WO2014143228A1 - Essais à base d'arnase-h utilisant de monomères d'arn modifiés - Google Patents

Essais à base d'arnase-h utilisant de monomères d'arn modifiés Download PDF

Info

Publication number
WO2014143228A1
WO2014143228A1 PCT/US2013/072690 US2013072690W WO2014143228A1 WO 2014143228 A1 WO2014143228 A1 WO 2014143228A1 US 2013072690 W US2013072690 W US 2013072690W WO 2014143228 A1 WO2014143228 A1 WO 2014143228A1
Authority
WO
WIPO (PCT)
Prior art keywords
rnase
enzyme
cleavage
primer
dna
Prior art date
Application number
PCT/US2013/072690
Other languages
English (en)
Inventor
Joseph Alan Walder
Mark Aaron Behlke
Scott D. Rose
Joseph R. DOBOSY
Susan M. RUPP
Original Assignee
Integrated Dna Technologies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US13/839,334 external-priority patent/US20140255925A9/en
Priority claimed from US13/959,637 external-priority patent/US9644198B2/en
Application filed by Integrated Dna Technologies, Inc. filed Critical Integrated Dna Technologies, Inc.
Priority to EP13811693.4A priority Critical patent/EP2971072A1/fr
Priority to AU2013381709A priority patent/AU2013381709A1/en
Priority to US14/123,944 priority patent/US10227641B2/en
Priority to CA2906365A priority patent/CA2906365A1/fr
Priority to SG11201507512QA priority patent/SG11201507512QA/en
Priority to JP2016500115A priority patent/JP2016510601A/ja
Publication of WO2014143228A1 publication Critical patent/WO2014143228A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates

Definitions

  • This invention pertains to methods of cleaving a nucleic acid strand to initiate, assist, monitor or perform biological assays.
  • primer-based amplification reactions such as the polymerase chain reaction (PCR)
  • PCR polymerase chain reaction
  • the primers Under the elevated temperatures used in a typical amplification reaction, the primers ideally hybridize only to the intended target sequence and form primer extension products to produce the complement of the target sequence.
  • amplification reaction mixtures are typically assembled at room temperature, well below the temperature needed to insure primer hybridization specificity.
  • the primers Under lower temperature conditions, the primers may bind non-specifically to other partially complementary nucleic acid sequences or to other primers and initiate the synthesis of undesired extension products, which can be amplified along with the target sequence.
  • Amplification of non-specific primer extension products can compete with amplification of the desired target sequences and can significantly decrease the efficiency of the amplification of the desired sequence. Non-specific amplification can also give rise in certain assays to a false positive result.
  • Primer dimers are double-stranded fragments whose length typically is close to the sum of the two primer lengths and are amplified when one primer is extended over another primer. The resulting duplex forms an undesired template which, because of its short length, is amplified efficiently.
  • Non-specific amplification can be reduced by reducing the formation of primer extension products (e.g., primer dimers) prior to the start of the reaction.
  • primer extension products e.g., primer dimers
  • one or more critical reagents are withheld from the reaction mixture until the temperature is raised sufficiently to provide the necessary hybridization specificity. In this manner, the reaction mixture cannot support primer extension at lower temperatures.
  • Manual hot-start methods in which the reaction tubes are opened after the initial high temperature incubation step and the missing reagents are added, are labor intensive and increase the risk of contamination of the reaction mixture.
  • a heat sensitive material such as wax
  • a heat sensitive material can be used to separate or sequester reaction components, as described in U.S. Pat. No. 5,411,876, and Chou et ah, 1992, Nucl. Acids Res. 20(7): 1717-1723.
  • a high temperature pre-reaction incubation melts the heat sensitive material, thereby allowing the reagents to mix.
  • One objective of the present invention can be used, for example, to address the problem of carry-over cross contamination which is a significant concern in amplification reactions, especially PCR wherein a large number of copies of the amplified product are produced.
  • attempts have been made to solve this problem in a number of ways. For example, direct UV irradiation can effectively remove contaminating DNA (Rys & Persing, 1993, J Clin Microbiol. 31(9):2356-60 and Sarkar & Sommer, 1990 Nature. 343(6253):27) but the irradiation of the PCR reagents must take place before addition of polymerase, primers, and template DNA.
  • UNG RNA glycosylase
  • UNG Uracil-N-Glycosylase
  • the UNG enzyme will cleave the uracil base from DNA strands of contaminating amplicons before amplification, and render all such products unable to act as a template for new DNA synthesis without affecting the sample DNA.
  • the UNG enzyme is then heat-inactivated and PCR is then carried out. The requirement for dUTP and the UNG enzyme adds significantly to the cost of performing PCR.
  • Another objective of the present invention is to provide PCR assays in which a hot-start reaction is achieved through a coupled reaction sequence with a thermostable RNase H.
  • Ribonucleases are enzymes that catalyze the hydrolysis of RNA into smaller components. The enzymes are present internally; in bodily fluids; on the surface of skin; and on the surface of many objects, including untreated laboratory glasswear. Double-stranded RNases are present in nearly all intracellular environments and cleave RNA-containing, double-stranded constructs. Single-stranded RNases are ubiquitous in extracellular environments, and are therefore extremely stable in order to function under a wide range of conditions.
  • RNase H The RNases H are a conserved family of ribonucleases which are present in all organisms examined to date. There are two primary classes of RNase H: RNase HI and RNase H2. Retroviral RNase H enzymes are similar to the prokaryotic RNase HI. All of these enzymes share the characteristic that they are able to cleave the RNA component of an RNA:DNA heteroduplex.
  • the human and mouse RNase HI genes are 78% identical at the amino acid level (Cerritelli, et al, (1998) Genomics, 53, 300-307). In prokaryotes, the genes are named rnha (RNase HI) and rnhb (RNase H2).
  • RNase H3 A third family of prokaryotic RNases has been proposed, rnhc (RNase H3) (Ohtani, et al. (1999) Biochemistry, 38, 605-618).
  • the Type II enzymes utilize Mg ++ , Mn ++ , Co ++ (and sometimes Ni ++ ) as cofactor, while the Type I enzymes require Mg ++ and can be inhibited by Mn ++ ions.
  • the reaction products are the same for both classes of enzymes: the cleaved products have a 3'-OH and 5'-phosphate (See Figure 1).
  • RNase III class enzymes which cleave RNA:RNA duplexes (e.g., Dicer, Ago2, Drosha) result in similar products and contain a nuclease domain with similarity to RNase H.
  • E. coli RNase HI has been extensively characterized. A large amount of work on this enzyme has been carried out, focusing on characterization of substrate requirements as it impacts antisense oligonucleotide design; this has included studies on both the E.
  • Type I RNase H requires multiple RNA bases in the substrate for full activity.
  • a DNA/RNA/DNA oligonucleotide hybridized to a DNA oligonucleotide with only 1 or 2 RNA bases is inactive.
  • E. coli RNase HI substrates with three consecutive RNA bases show weak activity. Full activity was observed with a stretch of four RNA bases (Hogrefe, et al, (1990) J Biol Chem, 265, 5561-5566).
  • An RNase HI was cloned from Thermus thermophilus in 1991 which has only 56% amino acid identity with the E. coli enzyme but which has similar catalytic properties (Itaya, et al, (1991) Nucleic Acids Res, 19, 4443-4449). This enzyme was stable at 65°C but rapidly lost activity when heated to 80°C.
  • the human RNase HI gene (Type I RNase H) was cloned in 1998 (Genomics, 53, 300-307 and Antisense Nucleic Acid Drug Dev, 8, 53-61). This enzyme requires a 5 base RNA stretch in DNA/RNA/DNA chimeras for cleavage to occur. Maximal activity was observed in 1 mM Mg ++ buffer at neutral pH and Mn ++ ions were inhibitory (J Biol Chem, 274, 28270-28278). Cleavage was not observed when 2'-modified nucleosides (such as 2'-OMe, 2'-F, etc.) were substituted for RNA.
  • 2'-modified nucleosides such as 2'-OMe, 2'-F, etc.
  • the minor groove width is 7.5 A in a B-form DNA:DNA duplex, is 1 1 A in a pure A-form RNA:RNA duplex, and is 8.5 A in the hybrid A-form duplex of an RNA:DNA duplex (Fedoroff et al, (1993) J Mol Biol, 233, 509-523).
  • 2 '-modifications protrude into the minor groove, which may account for some of the behavior of these groups in reducing or eliminating activity of modified substrates for cleavage by RNase HI .
  • the human Type II RNase H was first purified and characterized by Eder and Walder in 1991 (Eder, et al, (1991) J Biol Chem, 266, 6472-6479). This enzyme was initially designated human RNase HI because it had the characteristic divalent metal ion dependence of what was then known as Class I RNases H. In the current nomenclature, it is a Type II RNase H enzyme. Unlike the Type I enzymes which are active in Mg ++ but inhibited by Mn ++ ions, the Type II enzymes are active with a wide variety of divalent cations. Optimal activity of human Type II RNase H is observed with 10 mM Mg ++ , 5 mM Co ++ , or 0.5 mM Mn ++ .
  • RNase H2 the substrate specificity of the Type II RNase H (hereafter referred to as RNase H2) is different from RNase HI.
  • this enzyme can cleave a single ribonucleotide embedded within a DNA sequence (in duplex form) (Eder, et al, (1993) Biochimie, 75, 123-126). Interestingly, cleavage occurs on the 5' side of the RNA residue (See Figure 3). See a recent review by Kanaya for a summary of prokaryotic RNase H2 enzymes (Kanaya (2001) Methods Enzymol, 341, 377-394).
  • the E. coli RNase H2 gene has been cloned (Itaya, M. ( 1990) Proc Natl Acad Sci U SA, 87, 8587-8591) and characterized (Ohtani, et al, (2000) JBiochem (Tokyo), 127, 895-899). Like the human enzyme, the E. coli enzyme functions with Mn ++ ions and is actually more active with manganese than magnesium.
  • RNase H2 genes have been cloned and the enzymes characterized from a variety of eukaryotic and prokaryotic sources.
  • the RNase H2 from Pyrococcus kodakaraensis (KOD 1) has been cloned and studied in detail (Haruki, et al, (1998) J Bacteriol, 180, 6207-6214; Mukaiyama, et al, (2004) Biochemistry, 43, 13859-13866).
  • the RNase H2 from the related organism Pyrococcus furious has also been cloned but has not been as thoroughly characterized (Sato, et al, (2003) Biochem Biophys Res Commun, 309, 247-252).
  • Nucleic acid hybridization assays based on cleavage of an RNA-containing probe by RNase H such as the cycling probe reaction (Walder et al, U.S. Pat. No. 5,403,71 1) have been limited in the past by background cleavage of the oligonucleotide by contaminating single-stranded ribonucleases and by water catalyzed hydrolysis facilitated by Mg 2+ and other divalent cations.
  • the effect of single-stranded ribonucleases can be mitigated to a certain degree by inhibitors such as RNasin that block single-stranded ribonucleases but do not interfere with the activity of RNase H.
  • RNase H has been used as a cleaving enzyme in cycling probe assays, in PCR assays (Han et al, U.S. Patent No. 5,763, 181; Sagawa et al, U.S. Pat. No. 7, 135,291 ; and Behlke and Walder, U.S. Pat. App. No. 20080068643) and in polynomial amplification reactions (Behlke et al, U.S. Patent No. 7, 112,406). Despite improvements offered by these assays, there remain considerable limitations. The PCR assays utilize a hot-start DNA polymerase which adds substantially to the cost.
  • the current invention provides novel biological assays that employ RNase H cleavage in relation to nucleic acid amplification, detection, ligation, sequencing, and synthesis. Additionally, the invention provides new assay formats to utilize cleavage by RNase H and novel oligonucleotide substrates for such assays.
  • the compounds, kits, and methods of the present invention provide a convenient and economic means of achieving highly specific primer-based amplification reactions that are substantially free of nonspecific amplification impurities such as primer dimers.
  • the methods and kits of the present invention avoid the need for reversibly inactivated DNA polymerase and DNA ligase enzymes.
  • One objective of the present invention is to enable hot start protocols in nucleic acid amplification and detection assays including but not limited to PCR, OLA (oligonucleotide ligation assays), LCR (ligation chain reaction), polynomial amplification and DNA sequencing, wherein the hot start component is a thermostable RNase H or other nicking enzyme that gains activity at the elevated temperatures employed in the reaction.
  • Such assays employ a modified oligonucleotide of the invention that is unable to participate in the reaction until it hybridizes to a complementary nucleic acid sequence and is cleaved to generate a functional 5'- or 3'-end.
  • the specificity is greatly enhanced.
  • the requirement for reversibly inactivated DNA polymerases or DNA ligases is eliminated.
  • the modification of the oligonucleotide inhibiting activity is preferably located at or near the 3 '-end.
  • the oligonucleotide inhibiting activity may be positioned near the 3' end of the oligonucleotide, e.g., up to about 10 bases from the 3' end of the oligonucleotide of the invention.
  • the oligonucleotide inhibiting activity may be positioned near the 3' end, e.g., about 1-6 bases from the 3' end of the oligonucleotide of the invention. In other embodiments, the oligonucleotide inhibiting activity may be positioned near the 3' end, e.g., about 1-5 bases from the 3' end of the oligonucleotide of the invention. In other embodiments, the oligonucleotide inhibiting activity may be positioned near the 3' end, e.g., about 1-3 bases from the 3' end of the oligonucleotide of the invention.
  • the precise position (i.e., number of bases) from the 3' end where the oligonucleotide inhibiting activity may be positioned will depend upon factors influencing the ability of the oligonucleotide primer of the invention to hybridize to a shortened complement of itself on the target sequence (i.e., the sequence for which hybridization is desired). Such factors include but are not limited to Tm, buffer composition, and annealing temperature employed in the reaction(s).
  • the modification inhibiting activity may be located at or near either the 3 '- or 5 '-end of the oligonucleotide.
  • modification inhibitory activity if used, is preferably placed within the domain that is 3' to the cleavable RNA base in the region that is removed by probe cleavage.
  • C3 spacers may be positioned close to the RNA base in the oligonucleotide probes of the invention to improve specificity that is helpful for improving mismatch discrimination.
  • any blocking group may be placed in the domain of the oligonucleotide of the invention that is removed by RNase H cleavage.
  • the precise position of the blocking group in the RNase H cleavable domain may be adjusted to alter specificity for cleavage and precise placement of the blocking group relative to the cleavable RNA bases may alter the amount of enzyme needed to achieve optimal cleavage rates.
  • Yet a further objective of the present invention is to provide novel modifications of oligonucleotides to interfere with primer extension and ligation.
  • Yet a further objective of the present invention is to provide modifications of oligonucleotides that prevent the oligonucleotide from serving as a template for DNA synthesis and thereby interfere with PCR.
  • Yet a further objective of the invention is to provide modified oligonucleotide sequences lacking RNA that are cleaved by RNase H.
  • the oligonucleotide contains a single 2'-fluoro residue and cleavage is mediated by a Type II RNase H enzyme.
  • the oligonucleotide contains two adjacent 2'-fluoro residues.
  • Yet a further objective of the present invention is to provide oligonucleotides for use in the above mentioned assays that are modified so as to inhibit undesired cleavage reactions including but not limited to water and divalent metal ion catalyzed hydrolysis 3 ' to RNA residues, hydrolysis by single-stranded ribonucleases and atypical cleavage reactions catalyzed by Type II RNase H enzymes at positions other than the 5 '-phosphate of an RNA residue (see Figure 3).
  • the 2 '-hydroxy group of an RNA residue is replaced with an alternative functional group such as fluorine or an alkoxy substituent (e.g., O-methyl).
  • the phosphate group 3 ' to an RNA residue is replaced with a phosphorothioate or a dithioate linkage.
  • the oligonucleotide is modified with nuclease resistant linkages further downstream from the 3 '-phosphate group of an RNA residue or on the 5 '-side of an RNA residue to prevent aberrant cleavage by RNase H2.
  • Nuclease resistant linkages useful in such embodiments include phosphorothioates, dithioates, methylphosphonates, and abasic residues such as a C3 spacer. Incorporation of such nuclease resistant linkages into oligonucleotide primers used in PCR assays of the present invention has been found to be particularly beneficial (see Examples 25, 27 and 28 ).
  • Yet a further objective of the invention is to provide oligonucleotides for use in the above-mentioned assays that are modified at positions flanking the cleavage site to provide enhanced discrimination of variant alleles.
  • modifications include but are not limited to 2'-0-methyl RNA residues and secondary mismatch substitutions (see Example 23).
  • a further objective is to provide oligonucleotides and assay formats for use in the present invention wherein cleavage of the oligonucleotide can be measured by a change in fluorescence.
  • a primer cleavable by RNase H is labeled with a fluorophore and a quencher and the assay is monitored by an increase in fluorescence (see Examples 19-21).
  • Yet a further objective of the invention is to provide RNase H compositions and protocols for their use in which the enzyme is thermostable and has reduced activity at lower temperatures.
  • RNA residue in the probe is replaced with a 2'-fluoro residue.
  • a probe with two adjacent 2'-fluoro residues is used.
  • Type II RNase H enzymes are used in novel methods for DNA sequencing.
  • Type II RNase H enzymes are used in novel methods for DNA synthesis.
  • RNA base of the blocked-cleavable primer is positioned at the site of a single base polymorphism (the SNP). It is readily appreciated by one with skill in the art that a primer which overlays a polymorphic site can be made specific to the top or bottom (sense or antisense) strand of a duplex DNA target nucleic acid.
  • a single blocked-cleavable primer is employed having the RNA residue positioned directly at the site of the SNP (single nucleotide polymorphism) so that hybridization to a target having a perfect match with the primer results in efficient cleavage by RNase H2 whereas hybridization to a target having a mismatch at this site results in inefficient cleavage by RNase H2.
  • SNP single nucleotide polymorphism
  • two blocked-cleavable primers are paired, one corresponding to the top strand and the second corresponding to the bottom strand, with the SNP site positioned at the RNA base.
  • the two primers overlap and, following activation by RNase H2 cleavage, function as a PCR primer pair and preferentially amplify a matched target over a mismatched target.
  • a method of improving specificity during amplification of a target DNA sequence includes four steps.
  • the first step includes providing a reaction mixture.
  • the reaction mixture includes: (i) an oligonucleotide primer having a cleavage domain, which is cleavable by an RNase H enzyme, positioned 5' of a blocking group, said blocking group linked at or near the 3'-end of the oligonucleotide primer wherein said blocking group prevents primer extension and/or inhibits the oligonucleotide primer from serving as a template for DNA synthesis; (ii) a sample nucleic acid that may or may not the target sequence; (iii) a DNA polymerase, and
  • the second step includes hybridizing the oligonucleotide primer to the target DNA sequence to form a double-stranded substrate.
  • the third step includes cleaving the hybridized oligonucleotide primer with said RNase H enzyme at a cleavage site within or adjacent to the cleavage domain to remove the blocking group from the oligonucleotide primer.
  • the fourth step includes extending the oligonucleotide primer with the DNA polymerase.
  • Th reaction mixture includes a concentration of a divalent cation such that a ACp of at least about 5.0 or greater or about 50% or greater is obtained for the amplification of the target DNA as adjudged by a 3 '-mismatch discrimination assay.
  • a method of amplifying a target DNA sequence includes four steps.
  • the first step includes providing a reaction mixture.
  • the reaction mixture includes: (i) an oligonucleotide primer having a cleavage domain, which is cleavable by an RNase H enzyme, positioned 5' of a blocking group, said blocking group linked at or near the 3 '-end of the oligonucleotide primer wherein said blocking group prevents primer extension and/or inhibits the oligonucleotide primer from serving as a template for DNA synthesis; (ii) a sample nucleic acid that may or may not the target sequence; (iii) a DNA polymerase, and (iv) an RNase H enzyme wherein said RNase H enzyme is thermostable and has at least a 10 -fold decrease in activity at 30°C as compared to 70°C.
  • the second step includes hybridizing the oligonucleotide primer to the target DNA sequence to form a double-stranded substrate.
  • the third step includes cleaving the hybridized oligonucleotide primer with said RNase H enzyme at a cleavage site within or adjacent to the cleavage domain to remove the blocking group from the oligonucleotide primer.
  • the fourth step includes extending the oligonucleotide primer with the DNA polymerase.
  • the reaction mixture includes a divalent cation and a non-ionic detergent comprising polyethylene glycol hexadecyl ether.
  • a kit for performing amplification of a target DNA sequence has a reaction buffer that includes a metal salt comprising a divalent cation and associated counterion.
  • the divalent cation comprises Mg ++
  • the reaction buffer provides a final concentration of the metal salt no greater than about 2.0 mM free Mg ++ in the reaction mixture for performing amplification of the target DNA.
  • Figure 1 depicts the cleavage pattern that occurs with an RNase H enzyme on a substrate containing multiple RNA bases.
  • Figure 2 depicts the cleavage pattern that occurs with a single-stranded ribonuclease enzyme or through water catalyzed hydrolysis, wherein the end-product results in a cyclic phosphate group at the 2' and 3' positions of the ribose.
  • Figure 3 depicts the cleavage sites for RNase H2 and single-stranded ribonucleases on a substrate containing a single RNA base.
  • Figures 4A and 4B are photographs of SDS 10% polyacrylamide gels that illustrate the induced protein produced from five Archaeal RNase H2 synthetic genes.
  • Figure 4A shows induced protein for Pyrococcus furiosus and Pyrococus abyssi.
  • Figure 4B shows induced protein for Methanocaldococcus jannaschii, Sulfolobus solfataricus , Pyrococcus kodadarensis.
  • Figure 5 shows a Coomassie Blue stained protein gel showing pure, single bands after purification using nickel affinity chromatography of recombinant His tag RNase H2 proteins.
  • Figure 6 shows a Western blot done using anti-His tag antibodies using the protein gel from FIG. 5.
  • Figure 7 is a photograph of a gel that shows the digestion of a duplex, containing a chimeric 1 1 DNA - 8 RNA - 1 1 DNA strand and a complementary DNA strand, by recombinant RNase H2 enzymes from Pyrococcus kodakaraensis, Pyrococcus furiosus, and Pyrococcus abyssi.
  • Figures 8A and 8B are photographs of gels that show the digestion of a duplex, containing a chimeric 14 DNA - 1 RNA - 15 DNA strand and a complementary DNA strand, by recombinant RNase H2 enzymes from Pyrococcus abyssi, Pyrococcus furiosus, and Methanocaldococcus jannaschii (FIG. 8A) and Pyrococcus kodakaraensis (FIG. 8B).
  • Figure 9 shows the effects of incubation at 95 °C for various times on the activity of the Pyrococcus abyssi RNase H2 enzyme.
  • Figure 10 is a photograph of a gel that shows the relative amounts of cleavage of a single ribonucleotide-containing substrate by Pyrococcus abyssi RNase H2 at various incubation temperatures.
  • Figure 1 1 is a graph showing the actual quantity of substrate cleaved in the gel from FIG. 10.
  • Figure 12 is a photograph of a gel that shows cleavage by Pyrococcus abysii RNase H2 of various single 2' modified substrates in the presence of different divalent cations.
  • Figure 13 is a photograph of a gel that shows cleavage by Pyrococcus abyssi RNase H2 of single 2'-fluoro or double 2'-fluoro (di-fluoro) modified substrates. The divalent cation present was Mn ++ .
  • Figure 14 is a graph quantifying the relative cleavage by Pyrococcus abyssi RNase H2 of all 16 possible di-fluoro modified substrates.
  • Figure 15 is a graph quantifying the relative cleavage by Pyrococcus abyssi RNase H2 of rN substrates with a variable number of 3 ' DNA bases (i. e. , number of DNA bases on the 3 ' side of the RNA residue).
  • Figure 16 is a graph quantifying the relative cleavage by Pyrococcus abyssi RNase H2 of rN substrates with a variable number of 5' DNA bases (i.e., number of DNA bases on the 5' side of the RNA residue).
  • Figure 17 is a graph quantifying the relative cleavage by Pyrococcus abyssi RNase H2 of di-fluoro substrates with a variable number of 3' DNA bases (i.e., number of DNA bases on the 3 ' side of the fUfC residues).
  • Figure 18 is a reaction schematic of RNase H2 activation of blocked PCR primers.
  • Figure 19 is a photograph of a gel that shows the products of an end point PCR reaction performed with a single rU-containing blocked primer.
  • the suffix 2D, 3D, etc. represents the number of DNA bases between the rU residues and the 3 '-end of the primer.
  • the primer is blocked with a dideoxy C residue.
  • Figures 20A-B are PCR amplification plots for a 340 bp amplicon within the human HRAS gene, using both unmodified and blocked rN primers, without RNase H2 (20A) and with RNase H2 (20B). Cycle number is shown on the X-axis and relative fluorescence intensity is shown on the Y-axis.
  • Figures 21 A-B are PCR amplification plots for a 184 bp amplicon within the human ETS2 gene, using both unmodified and blocked rN primers, without RNase H2 (21 A) and with RNase H2 (2 IB). Cycle number is shown on the X-axis and relative fluorescence intensity is shown on the Y-axis.
  • Figures 22A-B are PCR amplification plots for a synthetic 103 bp amplicon, using both unmodified and 3 '-fN modified primers, without RNase H2 (22A) and with RNase H2 (22B).
  • Figure 23A shows HPLC traces of a rN primer containing a single phosphorothioate internucleoside modification (SEQ ID NO. 192).
  • the top panel shows the original synthesis product demonstrating resolution of the two isomers.
  • the middle panel is the purified Rp isomer and the bottom panel is the purified Sp isomer.
  • Figure 24 shows the relationship between RNase H2 versus RNase A enzymatic cleavage with substrates having (SEQ ID NOS 302 and 103, respectively, in order of appearance) having a single RNA base and different phosphorothioate stereoisomers.
  • Figure 25 shows a photograph of a polyacrylamide gel used to separate products from PCR reactions done using standard and blocked/cleavable primers on a HCV amplicon showing that use of standard primers results in formation of undesired small primer-dimer species while use of blocked primers results in specific amplification of the desired product.
  • the nucleic acids were imaged using fluorescent staining and the image was inverted for clarity.
  • Figure 26 is a graph quantifying the relative cleavage by Pyrococcus abyssi RNase H2 of a radiolabeled rC containing substrate in buffer containing different detergents at different concentrations (expressed as % vokvol).
  • Figure 27 is a reaction schematic of RNase H2 activation of fluorescence-quenched (F/Q) blocked PCR primers.
  • Figure 28 is an amplification plot showing the fluorescence signal resulting from use of unblocked primers with a fluorescence-quenched dual-labeled probe (DLP) compared with a blocked fluorescence-quenched cleavable primer for a 103 base synthetic amplicon. Cycle number is shown on the X-axis and relative fluorescence intensity is shown on the Y-axis.
  • DLP fluorescence-quenched dual-labeled probe
  • Figure 29 is an amplification plot showing the fluorescence signal resulting from use of a F/Q configuration blocked fluorescence-quenched cleavable primer compared with a Q/F configuration blocked fluorescence-quenched cleavable primer for a 103 base synthetic amplicon. Cycle number is shown on the X-axis and relative fluorescence intensity is shown on the Y-axis.
  • Figure 30 is an amplification plot showing the fluorescence signal resulting from use of F/Q configuration blocked fluorescence-quenched cleavable primers to distinguish DNA templates that differ at a single base within the SMAD 7 gene.
  • Panel (A) shows results from the FAM channel where the FAM-labeled "C” allele probe was employed.
  • Panel “B” shows results from the HEX channel wherein the HEX-labeled "T” allele probe was employed. Cycle number is shown on the X-axis and relative fluorescence intensity is shown on the Y-axis.
  • Figure 31 is a reaction schematic of R ase H2 cleavage of fluorescence-quenched (FQT) primer used in a primer probe assay.
  • the Primer Domain is complementary to the target nucleic acid and serves to primer DNA synthesis.
  • the Reporter Domain is non-complementary to target and contains a RNA base positioned between a reporter dye and a quencher group. The Reporter Domain remains single-stranded until conversion to double-stranded form during PCR where this domain now serves as template. Conversion to double-stranded form converts the Reporter Domain into a substrate for RNase H2; cleavage by RNase H2 separates reporter from quencher and is a detectable event.
  • Figure 32 shows amplification plots of qPCR reactions done with primers specific for the human Drosha gene using HeLa cell cDNA.
  • Figure 33 shows the sequences of cleavable-blocked primers that are either perfect match or contain a mismatch at position +2 relative to the single RNA base (2 bases 3 '- to the ribonucleotide).
  • SMAD7 target sequences at SNP site rs4939827 are aligned below the primers to indicate how this strategy results in the presence of a single mismatch when primers hybridize with one allele vs. a double mismatch when hybridize with the second allele.
  • DNA bases are uppercase
  • RNA bases are lowercase
  • SpC3 is a Spacer C3 modification.
  • Figure 33 discloses SEQ ID NOS 231-232, 234, 233, 303, 235-236, 238, 237 and 303, respectively, in order of appearance.
  • Figure 34 is a graph that shows the relative functional activity of different oligonucleotide compositions to prime DNA synthesis in a linear primer extension reaction.
  • Figure 35 shows the scheme for performing cycles of DNA sequencing by ligation using RNase H2 cleavable ligation probes
  • Figure 35 discloses the "3'-AGTCCAGGTCA" sequence as SEQ ID NO: 304.
  • Figure 36 shows the scheme for hybridization, ligation, and subsequent cleavage by RNase H2 of RNA-containing cleavable ligation probes of a set of specific exemplary synthetic sequences (SEQ ID NOS 253, 255, 254, 256, 257-259, 305, 258, 306 and 258, respectively, in order of appearance).
  • Figure 37 shows a photograph of a polyacrylamide gel used to separate products from ligation reactions done using cleavable ligation probes on a synthetic template showing that the 9mer probes are efficiently ligated to the acceptor nucleic acid (ANA) and that the ligation product is efficiently cleaved by RNase H2, leaving an ANA species that is lengthened by one base.
  • the nucleic acids were imaged using fluorescent staining and the image was inverted for clarity.
  • Figure 38 shows the scheme for hybridization and ligation of RNA-containing cleavable ligation probes containing either three or four 5-nitroindole residues.
  • Figure 38 discloses SEQ ID NOS. 257, 260, 307, 258, 308 and 258, respectively, in order of appearance.
  • Figure 39 shows a photograph of a polyacrylamide gel used to separate products from ligation reactions done using cleavable ligation probes on a synthetic template showing that an 8mer probe containing three 5-nitroindole (3x5NI) bases is efficiently ligated to an acceptor nucleic acid (ANA) whereas an 8mer probe containing four 5-nitroindole (4x5NI) bases is not.
  • the nucleic acids were imaged using fluorescent staining and the image was inverted for clarity.
  • Figure 40 shows a photograph of a polyacrylamide gel used to separate ligation products from reactions done using cleavable ligation probes on a synthetic template showing that an 8mer probe containing a single fixed DNA base at the 5 '-end, four random bases, and 3 universal base 5-nitroindoles can specifically ligate to the target as directed by the single fixed DNA base.
  • Figure 41 shows the scheme for a traditional oligonucleotide ligation assay (OLA).
  • Panel A shows the three oligonucleotides needed to interrogate a two allele target system.
  • Panel B shows the steps involved in making a ligation product.
  • FIG. 42 shows the scheme for the RNase H2 cleavable oligonucleotide ligation assay (OLA) of the present invention.
  • Panel A shows the four oligonucleotides needed to interrogate a two allele target system.
  • Panel B shows the steps involved in making a ligation product using the RNase H2 method.
  • Panel C illustrates how this method tests the identity of the base polymorphism twice.
  • Figure 43 shows alignment of sequences (SEQ ID NOS 268, 309-310, 309, 300, 310, 309, 31 1, 309 and 311-312, respectively, in order of appearance) used in the present Example during each step of the RNase H2 cleavable probe OLA using fluorescence microbeads and a Luminex LI 00 system to detect the ligation products.
  • Figure 44 is a chart that shows the resulting fluorescent signal detected by a Luminex L100 system to assess identity of the reaction products generated from the RNase H2 allelic discrimination OLA shown in Figure 43.
  • Figure 45 is a set of schematic figures outlining the single blocked-cleavable primer approach for the "For" orientation is shown in Figure 45A and for the "Rev” orientation in Figure 45B.
  • Figure 45 C is a schematic outlining the dual blocked-cleavable primer approach.
  • the current invention provides novel nucleic acid compounds having a cleavage domain and a 3' or 5' blocking group. These compounds offer improvements to existing methods for nucleic acid amplification, detection, ligation, sequencing and synthesis. New assay formats comprising the use of these novel nucleic acid compounds are also provided.
  • nucleic acid and “oligonucleotide,” as used herein, refer to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and to any other type of polynucleotide which is an N glycoside of a purine or pyrimidine base.
  • nucleic acid and “oligonucleotide”
  • polynucleotide refer only to the primary structure of the molecule.
  • an oligonucleotide also can comprise nucleotide analogs in which the base, sugar or phosphate backbone is modified as well as non-purine or non-pyrimidine nucleotide analogs.
  • Oligonucleotides can be prepared by any suitable method, including direct chemical synthesis by a method such as the phosphotriester method of Narang et al, 1979, Meth. Enzymol. 68:90-99; the phosphodiester method of Brown et al, 1979, Meth. Enzymol. 68: 109-151 ; the diethylphosphoramidite method of Beaucage et al, 1981, Tetrahedron Lett. 22: 1859-1862; and the solid support method of U.S. Pat. No. 4,458,066, each incorporated herein by reference.
  • a review of synthesis methods of conjugates of oligonucleotides and modified nucleotides is provided in Goodchild, 1990, Bioconjugate Chemistry 1(3): 165-187, incorporated herein by reference.
  • primer refers to an oligonucleotide capable of acting as a point of initiation of DNA synthesis under suitable conditions. Such conditions include those in which synthesis of a primer extension product complementary to a nucleic acid strand is induced in the presence of four different nucleoside triphosphates and an agent for extension (e.g., a DNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. Primer extension can also be carried out in the absence of one or more of the nucleotide triphosphates in which case an extension product of limited length is produced.
  • agent for extension e.g., a DNA polymerase or reverse transcriptase
  • the term "primer” is intended to encompass the oligonucleotides used in ligation-mediated reactions, in which one oligonucleotide is "extended” by ligation to a second oligonucleotide which hybridizes at an adjacent position.
  • primer extension refers to both the polymerization of individual nucleoside triphosphates using the primer as a point of initiation of DNA synthesis and to the ligation of two oligonucleotides to form an extended product.
  • a primer is preferably a single-stranded DNA.
  • the appropriate length of a primer depends on the intended use of the primer but typically ranges from 6 to 50 nucleotides, preferably from 15-35 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template.
  • a primer need not reflect the exact sequence of the template nucleic acid, but must be sufficiently complementary to hybridize with the template. The design of suitable primers for the amplification of a given target sequence is well known in the art and described in the literature cited herein.
  • Primers can incorporate additional features which allow for the detection or immobilization of the primer but do not alter the basic property of the primer, that of acting as a point of initiation of DNA synthesis.
  • primers may contain an additional nucleic acid sequence at the 5' end which does not hybridize to the target nucleic acid, but which facilitates cloning or detection of the amplified product.
  • the region of the primer which is sufficiently complementary to the template to hybridize is referred to herein as the hybridizing region.
  • target is synonymous and refer to a region or sequence of a nucleic acid which is to be amplified, sequenced or detected.
  • hybridization refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between "substantially complementary” nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as “stringent hybridization conditions” or “sequence-specific hybridization conditions”. Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions.
  • nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al, 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3/4):227-259; and Owczarzy et al, 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference).
  • Amplification reaction refers to any chemical reaction, including an enzymatic reaction, which results in increased copies of a template nucleic acid sequence or results in transcription of a template nucleic acid.
  • Amplification reactions include reverse transcription, the polymerase chain reaction (PCR), including Real Time PCR (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al, eds, 1990)), and the ligase chain reaction (LCR) (see Barany et al, U.S. Pat. No. 5,494,810).
  • Exemplary "amplification reactions conditions” or “amplification conditions” typically comprise either two or three step cycles. Two step cycles have a high temperature denaturation step followed by a hybridization/elongation (or ligation) step. Three step cycles comprise a denaturation step followed by a hybridization step followed by a separate elongation or ligation step.
  • a "polymerase” refers to an enzyme that catalyzes the polymerization of nucleotides. Generally, the enzyme will initiate synthesis at the 3'-end of the primer annealed to a nucleic acid template sequence.
  • DNA polymerase catalyzes the polymerization of deoxyribonucleotides.
  • Known DNA polymerases include, for example, Pyrococcus furiosus (Pfu) DNA polymerase (Lundberg et al, 1991, Gene, 108: 1), E. coli DNA polymerase I (Lecomte and Doubleday, 1983, Nucleic Acids Res.
  • T7 DNA polymerase (Nordstrom et al., 1981, J. Biol. Chem. 256:31 12), Thermus thermophilus (Tth) DNA polymerase (Myers and Gelfand 1991, Biochemistry 30:7661), Bacillus stearothermophilus DNA polymerase (Stenesh and McGowan, 1977, Biochim Biophys Acta 475:32), Thermococcus litoralis (Tli) DNA polymerase (also referred to as Vent DNA polymerase, Cariello et al, 1991, Nucleic Acids Res, 19: 4193), Thermotoga maritima (Tma) DNA polymerase (Diaz and Sabino, 1998 Braz J. Med.
  • a primer is "specific," for a target sequence if, when used in an amplification reaction under sufficiently stringent conditions, the primer hybridizes primarily to the target nucleic acid.
  • a primer is specific for a target sequence if the primer-target duplex stability is greater than the stability of a duplex formed between the primer and any other sequence found in the sample.
  • salt conditions such as salt conditions as well as base composition of the primer and the location of the mismatches, will affect the specificity of the primer, and that routine experimental confirmation of the primer specificity will be needed in many cases.
  • Hybridization conditions can be chosen under which the primer can form stable duplexes only with a target sequence.
  • the use of target-specific primers under suitably stringent amplification conditions enables the selective amplification of those target sequences which contain the target primer binding sites.
  • non-specific amplification refers to the amplification of nucleic acid sequences other than the target sequence which results from primers hybridizing to sequences other than the target sequence and then serving as a substrate for primer extension.
  • the hybridization of a primer to a non-target sequence is referred to as “non-specific hybridization” and is apt to occur especially during the lower temperature, reduced stringency, pre-amplification conditions, or in situations where there is a variant allele in the sample having a very closely related sequence to the true target as in the case of a single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • 3'-mismatch discrimination refers to a property of a DNA polymerase to distinguish a fully complementary sequence from a mismatch-containing (nearly complementary) sequence where the nucleic acid to be extended (for example, a primer or other oligonucleotide) has a mismatch at the 3' end of the nucleic acid compared to the template to which the nucleic acid hybridizes.
  • the nucleic acid to be extended comprises a mismatch at the 3' end relative to the fully complementary sequence.
  • 3'-mismatch discrimination assay refers to an assay to discern the present of improved specificity in amplification of a target DNA sequence when the target DNA sequence is interrogated with two primers having substantially identical sequence except for the occurrence of one of more nucleotide residue having different base composition at or near their respective 3'-ends.
  • a first primer having 3 '-end sequences with perfect complementarity to the target DNA sequence is considered a 3 '-matched primer
  • a second primer having a 3'-end sequences having at least one nucleotide base non-complementarity to the target DNA sequence is considered a 3 '-mismatched primer.
  • primer dimer refers to a template-independent non-specific amplification product, which is believed to result from primer extensions wherein another primer serves as a template. Although primer dimers frequently appear to be a concatamer of two primers, i.e., a dimer, concatamers of more than two primers also occur.
  • primer dimer is used herein generically to encompass a template-independent non-specific amplification product.
  • reaction mixture refers to a solution containing reagents necessary to carry out a given reaction.
  • An “amplification reaction mixture” which refers to a solution containing reagents necessary to carry out an amplification reaction, typically contains oligonucleotide primers and a DNA polymerase or ligase in a suitable buffer.
  • a “PCR reaction mixture” typically contains oligonucleotide primers, a DNA polymerase (most typically a thermostable DNA polymerase), dNTP's, and a divalent metal cation in a suitable buffer.
  • reaction mixture is referred to as complete if it contains all reagents necessary to enable the reaction, and incomplete if it contains only a subset of the necessary reagents.
  • reaction components are routinely stored as separate solutions, each containing a subset of the total components, for reasons of convenience, storage stability, or to allow for application-dependent adjustment of the component concentrations, and that reaction components are combined prior to the reaction to create a complete reaction mixture.
  • reaction components are packaged separately for commercialization and that useful commercial kits may contain any subset of the reaction components which includes the blocked primers of the invention.
  • non-activated refers to a primer or other oligonucleotide that is incapable of participating in a primer extension reaction or a ligation reaction because either DNA polymerase or DNA ligase cannot interact with the oligonucleotide for their intended purposes.
  • the non-activated state occurs because the primer is blocked at or near the 3 '-end so as to prevent primer extension.
  • specific groups are bound at or near the 3 '-end of the primer, DNA polymerase cannot bind to the primer and extension cannot occur.
  • a non-activated primer is, however, capable of hybridizing to a substantially complementary nucleotide sequence.
  • the term "activated,” as used herein, refers to a primer or other oligonucleotide that is capable of participating in a reaction with DNA polymerase or DNA ligase.
  • a primer or other oligonucleotide becomes activated after it hybridizes to a substantially complementary nucleic acid sequence and is cleaved to generate a functional 3 '- or 5'-end so that it can interact with a DNA polymerase or a DNA ligase.
  • a 3 '-blocking group can be removed from the primer by, for example, a cleaving enzyme such that DNA polymerase can bind to the 3' end of the primer and promote primer extension.
  • cleavage domain or "cleaving domain,” as used herein, are synonymous and refer to a region located between the 5 ' and 3 ' end of a primer or other oligonucleotide that is recognized by a cleavage compound, for example a cleavage enzyme, that will cleave the primer or other oligonucleotide.
  • a cleavage compound for example a cleavage enzyme
  • the cleavage domain is designed such that the primer or other oligonucleotide is cleaved only when it is hybridized to a complementary nucleic acid sequence, but will not be cleaved when it is single-stranded.
  • the cleavage domain or sequences flanking it may include a moiety that a) prevents or inhibits the extension or ligation of a primer or other oligonucleotide by a polymerase or a ligase, b) enhances discrimination to detect variant alleles, or c) suppresses undesired cleavage reactions.
  • One or more such moieties may be included in the cleavage domain or the sequences flanking it.
  • RNase H cleavage domain is a type of cleavage domain that contains one or more ribonucleic acid residue or an alternative analog which provides a substrate for an RNase H.
  • An RNase H cleavage domain can be located anywhere within a primer or oligonucleotide, and is preferably located at or near the 3 '-end or the 5 '-end of the molecule.
  • RNase HI cleavage domain generally contains at least three residues.
  • An "RNase H2 cleavage domain” may contain one RNA residue, a sequence of contiguously linked RNA residues or RNA residues separated by DNA residues or other chemical groups.
  • the RNase H2 cleavage domain is a 2'-fluoronucleoside residue.
  • the RNase H2 cleavable domain is two adjacent 2'-fluoro residues.
  • cleavage compound refers to any compound that can recognize a cleavage domain within a primer or other oligonucleotide, and selectively cleave the oligonucleotide based on the presence of the cleavage domain.
  • the cleavage compounds utilized in the invention selectively cleave the primer or other oligonucleotide comprising the cleavage domain only when it is hybridized to a substantially complementary nucleic acid sequence, but will not cleave the primer or other oligonucleotide when it is single stranded.
  • the cleavage compound cleaves the primer or other oligonucleotide within or adjacent to the cleavage domain.
  • adjacent means that the cleavage compound cleaves the primer or other oligonucleotide at either the 5 '-end or the 3 ' end of the cleavage domain.
  • Cleavage reactions preferred in the invention yield a 5 '-phosphate group and a 3' -OH group.
  • the cleavage compound is a "cleaving enzyme.”
  • a cleaving enzyme is a protein or a ribozyme that is capable of recognizing the cleaving domain when a primer or other nucleotide is hybridized to a substantially complementary nucleic acid sequence, but that will not cleave the complementary nucleic acid sequence (i.e., it provides a single strand break in the duplex).
  • the cleaving enzyme will also not cleave the primer or other oligonucleotide comprising the cleavage domain when it is single stranded.
  • Examples of cleaving enzymes are RNase H enzymes and other nicking enzymes.
  • nicking refers to the cleavage of only one strand of the double-stranded portion of a fully or partially double-stranded nucleic acid.
  • the position where the nucleic acid is nicked is referred to as the "nicking site” (NS).
  • a "nicking agent” (NA) is an agent that nicks a partially or fully double-stranded nucleic acid. It may be an enzyme or any other chemical compound or composition.
  • a nicking agent may recognize a particular nucleotide sequence of a fully or partially double-stranded nucleic acid and cleave only one strand of the fully or partially double-stranded nucleic acid at a specific position (i.e., the NS) relative to the location of the recognition sequence.
  • nicking agents include, but are not limited to, nicking endonucleases (e.g., N.BsfNB).
  • a "nicking endonuclease” thus refers to an endonuclease that recognizes a nucleotide sequence of a completely or partially double-stranded nucleic acid molecule and cleaves only one strand of the nucleic acid molecule at a specific location relative to the recognition sequence. In such a case the entire sequence from the recognition site to the point of cleavage constitutes the "cleavage domain”.
  • blocking group refers to a chemical moiety that is bound to the primer or other oligonucleotide such that an amplification reaction does not occur. For example, primer extension and/or DNA ligation does not occur.
  • the oligonucleotide is capable of participating in the assay for which it was designed (PCR, ligation, sequencing, etc).
  • the "blocking group” can be any chemical moiety that inhibits recognition by a polymerase or DNA ligase.
  • the blocking group may be incorporated into the cleavage domain but is generally located on either the 5'- or 3 '-side of the cleavage domain.
  • the blocking group can be comprised of more than one chemical moiety.
  • the "blocking group” is typically removed after hybridization of the oligonucleotide to its target sequence.
  • fluorescent generation probe refers either to a) an oligonucleotide having an attached fluorophore and quencher, and optionally a minor groove binder or to b) a DNA binding reagent such as SYBR ® Green dye.
  • fluorescent label or “fluorophore” refers to compounds with a fluorescent emission maximum between about 350 and 900 nm.
  • fluorophores can be used, including but not limited to: 5-FAM (also called
  • 5- carboxyfluorescein also called Spiro(isobenzofuran-l(3H), 9'-(9H)xanthene)-5-carboxylic acid,3',6'-dihydroxy-3-oxo-6-carboxyfluorescein); 5-Hexachloro-Fluorescein;
  • quencher refers to a molecule or part of a compound, which is capable of reducing the emission from a fluorescent donor when attached to or in proximity to the donor.
  • Quenching may occur by any of several mechanisms including fluorescence resonance energy transfer, photo-induced electron transfer, paramagnetic enhancement of intersystem crossing, Dexter exchange coupling, and exciton coupling such as the formation of dark complexes.
  • Fluorescence is "quenched" when the fluorescence emitted by the fluorophore is reduced as compared with the fluorescence in the absence of the quencher by at least 10%, for example, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.9% or more.
  • quenchers include but are not limited to DABCYL, Black HoleTM Quenchers (BHQ-1, BHQ-2, and BHQ-3), Iowa Black ® FQ and Iowa Black ® RQ. These are so-called dark quenchers. They have no native fluorescence, virtually eliminating background problems seen with other quenchers such as TAMRA which is intrinsically fluorescent.
  • ligation refers to the covalent joining of two polynucleotide ends.
  • ligation involves the covalent joining of a 3 ' end of a first polynucleotide (the acceptor) to a 5' end of a second polynucleotide (the donor). Ligation results in a phosphodiester bond being formed between the polynucleotide ends.
  • ligation may be mediated by any enzyme, chemical, or process that results in a covalent joining of the polynucleotide ends.
  • ligation is mediated by a ligase enzyme.
  • ligase refers to an enzyme that is capable of covalently linking the 3 ' hydroxyl group of one polynucleotide to the 5' phosphate group of a second polynucleotide.
  • ligases include E. coli DNA ligase, T4 DNA ligase, etc.
  • the ligation reaction can be employed in DNA amplification methods such as the "ligase chain reaction” (LCR), also referred to as the “ligase amplification reaction” (LAR), see Barany, Proc. Natl. Acad. Sci., 88: 189 (1991); and Wu and Wallace, Genomics 4:560 (1989) incorporated herein by reference.
  • LCR ligase chain reaction
  • LAR ligase amplification reaction
  • DNA ligase will covalently link each set of hybridized molecules.
  • two oligonucleotides are ligated together only when they base-pair with sequences without gaps. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA. A mismatch at the junction between adjacent oligonucleotides inhibits ligation. As in other oligonucleotide ligation assays this property allows LCR to be used to distinguish between variant alleles such as SNPs. LCR has also been used in combination with PCR to achieve enhanced detection of single-base changes, see Segev, PCT Public. No. WO9001069 (1990).
  • Novel oligonucleotides and compounds of the present invention are disclosed.
  • the novel oligonucleotides of the present invention are primers for DNA replication, as for example in PCR, DNA sequencing and polynomial amplification, to name a few such applications.
  • the primers have an inactive configuration wherein DNA replication (i.e., primer extension) is blocked, and an activated configuration wherein DNA replication proceeds.
  • the inactive configuration of the primer is present when the primer is either single-stranded, or the primer is hybridized to the DNA sequence of interest and primer extension remains blocked by a chemical moiety that is linked at or near to the 3 ' end of the primer.
  • the activated configuration of the primer is present when the primer is hybridized to a nucleic acid sequence of interest and subsequently acted upon by RNase H or other cleaving agent to remove the blocking group and allow for an enzyme (e.g., a DNA polymerase) to catalyze primer extension.
  • RNase H or other cleaving agent to remove the blocking group and allow for an enzyme (e.g., a DNA polymerase) to catalyze primer extension.
  • a number of blocking groups are known in the art that can be placed at or near the 3 ' end of the oligonucleotide (e.g., a primer) to prevent extension.
  • a primer or other oligonucleotide may be modified at the 3 '-terminal nucleotide to prevent or inhibit initiation of DNA synthesis by, for example, the addition of a 3 ' deoxyribonucleotide residue (e.g., cordycepin), a 2',3 '-dideoxyribonucleotide residue, non-nucleotide linkages or alkane-diol modifications (U.S. Pat. No. 5,554,516).
  • a 3 ' deoxyribonucleotide residue e.g., cordycepin
  • 2',3 '-dideoxyribonucleotide residue e.g., non-nucleotide linkages or alkane-diol modifications
  • blocking groups include 3 ' hydroxyl substitutions (e.g., 3 '-phosphate, 3 '-triphosphate or 3 '-phosphate diesters with alcohols such as 3- hydroxypropyl), a 2' 3 '-cyclic phosphate, 2' hydroxyl substitutions of a terminal RNA base (e.g., phosphate or sterically bulky groups such as triisopropyl silyl (TIPS) or tert-butyl dimethyl silyl (TBDMS)).
  • 2'-alkyl silyl groups such as TIPS and TBDMS substituted at the 3 '-end of an oligonucleotide are described by Laikhter et al, U.S. Pat. App. Serial No. 1 1/686,894 which is incorporated herein by reference.
  • Bulky substituents can also be incorporated on the base of the 3 '-terminal residue of the oligonucleotide to block primer extension.
  • Blocking groups to inhibit primer extension can also be located upstream, that is 5', from the 3 '-terminal residue.
  • Sterically bulky substituents which interfere with binding by the polymerase can be incorporated onto the base, sugar or phosphate group of residues upstream from the 3 '-terminus.
  • substituents include bulky alkyl groups like t-butyl, triisopropyl and polyaromatic compounds including fluorophores and quenchers, and can be placed from one to about 10 residues from the 3'-terminus.
  • abasic residues such as a C3 spacer may be incorporated in these locations to block primer extension. In one such embodiment two adjacent C3 spacers have been employed (see Examples 27 and 28).
  • blocking moieties upstream of the 3 '-terminal residue can serve two functions: 1) to inhibit primer extension, and 2) to block the primer from serving as a template for DNA synthesis when the extension product is copied by synthesis from the reverse primer. The latter is sufficient to block PCR even if primer extension can occur.
  • C3 spacers placed upstream of the 3 '-terminal residue can function in this manner (see Examples 26 and 27).
  • a modification used as a blocking group may also be located within a region 3 ' to the priming sequence that is non-complementary to the target nucleic acid sequence.
  • the oligonucleotide further comprises a cleavage domain located upstream of the blocking group used to inhibit primer extension.
  • An RNase H cleavage domain is preferred.
  • An RNase H2 cleavage domain comprising a single RNA residue or replacement of the RNA base with one or more alternative nucleosides is most preferred.
  • RNase H2 can be used to cleave duplexes containing a single 2'-fluoro residue. Cleavage occurs on the 5' side of the 2'-fluoro residue.
  • an RNase H2 cleavage domain comprising two adjacent 2'-fluoro residues is employed (see Example 6). The activity is enhanced when two consecutive 2'-fluoro modifications are present. In this embodiment cleavage occurs preferentially between the 2'-fluoro residues.
  • oligonucleotides with 2'-fluoro groups are not cleaved by single-stranded ribonucleases and are resistant to water catalyzed cleavage and completely stable at high temperatures. Enhanced cleavage has also been found when a 2'-fluoro modified RNA residue is used with a 2' LNA modified RNA residue. 2'-fluoro-containing oligonucleotides have been found to be further advantageous in certain applications compared to RNA-containing oligonucleotides in offering greater discrimination with respect to mismatches between the oligonucleotide and the target sequence.
  • the RNase H cleavage domain may include one or more of these modified residues alone or in combination with RNA bases. DNA bases and abasic residues such as a C3 spacer may also be included to provide greater performance.
  • the cleaving agent is an RNase HI enzyme a continuouse sequence of at least three RNA residues is preferred. A continuous sequence of four RNA residues generally leads to maximal activity. If the cleaving agent is an RNase H2 enzyme a single RNA residue or 2 adjacent 2'-fluoro residues are preferred.
  • One objective of incorporating modified residues within an RNase H cleavage domain is to suppress background cleavage of a primer or probe due to water catalyzed hydrolysis or cleavage by single stranded ribonucleases.
  • Replacement of the 2'-hydroxyl group with a substituent that cannot attack the adjacent phosphate group of an RNA residue can accomplish this goal.
  • Examples of this approach include the use of the 2 '-substituted nucleosides listed above, such as 2'-fluoro and 2'-0-methyl nucleosides. This is particularly advantageous when cleavage is mediated by RNase H2 and there is a single RNA residue within the cleavage domain. As shown in Figure 3, in this case cleavage by single stranded ribonucleases or water catalyzed hydrolysis occurs at a different position than cleavage by RNase H2.
  • RNA residues modifications that can be used to suppress cleavage by single stranded ribonucleases and water catalyzed hydrolysis at RNA residues include substitution of the 5' oxygen atom of the adjacent residue (3 '- to the RNA base) with an amino group, thiol group, or a methylene group (a phosphonate linkage).
  • substitution of the 5' oxygen atom of the adjacent residue (3 '- to the RNA base) with an amino group, thiol group, or a methylene group (a phosphonate linkage).
  • one or both of the hydrogen atoms on the 5' carbon of the adjacent residue can be replaced with bulkier substituents such as methyl groups to inhibit background cleavage of a ribonucleotide residue.
  • the phosphate group at the 3 '-side of an RNA residue can be replaced with a phosphorothioate, phosphorodithioates or boronate linkage.
  • a phosphorothioate the S stereoisomer is preferred. Combinations of these various modifications may also be employed.
  • the cleavage domain may include the blocking group provided that cleavage occurs on the 5 '-side of the blocking group and generates a free 3' -OH. Generally however the cleavage domain and the blocking group are separated by one to about 15 bases. After cleavage takes place the portion of the primer 3' from the cleavage site containing the blocking group dissociates from the template and a functional 3'-hydroxyl group is exposed, capable of being acted on by a polymerase enzyme. The optimal distance between the cleavage site and the blocking group will depend on the cleaving agent and the nature of the blocking group.
  • a distance of 3 to about 8 bases between the cleavage site and the blocking group is preferred.
  • the blocking group is sterically small, for example a phosphodiester at the 3' terminal nucleotide as in the following structure
  • a thermoph a cleavage site 5 bases from the 3 '-end is generally optimal. If the blocking group is larger it is advantageous to position the cleavage site further from it.
  • a thermophilic RNase H2 enzyme is utilized to cleave the oligonucleotide.
  • a thermophilic RNase H2 enzyme is used which is less active at room temperature than at elevated temperatures. This allows a hot-start type of reaction to be achieved in PCR and other primer extension assays using the blocked primers of the present invention without actually requiring a hot start, i.e., reversibly inactivated, DNA polymerase.
  • Standard less expensive DNA polymerase polymerases such as Taq polymerase can be used instead of the much more expensive hot start versions of the enzyme.
  • alternative DNA polymerases may be preferred. Utilizing RNase H as the hot start component of the assay obviates the need to develop a new reversibly inactivated analog of each different DNA polymerase.
  • Hot start properties of the enzyme may be intrinsic to the protein as in the case of Pyrococcus abysii RNase H2 (see Example 4).
  • the enzyme may be reversibly inactivated by chemical modification using, for example, maleic acid anhydride analogs such as citroconic anhydride. These compounds react with amino groups of the protein and at high temperature are released restoring activity.
  • antibodies against an RNase H which block the enzyme may be employed which are denatured at elevated temperatures.
  • the oligonucleotide of the present invention has a cleavage domain that is recognized and cleaved by a sequence specific nicking agent, e.g., a nicking enzyme.
  • the nicking agent also can be designed to cleave an oligonucleotide (e.g., a primer) at a modified nucleic acid or grouping of modified nucleic acids.
  • the oligonucleotide is designed to be recognized by a nicking agent upon hybridization with the target nucleic acid, and the nicking of the oligonucleotide/target duplex can be used to remove a blocking group and allow for oligonucleotide extension.
  • the nicking site (NS) is preferably located at or near the 3 '-end of the oligonucleotide, specifically, one to about 15 bases from the 3 '-end of the oligonucleotide.
  • nicking agents include, without limitation, single strand nicking restriction endonucleases that recognize a specific sequence such as N.BstNBI; or repair enzymes such as Mut H, MutY (in combination with an AP endonuclease), or uracil-N-glycosylase (in combination with an AP Lyase and AP endonucleases); and the genell protein of bacteriophage fl.
  • the blocked primers of the present invention minimize non-specific reactions by requiring hybridization to the target followed by cleavage before primer extension.
  • cleavage of the primer is inhibited especially when there is a mismatch that lies at or near the cleavage site. This reduces the frequency of false priming at such locations and thereby increases the specificity of the reaction. It should be noted that with Pyrococcus abysii Type II RNase H and other RNase H enzymes used in the present invention some cleavage does occur even when there is a mismatch at the cleavage site. Reaction conditions, particularly the concentration of RNase H and the time allowed for hybridization and extension in each cycle, can be optimized to maximize the difference in cleavage efficiencies between the primer hybridized to its true target and when there is a mismatch. This allows the methods of the present invention to be used very effectively to distinguish between variant alleles, including SNPs (see Examples 12-14, 22-25).
  • primer-dimers a common side reaction occurring in PCR, can also be inhibited using the 3 ' blocked primers of the present invention. This allows for a greater degree of multiplexing in PCR (e.g., detecting multiple target sequences in the case of a DNA detection/amplification assay).
  • nuclease resistant residues can be incorporated into the primer 3 ' to the RNA residue (see Example 22, 25 and 28).
  • Such groups include but are not limited to one or more phosphorothioates, phosphorodithioates, methyl phosphonates and abasic residues such as a C3 spacer.
  • substitutions both 5' and 3' to the RNA residue can also be utilized to enhance the discrimination and detection of variant alleles in the methods of the present invention. Such substitutions include but are not limited to 2'-0-methyl RNA and secondary mismatches (see Example 23).
  • substitutions include but are not limited to 2'-0-methyl RNA and secondary mismatches (see Example 23).
  • the nature of the blocking group which prevents primer extension is not critical. It can be placed at the 3 '-terminal residue or upstream from it. Labeling groups can be incorporated within the blocking group or attached at other positions on the 3 '-segment of the oligonucleotide primer which dissociates from the template after cleavage occurs.
  • labeling groups include, but are not limited to, fluorophores, quenchers, biotin, haptens such as digoxigenin, proteins including enzymes and antibodies, mass tags which alter the mass of the cleavage fragment for detection by mass spectrometry, and radiolabels such as 14 C, 3 H, 35 S, 32 P and 33 P.
  • labeling groups can also be attached to the primer 5' to the cleavage site, in which case they will be incorporated within the extension product.
  • the blocking group at or near the 3 '-end of the oligonucleotide can be a fluorescent moiety.
  • release of the fluorescent molecule can be used to monitor the progress of the primer extension reaction. This is facilitated if the oligonucleotide also contains a quencher moiety on the 5 '-side of the cleavage site. Cleavage of the oligonucleotide during the reaction separates the fluorophore from the quencher and leads to an increase in fluorescence. If the quencher is itself a fluorophore, such as Tamra, a decrease in its fluorescence may also be observed.
  • the oligonucleotide is labeled with a fluorescent molecule on the 5 '-side of the cleavage domain, and the blocking group located at or near the 3 '-end of the molecule is a quencher such as Iowa Black ® , Black HoleTM, or Tamra to name a few.
  • a quencher such as Iowa Black ® , Black HoleTM, or Tamra to name a few.
  • cleavage of the quencher from the oligonucleotide e.g., a primer
  • the primer extension product is fluorescently labeled.
  • the blocked primers of the present invention are used for nucleic acid sequencing.
  • the specificity of primer extension for DNA sequencing is also increased when using the oligonucleotides of the present invention.
  • 2', 3' dideoxynucleotide triphosphates that are fluorescently labeled and used as chain terminators and the nested fragments produced in the reaction are separated by electrophoresis, preferably capillary electrophoresis.
  • an oligonucleotide primer of the present invention is labeled with a fluorescent group and the 3 ' dideoxynucleotide triphosphate chain terminators are unlabeled.
  • the blocking group can be a quencher, in which case background fluorescence is reduced because the primer itself is not fluorescent. Only the extension products are fluorescent.
  • Another aspect of the invention includes the incorporation of alternative divalent cations such as Mn 2+ , Ni 2+ or Co 2+ , with or without Mg 2+ , into the assay buffer.
  • alternative divalent cations such as Mn 2+ , Ni 2+ or Co 2+ , with or without Mg 2+
  • the effectiveness of the particular assay is increased due to enhanced cleavage by RNase H2.
  • RNase H2 cleavable domain when two adjacent 2'-fluoronucleoside residues constitute the RNase H2 cleavable domain, 0.3-1 mM MnCb with 2-4 mM MgCk gave optimal performance in the assay (see Example 3).
  • primers, probes and other novel oligonucleotides described herein can be utilized in a number of biological assays. Although the following list is not comprehensive, the majority of the methods of the present invention fall into six general categories: (1) primer extension assays (including PCR, DNA sequencing and polynomial amplification), (2) oligonucleotide ligation assays (OLA), (3) cycling probe reactions, (4) sequencing by ligation, (5) sequencing by generation of end-labeled fragments using RNase H enzymes, and (6) synthesis by ligation.
  • primer extension assays including PCR, DNA sequencing and polynomial amplification
  • OOA oligonucleotide ligation assays
  • cycling probe reactions (4) sequencing by ligation, (5) sequencing by generation of end-labeled fragments using RNase H enzymes, and (6) synthesis by ligation.
  • primers, probes and other novel oligonucleotides described herein can be utilized in a number of primer extension assays.
  • a method of amplifying a target DNA sequence of interest comprises the steps of:
  • a 3 '-blocked primer containing a cleavage domain first hybridizes to the target sequence.
  • the primer cannot extend until cleavage of the 3' blocking group occurs after hybridization to the complementary DNA sequence.
  • an RNase H cleavage domain is present in the primer, an RNase H enzyme will recognize the double-stranded substrate formed by the primer and target and cleave the primer within or adjacent to the cleavage domain. The primer can then extend and amplification of the target can then occur. Because the primer needs to be recognized and cleaved by RNase H before extension, non-specific amplification is reduced.
  • a "hot start" polymerase is often used to reduce primer dimers and decrease non-specific amplification.
  • Blocked primers of the present invention requiring cleavage by RNase H can confer the same advantage.
  • a thermophilic RNase H enzyme with little or no activity at lower temperatures is preferred. Activation of the primers occurs only after hybridization to the target sequence and cleavage at elevated temperatures. Advantages of this approach compared to the use of a hot start reversibly inactivated DNA polymerase have been described above. Of course a hot start RNase H enzyme and a hot start DNA polymerase can be used in conjunction, if desired.
  • thermostable RNase H enzymes Three types of hot start RNase H enzymes are described here (see Tables 1, 2, and 3): 1) a thermostable RNase H enzyme that has intrinsically little or no activity at reduced temperatures as in the case of Pyrococcus abysii RNase H2; 2) a thermostable RNase H reversibly inactivated by chemical modification; and 3) a thermostable RNase H reversibly inactivated by a blocking antibody.
  • mutant versions of RNase H can be synthesized that can further improve the traits of RNase H that are desirable in the assays of the present invention.
  • mutant strains of other enzymes that share the characteristics desirable for the present invention could be used.
  • the cleavage domain within the primer is cleavable by RNase H.
  • the RNase H cleavage domain consists of a single RNA residue and cleavage of the primer is mediated by a Type II RNase H enzyme, preferably by a thermophilic Type II RNase H enzyme, and even more preferably a thermophilic Type II RNase H enzyme which is less active at room temperature than at elevated temperatures.
  • the RNase H2 cleavage domain consists of two adjacent 2'-fluoro nucleoside residues.
  • the PCR is carried out in buffers containing alternative divalent cations, including but not limited to, Mn 2+ , Ni 2+ or Co 2+ in addition to Mg 2+ .
  • alternative divalent cations including but not limited to, Mn 2+ , Ni 2+ or Co 2+ in addition to Mg 2+ .
  • the novel 3 '-blocked primers of the present invention comprising a cleavage domain can be utilized in a variation of hot start PCR in which a thermophilic nicking enzyme is used and the cleavage domain is a nicking site.
  • cleavage enzyme that lacks hot start characteristics can be used in the present invention with traditional hot-start methods such as adding the enzyme at an elevated temperature, encasing a necessary reagent or enzyme in wax, or with a hot start reversibly inactivated DNA polymerase.
  • the increased specificity of the present invention when used in amplification reactions, enables real-time PCR applications to achieve more specific results, as compared to conventional real-time PCR with standard DNA primers.
  • double-stranded DNA-binding dye assays such as SYBR ® Green assays
  • SYBR ® Green assays have a disadvantage in that a signal is produced once the dye binds to any double-stranded product produced by PCR (e.g., a primer dimer) and can thereby give rise to a false positive result.
  • a primer of the current invention is used, non-specific amplification and primer-dimer formation is reduced, and the intensity of the signal of the double-stranded DNA-binding dye will reflect amplification only of the desired target (see Example 17).
  • the reagent concentrations and reaction conditions of the assay can be varied to maximize its utility.
  • the relative efficiency of PCR using the blocked primers of the present invention relates to the concentration of the unblocking enzyme and the dwell time at the anneal/extend reaction temperature (where unblocking proceeds). With low amounts of enzyme and short dwell times, cleavage can be incomplete and the reactions with blocked primers have lower efficiency than those with unblocked primers. As either enzyme concentration or dwell time increases, the reaction efficiency with blocked primers increases and becomes identical to unblocked primers. The use of even more enzyme or longer dwell times can decrease the specificity of the assay and lessen the ability of the system to discriminate mismatches at the cleavage site or within the surrounding sequence (see Example 4).
  • the assay can be tuned for SNP assays requiring higher specificity, or for quantitation of expression levels of mRNA requiring less specificity. Specificity can also be adjusted by varying composition of the reaction buffer. For example, a Mg ++ ion concentration of 3 mM may support a very robust, high efficiency assay; lowering Mg ++ ion concentration to 2.5 mM, 2.0 mM, or lower may increase specificity of SNP discrimination, but may also lead to a slightly lower reaction efficiency (See Examples 36 and 37).
  • DNA polymerase enzymes may require use of higher Mg ++ ion concentrations. Therefore optimization of Mg ++ ion concentration can be used to adjust performance as the assay to suit specific needs, and this process is familiar to all with skill in the art.
  • Some DNA polymerase enzymes perform better when small amounts of detergent are present in the buffer. Pyrococcus abyssi RNase H2, and likely other RNase H2 enzymes, similarly has higher reaction rates when small amounts of detergent are present in the buffer.
  • Detergent content can be adjusted within a wide range and still be compatible with PCR amplification, using non-ioninc detergents (e.g., Triton-X-100, Brij-58, etc.) or select ionic detergents (e.g., CTAB) (see Examples 18 and 38).
  • non-ioninc detergents e.g., Triton-X-100, Brij-58, etc.
  • select ionic detergents e.g., CTAB
  • a primer pair having one blocked primer and one unblocked primer can be used.
  • an enzyme can be selected that has less sequence specificity and can cleave various sequences.
  • an additional mismatch flanking the cleavage site can be added to increase the ability to discriminate variant alleles.
  • Modified bases such as 2'-0-methyl nucleosides can also be introduced into the primer on either side of the cleavage site to increase specificity (see Example 23).
  • the reactions of the various assays described herein can be monitored using fluorescent detection, detection by mass tags, enzymatic detection, and via labeling the probe or primer with a variety of other groups including biotin, haptens, radionucleotides and antibodies to name a few.
  • the progress of PCR using the modified primers of the present invention is monitored in real time using a dye intercelating assay with, for example, SYBR ® Green.
  • the progress of PCR using the modified primers of the present invention is monitored using a probe labeled with a fluorophore and a quencher such as a molecular beacon or, as in the 5'nuclease assay where cleavage of the probe occurs.
  • a probe labeled with a fluorophore and a quencher such as a molecular beacon or, as in the 5'nuclease assay where cleavage of the probe occurs.
  • a dual labeled probe which is cleavable by RNase H2 may be employed. In the latter case, cleavage of both the hybridized primers and the probe can be mediated by the same enzyme.
  • the RNase H cleavage domain within the probe may comprise only RNA residues. In general, all of the combinations of residues useful in the cleavage domain of the blocked primers of the present invention can be used as the cleavage domain within the probe.
  • thermophilic versions of RNase H2 are preferred , especially thermophilic RNase H2 enzymes having lower activity at reduced temperatures.
  • thermophilic RNase H2 enzymes have been isolated and have shown to be stable under thermocycling conditions and useful in PCR.
  • the blocked primers of the present invention can be used in the primer-probe assay format for PCR described in U.S. Patent App. 2009/0068643.
  • the primer also contains a label domain on the 5' end of the oligonucleotide which may or may not be complementary to the target nucleic acid.
  • the product generated by extension of the primer serves as a template for synthesis by the reverse primer in the next cycle of PCR. This converts the label domain into a double stranded structure.
  • a fluorophore and a quencher are attached to the label domain and the reaction is monitored by an increase in fluorescence resulting from an increase in the distance between the fluorophore and quencher in the double stranded form compared to the single stranded state.
  • the label domain contains a cleavage domain located between the fluorophore and quencher. Cleavage occurs only when the cleavage domain is double stranded.
  • the reaction is monitored by an increase in fluorescence.
  • the cleaving agent may be one that cleaves both strands, the primer and its complement, such as a restriction enzyme.
  • the cleaving agent may be a nicking agent that cleaves only the primer, preferably an RNase H enzyme, and even more preferably a thermostable RNase H2 enzyme.
  • the label domain may also contain other labeling groups including but not limited to biotin, haptens and enzymes to name a few. Alternatively the 5' fragment released by cleavage within the label domain may serve as a mass tag for detection by mass spectrometry.
  • the blocked primers of the present invention can be used in the template-probe assay format for PCR described in U.S. Patent App. 2009/0068643.
  • RNase H2 cleavable blocked oligonucleotides are used to detect 5-methylcytosine residues by PCR analysis of sodium bisulfite treated nucleic acids, including but not limited to DNA and RNA.
  • PCR analysis of sodium bisulfite treated nucleic acids including but not limited to DNA and RNA.
  • 5-methylcytosine is highly resistant to this deamination, resulting in preservation of the 5-methylcytosine nucleotide as a cytosine, rather than conversion to a thymine.
  • Numerous methods have been employed to detect 5' cytosine methylation modifications following the bisulfite conversion technique. Examples include, but are not limited to, standard mismatch-specific quantitative and non-quantitative PCR methods, as well as subcloning and sequencing of the generated sodium bisulfite reaction products.
  • the template is bisulfite treated by methods that are well known to those in the art. If the starting template was RNA, a complementary cDNA strand is generated by any well known reverse transcription method. Blocked cleavable oligonucleotides that will either match or discriminate against the target template cytosines (now converted to uracils) or 5-methylcytosines are added to a PCR reaction containing the RNase H2 enzyme and the bisulfite treated template. Amplification of the mismatched (converted cytosine>uracil or unconverted 5-methylcytosine>5-methylcytosine) base containing template is highly reduced relative to the matched base template due to the mismatch discrimination of RNase H2 cleavage reaction.
  • the blocked primers of the present invention can also be used in allele-specific PCR (AS-PCR).
  • AS-PCR is used to detect variant alleles of a gene, especially single base mutations such as SNPs (see for example U.S. Patent No. 5,496,699). SNP locations in the genome, as well as sequences of mutated oncogenes, are known in the art and PCR primers can be designed to overlap with these regions.
  • Detection of single base mismatches is a critical tool in diagnosing and correlating certain diseases to a particular gene sequence or mutation.
  • AS-PCR has been known in the biological arts for more than a decade (Bottema et ah, 1993, Methods Enzymol., 218, pp. 388-402), tools are still needed to more accurately discriminate between particular mismatches and fully complementary sequences. The present invention addresses this need.
  • a primer is utilized which overlaps the variant locus.
  • the primer is designed such that the 3 '-terminal nucleotide is positioned over the mutation site.
  • the mutation site is sometimes located over one or two bases from the 3 '-end. If there is a mismatch at or near the 3 '-end, primer extension and hence PCR are inhibited.
  • the difference between the efficiency of amplification when there is an exact match with the primers versus an allelic variant where there is one or more mismatches can in some cases be measured by end point PCR in which case the final amplification products are analyzed by, for example, gel electrophoresis. More commonly real time PCR is used to determine the efficiency of amplification.
  • a fluorescence based method of detection of the amplicon in real time such as a DNA dye binding assay or a dual labeled probe assay is most often used.
  • the PCR cycle where fluorescence is first detectable above background levels (the Cp, or crossing point) provides a measure of amplification efficiency. If there is a mismatch between the primer and the target DNA, amplification efficiency is reduced and the Cp is delayed. Generally an increase in Cp of 4 to 5 cycles is sufficient for discrimination of SNPs.
  • the primer contains a single RNA residue, and the mismatch can be aligned directly over the RNA residue of the primer.
  • the difference in crossing point (Cp) values between a perfect match and a mismatch, correlating to a cleavage differential, is readily apparent (see Example 13).
  • aligning the mismatch one base to either the 5' side or the 3 ' side of the RNA residue increases the difference in Cp values.
  • the subsequent RNase H2 cleavage would leave the mismatch as the last base of the 3 ' end of the cleaved primer.
  • having the mismatch directly on top of the RNA residue is more effective in most cases than locating the mismatch to the 5' side of the RNA residue.
  • the primer contains multiple RNA residues or two adjacent 2'-fluoro residues and detection of the mismatch follows the same principles as with a primer containing one RNA residue; the mismatch preferably is located near or on top of the expected point of cleavage.
  • a second mismatch is used to increase the sensitivity of the assay.
  • the second mismatch is placed to the 3 ' side of the mismatch directly over the SNP site.
  • the second mismatch is placed one or two bases from the mismatch directly over the SNP site (see Example 23).
  • modified residues are incorporated into the primer on the 5'- or 3 '-side of the base located over the mutation site.
  • a 2'-0-methyl ribonucleoside is placed immediately 5' to the RNA base within the primer (see Example 22).
  • the sensitivity of the assay can also be increased through incorporation of nuclease resistant analogs into the primer on the 3 '-side of the base over the mutation site.
  • nuclease resistant analogs include, but are not limited to, phosphorothioates, phosphorodithioates, methylphosphonates and abasic residues such as a C3 spacer.
  • phosphorothioate internucleotide linkages are incorporated at each position from the RNA base over the mutation site to the 3 '-end of the primer.
  • phosphorothioate linkages or phosphoroditioate are incorporated at all positions from the base on the 3 '-side of the RNA residue to the 3 '-end of the primer.
  • a single phosphorothioate or phosphorodithioates is introduced on the 3 '-side of the residue immediately downstream from the RNA base within the primer.
  • the phosphorothioate bonds are placed between each monomer 3 ' to the RNA monomer directly over the SNP site, as well as between the RNA monomer and the base 3 ' to the RNA base (see Example 25).
  • the assay sensitivity can also be improved by optimizing the placement of the 3' blocking group or groups.
  • a blocking group is placed internal to the 3 ' end of the oligonucleotide.
  • more than on blocking group is placed internal to the 3' terminus.
  • an RNA monomer sits directly over the SNP site, with a DNA monomer 3' to the RNA monomer, followed by two C3 spacers, and finally followed by a 3 ' terminal base (see Example 28).
  • the assay sensitivity and specificity also be improved by optimization of magnesium ion concentration in the reaction buffer, wherein lower magnesium levels (e.g., 1.5 mM or 2.0 or 2.5 mM, etc.) may confer higher specificity and higher magnesium levels (e.g., 3.0 mM, 3.5 mM, etc.) may confer lower specificity but with higher amplification efficiency (see Examples 36 and 37).
  • lower magnesium levels e.g., 1.5 mM or 2.0 or 2.5 mM, etc.
  • higher magnesium levels e.g., 3.0 mM, 3.5 mM, etc.
  • One convenient, quantitative measure of improved specificity during amplification of a target DNA sequence is the observed change in Cp value (ACp) for amplifying a target DNA sequence with a matched primer vs. a mismatched primer.
  • a preferred ACp of at least about 5 or greater or a relative increase of ACp of at least about 50% or greater is indicative of improved specificity by optimization of magnesium ion concentration. More typically, however, as revealed by the Examples, preferred ACp can be much greater, such as ACp values of at least about 10-20 or greater or a relative increase of ACp of at least about 100% or greater.
  • the observed ACp indicateive of improved specificity by optimization of magnesium ion concentration can depend upon primer design and the particular target DNA sequence being interrogated.
  • the primers can be designed to detect more than one mismatch.
  • the forward primer can detect a first mismatch
  • the reverse primer could detect a second mismatch.
  • the assay can be used to indicate whether two mismatches occur on the same gene or chromosome being analyzed. This assay would be useful in applications such as determining whether a bacterium of interest is both pathogenic and antibiotic resistant.
  • the forward and reverse primers are both blocked and overlap at the mismatch.
  • the blocking groups are internal to the 3 ' end of the oligonucleotide.
  • an RNA monomer sits directly over the SNP site, with a DNA monomer 3' to the RNA monomer, followed by two C3 spacers, and finally followed by a 3' terminal base.
  • RT-PC Reverse transcriptase PCR
  • the methods of the present invention can be used in coupled reverse transcription-PCR (RT-PCR).
  • reverse transcription and PCR are carried out in two disctinct steps. First a cDNA copy of the sample mRNA is synthesized using either an oligo dT primer or a sequence specific primer. Random hexamers and the like can also be used to prime cDNA synthesis. The resulting cDNA is then used as the substrate for PCR employing the blocked primers and methods of the present invention.
  • reverse transcription and PCR can be carried out in a single closed tube reaction.
  • three primers are employed, one for reverse transcription and two for PCR.
  • the primer for reverse transcription binds to the mRNA 3 ' to the position of the PCR amplicon.
  • the reverse transcription primer can include RNA residues or modified analogs such as 2'-0-methyl RNA bases which will not form a substrate for RNase H when hybridized to the mRNA.
  • an RNase H2 enzyme which has decreased activity at lower temperatures is used as the cleaving agent.
  • RT-primer In the three primer RT-PCR assay it is desirable to inhibit the RT-primer from participating in the PCR reaction. This can be accomplished by utilizing an RT-primer having a lower Tm than the PCR primers so it will not hybridize under the PCR conditions.
  • a non-replicable primer incorporating, for example, two adjacent C3 spacers can be used as the RT-primer (as in polynomial amplification, see U.S. Pat. No. 7,1 12,406). In this case when the cDNA is copied by extension of the forward PCR primer it will not include the binding site for the RT-primer.
  • only the reverse PCR primer is blocked utilizing the compositions and methods of the present invention.
  • both the forward and reverse PCR primers are blocked.
  • the reverse PCR primer is blocked in the 3 primer RT-PCR assay to prevent it from being utilized for reverse transcription.
  • modified bases such as 2'-0-methyl RNA residues can be incorporated in the reverse PCR primer although any such modification must allow the primer sequence to serve as a template for DNA synthesis and be copied.
  • assay formats and applications include PCR; real-time PCR utilizing double-stranded DNA-binding dyes such as SYBR ® Green, 5' nuclease assays (TaqmanTM assays) or molecular beacons; primer-probe and template-probe assays (see U.S. Patent Application 2009/0068643); polynomial or linked linear amplification assays; gene construction or fragment assembly via PCR; allele-specific PCR and other methods used to detect single nucleotide polymorphisms and other variant alleles; nucleic acid sequencing assays; and strand displacement amplification.
  • cleavage of the primers of the present invention can be used to enhance the specificity of the particular reaction.
  • Fluorophore 2. Multiple RNA Nuclease- cally RNase H2 Coupled A. Fluorescence residues resistant linkages modified 1. Non- amplification B. Mass Specific RNA Nuclease- cally RNase H2 Coupled A. Fluorescence residues resistant linkages modified 1. Non- amplification B. Mass Specific RNA Nuclease- cally RNase H2 Coupled A. Fluorescence residues resistant linkages modified 1. Non- amplification B. Mass Specific
  • Phosphorothioate 2. Thermostable transcription 2. Dye-binding assay
  • Cycling probe reactions are another technique for detecting specific nucleic acid sequences (see U.S. Pat. No. 5,403,71 1). The reaction operates under isothermal conditions or with temperature cycling. Unlike PCR products accumulate in a linear fashion.
  • Table 2 illustrates a non-comprehensive set of possible elements of the current invention to improve assays based on the cycling probe reaction.
  • New features of the invention include 1) use of a hot start RNase H enzyme; 2) cleavage of novel sequences by RNase H enzymes (e.g., cleavage of substrates containing 2'-fluoronucleosides by Type II RNases H); and 3) introduction of modifications and secondary mismatches flanking an RNase H cleavage domain to enhance specificity and/or suppress nonspecific cleavage reactions. Such modifications and secondary mismatches are particularly useful when cleavage is mediated by a Type II RNase H and the cleavage domain is a single RNA residue or two adjacent 2'-fluoro residues.
  • the present invention can also serve to increase the specificity of DNA ligation assays.
  • Donor and/or acceptor oligonucleotides of the present invention can be designed which bind adjacent to one another on a target DNA sequence and are modified to prevent ligation.
  • Blocking groups on the acceptor oligonucleotide useful to inhibit ligation are the same as those used to prevent primer extension. Blocking the donor oligonucleotide can be readily accomplished by capping the 5'-OH group, for example as a phosphodiester, e.g..:
  • 5' blocking groups include 5'-0-alkyl substituents such as 5'-0-methyl or 5'-0-trityl groups, 5'-0-heteroalkyl groups such as 5'-OCH 2 CH 2 OCH3, 5'-0-aryl groups, and 5'-0-silyl groups such as TIPS or TBDMS.
  • a 5' deoxy residue can also be used to block ligation.
  • Sterically bulky groups can also be placed at or near the 5 '-end of the oligonucleotide to block the ligation reaction.
  • a 5 '-phosphate group cannot be used to block the 5' -OH as this is the natural substrate for DNA ligase.
  • the blocking groups Only after hybridization to the target DNA sequence are the blocking groups removed by, for example cleavage at an RNase H cleavable domain, to allow ligation to occur.
  • cleavage is mediated by an RNase H Type II enzyme, and even more preferably a thermophilic Type II RNase H enzyme.
  • thermophilic Type II RNase H enzyme which is less active at room temperature than at elevated temperature is utilized to mediate cleavage and thereby activation of the acceptor and/or donor oligonucleotide.
  • a sequence specific nicking enzyme such as a restriction enzyme, may be utilized to mediate cleavage of the donor and/or acceptor oligonucleotide.
  • the cleaving reaction is first carried out at a higher temperature at which only one of the two oligonucleotides hybridizes to the target sequence. The temperature is then lowered, and the second oligonucleotide hybridizes to the target, and the ligation reaction then takes place.
  • this oligonucleotide is not blocked at or near the 5 '-end, but simply has a free 5' -OH.
  • This oligonucleotide cannot serve as a donor in the ligation reaction; to do so requires a 5 '-phosphate group.
  • the 5 '-end is functionally blocked.
  • Cleavage by RNase H generates a 5 '-phosphate group allowing the donor oligonucleotide to participate in the ligation reaction.
  • An important advantage of the present invention is that it allows double interrogation of the mutation site, and hence greater specificity, than standard ligation assays. There is an opportunity for discrimination of a variant allele both at the cleavage step and the ligation step.
  • Table 3 illustrates a non-comprehensive set of possible elements of the current invention to improve oligonucleotide ligation assays.
  • a method of sequencing a target DNA of interest is provided.
  • the method entails
  • a reaction mixture comprising a primer having a cleavage domain and a blocking group linked at or near to the 3 ' end of the primer which prevents primer extension, a sample nucleic acid comprising the target DNA sequence of interest, a cleaving enzyme, nucleotide triphosphate chain terminators (e.g., 3 ' dideoxynucleotide triphosphates) and a polymerase,
  • next generation sequencing is “sequencing by synthesis", wherein genomic DNA is sheared and ligated with adapter oligonucleotides or amplified by gene-specific primers, which then are hybridized to complementary oligonucleotides that are either coated onto a glass slide or are placed in emulsion for PCR.
  • the subsequent sequencing reaction either incorporates dye-labeled nucleotide triphosphates or is detected by chemiluminescence resulting from the reaction of pyrophosphate released in the extension reaction with ATP sulfurylase to generate ATP and then the ATP-catalyzed reaction of luciferase and its substrate luciferin to generate oxyluciferin and light.
  • a second type of next generation sequencing is "sequencing by ligation", wherein four sets of oligonucleotides are used, representing each of the four bases. In each set, a fluorophore-labeled oligonucleotide of around 7 to 1 1 bases is employed in which one base is specified and the remaining are either universal or degenerate bases.
  • an 8-base oligonucleotide containing 3 universal bases such as inosine and 4 degenerate positions
  • a specified base A, T, C or G
  • fluorescent label attached to either the 5'- or 3 '-end of the molecule or at an internal position that does not interfere with ligation.
  • Four different labels are employed, each specific to one of the four bases.
  • a mixture of these four sets of oligonucleotides is allowed to hybridize to the amplified sample DNA.
  • DNA ligase the oligonucleotide hybridized to the target becomes ligated to an acceptor DNA molecule. Detection of the attached label allows the determination of the corresponding base in the sample DNA at
  • a donor oligonucleotide of about 7-11 bases contains a specified base at the 5' end of the oligonucleotide.
  • the remaining bases are degenerate or universal bases, and a label specific to the specified base is incorporated on the 3 ' side of the specified base.
  • the 3 ' end of the probe is irreversibly blocked to prevent the donor oligonucleotide from also acting as an acceptor. In some cases this may be accomplished by the labeling group.
  • the second base from the 5' end of the oligonucleotide, i.e., the residue next to the specified base is a degenerate mixture of the 4 RNA bases.
  • any anaolog recognized by RNase H2 such as a 2'-fluoronucleoside may be substituted at this position.
  • a universal base such as riboinosine or ribo-5-nitroindole, may also be incorporated at this location.
  • the probe first hybridizes to the target sequence and becomes ligated to the acceptor DNA fragment as in the standard sequencing by ligation reaction. After detection of the specified base, RNase H2 is added which cleaves the probe on the 5 '-side of the RNA residue leaving the specified base attached to the 3 ' end of the acceptor fragment. The end result is that the acceptor fragment is elongated by one base and now is in position to permit the determination of the next base within the sequence.
  • the cycle is repeated over and over, in each case moving the position of hybridization of the donor oligonucleotide one base 3 ' down the target sequence.
  • the specificity is increased compared to traditional sequencing by ligation because the specified base is always positioned at the junction of the ligation reaction.
  • the donor oligonucleotide probe can optionally contain universal bases including, but not limited to, 5-nitroindole, ribo-5'-nitro indole, 2'-0-methyl- 5-nitroindole, inosine, riboinosine, 2'-0-methylriboinosine and 3-nitropyrrole. This reduces the number of different oligonucleotides in each set required for the assay by a factor of four for every degenerate position on the probe substituted with a universal base.
  • the method can also include a capping step between the ligation reaction and the RNase H2 cleaving step. The capping reaction can be performed by introducing a DNA polymerase and a chain terminator, thereby capping any of the acceptor fragment molecules that did not ligate with a donor oligonucleotide probe in the previous step.
  • the ligation reactions and hence the sequencing readout proceeds in the 5'- to 3 '-direction one base at a time.
  • the donor oligonucleotide can be designed so that two bases are determined in each cycle.
  • oligonucleotide As in all cases there is a 5 '-phosphate (p) to permit ligation of the donor oligonucleotide to the acceptor.
  • p 5 '-phosphate
  • Sixteen such oligonucleotide sets are required, one for each of the sixteen possible dinucleotides.
  • Each of the sixteen can be labeled with a different fluorophore.
  • ligation reactions can be carried out with 4 separate pools each having four such sets of oligonucleotides. In that case, only four different fluorophores are required.
  • a donor oligonucleotide of the following type can be used: pA-N-R-N-N-N-I-I-X wherein p, N, R, I and X are as defined in the previous example.
  • One base is determined at each cycle but at alternate positions: 1, 3, 5, etc. This may be adequate for identification of the sequence if compared to a reference database.
  • the remaining bases can be determined by repeating the sequencing reaction on the same template with the original acceptor oligonucleotide shifted one base upstream or downstream.
  • a donor oligonucleotide of the following type can be used: p-A-F-FN-N-N-I-I-X wherein p, N, I and X are as defined above and F is a degenerate mixture of all four 2'-fluoronucleosides.
  • cleavage by RNase H2 results in the addition of two bases to the 3 '-end of the acceptor (i.e., AF).
  • the sequence at the 3 '-end of the acceptor would be ...A-F-S-F-F-N-N-N-I-I-X where S is the specified base at position 3, and X would be a different fluorophore from the previous cycle if the specified base were not A.
  • Cleavage with RNase H2 next occurs between the two 2'-fluororesidues. Cleavage by RNase H2 at the isolated 2'-fluororesidue occurs much more slowly and can be avoided by adjusting the RNase H2 concentration and reaction time.
  • a variant of the above method can be performed in which sequencing proceeds in the 3' - to 5 '-direction.
  • an acceptor oligonucleotide is added at each cycle as in the following structure: X-I-I-N-N-N-F-F-S-OH wherein the specified base (S) is at the 3 '-end of the oligonucleotide.
  • the 5 '-end is blocked to prevent the oligonucleotide from acting as a donor.
  • Cleavage by RNase H2 leaves the sequence pF-S at the 5 '-end of the donor fragment which is prepared for the next sequencing cycle.
  • a capping step can be included in the cycle before the cleavage reaction using a phosphatase to remove the 5 '-phosphate of the donor oligonucleotide if ligation to the acceptor failed to occur.
  • the invention provides an improvement for DNA sequencing using ribotriphosphates (or alternative analogs which provide a substrate for RNase H2, such as 2'-fluoronucleoside triphosphates) in conjunction with a fluorescently labeled primer.
  • ribotriphosphates or alternative analogs which provide a substrate for RNase H2, such as 2'-fluoronucleoside triphosphates
  • the triphosphate residue would be incorporated by a DNA polymerase.
  • the concentration of the ribo triphosphate, or the alternative analog providing a substrate for RNase H2 is adjusted to a concentration such that on average one such base is incorporated randomly within each extension product produced by the polymerase.
  • the nested family of fragments originating from the primer is generated by cleavage with RNase H2 and then separated by electrophoresis as in standard DNA sequencing methods.
  • RNA residues or modified nucleosides such as 2'-fluoronucleosides may be incorporated into the extension product and the subsequent digestion with RNase H2 is limited so that on average each strand is cut only once.
  • RNase H2 a different ribotriphosphate (A, C, T or G) or other RNase H2 cleavable analog.
  • use of expensive fluorescently labeled dideoxy triphosphate chain terminators is obviated.
  • NGS Next Generation DNA Sequencing
  • NGS methods typically involve PCR amplification of sub-fragments of a target nucleic acid sample prior to performing the actual sequencing reactions and base identity interrogation. Selective amplification of regions adjacent to SNP sites could be achieved using the blocked-cleavable primers with RNase H2 method of the present invention, enriching those sequences for input into NGS analysis. Further, NGS methods can involve the need for multiplex PCR reactions to enrich for many specific sequences of interest, and primer-dimer and other unwanted reactions can occur which conbritue unwanted fragemtns into the sequencing workflow, decreasing useful information content, increasing cost, and lowering throughput.
  • PCR amplification preformed as part of the work flow of NGS employs high fidelity DNA polymerases, which can have 10- 100 fold lower base incorporation error rate than Taq DNA polymerase.
  • Many high fidelity DNA polymerases possess a 3 '-exonuclease proofreading activity, which can in some cases remove a non-nucleotide blocking group from the 3 '-end of a modified primer.
  • blocked-cleavable primers particularly those with internal template blocking groups (e.g., internal C3 spacers) having an unmodified DNA 3 '-end are not recognized by the 3 '-exonuclease activity of the high fidelity polymerase and permit linked use of blocked-cleavable primers and RNase H2 with amplification reactions employing a high fidelity DNA polymerase (see Examples 39 and 40).
  • internal template blocking groups e.g., internal C3 spacers
  • an improved method for oligonucleotide synthesis is provided.
  • a composition acting as a donor oligonucleotide can be ligated to an acceptor fragment in order to add additional bases to the 3 '-end of the acceptor fragment. It is the acceptor fragment that is the growing polynucleotide undergoing synthesis.
  • the composition of the donor fragment is preferably a single-stranded oligonucleotide that forms a hairpin to provide a double-stranded region with an overhang of about 1-8 bases on the 3 '-end. The base at the 5' end would be the desired base to add to the growing acceptor fragment.
  • a polynucleotide containing all four bases A, C, T and G
  • four different donor fragments are employed which can have the identical sequence except varying in the 5' base.
  • the donor is blocked at the 3 '-end so it cannot react as an acceptor.
  • the blocking group placed at or near the 3 '-end of the donor can be a label to allow monitoring of the reaction.
  • Four different labels can be used corresponding to the four different bases at the 5 '-end of the donor.
  • the base adjacent to the desired base at the 5 '-end is a RNA base or an alternative analog such as a 2'-fluoronucleoside which provides a substrate for RNase H2.
  • the overhang at the 3 '-end can be random (degenerate) bases or universal bases or a combination of both.
  • the donor fragment binds to the acceptor fragment, through hybridization of the 3 '-end of the acceptor to the 3 '-overhang of the donor oligonucleotide.
  • a DNA ligase enzyme is then used to join the two fragments.
  • a Type II RNase H is used to cleave the product on the 5 '-side of the RNase H2 cleavage site, transferring the 5' base of the donor to the 3 '-end of the acceptor.
  • a third step can be included in the cycle between the ligase and RNase H2 cleavage reactions in which molecules of the growing polynucleotide chain which may have failed to ligate are capped by reaction with a dideoxynucleotide triphosphate (or other chain terminator) catalyzed by a DNA polymerase.
  • the DNA polymerase is a deoxynucleotide terminal transferase.
  • the cycle is repeated, and the acceptor fragment can continue to be extended in a 5' to 3' direction.
  • the acceptor can be attached to a solid support such as controlled pore glass or polystyrene
  • a donor oligonucleotide can be used to add two bases to the 3'-end of the acceptor oligonucleotide at each cycle.
  • the RNase H2 cleavable residue would be positioned 3 ' from the 5' end of the donor.
  • This enzymatic synthesis method is particularly advantageous for synthesis of longer DNA molecules.
  • the hairpin reagents corresponding to each base can be collected for reuse in further cycles or additional syntheses. Because the system does not use organic solvents, waste disposal is simplified.
  • kits for nucleic acid amplification, detection, sequencing, ligation or synthesis that allow for use of the primers and other novel oligonucleotides of the present invention in the aforementioned methods.
  • the kits include a container containing a cleavage compound, for example a nicking enzyme or an RNase H enzyme; another container containing a DNA polymerase and/or a DNA ligase and preferably there is an instruction booklet for using the kits.
  • the kits include a container containing both a nicking enzyme or an RNase H enzyme combined with a DNA polymerase or DNA ligase.
  • the modified oligonucleotides used in the assay can be included with the enzymes.
  • the cleavage enzyme agent, DNA polymerase and/or DNA ligase and oligonucleotides used in the assay are preferably stored in a state where they exhibit long-term stability, e.g., in suitable storage buffers or in a lyophilized or freeze dried state.
  • the kits may further comprise a buffer for the nicking agent or RNase H, a buffer for the DNA polymerase or DNA ligase, or both buffers.
  • the kits may further comprise a buffer suitable for both the nicking agent or RNase H, and the DNA polymerase or DNA ligase. Buffers may include RNasin and other inhibitors of single stranded ribonucleases. Descriptions of various components of the present kits may be found in preceding sections related to various methods of the present invention.
  • the kit may contain an instruction booklet providing information on how to use the kit of the present invention for amplifying or ligating nucleic acids in the presence of the novel primers and/or other novel oligonucleotides of the invention.
  • the information includes one or more descriptions on how to use and/or store the RNase H, nicking agent, DNA polymerase, DNA ligase and oligonucleotides used in the assay as well as descriptions of buffer(s) for the nicking agent or RNase H and the DNA polymerase or DNA ligase, appropriate reaction temperature(s) and reaction time period(s), etc.
  • kits for the selective amplification of a nucleic acid from a sample comprises
  • oligonucleotide primer each having a 3' end and 5' end, wherein each oligonucleotide is complementary to a portion of a nucleic acid to be amplified or its complement, and wherein at least one oligonucleotide comprises a RNase H cleavable domain, and a blocking group linked at or near to the 3 ' end of the oligonucleotide to prevent primer extension and/or to prevent the primer from being copied by DNA synthesis directed from the opposite primer;
  • kits may optionally include a DNA polymerase.
  • the kit for selective amplification of a nucleic acid includes an oligonucleotide probe having a 3 ' end and a 5' end comprising an RNase H cleavable domain, a fluorophore and a quencher, wherein the cleavable domain is positioned between the fluorophore and the quencher, and wherein the probe is complementary to a portion of the nucleic acid to be amplified or its complement.
  • the present invention is directed to a kit for the ligation of an acceptor oligonucleotide and a donor oligonucleotide in the presence of a target nucleic acid sequence.
  • the kit comprises
  • the kit may optionally include a DNA ligase enzyme.
  • the donor oligonucleotide contains an RNase H cleavage domain, but lacks a blocking group at or near the 5 '-end and instead has a free 5' -OH.
  • oligonucleotide primers include a cleavage domain, which is cleavable by an RNase H enzyme, positioned 5' of a blocking group.
  • the blocking group c an b e linked at or near the 3 '-end of the oligonucleotide primer.
  • the blocking group prevents primer extension and/or inhibits the oligonucleotide primer from serving as a template for DNA synthesis.
  • the blocking group can encompass one of several designs selected from the group consisting of RDDDDx, RDDDDMx, RDxxD, RDxxDM, RDDDDxxD, RDDDDxxDM and DxxD, wherein R is an RNA residue, D is a DNA residue, M is a mismatched residue and x is a C3 spacer.
  • RDDDDx, RDDDDMx, RDxxD, RDDDDxxDM a blocking group having an M
  • a mismatch exists at the location of the M in the blocking group oligonucleotide and its pairing partner in the target DNA sequence.
  • This example describes the cloning of codon optimized RNase H2 enzymes from thermophilic organisms.
  • candidate genes were identified from public nucleotide sequence repositories from Archaeal hyperthermophilic organisms whose genome sequences had previously been determined. While RNase H2 enzymes do share some amino acid homology and have several highly conserved residues present, the actual homology between the identified candidate genes was low and it was uncertain if these represented functional RNase H2 enzymes or were genes of unknown function or were non-functional RNase H2 genes. As shown in Table 4, five genes were selected for study, including two organisms for which the RNase H2 genes have not been characterized and three organisms to use as positive controls where the RNase H2 genes (rnhb) and functional proteins have been identified and are known to be functional enzymes.
  • References 1-6 1) Haruki, M., Hayashi, K., Kochi, T., Muroya, A., Koga, Y., Morikawa, M., Imanaka, T. and Kanaya, S. (1998) Gene cloning and characterization of recombinant RNase HII from a hyperthermophilic archaeon. J Bacteriol, 180, 6207-6214; 2) Haruki, M., Tsunaka, Y., Morikawa, M. and Kanaya, S. (2002) Cleavage of a DNA-RNA-DNA/DNA chimeric substrate containing a single ribonucleotide at the DNA-RNA junction with prokaryotic RNases HII.
  • Codons of the native gene sequence were optimized for expression in E. coli using standard codon usage tables. The following sequences were assembled and cloned into plasmids as artificial genes made from synthetic oligonucleotides using standard methods. DNA sequence identity was verified on both strands. Sequences of the artificial DNA constructs are shown below. Lower case letters represents linker sequences, including a Bam HI site on the 5'-end and a Hind III site on the 3'-end. Upper case letters represents coding sequences and the ATG start codons are underlined.
  • BL21(DE3) competent cells (Novagen) were transformed with each plasmid and induced with 0.5 mM isopropyl- -D-thio-galactoside (IPTG) for 4.5 hours at 25 °C.
  • IPTG isopropyl- -D-thio-galactoside
  • 5 mL of IPTG induced culture was treated with Bugbuster ® Protein Extraction Reagent and Benzonase ® Nuclease (Novagen) to release soluble proteins and degrade nucleic acids according to the manufacturer's instructions.
  • the recovered protein was passed over a Ni affinity column (Novagen) and eluted with buffer containing 1M imidazole according to protocols provided by the manufacturer.
  • a 10 fold dilution in 500 mM NaCl, 20 mM TrisHCl, 5 mM imidazole, pH 7.9 is made and 10 mL is used per 0.5 g of pelleted bacterial paste from induced cultures.
  • 5 mL of Bugbuster ® Protein Extraction Reagent (Novagen) per 100 mL of induced culture is used for cell lysis.
  • 5KU rLysozymeTM Novagen
  • 250U DNase I Roche Diagnostics, Indianapolis, IN
  • the lysates are heated for 15 minutes at 75°C to inactive the DNase I and any other cellular nucleases present.
  • the lysates are then spun at 16,000 x g for 20 minutes to sediment denatured protein following heat treatment.
  • the centrifugation step alone provides a large degree of functional purification of the recombinant thermostable enzymes.
  • the resulting soluble supernatant is passed over a Ni affinity column containing His -Bind ® Resin (Novagen) and eluted with an elution buffer containing 200 mM imidazole.
  • the purified protein is then precipitated in the presence of 70% ammonium sulfate and resuspended in storage buffer (lOmM Tris pH 8.0, ImM EDTA, lOOmM NaCl, 0.1% Triton X-100, 50% Glycerol) to concentrate and stabilize the protein for long term storage.
  • the concentrated protein is dialyzed 2 x 2 hours (x250 volumes each) against the same storage buffer to remove residual salts.
  • the final purified protein is stored at -20°C.
  • Recombinant protein was made and purified for each of the cloned RNase H2 enzymes as outlined above. Samples from Pyrococcus kodakaraensis, Pyrococcus furiosus, Pyrococcus abyssi, and Sulfolobus solfataricus were examined using SDS 10% polyacrylamide gel electrophoresis. Proteins were visualized with Coomassie Blue staining. Results are shown in Figure 5. If the expression and purification method functioned as predicted, these proteins should all contain a 6x Histidine tag (SEQ ID NO: 313), which can be detected using an anti-His antibody by Western blot.
  • SEQ ID NO: 313 6x Histidine tag
  • RNase H enzymes cleave RNA residues in an RNA/DNA heteroduplex. All RNase H enzymes can cleave substrates of this kind when at least 4 sequential RNA residues are present. RNase HI enzymes rapidly lose activity as the RNA "window" of a chimeric RNA/DNA species is shortened to less than 4 residues. RNase H2 enzymes, on the other hand, are capable of cleaving an RNA/DNA heteroduplex containing only a single RNA residue. In all cases, the cleavage products contain a 3'-hydroxyl and a 5'-phosphate (see FIG. 1).
  • cleavage occurs between RNA bases, cleaving an RNA-phosphate linkage.
  • cleavage occurs only with Type II RNase H enzymes. In this case cleavage occurs on the 5 '-side of the RNA base at a DNA-phosphate linkage (see FIG. 3).
  • RNase H enzymes require the presence of a divalent metal ion cofactor.
  • RNase HI enzymes require the presence of Mg ++ ions while RNase H2 enzymes can function with any of a number of divalent cations, including but not limited to Mg ++ , Mn ++ , Co ++ and Ni ++ .
  • RNA bases Cleavage of a substrate with multiple RNA bases.
  • the following synthetic 30 bp substrate was used to test the activity of these enzymes for cleavage of a long RNA domain.
  • the substrate is an "1 1-8-1 1" design, having 1 1 DNA bases, 8 RNA bases, and 11 DNA bases on one strand and a perfect match DNA complement as the other strand.
  • the oligonucleotides employed are indicated below, where upper case letters represent DNA bases and lower case letters represent RNA bases.
  • these single-stranded (ss) oligonucleotides form the following "1 1-8-1 1" double-stranded (ds) substrate:
  • RNA/DNA heteroduplex (1 1-8-11) substrate.
  • the recombinant proteins did not degrade the single stranded RNA-containing oligonucleotide (SEQ ID No. 6), indicating that a double-stranded substrate was required. Further, a dsDNA substrate was not cleaved.
  • Cleavage was not observed in the absence of a divalent cation (e.g., no activity was observed if Mg ++ was absent from the reaction buffer).
  • a Mg ++ titration was performed and high enzyme activity was observed between 2-8 mM MgCh.
  • Optimal activity was observed between 3-6 mM MgCh.
  • Cleavage activity was also detected using other divalent cations including Mn ++ and Co ++ .
  • MnCh good activity was seen from 0.3 mM to 10 mM divalent cation concentration.
  • Enzyme activity was optimal in the range of 300 nM to 1 mM.
  • Substrate cleavage by RNase H enzymes is expected to result in products with a 3' -OH and 5 '-phosphate.
  • the identity of the reaction products from the new recombinant RNase H2 proteins was examined by mass spectrometry. Electrospray ionization mass spectrometry (ESI-MS) has near single Dalton resolution for nucleic acid fragments of this size (accuracy of +/- 0.02%).
  • the oligonucleotide 1 1-8-1 1 substrate (SEQ ID NOS 6 and 7) was examined by ESI-MS both before and after digestion with the three Pyrococcus sp. RNase H enzymes. The primary masses observed are reported in Table 7 along with identification of nucleic acid species consistent with the observed masses.
  • control 3' GAGCACTCCACTACGTCCTCTACCCTCCGC (SEQ ID NO: 7) 8984 8984
  • DNA bases are indicated with upper case letters
  • RNA bases are indicated with lower case letters
  • phosphate "P”.
  • nucleic acids strands end in a 5'-hydroxyl or 3'-hydroxyl.
  • RNA-containing strands were efficiently cleaved and the observed masses of the reaction products are consistent with the following species being the primary fragments produced: 1) a species which contained undigested DNA
  • RNA base Cleavage of a substrate with a single RNA base.
  • RNase H2 enzymes characteristically cleave a substrate that contains a single RNA residue while RNase HI enzymes cannot.
  • the following synthetic 30 bp substrates were used to test the activity of these enzymes for cleavage at a single RNA residue.
  • the substrates are a "14-1-15" design, having 14 DNA bases, 1 RNA base, and 15 DNA bases on one strand and a perfect match DNA complement as the other strand.
  • Four different substrates were made from 8 component single-stranded oligonucleotides comprising each of the 4 RNA bases: C, G, A, and U.
  • the oligonucleotides employed are indicated below, where upper case letters represent DNA bases and lower case letters represent RNA bases.
  • these single-stranded (ss) oligonucleotides form the following "14-1-15 rC" double-stranded (ds) substrate:
  • these single-stranded (ss) oligonucleotides form the following "14-1-15 rG" double-stranded (ds) substrate: [0257] SEQ ID NOS 12 and 13, respectively, in order of appearance
  • these single-stranded (ss) oligonucleotides form the following "14-1-15 rA" double-stranded (ds) substrate:
  • these single-stranded (ss) oligonucleotides form the following "14-1-15 rU" double-stranded (ds) substrate:
  • RNA/DNA heteroduplex 14-1-15
  • All 5 recombinant peptides showed the ability to cleave a single RNA base in an RNA/DNA heteroduplex (14-1-15).
  • Each of the 4 RNA bases functioned as a cleavable substrate with these enzymes.
  • the recombinant proteins did not degrade the single stranded RNA-containing oligonucleotides (SEQ ID os. 10, 12, 14, 16), indicating that a double-stranded substrate was required.
  • the isolated enzymes therefore show RNase H2 activity. Titration of divalent cations was tested and results were identical to those obtained previously using the 8-1 1-8 substrate.
  • Substrate cleavage by RNase H enzymes is expected to result in products with a 3' -OH and 5 '-phosphate. Further, cleavage of a substrate containing a single ribonucleotide by RNase H2 enzymes characteristically occurs at the DNA linkage 5 '-to the RNA residue.
  • the identity of the reaction products using a single ribonucleotide substrate from the new recombinant RNase H2 proteins was examined by mass spectrometry.
  • the oligonucleotide 14-1-15 rC substrate (SEQ ID NOS 10 and 11) was examined by ESI-MS both before and after digestion with the three Pyrococcus sp.
  • RNase H2 enzymes and the Methanocaldococcus jannaschii enzyme The primary masses observed are reported in Table 8 along with identification of nucleic acid species consistent with the observed masses.
  • DNA bases are indicated with upper case letters
  • RNA bases are indicated with lower case letters
  • phosphate "P”.
  • Molecular weights are rounded to the nearest Dalton. In the absence of other notation, the nucleic acids strands end in a 5'-hydroxyl or 3'-hydroxyl.
  • the DNA complement strand was observed intact (non-degraded).
  • the RNA-containing strands were efficiently cleaved and the observed masses of the reaction products are consistent with the following species being the primary fragments produced: 1) a species which contained undigested DNA residues with a 3 '-hydroxyl (SEQ ID No. 18), and 2) a species with a 5'-phosphate, a single 5'-RNA residue, and undigested DNA residues (SEQ ID No. 19).
  • the observed reaction products are consistent with the known cleavage properties of RNase H2 class enzymes.
  • Activity is also present using Mn ++ or Co ++ ions; 2) Single-stranded nucleic acids are not degraded; 3) Double-stranded heteroduplex nucleic acids are substrates where one strand contains one or more RNA bases; 4) For substrates containing 2 or more consecutive RNA bases, cleavage occurs in a DNA-RNA-DNA chimera between RNA linkages; for substrates containing a single RNA base, cleavage occurs immediately 5 '-to the RNA base in a DNA-RNA-DNA at a DNA linkage; and 6) Reaction products have a 3-hydroxyl and 5 '-phosphate.
  • 1 unit is defined as the amount of enzyme that results in the cleavage of 1 nmole of a heteroduplex substrate containing a single rC residue per
  • Substrate SEQ ID NOS 10 and 11 were employed for characterizing RNase H2 enzyme preparation for the purpose of normalizing unit concentration. The following standardized buffer was employed unless otherwise noted. "Mg Cleavage Buffer”: 4 mM MgCk, 10 mM Tris pH 8.0, 50 mM NaCl, 10 ⁇ g/ml BSA (bovine serum albumin), and 300 nM oligo-dT (20mer poly-dT oligonucleotide). The BSA and oligo-dT serve to saturate non-specific binding sites on plastic tubes and improve the quantitative nature of assays performed.
  • Mg Cleavage Buffer 4 mM MgCk, 10 mM Tris pH 8.0, 50 mM NaCl, 10 ⁇ g/ml BSA (bovine serum albumin), and 300 nM oligo-dT (20mer poly-dT oligonucleotide).
  • BSA and oligo-dT serve to
  • Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager). The relative intensity of each band was quantified using the manufacturer's image analysis software and results plotted as a fraction of total substrate cleaved. Results are shown in Figure 9. The enzyme retained full activity for over 30 minutes at 95°C. Activity was reduced to 50% after 45 minutes incubation and to 10% after 85 minutes incubation.
  • the enzyme is functionally inactive at room temperature. Reactions employing this enzyme can therefore be set up on ice or even at room temperature and the reactions will not proceed until temperature is elevated. If Pyrococcus abyssi RNase H2 cleavage were linked to a PCR reaction, the temperature dependent activity demonstrated herein would effectively function to provide for a "hot start" reaction format in the absence of a modified DNA polymerase. EXAMPLE 5 - Cleavage at non-standard bases by RNase H2
  • the natural biological substrates for RNase HI and RNase H2 are duplex DNA sequences containing one or more RNA residues. Modified bases containing substitutions at the 2 '-position other than hydroxyl (RNA) have not been observed to be substrates for these enzymes.
  • RNA hydroxyl
  • LNA locked nucleic acid
  • 2'OMe 2'-0-methyl
  • 2'F 2'-fluoro
  • the single ribo-C containing substrate was employed as positive control.
  • LNA bases will be designated with a "+" prefix (+N)
  • 2'OMe bases will be designated with a "m" prefix (mN)
  • 2'F bases will be designated with a "f ' prefix (fN)
  • Results are shown in Figure 12.
  • the control substrate with a single ribo-C residue was 100% cleaved.
  • the substrates containing a single LNA-C or a single 2'OMe-C residue were not cleaved.
  • the substrate containing a single 2'-F-C residue was cleaved to a small extent. This cleavage occurred only in the manganese containing buffer and was not seen in either cobalt or magnesium buffers.
  • the control substrate with a single ribo-C residue was 100% cleaved.
  • the substrates containing a single 2'-F-C or single 2'-F-U residue were cleaved to a small extent.
  • the di-fluoro substrate containing adjacent 2'-F-C and 2'-F-U residues (fCfU) was cleaved nearly 100%.
  • both the Pyrococcus abyssi and Pyrococcus furiosus RNase H2 enzymes cleaved the modified substrate in an identical fashion. This example demonstrates that the unexpected cleavage of the fC group was not restricted to fC but also occurred with fU.
  • the mass spectrometry data indicates that digestion of a di-fluoro substrate such as the fCfU duplex studied above by RNase H2 results in cleavage between the two fluoro bases. Further, the reaction products contain a 3 '-hydroxyl and 5 '-phosphate, similar to the products resulting from digestion of RNA containing substrates.
  • Cleavage of the modified bases was not observed in the absence of a divalent cation.
  • a titration was performed and enzyme activity was observed between 0.25-10 mM MnCb and 0.25- 1.5 mM C0CI2.
  • Enzyme activity was optimal in the range of 0.5 mM to 1 mM for both MnCk and C0CI2.
  • 0.6 mM MnCk was employed in reactions or 0.5 mM C0CI2.
  • Reduced activity for cleavage of the modified substrate was observed using Mg buffers.
  • optimum activity was observed using Mn buffers for cleavage of the di-fluoro (fNfN) substrates whereas Mg buffers were superior for cleavage of ribonucleotide (rN) substrates.
  • Pyrococcus abyssi RNase H2 can be used to cleave substrates which do not contain any RNA bases but instead contain 2 '-modified bases.
  • di-fluoro (fNfN) containing substrates performed best.
  • Use of the modified substrates generally requires increased amounts of enzyme, however the enzyme is catalytically very potent and it presents no difficulty to employ sufficient enzyme to achieve 100% cleavage of a di-fluoro substrate.
  • the 2 '-modified substrate described in this example are not susceptible to cleavage by typical RNase enzymes. As such they can be employed in novel assay formats where cleavage events are mediated by RNase H2 using substrates that are completely resistant to cleavage by other RNase enzymes, particularly single stranded ribonucleases.
  • the modified strand of each substrate was radiolabeled as described above. Reactions were performed using 100 nM substrate with 25 mU of recombinant enzyme in Mn Cleavage Buffer (10 mM Tris pH 8.0, 50 mM NaCl, 0.6 mM MnCk, 10 ⁇ g/ml BSA). Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager). The relative intensity of each band was quantified, and results plotted as a fraction of total substrate cleaved are shown in Figure 14. The enzyme amount was titrated so that the most active substrate cleaved at 90-95% without having excess enzyme present so that accurate assessment could be made of relative cleavage efficiency for less active substrates.
  • Mn Cleavage Buffer 10 mM Tris pH 8.0, 50
  • the following example shows the optimization of the placement of the cleavable domain relative to the 3' and 5' ends of a primer or probe sequence.
  • the substrates all had 14 or 15 DNA bases on both the 5'- and 3 '-sides flanking the cleavable domain.
  • Tm hybridization temperature
  • the synthetic substrate duplexes shown in Table 13 were made having a single rC cleavable base, a fixed domain of 25 DNA bases 5'-flanking the ribonucleotide and a variable number of bases on the 3 '-side.
  • the modified strand of each substrate was radiolabeled as described above Reactions were performed using 100 nM substrate with 100 ⁇ of recombinant enzyme in Mg Cleavage Buffer (10 mM Tris pH 8.0, 50 mM NaCl, 4 mM MgCk, 10 ⁇ g/ml BSA). Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager). The relative intensity of each band was quantified, and results plotted as a fraction of total substrate cleaved are shown in Figure 15. Maximal cleavage occurred with 4-5 DNA bases flanking the ribonucleotide on the 3 '-side.
  • Mg Cleavage Buffer 10 mM Tris pH 8.0, 50 mM NaCl, 4 mM MgCk, 10 ⁇ g/
  • the modified strand of each substrate was radiolabeled as previously described. Reactions were performed using 100 nM substrate with 123 ⁇ of recombinant enzyme in a mixed buffer containing both Mg and Mn cations (10 mM Tris pH 8.0, 50 mM NaCl, 0.6 mM MnCh, 3 mM MgCb, 10 ⁇ BSA). Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager).
  • Mg and Mn cations 10 mM Tris pH 8.0, 50 mM NaCl, 0.6 mM MnCh, 3 mM MgCb, 10 ⁇ BSA. Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophore
  • the modified strand of each substrate was radiolabeled as above. Reactions were performed using 100 nM substrate with 37 mU of recombinant enzyme in a mixed buffer containing both Mg and Mn cations (10 mM Tris pH 8.0, 50 mM NaCl, 0.6 mM MnCk, 3 mM MgCb, 10 ⁇ g/ml BSA). Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager).
  • Mg and Mn cations 10 mM Tris pH 8.0, 50 mM NaCl, 0.6 mM MnCk, 3 mM MgCb, 10 ⁇ g/ml BSA. Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea
  • maximal cleavage activity is seen when at least 4-5 DNA residues are positioned on the 3 '-side and 10-12 DNA residues are positioned on the 5 '-side of the cleavable domain.
  • maximal cleavage activity is seen when at least 8-10 DNA residues are positioned on the 3 '-side of the cleavable domain; from prior examples it is clear that activity is high when 14-15 DNA residues are positioned on the 5'-side of the cleavable domain.
  • thermostable RNase H2 enzyme to cleave a duplex nucleic acid at a single internal ribonucleotide or at a 2'-fluoro dinucleotide.
  • Example 7 establishes parameters for designing short oligonucleotides which will be effective substrates in this cleavage reaction. These features can be combined to make cleavable primers that function in primer extension assays, such as DNA sequencing, or PCR.
  • a single stranded oligonucleotide is not a substrate for the cleavage reaction, so a modified oligonucleotide primer will be functionally "inert” until it hybridizes to a target sequence.
  • a cleavable domain is incorporated into an otherwise unmodified oligonucleotide, this oligonucleotide could function to prime PCR and will result in an end product wherein a sizable portion of the primer domain could be cleaved from the final PCR product, resulting in sterilization of the reaction (lacking the priming site, the product will no longer be a template for PCR using the original primer set). If the cleavable domain is incorporated into an oligonucleotide which is blocked at the 3 '-end, then this primer will not be active in PCR until cleavage has occurred. Cleavage will "activate" the blocked primer.
  • this format can confer a "hot start" to a PCR reaction, as no DNA synthesis can occur prior to the cleavage event.
  • Example 4 showed that this cleavage event is very inefficient with Pyrococcus abysii RNase H2 until elevated temperatures are attained.
  • the linkage between the cleavage reaction and primer extension confer added specificity to the assay, since both steps requireenzymatic recognition of the duplex formed when the primer hybridizes to the template.
  • a schematic of this reaction is shown in Figure 18. Note that this schema applies to both simple primer extension reactions as well as PCR. It can also be exploited in other kinds of enzymatic assays such as ligation reactions.
  • the following example demonstrates the use of an RNase H2 cleavable primer for DNA sequencing.
  • the most common method of DNA sequencing in use today involves sequential DNA synthesis reactions (primer extension reactions) done in the presence of dideoxy terminator nucleotides. The reaction is done in a thermal cycling format where multiple cycles of primer extension are performed and product accumulates in a linear fashion.
  • DNA sequencing was done using the Big DyeTM Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). The following primers were used:
  • RNA bases are indicated in lower case
  • SpC3 is a spacer C3 blocking group placed at the 3 '-end of the oligonucleotide.
  • the blocked cleavable primer contains 17 DNA bases on the 5 '-side of the ribonucleotide and 4 DNA bases on the 3'-side of the ribonucleotide (17-1-4 design) and so conforms to the optimized design rules established in Example 7.
  • Sequencing reactions were set up in 20 ⁇ volume comprising 0.75X ABI Reaction buffer, 160 nM primer, 0.5X Big Dye Terminators and 230 ng plasmid DNA template.
  • 4 mM additional MgCk was supplemented into the reaction, with or without 14, 1.4, or 0.14 mU of recombinant Pyrococcus abyssi RNase H2.
  • the following cycle sequencing program was employed: 96°C for 30 seconds followed by 25 cycles of [96°C for 5 seconds, 50°C for 10 seconds, 55°C for 4 minutes].
  • the DNA sequencing reactions were run on an Applied Biosystems model 3130x1 Genetic Analyzer. The resulting sequencing traces were examined for quality and read length. Results are summarized in Table 16 below.
  • reaction buffer Supplementing magnesium content of the reaction buffer was necessary to obtain cleavage and primer extension reactions using the blocked primers.
  • the amount of enzyme employed here is 100-fold higher than is needed to achieve 100% cleavage of a rN substrate under optimal conditions (70°C, 20 minute incubation).
  • primer annealing was run at 50°C and extension reactions were run at 55°C for 10 seconds and 4 minutes, respectively. These lower temperatures are suboptimal for Pyrococcus abyssi R ase H2 (see Example 4 above). Performing the cycle sequencing reaction at higher temperatures will require less enzyme but is not necessary.
  • blocked primers containing an internal cleavage site for RNase H2 can be used with primer-extension based sequencing methods, such as dideoxy (Sanger) sequencing, and are compatible with use of existing high throughput fluorescent sequencing protocols.
  • Use of blocked primers and the method of the present invention can confer added specificity to the sequencing reaction, thus permitting sequencing to be performed for more cycles and on highly complex nucleic acid samples that work poorly with unmodified primers.
  • Example 8 demonstrated that RNase H2 could be used to cleave a blocked primer and that this system could be linked to DNA synthesis and primer extension reactions, including DNA sequencing.
  • the following example demonstrates the utility of this method in PCR.
  • the first system demonstrates use in an end point PCR format and the second system demonstrates use in a quantitative real-time PCR format.
  • the Syn-For and Syn-Rev primers are unmodified control primers specific for an artificial amplicon (a synthetic oligonucleotide template).
  • the Syn-For primer is paired with the unmodified control Syn-Rev primer or the different modified Syn-Rev primers.
  • a set of modified Syn-Rev primers were made which contain a single rU (cleavable) base followed by 2-6 DNA bases, all ending with a dideoxy-C residue (ddC).
  • the ddC residue functions as a blocking group that prevents primer function.
  • the ddC blocking group is removed with cleavage of the primer at the rU base by the action of RNase H2 (the unblocking step, shown in Figure 18).
  • the synthetic template is a 103 -base long oligonucleotide, shown below (SEQ ID No. 75). Primer binding sites are underlined.
  • PCR reactions were performed in 20 ⁇ volume using 200 nM primers, 2 ng template, 200 ⁇ of each dNTP (800 ⁇ total), 1 unit of Immolase (a thermostable DNA polymerase, Bioline), 50 mM Tris pH 8.3, 50 mM KC1, and 3 mM MgCk. Reactions were run either with or without 100 ⁇ of Pyrococcus abyssi RNase H2. Reactions were started with a soak at 95°C for 5 minutes followed by 35 cycles of [95°C for 10 seconds, 60°C for 30 seconds, and 72°C for 1 second]. Reaction products were separated on a 10% non-denaturing polyacrylamide gel and visualized using GelStar staining.
  • Results are shown in Figure 19. Unmodified control primers produced a strong band of the correct size. 3 '-end blocked rU primers did not produce any products in the absence of RNase H2. In the presence of RNase H2, blocked primers produced a strong band of the correct size using the D4, D5, and D6 primers. No signal was seen using the D2 or D3 primers.
  • This example demonstrates that blocked primers can be used in PCR reactions using the method of the present invention. Further, this example is consistent with results obtained using cleavage of preformed duplex substrates in Example 7, where the presence of 4-5 3'-DNA bases were found to be optimal for cleavage of rN containing primers.
  • the following example demonstrates use of RNase H2 cleavage using rN blocked primers (both For and Rev) in a quantitative real-time PCR assay format using an endogenous human gene target and HeLa cell cDNA as template.
  • the primers shown in Table 19 specific for the human HRAS gene (NM_176795) were designed and synthesized. In this case a C3 spacer was use das the blocking group.
  • Reactions were performed in 10 1 volume in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA) using the iTAQ DNA polymerase at 25U/ml, 3 mM MgCk, 200 nM of each primer (for + rev), 2 ng cDNA (made from HeLa cell total RNA), with or without 5 mU of Pyrococcus abyssi RNase H2. Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 50 cycles were performed of [95°C for 10 seconds + 60°C for 20 seconds + 72°C for 30 seconds].
  • the following example demonstrates use of RNase H2 cleavage using rN blocked primers in a quantitative real-time PCR assay format using another endogenous human gene target and HeLa cell cDNA as the template.
  • the primers specific for the human ETS2 gene (NM_005239) shown in Table 20 were designed and synthesized.
  • Reactions were performed in 10 ⁇ volume in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA) using the iTAQ DNA polymerase at 25U/ml, 3 mM MgCk, 200 nM of each primer (for + rev), 2 ng cDNA (made from HeLa cell total RNA), with or without 5 mU of Pyrococcus abyssi RNase H2. Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 50 cycles were performed of [95°C for 10 seconds + 60°C for 20 seconds + 72°C for 30 seconds].
  • the HRAS assay performed identically using unmodified vs. blocked primers.
  • the ETS2 assay showed a delay between unmodified vs. blocked primers.
  • primer hybridization and cleavage kinetics play a significant role in the efficiency of the overall reaction for reactions which employ the blocked primers.
  • DNA synthesis is linked to the unblocking event, and unblocking requires hybridization, binding of RNase H2, and substrate cleavage before primers become activated and are capable of priming DNA synthesis. It should be possible to increase the amount of cleaved primer produced each cycle by either increasing the amount of RNase H2 enzyme present or by increasing the anneal time of the reaction.
  • DNA synthesis occurs at the anneal temperature (60°C) nearly as well as at the extension temperature (72°C) used in the above examples.
  • unblocking can only take place during the duration of the anneal step (60°C) and not during the extend step (72°C) due to the Tm of the primers employed which only permit formation of a double-stranded substrate for RNase H2 during the anneal step but not at 72°C (where the primers only exist in single-stranded form).
  • PCR cycle parameters were changed to a 2 step reaction with anneal/extend as a single event done at 60°C and the duration of the anneal/extend step was varied to see if changing these reaction parameters could allow the blocked ETS2 primers to perform with similar efficiency as the unmodified control primers. Reactions were done in 10 ⁇ volume in 384 well format using a Roche Lightcycler ® 480 platform.
  • Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA) using the iTAQ DNA polymerase at 25U/ml, 3 mM MgCb, 200 nM of each primer (for + rev), 2 ng cDNA (made from HeLa cell total RNA), with or without 5 mU oiPyrococcus abyssi RNase H2.
  • Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 45 cycles were performed of [95°C for 10 seconds + 60°C for 20-120 seconds]. All reactions were run in triplicate.
  • the differences between the Cp values obtained for the blocked primers and the unmodified control primers (ACp) are summarized in Table 21 below.
  • Example 9 above demonstrated utility of RNase H2 mediated cleavage for use of rN blocked primers in end point and quantitative real time PCR assays.
  • the present example demonstrates utility using fNfN blocked primers in quantitative real time PCR assays.
  • DNA bases are shown in uppercase. 2' -fluoro bases are indicated as fN.
  • Reactions were done in 10 ⁇ volume in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA) using the iTAQ DNA polymerase at 25U/ml, 3 mM MgCk, 0.6 mM MnCk, 200 nM of each primer (for + rev), 2 x 10 6 copies of synthetic oligonucleotide target, with or without 1.75 U of Pyrococcus abyssi RNase H2.
  • Reactions were done in 10 ⁇ volume in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA) using the iTAQ DNA polymerase at 25U/ml, 3 mM MgCk, 0.6 mM MnCk, 200 nM of each primer (for + rev), 2 x 10 6 copies of synthetic oligonucleotide target, with or without 1.75 U of Pyrococcus abyssi RNase H2.
  • Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 45 cycles were performed of [95°C for 10 seconds + 60°C for 120 seconds + 72°C for 120 seconds]. All reactions were run in triplicate. The reactions run with the control primer having a single 2 '-fluoro base at the 3 '-end (which mimics the cleavage product of the fNfN blocked primer) had a Cp of 20. Reactions run with the blocked fUfC primer also had a Cp of 20.
  • reactions were done in 10 ⁇ volume in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA) using the iTAQ DNA polymerase at 25U/ml, 3 mM MgCb, 0.6 mM MnCk, 200 nM of each primer (for + rev), 2 x 10 6 copies of synthetic oligonucleotide target. The same unmodified Syn-For primer was used in all reactions.
  • Recombinant Pyrococcus abyssi RNase H2 was added from 0 to 600 mU per reaction. Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 45 cycles were performed of [95°C for 10 seconds + 60°C for 120 seconds + 72°C for 120 seconds]. All reactions were run in triplicate. Cp values corresponding to the varying amounts of RNase H2 for each primer are shown in Table 24.
  • EXAMPLE 11 Improved specificity using rN blocked primers in PCR reactions.
  • PCR has an almost unlimited potential for amplification and a PCR reaction should only be limited by consumption of reagents in the reaction mix.
  • PCR reactions are typically limited to 40-45 cycles to help preserve specificity.
  • the amplification power of PCR is enormous and, as cycle number exceeds 40-45, it becomes increasingly common for mispriming events to give rise to amplification of undesired products and false positive signals.
  • This example demonstrates how use of cleavable blocked primers with the methods of the present invention improves reaction specificity and permits use of a greater number of PCR cycles, thereby increasing the potential sensitivity of PCR.
  • hETS2-For-rU SEQ ID No. 89 CCCTGTTTGCTGTTTTTCCTTCTCuAAAT-SpC3 hETS2-Rev SEQ ID No. 90 CGCCGCTGTTCCTTTTTGAAG
  • PCR reactions were done in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx BIO-RAD iQTM SYBR ® Green Supermix (BIO-RAD, Hercules, CA), 200 nM of each primer (For + Rev), and 1.3 mU of Pyrococcus abyssi RNase H2 in 10 ⁇ volume. Template DNA was either 2 ng of human HeLa cell cDNA or 2 ng of rat spinal cord cDNA. Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 60 cycles were performed of [95°C for 10 seconds + 60°C for 90 seconds]. Under these conditions, the Cp value observed for human cDNA represents a true positive event.
  • Example 11 demonstrated the ability of the methods of the invention to improve specificity of a qPCR reaction in the face of background mispriming events.
  • the present example demonstrates the specificity of the RNase H2 cleavage reaction with respect to single-base differences (SNPs).
  • SNPs single-base differences
  • the ability of the Pyrococcus abyssi RNase H2 enzyme to distinguish base mismatches in a duplex substrate containing a single rC base was tested under steady state conditions.
  • the following substrates were 32 P-end labeled and incubated in "Mg Cleavage Buffer" as described in Example 4 above. Reactions comprised 100 nM substrate with 100 ⁇ of enzyme in 20 ⁇ ⁇ volume and were incubated at 70°C for 20 minutes.
  • Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager). The relative intensity of each band was quantified and results plotted as a fraction of total substrate cleaved.
  • DNA bases are shown as uppercase. RNA bases are shown as lowercase. Mismatches are shown in bold font and are underlined.
  • Example 12 The ability of the Pyrococcus abyssi RNase H2 enzyme to distinguish base mismatches for a rC substrate under steady state conditions was described in Example 12. The ability of this enzyme to distinguish base mismatches for all rN containing substrates under conditions of thermal cycling was examined in the present example. In these conditions, the cleavable substrate is only available for processing by the enzyme for a short period of time before temperature elevation disrupts the duplex. Mismatch discrimination was assessed in the setting of a fluorescent quantitative real-time PCR assay. We found that base mismatch discrimination was greatly improved under these kinetically limited conditions than were observed under steady-state conditions.
  • Blocked rN substrate rev primers (C3 spacer blocking group at the 3 '-end) are shown below. DNA bases are uppercase and RNA bases are lower case. Regions of variation are indicated by bold and underlined. At total of 28 blocked primers containing a single RNA residue were synthesized. rA series:
  • nucleic acids SEQ ID NOS 68, 291, 116 and 69, respectively, in order of appearance
  • PCR assays set up as indicated:
  • the terminal C3 spacer group (indicated by "x") blocks the rU containing oligonucleotide to serve as a primer.
  • the duplex becomes a substrate for RNase H2 and cleavage occurs immediately 5'- to the rU residue, resulting in a functional primer as shown ( ⁇ -).
  • Thermal cycling parameters included an initial 5 minutes soak at 95°C and then 45 cycles were performed of [95°C for 10 seconds + 60°C for 20 seconds + 72°C for 30 seconds]. Under these conditions, the Cp value was identical for control reactions done using For + Rev (unmodified) primers and control coupled RNase H2 cleavage-PCR reactions done using the perfect match For (unmodified) + rN Rev (blocked) primers.
  • the reaction conditions employed had sufficient incubation time and RNase H2 concentration to cleave the perfect match species within the kinetic constraints of the real time thermal cycling and any deviations from this point will represent a change in reaction efficiency imparted by base mismatches present between the blocked primer and the various templates.
  • ACp is the difference of cycle threshold observed between control and mismatch reactions. Since each Cp represents a cycle in PCR (which is an exponential reaction under these conditions), a ACp of 10 represents a real differential of 2 10 , or a 1024 fold change in sensitivity. A ACp of 4 to 5 cycles is generally sufficient to discriminate between SNPs in allele specific PCR assays.
  • Table 32 ACp for all possible base mismatches at position +1 relative to a rA base
  • Table 33 ACp for all possible base mismatches at position -1 relative to a rC base
  • Table 34 ACp for all possible base mismatches at position +1 relative to a rC base
  • Table 35 ACp for all possible base mismatches at position -1 relative to a rG base
  • Table 36 ACp for all possible base mismatches at position +1 relative to a rG base
  • the relative change in reaction efficiency of cleavage of a rN substrate by Pyrococcus abyssi RNase H2 in the setting of a single base mismatch varies with the identity of the paired bases, the relative position of the mismatch to the cleavage site, and the neighboring bases.
  • the mismatch charts defined in this example can be used to design optimal mismatch detection assays which maximize the expected differential (ACp)between mismatch and matched loci, and can be built into an algorithm to automate optimization of new assay designs.
  • DNA bases are shown as uppercase. 2'-F bases are shown as fU.
  • DNA bases are shown as uppercase. 2'-F bases are shown as fU.
  • PS bonds are typically considered relatively nuclease resistant and are commonly used to increase the stability of oligonucleotides in nuclease containing solutions, such as serum. PS bonds form two stereoisomers, Rp and Sp, which usually show different levels of stabilization for different nucleases.
  • a substrate containing a single rC residue was studied next, testing placement of the PS modification on either side of the RNA base (5'- or 3 '-side as indicated). A mixture of both diastereomers were employed for the present study.
  • the 3 '-rC* substrate was studied in greater detail. Since RNase H2 cleaves this substrate on the 5'-side of the ribonucleotide while other RNases (such as RNase A, R ase 1, etc.) cleave this substrate on the 3 '-side of the ribonucleotide, it may be possible to use the PS modification as a way of protecting the substrate from unwanted degradation by other nucleases while leaving it available as an RNase H2 substrate. It is well known that cleavage of RNA substrates by RNase A and other single-stranded ribonucleases is inhibited to a greater extent by the Sp phosphorothioate isomer than the Rp isomer.
  • test material had a molecular weight of 9464 Daltons (calculated 9465) by ESI-MS with a molar purity of 95% by capillary electrophoresis.
  • This material was injected into a 4.6 mm x 50 mm XbridgeTM C18 column (Waters) with 2.5 micron particle size.
  • Starting mobile phase (Buffer A) was 100 mM TEAA pH 7.0 with 5% acetonitrile and which was mixed with pure acetonitrile (Buffer B) at 35°C.
  • Buffer A was 100 mM TEAA pH 7.0 with 5% acetonitrile and which was mixed with pure acetonitrile (Buffer B) at 35°C.
  • the HPLC method employed clearly resolved two peaks in the sample which were collected and re-run to demonstrate purity.
  • HPLC traces of the mixed isomer sample and purified specimens are shown in Figure 23. Both the "A” and “B” peaks had an identical mass of 94
  • Reactions were performed using 100 nM substrate in 20 ⁇ volume with 1 pg (72 attomoles) of RNase A in Mg Cleavage Buffer. Reactions were incubated at 70°C for 20 minutes. Reaction products were separated using denaturing 7M urea, 15% polyacrylamide gel electrophoresis (PAGE) and visualized using a Packard CycloneTM Storage Phosphor System (phosphorimager). The relative intensity of each band was quantified and results plotted as a fraction of total substrate cleaved. Peak “A” was more completely degraded by RNase A than peak "B"; peak “A” was therefore assigned identity as the Rp isomer and peak “B” was assigned as the Sp isomer.
  • RNA-containing strand of the substrate was radiolabeled with 32 P using 6000 Ci/mmol ⁇ - 32 ⁇ - ⁇ and the enzyme T4 Polynucleotide Kinase (Optikinase, US Biochemical). Trace label was added to reaction mixtures (1 :50). Reactions were performed using 100 nM substrate in 20 ⁇ volume with 100 ⁇ of recombinant Pyrococcus abyssi RNase H2 in Mg Cleavage Buffer. Substrates were employed in both single-stranded and duplex form. Reactions were incubated at 70°C for 20 minutes.
  • Example 9 the feasibility for use of rN blocked primers in qPCR using a SYBR ® Green detection format. Cleavage of blocked oligonucleotides using the method of the present invention can also be applied to the dual-labeled probe assay format.
  • Use of RNase HI to cleave a dual-labeled probe containing a 4 RNA base cleavage domain in an isothermal cycling probe assay format has been described by Harvey, J.J., et al. (Analytical Biochemistry, 333:246-255, 2004).
  • oligonucleotides shown in Table 39 were used as probes and primers in a qPCR assay with a dual-labeled fluorescence-quenched probe.
  • the target was a synthetic oligonucleotide template.
  • Synthetic template (primer and probe binding sites are underlined). [0452] SEQ ID No. 75 AGCTCTGCCCAAAGATTACCCTGACAGCTAAGTGGCAGTGGAAGTTGGCCTCAGAAGTAGTGGCCAGCT GTGTGTCGGGGAACAGTAAAGGCATGAAGCTCAG
  • PCR is performed using a thermostable DNA polymerase having 5'-exonuclease activity the polymerase will degrade the probe. Under these conditions, a DNA probe should perform the same as a rN modified probe. This reaction constitutes a positive control. If a DNA polymerase is employed which is lacking 5'-exonuclease activity, then neither probe should be degraded. This reaction constitutes a negative control. A PCR reaction using the exo-negative polymerase with RNase H2, however, should degrade the rN containing probe but not the DNA probe, demonstrating function of the invention.
  • thermostable polymerases were used: Immolase (intact 5' nuclease activity, Bioline) and Vent Exo " (5'-exonuclease negative mutant, New England Biolabs). Buffers employed were the manufacturer's recommended buffers for the DNA polymerases and were not optimized for RNase H2 activity.
  • the buffer comprised 16 mM (NH 4 )2S0 4 , 67 mM Tris pH 8.3, and 3 mM MgCk.
  • Vent Exo " the buffer comprised 10 mM (NH ) 2 S0 4 , 20 mM Tris pH 8.8, 10 mM KC1, and 3 mM MgS0 4 .
  • both probes showed similar functional performance and gave similar Cp values, both with or without RNase H2.
  • the DNA probe did not produce any detectable fluorescent signal; the rU probe failed to produce fluorescent signal in the absence of RNase H2, but in the presence of RNase H2 was cleaved and resulted in signal at the expected Cp value. Similar results can be obtained using di-fluoro containing probes. If the RNase H2 cleavage domain is placed over a mutation site such probes can be used to distinguish variant alleles.
  • RNase H-cleavable probes can also be linked with the use of blocked primers of the present invention to additively increase the specificity of amplification based assay systems.
  • primer-dimers or other small target independent amplicons can be a significant problem in both endpoint and real-time PCR. These products can arise even when the primers appear to be well designed. Further, it is sometimes necessary to employ primers which have sub-optimal design because of sequence constraints for selection of primers which hybridize to specific regions. For example, PCR assays for certain viruses can be subtype or serotype specific if primers are chosen in areas that are variable between strains. Conversely, PCR reactions can be designed to broadly amplify all viral strains if primers are placed in highly conserved regions of the viral genome. Thus the sequence space available to choose primers may be very limited and "poor" primers may have to be employed that have the potential to form primer dimers.
  • oligonucleotides as shown in Table 41, were used as primers in a PCR assay.
  • the target was a cloned synthetic amplicon isolated from a plasmid.
  • DNA bases are shown in uppercase. RNA bases are shown in lowercase. SpC3 spacer. The "B" designation indicates a blocked, cleavable primer.
  • PCR reactions were done in 384 well format using a Roche Lightcycler ® 480 platform. Reactions comprised lx New England Biolabs (Beverly, MA) DyNAmo reaction mix with DyNAmo DNA polymerase, 200 nM of each primer (For + Rev), with or without 1.3 mU of Pyrococcus abyssi RNase H2 in 10 ⁇ volume. Template DNA was either 2000 copies of the linearized HCV plasmid amplicon or no target control. Thermal cycling parameters included an initial 2 minutes soak at 95°C and then 50 cycles were performed of [95°C for 15 seconds + 60°C for 30 seconds]. Samples were separated on an 8% polyacrylamide non-denaturing gel and visualized using GelStar stain.
  • Results are shown in Figure 25.
  • the unblocked standard primers produced multiple products having sizes ranging from 55 bp to 90 bp in size and no desired full length product was seen.
  • use of the blocked primers did not result in any amplified product.
  • the blocked primers produced a single strong amplicon of the expected size and no undesired small species were seen.
  • the DyNAmo is a non hot-start DNA polymerase.
  • Use of RNase H2 blocked primer of the present invention with a hot-start RNase H2 having reduced activity at lower temperatures eliminated undesired primer-dimers from the reaction and resulted in formation of the desired amplicon whereas standard unblocked primers failed and produced only small, undesired species.
  • Reactions were performed using 100 nM substrate with 100 microunits (uU) of enzyme in Mg Cleavage Buffer with different detergents at varying concentrations.
  • Detergents tested included Triton-XlOO, Tween-20, Tween-80, CTAB, and N-lauryol sarcosyl. Results with Pyrococcus absii RNase H2 are shown in Figure 26. Additional experiments were done to more finely titrate CTAB detergent concentration. Optimum levels of detergent to obtain highest enzyme activity were (vokvol): Triton-XlOO 0.01%, Tween-20 0.01%, and CTAB 0.0013%.
  • thermophilic RNase H2 enzymes The detergents Tween-80 and N-lauryol sarcosyl did not perform as well as the other detergents tested. Thus both non-ionic (Triton, Tween) and ionic (CTAB) detergents can be employed to stabilize thermophilic RNase H2 enzymes of the present invention.
  • non-ionic (Triton, Tween) and ionic (CTAB) detergents can be employed to stabilize thermophilic RNase H2 enzymes of the present invention.
  • Example 9 it was demonstrated that cleavable blocked primers function in PCR and further can be employed in real-time quantitative PCR (qPCR) using SYBR green detection.
  • qPCR real-time quantitative PCR
  • Figure 18 illustrates the scheme for performing PCR using blocked cleavable primers.
  • Figure 27 illustrates the scheme for performing PCR using fluorescence-quenched cleavable primers.
  • one primer in the pair is detectably labeled with a fluorescent dye.
  • a fluorescence quencher is positioned at or near the 3 ' -end of the primer and effectively prevents priming and DNA synthesis when the probe is intact.
  • a single ribonucleotide base is positioned between the dye and the quencher. Cleavage at the ribonucleotide by RNase H2 separates the reporter and quencher, removing quenching, resulting in a detectable signal. Concomitantly, cleavage activates the primer and PCR proceeds.
  • DNA bases are shown in uppercase. RNA bases are shown in lowercase.
  • FAM 6-carboxyfluorescein.
  • IBFQ Iowa Black FQ, a dark quencher.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés et des compositions pour améliorer la spécificité au cours de l'amplification d'une séquence d'ADN cible. Les procédés et compositions reposent sur l'utilisation d'une enzyme ARNase H, d'une polymérase et des amorces oligonucléotidiques sensibles à l'enzyme ARNase H, bloquées du point de vue du clivage, dans les réactions d'amplification, les mélanges de réaction comprenant soit une concentration finale optimisée d'un sel métallique divalent comprenant 2,0 mM ou moins de cation Mg++ libre et/ou une concentration finale optimisée d'un détergent non ionique comprenant au moins environ 0,001 % d'éther hexadécylique de polyéthylène glycol.
PCT/US2013/072690 2008-04-30 2013-12-02 Essais à base d'arnase-h utilisant de monomères d'arn modifiés WO2014143228A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP13811693.4A EP2971072A1 (fr) 2013-03-15 2013-12-02 Essais à base d'arnase-h utilisant de monomères d'arn modifiés
AU2013381709A AU2013381709A1 (en) 2013-03-15 2013-12-02 RNase H-based assays utilizing modified RNA monomers
US14/123,944 US10227641B2 (en) 2008-04-30 2013-12-02 RNase H-based assays utilizing modified RNA monomers
CA2906365A CA2906365A1 (fr) 2013-03-15 2013-12-02 Essais a base d'arnase-h utilisant de monomeres d'arn modifies
SG11201507512QA SG11201507512QA (en) 2013-03-15 2013-12-02 Rnase h-based assays utilizing modified rna monomers
JP2016500115A JP2016510601A (ja) 2013-03-15 2013-12-02 修飾ＲＮＡモノマーを用いたＲＮａｓｅＨ系アッセイ

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US13/839,334 US20140255925A9 (en) 2008-04-30 2013-03-15 Modified rnase h enzymes and their uses
US13/839,334 2013-03-15
US13/959,637 US9644198B2 (en) 2008-04-30 2013-08-05 RNase H-based assays utilizing modified RNA monomers
US13/959,637 2013-08-05

Publications (1)

Publication Number Publication Date
WO2014143228A1 true WO2014143228A1 (fr) 2014-09-18

Family

ID=51537441

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/072690 WO2014143228A1 (fr) 2008-04-30 2013-12-02 Essais à base d'arnase-h utilisant de monomères d'arn modifiés

Country Status (6)

Country Link
EP (1) EP2971072A1 (fr)
JP (1) JP2016510601A (fr)
AU (1) AU2013381709A1 (fr)
CA (1) CA2906365A1 (fr)
SG (1) SG11201507512QA (fr)
WO (1) WO2014143228A1 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016096185A1 (fr) * 2014-12-16 2016-06-23 Microbiomix Gmbh Oligonucléotides modifiés et procédés pour l'inclusion d'amorces ou de molécules de contrôle ou de sondes dans des systèmes pcr clos
JP2018536412A (ja) * 2015-11-25 2018-12-13 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド バリアント検出のための方法
CN109415757A (zh) * 2016-02-15 2019-03-01 纽丽生物科技有限公司 核酸或蛋白实时检测用单核酸及利用其的检测方法
WO2020086896A1 (fr) * 2018-10-24 2020-04-30 University Of Washington Procédés et kits pour appauvrir et enrichir des molécules d'acide nucléique
CN112513265A (zh) * 2018-05-22 2021-03-16 博诚研究中心 用于人类癌症检测的修饰核酸的靶向富集和测序
US11155882B2 (en) * 2014-02-07 2021-10-26 University Of Iowa Research Foundation Oligonucleotide-based probes and methods for detection of microbes
US20220025365A1 (en) * 2020-07-23 2022-01-27 Integrated Dna Technologies, Inc. METHODS FOR NOMINATION OF NUCLEASE ON-/OFF-TARGET EDITING LOCATIONS, DESIGNATED "CTL-seq" (CRISPR Tag Linear-seq)
US11338296B2 (en) 2018-07-26 2022-05-24 Lex diagnostics Ltd. Variable temperature reactor, heater and control circuit for the same
WO2023126624A1 (fr) * 2021-12-29 2023-07-06 3Cr Bioscience Ltd Procédé de détection de séquences cibles
WO2023114090A3 (fr) * 2021-12-13 2023-08-03 Labsimply, Inc. Dosage en cascade d'amplification de signal
US11821025B2 (en) 2021-07-12 2023-11-21 Vedabio, Inc. Compositions of matter for detection assays
US11859182B2 (en) 2021-12-13 2024-01-02 Vedabio, Inc. Tuning cascade assay kinetics via molecular design
US11965205B1 (en) 2022-10-14 2024-04-23 Vedabio, Inc. Detection of nucleic acid and non-nucleic acid target molecules
US11982677B2 (en) 2022-10-02 2024-05-14 Vedabio, Inc. Dimerization screening assays
US12060602B2 (en) 2023-01-10 2024-08-13 Vedabio, Inc. Sample splitting for multiplexed detection of nucleic acids without amplification

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019536435A (ja) * 2016-09-27 2019-12-19 ヌリバイオ カンパニー リミテッドＮｕｒｉｂｉｏ Ｃｏ．， Ｌｔｄ． スモールｒｎａ又はスモールｒｎａに関連するタンパク質を検出する方法

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744308A (en) * 1994-09-26 1998-04-28 Bio Merieux Chimera oligonucleotide and its utilization for obtaining transcripts of a nucleic acid
US5830664A (en) * 1994-07-16 1998-11-03 Boehringer Mannheim Gmbh Method for the detection of target nucleic acid
WO2001021813A1 (fr) * 1999-09-22 2001-03-29 Genecopoeia, Inc. Procede et compositions pour la synthese amelioree de polynucleotides
EP1367136A1 (fr) * 2001-02-15 2003-12-03 Takara Bio Inc. Procede de detection de polymorphisme de nucleotide
WO2004059012A1 (fr) * 2002-12-23 2004-07-15 Wyeth Dosage d'activite arnase h
WO2006081426A2 (fr) * 2005-01-28 2006-08-03 Applera Corporation Compositions et methodes pour completer une reaction de sequencage a un emplacement specifique d'un modele d'adn cible
WO2007062495A1 (fr) * 2005-11-30 2007-06-07 Roy Rabindranauth Sooknanan Marquage terminal selectif d'acides nucleiques

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH04349885A (ja) * 1991-05-29 1992-12-04 Teijin Ltd Ｃ型肝炎ウイルスのエンビロープ領域核酸断片およびその検出方法
JP4257091B2 (ja) * 2001-10-09 2009-04-22 シスメックス株式会社 遺伝子増幅産物の検出方法及び遺伝子増幅産物の検出試薬キット
US8435741B2 (en) * 2007-07-26 2013-05-07 Fujifilm Corporation Isothermal nucleic acid amplification method using surfactant
US8911948B2 (en) * 2008-04-30 2014-12-16 Integrated Dna Technologies, Inc. RNase H-based assays utilizing modified RNA monomers
AU2009242546B2 (en) * 2008-04-30 2015-01-22 Integrated Dna Technologies, Inc. RNase-H-based assays utilizing modified RNA monomers
WO2011045744A2 (fr) * 2009-10-13 2011-04-21 Syntezza Molecular Detection Israel Ltd. Procédés et compositions pour amplifier des séquences cibles à partir d'échantillons d'acides nucléiques
JP6466173B2 (ja) * 2012-02-14 2019-02-06 ヴェラ オペレーションズ ユーエスエー，インコーポレーテッド ブロック型プライマーを用いた等温増幅法
CA2867435A1 (fr) * 2012-03-19 2013-09-26 Integrated Dna Technologies, Inc. Enzymes rnase h modifiees et leurs utilisations

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5830664A (en) * 1994-07-16 1998-11-03 Boehringer Mannheim Gmbh Method for the detection of target nucleic acid
US5744308A (en) * 1994-09-26 1998-04-28 Bio Merieux Chimera oligonucleotide and its utilization for obtaining transcripts of a nucleic acid
WO2001021813A1 (fr) * 1999-09-22 2001-03-29 Genecopoeia, Inc. Procede et compositions pour la synthese amelioree de polynucleotides
EP1367136A1 (fr) * 2001-02-15 2003-12-03 Takara Bio Inc. Procede de detection de polymorphisme de nucleotide
WO2004059012A1 (fr) * 2002-12-23 2004-07-15 Wyeth Dosage d'activite arnase h
WO2006081426A2 (fr) * 2005-01-28 2006-08-03 Applera Corporation Compositions et methodes pour completer une reaction de sequencage a un emplacement specifique d'un modele d'adn cible
WO2007062495A1 (fr) * 2005-11-30 2007-06-07 Roy Rabindranauth Sooknanan Marquage terminal selectif d'acides nucleiques

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ITAYA M ET AL: "Molecular cloning of a ribonuclease H (RNase HI) gene from an extreme thermophile Thermus thermophilus HB8: a thermostable RNase H can functionally replace the Escherichia coli enzyme in vivo.", NUCLEIC ACIDS RESEARCH 25 AUG 1991, vol. 19, no. 16, 25 August 1991 (1991-08-25), pages 4443 - 4449, XP002552896, ISSN: 0305-1048 *
See also references of EP2971072A1 *

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11155882B2 (en) * 2014-02-07 2021-10-26 University Of Iowa Research Foundation Oligonucleotide-based probes and methods for detection of microbes
WO2016096185A1 (fr) * 2014-12-16 2016-06-23 Microbiomix Gmbh Oligonucléotides modifiés et procédés pour l'inclusion d'amorces ou de molécules de contrôle ou de sondes dans des systèmes pcr clos
JP2022141858A (ja) * 2015-11-25 2022-09-29 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド バリアント検出のための方法
JP7112456B2 (ja) 2015-11-25 2022-08-03 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド バリアント検出のための方法
JP2018536412A (ja) * 2015-11-25 2018-12-13 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド バリアント検出のための方法
US11926866B2 (en) 2015-11-25 2024-03-12 Integrated Dna Technologies, Inc. Method for detecting on-target and predicted off-target genome editing events
JP2020182493A (ja) * 2015-11-25 2020-11-12 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド バリアント検出のための方法
US10886006B2 (en) 2015-11-25 2021-01-05 Integrated Dna Technologies, Inc. Methods for variant detection
JP7318072B2 (ja) 2015-11-25 2023-07-31 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド バリアント検出のための方法
JP7045702B2 (ja) 2016-02-15 2022-04-01 ヌリバイオ カンパニー リミテッド リアルタイムで核酸を検出するための一本鎖核酸及びこれを用いた検出方法
JP2019512214A (ja) * 2016-02-15 2019-05-16 ヌリバイオ カンパニー リミテッドＮｕｒｉｂｉｏ Ｃｏ．， Ｌｔｄ． リアルタイムで核酸又はタンパク質を検出するための一本鎖核酸及びこれを用いた検出方法
CN109415757A (zh) * 2016-02-15 2019-03-01 纽丽生物科技有限公司 核酸或蛋白实时检测用单核酸及利用其的检测方法
EP3418393A4 (fr) * 2016-02-15 2020-01-15 Nuribio Co., Ltd. Acide nucléique simple brin destiné à détecter un acide nucléique ou une protéine en temps réel et procédé de détection l'utilisant
CN112513265A (zh) * 2018-05-22 2021-03-16 博诚研究中心 用于人类癌症检测的修饰核酸的靶向富集和测序
US11338296B2 (en) 2018-07-26 2022-05-24 Lex diagnostics Ltd. Variable temperature reactor, heater and control circuit for the same
WO2020086896A1 (fr) * 2018-10-24 2020-04-30 University Of Washington Procédés et kits pour appauvrir et enrichir des molécules d'acide nucléique
US20220025365A1 (en) * 2020-07-23 2022-01-27 Integrated Dna Technologies, Inc. METHODS FOR NOMINATION OF NUCLEASE ON-/OFF-TARGET EDITING LOCATIONS, DESIGNATED "CTL-seq" (CRISPR Tag Linear-seq)
US11987839B2 (en) 2021-07-12 2024-05-21 Vedabio, Inc. Compositions of matter for detection assays
US11970730B2 (en) 2021-07-12 2024-04-30 Vedabio, Inc. Compositions of matter for detection assays
US11821025B2 (en) 2021-07-12 2023-11-21 Vedabio, Inc. Compositions of matter for detection assays
US11884921B2 (en) 2021-12-13 2024-01-30 Vedabio, Inc. Signal boost cascade assay
US11884922B1 (en) 2021-12-13 2024-01-30 Vedabio, Inc. Tuning cascade assay kinetics via molecular design
US11859182B2 (en) 2021-12-13 2024-01-02 Vedabio, Inc. Tuning cascade assay kinetics via molecular design
WO2023114090A3 (fr) * 2021-12-13 2023-08-03 Labsimply, Inc. Dosage en cascade d'amplification de signal
US11946052B1 (en) 2021-12-13 2024-04-02 Vedabio, Inc. Tuning cascade assay kinetics via molecular design
WO2023126624A1 (fr) * 2021-12-29 2023-07-06 3Cr Bioscience Ltd Procédé de détection de séquences cibles
US11982677B2 (en) 2022-10-02 2024-05-14 Vedabio, Inc. Dimerization screening assays
US11965205B1 (en) 2022-10-14 2024-04-23 Vedabio, Inc. Detection of nucleic acid and non-nucleic acid target molecules
US12060602B2 (en) 2023-01-10 2024-08-13 Vedabio, Inc. Sample splitting for multiplexed detection of nucleic acids without amplification

Also Published As

Publication number Publication date
JP2016510601A (ja) 2016-04-11
SG11201507512QA (en) 2015-10-29
EP2971072A1 (fr) 2016-01-20
CA2906365A1 (fr) 2014-09-18
AU2013381709A1 (en) 2015-10-01

Similar Documents

Publication Publication Date Title
JP6510695B2 (ja) 修飾されたｒｎａ単量体を用いるｒｎアーゼｈを基礎とするアッセイ
US8911948B2 (en) RNase H-based assays utilizing modified RNA monomers
US9434988B2 (en) RNase H-based assays utilizing modified RNA monomers
EP2971072A1 (fr) Essais à base d'arnase-h utilisant de monomères d'arn modifiés
US10227641B2 (en) RNase H-based assays utilizing modified RNA monomers
CA2949315A1 (fr) Dosages a base de rnase-h utilisant des monomeres d'arn modifies
AU2013203629A1 (en) RNase-H-Based Assays Utilizing Modified RNA Monomers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13811693

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14123944

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2906365

Country of ref document: CA

Ref document number: 2016500115

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2013381709

Country of ref document: AU

Date of ref document: 20131202

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2013811693

Country of ref document: EP