WO2014157966A1 - 글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물 - Google Patents

글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물 Download PDF

Info

Publication number
WO2014157966A1
WO2014157966A1 PCT/KR2014/002619 KR2014002619W WO2014157966A1 WO 2014157966 A1 WO2014157966 A1 WO 2014157966A1 KR 2014002619 W KR2014002619 W KR 2014002619W WO 2014157966 A1 WO2014157966 A1 WO 2014157966A1
Authority
WO
WIPO (PCT)
Prior art keywords
formula
composition
compound represented
foxl2
pharmaceutically acceptable
Prior art date
Application number
PCT/KR2014/002619
Other languages
English (en)
French (fr)
Inventor
배지현
이강석
김재홍
Original Assignee
중앙대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 중앙대학교 산학협력단 filed Critical 중앙대학교 산학협력단
Priority to JP2016505403A priority Critical patent/JP5973108B2/ja
Priority to EP14772608.7A priority patent/EP2979696B1/en
Priority to US14/779,817 priority patent/US20160058738A1/en
Publication of WO2014157966A1 publication Critical patent/WO2014157966A1/ko

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/4261,3-Thiazoles
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/4035Isoindoles, e.g. phthalimide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention relates to a pharmaceutical composition and health functional food composition for the prevention or treatment of ovarian granulocytoma, and more specifically to the prevention or prevention of ovarian granuloma tumor comprising glycogen synthase kinase-3beta inhibitor as an active ingredient.
  • the present invention relates to a therapeutic pharmaceutical composition and nutraceutical composition.
  • GCT ovarian granule cell tumor
  • SCST malignant ovarian stromal tumor
  • ovarian granulocytoma is less than 5% of all ovarian cancers and 90% or more patients are diagnosed and treated before 20s, development of a composition effective for the prevention, improvement or treatment of ovarian granuloma tumors very important.
  • FOXL2 is known as a winged-helix / forkhead (FH) domain transcription factor, and various studies have been conducted on FOXL2.
  • FH winged-helix / forkhead
  • FOXL2 mRNA is expressed in ovarian cells and the gradual expression of FOXL2 mRNA, and FOXL2 mRNA is expressed in both immature and mature mouse ovaries from the developmental stage, and is particularly found in small or medium follicles. By confirming limited expression in granulosa cells, it was reported that FOXL2 is a factor regulating the growth of follicles.
  • the present invention is a group consisting of a compound represented by the formula (1), a pharmaceutically acceptable salt of the compound represented by the formula (1), a compound represented by the formula (2), and a pharmaceutically acceptable salt of the compound represented by the formula (2) It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of ovarian granulocytic tumors comprising an active ingredient selected from.
  • the present invention provides a compound represented by the formula (1), a pharmaceutically acceptable salt of the compound represented by the formula (1), a compound represented by the formula (2), and a pharmaceutically acceptable salt of the compound represented by the formula (2)
  • Another object of the present invention is to provide a nutraceutical composition for preventing or improving ovarian granulocytic tumors comprising an active ingredient selected from the group consisting of:
  • the present invention provides a compound represented by the following formula (1), a pharmaceutically acceptable salt of the compound represented by the formula (1), a compound described by the formula (2), and a pharmaceutically acceptable compound of the compound represented by the formula (2) It provides a pharmaceutical composition for the prophylaxis or treatment of ovarian granulocytic tumors comprising an active ingredient selected from the group consisting of salts.
  • the composition is characterized by inhibiting glycogen synthase kinase-3beta (Glycogen synthase kinase 3-beta; GSK3beta).
  • composition is characterized in that it inhibits the phosphorylation of serine (serine), the 33rd amino acid of the forkhead box L2 (FOXL2) protein.
  • the present invention provides a compound represented by the formula (1), a pharmaceutically acceptable salt of the compound represented by the formula (1), a compound represented by the formula (2), and a pharmaceutically acceptable salt of the compound represented by the formula (2) It provides a health functional food composition for the prevention or improvement of ovarian granulocytic tumors comprising an active ingredient selected from the group consisting of.
  • the composition is characterized by inhibiting glycogen synthase kinase-3beta (Glycogen synthase kinase 3-beta; GSK3beta).
  • composition is characterized in that it inhibits the phosphorylation of serine (serine), the 33rd amino acid of the forkhead box L2 (FOXL2) protein.
  • the composition according to the present invention is a compound of Formula 1, a pharmaceutically acceptable salt of a compound of Formula 1, a compound of Formula 2 below, and a pharmaceutically acceptable compound of Formula 2 Glycogen synthase kinase 3-beta (GSK3beta) is inhibited by including as an active ingredient selected from the group consisting of possible salts, thereby, the 33rd amino acid of FOXL2 (forkhead box L2) protein Has the effect of inhibiting the phosphorylation of serine (serine) can be usefully used as a composition for the prevention or treatment of ovarian granuloma tumor. In addition, it is expected that it can be usefully used as a nutraceutical composition.
  • GSK3beta Glycogen synthase kinase 3-beta
  • 1 is a diagram showing the results of nucleotide sequence conservation analysis of S33 residues between mammalian and non-mammalian FOXL2.
  • FIG. 2 shows the results of cloning the FOXL2 non-phosphorylated mutant S33A and the hyperphosphorylated mutant S33D mutant by using Western blotting.
  • 3 is a view showing the result of predicting the kinase involved in phosphorylation using GPS2.1 phosphoplot.
  • Figure 4 shows the results of Western blotting analysis for identifying kinases involved in phosphorylation of FOXL2 S33 residues.
  • 5 is a view showing the results of Western blotting analysis to confirm whether GSK3beta specifically involved in the phosphorylation of the residue FOXL2 S33.
  • Figure 6 is a view showing the results of Western blotting analysis for confirming the stable overexpression of FOXL2 and S33 specific GSK3beta effect.
  • FIG. 7 is a diagram showing the results of immunoprecipitation analysis for identifying binding domains of GSK3beta and FOXL2 proteins.
  • FIG. 8 is a view showing the results of Western blotting analysis to confirm the degree of S33 phosphorylation of FOXL2 C134W (GCT).
  • 9 is a graph showing the results of a direct phosphorylation test of FOXL2 C134W and S33 residues.
  • FIG. 10 is a diagram showing the results of immunoprecipitation analysis to confirm the degree of GSK3beta binding between the FOXL2 C134W mutation and WT.
  • FIG. 11 is a view showing the results of luciferase analysis and cell viability analysis for verifying GSK3beta inhibitory effect.
  • FIG. 12 is a diagram showing the results of protein stability experiments for verifying GSK3beta inhibitory effect.
  • Figure 13 is a diagram showing the results of cell growth rate experiments for verifying GSK3beta inhibitory effect.
  • the present invention relates to 3- (2,4-dichlorophenyl) -4- (1-methyl-1H-indol-3-yl) -1H-pyrrole-2,5-dione ⁇ 3- ( 2,4-Dichlorophenyl) -4- (1-methyl-1H-indol-3-yl) -1H-pyrrole-2,5-dione ⁇ , a pharmaceutically acceptable salt of the compound of Formula 1, N-[(4-methoxyphenyl) methyl] -N '-(5-nitro-thiazol-2-yl) urea described as 2 ⁇ N-[(4-Methoxyphenyl) Methyl] -N'-(5 -nitro-thiazol-2-yl) urea ⁇ , and a pharmaceutical for the prophylaxis or treatment of ovarian granuloma tumors comprising as an active ingredient selected from the group consisting of pharmaceutically acceptable salts of the compounds of formula (2) To provide a composition.
  • Each compound represented by Chemical Formula 1 and Chemical Formula 2 may be prepared by a known chemical synthesis method, or a commercial reagent may be purchased and used.
  • glycogen synthase kinase 3-beta specifically regulates the phosphorylation of FOXL2 S33 residues (see Example 4), Formula 1
  • GSK3beta glycogen synthase kinase 3-beta
  • phosphorylation of FOXL2 S33 residues was reduced (see Example 5)
  • cell growth rate of C134W mutant which was found in ovarian granuloma cells (GCT) was reduced ( Example 9)
  • the size of the tumor induced in ovarian granuloma cells is reduced (see Example 10).
  • the compound represented by Formula 1 or Formula 2 may be used in the form of a pharmaceutically acceptable salt, and the term “pharmaceutically acceptable salt” used in the present invention causes severe irritation to the organism to which the compound is administered. It means a form of a compound that does not impair the biological activity and physical properties of the compound.
  • Acid addition salts formed with pharmaceutically acceptable free acids are useful.
  • Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. Obtained from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids.
  • Such pharmaceutically nontoxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and iodide.
  • the acid addition salts according to the present invention are dissolved in conventional methods, for example, compounds of formula (1) or (2) in excess acid aqueous solution, and the salts are water miscible organic solvents, such as methanol, ethanol, acetone. Or by precipitation with acetonitrile. Equivalent amounts of the compounds of formula (1) or (2) and acids or alcohols in water may be heated and then the mixture is evaporated to dryness or the precipitated salts may be produced by suction filtration.
  • Bases can also be used to make pharmaceutically acceptable metal salts.
  • Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare sodium, potassium or calcium salt as the metal salt.
  • Corresponding silver salts are also obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).
  • prevention means any action that inhibits or delays the onset of ovarian granuloma by administration of the composition of the present invention.
  • treatment refers to any action in which symptoms caused by ovarian granuloma are improved or beneficially altered by administration of the composition of the present invention.
  • the pharmaceutical composition according to the present invention is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used.
  • Solid preparations for oral administration include tablets, patients, powders, granules, capsules, troches and the like, which solid preparations comprise at least one excipient such as starch, calcium carbonate, or the like represented by one or more compounds of the invention. And sucrose, sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions, or syrups, and include various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. Can be.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, and the like.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used.
  • compositions of the present invention can be administered orally or parenterally (eg, applied intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, and the dosage is based on the condition and weight of the patient, Depending on the drug form, route of administration, and time, it may be appropriately selected by those skilled in the art.
  • composition according to the invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level refers to the type, severity, and activity of the patient's disease. , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of the drug, and other factors well known in the medical arts.
  • the compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the effective amount of the compound according to the present invention may vary depending on the age, sex, and weight of the patient, and generally 0.001 to 150 mg, preferably 0.01 to 100 mg daily or every other day or 1 day per kg of body weight It can be administered in 1 to 3 times.
  • the dosage may be increased or decreased depending on the route of administration, the severity of obesity, sex, weight, age, etc., and the above dosage does not limit the scope of the present invention in any way.
  • the present invention provides a pharmaceutical composition of a compound represented by Formula 1, a pharmaceutically acceptable salt of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 2 It provides a health functional food composition for the prevention or improvement of ovarian granulocytic tumor comprising an active ingredient selected from the group consisting of acceptable salts. That is, the composition of the present invention may be used simultaneously or separately with a medicament for the treatment of tumors before or after the onset of ovarian granuloma for the prevention or improvement of ovarian granuloma.
  • the term “improvement” refers to any action that at least reduces the parameters associated with the condition being treated, such as the extent of symptoms.
  • the dietary supplement composition according to the present invention inhibits glycogen synthase kinase 3-beta (GSK3beta), and thus, the 33rd amino acid of FOXL2 (forkhead box L2) protein is serine (serine). Because it inhibits the phosphorylation of), it can be added to dietary supplements such as foods and beverages for the purpose of preventing or improving ovarian granuloma tumors.
  • GSK3beta glycogen synthase kinase 3-beta
  • Examples of foods to which the above-mentioned substances may be added include dairy products, various soups, drinks, meat, sausages, breads, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, Beverages, alcoholic beverages and vitamin complexes, dairy products and dairy products, and the like includes all the health functional foods in the conventional sense.
  • composition of the present invention may be added as it is to food or used with other food or food ingredients, and may be appropriately used according to conventional methods.
  • the mixing amount of the active ingredient can be suitably determined according to the purpose of use (prevention or improvement).
  • the compositions of the invention are added in an amount of up to 15% by weight, preferably up to 10% by weight relative to the raw materials.
  • the amount may be below the above range.
  • composition for health drinks of the present invention is not particularly limited to other ingredients except for containing the compound as essential ingredients in the indicated ratios, and may contain various flavors or natural carbohydrates as additional ingredients, such as ordinary drinks.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents such as, tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of the natural carbohydrate can be appropriately determined by the choice of those skilled in the art.
  • the composition for health functional food of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors such as flavoring agents, colorants and neutralizing agents (cheese, chocolate, etc.), pectic acid and salts thereof , Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like.
  • the composition of the present invention may contain fruit flesh for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives may also be appropriately selected by those skilled in the art.
  • KGN Human granulosa cells
  • constructs of FOXL2 WT wild type
  • S33D wild type
  • S33A wild type
  • C134W C134W
  • NP-40 Nonidet P-40
  • Bicinchoninic acid (BCA) TM protein assay was performed. Quantified protein was electrophoresed using SDS-PAGE method and transferred to PVDF (polyvinylidene fluoride) membrane and incubated with each antibody to be confirmed. Secondary antibodies were then identified using the ChemDoc machine.
  • Cells were sampled and lysed in NP-40 lysis buffer to quantify protein levels. Thereafter, the antibody of the specific protein to be precipitated and the normal IgG of the antibody which is a control group were independently cultured together with the proteinase agrose G which binds to the antibody. The cultured samples and beads were washed three times with NP-40 buffer, and the samples were loaded using Western blotting. Then, the bands were identified by antibodies of other proteins to see the binding.
  • the overexpressed samples were incubated with 50 ⁇ M of proteosome inhibitor MG132 and sampled with NP-40 buffer. Thereafter, the overexpressed protein was precipitated using immunoprecipitation, and the sample was loaded using western blotting to incubate with ubiquitine antibodies and SUMO antibodies, and the bands were identified by a chemdoc machine.
  • the band of the FOXL2 S33 residue was not identified, and the hyperphosphorylation mutation was confirmed by confirming the band darker than the wild type (WT).
  • glycogen synthase kinase-3 beta (Glycogen synthase kinase; GSK3beta) was confirmed to represent 9.75. Therefore, from the above results, it could be predicted that the kinase could be involved in phosphorylation of FOXL2 S33 residues.
  • GSK3beta inhibitor SB 216763
  • RSK inhibitor S0101
  • ERK inhibitor U0126
  • JNK inhibitor SP600125
  • AKT inhibitor LY 294002
  • the FOXL2 WT wild type was overexpressed in KGN cells, and then treated with 10 ⁇ M of each kinase inhibitor. After 18 hours of incubation, the cells were sampled and Western blotting was performed to measure phosphorylation change. At this time, the phosphorylation change was measured using an antibody that specifically binds to the peptide consisting of the amino acid of SEQ ID NO: 21, the results are shown in FIG.
  • AR-A014418 includes a compound represented by the formula (2).
  • KGN cells which are ovarian granule cells, were sampled and immunoprecipitation was used to confirm the binding of FOXL2 and GSK3beta proteins.
  • the binding of FOXL2 with a mutant mutant protein (1-94 aa, 1-218 aa, 218-376 aa deletion forkhead domina) was confirmed using immunoprecipitation. Is shown in FIG. 7.
  • FOXL2 and GSK3beta proteins directly bind to each other and could be confirmed to bind to the N-terminal domain.
  • Luciferase analysis and cell viability analysis of FOXL2 target genes TNFR1, FAS, Caspase 8 and p21 proteins were performed to verify the effects of GSK3beta inhibition that regulates phosphorylation of FOXL2.
  • luciferase assays were performed using 170 ng of pCMV-galactosidase plasmid DNA, 300 ng of TNFR1, FAS, Caspase 8, p21 of reporter DNA, FOXL2 or mutant protein plasmid in 6 wells of 4 ⁇ 10 5 cells per well. After transfection using Microporator MP-100, and cultured for 20 hours, the absorbance was measured using a PerferElmer 1420 counter using a Luciferase kit provided by Promega, and the results are shown in FIG. 11.
  • cell viability assay was performed after overexpressing plasmids expressing specific proteins as 2 ⁇ 10 4 KGN cells in 96 wells. Afterwards, cell viability was measured by a PerkinElmer 1420 counter using a CellTiterGlo cell viability kit provided by Promega, and the results are shown in FIG. 11.
  • 6-week-old mature male BALB / c-nu mice were purchased from Central Experimental Animal Co., Ltd. .
  • Five animals were housed in polycarbonate and freely supplied with solid feed and drink for laboratory animals. Temperature, humidity, ventilation frequency, lighting time, and illumination were induced constantly in the breeding laboratory environment.
  • Tumors were induced by subcutaneous injection of 3 ⁇ 10 7 mice into KGN cells stably expressing FOXL2. After 3 weeks of injection, GSK3beta inhibitor (AR-A014418) was directly injected into the tumor-induced portion 10 times for 2 weeks at 2 mg / kg, and the tumor size was measured. The results are shown in FIG. 14.
  • GSK3beta inhibitors can substantially inhibit tumor production of ovarian granule cells in vivo.
  • the GSK3beta inhibitor has an excellent effect on the prevention or treatment of ovarian granulocytoma.
  • composition according to the present invention inhibits glycogen synthase kinase 3-beta (GSK3beta) and has the effect of inhibiting phosphorylation of serine, the 33rd amino acid of the forkhead box L2 protein. It can be usefully used as a composition for preventing or treating ovarian granuloma.
  • GSK3beta glycogen synthase kinase 3-beta

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물, 또는 건강기능식품 조성물에 관한 것이다. 본 발명에 따른 조성물은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함함으로써, 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하고, 이로 인해, FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 효과를 가져 난소과립세포종양의 예방 또는 치료용 조성물로 유용하게 사용될 수 있다. 이에 더하여 건강기능식품 조성물로도 유용하게 사용될 수 있을 것으로 기대된다.

Description

글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물
본 발명은 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물에 관한 것으로서, 보다 구체적으로는 글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물에 관한 것이다.
20대 여성에게 잘 발병하는 질환 중 대표적인 것으로, 난소과립세포 종양(granulosa cell tumor; GCT)과 난포막 세포 종양(theca cell tumor)이 있다. 이 중 난소과립세포종양은 악성 난소 성기삭 간질성 종양(sexcord-stromal tumor, SCST)의 가장 흔한 유형으로서, 에스트로겐을 생산해서 초경정 질 출혈 전 월경 불순이나 폐경 후 질 출혈 등의 증상이 있으며, 과립막 세포 종양의 3/4이 병기에 속하며 종양의 성장 속도가 느리고 재발도 매우 늦어서 무병기간이 10년 이상이다.
치료에 있어서는 자궁절제술 또는 양측난관 난소 적출술 등과 같은 수술요법, 방사능 요법, 화학요법 등이 있으나, 수술요법은 출혈, 감염 등의 부작용이나 수술 후의 후유증 문제가 있고, 방사능 요법은 방사능 노출에 의한 심각한 부작용이 발생할 수 있으며, 화학요법은 그 효과가 아직 입증되지 못한 문제점이 있다. 난소과립세포종양은 전체 난소암의 5% 이하이나 20대 전에 진단 및 치료 시 90% 이상의 환자가 조기 치료의 가능성이 있기 때문에, 난소과립세포종양의 예방, 개선 또는 치료에 효과적인 조성물에 대한 개발은 매우 중요하다.
한편, FOXL2는 winged-helix/forkhead (FH) 도메인 전사인자로서 알려져 있으며, 현재 FOXL2에 대한 다양한 연구가 이루어지고 있다. 즉, 2010년 유럽 분자생물 연구소에서 주도한 연구결과, 저명한 학술지인 Cell에 발표한 연구논문에서는 성별이 오로지 XY 염색체에 의해 결정된다는 과학적 사실을 뒤엎은 연구 결과를 보고 하였다. 연구진은 female mouse의 FOXL2 유전자를 Knock-out한 마우스의 female의 난소가 고환과 같은 구조를 가진 조직으로 변하며 남성 호르몬인 테스토스테론을 분비하는 결과를 확인하였고, 이러한 과정에서 특히 난소에서 존재하는 난소과립세포가 서서히 정자의 성숙에 관여하는 세토리(setori cell)로 변화하는 것을 확인하였다.
또한, FOXL2가 난소의 어느 세포에 발현하는지와 함께 그 발현의 단계별 추이를 살펴본 결과, FOXL2 mRNA는 발생단계부터 미성숙과 성숙한 생쥐의 난소에서 모두 발현하며 특히 작거나 중간 크기의 난포에 존재하는 미분화된 과립세포(granulosa cell)에 한정적으로 발현하는 것을 확인함으로써, FOXL2가 난포의 성장을 조절하는 인자임을 보고하였다.
더욱이, 난소과립종양세포(GCT)의 발병과 관련하여, 2009년도 6월 New England Journal of Medicine 지에 발표된 연구 결과에 의하면, whole-transcriptome paired-end RNA sequencing을 통하여 97%의 adult-type GCT 환자에게서 FOXL2라는 유전자에 point mutation(402C->G)이 있음이 보고되었다. 이를 통해, FOXL2의 단일, 재발성 체세포 돌연변이 (402C->G)가 성인형 GCT의 발병기전에서 잠재적 조정자로 판단될 수 있다는 것이 보고되었다(미국공개특허 US2011/0195070 참조).
본 발명자들은 FOXL2 단백질의 번역 후 변형(posttranslational modification) 분석을 통해, FOXL2 세린(serine) 33 잔기의 인산화를 확인함과 동시에, C134W돌연변이를 과발현 할 경우에도, S33 잔기 인산화정도가 WT(wild type) 보다 더 인산화되어 있는 것을 확인하였으며, GSK3beta가 특이적으로 FOXL2 S33 잔기의 인산화에 관여된다는 것을 발견하여, GSK3beta 억제물질이 난소과립세포종양을 예방, 치료 또는 개선하기 위해 유용하게 사용될 수 있음을 알아내고, 이에 기초하여 본 발명을 완성하게 되었다.
본 발명은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물을 제공하는 것을 그 목적으로 한다.
또한, 본 발명은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 개선용 건강기능식품 조성물을 제공하는 것을 또 다른 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은 하기의 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물을 제공한다.
[화학식 1]
Figure PCTKR2014002619-appb-I000001
[화학식 2]
Figure PCTKR2014002619-appb-I000002
본 발명의 일 구현예로, 상기 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하는 것을 특징으로 한다.
본 발명의 다른 구현예로, 상기 조성물은 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 것을 특징으로 한다.
또한, 본 발명은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명의 일 구현예로, 상기 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하는 것을 특징으로 한다.
본 발명의 다른 구현예로, 상기 조성물은 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 것을 특징으로 한다.
본 발명에 따른 조성물은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함함으로써, 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하고, 이로 인해, FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 효과를 가져 난소과립세포종양의 예방 또는 치료용 조성물로 유용하게 사용될 수 있다. 이에 더하여 건강기능식품 조성물로도 유용하게 사용될 수 있을 것으로 기대된다.
도 1은 FOXL2의 비포유류와 포유류 간의 S33 잔기의 염기서열 보전 분석 결과를 나타낸 도면이다.
도 2는 FOXL2 비인산화 돌연변이인 S33A와 과인산화돌연변이인 S33D 돌연변이를 클로닝 하여 웨스턴 블로팅 방법을 사용하여 각각의 인산화 정도를 확인한 결과를 나타낸 도면이다.
도 3은 GPS2.1 phosphoplot을 이용하여 인산화에 관여하는 Kinase를 예측한 결과를 나타낸 도면이다.
도 4는 FOXL2 S33 잔기의 인산화에 관여하는 키나아제 확인을 위한 웨스턴 블로팅 분석 결과를 나타낸 도면이다.
도 5는 GSK3beta가 특이적으로 FOXL2 S33잔기의 인산화에 관여하는지에 대한 확인을 위한 웨스턴 블로팅 분석 결과를 나타낸 도면이다.
도 6은 FOXL2의 안정적 과발현 및 S33 특이적 GSK3beta 효과 확인을 위한 웨스턴 블로팅 분석 결과를 나타낸 도면이다.
도 7은 GSK3beta와 FOXL2 단백질의 결합 도메인 확인을 위한 면역침전법 분석 결과를 나타낸 도면이다.
도 8은 FOXL2 C134W(GCT)의 S33 인산화정도의 확인을 위한 웨스턴 블로팅 분석 결과를 나타낸 도면이다.
도 9는 FOXL2 C134W와 S33 잔기의 직접적 인산화 관련성 확인 실험 결과를 나타낸 도면이다.
도 10은 FOXL2 C134W 돌연변이와 WT 간의 GSK3beta 결합정도 확인을 위한 면역 침전법 분석 결과를 나타낸 도면이다.
도 11은 GSK3beta 억제 효과 검증을 위한 루시퍼레이즈 분석 및 세포생존율 분석 결과를 나타낸 도면이다.
도 12는 GSK3beta 억제 효과 검증을 위한 단백질 안정도 실험 결과를 나타낸 도면이다.
도 13은 GSK3beta 억제 효과 검증을 위한 세포성장율 실험 결과를 나타낸 도면이다.
도 14는 난소과립종양세포에 대한 GSK3beta 억제물질의 효능 검증 결과를 나타낸 도면이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 하기 화학식 1로 기재되는 3-(2,4-디클로로페닐)-4-(1-메틸-1H-인돌-3-일)-1H-피롤-2,5-다이온{3-(2,4-Dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione}, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 화학식 2로 기재되는 N-[(4-메톡시페닐)메틸]-N'-(5-니트로-티아졸-2-일)우레아{N-[(4-Methoxyphenyl)Methyl]-N'-(5-nitro-thiazol-2-yl)urea}, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물을 제공한다.
[화학식 1]
Figure PCTKR2014002619-appb-I000003
[화학식 2]
Figure PCTKR2014002619-appb-I000004
상기 화학식 1 및 화학식 2로 기재되는 각 화합물은 공지된 화학적인 합성 방법으로 제조하거나, 시판되는 시약을 구입하여 사용할 수 있다.
본 발명의 일실시예에 따르면, 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)가 특이적으로 FOXL2 S33 잔기의 인산화를 조절한다는 것을 확인하였고(실시예 4 참조), 화학식 1 또는 화학식 2로 기재되는 화합물을 사용하여 GSK3beta를 억제할 경우, FOXL2 S33 잔기의 인산화가 줄어들고(실시예 5 참조), 난소과립종양세포(GCT)에서 많이 발견되어진 C134W돌연변이의 세포 성장율이 감소하였으며(실시예 9 참조), 난소과립종양세포에서 유도되어진 종양의 크기가 줄어드는 것을 확인하였다(실시예 10 참조).
또한, 상기 화학식 1 또는 화학식 2로 기재되는 화합물은 약학적으로 허용가능한 염의 형태로 사용할 수 있으며, 본 발명에서 사용되는 용어 "약학적으로 허용가능한 염"은 화합물이 투여되는 유기체에 심각한 자극을 유발하지 않고 화합물의 생물학적 활성과 물성들을 손상시키지 않는 화합물의 형태를 의미한다.
약학적으로 허용가능한 염으로는 약학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, 베타-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함하지만 이에 제한되지는 않는다.
본 발명에 따른 산 부가염은 통상의 방법, 예를 들면, 화학식 1 또는 화학식 2로 기재되는 화합물을 과량의 산 수용액 중에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들면 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 동량의 화학식 1 또는 화학식 2로 기재되는 화합물 및 물 중의 산 또는 알코올을 가열하고, 이어서 이 혼합물을 증발시켜서 건조시키거나 또는 석출된 염을 흡입 여과시켜 제조할 수도 있다.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염(예, 질산은)과 반응시켜 얻는다.
본 발명에서 사용되는 용어, "예방"이란 본 발명의 조성물의 투여에 의해 난소과립세포종양을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서 사용되는 용어, "치료"란 본 발명의 조성물의 투여에 의해 난소과립세포종양에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에 따른 상기 약학적 조성물을 제제화할 경우, 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 제조된다.
경구투여를 위한 고형 제제에는 정제, 환자, 산제, 과립제, 캡슐제, 트로키제 등이 포함되며, 이러한 고형 제제는 하나 이상의 본 발명으로 표시되는 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로스(sucrose) 또는 락토오스(lactose) 또는 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁용제, 유제, 동결건조제제, 좌제 등이 포함된다.
비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명에 따른 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로, 본 발명에 따른 화합물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1kg 당 0.001 내지 150 mg, 바람직하게는 0.01 내지 100 mg을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
다른 하나의 양태로서, 본 발명은 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 개선용 건강기능식품 조성물을 제공한다. 즉, 본 발명의 조성물은 난소과립세포종양의 예방 또는 개선을 위하여 난소과립세포종양의 발병 단계 이전 또는 발병 후, 종양의 치료를 위한 약제와 동시에 또는 별개로서 사용될 수 있다.
본 발명에서 사용되는 용어 "개선"이란 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미한다.
본 발명에 따른 상기 건강기능식품용 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하여, 이로 인해, FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하므로, 난소과립세포종양의 예방 또는 개선을 목적으로 식품, 음료 등의 건강보조 식품에 첨가할 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 드링크제, 육류, 소시지, 빵, 비스킷, 떡, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 알코올 음료 및 비타민 복합제, 유제품 및 유가공 제품 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
본 발명의 조성물은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합량은 그의 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 본 발명의 조성물은 원료에 대하여 15 중량% 이하, 바람직하게는 10 중량% 이하의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다.
본 발명의 건강음료용 조성물은 지시된 비율로 필수 성분으로서 상기 화합물을 함유하는 외에는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 당업자의 선택에 의해 적절하게 결정될 수 있다.
상기 외에 본 발명의 건강기능식품용 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율 또한 당업자에 의해 적절히 선택될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 실험준비
1-1. FOXL2 돌연변이 클로닝
다양한 FOXL2 돌연변이 형을 클로닝하기 위하여 하기의 표 1에 기재된 프라이머를 이용하여 재조합 PCR을 수행한 후, 증폭된 PCR 산물을 EcoRl과 Xhol 제한효소를 사용하여 pCMV-Myc 벡터에 ligation 과정을 거쳐 이콜라이에 형질전환 하였다. 한편, FOXL2 C134W+S33A 돌연변이는 C134W 돌연변이를 주형으로 S33A 정방향 및 역방향 프라이머를 사용하여 클로닝 하였다.
표 1
돌연 변이형 Forward primer(5'→3') Reverse primer(5'→3')
FOXL2 서열번호 1 CTAGAATTCAAATGATGGCCAGCTACCCC 서열번호 2 CTACTCGAGTCAGAGATCGAGGCGCGAATG
S33A 서열번호 3 CCGGCCCCAGGCAAGGGCGGTGGGGGT 서열번호 4 ACCCCCACCGCCCTTGCCTGGGGCCGG
S33D 서열번호 5 CCGCCGGATCCAGGCAAGGGCGGT 서열번호 6 ACCGCCCTTGCCTGGATCCGGCGG
S263A 서열번호 7 CAGGCCATGGCGCTGCCCCCCGGC 서열번호 8 GCCGGGGGGCAGCGCCATGGCCTG
K25R 서열번호 9 GGTCGCACAGTCAGAGAGCCAGAA 서열번호 10 TTCTGGCTCTCTGACTGTGCGACC
K36R 서열번호 11 CCAGGCAGAGGCGGTGGGGGTGGC 서열번호 12 GCCACCCCCACCGCCTCTGCCTGG
K48R 서열번호 13 GCCCCGGAGAGACCGGACCCG 서열번호 14 CGGGTCCGGTCTCTCCGGGGC
K54R 서열번호 15 CCGGACCCGGCGCAGAGACCC 서열번호 16 GGGTCTCTGCGCCGGGTCCGG
K87R 서열번호 17 ATCATCGCGAGATTCCCGTTC 서열번호 18 GAACGGGAATCTCGCGATGAT
C134W 서열번호 19 GCCTGGGAAGACATGTTCGA 서열번호 20 ATGTCTTCCCAGGCCGGGTC
1-2. 세포 배양
본 실시예의 실험을 위해서 Human granulosa 세포 (KGN)를 10% FBS와 1% 페니실린-스트렙토마이신(penicillin-streptomycin)이 함유된 DMEM/F12 media에 배양하였다. KGN 세포는 Yosihiro Nishi와 Toshihiko Yanase로부터 제공받았다.
1-3. 세포주(cell line) 제작
FOXL2가 안정적으로 세포에서 발현하는 클론을 제작하기 위해, pcDNA6 플라스미드에 FOXL2 WT(wild type), S33D, S33A, C134W의 컨스트럭을 EcoRI, XhoI의 제한효소를 이용하여 클로닝 하였다. 이후 1×107의 KGN 세포에 10μg의 DNA를 트랜스펙션(transfection) 한 후 3~4주간 블라스티사이딘(blasticidin)으로 선별하였다.
1-4. 세포 내 단백질 과발현을 위한 트랜스펙션
세포에서 플라스미드를 도입 단백질을 과발현하기 위해서 KGN 세포 1×106 당 3μg의 도입하고자 하는 플라스미드를 도입하였고, 이러한 도입을 하기 위해서 Invitro transfection Transfection kit인 Neon electro transfection kit를 형질 도입하였다.
실시예 2. 실험방법
2-1. 웨스턴 블로팅
배양 세포를 수거하여 NP-40(Nonidet P-40) 용액을 이용 세포에서 단백질을 추출하였다. 추출되어진 단백질의 정량을 위해서 Bicinchoninic acid(BCA)TM protein assay를 실시하였다. 정량되어진 단백질을 SDS-PAGE 방법을 이용 전기영동하여 PVDF(polyvinylidene fluoride) membrane에 transfer 하여 확인하고자 하는 각각의 항체를 이용하여 배양하였다. 이후 2차 항체를 이용 ChemDoc 기계를 이용하여 확인하였다.
2-2. 면역 침전법
세포를 샘플링 하여 NP-40 lysis 버퍼에 lysis 한 후 단백질 양을 정량하였다. 이후 침전 시키고자 하는 특정 단백질의 항체와 그 대조군인 항체의 normal IgG를 독립적으로 배양하여 항체와 결합하는 proteinase agrose G와 같이 배양하였다. 배양 되어진 샘플과 비드를 NP-40 버퍼로 3번 세척(washing)하고 웨스턴 블로팅 방법을 이용하여 샘플을 로딩한 후, 결합을 보고자 하는 다른 단백질의 항체로 밴드를 확인하였다.
2-3 유비퀴틴화 및 수모화 분석(Ubiqutination and SUMOrylation)
과발현 되어진 샘플을 프로테오좀 억제제인 MG132를 50μM으로 처리하여 배양한 후 NP-40 버퍼로 단백질을 샘플링 하였다. 이후 면역 침전법을 사용하여 과발현 한 단백질을 침전 한 다음 웨스턴 블로팅 방법을 사용하여 샘플을 로딩하여 유비퀴틴(Ubiqutine) 안티바디와 SUMO 안티바디로 배양 후 chemdoc 기계로 밴드를 확인하였다.
2-4 통계학적 분석
각 실험 시 triplicate로 3회 반복 실시하여 평균값 및 표준 오차를 계산하였다. 각 실험에서 통계학적 분석은 SAS statistical software(SAS Enterprise Guide, USA)를 이용하여 Student's t-test를 통해 분석하였으며, p<0.05일 때 유의성이 있는 것으로 해석하였다.
실시예 3. FOXL2 단백질의 인산화 분석
액체 크로마토그래피(liquid chromatography)를 이용하여 FOXL2 단백질의 번역 후 변형(posttranslational modification)을 분석한 결과, FOXL2의 33번째 아니노산인 세린(serine)의 인산화를 확인할 수 있었다.
또한, FOXL2 세린 33(S33) 잔기의 진화에서의 중요성을 확인하기 위해, FOXL2 종 간의 염기서열 계열분석을 수행하였으며, 그 결과를 도 1에 나타내었다.
도 1에 나타낸 바와 같이, 포유류에서 세린 33 잔기가 보전적으로 위치하는 것을 확인할 수 있었다.
한편, FOXL2 S33 잔기의 인산화에 관련되어진 실험을 진행하기 위해서 FOXL2 비인산화 돌연변이인 S33A 와 과인산화돌연변이인 S33D 돌연변이를 클로닝 하여 각각의 인산화 정도를 웨스턴 블로팅 방법을 사용하여 측정하였으며, 그 결과를 도 2에 나타내었다.
도 2에 나타낸 바와 같이, 비인산화돌연변이에서는 FOXL2 S33 잔기의 밴드가 확인되지 않았으며 과인산화 돌연변이는 WT(wild type) 보다 더 진한 밴드를 확인함으로서 과인산화를 확인할 수 있었다.
실시예 4. FOXL2 S33 잔기의 인산화에 관여하는 키나아제 예측 및 확인
4-1. FOXL2 S33 잔기의 인산화에 관여하는 키나아제 예측
실시예 3을 통해 포유류에서 보존적으로 존재하는 것을 확인한 FOXL2 S33 잔기의 인산화에 관여하는 키나아제(kinase)를 분석하기 위해서 예측 프로그램인 GPS2.1 phosphoplot을 이용하여 인산화에 관여하는 Kinase를 예측하였고, 그 결과를 도 3에 나타내었다.
도 3에 나타낸 바와 같이, 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase; GSK3beta)는 9.75를 나타냄을 확인할 수 있었다. 따라서 상기 결과로부터, 상기 키나아제가 FOXL2 S33 잔기의 인산화에 관여할 수 있음을 예측할 수 있었다.
4-2. FOXL2 S33 잔기의 인산화에 관여하는 키나아제 확인
먼저, 실시예 4-1에 의해 예측된 키나아제와 인산화에 관여되어지는 것으로 알려진 또 다른 키나아제의 억제제(inhibitor)를 구입하여 준비하였다. 보다 구체적으로, GSK3beta inhibitor (SB 216763), RSK inhibitor (SL0101), ERK inhibitor (U0126), JNK inhibitor (SP600125) 및 AKT inhibitor (LY 294002)를 준비하였고, 이 때, GSK3beta inhibitor인 SB 216763은 화학식 1로 기재되는 화합물을 포함한다.
[화학식 1]
Figure PCTKR2014002619-appb-I000005
FOXL2 WT(wild type)이 KGN 세포에서 과발현 되어 있는 상태에서 각각의 키나아제 억제제 10μM을 사용하여 세포처리하고, 18시간 배양 후 세포를 샘플링 하여 웨스턴 블로팅 방법을 수행하여 인산화 변화를 측정하였다. 이때, 서열번호 21의 아미노산으로 이루어진 펩타이드에 특이적으로 결합하는 항체를 사용하여 인산화 변화를 측정하였고, 그 결과를 도 4에 나타내었다.
도 4에 나타낸 바와 같이, GSK3beta 억제제를 처리하였을 때 FOXL2 S33 잔기의 인산화가 줄어드는 것을 확인할 수 있었다. 따라서 상기 결과로부터, GSK3beta가 FOXL2 S33 잔기의 인산화에 관여함을 알 수 있었다.
실시예 5. FOXL2의 S33잔기의 인산화를 특이적으로 조절하는 GSK3beta 역할 확인
GSK3beta에 의한 FOXL2 S33 잔기의 억제 효과가 GSK3beta 특이적인 효과인지를 확인하기 위해서 다른 GSK3beta 억제제인 AR-A014418과 TWS1119의 억제제 10μM를 FOXL2 WT이 과발현 되어진 세포에 처리하고, 세포를 샘플링 하여 웨스턴 블로팅 방법을 수행하였다. 이 때, AR-A014418은 화학식 2로 기재되는 화합물을 포함한다.
[화학식 2]
Figure PCTKR2014002619-appb-I000006
더욱이, GSK3beta 특이적인 siRNA를 처리하여 GSK3beta가 녹다운(knock-down) 되었을 때 FOXL2 S33 잔기의 인산화 변화를 웨스턴 블로팅 방법을 사용하여 확인하였고, 그 결과를 도 5에 나타내었다.
도 5에 나타낸 바와 같이, GSK3beta 억제제를 사용하였을 경우에 FOXL2 S33 잔기의 인산화가 줄어드는 것을 확인할 수 있었다.
추가적으로, FOXL2의 S33잔기의 인산화를 조절하는 GSK3beta의 효과를 확인하기 위해서, 인간난소과립세포중의 하나인 KGN 세포에 FOXL2가 안정적으로 과발현 하는 세포를 제작하였다. FOXL2 WT, S33D, S33A 와 C134W가 안정적으로 발현하는 세포에 GSK3beta 10nM을 처리하여 FOXL2의 인산화정도를 웨스턴 블로팅 방법을 이용하여 측정하였고, 그 결과를 도 6에 나타내었다.
도 6에 나타낸 바와 같이, FOXL2의 안정적발현 세포라인에서도 GSK3beta가 FOXL2 S33 잔기의 인산화를 조절하는 것을 확인할 수 있었다.
따라서 상기 결과로부터 GSK3beta가 특이적으로 FOXL2 S33 잔기를 인산화 함을 알 수 있었다.
실시예 6. GSK3beta와 FOXL2 단백질의 결합 도메인 확인
인산화를 위해서 GSK3beta가 FOXL2에 직접적으로 결합하는지를 확인하기 위하여 난소과립세포인 KGN 세포를 샘플링 하고, 면역침전법을 사용하여 FOXL2와 GSK3beta 단백질의 결합을 확인 하였다. 또한, 두 단백질의 결합 도메인을 확인하기 위해서 FOXL2의 결손 돌연변이 단백질(1-94 a.a, 1-218 a.a, 218-376 a.a. deletion forkhead domina)과의 결합을 면역침전법을 사용하여 확인하였고, 그 결과를 도 7에 나타내었다.
도 7에 나타낸 바와 같이, FOXL2와 GSK3beta 단백질이 직접적으로 결합하며, 도메인중 N-terminal 도메인과 결합함을 확인할 수 있었다.
실시예 7. 난소과립종양세포(GCT)에서 인산화 정도 확인
FOXL2의 S33 잔기의 인산화에 따른 FOXL2에 의해서 유발되어지는 질병과의 관계를 알아보기 위해서 하기와 같이 실험을 수행하였다.
즉, 실시예 1에 의해 제작된 FOXL2의 돌연변이들을 과발현하고, FOXL2 S33 잔기의 인산화 정도를 웨스턴 블로팅 방법을 사용하여 확인하였고, 그 결과를 도 8에 나타내었다.
도 8에 나타낸 바와 같이, 최근 97%의 GCT환자에게서 발견되어진 것으로 보고된 C134W돌연변이를 과발현 할 경우에, S33 잔기 인산화정도가 WT(wild type) 보다 더 인산화되어 있는 것을 확인할 수 있었다.
추가적으로, FOXL2 C134W 돌연변이와 S33 잔기의 인산화 관계를 알아보기 위해, 실시예 2-3의 방법을 통해 유비퀴틴화 및 수모화 양상을 확인하였고, 그 결과를 도 9에 나타내었다.
도 9에 나타낸 바와 같이, FOXL2 C134W 돌연변이가 유비퀴틴화가 증가하고 수모화가 감소하는 것을 확인할 수 있었다. 단, C134W에 S33A 돌연변이가 있는 샘플에서는 그러한 변화를 확인하지 못하였다.
상기 결과로부터, FOXL2 C134W 돌연변이의 과-인산화는 S33잔기와 직접적으로 관련이 있다는 것을 알 수 있었다.
실시예 8. FOXL2 C134W 돌연변이와 WT 간의 GSK3beta 결합정도 확인
GCT 유발 돌연변이인 FOXL2 C134W 단백질과 GSK3beta와의 관계를 확인하기 위하여, 면역침전법을 사용하여 FOXL2 C134W 돌연변이와 WT 간의 GSK3beta 결합정도를 확인하였고, 그 결과를 도 10에 나타내었다.
도 10에 나타낸 바와 같이, WT 보다 C134W 돌변변이가 더 많이 GSK3beta 와 결합하는 것을 확인할 수 있었다.
실시예 9. GSK3beta 억제 효과 검증
9-1. 루시퍼레이즈 분석 및 세포생존율 분석
FOXL2의 인산화를 조절하는 GSK3beta의 억제에 따른 효과를 검증하기 위하여 FOXL2 타켓 유전자인 TNFR1, FAS, Caspase 8 및 p21 단백질의 루시퍼레이즈 분석 및 세포생존율 분석을 수행하였다.
보다 구체적으로, 루시퍼레이즈 분석은 KGN을 6 well에 well 당 4×105의 세포에 170ng의 pCMV-galactosidase 플라스미드 DNA, 300ng의 TNFR1, FAS, Caspase 8, p21의 리포터 DNA, FOXL2 또는 돌연변이 단백질 플라스미드를 Microporator MP-100을 이용 트랜스펙션(transfection)하고, 20시간 배양 후, 프로메가에서 제공하는 Luciferase 키트를 사용하여 흡광도를 PerkinElmer 1420 카운터로 측정하였고, 그 결과를 도 11에 나타내었다.
또한, 세포 생존율 분석은, KGN 세포를 96 well에 2×104개로 특정 단백질을 발현하는 플라스미드를 과발현 후 배양하였다. 이후 프로메가에서 제공하는 CellTiterGlo cell viability 키트를 사용하여 PerkinElmer 1420 카운터로 세포생존율을 측정하였고, 그 결과를 도 11에 나타내었다.
도 11에 나타낸 바와 같이, GSK3beta가 저해되거나 없을 때, FOXL2의 인산화가 저해되고, 이로 인해 TNFR1, FAS, Caspase8, p21(발현도가 높을 때 세포 생존율을 감소시켜 cell death을 증가 시킨다) 프로모터가 활성화됨으로써, 세포생존율이 감소함을 확인할 수 있었다.
9-2. 단백질 안정도 실험
특정 프로모터 TNFR1, FAS, Caspase8, p21의 활성을 유도하여 세포생존율을 감소시키는 효과가 FOXL2의 S33 잔기 인산화에 따라 FOXL2 단백질 안정도를 조절하여 유도하는지 확인하기 위해서, FOXL2 단백질이 과발현되어진 세포에 GSK3beta 억제제(SB 216763)를 처리하고 발현 후 단백질 합성 억제제인 Cyclohexamide를 10μg 처리하여 0, 6, 12, 24 시간 단위로 샘플링 하여 웨스턴 블로팅을 수행하였고, 그 결과를 도 12에 나타내었다.
도 12에 나타낸 바와 같이, GSK3beta 가 억제될 때 단백질의 안정도가 증가함을 확인할 수 있었다.
9-3. 세포성장율 실험
FOXL2 단백질이 과발현되어진 세포에 GSK3beta 억제제(AR-A014418)를 처리한 후, 시간에 따른 세포성장율을 측정하였고, 그 결과를 도 13에 나타내었다.
도 13에 나타낸 바와 같이, GSK3beta 가 저해되거나 없을 때 FOXL2의 인산화가 저해되어 세포성장율이 감소하는 것을 확인할 수 있었고, 특히 GCT에서 많이 발견되어진 C134W돌연변이의 세포성장율이 확연히 감소하는 것을 확인할 수 있었다.
실시예 10. 난소과립종양세포에 대한 GSK3beta 억제물질의 효능 검증
난소과립세포종양에서의 GSK3beta 억제물질의 효능을 검증하기 위해 하기와 같이 실험을 수행하였다.
6주령의 성숙한 수컷 BALB/c-nu 마우스를 (주)중앙실험동물로부터 구입하여 중앙대학교 실험동물 연구지원센터 내에서 1주일간 사육실 및 실험실 환경에 적응시켜 일반증상이 없음을 확인하고 실험에 사용하였다. 5마리를 polycarbonate 수용하고, 실험동물용 고형사료와 음료수를 자유롭게 공급하였다. 사육실험실 환경으로 온도, 습도, 환기횟수, 조명시간, 조도를 일정하게 유도하였으며, 모든 실험은 중앙대학교 동물실험윤리위원회 규정에 입각하여 실시하였다.
FOXL2가 안정적으로 발현하는 KGN 세포를 마우스에 3×107 씩 피하주사를 하여 종양을 유도하였다. 인젝션 3주 후 GSK3beta억제제(AR-A014418)를 종양이 유도된 부분에 직접 2mg/kg 단위로 2주 동안 10회 주사하여 종양의 크기를 측정하였고, 그 결과를 도 14에 나타내었다.
도 14에 나타낸 바와 같이, 난소과립종양세포에서 유도되어진 종양의 크기가 GSK3beta 억제제를 투여한 그룹에서 확연히 줄어드는 것을 확인할 수 있었다.
또한, 실질적으로 in vivo에서 GSK3beta 억제물질이 난소과립세포의 종양 생성을 억제할 수 있다는 것을 누드마우스 모델로 확인하였다.
상기 결과로부터, GSK3beta 억제물질은 난소과립세포종양의 예방 또는 치료에 우수한 효과가 있음을 알 수 있었다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따른 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하여 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 효과를 가져 난소과립세포종양의 예방 또는 치료용 조성물로 유용하게 사용될 수 있다.

Claims (12)

  1. 하기의 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는, 난소과립세포종양의 예방 또는 치료용 약학적 조성물.
    [화학식 1]
    Figure PCTKR2014002619-appb-I000007
    [화학식 2]
    Figure PCTKR2014002619-appb-I000008
  2. 제1항에 있어서,
    상기 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하는 것을 특징으로 하는, 약학적 조성물.
  3. 제1항 또는 제2항에 있어서,
    상기 조성물은 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 것을 특징으로 하는, 약학적 조성물.
  4. 하기의 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 것을 유효성분으로 포함하는, 난소과립세포종양의 예방 또는 개선용 건강기능식품 조성물.
    [화학식 1]
    Figure PCTKR2014002619-appb-I000009
    [화학식 2]
    Figure PCTKR2014002619-appb-I000010
  5. 제4항에 있어서,
    상기 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하는 것을 특징으로 하는, 건강기능식품 조성물.
  6. 제4항 또는 제5항에 있어서,
    상기 조성물은 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 것을 특징으로 하는, 건강기능식품 조성물.
  7. 하기의 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 화합물을 포함하는 조성물을 개체에 투여하는 단계를 포함하는 난소과립세포종양의 치료방법.
    [화학식 1]
    Figure PCTKR2014002619-appb-I000011
    [화학식 2]
    Figure PCTKR2014002619-appb-I000012
  8. 제7항에 있어서,
    상기 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하는 것을 특징으로 하는, 방법.
  9. 제7항 또는 제8항에 있어서,
    상기 조성물은 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 것을 특징으로 하는, 방법.
  10. 하기의 화학식 1로 기재되는 화합물, 상기 화학식 1로 기재되는 화합물의 약학적으로 허용 가능한 염, 하기의 화학식 2로 기재되는 화합물, 및 상기 화학식 2로 기재되는 화합물의 약학적으로 허용 가능한 염으로 이루어진 군으로부터 선택되는 화합물을 포함하는 조성물의 난소과립세포종양을 예방 또는 치료에의 사용.
    [화학식 1]
    Figure PCTKR2014002619-appb-I000013
    [화학식 2]
    Figure PCTKR2014002619-appb-I000014
  11. 제10항에 있어서,
    상기 조성물은 글리코겐 신타아제 키나아제-3베타(Glycogen synthase kinase 3-beta; GSK3beta)를 억제하는 것을 특징으로 하는, 사용.
  12. 제10항 또는 제11항에 있어서,
    상기 조성물은 FOXL2(forkhead box L2) 단백질의 33번째 아미노산인 세린(serine)의 인산화를 억제하는 것을 특징으로 하는, 사용.
PCT/KR2014/002619 2013-03-29 2014-03-27 글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물 WO2014157966A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2016505403A JP5973108B2 (ja) 2013-03-29 2014-03-27 グリコーゲンシンターゼキナーゼ3β抑制物質を有効成分として含む卵巣顆粒細胞腫瘍の予防または治療用の薬学的組成物および健康機能性食品の組成物
EP14772608.7A EP2979696B1 (en) 2013-03-29 2014-03-27 Pharmaceutical composition for preventing or treating ovary granulosa cell tumors containing glycogen synthase kinase-3 beta inhibitor as active ingredient, and functional health food composition
US14/779,817 US20160058738A1 (en) 2013-03-29 2014-03-27 Pharmaceutical composition for preventing or treating ovary granulosa cell tumors containing glycogen synthase kinase-3 beta inhibitor as active ingredient, and functional health food composition

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0034672 2013-03-29
KR1020130034672A KR101440724B1 (ko) 2013-03-29 2013-03-29 글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물

Publications (1)

Publication Number Publication Date
WO2014157966A1 true WO2014157966A1 (ko) 2014-10-02

Family

ID=51624829

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/002619 WO2014157966A1 (ko) 2013-03-29 2014-03-27 글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물

Country Status (5)

Country Link
US (1) US20160058738A1 (ko)
EP (1) EP2979696B1 (ko)
JP (1) JP5973108B2 (ko)
KR (1) KR101440724B1 (ko)
WO (1) WO2014157966A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020052397A1 (en) * 2000-07-27 2002-05-02 Leyi Gong 3-indolyl-4-phenyl-1H-pyrrole-2,5-dione derivatives as inhibitors of glycogen synthase kinase-3beta
WO2010040204A1 (en) * 2008-10-09 2010-04-15 British Columbia Cancer Agency Branch Detection of granulosa-cell tumors
US20130071495A1 (en) * 2010-03-16 2013-03-21 Helmholtz Zentrum Muenchen Deutsches Forschungszentrum fuer Gesundheit und Umwelt (GmbH Inhibitors of glycogen synthase kinase 3 for use in therapeutic methods and screening method relating thereto

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7507547B2 (en) * 2004-09-09 2009-03-24 University Of Massachusetts Screening assays for antioxidants and antiproliferative compounds
WO2006034207A2 (en) * 2004-09-17 2006-03-30 Vanderbilt University Use of gsk3 inhibitors in combination with radiation therapies
US20060121040A1 (en) * 2004-12-08 2006-06-08 Wisconsin Alumni Research Foundation Compositions and methods for treating neuroendocrine tumors
WO2012135588A2 (en) * 2011-04-01 2012-10-04 Sloan Kettering Institute For Cancer Research Methods of treating serosal cancer
CN102258783A (zh) * 2011-07-14 2011-11-30 吴效科 Gsk3抑制剂在制备治疗高雄激素血症药物中的用途

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020052397A1 (en) * 2000-07-27 2002-05-02 Leyi Gong 3-indolyl-4-phenyl-1H-pyrrole-2,5-dione derivatives as inhibitors of glycogen synthase kinase-3beta
WO2010040204A1 (en) * 2008-10-09 2010-04-15 British Columbia Cancer Agency Branch Detection of granulosa-cell tumors
US20110195070A1 (en) 2008-10-09 2011-08-11 British Columbia Cancer Agency Branch Detection of granulosa-cell tumors
US20130071495A1 (en) * 2010-03-16 2013-03-21 Helmholtz Zentrum Muenchen Deutsches Forschungszentrum fuer Gesundheit und Umwelt (GmbH Inhibitors of glycogen synthase kinase 3 for use in therapeutic methods and screening method relating thereto

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NEW ENGLAND JOURNAL OF MEDICINE, June 2009 (2009-06-01)
S. UZBEKOVA ET AL.: "Glycogen synthase kinase 3B in bovine oocytes and granulosa cells: possible involvement in meiosis during in vitro maturation", REPRODUCTION, vol. 138, 2009, pages 235 - 246, XP055285131 *

Also Published As

Publication number Publication date
JP2016520541A (ja) 2016-07-14
EP2979696A1 (en) 2016-02-03
US20160058738A1 (en) 2016-03-03
KR101440724B1 (ko) 2014-09-18
EP2979696A4 (en) 2017-01-04
JP5973108B2 (ja) 2016-08-23
EP2979696B1 (en) 2019-05-08

Similar Documents

Publication Publication Date Title
WO2015130109A1 (ko) 고시폴 및 펜포르민을 유효성분으로 함유하는 암 치료용 약제학적 조성물
WO2018182329A1 (ko) S1pr4를 타겟으로 하는 비알코올성 지방간염 예방 또는 치료용 조성물
AU2019418259B2 (en) Anticancer compositions comprising immune checkpoint inhibitors
WO2012008788A2 (ko) 세린을 유효성분으로 함유하는 지방간 질환의 예방 및 치료용 조성물 및 이의 용도 {composition for the prevention and treatment of fatty liver diseases containing serine as an active ingredient and the use thereof}
WO2018155921A1 (ko) 고시폴 및 펜포르민을 유효성분으로 포함하는 췌장암 예방 및 치료용 약학적 조성물
WO2019190137A1 (ko) 1,2-디아실글리세롤 화합물, 그 제조방법 및 이를 유효성분으로 함유하는 면역조절제
WO2018074862A2 (ko) Tha를 유효성분으로 포함하는 유방암 치료용 약학적 조성물
WO2020071795A1 (ko) If1 을 유효성분으로 함유하는 항암용 약학 조성물
WO2020166779A1 (ko) 하이드란제놀을 유효성분으로 하는 지방형성 억제 및 체지방 감소용 조성물
WO2014157966A1 (ko) 글리코겐 신타아제 키나아제-3베타 억제물질을 유효성분으로 포함하는 난소과립세포종양의 예방 또는 치료용 약학적 조성물 및 건강기능성식품 조성물
AU2019381050B2 (en) Anticancer composition
WO2022245089A1 (ko) 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 코로나바이러스감염증-19(covid-19) 치료용 조성물
WO2021246755A1 (ko) 포스포리파아제 d2 억제제를 포함하는 대사성 질환의 예방, 개선 또는 치료용 조성물
WO2020032452A1 (ko) 금제제를 유효성분으로 포함하는 파골세포 분화 억제용 조성물
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2020111325A1 (ko) Plk1의 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물
WO2022164269A1 (ko) 악성 유방암의 치료 또는 예방용 약학적 조성물
WO2023113129A1 (ko) Surf4 억제제를 포함하는 혈액암의 예방 또는 치료용 약학적 조성물
WO2023195798A1 (ko) 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 폐섬유증 예방 또는 치료용 조성물
WO2021060944A1 (ko) Yap-tead 상호작용 저해제 및 혈당 강하제를 포함하는 암의 예방 또는 치료용 약학적 조성물
WO2022025709A1 (ko) 2,3,5-치환된 싸이오펜 화합물의 위장관기질종양 예방, 개선 또는 치료 용도
WO2023063523A1 (ko) 류마티스 관절염 예방 또는 치료용 약학적 조성물 및 건강기능식품
WO2023177128A1 (ko) Alox5 억제제를 포함하는 근감소증 예방 또는 치료용 조성물
WO2024107015A1 (ko) 한약재 복합 추출물을 유효성분으로 포함하는 혈액순환 개선용 조성물
WO2023085664A1 (ko) 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 바이러스 감염 질환 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14772608

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14779817

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2016505403

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2014772608

Country of ref document: EP