WO2014152137A2 - Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes - Google Patents
Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes Download PDFInfo
- Publication number
- WO2014152137A2 WO2014152137A2 PCT/US2014/026990 US2014026990W WO2014152137A2 WO 2014152137 A2 WO2014152137 A2 WO 2014152137A2 US 2014026990 W US2014026990 W US 2014026990W WO 2014152137 A2 WO2014152137 A2 WO 2014152137A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- host cell
- glcnac
- enzyme activity
- man
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/025—Enterobacteriales, e.g. Enterobacter
- A61K39/0258—Escherichia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/605—Glucagons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
- C07K2317/41—Glycosylation, sialylation, or fucosylation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention generally relates to the field of glycobiology and protein engineering. More specifically, the embodiments described herein relates to oligosaccharide compositions and therapeutic glycoprotein production in prokaryotes.
- N-linked protein glycosylation is predicted to affect more than half of all eukaryotic protein species (Apweiler et al, "On the Frequency of Protein Glycosylation, as Deduced From Analysis of the SWISS-PROT Database,” Biochim Biophys Acta 1473:4-8 (1999)) and is often essential for proper folding, pharmacokinetic stability, tissue targeting and efficacy for a large number of proteins (Helenius et al., "Intracellular Functions of N-linked Glycans," Science 291 :2364-9 (2001)). Since most bacteria do not glycosylate their own proteins, expression of most therapeutically relevant glycoproteins, including antibodies, is relegated to mammalian cells.
- mammalian cell culture suffers from a number of drawbacks including: (i) extremely high manufacturing costs and low volumetric productivity of eukaryotic hosts, such as CHO cells, relative to bacteria; (ii) retroviral contamination; (iii) the relatively long time required to generate stable cell lines; (iv) relative inability to rapidly generate stable, "high-producing” eukaryotic cell lines via genetic modification; and (v) high product variability created by glycoform heterogeneity that arises when using host cells, such as CHO, that have endogenous non-human glycosylation pathways (Choi et al., "Use of Combinatorial Genetic Libraries to Humanize N-linked Glycosylation in the Yeast Pichia pastoris," Proc Natl Acad Sci USA 100:5022-7 (2003)).
- coli expression including human growth hormone (hGH), granulocyte macrophage colony stimulating factor (GM-CSF), insulin- like growth factor (IGF-1, IGFBP-3), keratinocyte growth factor, interferons (IFN-a, IFN- ib, IFN-ylb), interleukins (IL- 1, IL-2, IL-11), tissue necrosis factor (TNF-a), and tissue plasminogen activator (tPA).
- hGH human growth hormone
- GM-CSF granulocyte macrophage colony stimulating factor
- IGF-1 insulin- like growth factor
- IGFBP-3 insulin- like growth factor
- keratinocyte growth factor IFN-a, IFN- ib, IFN-ylb
- interleukins IL- 1, IL-2, IL-11
- TNF-a tissue necrosis factor
- tPA tissue plasminogen activator
- aglycosylated human monoclonal antibodies e.g., anti-tissue factor IgGl
- mAbs e.g., anti-tissue factor IgGl
- E. coli E. coli
- co/z-derived mAbs retained tight binding to their cognate antigen and neonatal receptor and exhibited a circulating half- life comparable to mammalian cell-derived antibodies, they were incapable of binding to Clq and the FcyRI receptor due to the absence of TV-glycan.
- TV-linked protein glycosylation is an essential and conserved process occurring in the endoplasmic reticulum (ER) of eukaryotic organisms (Burda et al., "The Dolichol Pathway of N-linked Glycosylation,” Biochim Biophys Acta 1426:239- 57 (1999)). It is important for protein folding, oligomerization, quality control, sorting, and transport of secretory and membrane proteins (Helenius et al.,
- the eukaryotic TV- linked protein glycosylation pathway can be divided into two different processes: (i) the assembly of the lipid-linked oligosaccharide at the membrane of the endoplasmic reticulum and (ii) the transfer of the oligosaccharide from the lipid anchor dolichol pyrophosphate to selected asparagine residues of nascent
- TV-linked protein glycosylation namely (i) the use of dolichol pyrophosphate (Dol-PP) as carrier for oligosaccharide assembly, (ii) the transfer of only the completely assembled Glc3Man9GlcNAc 2 oligosaccharide, and (iii) the recognition of asparagine residues characterized by the sequence N-X-S/T where N is asparagine, X is any amino acid except proline, and S/T is serine/threonine (Gavel et al, "Sequence Differences Between Glycosylated and Non-glycosylated Asn-X-Thr/Ser Acceptor Sites: Implications for Protein Engineering," Protein Eng 3:433-42 (1990)) are highly conserved in eukaryotes.
- oligosaccharyltransferase catalyzes the transfer of the oligosaccharide from the lipid donor dolichylpyrophosphate to the acceptor protein.
- yeast eight different membrane proteins have been identified that constitute the complex in vivo (Kelleher et al., "An Evolving View of the Eukaryotic Oligosaccharyltransferase," Glycobiology 16:47R- 62R (2006)).
- STT3 is thought to represent the catalytic subunit of the OST (Nilsson et al., "Photocross-linking of Nascent Chains to the STT3 Subunit of the
- jejuni glycoproteins including PEB3 and CgbA
- used mass spectrometry and NMR to reveal that the N-linked glycan was a heptasaccharide with the structure GalNAc- al,4-GalNAc-al,4-[Glc i,3]GalNAc-al,4-GalNAc-al,4-GalNAc-al,3-Bac- i,N- Asn GalNAc 5 GlcBac, where Bac is bacillosamine or 2,4-diacetamido-2,4,6- trideoxyglucose) (Young et al, "Structure of the N-linked Glycan Present on Multiple Glycoproteins in the Gram-negative Bacterium, Campylobacter jejuni,” J Biol Chem 277:42530-9 (2002)).
- the branched heptasaccharide is synthesized by sequential addition of nucleotide-activated sugars on a lipid carrier undecaprenylpyrophosphate (Und-PP) on the cytoplasmic side of the inner membrane (Feldman et al.,
- PglB attaches the heptasaccharide to asparagine in the motif D/E-X 1 -N-X 2 -S/T (where D/E is aspartic acid/glutamic acid, Xi and X 2 are any amino acids except proline, N is asparagine, and S/T is serine/threonine), a sequon similar to that used in the eukaryotic glycosylation process (N-X-S/T) (Kowarik et al., "Definition of the Bacterial N-glycosylation Site Consensus
- a major problem encountered when expressing therapeutic glycoproteins in mammalian, yeast, or even bacterial host cells is the addition of non-human glycans.
- yeast one of the two most frequently used systems for the production of therapeutic glycoproteins, transfer highly immunogenic mannan-type N-glycans (containing up to one hundred mannose residues) to recombinant glycoproteins.
- Mammalian expression systems can also modify therapeutic proteins with non-human sugar residues, such as the N-glycosylneuraminic acid (Neu5Gc) form of sialic acid (produced in CHO cells and in milk) or the terminal a(l,3)- galactose (Gal) (produced in murine cells).
- Neuro5Gc N-glycosylneuraminic acid
- Gal terminal a(l,3)- galactose
- glyco-engineered expression systems could open the door to customizing the glycosylation of a therapeutic protein and could lead to the development of improved therapeutic glycoproteins.
- Such a system would have the potential to eliminate undesirable glycans and perform human glycosylation to a high degree of homogeneity.
- the yeast Pichia pastoris has been glyco-engineered to provide an expression system with the capacity for glycosylation for specific therapeutic functions (Gerngross, T.
- a panel of glyco-engineered P. pastoris strains was used to produce various glyco forms of the monoclonal antibody Rituxan (an anti-CD20 IgGl antibody) (Li et al., "Optimization of Humanized IgGs in Glycoengineered Pichia pastoris,” Nat Biotechnol 24:210-5 (2006)). Although these antibodies share identical amino acid sequences to commercial Rituxan, specific glycoforms displayed -100- fold higher binding affinity to relevant FcyRIII receptors and exhibited improved in vitro human B-cell depletion (Li et al., "Optimization of Humanized IgGs in
- yeast also perform 0-linked glycosylation whereby O-glycans are linked to Ser or Thr residues in glycoproteins (Gentzsch et al., "The PMT Gene Family: Protein O-glycosylation in Saccharomyces cerevisiae is Vital," EMBO J 15:5752-9 (1996)).
- O-glycosylation is essential for viability (Gentzsch et al., "The PMT Gene Family: Protein O-glycosylation in Saccharomyces cerevisiae is Vital," EMBO J 15:5752-9 (1996)) and thus cannot be genetically deleted from glyco-engineered yeast. Since there are differences between the O-glycosylation machinery of yeast and humans, the possible addition of O-glycans by glyco-engineered yeast strains has the potential to provoke adverse reactions including an immune response.
- Aebi and his coworkers transferred the C. jejuni glycosylation locus into E. coli and conferred upon these cells the extraordinary ability to post-translationally modify proteins with N-glycans (Wacker et al, "N-linked Glycosylation in
- glycosyltransferases Specifically, expression of UDP-GlcNAc transferases and GDP-mannose transferases in a prokaryotic host cell demonstrated the production of the trimannosyl core structure, which is the basis of nearly all eukaryotic N-linked oligosaccharide structures. Fully elaborated human-like glycans, however, still require additional glycoengineering.
- the present invention is directed to producing human-like glycans such as high-mannose, hybrid and complex types.
- the invention provides methods and materials for the production of oligosaccharide compositions and for the production of recombinant glycoproteins in prokaryotic host cells.
- Various glycoprotein compositions comprising specific N- glycans are produced using the methods of the invention.
- desired glyco forms are produced as the predominant species.
- the invention also provides methods and materials for the production of vaccines antigens comprising specific oligosaccharide compositions, for example, to induce immunity or immunological tolerance (e.g., anergy) within a subject.
- Various aspects of the present invention are directed to antigen-carbohydrate conjugates able to bind lectins expressable on the surfaces of dendritic cell and/or other antigen- presenting cell.
- a first aspect of the invention relates to a method of producing an oligosaccharide composition, said method comprising: culturing a recombinant prokaryotic host cell that produces an oligosaccharide composition having a terminal mannose residue to express one or more N-acetylglucosaminyl transferase enzyme activity (EC 2.4.1.101; EC 2.4.1.143; EC 2.4.1.145; EC 2.4.1.155; EC 2.4.1.201) that catalyzes the transfer of a UDP-GlcNAc residue onto said terminal mannose residue, said culturing step carried out under conditions effective to produce an N-acetylglucosaminyl transferase enzyme activity (EC 2.4.1.101; EC 2.4.1.143; EC 2.4.1.145; EC 2.4.1.155; EC 2.4.1.201) that catalyzes the transfer of a UDP-GlcNAc residue onto said terminal mannose residue, said culturing step carried out under
- oligosaccharide composition having a terminal GlcNAc residue.
- a second aspect of the invention relates to a method of producing an oligosaccharide composition, said method comprising: culturing a host cell to express one or more galactosyltransferase enzyme activity (EC 2.4.1.38) that catalyzes the transfer of a UDP-Galactose residue onto said terminal GlcNAc residue, said culturing step carried out under conditions effective to produce an oligosaccharide composition having a terminal galactose residue.
- EC 2.4.1.38 galactosyltransferase enzyme activity
- a third aspect of the invention relates to a method of producing an oligosaccharide composition, said method comprising: culturing the host cell to express one or more sialyltransferase enzyme activity (EC 2.4.99.4 and EC 2.4.99.1) that catalyzes the transfer of a CMP-NANA residue onto said terminal galactose residue, said culturing step carried out under conditions effective to produce an oligosaccharide composition having a terminal sialic acid residue.
- sialyltransferase enzyme activity EC 2.4.99.4 and EC 2.4.99.1
- aspects of the invention relates to expression of one or more of the enzymes as solubility enhanced fusion proteins. Further aspects of the invention include transfer of the glycans onto a gene encoding a protein of interest, whereby the host cell produces a glycosylated protein.
- Additional aspects include culturing conditions and overexpression of additional enzymes for the production of predominant glycoforms.
- Featured aspects of the invention provide prokaryotic host cells to express various glycosyltransferase activities to produce high-mannose, hybrid and/or complex oligosaccharide compositions as well as high-mannose, hybrid and/or complex glycosylated proteins.
- the present invention commercializes technologies for the design, discovery, and development of glycoprotein therapeutics and diagnostics. Specifically, the present invention provides for the development of an efficient, low- cost strategy for efficient production of authentic human glycoproteins in microbial cells.
- the glyco-engineered bacteria of the invention are capable of stereospecific production of N-linked glycoproteins.
- bacteria are transformed with genes encoding a novel glycosylation pathway that is capable of efficiently glycosylating target proteins at specific asparagine acceptor sites (e.g., N- linked glycosylation). Using these specially engineered cell lines, various
- recombinant protein-of-interest can be expressed and glycosylated.
- the invention provides methods for engineering permutations of oligosaccharide structures in prokaryotes, which is expected to alter e.g.,
- the invention provides biotechnological synthesis of therapeutic proteins, novel glycoconjugates, immunostimulating agents (e.g., vaccines) for research, industrial, and therapeutic applications.
- FIG. 1 Production of a high-mannose type Man 5 GlcNAc 2 glycoform.
- MALDI-TOF mass spectra of lipid-released glycans (A) extracted from GLY02 consistent with the expected MansGlcNAc 2 (m/z 1257.6) glycoform and (B) further treated with an l ,2-mannosidase consistent with the expected Man3GlcNAc 2 glycoform (m/z 933.4).
- FIG. 2 Production of a hybrid GlcNAcMan 3 GlcNAc 2 glycoform.
- MALDI-TOF mass spectra of lipid-released glycans (A) extracted from GLY03 consistent with the expected GlcNAcMan3GlcNAc 2 glycoform (m/z 1136.5) and (B) further treated with a ⁇ - ⁇ -acetylglucosaminidase consistent with the expected Man 3 GlcNAc 2 glycoform (m/z 933.5).
- FIG. 3 Production of a complex GlcNAc 2 Man 3 GlcNAc 2 glycoform.
- FIG. 4 Production of a hybrid, branched glycoform.
- MALDI-TOF mass spectra of lipid-released glycans (A) extracted from GLY05 consistent with the expected GlcNAc 2 Man3GlcNAc 2 glycoform (m/z 1339.7) and (B) further treated with a ⁇ - ⁇ -acetylglucosaminidase consistent with the expected Man3GlcNAc 2 glycoform (m/z 933.5).
- FIG. 5 Production of a multiple-antennary glyoform.
- FIG. 6. Production of a GalGlcNAcMan 3 GlcNAc 2 glycoform. MALDI- TOF mass spectrum of lipid-released glycans extracted from GLY04.1 consistent with the expected GalGlcNAcMan 3 GlcNAc 2 glycoform (m/z 1298.7).
- FIG. 7. Production of a Gal 2 GlcNAc 2 Man 3 GlcNAc 2 glycoform.
- Gal 2 GlcNAc2Man 3 GlcNAc2 (m/z 1662.2).
- FIG. 8 Production of a NANAGalGlcNAcMan 3 GlcNAc 2 glycoform. MALDI-TOF mass spectrum in positive ion mode of glycans synthesized ex vivo consistent with the expected NANAGalGlcNAcMan 3 GlcNAc 2 (m/z 1565.7).
- FACE Fluorophore-assisted carbohydrate electrophoresis
- FIG. 10 Increased product formation.
- FIG. 11 Glycosylated glucagon production.
- MALDI-TOF MS of partially purified glucagon appended with a C-terminal glycosylation site from various glycoengineered strains, which produce M3, M5, GlcNAcMan 3 GlcNAc 2 , and GalGlcNAcMan 3 GlcNAc 2 glycopeptides.
- FIG. 12 Glycosylated antigens.
- EC numbers are established by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB) (available at http://www.chem.qmul.ac.uk/iubmb/enzyme/).
- NC-IUBMB Nomenclature Committee of the International Union of Biochemistry and Molecular Biology
- the EC numbers referenced herein are derived from the KEGG Ligand database, maintained by the Kyoto Encyclopedia of Genes and Genomics, sponsored in part by the University of Tokyo. Unless otherwise indicated, the EC numbers are as provided in the database as of March 2013.
- accession numbers referenced herein are derived from the NCBI database (National Center for Biotechnology Information) maintained by the National Institute of Health, U.S.A. Unless otherwise indicated, the accession numbers are as provided in the database as of March 2013.
- glycoproteins refers to proteins having attached N-acetylglucosamine (GlcNAc) residue linked to the amide nitrogen of an asparagine residue (N- linked) in the protein, that is similar or even identical to those produced in humans.
- GlcNAc N-acetylglucosamine
- N-glycans or “N-linked glycans” refer to N-linked oligosaccharide structures.
- the N-glycans can be attached to proteins or synthetic glycoprotein intermediates, which can be manipulated further in vitro or in vivo.
- the predominant sugars found on glycoproteins are glucose (Glu), galactose (Gal), mannose (Man), fucose (Fuc), ⁇ -acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), and sialic acid (e.g., N-acetyl-neuraminic acid (NeuAc or NANA).
- Hexose (Hex) may also be found.
- N-glycans differ with respect to the number of branches (“antennae” or “arms") comprising peripheral sugars (e.g., GlcNAc, galactose, fucose and sialic acid) that are added to the "triamannosyl core".
- branches e.g., antiennae or “arms”
- peripheral sugars e.g., GlcNAc, galactose, fucose and sialic acid
- triamannosyl core also referred to as “M3”, “M3GN2”, the "triamannose core”, the “pentasaccharide core” or the “paucimannose core” reflects Man3GlcNAc 2 oligosaccharide structure where Manal,3 arm and the Manal,6 arm extends from the di-GlcNAc structure (GlcNAc 2 ): pi,4GlcNAc-pi,4GlcNAc.
- N-glycans are classified according to their branched constituents (e.g., high-mannose, complex or hybrid).
- a "high-mannose” type N-glycan comprises four or more mannose residues on the di-GlcNAc oligosaccharide structure.
- "M4" reflects Man 4 GlcNAc 2 .
- "M5" reflects Man 5 GlcNAc 2
- a "hybrid" type N-glycan has at least one GlcNAc residue on the terminal end of the al,3 mannose (Man al,3) arm of the trimannose core and zero or more mannoses on the al,6 mannose (Man al,3) arm of the trimannose core.
- the various N-glycans are also referred to as "glyco forms".
- An example of a hybrid glycan is "GNM3GN2", which is GlcNAcMan 3 GlcNAc 2 .
- a "complex" type N-glycan typically has at least one GlcNAc residue attached to the Manal,3 arm and at least one GlcNAc attached to the Manal,6 arm of the trimannose core.
- Complex N-glycans may also have galactose or N- acetylgalactosamine residues that are optionally modified with sialic acid or derivatives (e.g., "Neu” refers to neuraminic acid and "Ac” refers to acetyl).
- Complex N-glycans may also have intrachain substitutions comprising "bisecting" GlcNAc and core fucose.
- Complex N-glycans may also have multiple antennae on the trimannose core, often referred to as “multiple antennary glycans” or also termed “multi-branched glycans,” which can be tri-antennary tetra-antennary or penta-antennary glycans.
- GO refers to GlcNAc 2 Man 3 GlcNAc 2 .
- G0(1) refers to GlcNAc 3 Man 3 GlcNAc 2
- G0(2) refers to GlcNAc 4 Man 3 GlcNAc 2
- G0(3) refers to GlcNAc 5 Man 3 GlcNAc 2 .
- Gl refers to GalGlcNAc 2 Man 3 GlcNAc 2
- G2 refers to Gal 2 GlcNAc 2 Man 3 GlcNAc 2
- G3 refers to Gal 3 GlcNAc 3 _ 5 Man 3 GlcNAc 2
- G4 refers to Gal 4 GlcNAc 4 _ 5 Man 3 GlcNAc 2
- G5 refers to Gal 5 GlcNAc 5 Man 3 GlcNAc 2 .
- SI refers to N AN AGali_ 5 GlcNAc i_ 5 Man 3 GlcNAc 2
- S2 refers to NANA 2 Gal 2 _ 5 GlcNAc 2 _ 5 Man 3 GlcNAc 2
- S3 refers to NANA 3 Gal 3 _ 5 GlcNAc 3 _ 5 Man 3 GlcNAc 2
- S4 refers to NANA 4 Gal 4 _ 5 GlcNAc 4 _ 5 Man 3 GlcNAc 2
- S5" refers to NANA 5 Gal 5 GlcNAc 5 Man 3 GlcNAc 2 .
- the term “predominantly” or variations such as “the predominant” or “which is predominant” will be understood to mean the glycan species as measured that has the highest mole percent (%) of total N-glycans after the glycoprotein has been removed (e.g., treated with PNGase and the glycans released) and are analyzed by mass spectroscopy, for example, MALDI-TOF MS.
- the phrase “predominantly” is defined as an individual entity, such as a specific glycoform, present in greater mole percent than any other individual entity.
- compositions consists of species A in 40 mole percent, species B in 35 mole percent and species C in 25 mole percent, the composition comprises predominantly species A.
- enriched “uniform”, “homogenous” and “consisting essentially of are also synonymous with predominant in reference to the glycans.
- the mole % of N-glycans as measured by MALDI-TOF-MS in positive mode refers to mole % saccharide transfer with respect to mole % total N- glycans.
- Certain cation adducts such as K+ and Na+ are normally associated with the peaks eluted increasing the mass of the N-glycans by the molecular mass of the respective adducts.
- nucleic acid comprising SEQ ID NO: 1 refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ ID NO : 1 , or (ii) a sequence complementary to SEQ ID NO : 1.
- the choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.
- glycoprotein is one which is substantially separated from other cellular components that naturally accompany the native polynucleotide in its natural host cell, e.g., ribosomes, polymerases and genomic sequences with which it is naturally associated.
- the term embraces a nucleic acid, polynucleotide that (1) has been removed from its naturally occurring environment, (2) is not associated with all or a portion of a polynucleotide in which the "isolated polynucleotide" is found in nature, (3) is operatively linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature.
- isolated or “substantially pure” also can be used in reference to recombinant or cloned DNA isolates, chemically synthesized polynucleotide analogs, or polynucleotide analogs that are biologically synthesized by heterologous systems.
- isolated does not necessarily require that the nucleic acid, polynucleotide or glycoprotein so described has itself been physically removed from its native environment.
- an endogenous nucleic acid sequence in the genome of an organism is deemed “isolated” if a heterologous sequence is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered.
- a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not the heterologous sequence is itself endogenous (originating from the same host cell or progeny thereof) or exogenous (originating from a different host cell or progeny thereof).
- a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of a host cell, such that this gene has an altered expression pattern.
- This gene would now become “isolated” because it is separated from at least some of the sequences that naturally flank it.
- a nucleic acid is also considered “isolated” if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome.
- an endogenous coding sequence is considered “isolated” if it contains an insertion, deletion, or a point mutation introduced artificially, e.g., by human intervention.
- An "isolated nucleic acid” also includes a nucleic acid integrated into a host cell chromosome at a heterologous site and a nucleic acid construct present as an episome.
- an "isolated nucleic acid” can be substantially free of other cellular material or substantially free of culture medium when produced by
- terapéuticaally effective amount of a therapeutic protein refers to an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of a given disease and/or its complications. An amount adequate to accomplish this is defined as a “therapeutically effective amount”.
- Effective amounts for each purpose will depend on the severity of the disease or injury, as well as on the weight and general state of the subject. It will be understood that determination of an appropriate dosage may be achieved using routine experimentation, by constructing a matrix of values and testing different points in the matrix, all of which is within the level of ordinary skill of a trained physician or veterinarian.
- treatment refers to the management and care of a patient or subject for the purpose of combating a condition, such as a disease or a disorder.
- the terms are intended to include the full spectrum of treatments for a given condition from which the patient is suffering, such as administration of the active compound(s) in question to alleviate symptoms or complications thereof, to delay the progression of the disease, disorder or condition, to cure or eliminate the disease, disorder or condition, and/or to prevent the condition, in that prevention is to be understood as the management and care of a patient for the purpose of combating the disease, condition, or disorder, and includes the administration of the active compound(s) in question to prevent the onset of symptoms or complications.
- the patient to be treated is preferably a mammal, in particular a human being, but treatment of other animals, such as dogs, cats, cows, horses, sheep, goats or pigs, is within the scope of the invention.
- a therapeutically effective amount of glucagon peptide of the present invention for a patient suffering from insulin coma or insulin reaction resulting from severe hypoglycemia (low blood sugar) is lmg (lunit) for an adult.
- lmg lunit
- Glucagon is given if (1) the patient is unconscious, (2) the patient is unable to eat sugar or a sugar-sweetened product, (3) the patient is having a seizure, or (4) repeated administration of sugar or a sugar-sweetened product such as a regular soft drink or fruit juice does not improve the patient's condition.
- the dose can be in the range of 0.25 units to 2 units, which can be administered intramuscular or intravenously.
- a milligram of pure glucagon is approximately equivalent to 1 unit.
- a dosing schedule can vary but can be from about once a day to as needed per event. The actual schedule will depend on a number of factors including the type of glucagon administered to a patient (glucagon or glycosylated-glucagon) and the response of the individual patient. The higher dose ranges are not typically used in hypoglycemia applications but may be useful on other therapeutic applications. The means of achieving and establishing an appropriate dose for a patient is well known and commonly practiced in the art.
- compositions are generally compatible with other materials of the formulation and are not generally deleterious to the subject.
- compositions of the present invention may be administered to the subject in a therapeutically effective dose.
- a "therapeutically effective” or an “effective” amount or dose means that amount necessary to induce immunity or tolerance within the subject, and/or to enable the subject to more effectively resist a disease (e.g., against foreign pathogens, cancer, an autoimmune disease, etc.).
- effective amounts will depend on the particular condition being treated and the desired outcome.
- a therapeutically effective dose may be determined by those of ordinary skill in the art, for instance, employing factors such as those further described below and using no more than routine experimentation.
- a therapeutically effective amount can be initially determined from cell culture assays. For instance the effective amount of a composition of the invention useful for inducing dendritic cell response can be assessed using the in vitro assays with respect to a stimulation index.
- the stimulation index can be used to determine an effective amount of a particular composition of the invention for a particular subject, and the dosage can be adjusted upwards or downwards to achieve desired levels in the subject.
- Therapeutically effective amounts can also be determined from animal models.
- the applied dose can be adjusted based on the relative bioavailability and potency of the administered composition. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods are within the capabilities of those of ordinary skill in the art. These doses can be adjusted using no more than routine experimentation.
- dosing amounts, dosing schedules, routes of administration, and the like may be selected so as to affect known activities of these compositions. Dosages may be estimated based on the results of experimental models, optionally in combination with the results of assays of compositions of the present invention. Dosage may be adjusted
- compositional levels local or systemic, depending upon the mode of administration.
- the doses may be given in one or several administrations per day. In the event that the response of a particular subject is insufficient at such doses, even higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that subject tolerance permits. Multiple doses per day are also contemplated in some cases to achieve appropriate systemic levels of the composition within the subject or within the active site of the subject.
- the dose of the composition to the subject may be such that a therapeutically effective amount of the composition reaches the active site of the composition within the subject, i.e., dendritic cells and/or other antigen-presenting cells within the body.
- the dosage may be given in some cases at the maximum amount while avoiding or minimizing any potentially detrimental side effects within the subject.
- the dosage of the composition that is actually administered is dependent upon factors such as the final concentration desired at the active site, the method of administration to the subject, the efficacy of the composition, the longevity of the composition within the subject, the timing of administration, the effect of concurrent treatments (e.g., as in a cocktail), etc.
- the dose delivered may also depend on conditions associated with the subject, and can vary from subject to subject in some cases.
- the age, sex, weight, size, environment, physical conditions, or current state of health of the subject may also influence the dose required and/or the concentration of the composition at the active site. Variations in dosing may occur between different individuals or even within the same individual on different days. It may be preferred that a maximum dose be used, that is, the highest safe dose according to sound medical judgment. Preferably, the dosage form is such that it does not substantially deleteriously affect the subject.
- the composition may be administered to a subject as a preventive measure.
- the inventive composition may be administered to a subject based on demographics or epidemiological studies, or to a subject in a particular field or career.
- Administration of a composition of the invention may be accomplished by any medically acceptable method, which allows the composition to reach its target, i.e., dendritic cells and/or other antigen-presenting cells within the body.
- the particular mode selected will depend of course, upon factors such as those previously described, for example, the particular composition, the severity of the state of the subject being treated, the dosage required for therapeutic efficacy, etc.
- a "medically acceptable" mode of treatment is a mode able to produce effective levels of the composition within the subject without causing clinically unacceptable adverse effects.
- composition may be administered to the subject.
- the administration may be localized (i.e., to a particular region, physiological system, tissue, organ, or cell type) or systemic, depending on the condition to be treated.
- the composition may be administered
- parenteral modalities that can be used with the invention include intravenous, intradermal, subcutaneous, intracavity, intramuscular, intraperitoneal, epidural, or intrathecal.
- parenteral modalities include intravenous, intradermal, subcutaneous, intracavity, intramuscular, intraperitoneal, epidural, or intrathecal.
- implantation modalities include any implantable or injectable drug delivery system.
- the administration of the composition of the invention may be designed so as to result in sequential exposures to the composition over a certain time period, for example, hours, days, weeks, months or years. This may be accomplished, for example, by repeated administrations of a composition of the invention by one of the methods described above, or by a sustained or controlled release delivery system in which the composition is delivered over a prolonged period without repeated administrations. Administration of the composition using such a delivery system may be, for example, by oral dosage forms, bolus injections, transdermal patches or subcutaneous implants. Maintaining a substantially constant concentration of the composition may be preferred in some cases.
- the composition may also be administered on a routine schedule, but alternatively, may be administered as symptoms arise.
- a "routine schedule" as used herein, refers to a predetermined designated period of time.
- the routine schedule may encompass periods of time which are identical or which differ in length, as long as the schedule is predetermined. For instance, the routine schedule may involve
- compositions on a daily basis, every two days, every three days, every four days, every five days, every six days, a weekly basis, a bi-weekly basis, a monthly basis, a bimonthly basis or any set number of days or weeks there-between, every two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, etc.
- the predetermined routine schedule may involve administration of the composition on a daily basis for the first week, followed by a monthly basis for several months, and then every three months after that. Any particular combination would be covered by the routine schedule as long as it is determined ahead of time that the appropriate schedule involves administration on a certain day.
- the composition is administered to the subject in anticipation of an allergic event in order to prevent an allergic event.
- the allergic event may be, but need not be limited to, an asthma attack, seasonal allergic rhinitis (e.g., hay- fever, pollen, ragweed hypersensitivity) or perennial allergic rhinitis (e.g., hypersensitivity to allergens such as those described herein).
- the composition is administered substantially prior to an allergic event.
- substantially prior means at least six months, at least five months, at least four months, at least three months, at least two months, at least one month, at least three weeks, at least two weeks, at least one week, at least 5 days, or at least 2 days prior to the allergic event.
- the composition may be administered immediately prior to an allergic event (e.g., within 48 hours, within 24 hours, within 12 hours, within 6 hours, within 4 hours, within 3 hours, within 2 hours, within 1 hour, within 30 minutes or within 10 minutes of an allergic event), substantially simultaneously with the allergic event (e.g., during the time the subject is in contact with the allergen or is experiencing the allergy symptoms) or following the allergic event.
- an allergic event e.g., within 48 hours, within 24 hours, within 12 hours, within 6 hours, within 4 hours, within 3 hours, within 2 hours, within 1 hour, within 30 minutes or within 10 minutes of an allergic event
- substantially simultaneously with the allergic event e.g., during the time the subject is in contact with the allergen or is experiencing the allergy symptoms
- the conjugate containing that antigen or allergen may be administered in very small doses over a period of time, consistent with traditional desensitization therapy.
- Other delivery systems suitable for use with the present invention include time -release, delayed release, sustained release, or controlled release delivery systems. Such systems may avoid repeated administrations of the composition in many cases, increasing convenience to the subject. Many types of release delivery systems are available and known to those of ordinary skill in the art.
- polymer-based systems such as polylactic and/or polyglycolic acids, polyanhydrides, polycaprolactones and/or combinations of these; nonpolymer systems that are lipid-based including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-, di- and triglycerides; hydrogel release systems; liposome-based systems; phospholipid based-systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; or partially fused implants.
- the formulation may be as, for example, microspheres, hydrogels, polymeric reservoirs, cholesterol matrices, or polymeric systems.
- the system may allow sustained or controlled release of the
- composition to occur for example, through control of the diffusion or
- a pump-based hardware delivery system may be used to deliver one or more
- Long-term release means that a device containing the composition is constructed and arranged to deliver therapeutically effective levels of the composition for at least 30 or 45 days, and preferably at least 60 or 90 days, or even longer in some cases.
- Long-term release implants are well known to those of ordinary skill in the art, and include some of the release systems described above.
- One aspect of the present invention relates to a recombinant prokaryotic host comprising a biosynthetic pathway to express N-linked glycoproteins with structurally homogeneous human-like glycans.
- Applications of the present invention include improved biochemical and pharmacokinetic stability for therapeutic proteins.
- Additional embodiments provide methods and compositions for producing carbohydrate-conjugated vaccines capable of eliciting protective immunity in subjects.
- a rapid, microbial-based manufacturing process to produce safe and more effective glycoproteins and vaccines is an object of the present invention.
- the present invention provides methods for the recombinant expression of a mannosyltransferase enzyme to produce a high-mannose type glycan as shown in FIG. 1.
- the method provides culturing a recombinant prokaryotic host cell to express one or more alpha- 1 ,2-mannosyltransferase enzyme activities (EC 2.4.1.131) that catalyzes the transfer of two GDP-Mannose residues onto a trimannose oligosaccharide composition in a prokaryotic host cell.
- Example 3 describes expression of a a-1,2- mannosyltransferase enzyme activity (EC 2.4.1.131 ).
- Preferred a- 1 ,2- mannosyltransferase enzyme activity is encoded by a S. cerevisiae algll fused to GST, a solubility enhancer. Table I lists a variety of solubility enhancers.
- the invention provides a method of producing a high- mannose type oligosaccharide composition, said method comprising: culturing a recombinant prokaryotic host cell that produces an oligosaccharide composition having a terminal mannose residue to express one or more alpha- 1,2- mannosyltransferase enzyme activity (EC 2.4.1.131) that catalyzes the transfer of a GDP-Mannose residue onto the terminal mannose residue, said culturing step carried out under conditions effective to produce an oligosaccharide composition having at least 4 terminal mannose residues.
- the oligosaccharide composition comprises at least 2 additional mannose residues on the trimannose core.
- vaccine candidates are recombinantly expressed in the prokaryotic host cell where they are N-linked to the M5 glycoform.
- the expected structure of the major glycoform shown in FIG. 1 is Manal-2 Manal-2Manal- 3(Mana 1 -6)-Man 1 -4-GlcNAc 1 -4-GlcNAc.
- the glycosylation enzymes act on lipid-linked glycans prior to the glycosylation of the glycoprotein.
- the alpha- 1 ,2-mannosyltransferase acts on the trimannose core glycan linked to dolichol pyrophosphate on the cytosolic side of the endoplasmic reticulum membrane.
- the Man 5 GlcNAc 2 -dolichol pyrophosphate is then flipped into the endoplasmic reticulum by an endogenous flippase enzyme that is highly specific for
- Man 5 GlcNAc 2 -dolichol pyrophosphate to ensure the complete assembly of the oligosaccharide prior to flipping (Sanyal & Menon, PNAS 2009).
- the Man 3 GlcNAc 2 lipid can be flipped (Valderrama-Rincon, et. al. "An engineered eukaryotic protein glycosylation pathway in Escherichia coli,” Nat. Chem. Biol. AOP (2012)) and there is no known specificity for flipping, jeopardizing assembly of the oligosaccharide beyond the trimannose core. Therefore, it is an object of the invention to produce a high-mannose type oligosaccharide composition including Man7_9GlcNAc 2 , Man 6 GlcNAc, MansGlcNAc 2 and
- Man 4 GlcNAc 2 in a prokaryotic system that transfers mannose residues onto the M3 oligosaccharide substrates and, furthermore, catalyzes the flipping activity of the oligosaccharides into the periplasm.
- the host cell produces 50 mole % or more of the high-mannose type glycans.
- a method for producing an oligosaccharide composition comprising: culturing a recombinant prokaryotic host cell that produces an oligosaccharide composition having a terminal mannose residue to express one or more N-acetylglucosaminyl transferase enzyme activity (EC 2.4.1.101; EC 2.4.1.143; EC 2.4.1.145) that catalyzes the transfer of a UDP-GlcNAc residue onto said terminal mannose residue, said culturing step carried out under conditions effective to produce an oligosaccharide composition having a terminal GlcNAc residue.
- N-acetylglucosaminyl transferase enzyme activity EC 2.4.1.101; EC 2.4.1.143; EC 2.4.1.145
- N-acetylglucosaminyl transerases act on oligosaccharides that are covalently linked to asparagine residues of glycosylated proteins.
- oligosaccharides are produced independently of the protein glycosylation process jeopardizing the production of hybrid and complex oligosaccharides.
- UDP-GlcNAc residue is transferred onto the Manal,3 arm of the trimannosyl core oliogosaccharide structure, the acceptor substrate.
- the invention provides a prokaryotic host cell transformed with a gene encoding N. tabacum GnTI fused to MBP a solubility enhancer in a host cell expressing Algl3, Algl4, Algl and Alg2.
- a hybrid glycoform GlcNAcMan 3 GlcNAc 2 is produced as shown in FIG. 2A.
- the expected structure of the glycoform shown is pi-2-GlcNAcManal-3(Manal-6)-Manpi-4-GlcNAcpi-4- GlcNAc.
- UDP-GlcNAc residue is transferred onto both the Manal,3 and Manal,6 arm of the trimannosyl core oliogosaccharide structure, the acceptor substrate.
- a prokaryotic host cell is transformed with a gene encoding human GnTII fused to MBP in a host cell expressing Algl3, Algl4, Algl, Alg2 and GnTI.
- a complex GlcNAc 2 Man 3 GlcNAc 2 (GO) glycoform is produced as shown in FIG. 3 and the expected structure is ⁇ 1-2- GlcNAcMana 1 -3( ⁇ 1 -2-GlcNAc Mana 1 -6)-Man 1 -4-GlcNAc 1 -4-GlcNAc.
- multiple-antennary glycans are produced.
- a prokaryotic host cell is transformed with a gene encoding bovine GnTIV fused to MBP in a host cell expressing Algl 3, Algl 4, Algl, Alg2 and GnTI.
- FIG. 4A demonstrates GlcNAc 2 Man 3 GlcNAc 2 hybrid glycoform produced using the methods of the invention wherein two UDP-GlcNAc residues are transferred onto the Manal,3 arm of the trimannosyl core.
- the expected structure of the glycoform shown is i-2-GlcNAc( i-2-GlcNAc) Mana 1-3 (Mana l-6)-Manp 1-4- GlcNAc i-4-GlcNAc.
- glycans can also be formed ex vivo, e.g., through enzymatic synthesis of oligosacchardies as described in Example 7.
- FIG. 5 depicts a MS of complex, multiple-antennary glycans comprising GlcNAc 3 Man 3 GlcNAc 2 glycoform, which is produced by expressing GnTI, GnTII, GnTIV (ex vivo), Algl 3, Algl 4, Algl and Alg2 resulting in the transfer of two UDP- GlcNAc residues onto the Manal,3 arm and one UDP-GlcNAc residue onto the Manal,6 arm of the trimannosyl core oliogosaccharide structure.
- the expected structure of the glycoform shown is ( i-2-GlcNAcManal-3) i-2-GlcNAc( i-2- GlcNAc Mana 1 -6)-Man 1 -4-GlcNAc 1 -4-GlcNAc.
- GnT activites such as GnTV (EC 2.4.1.155) and GnTVI (2.4.1.201) can be expressed in the prokaroytoic system.
- multiple antennary glycans of up to 5 branches on the trimannose core are possible using the methods of the invention.
- Mulitple branched glycans enable, for example, enhanced sialylation on erythropoietin, increasing serum half-life and potentcy (Elliot, Nature Biotech 2003; Misaizu, Blood 1995).
- GnTs can be expressed in a host cell
- GnTs are fused to, for example, MBP and expressed as a fusion protein to transfer a terminal UDP-GlcNAc residue onto the trimannosyl core, in effect, enhancing solubility of the glycosyltransferase.
- Table 1 provides a list provides a class of membrane targeting domains and solubility enhancers.
- glycans such as GlcNAc(i_5 ) Man 3 GlcNAc 2 are produced in the prokaryotic system of the present invention.
- MBP-fused glycosyltransferases are expressed in a prokaryotic host.
- Other membrane targeting domains and solubility enhancers, such as MstX can also be expressed.
- Such N-acetylglucosaminyl transferase-MBP or N-acetylglucosaminyl transferase-MstX fusions are screened for the addition of UDP-GlcNAc residue onto the acceptor oligosaccharide substrate.
- N. tabacum GnTI-MBP, H. Sapiens GnTII-MBP, B. taurus GnT IV-MBP confer UDP-GlcNAc transfer onto the trimannosyl core. Accordingly, a library of
- GnT fusions can be made to produce hybrid, complex and multi-antennary glycans in prokaryotic host cells.
- Various GnT fusion constructs can be made using the methods of the present invention. Such fusion constructs are within the scope of invention and can be screened for better activity or enhanced solubility.
- a method for producing an oligosaccharide composition comprising: culturing the host cell to express one or more galactosyltransferase enzyme activity (EC 2.4.1.38, EC 2.7.8.18) that catalyzes the transfer of a UDP-Galactose residue onto said terminal GlcNAc residue, said culturing step carried out under conditions effective to produce an oligosaccharide composition having a terminal galactose residue.
- FIG. 6 depicts a MS of the hybrid glycoform GalGlcNAcMan 3 GlcNAc 2 produced in E. coli.
- Example 5 describes expression of Helicobacter pylori P-l,4GalT in E. coli, which transfers a UDP-galactose residue onto the GlcNAcMan 3 GlcNAc 2 acceptor oligosaccharide.
- UDP- galactose residue is transferred onto the P-l,2GlcNAcManal,3 of the trimannosyl core and both P-l,2GlcNAcMan l,3 and P-l,2GlcNAcManal,6 arms of the trimannosyl core for the complex glycoform.
- a prokaryotic host cell is transformed with a gene encoding H. pylori GalT in a host cell expressing the Algl3, Algl4, Algl, Alg2, GnTI and GnTII.
- Example 8 provides methods for producing a complex Gal 2 GlcNAc 2 Man 3 GlcNAc 2 glycoform.
- FIG. 7 shows a peak at m/z 1662.2, which correlates with the mass of the complex galactosylated glycan Gal 2 GlcNAc 2 Man 3 GlcNAc 2 .
- Additional galactosylated glycoforms can be produced including: Gal(i_ 4 )GlcNAc 2 Man 3 GlcNAc 2 .
- the expected structure of the hybrid terminal galactose glycan is i-4Gai i-2-GlcNAcManal-3(Manal-6)-Man i-4- GlcNAc i-4-GlcNAc and the complex terminal galactose glycan is i-4Gai i-2- GlcNAcMana 1 -3( ⁇ 1 -4Gai 1 -2-GlcNAc Mana 1 -6)-Man 1 -4-GlcNAc 1 -4-GlcNAc.
- Galactosyltransferases from various other organisms can be expressed, which include but are not limited to Helicobacter pylori, Neisseria meningitides, Neisseria gonorrhoeae, Leishmania donovani, Homo sapiens (GALT), Bos Taurus, Drosophia, melanogaster, Rattus norvegicus (GalT I), Mus musculus, Cricetulus griseus, Equus caballus, Macropus eugenii (4p ⁇ GalT), Danio rerio (GalT I) and Sus scrofa, Ovis aries.
- Helicobacter pylori Neisseria meningitides, Neisseria gonorrhoeae, Leishmania donovani
- Homo sapiens (GALT) Bos Taurus
- Drosophia melanogaster
- Rattus norvegicus GalT I
- Mus musculus Cricetul
- various galactosyltransferase enzyme activities are fused to solubility enhancers such as MBP or mstX and screened for addition of UDP- Galactose onto the acceptor oligosaccharide substrate.
- solubility enhancers such as MBP or mstX
- the human and bovine GalT-mstX fusions did not appear to transfer UDP-Galactose onto the terminal GlcNAc oligosaccharide substrate.
- oxidative bacterial strains are used for the expression of H. pylori P-l,4-GalT.
- the following enzymes are expressed in a prokaryotic host: Algl3, Algl4, Algl, Alg2, Nicotiana tabaccum GnTI, human GnTII, bovine GnTIV, Helicobacter pylori P-l,4GalT.
- the GnTs and the GalT are expressed in an oxidative bacterial host.
- the present invention provides methods to produce oligosaccharide compositions by culturing a recombinant prokaryotic host to express one or more sialyltransferase enzyme activity (EC 2.4.99.4 and EC 2.4.99.1) that catalyzes the transfer of a CMP -NANA residue onto said terminal galactose residue, said culturing step carried out under conditions effective to produce an
- oligosaccharide composition having a terminal sialic acid residue.
- sialyltransferases are expressed using the methods of the invention, either in vivo or ex vivo.
- an a-2, 3 sialyltransferase (EC 2.4.99.4) is expressed in a host cell or in the culture medium.
- sialyltransferase (EC 2.4.99.1) is expressed in a host cell or in the culture medium.
- the following enzymes are expressed in a prokaryotic host: Algl 3, Algl 4, Algl, Alg2, Nicotiana tabaccum GnTI, bovine GnTIV, Helicobacter pylori P-l,4-GalT and P. damselae ST6.
- the method allows for a combination of in vivo and ex vivo reactions that demonstrate the proper transfer of CMP-NANA onto the correct oligosaccharide substrates. As shown in Fig.
- the hybrid sialylated glycoform is produced where the expected structure of the glycoform shown is 2,6NANApi-4Gal pi-2-GlcNAcManal-3(Manal-6)-Manpi-4- GlcNAc i-4-GlcNAc.
- the method provides for culturing the host cell to increase sugar nucleotide precursors.
- enzymes that catalyze GDP- Mannose synthesis are expressed in the system.
- Phosphomannomutase enzyme activity (ManB) (EC 5.4.2.8)
- ManC mannose-1 -phosphate guanylyltransferase enzyme activity
- FIG. 9 A (left) shows increased production of the trimannosyl core when ManC/B is overexpressed.
- a sufficient pool of glycosyl donors in the cytoplasm is generated.
- UDP-GlcNAc the substrate for GnTI and GnTII, is naturally present in the E. coli cytoplasm but the host cell can be engineered for increased UDP-GlcNAc synthesis.
- the method provides for culturing the host cell to increase UDP-GlcNAc by expressing glutamine-fructose-6-phosphate transaminase enzyme activity GlmS (EC 2.6.1.16), GlmU (EC 2.7.7.23 & EC
- FIG. 9A shows an increase in GlcNAcMan 3 GlcNAc 2 when GlmS was overexpressed. Addition of glycerol with ManC/B results in increased glycan yield as shown in FIG. 9B. Pyruvate also appears to increase glycan yield as shown in FIG. 9C.
- UDP-Galactose can be increased by overexpression of UDP-Gal synthesis genes including uridylate kinase (pyrH), Glc-l-P uridyltransferase (galU), Gal-l-P uridyltransferase (gall), galactokinase (galK), and UDP-galactose epimerase (galE) (Chung, S., et al., Galactosylation and sialylation of terminal glycan residues of human immunoglobulin G using bacterial glycosyltransferases with in situ
- one or more genes selected from galETK, galU, and pyrH from E. coli K12 is cloned using yeast-based recombination and subsequently expressed in the host strain to ensure a sufficient UDP-Gal pool of glycosyl donor substrates for transfer of galactose onto the acceptor oligosaccharide composition.
- CMP-SA cytidine monophosphate sialic acid synthase
- SAS sialic acid phosphate synthase
- Host cells that lack certain enzyme activities are preferred, such host cells that do not express or are attenuated in certain enzymes that compete with sugar biosynthesis (e.g., mannosyltransferases).
- the method provides for culturing the host cell that is attenuated in GDP-D-mannose dehydratase enzyme activity (EC 4.2.1.47) as shown in Valderrama-Rincon et al. An E.
- GMD GDP-mannose dehydratase
- glycosyltransferases are codon optimized to overcome limitations associated with the codon usage bias between E. coli (and other bacteria) and higher organisms, such as yeast and mammalian cells.
- Codon usage bias refers to differences among organisms in the frequency of occurrence of codons in protein-coding DNA sequences (genes).
- a codon is a series of three nucleotides (triplets) that encodes a specific amino acid residue in a polypeptide chain. Codon optimization can be achieved by making specific transversion nucleotide changes, i.e. a purine to pyrimidine or pyrimidine to purine nucleotide change, or transition nucleotide change, i.e.
- codon optimized polypeptide variants retain the same biological function as the uncodon optimized polypeptides.
- one or more codons can be optimized as described in, e.g., Grosjean et al, Gene 18: 199-209 (1982). As used herein, "*" indicate stop codons.
- nucleic acid molecules, polypeptide molecules and homologs, variants and derivatives of the alg, N-acetylglucosaminyl transferase, galactosytransferase, sialyltransferase, ManB/C, glmS, oligosaccharyl trans feraes described herein also comprise polynucleotide and polypeptide variants, which can be naturally occurring or created in vitro including chemical synthesis using known genetic engineering techniques.
- the polynucleotide sequences have at least 75%, 77%, 80%, 85%, 90%, or 95% identity to SEQ ID NO: 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, or 29.
- polypeptide variants have at least about 50% ,55%, 60%, 65%, 70%, 75%, 77%, 80%, 85%, 90%, or 95% homology to SEQ ID NO:2, 4, 6, 8,10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 31, 32, or 33.
- the present invention also encompasses nucleic acid molecules that hybridize under stringent conditions to the above-described nucleic acid molecules.
- stringent hybridizations are performed at about 25°C below the thermal melting point (T m ) for the specific DNA hybrid under a particular set of conditions, where the T m is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe.
- Stringent washing can be performed at temperatures about 5°C lower than the T m for the specific DNA hybrid under a particular set of conditions.
- the polynucleotides or nucleic acid molecules of the present invention refer to the polymeric form of nucleotides of at least 10 bases in length. These include DNA molecules (e.g., linear, circular, cDNA, chromosomal, genomic, or synthetic, double stranded, single stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hair-pinned, circular, or in a padlocked conformation) and RNA molecules (e.g., tRNA, rRNA, mRNA, genomic, or synthetic) and analogs of the DNA or RNA molecules of the described as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native inter-nucleoside bonds, or both.
- DNA molecules e.g., linear, circular, cDNA, chromosomal, genomic, or synthetic, double stranded, single stranded, triple-stranded, quadruplexed, partially double-
- the isolated nucleic acid molecule of the invention includes a nucleic acid molecule free of naturally flanking sequences (i.e., sequences located at the 5' and 3' ends of the nucleic acid molecule) in the chromosomal DNA of the organism from which the nucleic acid is derived.
- an isolated nucleic acid molecule can contain less than about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of naturally flanking nucleotide chromosomal DNA sequences of the microorganism from which the nucleic acid molecule is derived.
- the heterologous nucleic acid molecule is inserted into the expression system or vector in proper sense (5' ⁇ 3') orientation relative to the promoter and any other 5' regulatory molecules, and correct reading frame.
- the preparation of the nucleic acid constructs can be carried out using standard cloning methods well known in the art, as described by Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory Press, Cold Springs Harbor, New York (1989).
- U.S. Patent No. 4,237,224 to Cohen and Boyer also describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase.
- Suitable expression vectors include those which contain replicon and control sequences that are derived from species compatible with the host cell. For example, if E. coli is used as a host cell, plasmids such as pUC19, pUC18, or pBR322 may be used. Other suitable expression vectors are described in Molecular Cloning: a Laboratory Manual: 3rd edition, Sambrook and Russell, 2001, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acids, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Ausubel et al. eds., (1992).
- RNA transcription and messenger RNA e.g., DNA transcription and messenger RNA (“mRNA”) translation
- mRNA messenger RNA
- Transcription of DNA is dependent upon the presence of a promoter, which is a DNA sequence that directs the binding of RNA polymerase, and thereby promotes mRNA synthesis. Promoters vary in their "strength" (i.e., their ability to promote transcription). For the purposes of expressing a cloned gene, it is desirable to use strong promoters to obtain a high level of transcription and, hence, expression and surface display.
- any one of a number of suitable promoters may also be incorporated into the expression vector carrying the deoxyribonucleic acid molecule encoding the protein of interest coupled to a stall sequence.
- promoters such as the T7 phage promoter, lac promoter, trp promoter, recA promoter, ribosomal R A promoter, the P R and P L promoters of coliphage lambda and others, including but not limited, to lac ⁇ JV5, ompF, bla, Ipp, and the like, may be used to direct high levels of transcription of adjacent DNA segments.
- a hybrid trp-lac ⁇ JV5 (tac) promoter or other E. coli promoters produced by recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted gene.
- SD Shine- Dalgarno
- the host cell is a prokaryote.
- Such cells serve as a host for expression of recombinant proteins for production of recombinant therapeutic proteins of interest.
- Exemplary host cells include E. coli and other Enter vbacteriaceae, Escherichia sp., Campylobacter sp., Wolinella sp., Desulfovibrio sp. Vibrio sp., Pseudomonas sp. Bacillus sp., Listeria sp.,
- Staphylococcus sp. Streptococcus sp., Peptostreptococcus sp., Megasphaera sp., Pectinatus sp., Selenomonas sp., Zymophilus sp., Actinomyces sp., Arthrobacter sp., Frankia sp., Micromonospora sp., Nocardia sp., Propionibacterium sp., Streptomyces sp., Lactobacillus sp., Lactococcus sp., Leuconostoc sp., Pediococcus sp.,
- Bordetella sp. Brucella sp., Capnocytophaga sp., Cardiobacterium sp., Eikenella sp., Francisella sp., Haemophilus sp., Kingella sp., Pasteurella sp., Flavobacterium sp. Xanthomonas sp., Burkholderia sp., Aeromonas sp., Plesiomonas sp., Legionella sp.
- alpha-proteobacteria such as Wolbachia sp., cyanobacteria, spirochaetes, green sulfur and green non-sulfur bacteria, Gram-negative cocc Gram negative bacilli which are fastidious, Enterobacteriaceae -glucose-fermenting gram- negative bacilli, Gram negative bacilli - non-glucose fermenters, Gram negative bacilli - glucose fermenting, oxidase positive.
- Wolbachia sp. cyanobacteria, spirochaetes, green sulfur and green non-sulfur bacteria
- Gram-negative cocc Gram negative bacilli which are fastidious
- Enterobacteriaceae -glucose-fermenting gram- negative bacilli Gram negative bacilli - non-glucose fermenters
- Gram negative bacilli - glucose fermenting oxidase positive.
- the E. coli host strain [00121] In one embodiment of the present invention, the E. coli host strain
- C41(DE3) is used, because this strain has been previously optimized for general membrane protein overexpression (Miroux et al., "Over-production of Proteins in Escherichia coli: Mutant Hosts That Allow Synthesis of Some Membrane Proteins and Globular Proteins at High Levels," JMol Biol 260:289-298 (1996). Further optimization of the host strain includes deletion of the gene encoding the DnaJ protein (e.g., AdnaJ cells).
- suitable techniques may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus.
- suitable techniques may include calcium chloride transformation, electroporation, and transfection using bacteriophage.
- a key advantage of the prokaryotic host cell of invention includes: (i) the massive volume of data surrounding the genetic manipulation of bacteria; (ii) the established track record of using bacteria for protein production -30% of protein therapeutics approved by the FDA since 2003 are produced in E. coli bacteria; and (iii) the existing infrastructure within numerous companies for bacterial production of protein drugs.
- the process employed using the methods and composition of the invention provides a scalable, cost-effective, optimal recombinant glycoprotein expression, free of human pathogens, free of immunogenic N- and 0-linked glycosylation reactions, capable of rapid cloning and fast growth rate, fast doubling time (-20 minutes), high growth (high OD), high titer and protein yields (in the range of 50% of the total soluble protein (TSP)), ease of product purification from the periplasm or supernatant, genetically tractable, thoroughly studied, compatible with the extensive collection of expression optimization methods (e.g., promoter engineering, mRNA stabilization methods, chaperone co-expression, protease depletion, etc.).
- expression optimization methods e.g., promoter engineering, mRNA stabilization methods, chaperone co-expression, protease depletion, etc.
- prokaryotes e.g., E. coli as a host for glycoprotein expression
- yeast and all other eukaryotes there are no native glycosylation systems.
- glycosylation-related genes is expected to have little to no bearing on the viability of glycoengineered E. coli cells.
- the potential for non-human glycan attachment to target proteins by endogenous glycosylation reactions is essentially eliminated in these cells.
- an alternative for glycoprotein expression and production of various oligosaccharide compositions is disclosed where a prokaryotic host cell is used to produce the same and produce N-linked glycoproteins, which provide an attractive solution for circumventing the significant hurdles associated with eukaryotic cell culture.
- a prokaryotic host cell is used to produce the same and produce N-linked glycoproteins, which provide an attractive solution for circumventing the significant hurdles associated with eukaryotic cell culture.
- bacteria as a production vehicle that yields structurally homogeneous human-like N-glycans while at the same time dramatically lowering the cost and time associated with protein drug development and manufacturing is an object of the invention.
- the Man 3 GlcNAc 2 oligosaccharide structure is generated via a recombinant pathway comprising lipid-linked biosynthesis in E. coli.
- one of several eukaryotic glycosyltransferases is functionally expressed in E. coli and the resulting lipid-linked oligosaccharides are transferred onto a protein via an oligosaccharyl transferase.
- Glycan assembly in the prokaryotic host cells is lipid-linked on undecaprenyl phosphate (Und-P) unlike eukaryotes where they are assembled on dolichol phosphate (Dol-P).
- Und-P undecaprenyl phosphate
- Dol-P dolichol phosphate
- N-linked glycosylation proceeds through the sequential addition of nucleotide-activated sugars onto a lipid carrier, resulting in the formation of a branched heptasaccharide.
- This glycan is then flipped across the inner membrane by PglK (formerly WlaB) and the OTase PglB then catalyzes the transfer of the glycan to an asparagine side chain.
- Bac is 2,4-diacetamido-2,4,6- trideoxyglucose; GalNAc is ⁇ -acetylgalactosamine; HexNAc is N-acetylhexosamine; Glc is glucose. See Szymanski et al., "Protein Glycosylation in Bacterial Mucosal Pathogens," Nat Rev Microbiol 3:225 -37 (2005).
- the PglK flippase is responsible for translocating the lipid-linked C. jejuni heptasaccharide across the inner membrane. Fortuitously, PglK exhibits relaxed specificity towards the glycan structure of the lipid-linked oligosaccharide intermediate (Alaimo et al., "Two Distinct But
- the host cell of the invention expresses a flippase enzyme activity (Genbank AN AP009048.1), which translocates the undecaprenol-linked oligosaccharide across the inner membrane.
- a flippase enzyme activity Genebank AN AP009048.1
- Such enzyme activity may be endogenous or heterologous or engineered to be modified in expression.
- the prokaryotic host cell comprises a flippase activity including pglK and rftl.
- oligosaccharyltransferase oligosaccharyltransferase
- OST oligosaccharyltransferase
- Various prokaryotic and eukaryotic OSTs have the ability to transfer the lipid-linked oligosaccharide onto the target protein.
- the present invention discloses a prokaryotic system that demonstrates the transfer of high-mannose, hybrid and complex glycans onto a protein.
- the prokaryotic protein expression system comprises at least one OST activity to produce a glycosylated target protein.
- the host cell expresses an oligosaccharyl transferase enzyme activity (EC 2.4.1.119) in addition to the glycosyltransferase enzymes.
- Various OSTs (Table 2) can be expressed and may be endogenous or heterologous or engineered to be modified in expression.
- the prokaryotic host cell comprises at least one oligosaccharyl transferase activity, such as PglB from C. jejuni (Aebi et al.) or C. lari (Valderrama- Rincon et al.). The oligosaccharide transferred onto the protein is N-linked to the protein.
- Dde_3699 desulfuricans str. G20 ABB40492.1
- yeast Pichia pastoris Hamilton, S.R., et al, Humanization of yeast to produce complex terminally sialylated glycoproteins. Science, 2006.
- Mammalian host cells have been shown to add uncontrollable levels of mannose-6-phosphate and fucose to glycans and often lack terminal sialic acid (Van Patten, S.M., et al., Effect of mannose chain length on targeting of
- glucocerebrosidase for enzyme replacement therapy of Gaucher disease.
- the oligosaccharide chain attached by the prokaryotic glycosylation machinery is structurally distinct from that attached by higher eukaryotic and human glycosylation pathways (Weerapana et al., "Asparagine-linked Protein Glycosylation: From Eukaryotic to Prokaryotic Systems," Glycobiology 16:91R-101R (2006).
- the oligosaccharide compositions produced in the prokaryotes and from the methods of the present invention are also distinguishable from eukaryotic systems such as yeast, insect, mammalian and even human cells.
- oligosaccharide compositions produced by the methods of the invention in comparison to eukaryotic host cell expression systems, e.g., CHO, NSO, lemna, Sf9.
- the oligosaccharide compositions of the present invention lack fucose.
- the absence of fucose in antibodies has been associated w increased ADCC and CDC activities (Shinkawa T et al., The absence of fucose but not the presence of galactose or bisecting N-acetylglucosamine of human IgGl complex-type oligosaccharides shows the critical role of enhancing antibody- dependent cellular cytotoxicity. J Bio Chem, 278, 3466-73, 2003).
- prokaryotes inherently lack 0-linked glycans, which is associated with
- glycoengineered E. coli provides (i) control of the specific site and stoichiometry of glycosylation including at the N- or C-terminus, (ii) selection of the glycoform (iii) ability to engineer novel glycoforms because glycosylation is not an essential process in E.
- the oligosaccharide compositions of the present invention can be uniform and also be enriched so as to boost anti-inflammatory properties, e.g., enriching for a2,6 sialic acid on Fc of intravenous Ig (IVIG) (Anthony et al., Identification of a receptor required for the anti -inflammatory activity of IVIG. Natl Acad Sci USA 2008 Dec 16;105(50):19571-8). Additional studies have indicated the presence of Neu5Gc-specific antibodies in all humans, sometimes at high levels (Ghaderi et al., Implications of the presence of N-glycolylneuraminic acid in recombinant therapeutic glycoproteins.
- IVIG intravenous Ig
- the prokaryotic system can yield homogenous glycans at a relatively high yield.
- the oligosaccharide composition consists essentially of a single glycoform in at least 50, 60, 70, 80, 90, 95, 99 mole %.
- the oligosaccharide composition consists essentially of two desired glycoforms of at least 50, 60, 70, 80, 90, 95, 99 mole %.
- the oligosaccharide composition consists essentially of three desired glycoforms of at least 50, 60, 70, 80, 90, 95, 99 mole %.
- the oligosaccharide compositions produced are GlcNAci_5Man3GlcNAc 2 and Man3GlcNAc 2 .
- Certain glycol-engineered host cells produce oligosaccharide composition that is predominantly GlcNAcMan3GlcNAc 2 or GlcNAc 2 Man 3 GlcNAc 2 .
- the oligosaccharide compositions produced are
- Gali_5GlcNAci_5Man3GlcNAc 2 and Man3GlcNAc 2 Certain glycol-engineered host cells produce oligosaccharide composition that is predominantly
- GalGlcNAcMan 3 GlcNAc 2 GalGlcNAc 2 Man 3 GlcNAc 2 or
- the oligosaccharide compositions produced are NANAi_5Gali_5GlcNAci_5Man3GlcNAc 2 .
- Certain glycol-engineered host cells produce oligosaccharide composition that is predominantly
- the oligosaccharide compositions produced are Man 2 GlcNAc 2 , Man 4 GlcNAc, Man 3 GlcNAc 2 , HexMan 3 GlcNAc 2 ,
- the present invention therefore, provides stereospecific biosynthesis of a vast array of novel oligosaccharide compositions and N-linked glycoproteins.
- reconstitution of a eukaryotic N-glycosylation pathway in E. coli using metabolic pathway and protein engineering techniques results in N- glycoproteins with structurally homogeneous human-like glycans. This ensures that each glycoengineered cell line corresponds to a unique carbohydrate signature.
- the glycans can be analyzed by metabolic labeling of cells with 3 H-
- GlcNAc and 3 H -mannose or with fluorescent lectins e.g., AlexaFluor-ConA.
- Glycans can also be released with PNGase and detected under MALDI/TOF-MS.
- Quantification of the glycans can be estimated with the MS or more exactly done through HPLC.
- NMR can determine the glycosidic linkages of the glycan structures.
- a gene encoding a target protein is introduced into the host cell.
- Target proteins include without limitation cytokines such as interferons, G-CSF, coagulation factors such as factor VIII, factor IX, and human protein C, soluble IgE receptor a-chain, IgG, IgG fragments, IgM, interleukins, urokinase, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor- 1, osteoprotegerin, a-1 antitrypsin, DNase II, a-feto proteins, AAT, rfiTBP-1 (aka TNF binding protein 1), TACI-Ig (transmembrane activator and calcium modulator and cyclophilin ligand interactor), FSH (follicle stimulating hormone), GM-C
- hormones human insulin and insulin analogues, calcitonin, parathyroid hormone, human growth hormone, glucagons, somatropin and insulin growth factor 1
- interferons al, a2a, a2b and ylb
- interleukins 2 and 11 light and heavy chains raised against vascular endothelial growth factor-a, tumor necrosis factor a, cholera B subunit protein, B-type natriuretic peptide, granulocyte colony stimulating factor and tissue plasminogen activator.
- Target proteins also include a glycoprotein conjugate comprising a protein and at least one peptide comprising a D-Xi-N-X 2 -T motif fused to the protein, wherein D is aspartic acid, Xi and X 2 are any amino acid other than proline, N is asparagine, and T is threonine.
- 100 mol% of glycans are transferred onto a target protein by an OST.
- the methods provide culturing the host cells under oxidative conditions.
- an oxidative bacterial strain is used.
- Culture conditions may result in increased yield and titre of glycoproteins and glycans.
- Such process conditions and parameters include regulating pH, temperature, osmolality, culture duration, media, nutrients, concentration of dissolved oxygen, nitrogen, level or availability of nucleotide sugars and even carbon source, e.g., glycerol (FIG. 9B) can influence the production system.
- Culture conditions may vary depending on the product and the specific host cell utilized. Productivity of the system is also likely to be affected by the culture conditions. Additional metabolic engineering may be required for maximum productivity and to limit growth-inhibiting metabolites.
- glycans are synthesized in a cell- free extract using an acceptor glycan, purified enzyme/lysate and adding nucleotide sugars as described in Example 7.
- the present invention provides a cell culture comprising a recombinant prokaryote, UDP-GlcNAc and a GnT (EC 2.4.1.101; EC 2.4.1.143; EC 2.4.1.145) wherein said GnT catalyzes the transfer of a UDP-GlcNAc residue onto said terminal mannose residue, cultured under conditions effective to produce an oligosaccharide composition having a terminal GlcNAc residue.
- the present invention provides a cell culture comprising a recombinant prokaryote, UDP-Galactose and a GalT (EC 2.4.1.38) wherein said GalT catalyzes the transfer of a UDP-Galactose residue onto said terminal GlcNAc residue, cultured under conditions effective to produce an oligosaccharide composition having a terminal galactose residue.
- the present invention provides a cell culture comprising a recombinant prokaryote, CMP-NANA and a sialyltransferase
- sialyltransferase catalyzes the transfer of a CMP-NANA residue onto said terminal galactose residue, cultured under conditions effective to produce an oligosaccharide composition having a terminal sialic acid residue.
- Another aspect of the present invention relates to a glycosylated antibody comprising an Fv portion which recognizes and binds to a native antigen and an Fc portion which is glycosylated at a conserved asparagine residue.
- Alternative embodiments include diabody, scFv, scFv-Fc, scFv-CH, Fab and scFab.
- glycosylated antibody of the present invention can be in the form of a monoclonal or polyclonal antibody.
- a single immunoglobulin molecule is comprised of two identical light (L) chains and two identical heavy (H) chains.
- Light chains are composed of one constant domain (C L ) and one variable domain (V L ) while heavy chains are consist of three constant domains (C H I , C H 2 and C H 3) and one variable domain (V H ).
- C L constant domain
- V L variable domain
- V H variable domain
- the Fc portion is glycosylated at a conserved Asn297 residue. Attachment of N-glycan at this position results in an "open" conformation that is essential for effector interaction.
- the polynucleotides encoding a monoclonal antibody are isolated, such as from mature B-cells or hybridoma cell, such as by RT- PCR using oligonucleotide primers that specifically amplify the genes encoding the heavy and light chains of the antibody, and their sequence is determined using conventional procedures.
- the isolated polynucleotides encoding the heavy and light chains are then cloned into suitable expression vectors, which are then transfected into the host cells of the present invention, and monoclonal antibodies are generated.
- recombinant DNA techniques are used to modify the heavy and light chains with N-terminal export signal peptides (e.g., PelB signal peptide) to direct the heavy and light chain polypeptides to the bacterial periplasm.
- the heavy and light chains can be expressed from either a bicistronic construct (e.g., a single mRNA that is translated to yield the two polypeptides) or, alternatively, from a two cistron system (e.g., two separate mRNAs are produced for each of the heavy and light chains).
- a bicistronic construct e.g., a single mRNA that is translated to yield the two polypeptides
- a two cistron system e.g., two separate mRNAs are produced for each of the heavy and light chains.
- translation levels can be raised or lowered using a series of translation initiation regions (TIRs) inserted just upstream of the bicistronic and two cistron constructs in the expression vector (Simmons et al., "Translational Level is a Critical Factor for the Secretion of TIRs)
- the polynucleotide(s) encoding a monoclonal antibody can further be modified in a number of different ways using recombinant DNA technology to generate alternative antibodies.
- the constant domains of the light and heavy chains of, for example, a mouse monoclonal antibody can be substituted for those regions of a human antibody to generate a chimeric antibody.
- the constant domains of the light and heavy chains of a mouse monoclonal antibody can be substituted for a non-immunoglobulin polypeptide to generate a fusion antibody.
- the constant regions are truncated or removed to generate the desired antibody fragment of a monoclonal antibody.
- site- directed or high-density mutagenesis of the variable region can be used to optimize specificity and affinity of a monoclonal antibody.
- the antibody of the present invention is a humanized antibody.
- Humanized antibodies are antibodies that contain minimal sequences from non-human (e.g. murine) antibodies within the variable regions. Such antibodies are used therapeutically to reduce antigenicity and human anti-mouse antibody responses when administered to a human subject.
- humanized antibodies are typically human antibodies with minimal to no non-human sequences.
- a human antibody is an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human.
- Humanized antibodies can be produced using various techniques known in the art.
- An antibody can be humanized by substituting the complementarity determining region (CDR) of a human antibody with that of a non-human antibody (e.g. mouse, rat, rabbit, hamster, etc.) having the desired specificity, affinity, and capability (Jones et al., "Replacing the Complementarity-Determining Regions in a Human Antibody With Those From a Mouse," Nature 321 :522-525 (1986);
- CDR complementarity determining region
- the humanized antibody can be further modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability.
- Bispecific antibodies are also suitable for use in the methods of the present invention.
- Bispecific antibodies are antibodies that are capable of specifically recognizing and binding at least two different epitopes.
- Bispecific antibodies can be intact antibodies or antibody fragments. Techniques for making bispecific antibodies are common in the art (Traunecker et al., "Bispecific Single Chain Molecules (Janusins) Target Cytotoxic Lymphocytes on HIV Infected Cells," EMBO J. 10:3655- 3659 (1991) and Gruber et al, "Efficient Tumor Cell Lysis Mediated by a Bispecific Single Chain Antibody Expressed in Escherichia coli," J. Immunol. 152:5368-74 (1994)).
- the present invention relates to novel glycosylated peptides with desired glycans.
- Advantages of glycosylated glucagon peptide include improved solubility, improved physical stability toward gel and fibril formation, with increased half-life and improved activity and pharmacokinetic properties.
- Other advantages include the capability of a single or simultaneous in vivo process to produce both protein and glycans thereby avoiding multiple steps.
- the novel glycosylated glucagon peptides have prolonged exposure in vivo due to prolonged plasma elimination half-life and a prolonged absorption phase and improved aqueous solubility at neutral pH or slightly basic pH.
- the present invention has improved stability towards formation of gels and fibrils in aqueous solutions.
- the predominant N-glycan is one that does not illicit immunogenicity to mammals.
- N-glycosylation site occupancy can vary in eukaryotic systems, e.g., CHO and yeast for any particular glycoproteins produced. Growth conditions can be made to control occupancy at sites. [00171] Typically, glucagon peptide has no glycosylation. In certain
- glycosylation sites are engineered onto the peptide.
- the glucagon peptide of the present invention has one glycosylation site.
- the method provides adding multiple glycans per peptide to confer better activity.
- the host cells are engineered to produce glucagon peptides, with specific N-glycan as the predominant species.
- the methods of the present invention provide glycoproteins and glycopeptides comprising one or more glycoforms.
- the glycoforms include M4, M5, GO, G0(1), G0(2), G0(3), Gl, G2, G3, G4, G5, SI, S2, S3, S4, S5 which confer improved solubility or stability properties as well as increased receptor binding activity.
- aglycosylated peptides such as glucagon
- the present invention is expected to increase half-life for the peptide.
- Additional peptides have been produced by the methods of the prevention invention such as hGH, ASNase, and ILl-Ra. Production of other peptides are within the scope of the invention.
- at least 50 mol% of glucagon peptide is glycosylated.
- a generalized method to enhance immunogenicity of candidate antigens would reduce the time and costs invested in the early stages of vaccine development and could be applied to any disease of interest.
- One documented strategy to enhance immunogenicity is mannosylation, the conjugation of mannose-terminal glycans to proteins.
- Mannose targets antigens to specific receptors including CD206 and CD209 on antigen presenting cells (APC) for internalization by receptor-mediated
- Mannosylation of antigens confers several advantages including: (i) increased antigen uptake by APC, (ii) enhanced MHC class II-mediated antigen presentation by up to 10,000-fold, (iii) promotion of T cell proliferation and maturation, and (iv) improved humoral immune response including bactericidal activity of serum (Arigita, C, et al, Liposomal Meningococcal B Vaccination: Role of Dendritic Cell Targeting in the Development of a Protective Immune Response. Infection and Immunity, 2003. 71(9): p. 5210- 5218.). E. coli has not been used as a platform for vaccine production primarily because it does not naturally encode a pathway for N-glycosylation and has therefore been unsuitable for the manufacture of glycoproteins.
- the present invention provides methods and compositions for mannosylated vaccine antigens through glycoengineered strains of E. coli.
- the effect of mannosylation on immunogenicity is assessed in a mouse model.
- the ability to produce vaccine candidates in bacteria provides multiple advantages.
- E. coli is an excellent platform for expression of ExPEC (extraintestinal pathogenic) and other bacterial proteins, offers facile recombinant DNA
- coli would allow for synthesis of the desired glycoprotein in vivo without the need for further chemical or enzymatic modification. Accordingly, a new paradigm for vaccine development is provided by a method to augment the efficacy of E. co/z ' -produced vaccine candidates.
- Glycoengineered E. coli of the present invention is contemplated to produce mannosylated proteins with enhanced immunogenicity. Synthesis of mannosylated antigens in E. coli represents a significant advance in vaccine development allowing for inexpensive, rapid production of candidate proteins with enhanced immunogenic properties.
- a uropathogenic E. coli (UPEC) antigen, cl275 was selected for preliminary expression and glycosylation.
- the cl275 protein was targeted to the periplasm of the glycoengineered E. coli, modified with a GlycTag (Fig 3a), and co- expressed with the OST PglB and the glycosyltransferases necessary to assemble the C. jejuni heptasaccharide glycan.
- glycosylated cl275 Upon purification, the glycosylated cl275 was evident based on the appearance of slower-migrating bands on a Western blot and reactivity of these products with the GalNAc specific lectin soybean agglutinin (SBA), which is known to recognize this oligosaccharide (FIG. 12) (Young, N.M., et al., Structure of the ⁇ -linked glycan present on multiple glycoproteins in the Gram- negative bacterium, Campylobacter jejuni. J Biol Chem, 2002. 277(45): p. 42530-9.). Interestingly, glycosylation of cl275 is not necessarily dependent on the presence of the GlycTag.
- the conventional vaccines induce merely a humoral immune response.
- DNA vaccines hold great promise since they evoke both humoral and cell-mediated immunity, without the same dangers associated with live virus vaccines.
- DNA vaccines may be delivered to same or different tissue or cells than the live virus that has to bind to specific receptors. The production of antigens in their native forms improves the presentation of the antigens to the host immune system. Unlike live attenuated vaccines, DNA vaccines are not infectious and can not revert to virulence.
- Candidate antigens are modified with the various oligosaccharides such as Man3GlcNAc 2 . This can result in generation of antigens modified with a eukaryotic mannose-terminal glycan for use in vaccine formulations.
- Numerous target antigens are selected from a published assessment of ExPEC vaccine candidates that are known to confer protection in a mouse model. It should be pointed out, however, that the invention is highly modular and thus could be widely applied to enhance vaccine development for a variety of protein and peptide candidates.
- Therapeutic formulations of the glycoprotein can be prepared by mixing the glycoprotein having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
- Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
- buffers such as phosphate, citrate, and other organic acids
- antioxidants including ascorbic acid and methionine
- preservatives such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzy
- low molecular weight polypeptide polypeptide
- proteins such as serum albumin, gelatin, or immunoglobulins
- hydrophilic polymers such as polyvinylpyrrolidone
- amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine
- chelating agents such as EDTA
- sugars such as sucrose, mannitol, trehalose or sorbitol
- salt-forming counter-ions such as sodium
- metal complexes e.g., Zn-protein complexes
- non-ionic surfactants such as TWEENTM, PLURONICSTTM or polyethylene glycol (PEG).
- a glycan is a convenient anchor for a PEG polymer because certain sugars, such as mannose or galactose, can easily be converted to reactive aldehydes in the presence of a mild oxidizer such as sodium periodate (Soares, A.L., et al, Effects of polyethylene glycol attachment on physicochemical and biological stability of E. coli L-asparaginase. Int J Pharm, 2002. 237(1-2): p. 163-70).
- a PEG polymer functionalized with a hydrazine group can then be used to create a glycoPEGylated bioconjugate. This allows the synthesis of site-specific, highly controlled,
- Site-specific PEGylation methods involve either: (i) mutating lysines to allow PEG targeting to a specific lysine (Narimatsu, S., et al, Lysine-deficient lymphotoxin-alpha mutant for site-specific PEGylation. Cytokine, 2011. 56(2): p. 489-93. Youn, Y.S. and K.C.
- the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
- the formulation may further comprise another antibody or a chemotherapeutic agent.
- Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
- the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly- (methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
- colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration
- sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the glycoprotein, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
- copolymers of L-glutamic acid and y ethyl-L-glutamate non-degradable ethylene-vinyl acetate
- degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
- poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene - vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
- encapsulated antibodies When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S--S bond formation through thio- disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
- the pharmaceutical composition may be lyphilized. Lyophilized antibody formulations are described in U.S. Pat. No. 6,267,958. Stable aqueous antibody formulations are described in U.S. Pat. No. 6,171,586B1.
- compositions of the present invention can be used for non-therapeutic purposes, such as assays, diagnostics, reagents and kits.
- the invention further provides an article of manufacture and kit containing oligosaccharide materials.
- the article of manufacture comprises a container with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials such as glass or plastic.
- the container holds a composition comprising the oligosaccharide preparations described herein.
- the kit includes the glycoprotein.
- the label on the container indicates that the composition is used for the treatment or prevention of a particular disease or disorder, and may also indicate directions for in vivo, such as those described above.
- the kit of the invention comprises the container described above and a second container comprising a buffer. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- prokaryotes e.g., E. coli
- synthesis of the various glycoforms in prokaryotes facilitates attachment to a protein, incorporation into a glycan array, and utilization as a substrate to produce other human-like, N-linked glycans, diagnostics, kits or reagents.
- Und-PP-GlcNAc a candidate precursor for the desired Man3GlcNAc 2 glycan.
- the Saccharomyces cerevisiae pi,4-GlcNAc transferase that is comprised of two subunits, Algl 3 and Algl 4 was expressed.
- Algl 4 is an integral membrane protein that functions as a membrane anchor to recruit soluble Algl 3 to the cytosolic face of the ER, where catalysis to Dol-PP-GlcNAc 2 occurs (Bickel, T. et al, Biosynthesis of lipid- linked oligosaccharides in Saccharomyces cerevisiae: Algl3p and Algl4p form a complex required for the formation of
- Plasmid pMW07 was constructed (Valderrama-Rincon et. al.) Plasmid pMQ70 (Shanks et. al, 2006 AEM. 72(7)5027-5036.) was linearized with Ahdl which is an isoschizomer of Eaml 1051. The pl5a ori and cat gene were amplified from pBAD33 and used to co-transform yeast with the linearized vector pMQ70. Homologous recombination in yeast resulted in replacement of the colEl ori and bla gene generating vector pMW07 (Valderrama-Rincon et al.). Table 3 lists the construction and genotype of various strains.
- Gao et al "Non-radioactive analysis of lipid linked oligosaccharide composition by fluorophore-assisted carbohydrate electrophoresis," Method Enzymol 415: 3-20). The purified
- oligosaccharides were analyzed by MALDI-TOF mass spectrometry using
- DAB Sciex TOF/TOF 5800 dihydroxybenzoic acid as the matrix (AB Sciex TOF/TOF 5800).
- the glycan figures are in standard CFG (Consortium for Functional Genomics) black and white notation, which were generated in Glyco Workbench 2.0.
- MansGlcNAc 2 glycoform is a key intermediate in glycan synthesis.
- this key glycoform is synthesized on the cytosolic side of the endoplasmic reticulum membrane.
- the enzyme Algl 1 catalyzes the addition of two, al,2-mannose residues to the a 1,3 mannose of the Man 3 GlcNAc 2 glycan core.
- the gene encoding Algl 1 from Saccharomyces cerevisiae was cloned as a fusion to the gene (gst) encoding glutathione S-transferase into plasmid pMW07-YCG-PglB.CO which is used for production of the Man 3 GlcNAc 2 trimannosyl core (Valderrama-Rincon et al.)
- the resulting plasmid was transformed into E. coli MC4100 AwaaL gmdv.kan by electroporation (Gly02).
- Gly02 was grown in 100 mL of Luria-Bertani (LB) broth and induced by adding 0.2% (v/v) arabinose once the culture reached an optical density of 3.0.
- Man5GlcNAc 2 glycoform (FIG. 1A).
- a minor peak appeared, which was consistent with the Man 3 GlcNAc 2 glycoform (m/z 933.5 Na+).
- minor peaks including glycans consistent with Man 2 GlcNAc 2 ,
- Man 4 GlcNAc, Man 3 GlcNAc 2 , HexMan 3 GlcNAc 2 , HexMan 5 GlcNAc Man 6 GlcNAc appeared.
- purified glycans were treated with a a 1,2 mannosidase (Prozyme) according to manufacturer's protocol. Following incubation with the enzyme, glycans were labeled and analyzed by mass spectrometry and a FACE gel in the method of Gao et al. In the untreated sample, a predominant peak consistent with the Man5GlcNAc 2 glycoform was observed (not shown).
- Man5GlcNAc 2 glycoform is challenging by other means since, in eukaryotes, it is a transient oligosaccharide. Synthesis of MansGlcNAc 2 in this system was also challenging due to difficulty in expression of a sufficient amount of active enzyme. Various fusion partners, along with Algl 1 alone, were explored and resulted in the lack of efficient product formation for majority of the Algl 1 moieties examined. The gst and mstX fused to Algl 1 produced the Man 5 GlcNAc 2 glycoform in this system.
- the GlcNAcMan 3 GlcNAc 2 glycoform is a key intermediate in glycan synthesis. This glycoform is typically only found on TV- linked glycans attached to proteins in the Golgi of eukaryotes. Here the glycan was assembled on a lipid carrier in E. coli. To accomplish this, the gene encoding a truncated form (residues 30-446) of Nicotiana tabaccum N- acetylglucosaminyltransferase I (GnTI) was synthesized.
- GnTI Nicotiana tabaccum N- acetylglucosaminyltransferase I
- the GnTI gene was amplified by PCR and subcloned into the plasmid pMQ70 as a fusion to the gene (malE) encoding E. coli maltose binding protein (MBP) lacking its native signal sequence.
- the resulting pMQ70-MBP-NtGnTI was transformed into E.
- GlcNAcMan3GlcNAc 2 glycoform (FIG. 2A). A minor peak was consistent with the Man3GlcNAc 2 glycoform (m/z 933.4 Na+).
- purified glycans were treated with a ⁇ - ⁇ - acetylglucosaminidase (New England Biolabs) according to manufacturer's protocol. Following incubation with the enzyme, glycans were labeled and analyzed by mass spectrometry, and a FACE gel in the method of Gao et al. In the untreated sample, a predominant peak consistent with the GlcNAcMan3GlcNAc 2 glycoform was observed (not shown). In the treated sample, the predominant peak is consistent with a
- Man3GlcNAc 2 glycoform (FIG. 2B). This confirms the expected addition of a ⁇ - GlcNAc to the Man3GlcNAc 2 glycan core. As a result, the human-like
- GlcNAcMan 3 GlcNAc 2 glycoform can be produced by expression of GnTI in E. coli. Isolation of the GlcNAcMan3GlcNAc 2 glycoform is challenging by other means since, in eukaryotes, it is a transient oligosaccharide. Obstacles were also encountered using this system, where expression of human GnTI alone, or fused to mstX, in E. coli was first attempted and did not efficiently produce the desired GlcNAcMan 3 GlcNAc 2 glycoform (figure not shown). Moreover, when not fused to MBP, the N. tabaccum GnTI failed to produce the desired product (figure not shown).
- Example 5 Production of TV-linked GlcNAc 2 Man 3 GlcNAc 2 complex oligosaccharide in E. coli
- GlcNAc 2 Man 3 GlcNAc 2 complex glycoform (“GO") is a key intermediate in glycan synthesis, as it is the "core” by which the glycan is fully decorated. This glycoform is typically only found on TV- linked glycans attached to proteins in the Golgi of eukaryotes. Here the glycan was assembled on a lipid carrier in E. coli.
- GnTII human N-acetylglucosaminyltransferase II
- GlcNAc 2 Man 3 GlcNAc 2 glycoform (FIG. 3). A minor peak was consistent with the Man 3 GlcNAc 2 glycoform (m/z 933.5 Na+). A second minor peak consistent with GlcNAcMan 3 GlcNAc 2 (m/z 1136.6 Na+) was also observed in the spectrum.
- GnTII in the glycoengineered E. coli proved to be challenging, where GnTII from three organisms were examined by expression alone, or when fused to mstX or MBP. Additionally, GnTII expression was examined in both oxidative and non-oxidative bacterial strains. Of the six GnTII moieties and four bacterial strains examined, efficient production of the GlcNAc 2 Man 3 GlcNAc 2 glycan was seen with MBP-fused, human GnTII in one of the four bacterial strains (figure not shown).
- Synthesis of multiantennary, TV-linked glycans is a common feature in humans and other eukaryotes. Production of triantennary oligosaccharides is accomplished by the addition of a GlcNAc residue to GlcNAc 2 Man 3 GlcNAc 2 by TV- acetylglucosaminyltransferase IV (GnTIV). GnTIV can also act on
- GlcNAcMan 3 GlcNAc 2 producing a biantennary, hybrid oligosaccharide that is a structural isomer of the GlcNAc 2 Man3GlcNAc 2 complex glycan.
- the bacterial codon optimized gene encoding a truncated form (residues 93-535) of bovine GnTIV was synthesized.
- the GnTIV gene was amplified by PCR and subcloned into the plasmid pMQ70 as a fusion to MBP lacking its native signal sequence. The resulting pMQ70- MBP-hGnTIV was transformed into E.
- Glycosyltransferase expression was induced with 0.2% (v/v) arabinose, added immediately upon inoculation into 1 L of Luria-Bertani (LB) broth.
- GlcNAc 2 Man3GlcNAc 2 glycoform (FIG. 4A). In some samples, a minor peak was consistent with the Man3GlcNAc 2 glycoform (m/z 933.5 Na+).
- purified glycans were treated with a ⁇ - ⁇ -acetylglucosaminidase (New England Biolabs) according to manufacturer's protocol. Following incubation with the enzyme, glycans were labeled and analyzed by mass spectrometry. In the untreated sample, a predominant peak consistent with the GlcNAc 2 Man3GlcNAc 2 glycoform was observed (not shown).
- the resulting construct was transformed into E. coli cells (Origami2 gmdv.kan) by electroporation along with a second plasmid pMW07-YCG-MBP- NtGnTI for production of the GlcNAcMan 3 GlcNAc 2 substrate oligosaccharide to create strain GLY06.1.
- Glycosyltransferase expression was induced with 0.2% (v/v) arabinose, added immediately upon inoculation into 1 L of Luria-Bertani (LB) broth.
- the method for extraction and purification of the N-linked oligosaccharide was followed as described in Gao et al.
- the purified oligosaccharides were analyzed by MALDI-TOF mass spectrometry using DHB as the matrix (AB Sciex TOF/TOF 5800).
- GLY06 was induced with 0.2% v/v arabinose for 20 hr at 30 °C.
- oligosaccharide was isolated by following the methods described in Gao et al.
- the glycosyltransferases were expressed in a separate, 100 mL culture by induction with 0.2% v/v arabinose for 16 hr at 25°C. This culture was pelleted by centrifugation and resuspended in 2 ml of GnTIV activity buffer (50 mM tris, 10 mM MnCl 2 , pH 7.5) and sonicated. The lysate was clarified by centrifugation and 20 uL was added to the dried trimannosyl core substrate ( ⁇ 5 ⁇ ). An excess of nucleotide-sugar (20 ⁇ g) was added to the reaction and subsequently incubated at 30°C. The reaction was monitored by MALDI-TOF mass spectrometry at various time points over a 24 hr period.
- GalGlcNAc 2 Man 3 GlcNAc 2 glycoform is an intermediate in glycan synthesis. This glycoform is somewhat atypical in healthy adults, but has been seen in individuals with prostate cancer (Kyselova et al., "Alterations in the serum glycome due to metastatic prostate cancer," J. Proteome Res. (2007)).
- the glycan was assembled on a lipid carrier in E. coli.
- the gene encoding Helicobacter pylori P-l,4-galactosyltransferase (GalT) was synthesized, amplified by PCR, and subcloned into the plasmid pMQ70.
- the resulting pMQ70-HpGalT was transformed into MC4100 AwaaL gmdwkan (Gly04) and Origami2 gmdwkan (Gly04.1) by electroporation along with a second plasmid pMW07-YCG-MBP-NtGnTI for production of the GlcNAcMan 3 GlcNAc 2 substrate oligosaccharide.
- Glycosyltransferase expression was induced with 0.2% (v/v) arabinose, added immediately upon inoculation into 1 L of Luria-Bertani (LB) broth.
- GalGlcNAcMan3GlcNAc 2 glycoform (FIG. 6). In some samples, a minor peak was consistent with the Man 3 GlcNAc 2 glycoform (m/z 933.5 Na+) (figure not shown).
- Expression of GalT in the glycoengineered E. coli proved to be challenging, where the GalT from bovine and human, both unfused and fused to MBP and mstX, and Neisseria meningitides did not produce the desired oligosaccharide in E. coli (not shown). Moreover, expression of H. pylori GalT was examined in both oxidative and non-oxidative bacterial strains and efficient galactosylation by was only seen in the oxidative bacterial strain.
- Gal 2 GlcNAc 2 Man3GlcNAc 2 glycoform is a key intermediate in glycan synthesis. This glycoform is typically only found on TV- linked glycans attached to proteins in eukaryotes.
- the glycan was produced ex vivo using the GO oligosaccharides produced from Gly06 and the methods as described in Example 7. Analysis of the purified oligosaccharides by mass spectrometry revealed a
- the resulting pMQ132- HpGalT was transformed into Origami2 gmdwkan (Gly04.2) by electroporation along with a second plasmid pMW07-YCG-MBP-NtGnTI and a third plasmid pMQ70- MBP-hGnTII for production of the GlcNAc 2 Man3GlcNAc 2 substrate oligosaccharide.
- Glycosyltransferase expression was induced with 0.2% (v/v) arabinose, added immediately upon inoculation into 1 L of Luria-Bertani (LB) broth.
- Gal 2 GlcNAc 2 Man3GlcNAc 2 glycoform (FIG. 7A).
- Analysis of glycans synthesized in Gly04.2 revealed a peak (m/z 1662.2 Na+) consistent with G2 glycoform, a peak (m/z 1500.0 Na+) consistent with the Gl glycoform, and a peak (m/z 1337.9 Na+) consistent with GO glycoform.
- the same challenges described in Example 7 were encountered when producing the Gal 2 GlcNAc 2 Man3GlcNAc 2 glycoform in E. coli, since the same enzyme was used to produce both products.
- glycoprotein production ii
- glycan arrays facilitating the production of glycoanalytical tools, such as glycan arrays. Therefore, improvement to the yield of the trimannosyl core glycan, the MansGlcNAc 2 glycan, and addition of GlcNAc residues to the trimannosyl core were undertaken. Understanding that the nucleotide-sugar pool in E. coli may be limiting, enzymes in the nucleotide-sugar biosynthesis pathway were targeted for overexpression in the glycoengineered E. coli.
- ManB mannose-1 -phosphate guanylyltransferase
- ManC mannose-1 -phosphate guanylyltransferase
- GlmS glutamine-fructose- 6-phosphate transaminase
- Man3GlcNAc 2 trimannosyl core (Valderrama-Rincon et al.) by electroporation (GlyOl .2).
- the gene encoding GlmS from E. coli was cloned into the plasmid pTrc99Y (Valderrama-Rincon et al.) and transformed into E. coli MC4100 AwaaL gmdv.kan along with pMW07-YCG-MBP-NtGnTI by electroporation (Gly01.3).
- GlyO 1.1 coli MC4100 AwaaL gmdv.kan containing pMW07-YCG-MBP-NtGnTI (GlyO 1.1) were used as controls.
- GlyOl and GlyO 1.2 were grown in 100 mL of Luria-Bertani (LB) broth and expression was induced with 0.2% (v/v) arabinose at an optical density (O.D.) of 3.
- GlyO 1.1 and GlyO 1.3 were grown in 100 mL LB broth and expression was induced with 0.2%> (v/v) arabinose and 1 mM IPTG (GlyOl .3 only) at an O.D. of 3.
- oligosaccharide was followed as described in Gao et al.
- the purified oligosaccharides were analyzed by fluorophore-assisted carbohydrate electrophoresis (FACE) using the methods described in Gao et al.
- FACE fluorophore-assisted carbohydrate electrophoresis
- Glycerol provides a carbon source alternative to glucose so as not to effect gene expression from plasmids via promoter repression, as cAMP levels remain high in E. coli with excess glycerol.
- Use of glycerol appears to increase glycan yield as shown in FIG. 9B.
- Pyruvate plays a role in recycling GDP to GTP in the Krebs cycle.
- GTP is a substrate of GDP-mannose pyrophosphorylase that is required for GDP-mannose formation.
- Increased glycan yield is also contemplated with the addition of pyruvate FIG. 9C.
- GLY01.4 produced a single predominant peak (m/z 933.5 Na+) consistent with the desired M3 glycoform (Fig. 10D).
- GLY02.1 produced a single predominant peak (m/z 1257.7 Na+) consistent with the desired M5 glycoform (Fig. 10E).
- GLY01.5 produced a single predominant peak (m/z 1136.9 Na+) consistent with the desired hybrid
- the glucagon construct consists of glucagon with an N- linked glycosylation site
- Glucagon is expressed as a fusion to the C-terminus of MBP after three consecutive C-terminal TEV protease sites in the vector pTrc99Y.
- the genes encoding for ManC and ManB were also cloned into this vector past the 3 ' end of the glucagon coding region.
- the resulting plasmid was transformed into E. coli cells (Origami2Awa ⁇ zL, gmdv.kan) cells by electroporation along with a corresponding glycosyltransferase plasmid.
- a lOOmL culture of each strain was grown to an optical density at 600nm of ⁇ 2.0 and induced with 0.2% v/v arabinose for 16 hr followed by induction with 0.1 mM IPTG for 8hr at 30°C.
- Cells were harvested by centrifugation and resuspended in lysis buffer (50 mM P04 buffer, 300 mM NaCl, pH 8.0), sonicated, and spun to remove debris.
- the clarified cell lysate was loaded onto a pre-equilibrated Ni-NTA spin column (Qiagen) and washed with buffer containing 30 mM imidazole.
- the fusion protein was eluted with 200 ⁇ ⁇ of 300 mM imidazole.
- Eluted protein was subsequently incubated with ⁇ g of TEV protease (Sigma Aldrich) at 30°C. Samples were analyzed by mass spectrometry at various time points over a 24hr period.
- GlycTag containing four iterations of an N-glycosylation sequon optimized for the bacterial OST PglB is employed.
- IPTG isopropyl-P-D-thiogalactopyranoside
- coli cells (MC4100 AwaaLAgmd::kan) by electroporation. After inoculation in to 10L cultures of each strain was grown to an approximate optical density at 600nm of 3.0 and induced with the addition of 0.2% (v/v) arabinose and ImM IPTG. Glycoprotein was isolated by ConA affinity chromatography followed by Nickel affinity chromatography, as previously (Valerrama-Rincon, et. al.). The partially purified samples were analyzed Western blot using an anti-hexahistidine antibody and the ConA lectin (FIG. 12).
- oligosaccharide structure is present as normal human N-glycans, and it is currently in use in a human therapeutic (Van Patten, S.M., et al, Effect of mannose chain length on targeting of glucocerebrosidase for enzyme replacement therapy of Gaucher disease. Glycobiology, 2007. 17(5): p. 467-478.) suggesting the glycan itself is tolerated in humans.
- Plasmid pYCG-PglB expresses the OST PglB and four glycosyltransferases from S. cerevisiae: Algl3, Algl4, Algl, and Alg2 (Valderrama et al.). These proteins coordinate the synthesis and conjugation of the Man3GlcNAc 2 glycan and its derivatives, which forms the base of the human complex N-glycan.
- Candidate antigens verified by glycosylation with the C. jejuni heptasaccharide is individually co-expressed with pYCG-PglB in glycosylation host strain MC4100 AwaaL gmdr. kan.
- cells are lysed and the target protein isolated with the ConA lectin which binds a- linked mannose residues. Because the engineered glycan terminates with a-mannose residues, purification with ConA favors the recovery of proteins modified with the complete desired glycan.
- Nickel-affinity chromatography is used to further purify the mannosylated antigen and a portion of the proteins is subjected to treatment with PNGase F to cleave off the glycan. Analysis by SDS- PAGE followed by immunob lotting with ConA and the aHis antibody verify recovery of the expected mannosylated protein. To confirm that the attached glycans are Man 3 GlcNAc 2 , PNGase F-released glycans are subject to mass spectrometry as described in (Valderrama-Rincon et al). This process is expected to yield
- Mannosylated antigen is detected by Western blot with the lectin ConA, and confirmation of the glycan identity by mass spectrometry.
- Mannosylated and aglycosylated vaccine antigens are purified and the immunogenic properties of the target antigens are assessed.
- markers of both the humoral and cell-mediated immune responses to mannosylated ExPEC antigens are examined.
- Mannosylated antigens are purified using lectin-affinity chromatography on a ConA column followed by nickel purification. Aglycosylated antigens are similarly purified by nickel-affinity chromatography. Preparations are compared to ensure similar purity by silver stain and endotoxin levels are determined for each sample. A suitable amount of mannosylated protein and aglycosylated protein of similar purity are recovered to conduct immunogenicity studies .
- mice Measure immunogenicity of mannosylated antigens.
- the immune response of mice following subcutaneous administration of mannosylated antigens are evaluated compared to aglycosylated controls. This step is an important validation for the use of the Man3GlcNAc 2 glycan as an enhancer of antigenicity for vaccine candidates.
- Groups of six CD1 mice (Charles River Laboratories) are immunized subcutaneously with e.g., 20 g of antigen on day 1, 21, and 35.
- CD1 mice have been used previously as a sepsis model for ExPEC vaccine studies using the same immunization timeline (Moriel, D.G., et al.,) and thus, these experiments pave the way for future challenge studies.
- Serum collected two weeks after the final immunization and ELISA are used to quantify the humoral response including the titers of IgG and IgM (Park, S.-U., et al., Immunization with a DNA vaccine cocktail induces a Thl response and protects mice against Mycobacterium avium subsp. paratuberculosis challenge. Vaccine, 2008. 26(34): p. 4329-4337.).
- the antigen- specific response are evaluated in comparison to an unrelated control protein bearing both a GlycTag and 6x-His tag.
- a CD8+ T cell assay are used to quantify the cellular response (Sivick, K.E. and H.L.T.
- Model antigens are constructed as fusion proteins with the normal E. coli periplasmic resident MBP.
- An N-terminal MBP fusion can promote proper folding and export from the cytoplasm which in turn can improve glycosylation (Nallamsetty et al). Testing alternate signal peptide sequences can address improper localization. Attachment of the C. jejuni heptasaccharide to a protein modified with a terminal GlycTag is reliably achieved in all cases where sufficient target protein is properly localized to the periplasm and serves as a predictive indicator for glycosylation success with the Man 3 GlcNAc 2 glycan.
- glycosylation may also be improved by adjusting the position of the GlycTag, or utilizing a different mannose-terminal glycan such as the poly-mannose LPS from E. coli 09 which has previously been conjugated to proteins in the bacterial N-glycosylation reaction (Wacker, M., et al., Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems. Proceedings of the National Academy of Sciences, 2006. 103(18): p. 7088-7093.).
- antigens can be modified with additional glycosylation sites to promote attachment of multiple glycans.
- GLY02.2 pMW07- pTrc99Y- Origami2 Man 5 GlcNAc 2 - YCG- MBP- gmd: :kan Glucagon GST- Glucagon
- PglB.CO GLY04.1 YCG- pMQ70- Origami2 GalGlcNAc- MBP- HpGalT gmd: :kan Man 3 GlcNAc 2 NtGnTI- PglB.CO
- SEQ ID NO: 12 MalE protein (MBP)
- ATGTTTTGTACATTTTTTGAAAAACATCACCGGAAGTGGGAC ATACTGTTAGAAAAAAGCACGGGTGTGATGGAAGCTATGAAAGTGACGA GTGAGGAAAAGGAACAGCTGAGCAC AGCAATCGACCGAATGAATGAAGG ACTGGACGCGTTTATCCAGCTGTATAATGAATCGGAAATTGATGAACCGC TTATTCAGCTTGATGATGATACAGCCGAGTTAATGAAGCAGGCCCGAGAT ATGTACGGCCAGGAAAAGCTAAATGAGAAATTAAATACAATTATTAAACA GATTTTATCCATCTCAGTATCTGAAGAAGGAGAAAAAAAGAA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Endocrinology (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP14767544.1A EP2971030B8 (en) | 2013-03-14 | 2014-03-14 | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
| CN201480028431.7A CN105378096A (zh) | 2013-03-14 | 2014-03-14 | 寡糖组合物、糖蛋白以及在原核生物中产生它们的方法 |
| CA2906671A CA2906671A1 (en) | 2013-03-14 | 2014-03-14 | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
| JP2016502303A JP2016518114A (ja) | 2013-03-14 | 2014-03-14 | オリゴ糖組成物、糖タンパク質および原核生物においてそれらを産生する方法 |
| SG11201508347YA SG11201508347YA (en) | 2013-03-14 | 2014-03-14 | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
| US14/775,859 US20160177355A1 (en) | 2013-03-14 | 2014-03-14 | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
| KR1020157028859A KR20160021075A (ko) | 2013-03-14 | 2014-03-14 | 올리고사카라이드 조성물, 당단백질, 및 원핵생물에서의 이들의 제조 방법 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361785586P | 2013-03-14 | 2013-03-14 | |
| US61/785,586 | 2013-03-14 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2014152137A2 true WO2014152137A2 (en) | 2014-09-25 |
| WO2014152137A3 WO2014152137A3 (en) | 2014-12-11 |
| WO2014152137A8 WO2014152137A8 (en) | 2015-12-30 |
Family
ID=51528818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/026990 Ceased WO2014152137A2 (en) | 2013-03-14 | 2014-03-14 | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US20140273163A1 (https=) |
| EP (1) | EP2971030B8 (https=) |
| JP (1) | JP2016518114A (https=) |
| KR (1) | KR20160021075A (https=) |
| CN (1) | CN105378096A (https=) |
| CA (1) | CA2906671A1 (https=) |
| SG (2) | SG11201508347YA (https=) |
| WO (1) | WO2014152137A2 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107778332A (zh) * | 2016-08-25 | 2018-03-09 | 株式会社雅嘉贸易 | 唾液酸低聚糖及其制造方法、生发和骨骼肌形成促进剂 |
| WO2022162704A1 (en) * | 2021-02-01 | 2022-08-04 | Dr. Reddy's Laboratories Limited | Compositions comprising fusion protein and analytical attributes thereof |
| EP3954778B1 (en) | 2020-08-10 | 2023-10-04 | Inbiose N.V. | Production of a mixture of neutral non-fucosylated oligosaccharides by a cell |
| EP4265730A1 (en) * | 2022-04-19 | 2023-10-25 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Cell-free enzymatic method for preparation of n-glycans |
| WO2023202991A2 (en) | 2022-04-19 | 2023-10-26 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Cell-free enzymatic method for preparation of n-glycans |
| US12077788B2 (en) | 2020-08-10 | 2024-09-03 | Inbiose N.V. | Production of a mixture of neutral non-fucosylated oligosaccharides by a cell |
| WO2024218743A1 (en) * | 2023-04-21 | 2024-10-24 | Glycoera Ag | Multi-functional molecules comprising glycans and uses thereof |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104388372B (zh) * | 2014-12-04 | 2017-07-21 | 江南大学 | 一种产软骨素的重组枯草芽孢杆菌及其应用 |
| BR112019015425A2 (pt) | 2017-01-27 | 2020-05-26 | University Of Florida Research Foundation, Incorporated | Uma vacina de segurança alimentar para controlar salmonella enterica e reduzir campylobacter em aves domésticas |
| EP3844271A4 (en) | 2018-08-29 | 2022-06-01 | Council of Scientific and Industrial Research | Recombinant microbial system for directed evolution of glycocins and a method of preparation thereof |
| CN110294810B (zh) * | 2019-06-26 | 2021-05-04 | 中国疾病预防控制中心传染病预防控制所 | 一种含有人IgG1Fc和甘露聚糖结合凝集素C端的重组蛋白 |
| CN111534495B (zh) * | 2020-05-14 | 2022-06-17 | 江南大学 | 一种提高重组n-乙酰葡糖胺转移酶ii可溶性表达的方法 |
| WO2023122641A1 (en) * | 2021-12-22 | 2023-06-29 | Zymergen Inc. | Compositions and methods for producing acetic acid and polysaccharides |
Family Cites Families (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5834251A (en) * | 1994-12-30 | 1998-11-10 | Alko Group Ltd. | Methods of modifying carbohydrate moieties |
| DE19754622A1 (de) * | 1997-12-09 | 1999-06-10 | Antje Von Dr Schaewen | Pflanzliche GntI-Sequenzen und Verwendung derselben zur Gewinnung von Pflanzen mit verminderter oder fehlender N-Acetylglucosaminyltransferase I (GnTI)-Aktivität |
| CA2351022A1 (en) * | 1998-11-18 | 2000-05-25 | Neose Technologies, Inc. | Low cost manufacture of oligosaccharides |
| US8697394B2 (en) * | 2000-06-28 | 2014-04-15 | Glycofi, Inc. | Production of modified glycoproteins having multiple antennary structures |
| US7449308B2 (en) * | 2000-06-28 | 2008-11-11 | Glycofi, Inc. | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes |
| AU2002307037B2 (en) * | 2001-04-02 | 2008-08-07 | Biogen Idec Inc. | Recombinant antibodies coexpressed with GnTIII |
| US7795210B2 (en) * | 2001-10-10 | 2010-09-14 | Novo Nordisk A/S | Protein remodeling methods and proteins/peptides produced by the methods |
| AU2003234445B2 (en) * | 2002-05-02 | 2009-11-26 | Vanderbilt University | Mammalian genes involved in viral infection and tumor suppression |
| CA2591992A1 (en) * | 2004-12-22 | 2006-06-29 | The Salk Institute For Biological Studies | Compositions and methods for producing recombinant proteins |
| CA2600391A1 (en) * | 2005-03-07 | 2006-09-14 | Plant Research International B.V. | Glycoengineering in mushrooms |
| US20100143969A1 (en) * | 2005-03-24 | 2010-06-10 | Neose Technologies, Inc. | Expression of soluble, active eukaryotic glycosyltransferases in prokaryotic organisms |
| WO2006112025A1 (ja) * | 2005-04-15 | 2006-10-26 | Japan Tobacco Inc. | 新規なβ-ガラクトシド-α2,3-シアル酸転移酵素、それをコードする遺伝子およびその製造方法 |
| US8198045B2 (en) * | 2006-04-19 | 2012-06-12 | Biogenerix Ag | Expression of O-glycosylated therapeutic proteins in prokaryotic microorganisms |
| CN107119095B (zh) * | 2008-01-03 | 2022-07-05 | 康乃尔研究基金会有限公司 | 原核生物中的糖基化蛋白表达 |
| US9927440B2 (en) * | 2009-11-25 | 2018-03-27 | Duke University | Protein engineering |
| US9051593B2 (en) * | 2009-12-21 | 2015-06-09 | Trustees Of Dartmouth College | Recombinant prokaryotes and use thereof for production of O-glycosylated proteins |
| WO2012050175A1 (ja) * | 2010-10-15 | 2012-04-19 | 日本ケミカルリサーチ株式会社 | 糖鎖の非還元末端がマンノース残基である糖蛋白質の製造方法 |
| EP2643456B1 (en) * | 2010-11-24 | 2016-05-11 | Novartis International Pharmaceutical Ltd. | Fusion enzymes having n-acetylglucosaminyltransferase activity |
| KR101906623B1 (ko) * | 2011-03-04 | 2018-10-10 | 가부시키가이샤 도우사 고가쿠 겐큐쇼 | 시알산 함유 당쇄의 제조방법 |
| EP2741772A1 (en) * | 2011-08-08 | 2014-06-18 | ETH Zurich | Pasteurellaceae vaccines |
| WO2013067523A1 (en) * | 2011-11-04 | 2013-05-10 | Cornell University | A prokaryote-based cell-free system for the synthesis of glycoproteins |
| RU2645252C2 (ru) * | 2012-01-05 | 2018-02-19 | Глюкос Финланд Ой | Клетка нитчатых грибов с дефицитом протеаз и способы ее применения |
| WO2014048439A1 (en) * | 2012-09-25 | 2014-04-03 | Glycom A/S | Glycoconjugate synthesis |
| ES2905107T3 (es) * | 2012-10-12 | 2022-04-07 | Glaxosmithkline Biologicals Sa | Procedimientos de modificación de células hospedadoras |
-
2014
- 2014-03-14 SG SG11201508347YA patent/SG11201508347YA/en unknown
- 2014-03-14 KR KR1020157028859A patent/KR20160021075A/ko not_active Ceased
- 2014-03-14 CN CN201480028431.7A patent/CN105378096A/zh active Pending
- 2014-03-14 SG SG10201707565WA patent/SG10201707565WA/en unknown
- 2014-03-14 JP JP2016502303A patent/JP2016518114A/ja active Pending
- 2014-03-14 US US14/210,559 patent/US20140273163A1/en not_active Abandoned
- 2014-03-14 EP EP14767544.1A patent/EP2971030B8/en not_active Not-in-force
- 2014-03-14 US US14/775,859 patent/US20160177355A1/en not_active Abandoned
- 2014-03-14 WO PCT/US2014/026990 patent/WO2014152137A2/en not_active Ceased
- 2014-03-14 CA CA2906671A patent/CA2906671A1/en not_active Abandoned
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107778332A (zh) * | 2016-08-25 | 2018-03-09 | 株式会社雅嘉贸易 | 唾液酸低聚糖及其制造方法、生发和骨骼肌形成促进剂 |
| CN107778332B (zh) * | 2016-08-25 | 2021-09-24 | 株式会社雅嘉贸易 | 唾液酸低聚糖及其制造方法、生发和骨骼肌形成促进剂 |
| EP3954778B1 (en) | 2020-08-10 | 2023-10-04 | Inbiose N.V. | Production of a mixture of neutral non-fucosylated oligosaccharides by a cell |
| US12077788B2 (en) | 2020-08-10 | 2024-09-03 | Inbiose N.V. | Production of a mixture of neutral non-fucosylated oligosaccharides by a cell |
| WO2022162704A1 (en) * | 2021-02-01 | 2022-08-04 | Dr. Reddy's Laboratories Limited | Compositions comprising fusion protein and analytical attributes thereof |
| EP4265730A1 (en) * | 2022-04-19 | 2023-10-25 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Cell-free enzymatic method for preparation of n-glycans |
| WO2023202991A2 (en) | 2022-04-19 | 2023-10-26 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Cell-free enzymatic method for preparation of n-glycans |
| WO2023202991A3 (en) * | 2022-04-19 | 2023-11-30 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Cell-free enzymatic method for preparation of n-glycans |
| WO2024218743A1 (en) * | 2023-04-21 | 2024-10-24 | Glycoera Ag | Multi-functional molecules comprising glycans and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160177355A1 (en) | 2016-06-23 |
| CA2906671A1 (en) | 2014-09-25 |
| JP2016518114A (ja) | 2016-06-23 |
| SG11201508347YA (en) | 2015-11-27 |
| EP2971030A2 (en) | 2016-01-20 |
| WO2014152137A8 (en) | 2015-12-30 |
| WO2014152137A3 (en) | 2014-12-11 |
| EP2971030B1 (en) | 2018-10-17 |
| US20140273163A1 (en) | 2014-09-18 |
| SG10201707565WA (en) | 2017-10-30 |
| EP2971030A4 (en) | 2017-03-15 |
| KR20160021075A (ko) | 2016-02-24 |
| CN105378096A (zh) | 2016-03-02 |
| EP2971030B8 (en) | 2018-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2971030B1 (en) | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes | |
| US8999668B2 (en) | Glycosylated protein expression in prokaryotes | |
| JP7437162B2 (ja) | 改変されかつ完全に機能カスタマイズされた糖タンパク質 | |
| Gomord et al. | Plant‐specific glycosylation patterns in the context of therapeutic protein production | |
| Saint-Jore-Dupas et al. | From planta to pharma with glycosylation in the toolbox | |
| JP2016518825A (ja) | ポリシアル酸、血液型抗原および糖タンパク質の発現 | |
| WO2019234021A1 (en) | Glycoengineered monoclonal antibody | |
| CN108779443A (zh) | 产生糖基化蛋白的方法 | |
| Khan et al. | Strategies for humanizing glycosylation pathways and producing recombinant glycoproteins in microbial expression systems | |
| Li et al. | Glycoproteins: Chemical features and biological roles | |
| US20220112535A1 (en) | Production of protein with humanized n-glycosylation in insect cells | |
| Wildt et al. | An alternative approach: Humanization of N-glycosylation pathways in yeast |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14767544 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2016502303 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2906671 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20157028859 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014767544 Country of ref document: EP |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14767544 Country of ref document: EP Kind code of ref document: A2 |