WO2014193625A1 - Anticorps intégralement humains dirigés contre le récepteur qu'est l'intégrine alpha-4 humaine - Google Patents

Anticorps intégralement humains dirigés contre le récepteur qu'est l'intégrine alpha-4 humaine Download PDF

Info

Publication number
WO2014193625A1
WO2014193625A1 PCT/US2014/037325 US2014037325W WO2014193625A1 WO 2014193625 A1 WO2014193625 A1 WO 2014193625A1 US 2014037325 W US2014037325 W US 2014037325W WO 2014193625 A1 WO2014193625 A1 WO 2014193625A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
seq
integrin alpha
variable region
sequence
Prior art date
Application number
PCT/US2014/037325
Other languages
English (en)
Inventor
Ilya ALEXANDROV
Tajib Mirzabekov
Roman MIKHAILOV
Khikmet SADYKOV
Anton CHESTUKHIN
Alexey REPIK
Vasily IGNATIEV
Yan Lavrovsky
Original Assignee
R-Pharm Overseas, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by R-Pharm Overseas, Inc. filed Critical R-Pharm Overseas, Inc.
Publication of WO2014193625A1 publication Critical patent/WO2014193625A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2839—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance

Definitions

  • the invention generally relates to the field of molecular biology, immunology, autoimmune and inflammatory diseases and oncology. More specifically, the invention relates to antibodies that bind to human receptor integrin alpha-4.
  • BACKGROUND Alpha4 integrin is among 24 integrin families of cell-adhesion molecules containing noncovalently-associated alpha and beta subunits. Eighteen different integrin alpha subunits and eight different beta subunits have been reported to date in vertebrates, forming at least 24 alpha/beta heterodimers. These varied formations suggest that integrins constitute the most structurally and functionally diverse family of cell-adhesion molecules yet known. Integrins mediate cell-cell and cell extracellular matrix interactions over a wide range of biological contexts. Integrins support force-resistant stable firm adhesion as well as the dynamic adhesive interactions observed in cellular polarization and cell migration. Integrins play a crucial role in many physiological processes, including tissue morphogenesis, inflammation, wound healing, and regulation of cell growth and differentiation.
  • Alpha4 integrin plays a critical role in their adhesive interactions with endothelial cells during migration to lymphoid organs and extravasation to sites of inflammation.
  • Alpha4-betal binds to a major endothelial ligand vascular cell adhesion molecule (VCAM-1), and an extracellular matrix ligand fibronectin (FN) deposited in inflamed tissues, while alpha4-beta7 binds to MAdCAM-1 preferentially expressed in the gut.
  • VCAM-1 major endothelial ligand vascular cell adhesion molecule
  • FN extracellular matrix ligand fibronectin
  • Alpha4 integrins are known to play crucial roles in tissue-specific leukocyte trafficking to the inflamed brain (alpha4- betal) and to the inflamed gut (alpha4-beta7).
  • Alpha4 integrins are also known to regulate hematopoietic stem cell trafficking and retention in the bone marrow.
  • Persistent accumulation of leukocytes is a hallmark of the chronic inflammation observed in the affected tissues of autoimmune diseases such as Multiple sclerosis (MS) and Crohn's disease.
  • MS Multiple sclerosis
  • the leukocyte-endothelial interactions leading to extravasation are regulated by a sequence of multiple steps involving adhesion molecules and chemokine signaling.
  • circulating leukocytes that flow in blood vessels start to tether and roll along endothelial cells via selectins and their ligands.
  • This rolling interaction serves to slow down leukocytes and place them in proximity to the inflamed endothelial cells, thereby enabling these cells to efficiently scan the endothelial surface for available chemokines.
  • leukocytes encounter chemokines and become activated via chemokine receptors present on the leukocytes.
  • Chemokine signaling elicits an intracellular signaling cascade that eventually impinges on integrin cytoplasmic domains, thereby triggering integrin activation.
  • global conformational changes occur that rapidly convert a low-affinity latent integrin into a high-affinity ligand-competent state. In this way, the high-affinity integrin mediates the rapid arrest of rolling leukocytes and shear-resistant firm adhesion at inflamed endothelial cells.
  • the cascade of leukocyte-endothelial cell interactions was originally thought to contain three steps (i.e., rolling by selectins, activation by chemokines, and upregulation of integrin affinity) before transmigration of leukocytes across the endothelial barrier could occur.
  • a crawling step has recently been added to this cascade. Specifically, leukocytes crawl along the endothelial surface from the point of arrest to that of transmigration.
  • the dynamic regulation of integrin affinity plays a critical role in supporting such leukocyte crawling.
  • leukocytes During transendothelial migration (TEM), leukocytes proceed through endothelial cells via two distinct routes, either paracellular or transcellular. In the former, leukocytes transmigrate in between adjacent endothelial cells, which usually form tightly sealed junctions, thereby leaving no space between them.
  • paracellular TEM the junctions between endothelial cells are dynamically disassembled, thereby creating a gap for a leukocyte to pass through. This gap is closed as soon as the trailing edge of the leukocyte passes beyond it.
  • transcellular TEM a leukocyte transmigrates through a single endothelial cell. A pore is formed for a leukocyte to move through.
  • the pore formation that develops during transcellular TEM is thought to be mediated by a dynamic remodeling of the endothelial cell-rich plasma membrane that involves vimentin as well as caveolae or vesiculovacuolar organelles.
  • Organ-specific homing of leukocytes is made possible primarily by unique combinations of cell-adhesionmolecules and chemokine receptors.
  • Naive lymphocytes recirculate between the blood stream and peripheral lymphoid tissues, thereby patrolling the body for microorganisms and transformed cells.
  • Gut-tropic effector T cells which play a pathogenic role in inflammatory bowel diseases, upregulate in integrin alpha-4-beta7 and the chemokine receptor CCR9.
  • Brain-tropic effector T cells which are responsible for the pathogenesis of multiple sclerosis, upregulate in integrin alpha-4-betal .
  • CNS central nervous system
  • integrin ligands chemoattractants and integrin ligands. Prolonged selectin-mediated rolling of neutrophils and lymphocytes may also lead to integrin activation. Once firmly arrested, integrins serve for leukocytes to bind to other blood-borne leukocytes and platelets. VLA-4 have been shown to facilitate leukocyte migration across the basement membrane of blood vessels, as well as across extracellular matrix (ECM). The interaction of these integrins with ECM may propagate leukocyte immobilization, or bridging between cells. Eventually, VLA-4 integration leads to extravasation of neutrophils and lymphocytes into peripheral tissues and CNS. Thus antibodies that inhibit the interaction between integrin alpha-4 and it's ligand VCAM1 may serve as a therapy for MS and Crohn's disease.
  • ECM extracellular matrix
  • MS is an inflammatory demyelinating disorder of CNS. Histopatho logically, most acute active MS lesions are characterized by monocytes and lymphocytes infiltration in to the brain. This is considered a critical event in the pathogenesis of MS. Cell adhesion of leukocytes to the endothelial wall has been a major target of drug development against MS.
  • Antibodies against integrin alpha-4 (VLA-4) were the first pharmacological agents that were successfully brought to clinical trials and approved for the treatment of relapsing-remitting MS (RR-MS).
  • Natalizumab is a humanized anti-integrin alpha-4 monoclonal antibody which under the trade name TYSABRI was approved by the U.S.
  • FDA Food and Drug Administration
  • natalizumab is regarded as the most potent treatment for RR-MS.
  • the scientific rationale for the therapy with antibodies that block integrin alpha-4 is the reduction of leukocyte extravasations into the peripheral tissues, including the brain and the spinal cord by interfering with the physical interaction of VLA-4 with its natural ligands, VCAM-1 and FN.
  • the invention is based, in part, upon the discovery of antibodies that specifically bind to human integrin alpha-4 blocking the VCAM-1 /integrin alpha-4 interactions.
  • Series of antibodies were isolated from antibody libraries that contained fully human antibody frames.
  • the CDRs (Complementarity Determining Regions) of integrin alpha-4 -specific antibodies differ from each other, consistent with the design of the antibody libraries used.
  • CDRl and CDR2 of the antibody heavy chain were randomized to provide limited number of variation and CDR3 of the heavy chain was randomized to include all possible amino acid combinations.
  • CDRl and CDR2 were invariant and CDR3 was randomized completely. Since the frameworks for both heavy and light chain of antibodies were corresponding to human sequences, the antibodies described herein could be administered to humans without additional modifications such as a "humanization" process.
  • the antibodies could also be used as diagnostics and for research purposes.
  • the monoclonal antibodies disclosed herein are applicable for integrin alpha-4 /VCAM-1 signaling cascade targeting in drug development for cancer and immunological disorders, such as Crohn's and MS, and others.
  • the invention provides for an isolated antibody (IN8), or an antigen binding fragment of the antibody, that binds human integrin alpha-4 receptor.
  • the antibody comprises an immunoglobulin light chain of SEQ. ID NO. 90, and an immunoglobulin heavy chain of SEQ. ID NO. 82.
  • the antibody can be a monoclonal antibody.
  • the invention further provides for an isolated antibody (integrin IN9A), or an antigen binding fragment of the antibody, that binds human integrin alpha-4 receptor.
  • the antibody comprises an immunoglobulin light chain of SEQ. ID NO. 92, and an immunoglobulin heavy chain of SEQ. ID NO. 84.
  • the antibody can be a monoclonal antibody.
  • the invention even further provides for an isolated antibody (IN 10), or an antigen binding fragment of the antibody, that binds human integrin alpha-4 receptor.
  • the antibody comprises an immunoglobulin light chain of SEQ. ID NO. 94, and an immunoglobulin heavy chain of SEQ. ID NO. 86.
  • the antibody can be a monoclonal antibody.
  • the invention provides for an isolated antibody, or an antigen binding fragment of the antibody, that binds human integrin alpha-4.
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRL1 comprising the sequence of SEQ. ID NO. 57, a CDRL2 comprising the sequence of SEQ. ID NO. 58, and a CDRL3 comprising the sequence of SEQ. ID NO. 59.
  • the antibody further comprises an immunoglobulin heavy chain variable region comprising a CDRH1 comprising the sequence of SEQ. ID NO. 17, a CDRH2 comprising the sequence of SEQ. ID NO. 18, and a CDRH3 comprising the sequence of SEQ. ID NO. 19.
  • the CDR sequences of the antibody can be interposed between human or humanized framework sequences.
  • the invention provides for an isolated antibody, or an antigen binding fragment of the antibody, that binds human integrin alpha-4.
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRL1 comprising the sequence of SEQ. ID NO. 58, a CDRL2 comprising the sequence of SEQ. ID NO. 59, and a CDRL3 comprising the sequence of SEQ. ID NO. 61.
  • the antibody further comprises an immunoglobulin heavy chain variable region comprising a CDRH1 comprising the sequence of SEQ. ID NO. 23, a CDRH2 comprising the sequence of SEQ. ID NO. 24, and a CDRH3 comprising the sequence of SEQ. ID NO. 25.
  • the CDR sequences of the antibody can be interposed between human or humanized framework sequences.
  • the invention provides for an isolated antibody, or an antigen binding fragment of the antibody, that binds human integrin alpha-4.
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRL1 comprising the sequence of SEQ. ID NO. 58, a CDRL2 comprising the sequence of SEQ. ID NO. 59, and a CDRL3 comprising the sequence of SEQ. ID NO. 63.
  • the antibody further comprises an immunoglobulin heavy chain variable region comprising a CDRH1 comprising the sequence of SEQ. ID NO. 29, a CDRH2 comprising the sequence of SEQ. ID NO. 30, and a CDRH3 comprising the sequence of SEQ. ID NO. 31.
  • the CDR sequences of the antibody can be interposed between human or humanized framework sequences.
  • the invention provides for an isolated antibody, or an antigen binding fragment of the antibody, that binds human integrin alpha-4.
  • the antibody comprises an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ. ID NO. 41, and an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ. ID NO. 01.
  • the antibody can be a monoclonal antibody.
  • the invention provides for an isolated antibody, or an antigen binding fragment of the antibody, that binds human integrin alpha-4.
  • the antibody comprises an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ. ID NO. 45, and an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ. ID NO. 05.
  • the antibody can be a monoclonal antibody.
  • the invention provides for an isolated antibody, or an antigen binding fragment of the antibody, that binds human integrin alpha-4 receptor.
  • the antibody comprises an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ. ID NO. 49, and an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ. ID NO. 09.
  • the antibody can be a monoclonal antibody.
  • Figure 1 schematically shows representation of a typical antibody. Gray areas on the scheme depict Constant Regions of both antibody light and heavy chains, black areas depict Variable
  • Regions of the antibody light chain depict Variable Regions of the antibody heavy chain.
  • VH - Variable Regions of the antibody heavy chain VL - Variable Regions of the antibody light chain
  • CL Constant Region of the antibody light chain. Links between heavy and light chains and between two heavy chains depict intermolecular disulfide bridges;
  • Figure 2 schematically shows the amino acid sequences defining a complete immunoglobulin Heavy Chain Variable Region of the antibodies assigned as IN8, IN9, IN9A, IN9B, INIO, IN20,
  • amino acid sequences are aligned relative to each other where the regions defining CDR1, CDR2 and CDR3 respectively are identified in boxes; the unboxed sequences represent immunoglobulin framework; the length of shorter CDRs is adjusted for the alignment purpose by introducing dashes (-);
  • FIG 3 schematically shows amino acid sequences of CDR1, CDR2 and CDR3 for each immunoglobulin Heavy Chain Variable Region shown in Figure 2;
  • Figure 4 schematically shows the amino acid sequences defining a complete immunoglobulin
  • amino acid sequences are aligned relative to each other where the regions defining CDR1, CDR2 and CDR3 respectively are identified in boxes; the unboxed sequences represent immunoglobulin framework; the length of shorter CDRs is adjusted for the alignment purpose by introducing dashes (-);
  • FIG. 5 schematically shows amino acid sequences of CDR1, CDR2 and CDR3 for each immunoglobulin Light Chain (Kappa) Variable Region shown in Figure 4;
  • Figure 6 A show a graphic representation of VCAM-1 adhesion assay results performed with
  • Figure 7 shows the distribution of hydrodymanic sizes of antibodies IN8 (top peak), IN9A (middle peak), and IN 10 (lower peak) on freshly isolated (top panel a) and stored at 37°C for 8 days (bottom panel b) preparations, the table insert in top panel a) shows the average diameters of antibody molecules in solution after incubation, the graph for Tysabri is not shown but in also appears with a hydrodinamyc diameter of around 12.55 nM, all measurements have been carried out at a final protein concentartions of 2 mg/ml;
  • Figure 8 shows a graphic representation of specific heat capacity (Cp) measurements of antibodies IN8 (dot line), IN9A (dashed line), and IN 10 (solid line), derived from DSC data; and
  • Figure 9 shows a graphic representation of far-UV circular dichroism (CD) data for antibodies IN8, IN9A and IN10, alongside with Tysabri, while the curves are virtually
  • the invention is based, in part, upon the discovery of antibodies that specifically bind to human integrin alpha-4 (UniProtKB/Swiss-Prot: P13612) and block interactions with its cognate ligand VCAM-1 (UniProtKB/Swiss-Prot: PI 9320).
  • the antibodies could be used for a variety of diagnostic and therapeutic applications and as research tools.
  • the antibodies were selected for their ability to bind to human integrin alpha-4 with high affinity, specificity and selectivity.
  • the antibodies described herein are engineered on the basis of human sequences, all of them could be administered to humans directly. Depending on a particular application, the described antibodies could be used as targeting moieties for various payloads such as
  • the invention provides for an isolated antibody that specifically binds to human integrin alpha-4.
  • the antibody is comprised of (1) an immunoglobulin light chain variable region comprised of three CDRs and (2) an immunoglobulin heavy chain variable region comprised of three other CDRs.
  • the CDRs are embedded into the immunoglobulin framework generated by less variable FR domains.
  • the CDRs of the immunoglobulin light and heavy chain brought together in immunoglobulin molecule define a unique binding site that specifically binds to a native conformation of integrin alpha-4.
  • the terms "binds specifically” or “specifically binds” are interchangeable and mean that binding affinities (EC50 values) of the antibodies described herein are below 50 nM (5* 10 ⁇ 8 M).
  • the antibodies can comprise both immunoglobulin heavy and light chain sequences of fragments thereof, such as Fab or Fab 2 fragments. It is understood that specific binding and functional properties can be displayed by a full-length intact immunoglobulin or antigen binding fragment thereof or biosynthetic antibody site.
  • each of the antibody molecules can be an intact antibody, for example, a monoclonal antibody.
  • the antigen binding could be displayed by an antigen binding fragment of an antibody or can be a biosynthetic antibody binding site.
  • Antibody fragments include Fab, Fab 2 or Fv fragments. Techniques for making such antibody fragments are known to those skilled in the art.
  • a number of biosynthetic antibody binding sites are known in the art and include single Fv or sFv molecules, for example as described in US Patent # 5,476,786.
  • Other biosynthetic antibody binding sites include bi-specific or bi-functional antibodies that bind to at least two different target molecules.
  • a bi-specific antibody can bind to human integrin alpha-4 and to another antigen of interest. Methods for making bi-specific antibodies are known in art and include fusing hybridomas or linking Fab fragment together.
  • Antibodies described in this invention can be produced in different ways utilizing previously developed approaches.
  • DNA encoding variable regions of light and heavy chains can be synthesized chemically using commercially available services and sequence information provided in this invention.
  • the DNA encoding variable regions of heavy and light chains can be amplified by Polymerase Chain Reaction (PCR) using the original clones of Fab fragments of the antibodies described herein, as templates.
  • Synthetic or PCR-amplified DNA fragments can be genetically fused with appropriate nucleotide sequences to generate full-size antibodies or fragments thereof.
  • Antibody expression constructs can be generated by including immunoglobulin constant region coding sequences, sequences providing expression control and other standard elements of expression systems. Generation of specific gene expression constructs is within ordinary skill in the art.
  • DNA sequences encoding antibodies of interest can be genetically inserted into expression vectors that can be introduced into host cells using standard transfection of
  • E. coli bacterial expression
  • mammalian expression Choinese Hamster Ovary (CHO) cells, HeLa cells, Baby Hamster Kidney (BHK) cells, monkey kidney (COS) cells, Human Embryo Kidney (HEK- 293) cells and myeloma cells that do not produce endogenous immunoglobulins.
  • Transfected or transformed host cells can be propagated under conditions providing expression of genes of interest, such as immunoglobulin light and heavy chains and fragments thereof.
  • the expressed proteins can be harvested using common techniques known in the art.
  • E. co/z ' -based expression system is particularly suitable for production of Fab, Fab 2 or sFv antibody fragments.
  • the engineered antibody gene is cloned into a vector suitable for bacterial expression downstream from a commonly used bacterial promoters, e.g. T5 of Lac. Genetic fusion of a signal sequence providing targeting on the expressed protein into the periplasm may enable production and accumulation of soluble forms of antibody fragments into the periplasm of bacterial cells. Extraction of proteins of interest and, specifically, of antibody fragments from the periplasm of bacteria is a well-established array of standard methods known in the art.
  • DNA coding sequences must be inserted into appropriate expression vectors containing adequate eukaryotic promoter, signal peptide for secretion from the cells and other genetic elements known in the arts.
  • Mammalian expression systems are particularly suitable for production of full-size
  • immunoglobulins One of the approaches for antibody production is transient co-expression of heavy (variable + constant) and light (variable + constant) chains of immunoglobulin genetically introduced into two separate expression vectors. Another approach for antibody production is expression on both heavy and light chains from a single bi-cistronic vector. Alternatively, stable cell lines constitutively expressing both heavy and light chains can be generated using single vector approach or utilizing two-vector systems.
  • epitope or purification tags or peptide and protein toxins can be genetically fused to the expression constructs encoding heavy chain, light chain or combination of both immunoglobulin chains.
  • the antibodies disclosed herein can be modified to improve performance which largely depends on the intended use.
  • the antibody can be genetically modified to reduce its immunogenicity in the intended recipient.
  • the antibody can be genetically fused or coupled to another peptide or protein, such as epitope tag, purification tag, a growth factor, cytokine or natural or modified toxin.
  • integrin alpha-4 -specific antibodies described herein can be used as therapeutic and diagnostic agents or as reagents for basic and applied research and development.
  • the antibodies in the invention specifically bind to human integrin alpha-4 and block interactions with its cognate ligand VCAM-1, they can be utilized in a variety of therapeutic applications. It is contemplated that the antibodies of the invention can be used for the treatment of a variety of disorders in which integrin alpha-4 mediated signaling is involved. This includes Multiple Sclerosis, Crohn's desease and alike, as well as various types of cancers.
  • the antibodies are typically modified directly or indirectly with a detection moiety.
  • the detection moiety is a functional addition to the antibody that can be detected either directly or indirectly or is capable of generating a detectable signal.
  • the detectable moiety can be a
  • radionuclide Iodine, Phosphorus, Carbon or others
  • fluorescent or chemiluminescent compound such as fluorescein, rhodamine or luciferine.
  • Enzyme moieties include alkaline phosphatase, horse radish peroxidase, beta-galactozidase and others. Methods for conjugation of the detection moieties largely depend on the nature of the moiety and routinely can be reproduced by those experienced in the art.
  • the antibodies of the invention can be used in a broad range of immunological techniques know in the art. Examples of such techniques include sandwich immunoassays (ELISA), competitive immunoassays, cell surface staining procedures combined with FACS analysis, immunocyto- and immunohistochemical procedures. Protocols and method all of these procedures and assays are well-established and can be routinely carried out by those skilled in the art. EXAMPLES
  • Example 1 Generation of Magnetic Proteo liposomes as antigen presenting platforms.
  • integrin alpha-4 Isolation of antibodies that recognize native conformations of integrin alpha-4 is absolutely critical for the development of such antibodies as therapeutics. In the human body and tissues integrin alpha-4 is present in its native form, therefore only the antibodies that bind to the native receptor have practical utility. Preparation of antigen-presenting platforms that provide oriented and functional receptor in its native conformation is far from being trivial. Many methods of antibody generation, for example generation of antibodies against peptide epitopes or receptor fragments, usually are not successful for complex targets such as integrin alpha-4.
  • Previously patented technology that relies on the generation of magnetic proteoliposomes (MPLs) (Sodroski, J.G. and T. Mirzabekov, Proteoliposomes containing an integral membrane protein having one or more transmembrane domains; US Patent 6,761,902;) has been used for isolation of antibodies against integrin alpha-4.
  • MPLs magnetic proteoliposomes
  • the main advantage of the core technology that relies on usage of MPLs is the ability to present highly purified and concentrated antigen (human integrin alpha-4 in this invention) properly oriented and, most importantly, in its native conformation and functional state.
  • highly purified and concentrated antigen human integrin alpha-4 in this invention
  • US Patent 6,761,902 can be applied to a variety of complex membrane proteins, each target requires extensive optimization of protein extraction and MPL formation conditions.
  • a stable cell line Prior to preparing MPL particles, a stable cell line was prepared, utilizing established protocols, overexpressing human recombinant integrin alpha-4. The condition for extraction of human integrin alpha-4 were tested and optimized prior to the initiation of the antibody selection procedure. An extensive matrix of combinations of various detergents, salts and buffer components was analyzed to identify conditions providing a balance between effective extraction of the integrin alpha-4 and retaining of its function and native conformation. The integrin alpha-4 functionality was tested by assaying binding of its ligand, VCAM-1, to the integrin alpha-4 immobilized on the surface of the MPLs.
  • Example 2 Antibody libraries and selection of anti-integrin alpha-4 antibodies.
  • phage display library represents a collection of individual phage particles that express only a certain type of a genetic fusion of an individual Fab antibody fragment with a surface protein intrinsic for this particular type of phage.
  • a fraction of the phage display library usually containing 10 12 -10 13 phage particles is used as a primary source of the antibody variety.
  • a fraction of the phage display library (10 12 -10 13 phage particles) was incubated with MPL preparations containing functional integrin alpha-4 in its native conformation.
  • the phage particles that did not bind to the integrin alpha-4-MPLs were removed by a series of subsequent washes under conditions providing retention of the native conformation of integrin alpha-4.
  • the pool of phage particles that was bound to integrin alpha-4-MPLs was removed by acidic elution.
  • the deconvo luted phage output (usually 10 6 -10 8 phage particles) was harvested and further amplified by propagation in E. coli.
  • the pool of the amplified phage is then used further for the second selection round as described for the first round above.
  • a minimum of 2 and maximum of 4 selection rounds are carried out for a standard selection procedure.
  • This example describes a procedure for screening antibodies specific against native conformations of integrin alpha-4 receptor.
  • the screening procedure is based on the usage of live cells expressing human integrin alpha- 4 receptor on their surface. Generation of stable cell lines expressing integrin alpha-4 is described in Example 6 below. R1610 cells expressing integrin alpha-4 were used for screening.
  • Phage outputs from 3 rd or 4 th selection rounds represented pools of page particles that were used to infect E. coli to produce phagemid DNA.
  • the phagemid DNA was digested with Nhel and BstEII to excise the entire Fab fragment and further introduced (ligated) into pQE3-Kan expression vector (Quiagen) digested with the same restriction enzymes, Nhel-BstEII.
  • the resulting genetic construct was suitable for expression of Fab antibody fragment in bacteria under control of T5 promoter.
  • the cells expressing human integrin alpha-4 were mixed with individual Fab preparations and allowed to interact for 30 min at 4°C. Unbound material was removed by pelleting the cells and by aspirating the supernatant. Binding the Fab antibody fragments to the cells was analyzed by secondary antibodies conjugated to phycoerythrin. The antibody binding was quantified by FACS analysis using 96-well plate compatible Guava flow cytometer. Clones that gave increase of the signal >5 fold over the background were scored as positive and kept for further analysis.
  • the antibody clones that bound to integrin alpha-4 were re-tested for their ability to interact with parental cells that did not express integrin alpha-4 in order to identify specific integrin alpha- 4 binders.
  • the test was performed as described above and the final candidates from the screening had the following properties: they bind to the integrin alpha-4-expressing cells but not the integrin alpha-4-negative parental cells.
  • Example 4 Sequencing of anti-integrin alpha-4 antibodies.
  • Example 3 The candidate Fab antibody clones identified in Example 3 were subjected to a sequencing analysis to identify independent clones. Bacterial cultures were submitted to Beckman Genomics automated sequencing facility.
  • the experimental sequencing data were analyzed by appropriate software, specifically the nucleic acid sequences were aligned to identify identical clones and to determine the differences in the deduced protein sequences.
  • variable regions can be identified using IMGT ACQUEST webserver-based software at http:// ⁇ vw.imgi org/IMGT_ y q3 ⁇ 4est/share/textes/.
  • the sequencing analysis enabled detection of clones with identical sequences and only clones with unique and distinct DNA and protein sequences were kept for further evaluation.
  • variable region of the sequences shown below are combined with the corresponding constant region sequences.
  • Signal peptides are not presented in the sequence; each sequence starts from the actual beginning of the antibody molecule according to Kabat numbering system.
  • nucleotide sequence (Seq. ID NO. 78) 1 GCTAGCACCA AGGGCCCATC GGTCTTCCCC CTGGCACCCT CCTCCAAGAG CACCTCTGGG
  • AAATCTTGTG ACAAAACTCA CACATGCCCA CCGTGCCCAG CACCTGAACT CCTGGGGGGA
  • EIVLTQSPGT LSLSPGERAT LSCRASQSVS SSYLAWYQQK PGQAPRLLIY GASSRATGIP 61 DRFSGSGSGT DFTLTISRLE PEDFAVYYCQ QSYASPFTFG QGTKVEIKRT VAAPSVFIFP 121 PSDEQLKSGT ASVVCLLNNF YPREAKVQWK VDNALQSGNS QESVTEQDSK DSTYSLSSTL 181 TLSKADYEKH KVYACEVTHQ GLSSPVTKSF NRGEC
  • EIVLTQSPGT LSLSPGERAT LSCRASQSVS SSYLAWYQQK PGQAPRLLIY GASSRATGIP 61 DRFSGSGSGT DFTLTISRLE PEDFAVYYCQ QYYDYPVTFG QGTKVEIKRT VAAPSVFIFP 121 PSDEQLKSGT ASVVCLLNNF YPREAKVQWK VDNALQSGNS QESVTEQDSK DSTYSLSSTL 181 TLSKADYEKH KVYACEVTHQ GLSSPVTKSF NRGEC
  • EIVLTQSPGT LSLSPGERAT LSCRASQSVS SSYLAWYQQK PGQAPRLLIY GASSRATGIP 61 DRFSGSGSGT DFTLTISRLE PEDFAVYYCQ QSYDDPITFG QGTKVEIKRT VAAPSVFIFP 121 PSDEQLKSGT ASVVCLLNNF YPREAKVQWK VDNALQSGNS QESVTEQDSK DSTYSLSSTL 181 TLSKADYEKH KVYACEVTHQ GLSSPVTKSF NRGEC
  • This Example describes design and generation of expression constructs for inducible expression of human integrin alpha-4 receptor.
  • this example describes epitope and purification tags genetically fused to the nucleic acid sequences encoding integrin alpha-4 and its orthologs.
  • Human integrin alpha-4 receptor (NCBI Reference Sequence: NM_000885.4) was amplified by PCR using Clone ID HsCD00446160 (DNASU Plasmid Repository) as a template.
  • Clone ID HsCD00446160 DNASU Plasmid Repository
  • the endogenous native Stop codon of integrin alpha-4 was removed using IA-004 Reverse primer to provide in- frame genetic fusion with Strep-tag (h.ttp://www.iba-go.de/prottoojs/prot_stT ptag.html..
  • IA-003 direct primer (Seq. ID NO. 67)
  • AC-001 direct 'structural' primer (Seq. ID NO. 69) 5' - AGCGGGTCCTCTGGAGGGGGAGACTATAAGGATGACGATGACAAGAGTA TGGATGAGAAAACGACAGGTTGGCGCGGCGGGCATGTCGTT -3' AC-002 reverse 'structural' primer (Seq. ID NO. 70)
  • AGCTCACCGGCCAGTCCTTCAACGACATGCCCGCCGCGCC -3' AC-003 direct PCR primer (Seq. ID NO. 71)
  • Example 6 Generation of stable cell lines expressing recombinant integrin alpha-4.
  • the expression constructs encoding human integrin alpha-4 receptor described in Example 5 were used for generation of stable cell lines.
  • Commercially available cell lines, R1610, Cf2Th and HEK-293 (ATCC) were used.
  • the expression constructs were verified for the expression of the protein of interest in a transient transfection experiment and then the cells were propagated on a medium containing Zeocin to select for stable cell lines harboring the gene of interest.
  • Expression of the integrin alpha-4 was verified by Western blot and by FACS analysis to ensure that the expressed protein was translocated to the plasma membrane. For both techniques, commercially available antibodies were used.
  • Example 7 Conversion of the Fab antibody fragments into immunoglobulins and their production. This Example provides description an approach for subcloning of Fab fragments into mammalian expression vectors for production of fully functional immunoglobulins. A protein production approach is also provided herein.
  • the candidate Fab antibody Heavy Chain variable region fragments described in the foregoing Examples 2-4 were converted into full size immunoglobulins of IgGl framework.
  • Variable region of the heavy chain was fused to the constant region of human IgGl isotype using expression vector pTT-5 (NRC Biotechnology Research Institute, National Research Council of Canada) modified by introducing the constant region of human IgGl from pFUSE-CHIg-hGl expression vector (Invivogen) resulting in pTT-IgGl-HC vector.
  • the signal peptide from immunoglobulin kappa light chain variable region (Mus musculus, gb
  • Immunoglobulin 20-amino acid signal peptide sequence where starting methionine is underlined (Seq. ID NO. 73)
  • variable regions of the heavy chain were amplified by PCR to introduce into the following cloning sites: 5 '-end cloning restriction site is Sail, 3 '-end restriction site is Nhel.
  • the resulting PCR fragment was digested with Sail -Nhel restriction enzymes and then introduced into pTT-IgGl-HC vector digested with the same enzymes.
  • A-370 direct PCR primer for amplification of Heavy Chain Variable Region (Sail restriction site is underlined) (Seq. ID NO. 74)
  • Region of light chain was fused to the constant region of human light chain kappa using expression vector pTT-5 (NRC Biotechnology Research Institute, National Research Council of Canada) modified by introduction of the constant region of human light chain fragmen from pFUSE2- CLIg-hk expression vector (Invivogen) resulting in pTT-LC-Kappa.
  • the signal peptide from immunoglobulin kappa light chain variable region (Mus musculus, gb
  • variable regions of the light chain were amplified by PCR to introduce for the following cloning sites: 5 '-end cloning restriction site is Sail, 3 '-end restriction site is BsiWI.
  • the resulting PCR fragment was digested with Sall-BsiWI restriction enzymes and then introduced into pTT-LC-Kappa vector digested with the same enzymes.
  • A-340 direct PCR primer for amplification of Light Chain Kappa Variable Region (Sail restriction site is underlined) (Seq. ID NO. 76)
  • the antibodies in a format of human IgGl framework were produced using a protocol for transfection of CHO-3E7 cells using LPEI MAX in shake flask cultures.
  • CHO-3E7 cells provided by NRC Biotechnology Research Institute, National Research Council of Canada, were diluted to 0.8 xlO 6 cells/ml 24 h before transfection.
  • On the day of transfection cell density was adjusted to 2.0 to 2.2xl0 6 cells/ml using complete FreeStyleTM CHO medium and cell viability was greater than 97%.
  • PEI Polyethylenimine
  • Polyethylenimine ' 'MAX' ' linear, MW 25 kDa (40 kDa nominal), 3 mg/ml stock solution in water, pH 7.0 (Polysciences Inc. cat# 24765-2) was mixed with purified and quantified plasmid DNA of interest.
  • A260/A280 ratio (use 50 mM Tris-HCl pH 8.0 to dilute the plasmid DNA) was between 1.85 and 1.95.
  • the cells were used in exponential growth phase, 2-2.2xl0 6 cells/ml in CHO FreeStyle medium.
  • DNA preparations (0.75mg/L) encoding for Heavy or Light chains of immunoglobulin were mixed with PEI in CHO FreeStyle medium at 1 :5 (w:w) ratio, the mixture was then incubated 8-10 min, add then added to culture. Volume of the transfection mixture was 1/10 of the final volume of the production culture.
  • immunoglobulins were from 20 to 100 mg/L.
  • the immunoglobulin production was monitored by commercially available ELISA kit (Bethyl Laboratories).
  • the Protein A Plus Agarose resin was harvested and placed into 15 -ml columns (Pierce) and then washed with 10 volumes of lx PBS, then with 10 volumes of 25mM Tris-HCl, 0.12M Glycine, 1.5M NaCl (pH 8.5), then with 10 volumes of TBS-Tween-20, then with 10 volumes of 20mM Sodium Citrate Buffer, 1M NaCl (pH 5.5) and the final wash with 10 volumes of 150mM Sodium Chloride without any buffer.
  • the elution of bound immunoglobulins was carried out with Elution Buffer (0.1 M Glycine pH 3.0, 10% Sucrose, 150mM NaCl) that was added at ratio of 1 : 1 to the volume of Protein A Plus Agarose resin.
  • Elution Buffer 0.1 M Glycine pH 3.0, 10% Sucrose, 150mM NaCl
  • the elution buffer was incubated with the Protein A Plus Agarose resin for 3 min, removed and then another portion of fresh Elution Buffer was added to the Protein A Plus Agarose resin.
  • the eluted material was immediately neutralized by 0.5 M Sodium Citrate Buffer, pH 6.0, at the 1/10 volume ratio to the eluted volume.
  • the concentration of the resulting immunoglobulin preparations was determined by measure optical density of the solution at 280nm in UV-transparent cuvettes where a mixture of 0.1 ml of 0.5 M Sodium Citrate, pH 6, with 1ml of the Elution Buffer was used as a Reference Buffer.
  • concentration of IgG the following formula that provides IgG concentration in mg/ml, was used:
  • [IgG] OD 280 * DilutionFactor ⁇ w ⁇ Q .
  • This example describes the method for determination of the affinities of the antibodies against human integrin alpha-4 receptor and provides means of comparison of properties of different antibody clones.
  • VCAM-1 was coated onto an ELISA plate by overnight incubation (lOug/ml).
  • KA4 cells K562 overexpressing Integrin alpha-4) (5xl0 3 per well) were plated on a 96-well plate.
  • Antibodies were added at various concentrations (from 0.02 nM to 500 nM) and incubated for 30 minutes. Cells were transferred onto the VCAM-1 coated plate and incubated overnight at 37°C. Unbound cells were removed by washing three times with PBS. Washing efficiency was monitored using a microscope. The cells that remained attached to the VCAM-1 coated plate were analyzed using the MTT assay for colorimetric analysis and quantitation. Background binding was assessed using BSA-coated wells and subtracted from the experimental values. As a positive control commercially available comparator anti- integrin alpha-4 antibody - Tysabri was used. The obtained data were analyzed utilizing GraphPad Prism 5.0 software and EC50 values were calculated using antagonistic 4-parameter curve fit algorithm. The results of the analysis are presented graphically in Figures 6 A and 6B.
  • Dynamic light scattering also called photon correlation spectroscopy or quasi-elastic light scattering
  • Large protein (di-, tri-, and other multimer) particles exhibit long decay times and contribute more significantly to the overall light scattering intensity compared to small particles, e.g. a monomeric form of a MAB.
  • DLS allows picking up signals arising from small populations of protein oligomers among a highly concentrated monomeric form.
  • the light scattering arising from a monomeric protein is often lost in the strong contribution of aggregates. To prevent this effect, all protein solutions to be studied by DLS are thoroughly filtrated prior to analysis.
  • natalizumab (Tysabri); and the other - on the same antibodies after eight days of incubation at 37° C.
  • the antibodies Prior to conducting measurements, the antibodies were centrifuged at 12,000 rpm for 10 min. Measuremets with IN8 were conducted without antibody stock dilution, while IN9A and IN 10 stocks were diluted twofold with the antibody storage buffer solution. DLS measurements were carried out using a Zetasizer Nano ZS (Malvern Instruments Ltd, UK) system. The backscattered light from a 4 mW He-Ne 632.8 nM laser was collected at an angle of 173°. Protein concentration was between 0.3 andl mg/ml. Buffer conditions were as follows: PBS, PMSF and NaN3 (0.02%), pH 7.4. Prior to experiments solutions were passed through 0.1 ⁇ Whatman® Anotop® 10 syringe filter. Sample temperature was kept at 25.0°C. The acquisition time for a single
  • Circular dichroism refers to the difference in absorption of left and right circularly polarized light.
  • Each of the protein secondary structure types possesses its own characteristic CD spectrum.
  • the CD spectrum of protein under study is deconvoluted into components corresponding to the contributions from different secondary structure types. Since antibodies are characterized by very high content of ⁇ -pleated sheets, their CD spectra closely resemble those for pure ⁇ -strand structure.
  • Figure 9 shows far-UV CD data for antibodies IN8, IN9A and IN10, alongside with Tysabri, all formulated in PBS, pH 7.4. Protein concentration used was between 0.11 and 0.18 ⁇ . CD studies were carried out utilizing a J-810
  • spectropolarimeter (JASCO, Inc.), equipped with a Peltier-controlled cell holder.
  • the instrument was calibrated with an aqueous solution of d-10-camphorsulfonic acid.
  • the cell compartment was purged with nitrogen.
  • a quartz cell with a path length of 1 mm was used. Buffer contribution was subtracted from experimental spectra. Bandwidth was 2 nm, averaging time - 2 s, and
  • Trosabri is a registered trademark of Biogen Po Inc., a Delaware Corporation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des anticorps thérapeutiques qui peuvent être utilisés en vue du traitement ou de la prévention de maladies associées à la modulation de l'activité de l'intégrine alpha-4 humaine. Selon certains aspects, la présente invention est fondée sur la découverte d'anticorps capables de se lier à l'intégrine alpha-4 humaine. Les anticorps décrits se révèlent capables de bloquer les interactions entre l'intégrine alpha-4 et son VCAM-1. Les anticorps décrits peuvent être administrés à des êtres humains sans modification supplémentaire telle qu'une « humanisation ». Lesdits anticorps peuvent également être utilisés à des fins de diagnostic et de recherche. Les anticorps monoclonaux selon l'invention peuvent être utilisés afin de cibler la cascade de signalisation intégrine alpha-4/VCAM-1 dans le cadre de la mise au point de médicaments destinés à traiter les cancers et les affections immunologiques.
PCT/US2014/037325 2013-05-30 2014-05-08 Anticorps intégralement humains dirigés contre le récepteur qu'est l'intégrine alpha-4 humaine WO2014193625A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
USPCT/US13/43463 2013-05-30
US2013043463 2013-05-30

Publications (1)

Publication Number Publication Date
WO2014193625A1 true WO2014193625A1 (fr) 2014-12-04

Family

ID=51989313

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/037325 WO2014193625A1 (fr) 2013-05-30 2014-05-08 Anticorps intégralement humains dirigés contre le récepteur qu'est l'intégrine alpha-4 humaine

Country Status (1)

Country Link
WO (1) WO2014193625A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997018838A1 (fr) * 1995-11-21 1997-05-29 Athena Neurosciences, Inc. Utilisations therapeutiques d'anticorps humanises contre l'alpha-4 integrine
US5968826A (en) * 1998-10-05 1999-10-19 Isis Pharmaceuticals Inc. Antisense inhibition of integrin α4 expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997018838A1 (fr) * 1995-11-21 1997-05-29 Athena Neurosciences, Inc. Utilisations therapeutiques d'anticorps humanises contre l'alpha-4 integrine
US5968826A (en) * 1998-10-05 1999-10-19 Isis Pharmaceuticals Inc. Antisense inhibition of integrin α4 expression

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BONIG HALVARD ET AL.: "Increased numbers of circulating hematopoietic stem/progenitor cells are chronically maintained in patients treated with the CD 49d blocking antibody natalizumab.", BLOOD, vol. 111, no. 7, 1 April 2008 (2008-04-01), pages 3439 - 3441 *
SOILU-HANNINEN M. ET AL.: "Therapy with antibody against leukocyte integrin VLA-4 ( CD 49d) is effective and safe in virus-facilitated experimental allergic encephalomyelitis.", JOURNAL OF NEUROIMMUNOLOGY, vol. 72, 1997, pages 95 - 105, XP000993010, DOI: doi:10.1016/S0165-5728(96)00158-0 *
XIAO-DONG YANG ET AL.: "A predominant role of integrin a4 in the spontaneous development of autoimmune diabetes in nonobese diabetic mice.", IMMUNOLOGY, vol. 91, 1994, pages 12604 - 12608 *

Similar Documents

Publication Publication Date Title
RU2755503C2 (ru) Анти-lag-3 антитела и их композиции
CN110214153B (zh) 抗pd-1抗体及组合物
KR101931591B1 (ko) 항－ｉｌ－２３ 항체
CN114026125B (zh) Cldn18.2抗体及其用途
CN111094352A (zh) B7-h4抗体及其使用方法
KR101453462B1 (ko) Her2에 특이적으로 결합하는 항체
KR102478986B1 (ko) 암 치료용 항-ck8 항체
CN113906052B (zh) 一种抗ceacam5的单克隆抗体及其制备方法和用途
CN114685660A (zh) 抗cldn18.2抗体及其制备方法和应用
KR20160131073A (ko) Lg4-5에 대해 특이적인 항-라미닌4 항체
KR20160131082A (ko) Lg1-3에 특이적인 항-라미닌4 항체
CN106795223A (zh) 针对Fcγ受体IIB及Fcε受体的新型抗体
CN113121686A (zh) 抗pd-l1抗体及其应用
CN111548417B (zh) EGFRvIII和EGFR的双特异性人源抗体及其应用
CN101918549B (zh) 改良的人源化的抗-人α9-整联蛋白抗体
CN113135994A (zh) 一种激活型抗ox40抗体、生产方法及应用
CN111961135A (zh) 一种用于预防或治疗癌症的抗体
CN112574313B (zh) 抗cd73抗体及其用途
CN112851809A (zh) 一种抗终末糖基化蛋白受体的抗体及其应用
CN112175087B (zh) 一种抗CD4和TGFβ的双特异性抗体、其药物组合及其用途
TW202222838A (zh) 一種抗ceacam5的人源化抗體及其製備方法和用途
WO2014193625A1 (fr) Anticorps intégralement humains dirigés contre le récepteur qu'est l'intégrine alpha-4 humaine
KR20160022857A (ko) Her2에 특이적으로 결합하는 항체
WO2015174978A1 (fr) Anticorps anti-intégrine alpha -4 récepteur humain
KR20170012754A (ko) Egfr에 특이적으로 결합하는 항체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14803402

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14803402

Country of ref document: EP

Kind code of ref document: A1