235: um+3mzuFDu333333353539396: 3953963953033385333595953 395306333033:uuBP3mMm5u5: 39585 353333 3039333835 395805333333895mu3MmEUED: 39635963538:E<m+0+<u5u533u 39635£09538::u3flwm3533u EDuU: 3 um+3m3+<m535ubss 935330 35 3 939355333an mu3mu3JUJSEUm 553535355:253993332: 3535:5285:gagging? 355:525555332 swampsesutesmmmZeugsuomSm 35mg3385E<mmm5§55£<3<m U£D=W<mmm505=§<3<m $535°83:«$332203:96m $335535gmmsbsaafiayam 353805323090533523235 3536053230EUSEBNEEUFE 358635$<9<BJSEU+<S£0960 3536EDEEEEEDEUS£0960 368533338:358593528 $2 $2 03H :2 N5 figEaEaEaEaEaEaEaEaEE $2 $2 3E Mama? 3&2 8&2 8&2 mama/3 $32 $32 «$53 ©9253:mmwofls/‘Uefiomzmb 03238352230eésuagogmb 036.285:263/3223??ng o30.28552aofifisfiSSEER 53£<HoUF<UF<NUJUF<mG£< bssmu,<mu,ou,<u,<mu,ua<£omu,< @3253?:EEPGUFEEDyam: 3353295323052335yam: 342332895£<§6£<£ua<£o omgmzmfiéoss£<§6£<mba<£o omdofigomfis932593355m2 853302595322559395m2 QSSMEEEN532$<Mofi<£ua< om:agesozsbaagéflo£532 02:35flammflBSSEEoMEES 02233330NSUSSEEomZmZUS omdsfisgmmgegazgrog/Fa 025«532253655Egg/Fa omdoEEGNEomSUS3233393 OSUEEGEENG£995image/3 ©3595«SWQZWESUED985$ ©3595£3§<£§<§u953&5“: omdosbeém£52303323%? 8553236£<£E<SUS3&3wa $36985msnguéuéeuasmzmfi 5»?£59,363:NEWS $36995:36$§£5£353<96 Em Rm E 2m a Nmm mmm «mm ma omw am wmw mmw 0% 8w Nam mmm «mm mmm mam am gfi mam 8m mom mmmfim mmmfim 038 :58 #53 gEEEaaaaaEEaaEaa EHggg Mama $80 880 $80 News mowao dmwao mowHD woman woman wmwao mmwao onwao thfio NR8 mafia «$8 mafia 0&8 Rwa MEWS $89 owwS Swan NwwS mwwS «$8 127 WO 2013075035 PCTmS2012/065691 3835:2338:28233560 85353<3<3§3303:2596me 05353&253533$35M 353230.285:82330255: 853230338:snow<3<mmuu6uu63 3:3255353539626533 32332535:UEDNBSUUWSU 3$35£853833339855: 5Enumafifiuxosbs §<§<eu§=b§flombuobmSuS3 mmémmzeuesaugflogsmusuus3 363505352?mmzuuobuéauysm 36350533?mmzuuoumauasm $553253:mumbubfiusysaou $353553:$553538 9.333=58<E<WSUUGSUasmbm $335232<2<m§§o8959% 3835eoflseomUyOWSED336m 38353082685338202% 8.5SSUEEEESG282%me 853592329505Eu39%;: 352633«558385565£8 3msmzbezemumgufiag@638 guana5328338 3.3823<3<5Um5353528 atmysmuégaum§32996955: 55E:sogaumaus283:5: HNON :22 0263985230932595053296 omdumeSSeamzzuzmvzaueamz om¢§om555fingzzmzauesg 0323090:82302230385=2 o3220993832362230£33=2 omdogmfimasNEPENEMEEUJS 353999359,293935535 ommaua<§o$309505 84236655auassuégaomsus mad/EBgummy,8525593530 $22.5«SEEM,BEESMENZWEEU oflbefiéummfi395235£3095 oEUmuzmuébuémuéauuégo£9695 aoSMoMSUSNEH/Fag omdogfiésuw0929533939393 gmmaoflgsuoazaogfio o3633302053956E<ao£<£o 0259502mmaufloGSUS£35m: 02528225NUWGGSUS955m: 022:thmmwfivévévéeusuaeég omd<eum§$<$§$2o5:23am: 03538503036693595m: 85383523056638595m? omdomzeumugmzbfimfiaugao wmdomzeuGUNEMUEUEMGEUEEG wad/EmEoumgeggmuémsg:m5 magma£29,BEEoEUWGWSUSm5 mom moo. mom 03 So NE mg So ma go Do mam 2m 0% mm mg mmm «No. ma omm Rm mNm mmm a a a aaaaaEaaEEaaaaaEaEEE mwwao owwao nwwao wwwao mwwfio omwfio Hmwfio waHD mmwao dmwfio woman woman woman wmmfio mmwfio oomfio Homfio Nomao momao womao mOmHQ oomao nomao womao momfio OHmHD HHmHD 128 WO 2013075035 012/065691 Umuamafizubemva:SWUQFPEJUUSU 823235805sueambmm3850 figmewmbeumsg38625596: 35358538:305355: 333958205:$835633? 33353865:$633858? 8536538533320655: 806355985336958965: $28068osbesmfiéaubusU595m $28655333338852:m ,85acummBUUSUJUE/‘m m58063323360335853$ 0885guesmuommauxsbusa:gm U585euasmbmmauysuaS96m 08mm”,BS236may,u=u,uu,3u,u=u,<mu,o= Umomflauseméo35968335: 8538333053850565NEWS: 3626EDWUWEBUSUSSNEWS: $535Eoeomsseuaéazwoa:3 we:3520533855:amass: 3fiSSMUmZEUU8505259535m 3mbméambmzsngaea$3332 3535303888533063:32m 853530385853239532m iambmzeueagxaNGUGBEDNEN sasmmucgsbeouausflowing/é 3585£88.58Emfiuésszmzm omdoewmzamb3395539832 853%25830£<§§om¥oeu3< 09%sz95022633333 o3&2902550226530M583 8:030£0?JUMUUF<UF<MUF<UGWBEU 035.5£9Q<EUMUUF<EH<UGMwas oSEE/$2»?BEUENENagy: fl<§oEBEUENE59%: wasflogmmmuésuouébpémuayémué 8::3o393653996£33596 oatszgmauéEDUGUENGEUMG egosuamuEGEmGEQUEUENGEUMG 3:85 035:5 m5mmflofl<58m8m+<m+<aw 8:85£935EomZSUMUfl/EEG omd<9963<mmmuamuééSsoxEoNU o3&59,3623%”,9<5y6£<£oNU amaoflwué/Eumuomu,<fl< 02252230mv,om§6u,<aumuo£<mu,< oats/tbsmmvamvavéoysxofiao omd<£§82<9<fl<§o95050296 095338:goggsomzsbmbg 03533065£o£9$om23umb£< 8::3<£<83<9$9<m69552< 0353%?qu2&2623933592 805NUGUF<BNG$<EUWU £2605egséfiogaumb 938:532mSuoa<§<fl<flom52o 03 mmo mmm omm “mm wmm mmm So Sm 2% mg Sm ma 03 mmm «mm mmm omm a E EaEEa aEE a EE a EEEE NHmHQ mamao «Hmfio mHmHQ ofimfio hHmHD meHD mHmHD ONmHo HNmHD NNmHD mNmHo «Noam mNmHQ ommfio Amman wNmHQ mNmHQ ommHQ Hmmao Nmmfio mmmao Qmmao mmmao ommfio hmmfio wmmHD 129 WO 2013075035 PCTmS2012/065691 3636ensueuae/Eog333$ mfimmzauezezgflomSSSmZeom Mmbmmzeueaeausaomngzaom 8535555:mwoeaafifias umwOmmM—DquEUEU: auomysuusuSflom: EQUSUSNGMSE sesggm: meOED 3 mmucqmtws mafigusseoxommwa95223032 3:$3335mmmfiflsm masmfisbsbgmwe:afifififiafi $586stating:E<mmfloa<m EDEEGWSNEU 3680,3330»:asmzmmflsflfi gnomeugefiég33<NUF<UGUGE<£UN Umbmgbeuefiés33<£<mma<mu6m £<p§65£§<m “$335235?Egaomsfifizm =5363§o233mgwéuszmbaom 3836:2395:mmzwosmmbaom 89535£0333:mmaomvésfiuamuém 3535£3335mmm+om5mmu+<m+<m esE<m§oes<baoa<u 3532m5333<m~303<8£o£<u fiamewgszefimfla£<§<m2mbm Deacomsssfifimw:£<U§<£um 33<£<mm3<£8<6£55: 339953<£<mm3<muomm£<y6= £52628is $995eagfiom:£833,093: 028:532225es§<w<flomu55 038053:£332<u6£o£omuF<eu 8:85352250526£3335 03253::E§u§<3§§om5 m325322<£<u§2<$<$<m5m5 035.285ssmémbuousmuéfiofiog 3:353:55FENUUQDEGEGNGQ 3E<£<UUE<H<H<MG 84536555E<£<§ua<fl<fl<m5 85358395NEEUUSNGNGNG 8535999595NEEUUSNGNGNG 3835E<UF<UF<UUE<H<M< 02595359635E<UF<UF<UUE<H<M< 02696958y532<2§y§3o£o 0363529360535223859696 0259533=88322<£<53<M< 02595335253293935335 025520:fioyésusgmbxsao 02553055£§295£<5§£o omdosssamgefibss3293532 03838555356553233632 03833383333653229605 0389:5563:563322595 032303839:3<§5353<£<5 0325:5553:agobssszfifib 0325938202239595935 33592969695282:959396 Rm 39. Nam mom mom $5 mom 03 Em N3 m3 Em mg Rm Rm m8 0% £6 mmm E a EE E Ea EEEEEaaa EE EE mmmao owmfio HQmHQ Nvmao MVQHD edmfio mQQHD onHD hemao wemao memao ommfio Hmmao Nmmfio mmmfio wmmfio mmmfio ommao Amman wmmao mmmfio Oomfio Homao Nomao momfio emmfio woman 130 WO 2013075035 PCTmS2012/065691 3%:ngmfiugofifioeau $635323,430:msusomsuaeau $535£3mem§<m§<bm55m $535«2.209:mm£§<mum32um 3memP—d‘mH—d‘mu—OP—d‘muEOE/$963396: 3m532336328£33355: 3532969:ESNMEEUBS96is 3m5mmzflomSfifimmEEum:96is game/$53<mbmm£§9§5y6953 3230,3558awe/Em:8595: $23595362$96395893350 32mEmmsmuagmfiufls83:38 maimfiegogm8539963596m 82mg3<muo£om§oasumas96m 36%,:£§<fl<8m53905955: $995£§<MEGWSEUWJ $555935»: 95053 £363,392:593m mm,mma<£o£o£<ume§o=saumusm $29,523.48?593555960 maammzuzmzmbm:59538528 32283355:BEEEEUMSWUM 32383355:853583399 $282M:Sums8333280382: me<§<m25m58m533382: $00396£53895EUUGSMGNSm mwomewfl<£o350m23sonata”? asyéaouzszm 025366305955253532m: o35«2055533329353532m: omfimzmbm:auaoSSmbysesg 859458055305338335? omd<£o£<um2§96323633:: o356338339653259532 smusEUUSEJSNUUSED @225»??me5353538335 omgfifiomSBJSUUFDHDE/EUED om¢<£<y,ou,<u,<uu,oasbusmusafiosus $369290?muomSSUaosS£85 omdwgegouémbmuésb3535£85 o28m?£<um£§o§5§m53&5 REHEEUEmuzxoSusxsmSgyo amigomzsmz999596363:yo maggoessomz396559635yo 8830525”EUGEBSWSa: 026533355£853,359:=2 om$633303:963535 o2586522£33303:59695 omdsmbmbmm«205220535053: oa:353802336225950333 oSZEouzum£56283:9696 032300256£<8UFQF<£M5596 o3:”EMUSMZE<653<595§ 935£398<UMUF<NUF<§0£5595:: %maomu,<u,<+umu,<£umu,396 «mm ma £3. R3 96 3m Nam mam mam 3m mam 83 83 83 83 88 88 88 88 moofi E5EE E EEE a Ea EaEaaaaEE oomao nomao woman momao Ohmfio Human thfio manD enmfio mhmao ohmao human whmao mhmfio owmfio meHQ Nwmfio mwmao wwmao mwmao owmfio nwmao wwmao mwmao ommfio Hmmfio NmmHD 131 WO 2013075035 PCTmS2012/065691 fiammzmthEum:saxogmuzgm 358295385:38322033933 86325386:36333322: $23533gums:85305232is m$<m£um530m533803003295: $285355358333935£95: $2853863589363£95: $06megownssomaoa<SUP<£335m Stags203338368?$535M 853553:=8»%Ue2<2333<= :sewage:$3532: $52;ng3509633232259595a $535333353§<E<§9595m sasmxoeaeumsmua:93553235 smsmeweseomusmuys£33233 36%,:385200323235£396: 39$:355200323:ngNU: 693mm?£<222<3<Usm fiémaagbmsmbm:geasmefism magmaaxoaoe<gm£3EDESNUJEW 592:Engamsgszm saamgbgmbeammga3<§§3£om 303:$33238330m 3385392323325263235 338539232935$383333 geomflsmbfiagg323265£05m EQMSMUNSNEJ=2<E<u=£o£um mm: 282 0353239856NZZUWZNUWSPG ©3235~53SUE/«220535635 032:5£356352206339635 032$: ©2595 8:85 ozéfiumzaums @322:33Eogxozzflugflufi3 omd<£<35mambmbuéuéefiaflfia o3<£<32<5mbyQEEfiGefiG 0353,33:36a<UUFomu,<mbmu,<£u 8::£<£3ué<aox<§ogmbmzmb $323293?gawgbflgfiog 83323355NSMQ<UMUF<NUF<05£< 025m59&3a<ao§§o£<mbfl< £5353<399§o£<8m+< 0253292395NUFEPGNUGMENEUG 02632322295musuébmbggyé 0223333amassu,<+3u,ouu,<uu,omu,<mu,u omngmSZZNSE<§ox§ofi<mb 025.52%E<=§<u5mbmbfl<£< 025£o£<§<£<32<5mbMUM/Ea 026335S£<m5§<96£§o£< 038323325£<£22<2o£§o£< 0359530:m3<£<55m5mbeumz £o§<3<£<35£3965? 036.5:sz£3£<UF<SE<963<UG 3553265NSNUF<UF<SE<E§<UG 35985mma<a<§<aspsmbfiu 359852632322235Esmbmb HHOH NHOH mHoH «HOH mHoH oHoH “HOH wHoH mHoH ONOH HNOH NNOH mNoH «NOH mNoH oNoH KNOH wNoH mNoH omoH Hmofi Nmofi mmofi dmOH mmoH mmmHQ #mmfio mamao ommao hmmfio woman woman OOOND HOOND NOOND mooNo «OONQ mooNo oOONQ NOONQ wooNo mOONQ OHONQ HHONQ NHONQ MHONQ «HONQ mHONQ QHOND NHOND wHoND mHoND 132 WO 2013075035 012/065691 EmmEouzefisg$585255: 853592333333333563 «2:5:9205263950 MmsmmbmsgaasmefiSmmmUmSu 358232.233:mamUJZGUF<yFoJUFUW 35823233359 3235:2265 3285 massmsuéaum “8:5£3532:SSNBEUWEUEM M835£3532:SSNBSWSUEW 823295353:82%2555303 323233359582<M<Umaumu6= mmsmyaesszafis9639650532 3532353235:fiombmfiomsm 32E:358:5:mMEUGSUHoEE 5335359530:fiéaoafloafi mumbflagoflsmz: $23532255mmgmusummszs $535m5£3<$y628969€p§3 «Unzmmyéeumma/E:a a$332355«5898555£95: inmatefis£08385?£35: 3535NUEEEWEUWGSEED353 efifimgumwosma:95: 323205smegmsgofiazzgs:3: 323205Eoeuméomw:$9595: mm5mmbgmzeoawo33,353523 $5$9533568303339538 £538”?£55955: ©2255:mysfiaggegofi 032055523:easaysszeoya 035.338:3333233595? 8:089:55aoe<§<£§5£3mb omdumzu‘oaedmsuPsS93953236 03595656323253NENSEEG 03558”anNBSEEEEED 355396393£99€3<£<35m3 33533303253gains: oQEUWEEEUJEGS«US$953: oflsgeosmsuuésé3232933: 8::gunfisomusxafio32:23:: was33535995295959395 3:33.59955552MBegg: REEDNUUEUWSED96:23:? 022:5NUUGEUMSUQD£03232? 022$:23033558ng95m: 022$:E<me+<y§903<fla£393 02233.5GaoagoSUSfloE/E< omd<£<32<bso996505£03232 ©3233:smubw<§o53<m5ms 259486363E:m3 032.2%?saugoZUMSUSmGE $223332:auxgbflsesgg 036.23%3256255:295 omdo£<£$<532562055323: gigging:8655932330 mmofi mmofi owofi HQOH Ndofi mdofi «wofi mfiofi ofiofi “fiofi wfiofi mfiofi omoH Hmofi Nmofi mmofi «mofi mmoH omofi nmofi mmofi mmofi ooofi Hoofi NooH ONONQ HNONQ NNONQ MNONQ VNOND mNoND oNoND NNOND wNoNo mNoNo OmoNo HmoNo NmoNo mmoNQ «MONO mmoNQ omoNo AMONG wmoNQ mmoNQ O¢ONQ HQONQ NQONQ MVOND QQOND mQOND oQOND 133 WO 2013075035 PCTmS2012/065691 3235ewflumSUmmS£33536: 88m3<E§wsbmm3<£223335m Sb§<$§oeumm3<m53SEBSM Eameoeumsoam:$335555: 033339320?$333520: 333553099WNSEPSSUSMSW 33355590:EDEDJBSWSW SGQUMSUGWS32323563530: 35:63:59:2359583630: ???EDJSUSMSWSN mgsfisbfioefigs953953:m atmmsuuémsng353955963: mmbmmSuGuszssagagmaoszm 8535963233:sesssasmsmzm 3233:DEBSMJWSNEM $58595£35:EUEoSGJEEom mwsauémSfiéSgsubsosme/Eom ambmmuéefiSsSg853295£95 efisea38533? NEH/U 86$:£3535:UEoEoSZNGNUN 85mg:gesaaaego:Eombm $53233=5enusmSmSzzmzuzs $9323:35358333:$352: $5323535533032265333 was$235355smzoafimflue:a 32E:35385943383633235: 32E:finenesmsfis£<m§<353 omd<m3< @330 330 0330 330 mad: wad: mad: 30 035 30 30 09:0 30 om3<3<3<3 003033 33033 @2533 ©3533 33030 33403030“. om3<3<303 3<3<3<3D 30 30 3<m om3<3<m3<m 30 30 303: 30 0253333 0323030 m om3<3<3<m 3<3<u 3<u 3 3 m a??? mm3<3<mw<w<w< 3032 02 30330 30330 mo 3330 m m m mm mo 3 33 omd<33m5§ 3340339305 30 33 33 3< 3< 3< 3< 3< FE 3< 3< mm; 3<3<+0+<M+< 30 30 30 30 30 30 33 3330 3<3030m3<30 330309330 0 333030 395330933030 3339330933030 3335 3335 33$: 33$: 3<+<+<33 3<+<+<33 3<UF<+< 3<UF<+< 3<+< 3<+0+<3<m+<+<+< 30+<+< 30+<+< m3<3<30+< o35933352023302 30330 30330 30330 309333 3030 3030 3<30m3<30 3<30m3<30 33 33 3< 3< 3< 3< 3< 3< mucq 3< 3<3<UF0UF<MUF< 33330293 30 33 33 33 33 3< 3< 3< 3< 3< 3< 3< 30 30 3030 3030 33 33 33 33 3< 30 3< 3< 30mv533 303333 309.5 309.5 30 30 F< 333093 3030 3030 3<30 3<30 30 30 3< 3< 34:33 3<3D wm43<m3<3303u333m303<30m30m3<m+<m33 33 moofi moofi noofi moofi moofi onoH HNOH Nnofi mnofi «nofi mnofi onofi nnofi wnofi mnofi owofi Hwofi Nmofi mmofi «mofi mmofi omofi hmofi mmofi mwofi mwoNQ wfioNQ mQONQ OmONQ HmOND NmoND mmoND QmOND mmoNo omoNo hmoNo wmoNo mmoNo ooONQ HooNQ NOONQ mooNQ wooNo mooNQ OOONQ NOONQ wooNQ mOONQ ONOND HNOND NNOND mnoND 134 W 2013:0;75035 PCT/U82012/065691 Momwxs: wagoflfioammoam a E m m $23535:830&3<£9&U§=5: $235essbeosmszeosg353 figmgagaezmsm:£<m2§<33333 $5353853:?$333333: 333mg:3w03w03w03mmw0mew<wDED3+3: 3535363636:269632395: 353595333:2332553535: 533932332:3535: 3m526easeszmmfluesuss9595: 3mSmJUEwanfimyom5:3595: am585333:«$8295559595: aSsSmusmS£38235:39595: 383535329683332959595: anomamawefiésmus3539595: 33293595559535: fiammSmngzume:9539595: Emmamafiogg3532959595: $953258?353539595: 25020:: 825nm w 2 Q< swrov wZ $038203: omd<fi< 0323,43 0323.4 $323.4 omd<£< $323.4 mad/«3.4 omd<fl< one—<93 omd<£< man—<92 omd<£< EamsuS 2 mzsm omd<3<£<55 Eda wmd<£<£<§¢Dflsfistd<£<£<fl<fl< omd<£<mw<m 845 omd<E<E<m 8.4m omd<£<fl<m £<m um m £4.23 m 9&2; m 34.22 £<+$< m fl<¥<¥< m m £<w<+< 0505 303230 303230 333$ 303955 303955 95%”, 33m”, m? m+< m+< m+< m+< m+< 8w E<+U+<u+<®+< 3<U+<u+<va< E m2”, 0 DUSUF<£<UUF<M+< 295 295 £29595 .w 30 EU EU EU 93305535 @5535 £29595 .5 2%: £0 80 EU EU EU 9393553635 3.3359583 mw<+<u5mu5u5 .8 EU 203635 m+< m+< 30 E<u+<u+<®+< m+< £<£< 30 E<u+<u+<®+< EU EU EU EU m+< m+< m+< m+< m+< m+< 30 30 3+<£<£< 3+<£<£< EU EU 3+<u+< 3+<u+< 8,25 a Nmofi mmofi «mofi mmofi omofi nmofi wmofi mmofi OOHH HOHH NOHH mOHH «OHH mOHH ooHH NOHH 82820:: 838304 3:865 03 wmomo mmomo onomo NNONQ whomo mnowo owomo HwOND Nwomo mwomo «womo mwomo mwomo hwomo wwomo mwONQ omomo Hmomo 135 W0 2013.:‘075035 PCT/U82012/065691 Example 4: In vitro screening of RNAi Agents Cell culture and transfections Human Hep3B cells or rat .E cells (ATCC, Manassas, VA) were grown to near confluence at 37 °C in an atmosphere of 5% CO2 in RPMI (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 14.8 ul of Opti—MEM plus 0.2 ul of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778— 150) to 5 pl of siRNA duplexes per well into a 96—well plate and incubated at room temperature for 15 minutes. 80 ul of complete growth media t antibiotic 10 containing ~2 x104 Hep3B cells were then added to the siRNA mixture. Cells were incubated for either 24 or 120 hours prior to RNA purification. Single dose experiments were performed at 10nM and 0.1nM final duplex concentration and dose response experiments were done using 8, 4 fold serial dilutions with a maximum dose of 10nM final duplex concentration. 15 Total RNA isolation usin ADS mRNA Isolation Kit Invitro en art #: 610— £1 Cells were harvested and lysed in 150 pl of Lysis/Binding Buffer then mixed for 5 minutes at 850rpm using an orf mixer (the mixing speed was the same 20 throughout the process). Ten microliters of magnetic beads and 80 pl Lysis/Binding Buffer e were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the ing beads and mixed for 5 minutes. After removing the supernatant, magnetic 25 beads were washed 2 times with 150 pl Wash Buffer A and mixed for 1 minute. Beads were capture again and supernatant removed. Beads were then washed with 150 pl Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 pl Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 ul of Elution Buffer was added and mixed for 5 minutes 30 at 70°C. Beads were captured on magnet for 5 minutes. 40 ul of atant was d and added to another 96 well plate. 136 W0 ‘075035 PCT/US2012/065691 cDNA sis using ABI High capacity cDNA reverse transcription kit {Applied Biosystems, Foster City, CA, Cat #4368813 2 A master mix of 1 ul 10X Buffer, 0.4ul 25X dNTPs, 1pl Random primers, 0.5 ul Reverse Transcriptase, 0.5 ul RNase inhibitor and 1.6ul of H20 per reaction were added into 5 ul total RNA. cDNA was generated using a d C—1000 or S—1000 thermal cycler (Hercules, CA) through the following steps: 25 0C 10 min, 37 °C 120 min, 85 0C 5 sec, 4 0C hold. 10 Real time PCR 2p] of cDNA were added to a master mix containing 0.5ul GAPDH TaqMan Probe (Applied Biosystems Cat 17E (human) Cat # 3 (rodent)), 0.5ul TTR TaqMan probe (Applied Biosystems cat # HS00174914 _m1 (human) cat # Rn00562l24_m1 (rat)) and 5ul ycler 480 probe master mix (Roche Cat 15 #04887301001) per well in a 384 well plate (Roche cat # 04887301001). Real time PCR was done in a Roche LC 480 Real Time PCR machine (Roche). Each duplex was tested in at least two independent transfections and each transfection was assayed in duplicate, unless otherwise noted.
To calculate relative fold change, real time data were analyzed using the AACt 20 method and normalized to assays performed with cells transfected with 10nM AD—1955, or mock transfected cells. IC50s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 (sense sequence: cuuAchuGAGuAcuchAdedT (SEQ ID NO: 2202); antisense sequence: UCGAAGuCUcAGCGuAAGdedT (SEQ ID NO: 2203)) or naive cells over the same 25 dose range, or to its own lowest dose. IC50s were calculated for each individual transfection as well as in combination, where a single IC50 was fit to the data from both transfections.
The results of gene ing of the exemplary siRNA duplex with various motif modifications of the invention are shown in Table 1 above. 30 137 W0 2013,:‘075035 PCT/U82012/065691 Example 5: In vitro Silencing Activity of Chemically Modified RNAi Agents that Target TTR The following experiments demonstrated the beneficial effects of al modifications, including the introduction of triplet repeat motifs, together with a GalNA03 ligand, on the silencing activity of RNAi agents that target TTR. The sequences of the agents investigated are provided in Table 2 below. The regions of mentarity to the TTR mRNA are as s: the region of complementarity of RNAi agents AD-45165, AD-51546 and AD-51547 is GGATGGGATTTCATGTAACCAAGA (SEQ ID NO: 2204) and the region or 10 metarity of RNAi agents AD—45163, AD—51544, and AD-S 1545 is TTCATGTAACCAAGAGTATTCCAT (SEQ ID NO: 2205).
Protocol for assessment of ICE in Hep3B cells The IC50 for each modified siRNA was determined in Hep3B cells (a human 15 hepatoma cell line) by standard reverse transfection using Lipofectamine RNAiMAX.
In brief, reverse transfection was carried out by adding 5 uL of Opti—MEM to 5 uL of siRNA duplex per well into a 96—well plate along with 10 uL of Opti—MEM plus 0.5 uL of ctamine x per well (Invitrogen, ad CA. cat # 13778—150) and incubating at room temperature for 15—20 minutes. Following incubation, 100 uL of 20 complete growth media without antibiotic containing 12,000—15,000 Hep3B cells was then added to each well. Cells were incubated for 24 hours at 37°C in an atmosphere of 5% C02 prior to lysis and analysis of TTR and GAPDH mRNA by bDNA (Quantigene).
Seven different siRNA concentrations ranging from lOnM to 0.6pM were assessed for IC50 determination and TTR/GAPDH for siRNA transfected cells was normalized to 25 cells transfected with lOnM Luc siRNA. The s are shown in Table 2.
Protocol for assessment of free—uptake ICE Free uptake silencing in primary cynomolgus hepatocytes was assessed following incubation with TTR siRNA for either 4 hours or 24 hours. Silencing was 30 measured at 24 hours from the initial exposure. In brief, 96—well culture plates were coated with 0. 1% collagen (Sigma 1VL) at room temperature, 24 hours 138 W0 2013,:‘075035 PCT/U82012/065691 prior to the start of the experiment. On the day of assay, siRNAs were diluted in pre— warmed Plating Media consisting of DMEM supplemented with GIBCO’s nance Media Kit —Free, Life Technologies CM4000), and added to the collagen—coated 96—well culture plates. Cryopreserved primary cynomolgus hepatocytes were rapidly thawed in a 37°C water bath, and immediately diluted in Plating Media to a concentration of 360,000 cells/mL. A volume of cell sion was gently pipetted on top of the pre—plated siRNAs such that the final cell count was 18,000 well. The plate was lightly swirled to mix and spread cells evenly across the wells and placed in a 37°C, 5% C02 incubator for 24 hours prior to lysis and analysis of TTR and GAPDH 10 mRNA by bDNA (Quantigene, Affymetrix). In the case of the 4h incubation with siRNA, the media was decanted after 4 hours of exposure to the cells, and replaced with fresh Plating Media for the remaining 20 hours of incubation. Downstream analysis for TTR and GAPDH mRNA was the same as described above. For a typical dose reponse curve, siRNAs were ed from luM to 0.24nM by 4 fold serial dilution. 15 139 WO 2013075035 PCT/US2012/065691 0mg i 2 300.0 m 2 998$ _0.0 50.0 So :8: 300.0 81:: 638: w 8 888 oxfimbéofi H 0Nw00.0 #3000 0wm000 $85.0 $80.0 vnm000 08838888 2: 8 2 @282 I! 0:800 m0m00 : x #0 H $80.0 00:00 22808:: :00 0 mood 0 8806:: Eon «23:8 m 8%. :33 : 8%: m:::_::> «£0:E<£<EDHOEDQMDQZEAQEOHD: $00m:0<£<EDW0©::£D£<E<H<0©HDN mm00w3<£<::wuU::£D£<E<fl©wubm 0m::§00:0=:<:<w:::8:30:8585 a::2:08::<:<w=:0::e085:0: U£UE<£<w:&0flBDm©wMD:mU: 08::JN 88:: 0%.an : 0:: m< ANMNN AmfiNN AENN EN: 68m ASNN 3808:: 88:38:80 u<ZEUJHHH UOZ UOZ UOZ Uoz Uoz uOZ ©< 2: A: A: OH :: :: DH 8 OMB OMB 0mg 0:8 0:8 Ommv rwdv 0 Z 0388: yea—:32 $02828: 8:58: 8.88:: :8 FEE—Ea 001mb:0UomDE<EO£O£<£O£<EGE< 83808:: SERFOJN $0NN ooflbflvo::w<:0©fl©m<w<£ofl<:w©:w< 001mDEDom3:04:30OEOHAG/wowUmAa/NEOEAQ $0NN 03:32::o:<::w:::oe:a<w8w:: 986:: AhoNN 38: C Eon HNN 8 53:04 UOZ UOZ UOZ 032:2:<8:<::::E80::33083: 88: Uoz Uoz uOZ am a: 85w: A: A: OH :: :: ,8 0:8 001E<3<£Dowflbfla‘fiofibfiaflflwflb DH 92.: 0mg 0mg 0mg 0:8 Ommv 82808:: mold/2:0 : E A: ”N mg 3:2 $2 Saab 83:0 9%: B: tum 3.0? m-m_< m Hm 8286:: Q< 822 89: Q< 0835304 001— 0:9: 140 W0 2013,:‘075035 PCT/U82012/065691 The results are provided in Table 2 and demonstrate that modified RNAi agents that target TTR provide enhanced silencing activity.
Results: Improved Activity of Modified RNAi Agents Parent RNAi agents with alternating chemical modifications and a GalNAc3 ligand ed an IC50 in Hep3B cells of about 0.01 nM. As shown in Figures 4—5 and in Table 2, agents modified relative to the parent agents, for example, by the addition of one or more repeating triplets of 2’—fluoro and 2’—O—methyl modifications, showed unexpectedly enhanced silencing activity, achieving IC50 values in Hep3B cells that 10 were 5—8 fold better than the corresponding parent agent.
Results: Free Uptake IC50s in Hep3B cells As shown in Table 2 and Figures 6—7, RNAi agents modified relative to the parent AD—45 163 also showed enhanced free uptake silencing. The modified agents 15 showed more than double the silencing activity of the parent after a 24 hour tion period and nearly 10 times the silencing activity of the parent after a 4 hour tion period.
As shown in Table 2 and Figures 8—9, RNAi agents modified relative to the parent AD—45 165 also showed ed free uptake silencing. The modified agents 20 showed 2—3 times the silencing activity of the parent after a 24 hour incubation period and 5—8 times the silencing activity of the parent after a 4 hour incubation period.
Taken collectively, these results demonstrate that the modified RNAi agents ted herein, e.g., AD—51544, AD—51545, AD—51546, and 47, all showed unexpectedly good inhibition of TTR mRNA in in vitro silencing experiments. 25 141 W0 2013,:‘075035 PCT/U82012/065691 e 6: TTR mRNA silencing and TTR Protein ssion in Transgenic Mice To assess the efficacy of the RNAi agents 63, AD—5 1544, AD-51545, AD45165, AD—51546, and AD—51547, these agents were administered to transgenic mice that express human transthyretin with the V30M mutation (see Santos, SD., Fernaandes, R., and a, MJ. (2010) Neurobiology ofAging, 31, 280—289). The V30M mutation is known to cause familial amyloid polyneuropathy type I in humans.
See, e.g., Lobato, L. (2003) JNephrol., 16(3):438—42. 10 The RNAi agents (in PBS buffer) or PBS l were administered to mice (2 male and 2 female) of 18—24 months of age in a single subcutaneous dose of 5 mg/kg or 1 mg/kg. After approximately 48 hours, mice were anesthetized with 200 pl of ketamine, and then exsanguinated by severing the right caudal artery. Whole blood was isolated and plasma was isolated and stored at —80°C until assaying. Liver tissue was 15 ted, flash—frozen and stored at —80°C until processing.
Efficacy of ent was evaluated by (i) measurement of TTR mRNA in liver at 48 hours post—dose, and (ii) measurement of TTR protein in plasma at pre—bleed and at 48 hours post—dose. TTR liver mRNA levels were assayed utilizing the Branched DNA assays— QuantiGene 2.0 (Panomics cat #: ). Briefly, mouse liver samples were 20 ground and tissue lysates were ed. Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volume of nuclease—free water and 10ul of Proteinase—K/ml for a final concentration of 20mg/ml) was incubated at 65 °C for 35 minutes. 20p] of Working Probe Set (TTR probe for gene target and GAPDH for endogenous control) and 80ul of tissue—lysate were then added into the Capture Plate. Capture Plates were incubated at 25 55 °C 11 °C (aprx. 16—20hrs). The next day, the Capture Plates were washed 3 times with 1X Wash Buffer (nuclease—free water, Buffer Component 1 and Wash Buffer Component 2), then dried by centrifuging for 1 minute at 240g. 100ul of pre—Amplifier Working Reagent was added into the Capture Plate, which was sealed with aluminum foil and incubated for 1 hour at 55°C iloC. Following 1 hour incubation, the wash step 30 was repeated, then 100ul of Amplifier Working Reagent was added. After 1 hour, the wash and dry steps were ed, and 100ul of Label Probe was added. Capture plates 142 W0 2013,:‘075035 PCT/U82012/065691 were incubated 50 °C i1 °C for 1 hour. The plate was then washed with 1X Wash Buffer, dried and lOOul ate was added into the Capture Plate. Capture Plates were read using the SpectraMax Luminometer following a 5 to 15 minute incubation. bDNA data were analyzed by subtracting the average background from each triplicate , ing the resultant triplicate GAPDH (control probe) and TTR (experimental probe) values, and then computing the ratio: (experimental probe—background)/(control probe— background).
Plasma TTR levels were assayed utilizing the commercially available kit “AssayMax Human Prealbumin ELISA Kit” (AssayPro, St. Charles, MO, Catalog # 10 EP3010—1) according to manufacturer’s guidelines. Briefly, mouse plasma was diluted 1:10,000 in 1X mix diluents and added to pre—coated plates along with kit standards, and incubated for 2 hours at room temperature followed by 5X washes with kit wash buffer.
Fifty microliters of biotinylated umin antibody was added to each well and incubated for 1 hr at room temperature, ed by 5X washes with wash buffer. Fifty 15 microliters of streptavidin—peroxidase ate was added to each well and plates were incubated for 30 minutes at room temperature followed by washing as previously described. The reaction was developed by the on of 50 ul/well of chromogen substrate and incubation for 10 minutes at room temperature with stopping of reaction by the addition of 50 ul/well of stop solution. Absorbance at 450 nm was read on a 20 Versamax microplate reader (Molecular Devices, Sunnyvale, CA) and data were analyzed utilizing the Softmax 4.6 software package ular Devices).
The results are shown in Figures 10-12. Figure 10 shows that the RNAi agents modified relative to the parent agents AD—45 163 and AD—45 165 showed RNA silencing activity that was similar or more potent compared with that of the parent . Figure 25 11 shows that the agents 44 and AD—51545 showed dose dependent silencing activity and that the silencing activity of these agents at a dose of 5mg/kg was similar to that of the corresponding parent 63. Figure 12 shows that the agents AD—51546 and AD—51547 also showed ependent silencing activity. Furthermore, the silencing activity of AD—51546 and AD—51547 at a dose of 5mg/kg was superior to that 30 of the corresponding parent AD—45165. 143 W0 2013,:‘075035 PCT/U82012/065691 Example 7: Serum and Liver Pharmacokinetic Profiles of RNAi Agents that Target TTR in Mice To assess the pharmacokinetic profiles of the RNAi agents AD—45163, AD— 51544, AD—51545, AD—51546, and AD—51547, these agents, in PBS , were administered to C57BL/6 mice using a single IV bolus or subcutaneous (SC) administration. The plasma trations and liver concentrations of the agents were assessed at various timepoints after the administration. 10 The plasma pharmacokinetic parameters are presented in Tables 3 and 4 below.
The mean resident time (MRT) in plasma was about 0.2 hours after IV dosing and about 1 hour after SC dosing. At a dose of 25 mg/kg, the agents AD-51544, AD-51545, AD- 51546, and AD—51547 showed similar plasma pharmacokinetic properties. Each of these agents had more than 75% bioavailability from the subcutaneous space. Their 15 bioavailability was superior to that of the parent agent AD—45 163 that was administered at a higher dose of 30 mg/kg. The subcutaneous ilability of AD—51544 and AD— 51547 was about 100%, whereas that of 45 was 90% and that of and AD—51546 was 76%. 144 WO 2013/075035 PCT/U82012/065691 Table 3: Summary of Plasma PK ter Estimates After SC Administration of TTR-GalNAc siRNAs in Mice Parameter Plasma AUC (Mug/mm 145 WO 2013/075035 PCT/US2012/065691 08 mm mfimoc Mm >~ MARE .5 US$083- Saw mm 2.15 mofiogm 3: E 08 @506 >H EEEE EEEEEEEE EEEEEEEE :8 v £38 >H SW Ewe 2m a USN 5w mm (Baa Um ma AQZV .83on Eda 8:2 a mfimow BEEEEU :2» E E: >H Hon E.OUD< whoaofifiwm 3 Eda defame we 3 $3 32m Ana: Ho: QUE go: 03500 $5on 895 2 093:8qu .mvmm was v5 Q5 Amm> mm 473% MEEEE USN €$Ed< owning cauéogbqooqoo AU E 603328 9:me 05 E 05 “5:338qu we .8.OUD< mo nougubzo “m8 “v 35a ommnm «Bah €8me< ZNOE Um 0m a u. REES Susana; no 146 W0 20132'075035 PCT/U82012/065691 The results also indicated that the RNAi agents AD-45163, AD-51544, AD- 51545, AD—51546, and AD—51547 achieved similar or higher trations in the liver when stered subcutaneously than when administered by IV bolus. The liver pharmacokinetic parameters are presented in Tables 5 and 6 below. The peak concentration (Cmax) and area under the curve (AUC0_1ast) in the liver were two to three times higher after aneous administration as compared with IV administration of the same agent at the same dose. Liver exposures were highest for AD—51547 and lowest for AD—51545. The mean resident time (MRT) and elimination half—life were 10 longer for AD—51546 and AD—51547 compared with AD—51544 and AD—51545.
Following subcutaneous administration, the approximate MRTs were 40 hours for AD— 51546 and 25 hours for AD-51547, whereas the MRTs for AD-51544 and AD-51545 were lower (about 6-9 hours). The elimination half life of AD-51546 and 47 was also higher (41—53 hours) than was the elimination half life of AD—5 1544 and AD— 15 51545 (6—10 hours). 147 WO 2013/075035 PCT/U82012/065691 8:2 5 @4736 ibb ac :235EEEc4 is mm A2 Sm: 85 -m: 37:8 mm? Um no£< is 32m £5 i: A2230. 8383mm— mm A2 5m .Suofifiwm is mu AZ 32m 85 -59 A2230 Mm is mm A? 32m .35 39:8 88 33A £5 mo Enfifism is cm .94 35 £5 -m: 0230 a? um meH $80 mg ozmh 33523 53: $34 Awmzv :5 Awaits 148 WO 2013/075035 PCT/U82012/065691 wv—RE ma 3 bVMHm .5 cvmfim VM m“. lnN *v Nlfi l0 IHI32 nmvmfim Emma (\1 {VMHMAJN m-Q< OO 1\ ova U l\ mo omoQ l0 I”: (\1 [\OH "iv Um m-Q< ><r go00 an—l film .5 miom mob a 0.2 >H 113 aH% «5 ll@222 2 fi' 0 l\ Bin m 3:2 v as E 3222 mN muowofimumm EE E Mm 492% 33A 6 g 3&3 Bank Eu 149 W0 2013,:‘075035 2012/065691 Example 8: In vitro Stability of RNAi Agents in Monkey Serum The serum stability of RNAi agents AD—51544, AD—51545, AD—51546, and AD— 51547 was also ed in monkeys. The results demonstrated that the nse and sense s of AD—51544, AD—51545, and AD—51547 showed serum stability over a period of about 24 hours (data not shown).
Example 9: RNAi Agents Produce Lasting Suppression of TTR n in Non- Human Primates 10 The RNA silencing activity of RNAi agents AD—45163, AD—51544, AD—51545, AD—51546, and AD—51547 was assessed by measuring suppression of TTR protein in serum of cynomologous monkeys following subcutaneous administration of five 5 mg/kg doses (one dose each day for 5 days) or a single 25mg/kg dose. Pre—dose TTR protein levels in serum were assessed by averaging the levels at 11 days prior to the first 15 dose, 7 days prior to the first dose, and 1 day prior to the first dose. Post—dose serum levels of TTR protein were assessed by determining the level in serum ing at 1 day after the final dose (i.e., study day 5 in the 5x5 mg/kg group and study day 1 in the 1x25 mg/kg group) until 49 days after the last dose (i. 6., study day 53 in the 5x5 mg/kg group and study day 49 in the 1x25 mg/kg group). See Figure 13. 20 TTR protein levels were assessed as described in Example 6. The results are shown in Figure 14 and in Tables 7 and 8.
A maximal suppression of TTR protein of up to about 50% was achieved in the groups that ed 25 mg/kg of 63, AD—51544, AD—51546, and AD—51547 (see Table 8). A greater maximal suppression of TTR protein of about 70% was 25 achieved in the groups that received 5x5 mg/kg of AD—45163, AD—5l544, AD—5l546, and AD—51547 (see Table 7). The agent AD—51545 produced a lesser degree of suppression in both administration protocols. Significant suppression of about 20% or more persisted for up to 49 days after the last dose of AD—51546 and AD-51547 in both the 1x25 mg/kg and 5x5 mg/kg protocols. Generally, better suppression was achieved 30 in the 5x5 mg/kg ol than in the 1x25 mg/kg protocol. 150 W0 2013f075035 PCT/U82012/065691 336 m .5.“ Emma. wv—RE m V mag—.52 mayofiosho E 086-95 8 fifiafififififiafi 9523— mzfih 850m scream b 2an HHHEEI EEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEQ EEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEQ EEEEEEEEEEEEEEEIA..EMNVm“av—:02mi.Logo:0a:owOU-OhmOw“Swim—OHM:59—Saws—NEHSic—om:O—wuflhrflwo—a—NHL EEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEQ EEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEE 151 W0 2013,:‘075035 PCT/U82012/065691 Example 10: Tolerability of RNAi Agents that Target TTR In ne Evaluation in Whole Blood Assay To assess the tolerability of RNAi agents that target TTR (including AD-45163, AD—51544, AD-51545, 46, and AD—51547), each agent was tested in a whole blood assay using blood from three human donors. The agents were either 300 nM DOTAP transfected or 1 uM without transfection t (free siRNA). There was less than a two fold change for the following cytokines/chemokines: G—CSF, IFN—y, IL—10, IL—12 (p70), ILlB, IL—lra, IL—6, IL—8, lP—lO, MCP—l, MIP—la, MIP—lB, TNFOL. (Results not shown). 10 In Vivo Evaluation To assess in vivo tolerability, RNAi agents were injected subcutaneously in CD1 mice at a dose of 125 mg/kg. No cytokine induction was observed at 2, 4, 6, 24, or 48 hours after subcutaneous injection of AD—45163. No significant cytokine induction was 15 ed at 6 or 24 hours after subcucutaneous injection of AD—51544, AD—51545, AD— 51546, or AD—51547.
To further assess in viva tolerability, multiple RNAi agents (including AD— 45163, AD-51544, AD—51545, AD—51546, and AD—51547) were tested by subcutaneous injection of 5 and 25 mg in non—human es (cynomologous monkeys) with dose 20 volumes n 1—2 ml per site. No erythema or edema was observed at injection sites.
Single SC Dose Rat Tolerability Study To assess toxicity, rats were injected with a single subcutaneous dose of 100, 250, 500, or 750 mg/kg of AD—45163 (see Table 9). The following assessments were 25 made: clinical signs of toxicity, body , hematology, clinical chemistry and coagulation, organ weights (liver & spleen); gross and microscopic evaluation (kidney, liver, lung, lymph node, spleen, testes, , aorta, heart, intestine (small and large). 152 W0 20132'075035 PCT/U82012/065691 Table 9: Single SC Dose Rat Tolerability Study: 100, 250, 500 & 750 mg/kg of AD- 45163 in Sprague Dawley Rats -II SC Injection 7/group 1 0 Day 1 (5 Tox ggégtssss sssss - amma S1) 750 The s showed no test article—related clinical signs of toxicity, effects on 5 body weight, organ weights, or clinical chemistry. No histopathology was observed in heart, kidneys, testes, spleen, liver, and thymus. There was a non—adverse, slight test article—related increase in WBC (T68%, primarily attributed to se in NEUT and MONO) at 750 mg/kg. These results indicate that a single—dose of up to 750 mg/kg is well tolerated in rats. 10 Tolerability of Repeated Subcutaneous Administrations in Rats To assess the tolerability of repeated subcutaneous strations of AD—45163, daily subcutaneous ions of 300 mg/kg were given for 5 days, and a necropsy was performed on day 6. The study design is shown in Table 10. 15 153 W0 2013,:‘075035 PCT/U82012/065691 Table 10: Five Day Repeat Dose Tolerability Study in Rat The following e variables were assessed: clinical signs, body weights, hematology, clinical chemistry and coagulation, organ weights, gross and microscopic evaluation (liver, spleen, kidney, heart, GI tract and first and last ion site). The results showed no test article-related clinical signs, body weight or organ weight effects, and also no test article-related findings in clinical hematology or chemistry. There was a possible slight prolongation of activated partial thromboplastin time (APTT) on day 6 10 (20.4 vs. 17.4 sec). Histopathology revealed no test article—related findings in the liver, spleen, heart, and GI tract. In the , minimal to slight hypertrophy of the r epithelium (not adverse) was observed. At the last injection site, there was minimal multifocal mononuclear infiltration, not adverse. These results indicate that five daily 300 mg/kg doses of the parent RNAi agent AD—45 163 are well tolerated in rats. 15 e 11: RNAi Agents Produce Lasting Suppression of TTR Protein in Non- Human Primates The RNA silencing activity of RNAi agent AD-51547 was assessed by measuring suppression of TTR protein in the serum of cynomologous monkeys 20 ing subcutaneous administration of a “loading phase” of the RNAi agent: five daily doses of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg (one dose each day for 5 days) followed by a “maintenance phase” of the RNAi agent: weekly dosing of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg for 4 weeks. Pre—dose TTR n levels in serum were assessed by averaging the levels at 11 days prior to the first dose, 7 days prior to the first 25 dose, and 1 day prior to the first dose. Post—dose serum levels of TTR protein were assessed by determining the level in serum ve to pre—dose beginning at 1 day after 154 W0 2013,:‘075035 PCT/U82012/065691 the loading phase was completed until 40 days after the last dose of the maintenance phase (i.e., study day 70).
TTR protein levels were assessed as described in Example 6. The results are shown in Figure 15.
A maximal suppression of TTR protein of up to about 80% was ed in all of the groups that received either 2.5 mg/kg, 5 mg/kg or 10 mg/kg of AD—51547. Nadir knockdown was achieved in all of the groups by about day 14, the suppression sustained at nadir knockdown levels with a weekly nance dose of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg of AD—51547. The levels of TTR had not returned to baseline more than 40 10 days after the day of administration of the last maintenance dose for the 5 and 2.5 mg/kg dose levels. 155 W0 2013I075035 PCT/U82012/065691 lents: Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the 5 following claims.

Claims (2)

  1. We claim: 1. A double stranded RNAi agent comprising a sense strand complementary to an antisense strand, wherein said antisense strand ses a sequence that is complementary to nucleotides 504 to 526 of the transthyretin (TTR) gene (SEQ ID 5 NO:1), wherein the sense strand is 21 tides in length and the antisense strand is 23 tides in length, n said double stranded RNAi agent is represented by formula (III): sense: 5' np -Na -(X X X)i-Nb -Y Y Y -Nb -(Z Z Z)j -Na - nq 3' antisense: 3' npV'6aV'$<V<V<V%k-NbV'=V=V=V'6bV'$>V>V>V%l-NaV'"KqV"-#" 10 (III) wherein: j = 1; and i, k, and l are 0; p’ is 2; p, q, and q’ are 0; each Na and NaV"GKBCMCKBCKQIU"OCMOCPCKQP"?K"LIGELKRAICLQGBC"PCNRCKAC" 15 sing 2-10 nucleotides which are modified nucleotides; each Nb and NbV"GKBCMCKBCKQIU"OCMOCPCKQP"?K"LIGELKRAICLQGBC"PCNRCKAC" comprising 0-7 nucleotides which are modified nucleotides; npV"OCMOCPCKQP"?K"LSCOF?KE"KRAICLQGBC0" " ===&">>>&"?KB"=V=V=V&"C?AF"GKBCMCKBCKQIU"OCMOCPCKQ"LKC"JLQGD"LD"QFOCC" 20 identical modifications on three consecutive nucleotides, wherein the Y nucleotides contain a 2’-fluoro modification, the Y’ nucleotides contain a 2’-O-methyl modification, and the Z nucleotides contain a 2’-O-methyl modification; and wherein the sense strand is ated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched 25 linker.
  2. 2. The RNAi agent of claim 1, wherein the YYY motif occurs at or near the AIC?S?EC"PGQC"LD"QFC"PCKPC"PQO?KB0"LO"TFCOCGK"QFC"=V=V=V"JLQGD"LAAROP"?Q"QFC"))&")*"?KB" 13 ons of the antisense strand from the 5'-end. 30 3. The RNAi agent of claim 1 or claim 2, n the modifications on the Na, Na’, Nb, and Nb’ nucleotides are each independently selected from the group consisting of LNA, HNA, CeNA, 2"-methoxyethyl, 2"-O-alkyl, 2"-O-allyl, 2"-C- allyl, 2"-fluoro, 2"- deoxy, 2’-hydroxyl, and combinations thereof. 35 157 4. The RNAi agent of claim 3, wherein the modifications on the Na, Na’, Nb, and Nb’ nucleotides are 2"-O-methyl, 2"-fluoro or both. 5. The RNAi agent of claim 1, wherein the ligand is HO OH O H H HO O N N O AcHN O HO OH O O H H HO O N N O AcHN O O O HO OH O HO O N N O AcHN H H 5 O . 6. The RNAi agent of claim of any one of claims 1 to 5, wherein the ligand is attached to the 3’ end of the sense strand. 10 7. The RNAi agent of claim 6, wherein the RNAi agent is conjugated to the ligand as shown in the following tic , wherein X is O or S. 15 8. The RNAi agent of claim 7, wherein the RNAi agent is conjugated to the ligand as shown in the following schematic 158 9. The RNAi agent of any one of claims 1 to 8 further comprising at least one phosphorothioate or methylphosphonate internucleotide linkage. 5 10. The RNAi agent of claim 9, wherein the orothioate or methylphosphonate internucleotide linkage is at the 3’-terminal of one strand. 11. The RNAi agent of claim 10, wherein said strand is the antisense strand or the 10 sense strand. 12. The RNAi agent of any one of claims 1 to 11, wherein the base pair at the 1 on of the 5’-end of the antisense strand of the duplex is an AU base pair. 15 13. The RNAi agent of any one of claims 1 to 11, wherein the p’ overhang nucleotides are mentary to the target mRNA or wherein the p’ overhang nucleotides are non-complementary to the target mRNA. ),(" 9FC"861G"?ECKQ"LD"?KU"LKC"LD"AI?GJP")"QL"))&"TFCOCGK"?Q"IC?PQ"LKC"KMV"GP"IGKHCB" 20 to a neighboring nucleotide via a phosphorothioate linkage. )-(" 9FC"861G"?ECKQ"LD"AI?GJ"),&"TFCOCGK"?II"KMV"?OC"IGKHCB"QL"KCGEF@LOGKE" tides via phosphorothioate linkages. 25 16. An isolated cell containing an RNAi agent of any one of claims 1-15. 17. A pharmaceutical composition comprising an RNAi agent of any one of claims 1-15. 159 18. The pharmaceutical composition of claim 17, wherein the RNAi agent is administered in an unbuffered solution. 19. The pharmaceutical composition of claim 18, wherein said unbuffered solution is 5 saline or water. 20. The pharmaceutical composition of claim 17, wherein said RNAi agent is administered with a buffer solution. 10 21. The pharmaceutical composition of claim 20, wherein said buffer solution comprises acetate, citrate, prolamine, carbonate, phosphate or any combination thereof. 22. The ceutical composition of claim 21, n said buffer on is phosphate ed saline (PBS). 15 23. A method of inhibiting expression of a transthyretin (TTR) in an isolated cell comprising contacting said isolated cell with an RNAi agent of any one of claims 1-15 in an amount effective to inhibit expression of said TTR in said isolated cell, thereby inhibiting expression of said transthyretin (TTR) in said isolated cell. 20 24. Use of an RNAi agent of any one of claims 1-15, for the cture of a medicament for treating a TTR-associated disease in a subject. 25. A kit for performing the method of claim 23, sing 25 a) said RNAi agent, and b) instructions for use. 26. A kit for the use of claim 24, said kit comprising a) said RNAi agent, and 30 b) instructions for said use. 27. The double stranded RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence 5’ – UGGGAUUUCAUGUAACCAAGA – 3’ (SEQ ID NO:2211). 35 160 28. The double stranded RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence 5’- UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAfL96-3’ (SEQ ID NO:2) and the antisense strand comprises the nucleotide sequence 5’- uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3’ (SEQ ID NO:3), -" " TFCOCGK"?&"E&"A"?KB"R"?OC"*V'7'JCQFUI"$*V'75C%"1&"3&"2&"?KB";0""1D&"3D&"2D&"?KB" ;D"?OC"*V'DIRLOL"1&"3&"2"?KB";0"P"GP"?"MFLPMFLOLQFGL?QC"IGKH?EC0"?KB"4/."GP"?"3?I61A+" ligand. 29. The use of claim 24, wherein said ment is suitable for administration to a 10 human. 30. The method of claim 24, wherein said subject carries a TTR gene mutation that is associated with the pment of a TTR-associated disease. 15 31. The use of claim 24, wherein said TTR-associated disease is selected from the group consisting of senile ic amyloidosis (SSA), ic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia. 20 32. The use of claim 24, wherein said TTR-associated-disease is TTR-associated amyloidosis. 33. The use of claim 24, wherein said medicament is le for subcutaneous 25 administration. 34. A double stranded RNAi agent, comprising a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide ce 5’- UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAfL96-3’ (SEQ ID NO:2) and the nse strand 30 comprises the nucleotide sequence 5’-uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3’ (SEQ ID NO:3), " TFCOCGK"?&"E&"A&"?KB"R"?OC"*V'7'JCQFUI"$*V'75C%"1&"3&"2&"?KB";0""1D&"3D&"2D&"?KB" ;D"?OC"*V'DIRLOL"1&"3&"2&"?KB";0"P"GP"?"MFLPMFLOLQFGL?QC"IGKH?EC0"?KB"4/."GP"?"3?I61A+" ligand.
NZ624336A 2011-11-18 2012-11-16 Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases NZ624336B2 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US201161561710P 2011-11-18 2011-11-18
US61/561,710 2011-11-18
US201261615618P 2012-03-26 2012-03-26
US61/615,618 2012-03-26
US201261680098P 2012-08-06 2012-08-06
US61/680,098 2012-08-06
PCT/US2012/065691 WO2013075035A1 (en) 2011-11-18 2012-11-16 Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases

Publications (2)

Publication Number Publication Date
NZ624336A NZ624336A (en) 2016-06-24
NZ624336B2 true NZ624336B2 (en) 2016-09-27

Family

ID=

Similar Documents

Publication Publication Date Title
AU2017225076B2 (en) Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
CN108064154B (en) Compositions and methods for inhibiting expression of the HAO1 (glycolate oxidase 1) gene
DK2999785T3 (en) SERPINA1-IRNA COMPOSITIONS AND PROCEDURES FOR USE THEREOF
WO2015042564A1 (en) Methods for treating or preventing transthyretin (ttr) associated diseases
JP2015177801A (en) COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 AND VEGF GENES
TWI669393B (en) Compositions and methods for inhibiting expression of the lect2 gene
US20230357774A1 (en) Compositions and methods for the treatment of angiopoietin like 7 (angptl7) related diseases
JP2020531450A (en) Adjustable REVERSIR ™ compound
KR20200014320A (en) Nucleic Acids Inhibit Expression of APCS
DK2997614T3 (en) ELECTROCHEMICAL STORAGE MATERIAL AND ELECTROCHEMICAL STORAGE DEVICE FOR STORAGE OF ELECTRICAL ENERGY, INCLUDING SUCH STOCK MATERIAL
KR20220047865A (en) Nucleic Acids for Inhibiting Expression of C3 in Cells
NZ624336B2 (en) Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
RU2804776C2 (en) AGENTS FOR RNAi, COMPOSITIONS AND METHODS OF THEIR USE FOR THE TREATMENT OF DISEASES ASSOCIATED WITH TRANSTHYRETIN (TTR)
AU2017204161B2 (en) SiRNA therapy for transthyretin (TTR) related ocular amyloidosis
US20230041178A1 (en) Methods for the treatment of trinucleotide repeat exapnsion disorders associated with ogg1 activity
OA16815A (en) RNAI agents, compositions and methods of use thereof for treating transthyretin (TTR) associated diseases.
NZ714530B2 (en) SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
NZ624471A (en) Modified rnai agents
NZ624471B2 (en) Modified rnai agents