WO2015002969A1 - Anticancer combinations - Google Patents
Anticancer combinations Download PDFInfo
- Publication number
- WO2015002969A1 WO2015002969A1 PCT/US2014/045086 US2014045086W WO2015002969A1 WO 2015002969 A1 WO2015002969 A1 WO 2015002969A1 US 2014045086 W US2014045086 W US 2014045086W WO 2015002969 A1 WO2015002969 A1 WO 2015002969A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- bacterial cell
- tumor
- composition
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
- A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01035—Hyaluronoglucosaminidase (3.2.1.35), i.e. hyaluronidase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- PDAC pancreatic ductal adenocarcinoma
- IDO indoleamine 2,3-dioxygenase
- compositions and kits comprising a bacterial cell and a tumor penetrating agent.
- methods of treating cancer in a subject including the step of administering to the subject an effective amount of a bacterial cell and a tumor penetrating agent.
- methods of stimulating an immune system in a subject include administering to the subject an effective amount of a bacterial cell and a tumor penetrating agent.
- methods of enhancing delivery of an anti-cancer agent to a tumor cell including the step of contacting the tumor cell with a bacterial cell, a tumor penetrating agent and an anti-cancer agent.
- Figure 1 shows a series of images demonstrating the effects of shIDO-ST
- FIGS. 2A and 2B show a series of images demonstrating the effects of the combined treatment with shIDO-ST and PEGPH20TM under different dosing regimes. Mice were imaged using an intravital imaging system (IVIS) at the indicated time points after tumor implantation.
- IVIS intravital imaging system
- Figure 3 is a graph showing quantitation of the IVIS for Figures 2A and 2B. Photons emitted from mice imaged in Figure 2 were quantitated. Tumors from mice treated with shlDO- ST and PEGPH20TM at a specific dose of each are controlled significantly better than all other groups.
- Figure 4 shows a series of images demonstrating the effects of shIDO-ST and
- Figure 5 is a graph showing quantitation of the IVIS for Figure 4. Photons emitted from mice imaged in Figure 4 were quantitated. Tumors from mice treated with shIDO-ST and PEGPH20TM are controlled significantly better than all other groups, and were alive at the conclusion of the experiment.
- Figure 6 is a graph showing treatment does not significantly change the weight of the mice. Mice in Figure 4 were weighed at each imaging point. No reductions were observed in mouse weight for any group.
- Figure 7 shows a series of images demonstrating the effects of PEGPH20TM in combination with shArg-ST or a control shScr-ST in orthotopic KPC-luc model mice. Mice were imaged using an intravital imaging system (IVIS) at the indicated time points after tumor implantation. Tumor reduction was observed with the combined treatment of shArg-ST and PEGPH20TM and the combined treatment of shScr-ST and PEGPH20TM.
- IVIS intravital imaging system
- Figure 8 shows a series of images demonstrating the effects of the combined treatment with shArg-ST and PEGPH20TM under a different dosing regime. Mice were imaged using an intravital imaging system (IVIS) at the indicated time points after tumor implantation. The combination of shIDO-ST and PEGPH20 resulted in control of tumor growth.
- IVIS intravital imaging system
- Figure 9 shows a series of images demonostrating the effects of the combined treatment of shIDO-AT and PEGPH20TM Mice were imaged using an intravital imaging system (IVIS) at the indicated time points after tumor implantation.
- IVIS intravital imaging system
- PEGPH20TM resulted in tumor regression and prolonged survival of the mice.
- Figure 10 is a graph of the quantitation of tumor burden at different time points post tumor implantation. Specifically, the photons emitted from IVIS imaging of the mouse groups represented in Figure 9 were quantitated. The combination of shIDO-ST and PEGPH20TM resulted in statistically significant control of tumors while all other groups exhibited no durable control.
- Figure 11 is a graph showing the weight of the mouse groups represented in Figure 9 at each time point indicated in the graph. Figure 11 shows that elimination of PDAC tumors using shIDO-ST and PEGPH20TM combination therapy did not result in weight loss.
- Figure 12 shows images of hyaluronan (HA) staining of tumor bearing mice treated wwiitthh PPEEGGPPHH2200TM . FFoorrttyy--ieight hours after treatment with PEGPH20 , a significant depletion of hyaluronan was observed.
- HA hyaluronan
- Figure 13 shows images of open vessels in tumors in mice treated with PEGPH20 . Sections from 14 day tumors of mice untreated or treated with PEGPH20TM were stained with anti-CD31 antibody to locate cross sections of vessels within the tumor mass. Many more open vessels were observed in tumors of mice treated with PEGPH20TM.
- Figure 14 shows images of the influx of Salmonella typhimurium (ST) and neutrophils (PMN) into tumors treated with shIDO-ST and PEGPH20TM combination therapy.
- Figure 15 shows images of surgically removed tumors analyzed for PMN 96 hours after treatment with PEGPH20TM/shScr-ST or PEGPH20TM/shIDO-ST.
- Figure 16 shows images showing necrosis of tumor cells in the core of shlDO- ST/PEGPH20TM combination therapy treated tumors.
- Figure 17 shows an image of spleen and pancreas taken from normal BL/6 mice or KPC-Brcal mice treated with shIDO-ST/PEGPH20TM combination therapy at 12 weeks.
- Figure 18 shows a schematic of treatments of KPC-Brcal mice to determine if shlDO- ST/PEGPH20TM combination therapy has efficacy in controlling spontaneous pancreatic tumors.
- Figure 19 shows images of the pancreas from mice treated with PEGPH20TM/shScr-ST or PEGPH20TM/shIDO-ST or control littermates.
- compositions and kits comprising a bacterial cell and a tumor penetrating agent. Also provided are methods of treating cancer in a subject including the step of administering to the subject an effective amount of a bacterial cell and a tumor penetrating agent, wherein administration treats the cancer in the subject.
- kits for stimulating an immune system in a subject include administering to the subject an effective amount of a bacterial cell and a tumor penetrating agent, wherein administration stimulates the immune system in the subject.
- methods of enhancing delivery of an anti-cancer agent to a tumor cell including the step of contacting the tumor cell with a bacterial cell, a tumor penetrating agent and an anticancer agent, wherein contacting the tumor cell with the bacterial cell and tumor penetrating agent enhances delivery of the anti-cancer agent to the tumor cell.
- tumor penetrating agent refers to an agent that is capable of penetrating a tumor and/or a tumor cell.
- a tumor penetrating agent can penetrate a tumor cell itself or penetrates the area surrounding tumor cells, e.g., the extracellular matrix.
- a tumor penetrating agent penetrates a tumor by breaking down or degrading the extracellular matrix surrounding tumor cells.
- a tumor penetrating agent penetrates a tumor by entering the tumor cell itself.
- tumor penetrating agents for use in the provided compositions and methods include, but are not limited to, hyaluronidase polypeptides, pirfenidone, Saridegib (IPI-926), nanoparticles, albumin nanoparticles, dextrans, liposomes, and cell penetrating peptides.
- Such tumor penetrating agents including methods of making and using the agents are known and are described in, for example, U.S. Patent Nos. 7,767,429; 7,829,081; 7,846,431; 7,871,607; 8,105,586; 8,202,517; 8,257,699; 8,431,380; and 8,450,470; Kozono et al, Cancer Res.
- hyaluronidase polypeptide comprises SEQ ID NO: l or SEQ ID NO:2 or a fragment thereof.
- the hyaluronidase polypeptide is a modified hyaluronidase polypeptide.
- the hyaluronidase polypeptide is pegylated.
- the hyaluronidase polypeptide is PEGPH20TM (Halozyme, Inc., San Diego, CA).
- Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, and complements thereof.
- the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl
- PNAs peptide-nucleic acids
- nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
- a particular nucleic acid sequence also implicitly encompasses "splice variants.”
- a particular protein encoded by a nucleic acid implicitly encompasses any protein encoded by a splice variant of that nucleic acid.
- “Splice variants,” as the name suggests, are products of alternative splicing of a gene. After transcription, an initial nucleic acid transcript may be spliced such that different (alternate) nucleic acid splice products encode different polypeptides.
- Mechanisms for the production of splice variants vary, but include alternate splicing of exons. Alternate polypeptides derived from the same nucleic acid by read-through transcription are also encompassed by this definition. Any products of a splicing reaction, including recombinant forms of the splice products, are included in this definition.
- An example of potassium channel splice variants is discussed in Leicher, et al, J. Biol. Chem.
- Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
- DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
- a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- "operably linked” means that the DNA sequences being linked are near each other, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
- nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%o, 99%), or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like).
- sequences are then said to be “substantially identical.”
- This definition also refers to, or may be applied to, the compliment of a test sequence.
- the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions.
- the preferred algorithms can account for gaps and the like.
- identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence algorithm program parameters Preferably, default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window,” as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well- known in the art.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
- a preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al, J. Mol. Biol.
- BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins.
- HSPs high scoring sequence pairs
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0).
- M forward score for a pair of matching residues; always > 0
- N penalty score for mismatching residues; always ⁇ 0.
- a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- W wordlength
- E expectation
- an "inhibitory nucleic acid” is a nucleic acid (e.g. DNA, RNA, polymer of nucleotide analogs) that is capable of binding to a target nucleic acid (e.g. an mRNA translatable into
- PTPRS and reducing transcription of the target nucleic acid (e.g. mRNA from DNA) or reducing the translation of the target nucleic acid (e.g.mRNA) or altering transcript splicing (e.g. single stranded morpholino oligo) relative to the absense of the inhibitory nucleic acid.
- target nucleic acid e.g. mRNA from DNA
- target nucleic acid e.g.mRNA
- altering transcript splicing e.g. single stranded morpholino oligo
- morpholino oligo may be alternatively referred to as a "morphlino nucleic acid” and refers to morpholine-containing nucleic acid nucleic acids commonly known in the art (e.g.
- the "inhibitory nucleic acid” is a nucleic acid that is capable of binding (e.g. hybridizing) to a target nucleic acid (e.g. an mRNA translatable into an RPTPS) and reducing translation of the target nucleic acid.
- the target nucleic acid is or includes one or more target nucleic acid sequences to which the inhibitory nucleic acid binds (e.g. hybridizes).
- an inhibitory nucleic acid typically is or includes a sequence (also referred to herein as an "antisense nucleic acid sequence") that is capable of hybridizing to at least a portion of a target nucleic acid at a target nucleic acid sequence.
- an inhibitory nucleic acid is an antisense nucleic acid.
- Another example of an inhibitory nucleic acid is siRNA or RNAi (including their derivatives or pre-cursors, such as nucleotide analogs). Further examples include shRNA, miRNA, shmiRNA, or certain of their derivatives or pre-cursors.
- the inhibitory nucleic acid is single stranded. In other embodiments, the inhibitory nucleic acid is double stranded.
- an "antisense nucleic acid” is a nucleic acid (e.g. DNA, RNA or analogs thereof) that is at least partially complementary to at least a portion of a specific target nucleic acid (e.g. a target nucleic acid sequence), such as an mRNA molecule (e.g. a target mRNA molecule) (see, e.g., Weintraub, Scientific American, 262:40 (1990)), for example antisense , siRNA, shRNA, shmiRNA, miRNA (microRNA).
- a target nucleic acid e.g. target mRNA
- the antisense nucleic acid hybridizes to the target nucleic acid sequence (e.g. mRNA) under stringent hybridization conditions. In some embodiments, the antisense nucleic acid hybridizes to the target nucleic acid (e.g. mRNA) under moderately stringent hybridization conditions.
- Antisense nucleic acids may comprise naturally occurring nucleotides or modified nucleotides such as, e.g., phosphorothioate, methylphosphonate, and -anomeric sugar-phosphate, backbonemodified nucleotides.
- an "anti-PTPRS antisense nucleic acid” is an antisense nucleic acid that is at least partially complementary to at least a portion of a target nucleic acid sequence, such as an mRNA molecule, that codes at least a portion of the PTPRS.
- an antisense nucleic acid is a morpholino oligo.
- a morpholino oligo is a single stranded antisense nucleic acid, as is known in the art.
- a morpholino oligo decreases protein expression of a target, reduces translation of the target mRNA, reduces translation initiation of the target mRNA, or modifies transcript splicing.
- the morpholino oligo is conjugated to a cell permeable moiety (e.g. peptide).
- Antisense nucleic acids may be single or double stranded nucleic acids.
- the antisense nucleic acids may hybridize to the target mRNA, forming a double-stranded molecule.
- the antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double-stranded.
- the use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem., 172:289, (1988)). Antisense molecules which bind directly to the DNA may be used.
- Inhibitory nucleic acids can be delivered to the subject using any appropriate means known in the art, including by injection, inhalation, or oral ingestion.
- Another suitable delivery system is a colloidal dispersion system such as, for example, macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
- An example of a colloidal system of this invention is a liposome. Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo.
- Nucleic acids including RNA and DNA within liposomes and be delivered to cells in a biologically active form (Fraley, et al, Trends Biochem. Sci., 6:77, 1981). Liposomes can be targeted to specific cell types or tissues using any means known in the art.
- Inhibitory nucleic acids e.g. antisense nucleic acids, morpholino oligos
- cell permeable delivery systems e.g. cell permeable peptides.
- inhibitory nucleic acids are delivered to specific cells or tissues using viral vectors or viruses.
- siRNA refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when the siRNA is present (e.g. expressed) in the same cell as the gene or target gene.
- the siRNA is typically about 5 to about 100 nucleotides in length, more typically about 10 to about 50 nucleotides in length, more typically about 15 to about 30 nucleotides in length, most typically about 20-30 base nucleotides, or about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- siRNA molecules and methods of generating them are described in, e.g., Bass, 2001, Nature, 411 , 428-429; Elbashir et al, 2001, Nature, 411, 494-498; WO 00/44895; WO 01/36646; WO 99/32619; WO 00/01846; WO 01/29058; WO 99/07409; and WO 00/44914.
- a DNA molecule that transcribes dsRNA or siRNA also provides RNAi.
- DNA molecules for transcribing dsRNA are disclosed in U.S. Patent No. 6,573,099, and in U.S. Patent Application Publication Nos.
- ShRNA small or short hairpin RNA molecules
- shR typically include two complementary R A sequences linked by a short loop of nucleotides similar to the hairpin found in naturally occurring miR A.
- shRNA molecules are about 20-30 base nucleotides, or about 19- 22, or about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, with the short loop of nucleotides forming the hairpin being about 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides in length.
- siRNA can be administered directly or siRNA expression vectors can be used to induce RNAi that have different design criteria.
- a vector can have inserted two inverted repeats separated by a short spacer sequence and ending with a string of T's which serve to terminate transcription.
- polypeptide As used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
- Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
- Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
- Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
- Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles.
- the following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
- stringent hybridization conditions refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in
- stringent conditions are selected to be about 5-lOoC lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH.
- Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a positive signal is at least two times background, preferably 10 times background hybridization.
- Exemplary stringent hybridization conditions can be as following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42oC, or, 5x SSC, 1% SDS, incubating at 65oC, with wash in 0.2x SSC, and 0.1% SDS at 65oC.
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.
- Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37oC, and a wash in IX SSC at 45oC. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency.
- telomere length a temperature of about 36°C is typical for low stringency amplification, although annealing temperatures may vary between about 32°C and 48°C depending on primer length.
- a temperature of about 62°C is typical, although high stringency annealing temperatures can range from about 50°C to about 65°C, depending on the primer length and specificity.
- Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90°C to 95°C for 30 seconds to 2 minutes, an annealing phase lasting 30 seconds to 2 minutes, and an extension phase of about 72°C for 1 to 2 minutes. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.).
- a "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample.
- a test sample can be taken from a test condition, e.g., in the presence of a test agent, and compared to samples from known conditions, e.g., in the absence of the test agent (negative control), or in the presence of a known agent (positive control).
- a control can also represent an average value gathered from a number of tests or results.
- controls can be designed for assessment of any number of parameters.
- a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of side effects).
- pharmacological data e.g., half-life
- therapeutic measures e.g., comparison of side effects
- One of skill in the art will understand which controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.
- cancer refers to all types of cancer, neoplasm, or malignant tumors found in mammals, including leukemia, carcinomas and sarcomas.
- exemplary cancers include cancer of the brain, breast, cervix, colon, head & neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and Medulloblastoma.
- Additional examples include, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary
- macroglobulinemia primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine and exocrine pancreas, and prostate cancer.
- leukemia refers broadly to progressive, malignant diseases of the blood- forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or aleukemic (subleukemic).
- the P388 leukemia model is widely accepted as being predictive of in vivo antileukemic activity.
- the present application includes a method of treating leukemia, and, preferably, a method of treating acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophylic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia,
- hemocytoblastic leukemia histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocyte leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myelocytic leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia,
- sarcoma generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance.
- Sarcomas which can be treated with a combination of antineoplastic thiol-binding mitochondrial oxidant and an anticancer agent include a chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sar
- melanoma is taken to mean a tumor arising from the melanocytic system of the skin and other organs.
- Melanomas which can be treated with a combination of antineoplastic thiol-binding mitochondrial oxidant and an anticancer agent include, for example, acral- lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, and superficial spreading melanoma.
- carcinoma refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases.
- exemplary carcinomas which can be treated with a combination of antineoplastic thiol-binding mitochondrial oxidant and an anticancer agent include, for example, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, ence
- ShIDO-ST is a Salmonella typhimurium (ST) cell that expresses a small hairpin
- shIDO-ST is composed of an attenuated Salmonella typhimurium strain known as YS1646 (ATCC Accession No. 202165, also referred to herein as VNP20009) expressing a small hairpin RNA targeted to IDO comprising SEQ ID NO:8.
- YS1646 ATCC Accession No. 202165, also referred to herein as VNP20009
- VNP20009 small hairpin RNA targeted to IDO comprising SEQ ID NO:8.
- compositions comprising a bacterial cell and a tumor penetrating agent.
- the composition further comprises an anti-cancer agent.
- the anti-cancer agent can be selected from the group consisting of a small molecule, a nucleic acid, a
- tumor penetrating agents include, but are not limited to, hyaluronidase polypeptides, pirfenidone, Saridegib (IPI-926), nanoparticles, albumin nanoparticles, dextrans, liposomes, and cell penetrating peptides.
- the tumor penetrating agent is a hyaluronidase polypeptide.
- the bacterial cell and hyaluronidase polypeptide are present in an effective amount, e.g., a synergistic effective amount.
- the bacterial cell is a Salmonella bacterial cell.
- compositions comprising a Salmonella bacterial cell and a hyaluronidase polypeptide.
- Hyaluronidases are a group of neutral- and acid-active enzymes generally grouped in three different classes, mammalian-type hyaluronidases, bacterial hyaluronidases and
- hyaluronidases from leeches, other parasites and crustaceans.
- Mammalian-type hyaluronidases are endo-beta-N-acetylhexosaminidases that have both hydrolytic and transglycosidase activities, and can be further divided into two groups, neutral active and acid active enzymes.
- Hyaluronan is found in the extracellular matrix of many cells and plays a key role in biological phenomena associated with cell mobility including tumorigenesis.
- Hyaluronidase polypeptides suitable for use in the provided methods and compositions include mammalian hyaluronidases, for example, PH-20 hyaluronidase.
- the hyaluronidase polypeptide comprises SEQ ID NO: l or SEQ ID NO:2 or a fragment thereof.
- the term "hyaluronidase polypeptide" includes domains, fragments, and variants thereof.
- the hyaluronidase polypeptide can comprise a fragment of SEQ ID NO: l or SEQ ID NO:2 as long as the fragment remains catalytically active, e.g., the polypeptide retains the ability to degrade hyaluron and/or chondroitin sulfate.
- the hyaluronidase polypeptide can comprise SEQ ID NO: 1 or SEQ ID NO:2 or a fragment of SEQ ID NO: 1 or SEQ ID NO:2 with one or more amino acid substitutions again as long as the hyaluronidase polypeptide remains catalytically active.
- the amino acid substitution is a conservative amino acid substitution as described in more detail above.
- the hyaluronidase polypeptide can include a fragment of SEQ ID NO:l, e.g., amino acids 35-464 of SEQ ID NO: l or the entire sequence of amino acids set forth in SEQ ID NO:l .
- Exemplary nucleic acid sequences of hyaluronidases can be found, for example, at GenBank Accession Nos. NM_003117 and NM_153189.2 and exemplary polypeptide sequences of hyaluronidases can be found, for example, at GenBank Accession Nos. NP 003108 and
- Hyaluronidase polypeptides suitable for use in the provided compositions, kits and methods are described in U.S. Patent Nos. 7,767,429; 7,829,081; 7,846,431; 7,871,607;
- the hyaluronidase polypeptide is a chemically modified hyaluronidase polypeptide, i.e., the polypeptide has been modified to include one or more glycosylated and/or pegylated moieties.
- the hyaluronidase polypeptide is pegylated.
- the hyaluronidase polypeptide is PEGPH20TM (Halozyme, Inc., San Diego, CA), which is used in the examples below.
- PEGPH20TM (Halozyme, Inc., San Diego, CA), is recombinant human hyaluronidase PH-20 (SEQ ID NO: l) that has been modified by pegylation.
- PEGPH20TM (Halozyme, Inc., San Diego, CA) is pegylated recombinant human hyaluronidase PH-20.
- peptide, polypeptide, or protein are used broadly to mean two or more amino acids linked by a peptide bond. Protein, peptide, and polypeptide are also used herein interchangeably to refer to amino acid sequences. It should be recognized that the term polypeptide is not used herein to suggest a particular size or number of amino acids comprising the molecule and that a peptide of the invention can contain up to several amino acid residues or more. It is understood that the nucleic acids that can encode those peptide, polypeptide, or protein sequences, variants and fragments thereof are also disclosed. This would include all degenerate sequences related to a specific polypeptide sequence, i.e.
- nucleic acids having a sequence that encodes one particular polypeptide sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the polypeptide sequences.
- degenerate nucleic acids encoding the disclosed variants and derivatives of the polypeptide sequences.
- polypeptides which have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent identity to the polypeptides provided herein.
- polypeptides which have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent identity to the polypeptides provided herein.
- Those of skill in the art readily understand how to determine the identity of two polypeptides as discussed in more detail above.
- Bacterial cells useful in the provided composition, kits and methods include, but are not limited to Salmonoella bacterial cells, Bifidobacteria bacterial cells, Listeria monocytogenes bacterial cells, Clostridium histolyticus bacterial cells, Clostridium novyi bacterial cells, Vibrio cholera bacterial cells, Shigella bacterial cells, Streptococcus bacterial cells, Mycobacterium bovis bacterial cells, Yersinia enterocolitica bacterial cells, Bacillus anthracis bacterial cells, Lactobacillus bacterial cells, Staphylococcus bacterial cells, E. coli bacterial cells.
- the Streptococcus bacterial cells are Streptococcus pyrogenes bacterial cells or Streptococcus gordonii bacterial cells. Suitable bacterial cells include bacterial cells described in International Publication No. WO 2012/149364, which is incorporated by reference herein in its entirety.
- the Salmonella bacterial cell is an attenutated attenuated Salmonella strain, for example, any serovar or Salmonella enterica, including, but not limited to, Salmonella typhimurium, Salmonella enteritidis or Salmonella typhi.
- the Salmonella bacterial cell is an attenuated strain of Salmonella typhimurium.
- Attenuated Salmonella typhimurium strains include, but are not limited to, YS1646, RE88, LH430, SL7207, ⁇ 8429, ⁇ 8431 or ⁇ 8468.
- the attenuated Salmonella typhimurium strain is a YS1646 Salmonella typhimurium strain (ATCC Accession No. 202165, also referred to herein as VNP20009), which is the strain used in the examples below and used to generate shIDO-ST.
- the bacterial cells provided herein comprise one or more molecules suitable for the treatment of a disease or disorder.
- the disease or disorder is cancer.
- the bacterial cell can comprise one or more agents capable of blocking, inhibiting or suppressing target gene expression or a target protein activity including, but not limited to, antibodies or functional fragments thereof, small molecules, aptamers, nucleic acids and RNA interference molecules (e.g., small interfering RNA (siRNA), microRNA (miRNA) and small hairpin RNA (shRNA)).
- the bacterial cell comprises a functional nucleic acid, e.g., an antisense nucleic acid.
- Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction.
- Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains.
- functional nucleic acids can interact with a target molecule directly.
- Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule.
- Antisense nucleic acids or antisense oligonucleotides are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing.
- the interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation.
- the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication.
- Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. See for example, Vermeulen et al., RNA 13: 723-730 (2007) and in WO2007/095387 and WO 2008/036825; Yue, et al, Curr. Genomics, 10(7):478-92 (2009) and Lennox Gene Ther.l8(12):l 111-20 (2011), which are incorporated by reference herein in their entireties.
- the antisense nucleic acid is a short haripin RNA, which is a sequence of R A that makes a tight hairpin turn.
- the antisense nucleic acid is an siR A or an miRNA.
- Antisense nucleic acid can be designed and made using standard nucleic acid synthesis techniques or obtained from a commercial entity, e.g., Sigma- Aldrich (St. Louis, MO) or Regulus Therapeutics (San Diego, CA).
- the backbone of the antisense nucleic acid is modified by various chemical modifications to improve the in vitro and in vivo stability and to improve the in vivo delivery of antisense molecules.
- Modifications of antisense molecules include, but are not limited to, 2'-0- methyl modifications, 2'-0-methyl modified ribose sugars with terminal phosphorothioates and a cholesterol group at the 3' end, 2'-0-methoxyethyl (2'-MOE) modifications, 2'-fluoro
- inhibitory nucleic acids include, for example, modified oligonucleotides (2'-0- methylated or 2'-0-methoxyethyl), locked nucleic acids (LNA; see, e.g, Valoczi et al, Nucleic Acids Res.
- oligonucleotides see, e.g, Kloosterman et al, PLoS Biol 5(8):e203 (2007)), peptide nucleic acids (PNAs), PNA-peptide conjugates, and LNA/2'-0- methylated oligonucleotide mixmers (see, e.g., Fabiani and Gait, RNA 14:336-46 (2008)).
- the antisense nucleic acid targets a metabolic enzyme, an
- the antisense nucleic acid targets an immunosuppressive target and the immunosuppressive target is STAT3, IDOl, ID02, Arginase 1, iNOS, CTLA-4, TGF- ⁇ , IL-10, pGE2 or VEGF.
- the immunosuppressive target is IDOl .
- the agent may be an antisense nucleic acid that targets STAT3, IDOl, ID02, Arginase 1 (Argl), iNOS, CTLA-4, IL-10, VEGF, pEGF2, or TGF- ⁇ .
- targets including their amino acid and nucleic acid sequences are known and, as is known and described herein, the nucleic acid sequences of these targets can be used to generate inhibitory nucleic acid molecules including antisense oligonucleotides and short hairpin RNA using known methods.
- the bacterial cells can comprise one or more of any of the following antisense nucleic acids of SEQ ID NOs: 3-31.
- the antisense nucleic acid can target STAT3 and can be short hairpin RNA comprising shSTAT3#58: AGTTCCTGGCACCTTGGATTGAGAGTCAA (SEQ ID NO:3), shSTAT3#59:
- the antisense nucleic acid can target IDOl and can be short hairpin R A comprising shIDOl-8:
- the antisense nucleic acid can target Argl and can be short hairpin RNA comprising shArgl-5: GCAGTTCCTTTCTGGTATG (SEQ ID NO: 12), shArgl-6: GCCTTTGTTGATGTCCCT (SEQ ID NO: 13), shArgl-7:
- the antisense nucleic acid can target iNOS and can be short hairpin RNA comprising shiNOS-43:
- the antisense nucleic acid can target ID02 and can be short hairpin RNA comprising CGCAGTTATGAGCTTTCTTAA (SEQ ID NO:22), CCGCAGTTATGAGCTTTCTTA (SEQ ID NO:23),
- CCATTGTCTTTGGAAAGCTAT (SEQ ID NO:27), CTTCTTCCAGATTCTCTGAAA (SEQ ID NO:28), GCTTCAAGCTCATGTGGACAA (SEQ ID NO:29),
- antisense molecules can be readily designed and obtained using the nucleic acid sequence of a known target using known methods.
- antisense molecules can be designed and made using standard nucleic acid synthesis techniques or obtained from a commercial entity, e.g., Regulus Therapeutics (San Diego, CA).
- the agents capable of blocking, inhibiting or suppressing target gene expression or a target protein activity can be expressed from an expression vector or cassette in the bacterial cell. Suitable expression vectors, e.g., plasmids, and their methods of use are known.
- compositions including the agents provided herein.
- Provided compositions can include a single agent, e.g., a bacterial cell or more than one agent, e.g., a bacterial cell and tumor penetrating agent.
- the provided compositions are, optionally, suitable for formulation and administration in vitro or in vivo.
- the compositions comprise one or more of the provided agents and a pharmaceutically acceptable carrier. Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005).
- pharmaceutically acceptable carrier a material that is not biologically or otherwise undesirable, i.e., the material is administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained. If administered to a subject, the carrier is optionally selected to minimize degradation of the active ingredient and to minimize adverse side effects in the subject.
- pharmaceutically acceptable salts or “pharmaceutically acceptable carrier” is meant to include salts of the active agents which are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the agents described herein.
- base addition salts can be obtained by contacting the neutral form of such agents with a sufficient amount of the desired base, either neat or in a suitable inert solvent.
- pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt.
- agents of the present application contain relatively basic
- acid addition salts can be obtained by contacting the neutral form of such agents with a sufficient amount of the desired acid, either neat or in a suitable inert solvent.
- suitable inert solvent examples include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric,
- the agents are administered in accord with known methods, such as intravenous administration, e.g., as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, intracavity, transdermal, oral, topical, intratumoral, parenteral, or inhalation routes.
- intravenous administration e.g., as a bolus or by continuous infusion over a period of time
- intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, intracavity, transdermal, oral, topical, intratumoral, parenteral, or inhalation routes are administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated.
- compositions for administration will commonly comprise an agent as described herein dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier.
- a pharmaceutically acceptable carrier preferably an aqueous carrier.
- aqueous carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter.
- These compositions may be sterilized by conventional, well known sterilization techniques.
- the compositions may contain
- auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like.
- concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the subject's needs.
- Solutions of the active agents as free base or pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
- Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.
- Oral formulations can include excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
- oral pharmaceutical compositions will comprise an inert diluent or assimilable edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
- the active agents may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
- Such compositions and preparations should contain at least 0.1% of active agent. The percentage of the
- compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 75% of the weight of the unit, or preferably between 25-60%.
- the amount of active agents in such compositions is such that a suitable dosage can be obtained
- the solution should be suitably buffered and the liquid diluent first rendered isotonic with sufficient saline or glucose.
- Aqueous solutions in particular, sterile aqueous media, are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion
- Sterile injectable solutions can be prepared by incorporating the active agents or constructs in the required amount in the appropriate solvent followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium. Vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired ingredients, can be used to prepare sterile powders for reconstitution of sterile injectable solutions.
- the preparation of more, or highly, concentrated solutions for direct injection is also contemplated.
- DMSO can be used as solvent for extremely rapid penetration, delivering high concentrations of the active agents to a small area.
- compositions of agents can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
- the composition can be in unit dosage form.
- the preparation is subdivided into unit doses containing appropriate quantities of the active component.
- the compositions can be administered in a variety of unit dosage forms depending upon the method of administration.
- unit dosage forms suitable for oral administration include, but are not limited to, powder, tablets, pills, capsules and lozenges.
- compositions and agents as described herein are useful for both prophylactic and therapeutic treatment.
- a therapeutically effective amount of the agents described herein are administered to a subject prior to or during early onset (e.g., upon initial signs and symptoms of cancer).
- Therapeutic treatment involves administering to a subject a therapeutically effective amount of the agents described herein after diagnosis or development of disease.
- a method of treating cancer in a subject comprising administering to the subject an effective amount, e.g., a combined effective amount, of a bacterial cell and a tumor penetrating agent, wherein administration treats the cancer in the subject.
- the effective amount or combined effective amount is a synergistic amount or combined synergistic effective amount.
- a method of stimulating an immune system in a subject comprising administering to the subject an effective amount of a bacterial cell and a tumor penetrating agent, wherein administration of the bacterial cell and the tumor penetrating agent stimulates the immune system of the subject.
- the immune response is an anti-cancer immune response.
- the provided methods further include administering to the subject an anti-cancer agent.
- the anti-cancer agent is administered subsequent to
- a method of enhancing delivery of an anti-cancer agent to a tumor cell comprising contacting the tumor cell with a bacterial cell, a tumor penetrating agent and an anti-cancer agent, wherein administration of the bacterial cell and cell penetrating agent enhances delivery of the anti-cancer agent.
- Anti-cancer agent can be selected from the group consisting of a small molecule, a nucleic acid, a polypeptide, and an antibody. Anti-cancer agents are known to those of skill in the art. See, e.g., Physician's Drug Handbook, 12 th Edition, Lippincott, Williams & Wilkins,
- the anti-cancer agent is a chemotherapeutic agent.
- Chemotherapeutic agents are agents which may inhibit the growth of tumors. Such agents, include, but are not limited to 5-fluorouracil; gemcitabine; mitomycin C; methotrexate; hydroxyurea; cyclophosphamide; dacarbazine; mitoxantrone; anthracyclins (epirubicin and doxurubicin); antibodies to receptors, such as herceptin; etoposide; pregnasome; hormone therapies such as tamoxifen and anti-estrogens; interferons; aromatase inhibitors; progestational agents; and LHRH analogs.
- 5-fluorouracil gemcitabine
- mitomycin C methotrexate
- hydroxyurea cyclophosphamide
- dacarbazine mitoxantrone
- anthracyclins epirubicin and doxurubicin
- antibodies to receptors such as herceptin; etoposide; pre
- the tumor penetrating agent is administered prior to the bacterial cell.
- the anticancer agent can be administered after administration of the bacterial cell and/or tumor penetrating agent.
- combinations of agents or compositions can be administered either concomitantly (e.g., as a mixture), separately but simultaneously (e.g., via separate intravenous lines) or sequentially (e.g., one agent is administered first followed by administration of the second agent).
- the term combination is used to refer to concomitant, simultaneous or sequential administration of two or more agents or compositions.
- the bacterial cell and hyaluronidase polypeptide are, optionally, present in an effective amount, e.g., a synergistic effective amount.
- the bacterial cell is a Salmonella bacterial cell.
- the tumor penetrating agent is a hyaluronidase polypeptide.
- the hyaluronidase polypeptide comprises SEQ ID NO: l or SEQ ID NO:2 or a fragment thereof.
- Hyaluronidase polypeptides suitable for use in the provided compositions, kits and methods are described in U.S. Patent Nos.
- the hyaluronidase polypeptide is a modified hyaluronidase polypeptide.
- the hyaluronidase polypeptide is pegylated.
- the hyaluronidase polypeptide is PEGPH20TM (Halozyme, Inc., San Diego, CA).
- the tumor penetrating agent is selected from the group consisting of pirfenidone (Kozono et al, Cancer Res. 73(7):2345-56 (2013)), IPI-929 (Olive et al, Science 324(5933): 1457-61 (2009)), nanoparticles, albumin nanoparticles, dextrans, liposomes, and cell penetrating peptides.
- Bacterial cells useful in the provided methods include, but are not limited to,
- Salmonella bacterial cells Salmonella bacterial cells, Bifidobacteria bacterial cells, Listeria monocytogenes bacterial cells,
- Clostridium histolyticus bacterial cells Clostridium novyi bacterial cells, Vibrio cholera bacterial cells, Shigella bacterial cells, Streptococcus bacterial cells, Mycobacterium bovis bacterial cells, Yersinia enterocolitica bacterial cells, Bacillus anthracis bacterial cells, Lactobacillus bacterial cells, Staphylococcus bacterial cells, E. coli bacterial cells.
- the Streptococcus bacterial cells are Streptococcus pyrogenes bacterial cells or Streptococcus gordonii bacterial cells.
- Suitable bacterial cells include bacterial cells described in International Publication No. WO 2012/149364, which is incorporated by reference herein in its entirety.
- the Salmonella bacterial cell is an attenuated attenuated Salmonella strain.
- the Salmonella bacterial cell is an attenuated attenuated Salmonella strain.
- the Salmonella bacterial cell is an attenuated attenuated
- Salmonella bacterial cell is a Salmonella choleraesuis bacterial cells.
- the Salmonella bacterial cell is an attenuated strain of Salmonella typhimurium.
- Attenuated Salmonella typhimurium strains include, but are not limited to, YS1646, RE88, LH430, SL7207, ⁇ 8429, ⁇ 8431 or ⁇ 8468.
- the attenuated Salmonella typhimurium strain is an YS1646
- Salmonella typhimurium strain also referred to herein as ATCC Accession No. 202165, also referred to herein as
- Toxoplasma gondii cells can be used in the provided compositions, kits and methods.
- the bacterial cells provided herein comprise one or more molecules suitable for the treatment of a disease or disorder.
- the bacterial cell can comprise one or more agents capable of blocking, inhibiting or suppressing target gene expression or a target protein activity including, but not limited to, antibodies or functional fragments thereof, small molecules, aptamers, nucleic acids and RNA interference molecules (e.g., small interfering RNA (siRNA), microRNA (miRNA) and small hairpin RNA (shRNA)).
- the bacterial cell comprises a functional nucleic acid, e.g., an antisense nucleic acid.
- the antisense nucleic acid targets a metabolic enzyme, an immunosuppressive target or a cancer target.
- the antisense nucleic acid targets an immunosuppressive target and the immunosuppressive target is STAT3, IDOl, ID02, Arginase 1, iNOS, CTLA-4, TGF- ⁇ , IL-10, pGE2 or VEGF.
- the immunosuppressive target is IDOl .
- the antisense nucleic acid is selected from the group consisting of SEQ ID NOs:3-31.
- an effective dose or amount herein is meant a dose that produces effects for which it is administered.
- combined effective dose or amount herein is meant a dose of two or more agents administered concomitantly (e.g., as a mixture), separately but simultaneously (e.g., via separate intravenous lines) or sequentially (e.g., one agent is administered first followed by administration of the second agent), that produces effects for which it is administered.
- therapeutically effective amount or combined effect amount includes that amount of an agent or combination of agents sufficient to reduce or ameliorate one or more symptoms of a disease or disorder.
- an effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%.
- Efficacy can also be expressed as "-fold" increase or decrease.
- a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.
- the exact dose and formulation will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), and Pickar, Dosage Calculations (1999)).
- “synergistically effective amount” and the like in the context of co-administration of agents described herein refer to a more than additive (e.g., supra-additive) response (e.g., biological response) when two or more agents are administered with respect to the summed effects upon administration of each agent in the absence of the other agent or agents. For example, if two agents provide a synergistic therapeutic effect, then the therapeutic effect observed upon coadministration of both agents is greater than the summed observed therapeutic effects when either agent is administered in the absence of the other agent.
- additive e.g., supra-additive response
- biological response e.g., biological response
- a first amount of a first agent and a second amount of a second agent together provide a synergistically effective amount where the therapeutic effect observed upon co-administration of both agents is greater than the summed observed therapeutic effects when either agent is administered in the absence of the other agent.
- treatment refers to a method of reducing the effects of one or more symptoms of a disease or condition characterized by expression of the protease or symptom of the disease or condition characterized by expression of the protease.
- treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%), 90%), or 100%) reduction in the severity of an established disease, condition, or symptom of the disease or condition.
- a method for treating a disease is considered to be a treatment if there is a 10% reduction in one or more symptoms of the disease in a subject as compared to a control.
- the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%), 90%), 100%), or any percent reduction in between 10%> and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition. Further, as used herein, references to decreasing, reducing, or inhibiting include a change of 10%>, 20%>, 30%>, 40%), 50%), 60%o, 70%o, 80%), 90%> or greater as compared to a control level and such terms can include but do not necessarily include complete elimination.
- a "subject,” “individual,” or “patient,” is used interchangeably herein, which refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vitro or cultured in vitro are also encompassed.
- kits comprising one or more of the provided compositions.
- kits comprising a bacterial cell and a tumor penetrating agent.
- the bacterial cell and tumor penetrating agent are present in an effective amount, e.g., a synergistic effective amount.
- the kits comprise a first composition comprising a Salmonella bacterial cell and a second composition comprising a hyaluronidase polypeptide.
- the Salmonella bacterial cell and hyaluronidase polypeptide are present in an effective amount, e.g., a synergistic effective amount.
- the compositions are present in a container such as a vial or packet.
- the kit comprises one or more additional agents.
- the kit further includes an additional therapeutic agent, e.g., an anti-cancer agent.
- the additional therapeutic agent may be included in a composition comprising the bacterial cell and/or tumor penetrating agent or formulated as a separate composition.
- the kit comprises a means of administering the compositions, such as, for example, a syringe, needle, tubing, catheter, patch, and the like.
- the kit may also comprise formulations and/or materials requiring sterilization and/or dilution prior to use.
- the provided kits include instructions for use.
- any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.
- Example 1 Combination of shIDO-ST and PEGPH20TM for Cancer Treatment.
- shIDO-ST nine C57BL/6 mice were injected orthotopically (in the pancreas) with 5xl0 5 KPC-luc cells.
- Three small groups (n 3) were created: shIDO-ST alone, PEGPH20TM alone, and shIDO-ST with PEGPH20TM.
- the shIDO-ST alone group received shIDO-ST at a dose of 5xl0 6 cfu/mouse through intravenous (i.v.) injection on days 8 and 12.
- PEGPH20TM alone group received PEGPH20TM at a dose of 4.5 mg/kg ( ⁇ 90 ug/mouse) on day 7 through i.v. injection.
- the combination (PEGPH20TM with shIDO-ST) group received PEGPH20TM at 4.5 mg/kg on day 7 followed by treatment with shIDO-ST on day 8 at 5xl0 6 cfu/mouse.
- Mice were imaged using an intravital imaging system (IVIS) at indicated time points after tumor cell implantation. Mice were injected with D-luciferin at indicated days and imaged 5-10 minutes post-injection. Exposure time was 2 seconds for all time points.
- IVIS intravital imaging system
- mice were injected with D-luciferin at indicated days and imaged 5-10 minutes post-injection. Exposure time was 2 seconds for all time points.
- mice exhibited signs of sickness due to toxicity of the shIDO-ST, which was likely a result of too high a dose. Tumor reduction in the combination group, and to a lesser degree in the shIDO-ST alone group, was observed. Mice in the PEGPH20TM group were euthanized due to significantly large tumors which caused problems with
- a control group was added that consisted of full dose of PEGPH20TM and full dose of the scrambled (shScr-ST) control that is not specific to any gene target.
- mice received PEGPH20TM on day 7 and shIDO-ST or shScr-ST on day 8. In this experiment, no mice were observed to become ill due to treatment using the mentioned doses.
- PEGPH20TM and shIDO-ST combination group were euthanized by day 30 due to significantly large tumors causing mobility issues or illness in mice. Again, significant reduction in tumor growth was observed in 2 of 3 mice in the PEGPH20TM and shIDO-ST combination group on days 21 and 30. Although not as significant, the third mouse also exhibited tumor control which will extend survival. Tumors reappeared in mice by day 37. Therefore, a second treatment was administered to these mice to determine if this could induce further tumor regression. We saw modest tumor reduction through day 44. Photons emitted from mice imaged in Figure 4 were quantitated using Living Image® software. Tumors from PEGPH20TM (PEG) + shIDO-ST treated mice are controlled significantly better than all other groups. See Figure 5. Further, mice in Figure 4 were weighed at each imaging point. There were no significant changes in mouse weight for any group. See Figure 6.
- mice were orthotopically implanted with 0.5 million KPC (KrasLSL.G12D/+;
- mice Fourteen days after implantation, all mice were treated with indicated therapies according to the schedule outlined in Table 1.
- shScr-ST is a Salmonella control that carries a scrambled shRNA sequence with no specificity.
- mice were injected with D-luciferin 5 minutes prior to imaging by intravital imaging using a Xenogen 100 machine.
- 100% of mice treated with PEGPH20TM/shIDO-ST were observed to have substantial tumor regression with nearly 75% of mice showing remarkable elimination of tumors and indefinite survival (> 1Y) comparable to that of healthy, tumor- free mice. No other treatment combinations were nearly as effective.
- Sections from 14 day tumors of mice untreated or treated with PEGPH20 were stained with anti-CD31 antibody to locate cross sections of vessels within the tumor mass.
- FITC- conjugated secondary specific to CD31 primary and DAPI staining were visualized by fluorescence microscopy. As shown in Figure 13, the images represent a majority of closed vessels in untreated tumors and many more open vessels in tumors of mice treated with
- the treatment schedule is outlined in Figure 18.
- the treated KPC- Brcal mouse was euthanized 5 weeks later (at 12 weeks of age).
- the KPC-Brcal mouse was observed to have a significantly smaller pancreas when compared to a normal sized pancreas.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Enzymes And Modification Thereof (AREA)
- Oncology (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112015033053A BR112015033053A2 (pt) | 2013-07-03 | 2014-07-01 | método de tratamento de câncer em um sujeito, método de estimulação do sistema imune em um sujeito, método de aumentar a distribuição de um agente anticâncer a uma célula tumoral, composição, e kit |
| EP14819900.3A EP3016716B1 (en) | 2013-07-03 | 2014-07-01 | Anticancer combination of a bacterial cell and a tumor penetrating agent |
| JP2016524319A JP6896420B2 (ja) | 2013-07-03 | 2014-07-01 | 抗癌組成物 |
| KR1020167001786A KR20160027971A (ko) | 2013-07-03 | 2014-07-01 | 항암 병용제 |
| CA2917102A CA2917102A1 (en) | 2013-07-03 | 2014-07-01 | Anticancer combinations |
| CN201480041314.4A CN105407974A (zh) | 2013-07-03 | 2014-07-01 | 抗癌组合 |
| AU2014284396A AU2014284396A1 (en) | 2013-07-03 | 2014-07-01 | Anticancer combinations |
| US14/978,590 US11141492B2 (en) | 2013-07-03 | 2015-12-22 | Anticancer combinations |
| IL243323A IL243323A0 (en) | 2013-07-03 | 2015-12-24 | Anti-cancer combinations |
| US17/478,133 US20220241432A1 (en) | 2013-07-03 | 2021-09-17 | Anticancer combinations |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361842749P | 2013-07-03 | 2013-07-03 | |
| US61/842,749 | 2013-07-03 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/978,590 Continuation US11141492B2 (en) | 2013-07-03 | 2015-12-22 | Anticancer combinations |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015002969A1 true WO2015002969A1 (en) | 2015-01-08 |
Family
ID=52144163
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/045086 Ceased WO2015002969A1 (en) | 2013-07-03 | 2014-07-01 | Anticancer combinations |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US11141492B2 (https=) |
| EP (1) | EP3016716B1 (https=) |
| JP (2) | JP6896420B2 (https=) |
| KR (1) | KR20160027971A (https=) |
| CN (1) | CN105407974A (https=) |
| AU (1) | AU2014284396A1 (https=) |
| BR (1) | BR112015033053A2 (https=) |
| CA (1) | CA2917102A1 (https=) |
| IL (1) | IL243323A0 (https=) |
| WO (1) | WO2015002969A1 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018055014A1 (en) * | 2016-09-23 | 2018-03-29 | Ventana Medical Systems, Inc. | Methods and systems for scoring extracellular matrix biomarkers in tumor samples |
| WO2019014398A1 (en) | 2017-07-11 | 2019-01-17 | Actym Therapeutics, Inc. | MODIFIED IMMUNOSTIMULATORY BACTERIAL STRAINS AND USES THEREOF |
| WO2020014543A2 (en) | 2018-07-11 | 2020-01-16 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020047161A2 (en) | 2018-08-28 | 2020-03-05 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US11015199B2 (en) | 2015-11-09 | 2021-05-25 | Swansea University | Cancer therapy |
| US20220193149A1 (en) * | 2019-05-16 | 2022-06-23 | City Of Hope | Compositions and methods for targeting tumor-associated extracellular matrix components to improve drug delivery |
| US12024709B2 (en) | 2019-02-27 | 2024-07-02 | Actym Therapeutics, Inc. | Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022524951A (ja) | 2019-02-27 | 2022-05-11 | アクティム・セラピューティクス・インコーポレイテッド | 腫瘍、腫瘍常在免疫細胞および腫瘍微小環境にコロニー形成するよう操作した免疫刺激性細菌 |
| JP2023501539A (ja) | 2019-11-12 | 2023-01-18 | アクティム・セラピューティクス・インコーポレイテッド | 免疫刺激細菌デリバリープラットフォーム、および治療用産物のデリバリーのためのその使用 |
| IL300447A (en) | 2020-08-12 | 2023-04-01 | Actym Therapeutics Inc | Bacteria-based ingredients that stimulate the immune system, treatments and platforms for delivering RNA |
| CN113769063B (zh) * | 2021-09-30 | 2024-01-19 | 浙江大学 | 一种多肽ptpr在制备肿瘤免疫治疗药物中的应用 |
| KR102680316B1 (ko) * | 2021-11-01 | 2024-07-01 | 오토텔릭바이오 주식회사 | 안티센스 올리고뉴클레오타이드 |
| WO2023086796A2 (en) | 2021-11-09 | 2023-05-19 | Actym Therapeutics, Inc. | Immunostimulatory bacteria for converting macrophages into a phenotype amenable to treatment, and companion diagnostic for identifying subjects for treatment |
| CN115838720A (zh) * | 2022-07-28 | 2023-03-24 | 吉林启众生物科技有限公司 | 一种携带shSTAT3/shPD-L1重组质粒的减毒沙门氏菌载体及其应用 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090208534A1 (en) * | 2006-07-26 | 2009-08-20 | The Government Of The United States Of America, As Represented By The Secretary, Dept.Of Health | Attenuated salmonella as a delivery system for sirna-based tumor therapy |
| US20100239546A1 (en) * | 2007-06-15 | 2010-09-23 | Beth Israel Deaconess Medical Center | Bacterial mediated tnf alpha gene silencing |
| WO2012149364A1 (en) * | 2011-04-28 | 2012-11-01 | Diamond Don J | Tumor associated vaccines and compositions for disrupting tumor-derived immunosuppression for use in combination cancer immunotherapy |
| US20120294830A1 (en) * | 2004-03-05 | 2012-11-22 | Bookbinder Louis H | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases |
Family Cites Families (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR013269A1 (es) | 1997-08-04 | 2000-12-13 | Scras | Producto que contiene por lo menos un rna de doble filamento combinado con por lo menos un agente anti-viral, para la utilizacion terapeutica en eltratamiento de una enfermedad viral, en especial de la hepatitis viral |
| US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| AUPP249298A0 (en) | 1998-03-20 | 1998-04-23 | Ag-Gene Australia Limited | Synthetic genes and genetic constructs comprising same I |
| GB9827152D0 (en) | 1998-07-03 | 1999-02-03 | Devgen Nv | Characterisation of gene function using double stranded rna inhibition |
| CA2361201A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| DE19956568A1 (de) | 1999-01-30 | 2000-08-17 | Roland Kreutzer | Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens |
| US20050112141A1 (en) * | 2000-08-30 | 2005-05-26 | Terman David S. | Compositions and methods for treatment of neoplastic disease |
| HK1047109A1 (zh) | 1999-10-15 | 2003-02-07 | University Of Massachusetts | 作为指定基因干预工具的rna干预轨迹基因 |
| GB9927444D0 (en) | 1999-11-19 | 2000-01-19 | Cancer Res Campaign Tech | Inhibiting gene expression |
| CA2433680A1 (en) | 2000-12-28 | 2002-08-01 | Gregory M Arndt | Double-stranded rna-mediated gene suppression |
| US20060104968A1 (en) * | 2003-03-05 | 2006-05-18 | Halozyme, Inc. | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminogly ycanases |
| NZ542873A (en) | 2003-03-05 | 2008-07-31 | Halozyme Inc | Soluble, neutral-active hyaluronidase activity glycoprotein (sHASEGP) that is produced with high yield in a mammalian expression system by introducing nucleic acids that lack a narrow region encoding amino acids in the carboxy terminus of the human PH20 cDNA |
| US20090123367A1 (en) * | 2003-03-05 | 2009-05-14 | Delfmems | Soluble Glycosaminoglycanases and Methods of Preparing and Using Soluble Glycosaminoglycanases |
| WO2005018332A1 (en) * | 2003-08-13 | 2005-03-03 | The General Hospital Corporation | Modified microorganisms for anti-cancer therapy |
| WO2007095387A2 (en) | 2006-02-17 | 2007-08-23 | Dharmacon, Inc. | Compositions and methods for inhibiting gene silencing by rna interference |
| AU2007299705B2 (en) | 2006-09-22 | 2012-09-06 | Dharmacon, Inc. | Duplex oligonucleotide complexes and methods for gene silencing by RNA interference |
| KR20130116386A (ko) * | 2008-04-14 | 2013-10-23 | 할로자임, 아이엔씨 | 히알루로난 관련 질환 및 상태 치료용 변형된 히알루로니다제 및 그 용도 |
-
2014
- 2014-07-01 WO PCT/US2014/045086 patent/WO2015002969A1/en not_active Ceased
- 2014-07-01 BR BR112015033053A patent/BR112015033053A2/pt not_active Application Discontinuation
- 2014-07-01 KR KR1020167001786A patent/KR20160027971A/ko not_active Withdrawn
- 2014-07-01 CN CN201480041314.4A patent/CN105407974A/zh active Pending
- 2014-07-01 CA CA2917102A patent/CA2917102A1/en not_active Abandoned
- 2014-07-01 JP JP2016524319A patent/JP6896420B2/ja active Active
- 2014-07-01 EP EP14819900.3A patent/EP3016716B1/en active Active
- 2014-07-01 AU AU2014284396A patent/AU2014284396A1/en not_active Abandoned
-
2015
- 2015-12-22 US US14/978,590 patent/US11141492B2/en active Active
- 2015-12-24 IL IL243323A patent/IL243323A0/en unknown
-
2019
- 2019-05-07 JP JP2019087445A patent/JP2019167346A/ja active Pending
-
2021
- 2021-09-17 US US17/478,133 patent/US20220241432A1/en not_active Abandoned
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120294830A1 (en) * | 2004-03-05 | 2012-11-22 | Bookbinder Louis H | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases |
| US20090208534A1 (en) * | 2006-07-26 | 2009-08-20 | The Government Of The United States Of America, As Represented By The Secretary, Dept.Of Health | Attenuated salmonella as a delivery system for sirna-based tumor therapy |
| US20100239546A1 (en) * | 2007-06-15 | 2010-09-23 | Beth Israel Deaconess Medical Center | Bacterial mediated tnf alpha gene silencing |
| WO2012149364A1 (en) * | 2011-04-28 | 2012-11-01 | Diamond Don J | Tumor associated vaccines and compositions for disrupting tumor-derived immunosuppression for use in combination cancer immunotherapy |
Non-Patent Citations (3)
| Title |
|---|
| BLACHE ET AL.: "Systemic delivery of Salmonella typhimurium transformed with IDO shRNA enhances intratumoral vector colonization and suppresses tumor growth", CANCER RES., vol. 72, 22 October 2012 (2012-10-22), pages 6447 - 6456, XP055305466 * |
| MANUEL ET AL.: "Enhancement of cancer vaccine therapy by systemic delivery of a tumor-targeting Salmonella-based STAT3 shRNA suppresses the growth of established melanoma tumors", CANCER RES., vol. 71, 28 April 2011 (2011-04-28), pages 4183 - 4191, XP055305469 * |
| See also references of EP3016716A4 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11015199B2 (en) | 2015-11-09 | 2021-05-25 | Swansea University | Cancer therapy |
| WO2018055014A1 (en) * | 2016-09-23 | 2018-03-29 | Ventana Medical Systems, Inc. | Methods and systems for scoring extracellular matrix biomarkers in tumor samples |
| WO2019014398A1 (en) | 2017-07-11 | 2019-01-17 | Actym Therapeutics, Inc. | MODIFIED IMMUNOSTIMULATORY BACTERIAL STRAINS AND USES THEREOF |
| US12553047B2 (en) | 2017-07-11 | 2026-02-17 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US11168326B2 (en) | 2017-07-11 | 2021-11-09 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12201653B2 (en) | 2018-07-11 | 2025-01-21 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020014543A2 (en) | 2018-07-11 | 2020-01-16 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12357661B2 (en) | 2018-07-11 | 2025-07-15 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12226439B2 (en) | 2018-07-11 | 2025-02-18 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US11242528B2 (en) | 2018-08-28 | 2022-02-08 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12012600B2 (en) | 2018-08-28 | 2024-06-18 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020047161A2 (en) | 2018-08-28 | 2020-03-05 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US11779612B2 (en) | 2019-01-08 | 2023-10-10 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12024709B2 (en) | 2019-02-27 | 2024-07-02 | Actym Therapeutics, Inc. | Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment |
| US20220193149A1 (en) * | 2019-05-16 | 2022-06-23 | City Of Hope | Compositions and methods for targeting tumor-associated extracellular matrix components to improve drug delivery |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3016716B1 (en) | 2020-06-17 |
| CN105407974A (zh) | 2016-03-16 |
| US11141492B2 (en) | 2021-10-12 |
| EP3016716A4 (en) | 2017-03-22 |
| JP2016530233A (ja) | 2016-09-29 |
| US20220241432A1 (en) | 2022-08-04 |
| EP3016716A1 (en) | 2016-05-11 |
| JP2019167346A (ja) | 2019-10-03 |
| AU2014284396A1 (en) | 2016-02-04 |
| IL243323A0 (en) | 2016-02-29 |
| US20160184456A1 (en) | 2016-06-30 |
| BR112015033053A2 (pt) | 2018-03-20 |
| JP6896420B2 (ja) | 2021-06-30 |
| CA2917102A1 (en) | 2015-01-08 |
| KR20160027971A (ko) | 2016-03-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220241432A1 (en) | Anticancer combinations | |
| RU2719185C2 (ru) | Препараты, осуществляющие рнк-интерференцию, для модуляции гена gst-pi | |
| EP2908865B1 (en) | Adenovirus expressing a fas-chimera and use thereof in cancer treatment methods | |
| US7968526B2 (en) | Antisense oligonucleotides directed to ribonucleotide reductase R2 and uses thereof in the treatment of cancer | |
| US8394418B2 (en) | Combination preparation of a biological response modifier and an anticancer agent and uses thereof | |
| US20170016002A1 (en) | Method of Treating Cancer by Inhibition of DNA Repair Proteins | |
| US9931322B2 (en) | Treatment of BRCA1-defective cancer or resistant cancers | |
| US20070274947A1 (en) | Antisense Oligonucleotides Directed to Ribonucleotide Reductase R1 and Uses Thereof in the Treatment of Cancer | |
| US20160369272A1 (en) | Compositions and methods for delivering microrna | |
| DK2613789T3 (en) | SDF-1-binding nucleic acids and their use in cancer treatment | |
| KR20200052294A (ko) | Setd2의 저해에 의한 암의 치료 방법 | |
| US20190002884A1 (en) | Methods of treating cancer by inhibition of dna repair proteins using antisense based therapies | |
| KR20190111116A (ko) | 암의 치료 | |
| US20110274745A1 (en) | Instillation of liposomal formulation of sirna and antisense oligonucleotides | |
| WO2005070469A1 (en) | Methods of treating mesothelioma using an antisense oligonucleotide to thymidylate synthase | |
| US20040121972A1 (en) | Methylenetetrahydrofolate reductase inhibitors and uses thereof | |
| WO2014201283A1 (en) | Methods for protecting ovarian function | |
| HK1262562A1 (en) | Treatment methods using adenovirus | |
| WO2004106518A1 (en) | Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treatment of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201480041314.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14819900 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 243323 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2016524319 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2917102 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014819900 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20167001786 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014284396 Country of ref document: AU Date of ref document: 20140701 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015033053 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112015033053 Country of ref document: BR Kind code of ref document: A2 Effective date: 20151230 |