WO2014124228A1 - Protein antigens that provide protection against pneumococcal colonization and/or disease - Google Patents

Protein antigens that provide protection against pneumococcal colonization and/or disease Download PDF

Info

Publication number
WO2014124228A1
WO2014124228A1 PCT/US2014/015254 US2014015254W WO2014124228A1 WO 2014124228 A1 WO2014124228 A1 WO 2014124228A1 US 2014015254 W US2014015254 W US 2014015254W WO 2014124228 A1 WO2014124228 A1 WO 2014124228A1
Authority
WO
WIPO (PCT)
Prior art keywords
pneumococcal
antigen
seq
immunogenic composition
immune response
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/015254
Other languages
English (en)
French (fr)
Inventor
Richard Malley
Yingjie Lu
Fan Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boston Childrens Hospital
Original Assignee
Boston Childrens Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US14/766,252 priority Critical patent/US11576958B2/en
Priority to ES14748672T priority patent/ES2959258T3/es
Priority to JP2015557089A priority patent/JP6494527B2/ja
Priority to EP14748672.4A priority patent/EP2953638B1/en
Priority to AU2014214844A priority patent/AU2014214844B2/en
Priority to EP23182914.4A priority patent/EP4272750A3/en
Application filed by Boston Childrens Hospital filed Critical Boston Childrens Hospital
Priority to CA2900008A priority patent/CA2900008C/en
Publication of WO2014124228A1 publication Critical patent/WO2014124228A1/en
Anticipated expiration legal-status Critical
Priority to AU2018201768A priority patent/AU2018201768B2/en
Priority to US17/834,865 priority patent/US12083173B2/en
Priority to US18/799,550 priority patent/US20250114443A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/09Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • A61K39/092Streptococcus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3156Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505Inorganic adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6087Polysaccharides; Lipopolysaccharides [LPS]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/62Medicinal preparations containing antigens or antibodies characterised by the link between antigen and carrier
    • A61K2039/625Medicinal preparations containing antigens or antibodies characterised by the link between antigen and carrier binding through the biotin-streptavidin system or similar
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present application is generally directed to methods for identifying immunogens from organisms and pathogens, and in particular for identifying immunogens which when administered as vaccines elicit a cellular and/or humoral immune response.
  • the present application is also directed to pneumococcal T-cell immunogens, and methods and compositions thereof.
  • An aspect of the present invention encompasses the discovery of novel antigens for pneumococcus that elicit antigen specific immune responses in mammals.
  • novel antigens, and/or nucleic acids encoding the antigens can be incorporated into immunogenic compositions and administered to elicit immune responses, e.g., to provide protection against pneumococcal colonization, invasive diseases, such as but not limited to, sepsis, and diseases and disorders caused by pneumococcus.
  • Such novel antigens and/or responses to novel antigens can be detected to identify and/or characterize immune responses to pneumococcus.
  • immunogenic compositions comprising at least one isolated pneumococcal antigen selected from the pneumococcal proteins SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069, SP1154, SP1267, SP1376, SP1386, SP1404, SP1405, SP1419, SP1479, SP1500, SP1545, SP1560, SP16
  • One aspect of the present invention relates to an immunogenic composition
  • an immunogenic composition comprising at least one isolated pneumococcal antigen or fragment thereof with the amino acid sequence selected from SEQ ID NO: 1 -76 or SEQ ID NO: 153-234, and wherein the composition elicits an immune response against Streptococcus pneumoniae when administered to a mammal.
  • a pneumococcal antigen or fragment thereof exists as a fusion conjugate, for example, where the fusion conjugate is a polysaccharide conjugate.
  • a fusion conjugate comprises the pneumococcal antigen or fragment thereof fused to a pneumococcal pneumolysoid PdT, wherein the pneumococcal pneumolysoid PdT is conjugated to the polysaccharide.
  • the fusion conjugate comprises a polysaccharide which is dextran, Vi polysaccharide of Salmonella typhi, or pneumococcal cell wall polysaccharide (CWPS), or another polysaccharide of prokaryotic or eukaryotic origin.
  • an immunogenic composition induces a IL-17A (Thl7-cell) response in a subject.
  • an immunogenic composition induces an immune response which comprises a humoral immune response and/or cellular immune response.
  • an immunogenic composition is further prepared as a vaccine that reduces or protects a mammal against pneumococcal colonization.
  • an immunogenic composition further comprises an adjuvant.
  • an immunogenic composition as disclosed herein is administered mucosally.
  • an immunogenic composition comprises at least 3, or at least 5, or between 5-20 pneumococcal antigens or fragments or more than 20 with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • an immunogenic composition comprises at least one of the pneumococcal proteins SP0785, SP1500 and SP2145.
  • Another aspect of the present invention relates to a method of inducing an IL-17A response in a subject, comprising administering to the subject at least one immunogenic composition as disclosed herein, e.g., a pneumococcus antigen of Table 1, or a functional fragment thereof effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • at least one immunogenic composition as disclosed herein, e.g., a pneumococcus antigen of Table 1, or a functional fragment thereof effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • Another aspect of the present invention relates to a method to protect against pneumococcus colonization, comprising administering to the subject at least one immunogenic composition as disclosed herein, e.g., a pneumococcal antigen of Table 1, or a functional fragment thereof
  • Another aspect of the present invention relates to a method to elicit an immune response against Streptococcus pneumoniae in a mammal, the method comprising administering to the mammal at least one immunogenic composition comprising one or more isolated pneumococcal antigen or fragment thereof as disclosed herein in Table 1 , with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234 in an effective to induce an immune response against
  • Another aspect of the present invention relates to a method to protect against Salmonella typhi colonization in a mammal, comprising administering to the mammal at least one immunogenic composition as disclosed herein, e.g., a pneumococcus antigen of Table 1, or a functional fragment thereof effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • at least one immunogenic composition as disclosed herein, e.g., a pneumococcus antigen of Table 1, or a functional fragment thereof effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • an immunogenic composition can comprise at least one isolated pneumococcus antigen or fragment thereof selected from SP0785 or SP1500, and/or has an amino acid sequence substantially identical to SEQ ID NO: 34 ( SP0785) or SEQ ID NO: 51(SP1500) or a functional fragment thereof.
  • Another aspect of the present invention relates to a method to protect against an invasive disease of Streptococcus pneumoniae in a subject, comprising administering to the subject an immunogenic composition as disclosed herein, e.g., a pneumococcus antigen of Table 1, or a functional fragment thereof in effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • an immunogenic composition as disclosed herein, e.g., a pneumococcus antigen of Table 1, or a functional fragment thereof in effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • such an invasive disease is, for example, sepsis.
  • the method comprises an immunogenic composition comprising at least one isolated pneumococcus antigen or fragment thereof is SP1386, SP1500, SP0084 and SP1479 and SP0346, and/or at least one pneumococcal antigen that has an amino acid sequence substantially identical to SEQ ID NO: 46 (SP1386), SEQ ID NO: 51(SP1500), SEQ ID NO: 4 (SP0084), SEQ ID NO: 50 (SP1479) and SEQ ID NO: 15 (SP0346) or a functional fragment thereof.
  • an immunogenic composition can be administered by mucosal administration, or any other applicable route, for example but not limited to, intravenous, subcutaneous or intraperitoneal (IP) administration.
  • mucosal administration or any other applicable route, for example but not limited to, intravenous, subcutaneous or intraperitoneal (IP) administration.
  • IP intraperitoneal
  • an immunogenic composition comprises at least one isolated pneumococcus antigen selected from any one or a combination of the pneumococcus antigens with the amino acid sequences 1-76 or SEQ ID NO: 153-234.
  • the pneumococcus antigens are the full length pneumococcus proteins of SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069,
  • a pneumococcus antigen comprises a pneumococcus protein that lacks a signal sequence and/or transmembrane domain.
  • a pneumococcus antigen comprises a mixture of a full length pneumococcus proteins and fragments resulting from processing, or partial processing of a signal sequence by an expression host, e.g., E. coli or an insect cell line (e.g., the baculovirus expression system), or a mammalian (e.g., human or Chinese hamster Ovary (CHO)) cell line.
  • an expression host e.g., E. coli or an insect cell line (e.g., the baculovirus expression system), or a mammalian (e.g., human or Chinese hamster Ovary (CHO)) cell line.
  • an expression host e.g., E. coli or an insect cell line (e.g., the baculovirus expression system), or a mammalian (e.
  • the pneumococcal antigens are fragments of the full length pneumococcal proteins of SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069, SP1154, SP1267, SP1376, SP1386, SP1404, SP1405, SP1419, SP1479, SP1500, SP1545, SP1560, SP1624, SP1652, SP1683, SP1826, SP1872,
  • a pneumococcal antigen comprises an amino acid sequence which is at least 60% (e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%) identical to at 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 150, 200, 250, 300, 350 or 400 consecutive amino acids of the pneumococcal proteins of SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648,
  • pneumococcal T-cell immunogens that both induce an IL-17A (e.g. a Thl7-cell) response and protect mice from colonization.
  • IL-17A e.g. a Thl7-cell
  • these proteins including SP0785, SP1500, SP2145, or fragments thereof, show promise as vaccine candidates against colonization and sepsis.
  • a novel pneumococcal immunogens as disclosed herein e.g., as disclosed in Table 1, are administered by mucosal immunization, and can be optionally administered with an adjuvant, to reduce subsequent pneumococcal nasal colonization.
  • an immunogenic composition comprises a SP1386, SP1500, SP0084, SP1479 and SP0346, or fragments thereof in a method to prevent or treat sepsis in a subject, such as a mammalian subject, including a human subject.
  • an immunogenic composition comprising at least one isolated pneumococcal antigen is prepared as a vaccine that reduces or protects a mammal against pneumococcal colonization.
  • an immunogenic composition can further comprise at least one adjuvant, e.g., selected from the group comprising, but not limited to cholera toxin, CFA, IF A, alum and others commonly known in the art and disclosed herein.
  • compositions for eliciting an immune response in a mammal comprising the T-cell stimulating immunogens prepared according to the methods as disclosed herein.
  • a pharmaceutical composition can further comprise an adjuvant and/or a vaccine scaffold.
  • a pharmaceutical composition can further comprise an adjuvant.
  • the immunogenic composition as disclosed herein can be administered to a subject mucosally.
  • a subject is a mammalian subject, e.g., a human, however other subjects are contemplated such as domestic and agricultural animals and the like.
  • compositions including nucleic acids encoding a pneumococcal antigen as described herein.
  • a composition includes an isolated nucleic acid comprising a nucleotide sequence encoding a pneumococcal antigen selected from Table 1 , or combinations thereof, and further comprises a pharmaceutically acceptable excipient.
  • a composition further comprises an adjuvant.
  • the invention provides methods for eliciting an immune response against pneumococcus in a mammal based on nucleic acids described herein in Table 1. In some
  • the invention provides methods for eliciting an immune response against
  • pneumococcus in a mammal by administering to the mammal a composition comprising a nucleic acid, wherein the nucleic acid comprises a nucleotide sequence encoding a pneumococcal antigen as disclosed in Table 1 or combinations thereof.
  • the invention provides methods for characterizing and/or detecting an immune response to a pneumococcal antigen in a subject (e.g., a pneumococcal polypeptide antigen selected from Table lor combinations thereof).
  • a pneumococcal antigen in a subject e.g., a pneumococcal polypeptide antigen selected from Table lor combinations thereof.
  • an immune response in a naive subject is characterized.
  • an immune response in a subject infected, or suspected of having been infected, with pneumococcus is characterized.
  • an immune response in a subject administered an immunogenic composition comprising a pneumococcal antigen e.g., an immunogenic composition described herein
  • an antibody response is characterized.
  • a B cell response is characterized.
  • a T cell response is characterized.
  • IFN- ⁇ secretion by antigen-specific T cells is characterized.
  • a Thl T cell response is characterized.
  • a Thl 7 T cell response is characterized, and in some emodiments, IL-17A secretion is characterized.
  • a cytotoxic T cell response is characterized.
  • both a T cell and a B cell response are characterized.
  • an innate immune response is characterized.
  • compositions including
  • pneumococcual antigens and antibodies that specifically bind to pneumococcal antigens as disclosed in Table 1.
  • compositions and methods described herein can be used for the prophylaxis and/or treatment of any pneumococcus disease, disorder, and/or condition due to a pneumococcual infection.
  • an immunogenic composition described herein reduces risk of infection by, and/or treats, alleviates, ameliorates, relieves, delays onset of, inhibits progression of, reduces severity of, and/or reduces incidence of one or more symptoms or features of a pneumococcal disease, disorder, and/or condition.
  • the prophylaxis and/or treatment of pneumococcal infection comprises administering a therapeutically effective amount of an immunogenic composition comprising a novel pneumococcal antigen described herein to a subject in need thereof, in such amounts and for such time as is necessary to achieve the desired result.
  • a "therapeutically effective amount" of an inventive immunogenic composition is that amount effective for treating, alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of pneumococcal infection.
  • inventive prophylactic, prognostic and/or therapeutic protocols involve administering a therapeutically effective amount of one or more immunogenic compositions comprising a novel pneumococcal antigen to a subject such that an immune response is stimulated in one or both of T cells and B cells.
  • the present invention also provides novel immunogenic compositions comprising a therapeutically effective amount of one or more pneumococcal antigens (e.g., one or more of a polypeptide antigen selected from Table 1 or combinations thereof) and one or more pharmaceutically acceptable excipients.
  • the present invention provides for pharmaceutical compositions comprising an immunogenic composition as described herein.
  • a method of administering a pharmaceutical composition comprising inventive compositions to a subject e.g. human, e.g., a child, adolescent, or young adult in need thereof is provided.
  • a therapeutically effective amount of an immunogenic composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after diagnosis with a pneumococcal disease, disorder, and/or condition.
  • a therapeutic amount of an inventive immunogenic composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after onset of symptoms of a pneumococcal disease, disorder, and/or condition.
  • immunogenic compositions of the present invention are administered by any of a variety of routes, including oral, intramuscular, subcutaneous, transdermal, intradermal, rectal, intravaginal, mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • routes including oral, intramuscular, subcutaneous, transdermal, intradermal, rectal, intravaginal, mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • immunogenic compositions of the present invention are administered by a variety of routes, including intravenous, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), transdermal, or by intratracheal instillation.
  • routes including intravenous, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), transdermal, or by intratracheal instillation.
  • an immunogenic composition may be administered in combination with one or more additional therapeutic agents which treat the symptoms of pneumococcal infection (e.g., with an antibiotic such as a beta-lactam antibiotic, an erythromycin, or a tetracycline).
  • additional therapeutic agents which treat the symptoms of pneumococcal infection (e.g., with an antibiotic such as a beta-lactam antibiotic, an erythromycin, or a tetracycline).
  • Another aspect of the present invention relates to the use of the immunogenic composition as disclosed herein to be administered to a subject to elicit an immune response in the subject.
  • the immune response is an antibody/B cell response, a CD4+ T cell response (including Thl, Th2 and Thl7 cells) and/or a CD8+ T-cell response.
  • at least one adjuvant is administered in conjunction with the immunogenic composition.
  • Another aspect of the present invention relates to a method for inducing an immune response in a subject to at least one antigen, comprising administering to the subject the immunogenic composition as disclosed herein.
  • Another aspect of the present invention relates to a method of vaccinating an animal, e.g., a bird, a mammal or a human, against at least one antigen comprising administering a vaccine composition comprising the immunogenic composition as disclosed herein.
  • an animal or a subject can be a human.
  • the subject can be an agricultural or non-domestic animal, or a domestic animal.
  • a vaccine composition comprising the immunogenic composition as disclosed herein can be administered via subcutaneous, intranasal, oral, sublingual, vaginal, rectal, intradermal, intraperitoneal, intra muscular injection, or via skin-patch for transcutaneous immunization.
  • an immune response is an antibody/B cell response, a CD4+ T cell response (including Thl, Th2 and Thl7 responses) or a CD8+ T-cell response against protein/peptide antigen(s).
  • an immune response is an antibody/B cell response against the polymer, e.g., a pneumococcal polysaccharide.
  • at least one adjuvant is administered in conjunction with the immunogenic composition.
  • Another aspect of the present invention relates to the use of the immunogenic composition as disclosed herein for use in a diagnostic for exposure to a pathogen or immunogenic agent.
  • kits for preparing an immunogenic composition can comprise any one or more of the following materials: a container comprising a polymer, e.g., a polysaccharide, cross-linked with a plurality of first affinity molecules; and a container comprising a complementary affinity molecule which associates with the first affinity molecule, wherein the complementary affinity molecule associates with an antigen.
  • a container comprising a polymer e.g., a polysaccharide, cross-linked with a plurality of first affinity molecules
  • a container comprising a complementary affinity molecule which associates with the first affinity molecule, wherein the complementary affinity molecule associates with an antigen.
  • kits comprising one or more of the immunogenic compositions of the invention.
  • the invention provides a kit comprising an immunogenic composition comprising a pneumococcual antigen, or a nucleic acid encoding the antigen, wherein the antigen is selected from Table 1 or functional fragments or combinations thereof; and instructions for use.
  • a kit may comprise multiple different pneumococcal antigens.
  • a kit may comprise any of a number of additional components or reagents in any combination.
  • a kit may include, for example, (i) a pneumococcal polypeptide antigen selected from Table 1 or combinations thereof; (ii) an adjuvant; and (iii) instructions for administering a composition including the pneumococcal antigen and the adjuvant to a subject in need thereof.
  • the kit can comprise a container comprising an expression vector for expressing a pneumococcal polypeptide antigen selected from Table 1 , for example.
  • the vector can optionally comprise a sequence for a linker peptide, wherein the expression vector can expresses a pneumococcal polypeptide antigen selected from Table 1.
  • a method of vaccinating a subject e.g., a mammal, e.g., a human with the immunogenic compositions as disclosed herein, the method comprising administering a vaccine composition as disclosed herein to the subject.
  • Figures 1A-1B show that pneumococcus antigens provide protection against colonization.
  • Figure 1A shows decreased colony forming units (CFU) in a nasal wash of mice challenged with serotype 6B pneumococcal strain after twice weekly immunization with SP0785 in the presence of the adjuvant cholera toxin (CT) as compared to CT alone.
  • Figure IB shows decreased colony forming units (CFU) in a nasal wash of mice challenged with serotype 6B pneumococcal strain after twice weekly immunization with SP1500 in the presence of the adjuvant cholera toxin (CT) as compared to CT alone.
  • CT adjuvant cholera toxin
  • Figure 2 shows pneumococcus antigens fused to Pdt (pneumococcal pneumolysoid PdT) protects against sepsis challenge and prevents against invasive infection and nasopharyngeal colonization of pneumococcus.
  • Figure 2 is a survival curve of mice with sepsis showing that immunization with a fusion protein consisting of SP0785-PdT protected 80% mice against sepsis, and fusion protein SP2145-PdT protected 90%> of mice against sepsis as compared to mice immunized with control mice (Alum only) or PdT alone (which protected only 30%> of mice).
  • Figures 3A-3B show pneumococcal antigens fused to PdT (pneumococcal pneumolysoid PdT) and covalently conjugated to the Vi polysaccharide generates IL-17A and anti-Vi antibody; protecting against sepsis challenge and preventing invasive infection and nasopharyngeal colonization of pneumococcus.
  • Figure 3A shows high levels of IL-17A when stimulated with whole cell vaccine (WCV) after the mice were immunized with SP0785-PdT-Vi congugate or SP2145-PdT-Vi conjugate as compared to the control Alum alone.
  • Figure 3B shows high levels of anti-Vi IgG in mice were immunized with SP0785-PdT-Vi conjugate or SP2145-PdT-Vi conjugate, as compared to Alum alone.
  • Figure 4 shows pneumococcal antigens fused to Pdt (pneumococcal pneumolysoid PdT) and covalently conjugated to the Vi polysaccharide protects against sepsis challenge and prevents against invasive infection and nasopharyngeal colonization of pneumococcus.
  • Figure 4 is a survival curve of mice with sepsis showing that immunization with a fusion protein consisting of SP2145-PdT-Vi or SP0785-PdT-Vi protected 80% mice against sepsis as compared to mice immunized with control mice (Alum only) (which protected only 20% of mice).
  • Figure 5 shows sera from immunized mice bind encapsulated pneumococcal strain Tigr4.
  • Figure 5 shows results from a flow cytometric assay showing that antibodies present in the serum from mice immunized with SP0785 (black) can label the encapsulated pneumococcal strain Tigr4 as compared to serum obtained from mice immunized with alum alone (grey).
  • Figure 5 demonstrates that anti-SP0785 antibody is able to bind to encapsulated pneumococcal strain.
  • FIGS 6A-6B demonstrate protection against pneumococcal colonization by a Multiple Antigen Presenting System (MAPS) construct.
  • MAPS complexes were made using biotinylated type- 1 pneumococcal polysaccharide attached to a fusion protein consisting of rhizavidin and SP0785, SP1500, SP0435 or PdT.
  • C57/BL6 mice were immunized with a mixture of 3 MAPS complexes containing SP0785, SP1500 and PdT, or a mixture of all 4 MAPS complexes described above, on aluminum hydroxide, at a dosage of 6.7 ⁇ g of each antigen.
  • mice received either aluminum hydroxide alone (alum, negative control) or a whole cell vaccine in alum (as a positive control). Immunization was given subcutaneously three times, two weeks apart. Blood was drawn after the third immunization and stimulated with 10 ⁇ g/ml of S. pneumoniae whole cell antigen or 5 ⁇ g/ml of purified SP0785, SP1500 or PdT protein. Antigen-specific or whole cell (WCB) IL-17A production was measured 7 days post stimulation by ELISA ( Figure 6A). One week after bleeding, mice were challenged with pneumococcal 603B strain and bacterial colonization rate in the nose was determined 10 days post challenge (Figure 6B). Mice that received immunizations with either 3 or 4 MAPS complexes were protected against pneumococcal colonization.
  • Figure 7 demonstrates protection against pneumococcal colonization by a fusion protein of SP0785, SP1500 and PdT conjugated to Vi polysaccharide of Salmonella typhi.
  • C57BL/6 mice were immunized with vaccines containing 5 ⁇ g of protein antigen adsorbed onto alum, subcutaneously three times, two weeks apart. Control mice received alum alone. Two weeks after last immunization, mice were intranasally challenged with pneumococcal 603B strain and bacterial colonization rate in the nose was determined by nasal wash. The mice that were immunized with the fusion conjugate were significantly protected against pneumococcal colonization compared to the mice in the control group.
  • Figure 8 demonstrates that passive transfer of rabbit serum protects mice against pneumococcal challenge.
  • New Zealand white rabbits were immunized with purified SP0785, SP1500 or PdT.
  • An equal mixture of each serum from rabbits pre-immunization vs. post immunization (in this case, 67 ⁇ each) was given to groups of 10 mice via the intraperitoneal route. Mice were then intraperitoneally infected with a serotype 3 strain 24 hours later and mice survival was monitored for 8 days.
  • Group received post immunization serum had 60% survival comparing to 0% survival in the pre-serum group, a difference that was highly statistically significant, attesting to the protective capacity of antibodies to these proteins for pneumococcal invasive disease.
  • Streptococcus pneumoniae (S. pneumoniae) is a common cause of bacterial pneumonia, meningitis, otitis media, and bacteremia in children, the elderly, and immunodeficient individuals. S. pneumoniae can be subdivided into approximately 90 serotypes, based on the capsular polysaccharide of the organism. However, disease is generally caused by approximately 30 types of S. pneumoniae isolates. The World Health Organization estimates that there are one million deaths among children due to pneumococcal meningitis and sepsis each year, with 98% of these deaths occurring in developing countries.
  • One aspect of the present invention encompasses the discovery of novel antigens for pneumococcus that elicit antigen specific immune responses in mammals.
  • novel antigens, and/or nucleic acids encoding the antigens can be incorporated into immunogenic compositions and administered to elicit immune responses, e.g., to provide protection against pneumococcal colonization, invasive diseases, such as but not limited to, sepsis, and diseases and disorders caused by pneumococcus organisms.
  • Such novel antigens and/or responses to novel antigens can be detected to identify and/or characterize immune responses to pneumococcal organisms.
  • compositions comprising at least one isolated pneumococcus antigen selected from the pneumococcus proteins listed in Table 1, e.g., SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069, SP1154, SP1267, SP1376, SP1386, SP1404, SP1405, SP1419, SP1479, SP1500, SP
  • SP0346,SP1386, SP0084, SP1479 and SP2145 which protect against pneumococcus and pneumococcal infection, such as sepsis.
  • antigen refers to a molecule (e.g., a polypeptide) that elicits a specific immune response.
  • Antigen specific immunological responses also known as adaptive immune responses, are mediated by lymphocytes (e.g., T cells, B cells) that express antigen receptors (e.g., T cell receptors, B cell receptors).
  • an antigen is a T cell antigen, and elicits a cellular immune response.
  • an antigen is a B cell antigen, and elicits a humoral (i.e., antibody) response.
  • an antigen is both a T cell antigen and a B cell antigen.
  • antigen encompasses both a full-length polypeptide as well as a portion of the polypeptide, that represent immunogenic fragments (i.e., fragments that elicit an antigen specific T cell response, B cell response, or both) of such complete polypeptides.
  • antigen is a peptide epitope found within a polypeptide sequence (e.g., a peptide epitope bound by a Major Histocompatibility Complex (MHC) molecule (e.g., MHC class I, or MHC class II).
  • MHC Major Histocompatibility Complex
  • peptides 5-15 amino acids in length, and longer polypeptides, e.g., having 60, 70, 75, 80, 85, 90, 100, 150, 200 250, or more amino acids, can be "antigens".
  • the present invention provides a SP0785 polypeptide antigen.
  • a SP0785 polypeptide antigen includes a full-length SP0785 polypeptide amino acid sequence (e.g., a full-length SP0785 polypeptide of SEQ ID NO:34).
  • a SP0785 polypeptide antigen includes a portion of a SP0785 polypeptide (e.g., a portion of the SP0785 polypeptide of SEQ ID NO:34, which portion includes at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 contiguous amino acids of SEQ ID NO:34).
  • a portion of a SP0785 polypeptide corresponds to a protein having the amino acid sequence of SEQ ID NO: 190.
  • a SP0785 polypeptide antigen contains one or more amino acid alterations (e.g., deletion, substitution, and/or insertion) from a naturally-occurring wild-type SP0785 polypeptide sequence.
  • a SP0785 polypeptide antigen may contain an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to SEQ ID NO:34 or a portion thereof (e.g., at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:34).
  • a SP0785 polypeptide antigen may contain a portion (e.g., at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids) of a sequence that is at least 60%> (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to SEQ ID NO:34 or SEQ ID NO: 190.
  • SP0785 polypeptide antigen is used as an example.
  • This concept is applicable to other polypeptide antigen described herein including, but not limited to, SP1500, SP0346, SP1386, SP0084, SP1479, and SP2145 polypeptide antigens, and any of those polypeptide antigens listed in Table 1.
  • pneumococcal antigen refers to an antigen that elicits an antigen specific immune response against any organism of the pneumococcal genus, such as a Streptococcus pneumonia organism, etc.
  • a pneumococcal antigen elicits an antigen specific immune response against S. pneumonia organisms of multiple species.
  • Pneumococcal antigens include full-length polypeptides encoded by pneumococcal genes shown in Table 1 (SEQ ID NO: 1- 76), as well as immunogenic portions of the polypeptides shown in Table 2 (SEQ ID NOs: 153-234).
  • immunogenic composition refers to a composition that is capable of eliciting an immune response, such as an antibody or cellular immune response, when administered to a subject.
  • an immunogenic composition includes a polypeptide or peptide antigen.
  • the immunogenic compositions of the present invention may or may not be
  • an immunogenic composition includes a nucleic acid encoding a polypeptide or peptide antigen.
  • An immunogenic composition can include molecules that induce an immune response against multiple antigens.
  • antibody refers to any immunoglobulin, whether natural or wholly or partially synthetically produced. All derivatives thereof that maintain specific binding ability are also included in the term.
  • the term also covers any protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain. Such proteins may be derived from natural sources, or partly or wholly synthetically produced.
  • An antibody may be monoclonal or polyclonal.
  • An antibody may be a member of any immunoglobulin class, including any of the human classes: IgG, IgM, IgA, IgD, and IgE.
  • antibody fragment or “characteristic portion of an antibody” are used interchangeably and refer to any derivative of an antibody which is less than full-length.
  • an antibody fragment retains at least a significant portion of the full-length antibody's specific binding ability.
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, scFv, Fv, dsFv diabody, and Fd fragments.
  • An antibody fragment may be produced by any means.
  • an antibody fragment may be enzymatically or chemically produced by fragmentation of an intact antibody and/or it may be recombinantly produced from a gene encoding the partial antibody sequence.
  • an antibody fragment may be wholly or partially synthetically produced.
  • An antibody fragment may optionally comprise a single chain antibody fragment.
  • an antibody fragment may comprise multiple chains which are linked together, for example, by disulfide linkages.
  • An antibody fragment may optionally comprise a multimolecular complex.
  • a functional antibody fragment will typically comprise at least about 50 amino acids and more typically will comprise at least about 200 amino acids.
  • CTL Cytotoxic T Lymphocyte
  • Ag processed antigen
  • CMI cell mediated immunity
  • NK natural killer cells
  • T -cells antigen-specific cytotoxic T-lymphocytes
  • neutrophils neutrophils
  • CMI refers to immune cells (such as T cells and other lymphocytes) which bind to the surface of other cells that display a target antigen (such as antigen presenting cells (APC)) and trigger a response.
  • APC antigen presenting cells
  • the response may involve either other lymphocytes and/or any of the other white blood cells (leukocytes) and the release of cytokines.
  • Cellular immunity protects the body by: (i) activating antigen-specific cytotoxic T-lymphocytes (CTLs) that are able to destroy body cells displaying epitopes of foreign antigen on their surface, such as virus-infected cells and cells with intracellular bacteria; (2) activating macrophages and NK cells, enabling them to destroy intracellular pathogens; and (3) stimulating cells to secrete a variety of cytokines or chemokines that influence the function of other cells such as T cells, macrophages or neutrophils involved in adaptive immune responses and innate immune responses.
  • CTLs cytotoxic T-lymphocytes
  • NK cells enabling them to destroy intracellular pathogens
  • stimulating cells to secrete a variety of cytokines or chemokines that influence the function of other cells such as T cells, macrophages or neutrophils involved in adaptive immune responses and
  • immunode refers to any cell which can release a cytokine, chemokine or antibody in response to a direct or indirect antigenic stimulation.
  • lymphocytes including natural killer (NK) cells, T-cells (CD4+ and/or CD8+ cells), B-cells, macrophages; leukocytes; dendritic cells; mast cells; monocytes; and any other cell which is capable of producing a cytokine or chemokine molecule in response to direct or indirect antigen stimulation.
  • NK natural killer
  • T-cells CD4+ and/or CD8+ cells
  • B-cells macrophages
  • leukocytes dendritic cells
  • mast cells mast cells
  • monocytes monocytes
  • an immune cell is a lymphocyte, for example a T-cell lymphocyte.
  • cytokine refers to a molecule released from an immune cell in response to stimulation with an antigen.
  • cytokines include, but are not limited to: GM-CSF; IL-la; IL- ⁇ ⁇ ; IL-2; IL-3; IL-4; IL-5; IL-6; IL-7; IL-8; IL-10; IL-12; IL-17A, IL-17F or other members of the IL-17 family, IL-22, IL-23, IFN- ⁇ ; IFN- ⁇ ; IFN-a; MIP-l a; MIP- ⁇ ⁇ ; TGF-a; TNFaD or ⁇ .
  • the term "cytokine" does not include antibodies
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant, and/or microbe).
  • in vivo refers to events that occur within an organism (e.g., animal, plant, and/or microbe).
  • isolated means that the isolated entity has been separated from at least one component with which it was previously associated. When most other components have been removed, the isolated entity is "purified.” Isolation and/or purification and/or concentration may be performed using any techniques known in the art including, for example, chromatography, fractionation, precipitation, or other separation.
  • adjuvant refers to any agent or entity which increases the antigenic response (e.g., immune response) by a cell or a subject to a target antigen.
  • an adjuvant is used to enhance an immune response to a peptide antigen administered to a subject.
  • an adjuvant is used to enhance an immune response to an antigen encoded by a nucleic acid administered to a subject.
  • pathogen refers to an organism or molecule that causes a disease or disorder in a subject.
  • pathogens include but are not limited to viruses, fungi, bacteria, parasites and other infectious organisms or molecules therefrom, as well as taxonomically related macroscopic organisms within the categories algae, fungi, yeast and protozoa or the like.
  • prokaryotic pathogen refers to a bacterial pathogen.
  • viral pathogen refers to a virus that causes illness or disease, such as HIV.
  • parasitic pathogen refers to a microorganism that is parasitic, residing for an extended period inside a host cell or host organism that gains benefits from the host and at the same time causes illness or disease.
  • a parasitic pathogen can be bacteria, viruses, fungi, and parasites, and protists.
  • the term "functional fragment” or "portion” as used in the context of a functional fragment of an immunogen of protein "x" refers to a fragment of such a protein or peptide that mediates, effects or elicits a cellular and/or humoral immune response as similar to the protein or peptide from which it was derived (e.g. a fragment thereof).
  • the term “functional” when used in conjunction with “derivative” or “variant” or “fragment” refers to a polypeptide which possess a biological activity that is substantially similar to a biological activity of the entity or molecule of which it is a derivative or variant or fragment thereof.
  • a functional fragment of SEQ ID NO: 34 or SEQ ID NO: 190 would be a protein or peptide comprising a portion of SEQ ID NO: 34 or SEQ ID NO: 190 which retained an activity for eliciting an IL-17A response in splenocytes or human PMBC, and protect against colonization by pneumococcal organism; preferably the fragment of SEQ ID NO: 34 or SEQ ID NO: 190 retains at least 25%, at least 35%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 100%) or even higher (i.e., the variant or derivative has greater activity than the wild-
  • Such functional fragments of the immunogens can be assessed by the assays as disclosed in the Examples, e.g., to assess if a functional fragment elicits an IL-17A response in mouse splenocytes or human PBMCs in vitro as disclosed in Example 2, or protects colonization in vivo in a mouse colonization model, where mice are challenged with a serotype of pneumococcal strain (e.g., serotypes 6B, 14F or 19F) after biweekly immunization with a pneumococcal antigen (or functional fragment), and assessing for presence of pneumococcal colonization in the nasopharynx, as disclosed in Example 3.
  • a serotype of pneumococcal strain e.g., serotypes 6B, 14F or 19F
  • a "fragment" of an antigen or immunogen of Table 1 as that term is used herein will be at least 15 amino acids in length, and can be, for example, at least 16, at least 17, at least 18, at least 19, at least 20 or at least 25 amino acids or greater inclusive.
  • CTL Cytotoxic T Lymphocyte
  • Ag processed antigen
  • CMI cell mediated immunity
  • NK natural killer cells
  • T -cells antigen-specific cytotoxic T-lymphocytes
  • cytokines in response to a target antigen.
  • CMI refers to immune cells (such as T cells and lymphocytes) which bind to the surface of other cells that display the antigen (such as antigen presenting cells (APS)) and trigger a response.
  • the response can involve either other lymphocytes and/or any of the other white blood cells (leukocytes) and the release of cytokines.
  • CMI cell-mediated immunity
  • Cellular immunity protects the body by: (i) activating antigen-specific cytotoxic T-lymphocytes (CTLs) that are able to destroy body cells displaying epitopes of foreign antigen on their surface, such as virus- infected cells, cells with intracellular bacteria, and cancer cells displaying tumor antigens; (2) activating macrophages and NK cells, enabling them to destroy intracellular pathogens; and (3) stimulating cells to secrete a variety of cytokines that influence the function of other cells involved in adaptive immune responses and innate immune responses.
  • CTLs cytotoxic T-lymphocytes
  • humoral immunity for which the protective function of immunization could be found in the humor (cell-free bodily fluid or serum)
  • cellular immunity for which the protective function of immunization was associated with cells.
  • immunode refers to any cell which can release a cytokine in response to a direct or indirect antigenic stimulation.
  • lymphocytes including natural killer (NK) cells, T-cells (CD4+ and/or CD8+ cells), B-cells, macrophages and monocytes, Th cells; Thl cells; Th2 cells; Tc cells; stromal cells; endothelial cells; leukocytes; dendritic cells; macrophages; mast cells and monocytes and any other cell which is capable of producing a cytokine molecule in response to direct or indirect antigen stimulation.
  • NK natural killer
  • T-cells CD4+ and/or CD8+ cells
  • B-cells B-cells, macrophages and monocytes
  • Th cells Thl cells
  • Th2 cells Th2 cells
  • Tc cells stromal cells
  • endothelial cells endothelial cells
  • leukocytes dendritic cells
  • macrophages macrophages
  • an immune cell is a lymphocyte, for example a T-cell lymphocyte.
  • nucleic acid refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain.
  • a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage.
  • oligonucleotide and “polynucleotide” can be used interchangeably.
  • nucleic acid encompasses RNA as well as single and/or double-stranded DNA and/or cDNA.
  • nucleic acid includes nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and/or encode the same amino acid sequence.
  • Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. A nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated.
  • polypeptide generally has its art-recognized meaning of a polymer of at least three amino acids. However, the term is also used to refer to specific classes of antigen polypeptides, such as, for example, SP0785 polypeptides, SP1500 polypeptides, SP0346 polypeptides, SP1386 polypeptides, SP0084 polypeptides, SP1479 polypeptides and SP2145 polypeptides. For each such class, the present specification provides several examples of known sequences of such polypeptides.
  • polypeptide as used herein to refer to "polypeptide antigen” is intended to be sufficiently general as to encompass not only polypeptides having a sequence recited herein, but also to encompass polypeptides having a variation of the sequence that elicits an antigen-specific response to the polypeptide.
  • a "SP0785 polypeptide” includes the SP0785 polypeptide shown in SEQ ID NO:34, as well as polypeptides that have variations of a SEQ ID NO:34 sequence, such as for example, a fragment of SP0785 as shown in SEQ ID NO: 190, and that maintain the ability to elicit an antigen-specific response to a polypeptide of SEQ ID NO:34.
  • polypeptides that have variations of a SEQ ID NO:34 sequence, such as for example, a fragment of SP0785 as shown in SEQ ID NO: 190, and that maintain the ability to elicit an antigen-specific response to a polypeptide of SEQ ID NO:34.
  • protein sequences generally tolerate some substitution without destroying
  • polypeptide encompassing at least 3-4 and often up to 20 or more amino acids, with another polypeptide of the same class, is encompassed within the relevant term "polypeptide" as used herein. Other regions of similarity and/or identity can be determined by those of ordinary skill in the art by analysis of the sequences of various polypeptides presented herein. See the definition of Antigen. It will be appreciated that proteins or polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal amino acids, can be modified in a given polypeptide, either by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques which are well known in the art.
  • polypeptides of the present invention include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a polynucleotide or polynucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formulation, gamma-carboxylation, glycation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins
  • BLAST is used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the present disclosure.
  • Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (available at the following internet address: ncbi.nlm.nih.gov).
  • HSPs high scoring sequence pairs
  • T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score.
  • Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • W wordlength
  • E expectation
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA, 90:5873-5787, 1993).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • subject is used interchangeably herein with "patient” or “individual” refers to any organism to which a composition of this invention may be administered, e.g., for experimental, diagnostic, and/or therapeutic purposes. Typical subjects include mammals such as mice, rats, rabbits, non-human primates, domestic animals and humans. In some embodiments, the term “subject” refers to any animal in which it is useful to elicit an immune response.
  • the subject can be a wild, domestic, commercial or companion animal such as a bird or mammal.
  • the subject can be a human.
  • the immunogenic compositions as disclosed herein can also be suitable for the therapeutic or preventative treatment in humans, it is also applicable to warm-blooded vertebrates, e.g., mammals, such as non-human primates, (particularly higher primates), sheep, dog, rodent (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbits, cows, and non- mammals such as chickens, ducks, or turkeys.
  • the subject is a wild animal, for example a bird such as for the diagnosis of avian flu.
  • the subject is an experimental animal or animal substitute as a disease model.
  • the subject may be a subject in need of veterinary treatment, where eliciting an immune response to an antigen is useful to prevent a disease and/or to control the spread of a disease, for example SIV, STL1, SFV, or in the case of live-stock, hoof and mouth disease, or in the case of birds Marek's disease or avian influenza, and other such diseases.
  • a disease for example SIV, STL1, SFV, or in the case of live-stock, hoof and mouth disease, or in the case of birds Marek's disease or avian influenza, and other such diseases.
  • recombinant when used to describe a nucleic acid molecule, means a polynucleotide of genomic, cDNA, viral, semisynthetic, and/or synthetic origin, which, by virtue of its origin or manipulation, is not associated with all or a portion of the polynucleotide sequences with which it is associated in nature.
  • recombinant as used with respect to a peptide, polypeptide, protein, or recombinant fusion protein, means a polypeptide produced by expression from a recombinant polynucleotide.
  • recombinant as used with respect to a host cell means a host cell into which a recombinant polynucleotide has been introduced.
  • Recombinant is also used herein to refer to, with reference to material (e.g., a cell, a nucleic acid, a protein, or a vector) that the material has been modified by the introduction of a heterologous material (e.g., a cell, a nucleic acid, a protein, or a vector).
  • vectors refers to a nucleic acid molecule capable of transporting or mediating expression of a heterologous nucleic acid to which it has been linked to a host cell; a plasmid is a species of the genus encompassed by the term “vector.”
  • vector typically refers to a nucleic acid sequence containing an origin of replication and other entities necessary for replication and/or maintenance in a host cell.
  • vectors capable of directing the expression of genes and/or nucleic acid sequence to which they are operatively linked are referred to herein as "expression vectors”.
  • expression vectors of utility are often in the form of "plasmids" which refer to circular double stranded DNA molecules which, in their vector form are not bound to the chromosome, and typically comprise entities for stable or transient expression or the encoded DNA.
  • Other expression vectors that can be used in the methods as disclosed herein include, but are not limited to plasmids, episomes, bacterial artificial chromosomes, yeast artificial chromosomes, bacteriophages or viral vectors, and such vectors can integrate into the host's genome or replicate autonomously in the particular cell.
  • a vector can be a DNA or RNA vector.
  • Other forms of expression vectors known by those skilled in the art which serve the equivalent functions can also be used, for example self replicating
  • extrachromosomal vectors or vectors which integrates into a host genome are those capable of autonomous replication and/or expression of nucleic acids to which they are linked.
  • An individual who is "suffering from” a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition.
  • An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with and/or may not exhibit symptoms of the disease, disorder, and/or condition.
  • a disease, disorder, and/or condition is associated with a pneumococcal infection.
  • S. pneumoniae is responsible for 15-50% of all episodes of community-acquired pneumonia, 30-50% of all cases of acute otitis media and a significant proportion of bacteremia and bacterial meningitis.
  • an individual who is susceptible to a pneumococcal infection may be exposed to a pneumococcus (e.g., by ingestion, inhalation, physical contact, etc.).
  • an individual who is susceptible to a pneumococcal infection may be exposed to an individual who is infected with the microbe.
  • an individual who is susceptible to a pneumococcal infection is one who is in a location where the microbe is prevalent (e.g., one who is traveling to a location where the microbe is prevalent).
  • an individual who is susceptible to a pneumococcal infection is susceptible due to young age (e.g., a child, adolescent, or young adult).
  • a subject who is susceptible is to pneumococcal infection is a subject with Job's syndrome (subject lacking Th-17 cell-mediated response) or a aggamaglobunemic subject (a subject lacking antibody- mediated response).
  • a subject who is susceptible is a subject whose immune system is compromised, such as those living with HIV, or has an auto-immune disease, or has influenza.
  • a subject who is susceptible to a pneumococcal infection is a subject who has other risk factors, such as, but not limited to smoking, injection drug use, Hepatitis C, and COPD.
  • an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
  • therapeutically effective amount means an amount of a therapeutic, prophylactic, and/or diagnostic agent (e.g., inventive immunogenic composition) that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, alleviate, ameliorate, relieve, alleviate symptoms of, prevent, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of the disease, disorder, and/or condition.
  • therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic, prophylactic, and/or diagnostic effect and/or elicits a desired biological and/or pharmacological effect.
  • treating refers to the term “treating” refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular disease, disorder, and/or condition.
  • “treating" a microbial infection may refer to inhibiting survival, growth, and/or spread of the microbe.
  • Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
  • treatment comprises delivery of an immunogenic composition (e.g., a vaccine) to a subject.
  • vaccine refers to an entity comprising at least one immunogenic component (e.g., an immunogenic component which includes a peptide or protein, and/or an immunogenic component which includes a nucleic acid).
  • a vaccine includes at least two immunogenic components.
  • a vaccine is capable of stimulating an immune response of both T cells and B cells.
  • any assay available in the art may be used to determine whether T cells and/or B cells have been stimulated.
  • T cell stimulation may be assayed by monitoring antigen-induced production of cytokines, antigen- induced proliferation of T cells, and/or antigen-induced changes in protein expression.
  • B cell stimulation may be assayed by monitoring antibody titers, antibody affinities, antibody performance in neutralization assays, class-switch recombination, affinity maturation of antigen-specific antibodies, development of memory B cells, development of long-lived plasma cells that can produce large amounts of high-affinity antibodies for extended periods of time, germinal center reactions, and/or antibody performance in neutralization assays.
  • a vaccine further includes at least one adjuvant that can help stimulate an immune response in T cells and/or B cells.
  • pharmaceutically acceptable refers to compounds and compositions which may be administered to mammals without undue toxicity.
  • pharmaceutically acceptable carriers excludes tissue culture medium.
  • exemplary pharmaceutically acceptable salts include but are not limited to mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like, and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • Pharmaceutically acceptable carriers are well known in the art.
  • wild-type refers to the typical or the most common form existing in nature or as it normally exists in vivo.
  • mutant refers to an organism or cell with any change in its genetic material, in particular a change (i.e., deletion, substitution, addition, or alteration) relative to a wild-type polynucleotide sequence or any change relative to a wild-type protein sequence.
  • change i.e., deletion, substitution, addition, or alteration
  • variant may be used interchangeably with “mutant”.
  • mutant and variant refer to a change in the sequence of a wild-type protein regardless of whether that change alters the function of the protein (e.g., increases, decreases, imparts a new function), or whether that change has no effect on the function of the protein (e.g., the mutation or variation is silent).
  • reduced or “reduce” or “decrease” as used herein generally means a decrease by a statistically significant amount relative to a reference.
  • reduced means statistically significant decrease of at least 10% as compared to a reference level, for example a decrease by at least 20%, at least 30%, at least 40%, at least t 50%, or least 60%>, or least 70%, or least 80%o, at least 90% or more, up to and including a 100% decrease (i.e., absent level as compared to a reference sample), or any decrease between 10-100%) as compared to a reference level, as that term is defined herein.
  • low as used herein generally means lower by a statically significant amount; for the avoidance of doubt, “low” means a statistically significant value at least 10% lower than a reference level, for example a value at least 20% lower than a reference level, at least 30% lower than a reference level, at least 40% lower than a reference level, at least 50% lower than a reference level, at least 60% lower than a reference level, at least 70% lower than a reference level, at least 80% lower than a reference level, at least 90% lower than a reference level, up to and including 100% lower than a reference level (i.e., absent level as compared to a reference sample).
  • a reference level for example a value at least 20% lower than a reference level, at least 30% lower than a reference level, at least 40% lower than a reference level, at least 50% lower than a reference level, at least 60% lower than a reference level, at least 70% lower than a reference level, at least 80% lower than a reference level, at least 90% lower than a reference level, up to and including 100%
  • the terms "increased” or “increase” as used herein generally mean an increase by a statically significant amount; such as a statistically significant increase of at least 10% as compared to a reference level, including an increase of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%o, at least 70%, at least 80%, at least 90%, at least 100% or more, inclusive, including, for example at least 2 fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold increase or greater as compared to a reference level, as that term is defined herein.
  • the term "high” as used herein generally means a higher by a statically significant amount relative to a reference; such as a statistically significant value at least 10% higher than a reference level, for example at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, inclusive, such as at least 2-fold higher, at least 3-fold higher, at least 4-fold higher, at least 5-fold higher, at least 10-fold higher or more, as compared to a reference level.
  • compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
  • the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
  • the effector T cell is the CD4+ TH17 cell, with neutralization of IL-17A response with an anti IL-17A antibody diminished the protection by the WCV, and IL-17A receptor knockout mice are not protected by the WCV.
  • IFN-gamma or IL-4 deficient mice which are skewed away from TH1 or TH2 responses, respectively) are fully protected (Lu et al., 4 PLoS Pathogens. el000159 (2008)).
  • Rats and mice immunized with the WCV are reported to be significantly protected against pneumococcal sepsis in two pneumonia models (Malley et al., 2001).
  • pneumococcal antigens which are listed in Table 1 which protect against pneumococcal colonization and infection, such as against pneumococcal sepsis infection. These pneumococcal antigens listed in Table 1 can be administered as vaccines, in the presence or absence of an adjuvant, to elicit a systemic IL-17A response and reduce or protect against intranasal pneumococcal colonization.
  • a pneumococcal antigen of any listed in Table 1 can be administered as mucosal vaccines to protect against intranasal pneumococcal colonization as well as pneumococcal infection, such as sepsis.
  • Table 1 lists the amino acid sequence identification numbers of the pneumococcal immunogens.
  • GNAT family (SEQ ID NO: 207) peptidoglycan N- 50 126 15901329 NP 345933.1
  • SP1683 transporter substrate- (SEQ ID NO: 214) binding protein Prot DNA Gene ID NO. GenBank Immunogenic ein SEQ Accession No fragments of the
  • SEQ ID NO: 70 carbamate kinase (EC 71 147 15901963 NP 346567.1 SP2151 (25-end)
  • the other appropriate 51 pneumoniae antigen is at least at least 70%, 80%>,
  • this application also provides immunogenic compositions that include one or more of the polypeptides or genes listed in Table 2, or variants or fragments thereof as described herein.
  • the DNA and protein sequence of each gene and protein may be found by searching for the Locus Tag in the publicly available database, Entrez Gene, as described above.
  • immunogenic compositions comprising at least one isolated pneumococcus antigen selected from the pneumococcal proteins SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069, SP1154, SP1267, SP1376, SP1386, SP1404, SP1405, SP1419, SP1479, SP1500, SP1545, SP1560, SP16
  • the pneumococcal antigen has an amino acid sequence selected from any or a combination from SEQ ID NO: 1-76, or functional fragments thereof.
  • the pneumococcus antigen corresponding to SEQ ID NO: 1 -76 are encoded by nucleic acids of SEQ ID NO: 77-152.
  • fragments of the pneumococcal antigen are encompassed for use in the methods and composistions as disclosed herein, for example,
  • pneumococcus antigens corresponding to SEQ ID NO: 153-234 as disclosed in Table 1.
  • Other functional fragments of the pneumococcus antigens are encompassed for use in the methods and compositions as disclosed herein, and can be assessed by one of ordinary skill in the art to determine if they provide protection against pneumococcus colonization, according to the methods as disclosed in Example 3 herein.
  • a functional fragment of a pneumococcal antigen of SEQ ID NO: 1-76 or SEQ ID NO: 153-234 can also be assessed by one of ordinary skill in the art for protection against an invasive disease, such as sepsis according to the methods as disclosed in Example 4 and 5, in particular when used alone or as part of a fusion protein with PdT.
  • a functional fragment of a pneumococcal antigen of SEQ ID NO: 1-76 or SEQ ID NO: 153-234 can also be assessed by one of ordinary skill in the art for protection against an S.typhi according to the methods as disclosed in Example 5, in particular when used alone or as part of a fusion protein with PdT and/or fused to Vi.
  • an immunogenic compositon comprises at least one isolated pneumococcal antigen selected from any one or a combination of the pneumococcal antigens with the amino acid sequences SEQ ID NO: 1 -76 or SEQ ID NO: 153-234.
  • the pneumococcal antigens are the full length pneumococcal proteins of SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069, SP1154, SP1267, SP1376, SP1386, SP1404, SP1405, SP1419, SP1479, SP1500, SP1545, SP1560, SP1624, SP1652, SP1683, SP1826, SP1872, SP1891, SP1897,
  • a pneumococcal antigen comprises a pneumococcal protein that lacks a signal sequence and/or transmembrane domain.
  • a pneumococcal antigen comprises a mixture of a full length pneumococcal proteins and fragments resulting from processing, or partial processing of a signal sequence by an expression host, e.g., E. coli or an insect cell line (e.g., the baculovirus expression system), or a mammalian (e.g., human or Chinese hamster Ovary (CHO)) cell line.
  • an expression host e.g., E. coli or an insect cell line (e.g., the baculovirus expression system), or a mammalian (e.g., human or Chinese hamster Ovary (CHO)) cell line.
  • an expression host e.g., E. coli or an insect cell line (e.g., the baculovirus expression system), or a mammalian (e.
  • the pneumococcal antigens are a fragment of the full length pneumococcal proteins of SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648, SP0659, SP0662, SP0664, SP0678, SP0724, SP0742, SP0757, SP0785, SP0787, SP0872, SP0878, SP0899, SP1002, SP1026, SP1032, SP1069, SP1154, SP1267, SP1376, SP1386, SP1404, SP1405, SP1419, SP1479, SP1500, SP1545, SP1560, SP1624, SP1652, SP1683, SP1826, SP187
  • fragment of the full-length pneumococcal protein correspond to SEQ ID NO: 153-234.
  • a fragment of a pneumococcal protein is a functional fragment of any of SEQ ID NO: 153-234, for example, at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 150, 200, 250, 300, 350 or 400 consecutive amino acids of pneumococcal antigens corresponding to SEQ ID NO: 153-234.
  • a pneumococcal antigen comprises an amino acid sequence which is at least 60% (e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%) identical to at 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 150, 200, 250, 300, 350 or 400 consecutive amino acids of the pneumococcal proteins of SP0010, SP0043, SP0079, SP0084, SP0092, SP0098, SP0106, SP0107, SP0127, SP0149, SP0191, SP0198, SP0249, SP0321, SP0346, SP0402, SP0453, SP0564, SP0582, SP0589, SP0601, SP0604, SP0617, SP0620, SP0629, SP0648,
  • the inventors demonstrate herein that the pneumococcal antigen SP0785 showed IL-17 response to protein stimulation and protection against pneumococcal colonization, and that SP0785- PdT protected 80% of mice from sepsis infection and SP0785-PdT-Vi protected against Salmonella typhi infection.
  • the inventors also demonstrated that the pneumococcal antigen SP1500 elicited an IL-17 response to protein stimulation and protected against pneumococcal colonization, and also resulted in protection of 50%> of mice from from pneumococcal infection, and that the pneumococcal antigen SP0346 protected 60%> of mice from from pneumococcal infection and sepsis, that the pneumococcal antigens SP1386, SP0084 and SP1479 protected 50%> of mice from from from
  • SP2145 when conjugated to PdT (SP2145-PdT) protected 80%> of mice from sepsis infection and that SP2145-PdT-Vi protected against S.typhi infection. Accordingly, these antigens provide novel compositions for eleciting immune responses with the aim of eleciting beneficial immune responses, e.g., to protect against
  • pneumococcal infections and associated pathogens are pneumococcal infections and associated pathogens. These antigens provide novel targets for characterizing pneumococcal infections and immune responses to pneumococcal infections.
  • an immunogenic composition comprising an isolated pneumococcal antigen selected from a SP0785 polypeptide antigen, a SP1500 polypeptide antigen, a SP0346 polypeptide antigen, a SP1386 polypeptide antigen, a SP0084 polypeptide antigen, a SP1479 polypeptide antigen, a SP2145 polypeptide antigen, and combinations thereof.
  • an isolated pneumococcal antigen selected from a SP0785 polypeptide antigen, a SP1500 polypeptide antigen, a SP0346 polypeptide antigen, a SP1386 polypeptide antigen, a SP0084 polypeptide antigen, a SP1479 polypeptide antigen, a SP2145 polypeptide antigen, and combinations thereof.
  • an immunogenic composition comprises a SP0785 pneumococcal polypeptide antigen.
  • a SP0785 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP0785 polypeptide sequence.
  • a SP0785 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:34.
  • a SP0785 polypeptide antigen comprises an amino acid sequence that is at least 60%> (e.g., at least 65%>, 70%>, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:35.
  • a SP0785 comprises an amino acid sequence that is at least 60%> (e.g., at least 65%>, 70%>, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:35.
  • pneumococcal polypeptide antigen is encoded by SEQ ID NO: 110 or a fragment thereof.
  • functional fragment of a SP0785 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 190 or comprises an amino acid sequence that is at least 60%> (e.g., at least 65%>, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 190.
  • an immunogenic composition comprises a SP1500 pneumococcal polypeptide antigen.
  • a SP1500 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP1500 polypeptide sequence.
  • a SP1500 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:51.
  • a SP1500 polypeptide antigen comprises an amino acid sequence that is at least 60%> (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:51.
  • a SP1500 polypeptide antigen comprises an amino acid sequence that is at least 60%> (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:51.
  • pneumococcal polypeptide antigen is encoded by SEQ ID NO: 127 or a fragment thereof.
  • functional fragment of a SP1500 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 209 or comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:209.
  • an immunogenic composition comprises a SP0346 pneumococcual polypeptide antigen.
  • a SP0346 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP0346 polypeptide sequence.
  • a SP0346 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 15.
  • a SP0346 polypeptide antigen comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 15.
  • a SP0346 comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 15.
  • a SP0346 comprises an amino acid sequence that is at
  • pneumococcal polypeptide antigen is encoded by SEQ ID NO: 91 or a fragment thereof.
  • functional fragment of a SP0346 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 166 or comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 166.
  • an immunogenic composition comprises a SP1386 pneumococcal polypeptide antigen.
  • a SP1386 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP1386 polypeptide sequence.
  • a SP1386 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:46.
  • a SP1386 polypeptide antigen comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:46.
  • a SP1386 comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:46.
  • a SP1386 comprises an amino acid sequence that
  • pneumococcal polypeptide antigen is encoded by SEQ ID NO: 122 or a fragment thereof.
  • functional fragment of a SP1386 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 204 or comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 204.
  • an immunogenic composition comprises a SP0084 pneumococcal polypeptide antigen.
  • a SP0084 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP0084 polypeptide sequence.
  • a SP0084 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:4.
  • a SP0084 polypeptide antigen comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:4.
  • a SP0084 pneumococcal polypeptide antigen is encoded by the sequence shown in SEQ ID NO: 80 or a fragment thereof.
  • functional fragment of a SP0084 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 156 or comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 156.
  • an immunogenic composition comprises a SP1479 pneumococcal polypeptide antigen.
  • a SP1479 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP1479 polypeptide sequence.
  • a SP1479 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:50.
  • a SP1479 polypeptide antigen comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:50.
  • a SP1479 comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:50.
  • pneumococcal polypeptide antigen is encoded by the sequence shown in SEQ ID NO: 126 or a fragment thereof.
  • functional fragment of a SP1479 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 208 or comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 208.
  • an immunogenic composition comprises a SP2145 pneumococcal polypeptide antigen.
  • a SP2145 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of a SP2145 polypeptide sequence.
  • a SP2145 polypeptide antigen comprises at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:70.
  • a SP2145 polypeptide antigen comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:70.
  • a SP2145 comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO:70.
  • a SP2145 e.g.,
  • pneumococcal polypeptide antigen is encoded by the sequence shown in SEQ ID NO: 146 or a fragment thereof.
  • functional fragment of a SP2145 pneumococcal polypeptide antigen comprises amino acids of SEQ ID NO: 70 or comprises an amino acid sequence that is at least 60% (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) identical to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 consecutive amino acids of the sequence shown in SEQ ID NO: 70.
  • an immunogenic composition comprises two or more isolated pneumococcal antigens.
  • the two or more isolated antigens comprise two or more of a polypeptide antigens selected from Table 1.
  • the two or more isolated pneumococcal antigens comprise three or more of a polypeptide antigen selected from Table 1.
  • the two or more isolated pneumococcal antigens comprise four or more of a polypeptide antigen selected from Table 1.
  • the two or more isolated pneumococcal antigens comprise five, six, seven or more of a polypeptide antigen selected from Table 1.
  • the two or more isolated pneumococcal antigens comprise eight polypeptide antigens selected from Table 1.
  • inventive pneumococcal antigens as described herein may be used in conjunction with other pneumococcal antigens such as those known in the art, such as those disclosed in US patent WO/2000/037105, 7,217,791 and 7,585,669, US2006/0121058, US2012/0251577, US2011/0159040, US2012/0189649, and US20110020386 which are incorporated herein in their entirety by reference. Other appropriate S.
  • pneumoniae antigens for combination vaccines include Pneumococcal surface protein A (PspA); derivatives of PspA, Choline-binding protein A (CbpA) and derivatives thereof ; Pneumococcal surface adhesin A (PsaA); caseinolytic protease; sortase A (SrtA); pilus 1 RrgA adhesin; PpmA; PrtA; PavA; LytA; Stk-PR; PcsB; RrgB and derivatives thereof.
  • PspA Pneumococcal surface protein A
  • CbpA Choline-binding protein A
  • PrtA caseinolytic protease
  • SrtA sortase A
  • pilus 1 RrgA adhesin PpmA
  • PrtA PavA
  • LytA LytA
  • Stk-PR Stk-PR
  • PcsB RrgB and derivatives thereof.
  • Derivatives of PspA include proline-rich segments with the non-pro line block (PR+NPB, further described below as well as in Daniels, C. C. et al. (2010) Infection and Immunity 78:2163-72) and related constructs comprising all or a fragment of the proline-rich region of PspA (e.g., regions containing one or more of the sequences PAPAP (SEQ ID NO: 262), PKP, PKEPEQ (SEQ ID NO: 402) and PEKP (SEQ ID NO: 403) and optionally including a non-proline block).
  • non-proline-block has the exemplary sequence EKSADQQAEEDYARRSEEEYNRLTQQQ (SEQ ID NO: 239), which generally has no proline residues in an otherwise proline-rich area of the non-coiled region of PspA.
  • PspA and its derivatives can include genes expressing similar proline-rich structures (i.e. PKP, PKEPEQ (SEQ ID NO: 402) and PEKP (SEQ ID NO: 403)), with or without the NPB.
  • the amino acids at either end of the NPB mark the boundaries of the proline-rich region.
  • the amino-terminal boundary to the PR-region is DLKKAVNE (SEQ ID NO: 240), and the carboxy- terminal boundary is (K/G)TGW(K/G)QENGMW (SEQ ID NO: 241).
  • Peptides containing the NPB are particularly immunogenic, suggesting that the NPB may be an important epitope.
  • Exemplary immunogenic PspA polypeptides and derivatives thereof e.g. with and without the coiled-coil structure are described, e.g., in International Patent Publication WO2013109995; which is incorporated by reference herein in its entirety.
  • Immunogenic PspA polypeptides include both PR and NPB sequences (PR+NPB). Immunogenic PspA polypeptides can include only a PR sequence (PR only) and lack the NPB.
  • an immunogenic composition comprises an isolated pneumococcal polypeptide antigen selected from Table 1. In some embodiments, an immunogenic composition comprises two, three, four, five or more isolated pneumococcal polypeptide antigens selected from Table 1. In some embodiments, a pneumococcal antigen is fused to a heterologous polypeptide (e.g., an epitope tag). In some embodiments, an immunogenic composition comprising a pneumococcal antigen includes a pharmaceutically acceptable excipient.
  • pneumococcal antigens are disclosed in WO/2000/037105, unlike in the present invention, in WO/2000/037105 their ability to induce a Thl7 cell response was not assessed or known. Additionally, pneumococcal antigens are also disclosed in US application 2012/0189649 and US2012/0251577. However unlike the present invention, in the '649 and '577 applications, a whole genome library was used instead of purified proteins to screen for antigens which elicited a Thl7 response, thus high expression levels of the antigens are likely to be required for an immunogenic effect or to elicit a Thl7 response.
  • purified pneumococcal antigen proteins are used, and thus has an advantage of very low background and requires lower expression levels of each pneumococcal antigen to induce an immunogenic effect and elicit a Thl7 response, as demonstrated in the Examples.
  • the pneumococcal antigens as described herein can be prepared using recombinant DNA technology, purified from natural sources, or synthesized chemically.
  • the PdT can differ in amino acid sequence from a naturally occurring S. pneumoniae pneumolysin protein.
  • Nucleic acids encoding truncated and/or mutated forms of a pneumococcal antigen as described herein can be prepared, for example, by polymerase chain reaction (PCR). Nucleic acids encoding such proteins can be chosen for having codons, which are preferred or non-preferred, for a particular expression system. For example, the nucleic acid can be one in which at least one codon, preferably at least 10%, or 20% of the codons have been altered such that the sequence is optimized for expression in E. coli, yeast, human, insect, or CHO cells.
  • PCR polymerase chain reaction
  • Nucleic acids encoding truncated and/or mutated forms of a pneumococcal antigen as described herein can be fused to nucleotide sequences encoding (1) other pneumococcal proteins, such as autolysin, surface protein A, neuraminidase, hyaluronate lysate, choline binding protein A, or (2) non-pneumococcal proteins from organisms such as hemophilus influenza b, meningococcus group A, B, or C, or streptococcus group B.
  • the nucleic acids encoding such fused protein are expressed in the expression systems.
  • Pneumolysin truncates can be useful carriers of polysaccharides, as hosts may lacking preexisting antibodies to such a carrier polypeptide.
  • Pneumolysin is a virulence factor in pneumococcal infections and there is little antigenic variation of the pneumolysin among pneumococci with different subtypes.
  • a pneumococcal antigen as described herein when administered to a mammal such as a human, when fused to a polysaccharide induces immune response that exceeds in magnitude, type, and/or duration the immune response induced by administration to a mammal of only the
  • the pneumococcal antigen component must be of a length sufficient to induce such an enhanced immune response.
  • the fragments are at least 8, 10, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 425, 450, 460, 465, 460, 465, or more amino acids in length.
  • pneumococcal antigens varying in sequence from a naturally occurring S.
  • the polypeptide can be at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%), 95%), 98%) or more identical to a naturally occurring S. pneumococcal antigens as described herein in Table 1.
  • the polysaccharide component which can be conjugated to one or more of a pneumococcal antigen as described herein can be any S. pneumoniae capsular polysaccharide, including but not limited to, any of subtypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 19A, 20, 22F, 23A, 23F, 24F, 27, 33F, or 34.
  • the capsular polysaccharide is selected from subtypes 4, 6B, 9V, 14, 18C, 19F, or 23F.
  • the polysaccharide is serotype 14.
  • the polysaccharide is serotype 18C.
  • One or more of different capsular polysaccharides can be conjugated to a single polypeptide or a plurality of polypeptides.
  • a multivalent conjugate can include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different capsular polysaccharides.
  • Polysaccharides can be conjugated to polypeptides, for example, via a monomelic linkage (only one end of the polysaccharide is attached to the polypeptide), a looped linkage (a single polypeptide is attached to looped polysaccharides), or cross-linked (multiple polysaccharides attached to multiple polypeptides).
  • polypeptides e.g., a pneumococcal antigen as described herein
  • Methods for the purification of polypeptides can be performed by one of ordinary skill in the art, and polypeptide or polysaccharide purification and conjugation processes are described in, e.g., U.S. Pat. Nos. 4,242,501 ; 4,686,102; 5,623,057; and 5,565,204, which are incorporated herein in its entirety by reference.
  • the immunogenic compositions described herein can be administered to a mammal to elicit an immune response (a prophylactic and/or therapeutic immune response) against S. pneumoniae in the mammal.
  • a pharmaceutical composition containing a pneumococcal antigen, alone or as a conjugate can be delivered in a pharmaceutically acceptable carrier, buffer, or preservative which is suitable for a vaccine including, but not limited to, physiological saline or other injectable liquids.
  • Additives customary in vaccines may also be present, for example stabilizers such as lactose or sorbitol, and adjuvants to enhance the immunogenic response such as aluminum phosphate, hydroxide, or sulphate and stearyl tyrosine.
  • the vaccine produced may also be used as components of multivalent vaccines which elicit an immune response against a plurality of infectious agents.
  • compositions can be administered in any manner known in the art, e.g., orally intramuscularly, intravenously, intraarterially, intrathecally, intradermally, intraperitoneally, intranasally, intrapulmonarily, intraocularly, intravaginally, intrarectally or subcutaneously. They can be introduced into the gastrointestinal tract or the respiratory tract, e.g., by inhalation of a solution or powder containing the conjugates. In some embodiments, the compositions can be administered via a skin patch.
  • a pharmaceutical composition e.g., a vaccine
  • a pharmaceutical composition is administered in an amount sufficient to elicit production of antibodies as part of an immunogenic response.
  • Dosage for any given patient depends upon many factors, including the patient's size, general health, sex, body surface area, age, the particular compound to be administered, time and route of administration, and other drugs being administered concurrently. Determination of optimal dosage is well within the abilities of a pharmacologist of ordinary skill.
  • the ability of a composition to elicit an immune response in a host mammal can be assayed by using methods for measuring immune responses that are well known in the art.
  • the generation of cytotoxic T cells can be demonstrated in a standard 51 Cr release assay, by measuring intracellular cytokine expression or secretion, or by using major histocompatibility complex (MHC) tetramers.
  • Standard assays such as enzyme-linked immunosorbent assay (ELISA) or enzyme-linked immunospot (ELISPOT), can be used to measure cytokine profiles attributable to T cell activation.
  • T cell proliferation can be measured using assays such as 3 H-thymidine uptake and other assays known in the art.
  • B cell responses can be measured using art recognized assays such as ELISA.
  • Other methodologies can also be used to evaluate the effects of the conjugates on pathogen-associated lesions or on other pathogen levels generally (e.g., pneumococci clearance in challenged mice treated with the conjugate).
  • composition described herein can be used in the manufacture of a medicament for the prevention or treatment of an infection with S. pneumoniae or conditions associated with such infection.
  • an immunogenic composition comprising a pneumococcal antigen includes an adjuvant.
  • an immunogenic composition includes a mineral- containing adjuvant.
  • the mineral-containing adjuvant includes aluminum hydroxide.
  • an immunogenic composition includes an adjuvant comprising an immunomodulatory oligonucleotide.
  • an immunogenic composition includes IC31TM adjuvant (Intercell AG).
  • an immunogenic composition includes an adjuvant comprising a toxin.
  • an immunogenic composition includes an adjuvant comprising an endotoxin.
  • an immunogenic composition includes an adjuvant comprising a muramyl dipeptide.
  • an immunogenic composition includes an adjuvant comprising an oil emulsion. In some embodiments, an immunogenic composition includes an adjuvant comprising a saponin. In some embodiments, an immunogenic composition includes an adjuvant comprising an immune stimulating complex (ISCOM). In some embodiments, an immunogenic composition includes an adjuvant comprising a nonionic block copolymer. In some embodiments, an immunogenic composition includes virus-like particles (VLPs), for example, a cholera toxin. In some embodiments, an immunogenic composition includes replicons. In some embodiments, an immunogenic composition includes an adjuvant comprising liposomes. In some embodiments, an immunogenic composition includes an adjuvant comprising microparticles.
  • VLPs virus-like particles
  • an immunogenic composition includes an adjuvant comprising liposomes. In some embodiments, an immunogenic composition includes an adjuvant comprising microparticles.
  • an immunogenic composition includes an adjuvant comprising biodegradable microspheres. In some embodiments, an immunogenic composition includes an adjuvant comprising a cytokine. In some embodiments, an immunogenic composition includes an adjuvant comprising a lipopeptide.
  • Immunogenic compositions may contain adjuvants.
  • cholera toxin CT
  • CT cholera toxin
  • Alum is an affective adjuvant for subcutaneous injection.
  • Adjuvants are typically a heterogeneous group of substances that enhance the immunological response against an antigen that is administered simultaneously. In some instances, adjuvants are added to a vaccine to improve the immune response so that less vaccine is needed. Adjuvants serve to bring the antigen— the substance that stimulates the specific protective immune response— into contact with the immune system and influence the type of immunity produced, as well as the quality of the immune response (magnitude or duration). Adjuvants can also decrease the toxicity of certain antigens and provide solubility to some vaccine components. Almost all adjuvants used today for enhancement of the immune response against antigens are particles or form particles together with the antigen.
  • Adjuvants for vaccines are well known in the art. Suitable additional adjuvants include, but are not limited to: complete Freund's adjuvant (CFA), incomplete Freund's adjuvant (IF A), saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyaninons, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Selection of an adjuvant depends on the animal subject to be vaccinated.
  • CFA complete Freund's adjuvant
  • IF A incomplete Freund's adjuvant
  • saponin mineral gels such as aluminum hydroxide
  • surface active substances such as lysolecithin, pluronic polyols, polyaninons, peptides, oil or hydrocarbon emulsions, keyhole
  • Additional examples include, but are not limited to, monoglycerides and fatty acids( e. g. a mixture of mono-olein, oleic acid, and soybean oil); mineral salts, e.g., aluminium hydroxide and aluminium or calcium phosphate gels; oil emulsions and surfactant based formulations, e.g., MF59 (microfluidised detergent stabilized oil-in- water emulsion), QS21 (purified saponin), AS02 [SBAS2] (oil-in-water emulsion + MPL + QS-21), Montanide ISA-51 and ISA-720 (stabilized water-in-oil emulsion);
  • monoglycerides and fatty acids e. g. a mixture of mono-olein, oleic acid, and soybean oil
  • mineral salts e.g., aluminium hydroxide and aluminium or calcium phosphate gels
  • particulate adjuvants e.g., virosomes (unilamellar liposomal vehicles incorporating influenza haemagglutinin), AS04 ([SBAS4] Al salt with MPL), ISCOMS (structured complex of saponins and lipids), polylactide co-glycolide (PLG); microbial derivatives (natural and synthetic), e.g., monophosphoryl lipid A (MPL), Detox (MPL + M.
  • virosomes unilamellar liposomal vehicles incorporating influenza haemagglutinin
  • AS04 [SBAS4] Al salt with MPL
  • ISCOMS structured complex of saponins and lipids
  • PLG polylactide co-glycolide
  • microbial derivatives naturally and synthetic
  • MPL + M monophosphoryl lipid A
  • MPL + M monophosphoryl lipid A
  • Phlei cell wall skeleton Phlei cell wall skeleton
  • AGP [RC-529] (synthetic acylated monosaccharide), DC Chol (lipoidal immunostimulators able to self organize into liposomes), OM-174 (lipid A derivative), CpG motifs (synthetic oligonucleotides containing immunostimulatory CpG motifs), modified LT and CT (genetically modified bacterial toxins to provide non-toxic adjuvant effects); endogenous human immunomodulators, e.g., hGM-CSF or hlL- 12 (cytokines that can be administered either as protein or plasmid encoded), Immudaptin (C3d tandem array) and inert vehicles, such as gold particles. Newer adjuvants are described in United States Patent No. 6,890,540, United States Patent Application No. 2005/0244420, and
  • the adjuvant can also be selected from the group consisting of QS- 21, Detox- PC, MPL-SE, MoGM-CSF, TiterMax-G, CRL-1005, GERBU, TERamide, PSC97B, Adjumer, PG- 026, GSK-I, GcMAF, B-alethine, MPC-026, Adjuvax, CpG ODN, Betafectin, Alum, and MF59.
  • alternative adjuvants can be used, such as a pharmaceutically acceptable adjuvant.
  • oils or hydrocarbon emulsion adjuvants should not be used for human vaccination.
  • an adjuvant suitable for use with humans is alum (alumina gel). Details of common adjuvants which are contemplated to be added to the vaccine comprising an antigen as disclosed in Table 1 include those discussed below:
  • CFA Complete Freund's Adjuvant
  • a mineral oil adjuvant uses a water-in-oil emulsion which is primarily oil.
  • the adjuvant of choice was complete Freund's adjuvant.
  • This adjuvant while potent immunogenically, also has had a significant history of frequently producing abscesses, granulomas and tissue sloughs. It contains paraffin oil, killed mycobacteria and mannide monoosleate. The paraffin oil is not metabolized; it is either expressed through the skin (via a granuloma or abscess) or phagocytized by macrophages. Multiple exposures to CFA will cause severe hypersensitivity reactions. Accidental exposure of personnel to CFA can result in sensitization to tuberculin.
  • Incomplete Freund's Adjuvant (IF A): Also a mineral oil adjuvant. Composition similar to CFA but does not contain the killed mycobacteria so does not produce as severe reactions. Used for the booster immunizations following the initial injection with antigen-CFA. IFA can be used for initial injection if the antigen is strongly immunogenic.
  • Montanide ISA Incomplete Seppic Adjuvant: A mineral oil adjuvant. Uses mannide oleate as the major surfactant component. The antibody response is generally similar to that with IFA. Montanide ISA may have a lessened inflammatory response.
  • Ribi Adjuvant System An oil-in-water emulsion that contains detoxified endotoxin and mycobacterial cell wall components in 2% squalene. Multiple formulations are commercially available, dependent on use. Is an alternative to CFA. Lower viscosity than CFA. Results (titers) often comparable to those with CFA. The squalene oil is metabolizable. RAS has a lower incidence of toxic reactions.
  • TiterMax Another water-in-oil emulsion, this preparation combines a synthetic adjuvant and microparticulate silica with the metabolizable oil squalene. The copolymer is the immunomodulator component. Antigen is bound to the copolymer and presented to the immune cells in a highly concentrated form. Less toxicity than CFA. TiterMax usually produces the same results as CFA.
  • Syntex Adjuvant Formulation A preformed oil-in-water emulsion. Uses a block copolymer for a surfactant. A muramyl dipeptide derivative is the immunostimulatory component. All in squalene, a metabolizable oil. SAF can bias the humoral response to IgG2a in the mouse, but is less toxic than CFA.
  • Aluminum Salt Adjuvants Most frequently used as adjuvants for vaccine antigen delivery. Generally weaker adjuvants than emulsion adjuvants. Aluminum Salt Adjuvants are best used with strongly immunogenic antigens, but result generally in mild inflammatory reactions.
  • Nitrocellulose-adsorbed antigen The nitrocellulose is basically inert, leading to almost no inflammatory response. Slow degradation of nitrocellulose paper allows prolonged release of antigen. Does not produce as dramatic an antibody response as CFA. Nitrocellulose-adsorbed antigen is good for use if only a small amount of antigen can be recovered from a gel band, e.g., for animal immunization.
  • Encapsulated or entrapped antigens Permits prolonged release of antigen over time; can also have immunostimulators in preparation for prolonged release. Preparation of encapsulated or entrapped antigens is complex.
  • ISCOMs Immune-stimulating complexes
  • Stable structures are formed which rapidly migrate to draining lymph nodes. Both cell-mediated and humoral immune responses are achieved. Low toxicity; ISCOMs can elicit significant antibody response.
  • Quil A is one example, QS-21 is another.
  • GerbuR adjuvant An aqueous phase adjuvant which uses immunostimulators in combination with zinc proline. GerbuR does not have a depot effect and has minimal inflammatory effect. GerbuR requires frequent boosting to maintain high titers.
  • GM-CSF is administered to the patient before the initial immune administration.
  • GM-CSF can be administered using a viral vector or an isolated protein in a pharmaceutical formulation.
  • Combinations of adjuvants can be used such as CM-CSF, ICAM and LFA. While a strong immune response is typically generated to infectious disease antigens, tumor associated antigens typically generate a weaker immune response.
  • immune stimulators such as described above are preferably used with them.
  • a pneumococcal vaccine can contain several pneumococcal antigens and/or be formulated with different or novel adjuvants, or incorporated in vaccine scaffolds, such as a fusion-conjugate (e.g., a fusion with a pneumolysoid and conjugation to a polysaccharide as proposed in Lu et al, Infection and Immunity, 2009), or using a scaffold, as disclosed in PCT/US12/37412 and WO 2012/155007 (which are incorporated herein in their entirety by reference) to improve immunogenicity and facilitate different routes of administration.
  • a fusion-conjugate e.g., a fusion with a pneumolysoid and conjugation to a polysaccharide as proposed in Lu et al, Infection and Immunity, 2009
  • a scaffold as disclosed in PCT/US12/37412 and WO 2012/155007 (which are incorporated herein in their entirety by reference) to improve immunogenicity and facilitate different routes of
  • composition comprising at least 2, or at least about 3, or at least about 4, or at least about 5, or at least about 6, or at least about 7, or at least about 8, or at least about 9, or at least about 10, or at least about 12, or at least about 14, or at least about 16, or at least about 18, or at least about 20, or at least about 25, or any integer between about 2 and about 26 different antigens or more that 25 different antigens can be used, alone or in combination with an adjuvant and/or vaccine scaffold, such as a polysaccharide can be used.
  • an adjuvant and/or vaccine scaffold such as a polysaccharide
  • the invention provides methods for eliciting an immune response against pneumococcus in a mammal.
  • the methods include, for example, administering to the mammal an immunogenic composition comprising an isolated pneumococcal polypeptide antigen selected from Table 1 or fragments and combinations thereof, e.g., an immunogenic composition described herein.
  • a method elicits an immune response against pneumococcus.
  • a method elicits a T cell response to a pneumococcal antigen (e.g., a CD4+ T cell mediated immune response and/or a CD8+ T cell mediated immune response).
  • a method elicits a Thl T cell response.
  • a method elicits a Thl7 T cell response.
  • a method elicits IFN- ⁇ secretion by antigen-specific T cells.
  • a method elicits an antibody response (e.g., an IgG response, and/or an IgA response).
  • a method elicits a cytotoxic T cell (CTL) response. In some embodiments, a method elicits a B cell-mediated immune response. In some embodiments, a method elicits both a T cell- and a B cell-mediated response. In some embodiments, a method elicits an innate immune response.
  • CTL cytotoxic T cell
  • B cell-mediated immune response In some embodiments, a method elicits both a T cell- and a B cell-mediated response. In some embodiments, a method elicits an innate immune response.
  • a method reduces the incidence of pneumococcal infection in subjects administered the composition. In some embodiments, a method reduces the likelihood of lower tract infection by a pneumococcus. In some embodiments, a method reduces the likelihood of upper tract infection by a pneumococcal organism. In some embodiments, a method reduces the likelihood of chronic infection by a pneumococcal organism. In some embodiments, a method reduces the likelihood of suffering from pelvic inflammatory disease due to a pneumococcal infection. In some embodiments, a method reduces the likelihood of infertility subsequent to a pneumococcal infection.
  • an immunogenic composition is administered to the mammal at least two times (e.g., two, three, four, or five times).
  • an immunogenic composition administered after a first administration differs from the composition administered initially, e.g., the composition includes a different pneumococcal antigen or a different subset of pneumococcal antigens, or a different pneumococcal antigen substance (polypeptide or nucleic acid encoding same), or a different dose of antigen, or a different adjuvant, or a different dose of adjuvant.
  • a boost is administered by a different route than a previous administration.
  • the mammal is at risk for infection with pneumococcus. In some embodiments, the mammal is infected with a pneumococcal infection. In some embodiments, the mammal is a human.
  • an immunogenic composition administered in a method comprises an adjuvant.
  • an adjuvant is a mineral-containing adjuvant.
  • an immunogenic composition administered in a method comprises a pharmaceutically acceptable excipient.
  • a pneumococcal antigen composition includes an adjuvant.
  • the adjuvant includes mineral-containing adjuvant.
  • Mineral-containing adjuvants can be formulated as gels, in crystalline form, in amorphous form, as particles, etc.
  • Mineral-containing adjuvants include, for example, aluminum salts and/or calcium salts (e.g., aluminum hydroxide, aluminum phosphate, aluminum sulfate, calcium phosphate, etc.).
  • a pneumococcal antigen composition includes aluminum hydroxide.
  • Alhydrogel.TM. is an example of an aluminum hydroxide gel adjuvant.
  • an adjuvant includes an immunomodulatory oligonucleotide.
  • an immunomodulatory oligonucleotide sequence includes CpG (unmethylated cytosine-guanosine) motifs.
  • Oligonucleotides having CpG motifs can include nucleotide analogs and/or non-naturally occurring internucleoside linkages (e.g., phosphorothioate linkages).
  • CpG motifs see Kandimalla, et al., Nuc. Acids Res. 31(9): 2393-2400, 2003; WO02/26757; W099/62923; Krieg, Nat. Med. 9(7): 831-835, 2003;
  • an adjuvant comprises IC.sub.31.TM. (Intercell AG).
  • IC31.TM. is a synthetic adjuvant that includes an antimicrobial peptide, KLK, and an immunostimulatory oligonucleotide, ODNla, and acts as a Toll-like Receptor 9 (TLR9) agonist.
  • an adjuvant includes a toxin.
  • a toxin is a bacterial ADP-ribosylating toxin, e.g., cholera toxin (CT), E. coli heat labile toxin, or pertussis toxin.
  • CT cholera toxin
  • E. coli heat labile toxin
  • pertussis toxin or pertussis toxin.
  • the bacterial toxin is a detoxified form of an ADP-ribosylating toxin (see, e.g., Beignon, et al., Inf. Immun.
  • an adjuvant includes an endotoxin such as monophosphoryl lipid A or 3-De-O-acylated monophosphoryl lipid A (see U.S. Pat. No.
  • an adjuvant includes a muramyl dipeptide (e.g., N-acetyl-muramyl-L- threonyl-D-isoglutamine(thr-MDP), N-acetyl-normuramyl-1 -alanyl-d-isoglutamine(nor-MDP), and N-acetylmuramyl- 1 -alanyl-d-isoglutaminyl- 1 -alanine-2-( 1 '-2'-dipalmitoyl-s- -n-glycero-3 - hydroxyphosphoryloxy)-ethylamine MTP-PE).
  • a muramyl dipeptide e.g., N-acetyl-muramyl-L- threonyl-D-isoglutamine(thr-MDP), N-acetyl-normuramyl-1 -alanyl-d-isoglutamine(nor-M
  • an adjuvant includes an oil emulsion and/or emulsifier-based adjuvant.
  • an oil emulsion adjuvant includes a Freund's Adjuvant (e.g., Complete Freund's adjuvant (CFA), or incomplete Freund's adjuvant (IF A)).
  • an oil-emulsion adjuvant includes a squalene water emulsion, such as MF59 (Novartis; see, e.g., WO9014837), or a Synex adjuvant formulation (SAF)).
  • an oil emulsion includes a dispersing agent, e.g., a mono- or di-C.sub.12-C.
  • sub.24-fatty acid ester of sorbitan or mannide e.g., sorbitan mono-stearate, sorbitan mon-oleate, or mannide mono-oleate.
  • oil emulsions that include squalene and dispersing agents includes ArlacelTM,
  • MontanideTM ISA-720 MontanideTM ISA-703.
  • Other oil emulsions are described, e.g., in WO 95/17210 and EP 0399842.
  • an adjuvant includes a saponin.
  • Saponins are steroid and/or triterpenoid glycosides derived from plants such as Quillaja saponaria, Saponaria officianalis, Smilax ornata, and Gypsophilla paniculata.
  • Fractions of saponin-containing extracts that have been described and that can be used as adjuvants for pneumococcal antigens include Quil.TM.A, QS21, QS7, QS17, QS18, QH-A, QH-B, QH-C, and QuilA (see, e.g., U.S. Pat. No. 5,057,540).
  • QS21 is used as an adjuvant.
  • an adjuvant includes an immune stimulating complex (ISCOM).
  • ISCOMs are particles that typically include a glycoside (e.g., a saponin) and a lipid.
  • an ISCOM includes a saponin and a cholesterol.
  • an ISCOM includes a saponin, a cholesterol, and a phospholipid (e.g., phosphatidylcholine and/or
  • an ISCOM includes a nonionic block copolymer.
  • ISCOMs can include additional adjuvants, e.g., additional adjuvant substances described herein (see, e.g., WO 05/002620).
  • an ISCOM includes a substance that targets it to a mucosal membrane (see, e.g., WO97/030728).
  • Other ISCOM compositions and preparation of the compositions suitable for combination with pneumococcal antigens provided herein are described, e.g., in U.S. Pat. Pub. No.
  • an adjuvant comprises an AblSCO® adjuvant (e.g., Matrix-MTM, Isconova). In some embodiments, an adjuvant comprises AbISCO®-100. In some embodiments, an adjuvant comprises AbISCO®-300.
  • AblSCO® adjuvant e.g., Matrix-MTM, Isconova.
  • an adjuvant comprises AbISCO®-100. In some embodiments, an adjuvant comprises AbISCO®-300.
  • an adjuvant includes a nonionic block copolymer.
  • Nonionic block copolymers typicaly include two chains of hydrophobic polyoxyethylenes of various lengths combined with a block of hydrophobic polyoxypropylene.
  • a nonionic block copolymer is formulated in an oil-in-water emulsion (e.g., with oil and squalene).
  • an adjuvant includes virus like particles (VLPs). VLPs are non replicating, non infectious particles that typically include one or more viral proteins, optionally formulated with an additional component such as a phospholipid.
  • a VLP includes proteins from one or more of the following: an influenza virus (e.g., a hemaglutinin (HA) or neuraminidase (NA) polyptide), Hepatitis B virus (e.g., a core or capsid polypeptide), Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth Disease virus, Retrovirus, Norwalk virus, human papilloma virus, HIV, RNA-phages, Q13-phage (e.g., a coat protein), GA-phage, fr- phage, AP205 phage, a Ty (e.g., retrotransposon Ty protein pi). See, e.g., WO03/024480,
  • influenza virus e.g., a hemaglutinin (HA) or neuraminidase (NA) polyptide
  • Hepatitis B virus e.g., a core or capsid poly
  • an adjuvant includes replicons.
  • Replicons resemble VLPs in that they are noninfectious particles including viral proteins, and further include a nucleic acid encoding a polypeptide (e.g., an antigen).
  • a replicon includes proteins from an alphavirus.
  • Alphaviruses include, e.g., Eastern Equine Encephalitis Virus (EEE), Venezuelan Equine Encephalitis Virus (VEE), Everglades Virus, Mucambo Virus, Pixuna Virus, Western Equine Encephalitis Virus (WEE), Sindbis Virus, Semliki Forest Virus, Middleburg Virus, Chikungunya Virus, O'nyong-nyong Virus, Ross River Virus, Barmah Forest Virus, Getah Virus, Sagiyama Virus, Bebaru Virus, Mayaro Virus, Una Virus, Aura Virus, Whataroa Virus, Babanki Virus, Kyzylagach Virus, Highlands J Virus, Fort Morgan Virus, Ndumu Virus, and Buggy Creek Virus.
  • EEE Eastern Equine Encephalitis Virus
  • VEE Venezuelan Equine Encephalitis Virus
  • Everglades Virus Mucambo Virus
  • Pixuna Virus Pixuna Virus
  • an adjuvant includes a replicon that includes a nucleic acid encoding one or more pneumococcal antigens described herein.
  • an adjuvant includes a replicon that encodes a cytokine (e.g., interleukin-12 (IL-12), IL-23, or granulocyte -macrophage colony-stimulating factor (GM-CSF)).
  • IL-12 interleukin-12
  • GM-CSF granulocyte -macrophage colony-stimulating factor
  • a VLP or replicon adjuvant includes one or more pneumococcal antigens (i.e., VLP or replicon particles include a pneumococcal antigen as part of the particles). In some embodiments, a VLP or replicon adjuvant is co-administered with a pneumococcal antigen polypeptide.
  • an adjuvant includes liposomes, which are are artificially-constructed spherical lipid vesicles (see, e.g., U.S. Pat. Nos. 4,053,585; 6,090,406; and 5,916,588).
  • a lipid to be used in liposomes can be, but is not limited to, one or a plurality of the following: phosphatidylcholine, lipid A, cholesterol, dolichol, sphingosine, sphingomyelin, ceramide, glycosylceramide, cerebroside, sulfatide, phytosphingosine, phosphatidyl-ethanolamine,
  • an adjuvant includes a liposome and a ligand for a Toll-like Receptor (TLR; see, e.g., WO/2005/013891, WO/2005/079511, WO/2005/079506, and
  • an adjuvant includes JVRS-100.
  • JVRS-100 comprises cationic liposomes combined with non-coding oligonucleotides or plasmids.
  • an adjuvant includes microparticles comprised of a polymer, e.g., a polymer of acrylic or methacrylic acid, polyphosphazenes, polycarbonates, polylactic acid, polyglycolic acid, copolymers of lactic acid or glycolic acid, polyhydroxybutyric acid, polyorthoesters, polyanhydrides, polysiloxanes, polycaprolactone, or a copolymer prepared from the monomers of these polymers.
  • a polymer e.g., a polymer of acrylic or methacrylic acid, polyphosphazenes, polycarbonates, polylactic acid, polyglycolic acid, copolymers of lactic acid or glycolic acid, polyhydroxybutyric acid, polyorthoesters, polyanhydrides, polysiloxanes, polycaprolactone, or a copolymer prepared from the monomers of these polymers.
  • an adjuvant includes microparticles comprised of a polymer selected from the group consisting of polyvinylpyrrolidone, polyvinylalcohol, polyhydroxyethylmethacrylate, polyacrylamide, polymethacrylamide, and polyethyleneglycol (see, e.g., U.S. Pat. No. 5,500,161).
  • an adjuvant includes biodegradable microspheres (e.g., microspheres comprised of poly(D,L-lactic acid), poly(D,L-glycolic acid), poly(.epsilon.-capro lactone), polye
  • an adjuvant includes a cytokine. In some embodiments, an adjuvant includes IL-12. In some embodiments, an adjuvant includes IL-23. In some embodiments, an adjuvant includes GM-CSF. In some embodiments, an adjuvant includes a lipopeptide. In some embodiments, an adjuvant includes a Pam-3-Cys lipopeptide. In some embodiments, an adjuvant including a lipopeptide activates Toll-like receptors (TLRs).
  • TLRs Toll-like receptors
  • a vaccine formulation or immunogenic composition may include one or more additional components.
  • the vaccine formulation or immunogenic composition may include one or more stabilizers such as sugars (such as sucrose, glucose, or fructose), phosphate (such as sodium phosphate dibasic, potassium phosphate monobasic, dibasic potassium phosphate, or monosodium phosphate), glutamate (such as monosodium L-glutamate), gelatin (such as processed gelatin, hydrolyzed gelatin, or porcine gelatin), amino acids (such as arginine, asparagine, histidine, L-histidine, alanine, valine, leucine, isoleucine, serine, threonine, lysine, phenylalanine, tyrosine, and the alkyl esters thereof), inosine, or sodium borate.
  • stabilizers such as sugars (such as sucrose, glucose, or fructose), phosphate (such as sodium phosphate dibasic, potassium phosphate monobasic, dibasic potassium phosphate, or mono
  • the vaccine formulation or immunogenic composition includes one or more buffers such as a mixture of sodium bicarbonate and ascorbic acid.
  • the vaccine formulation may be administered in saline, such as phosphate buffered saline (PBS), or distilled water.
  • PBS phosphate buffered saline
  • the vaccine formulation or immunogenic composition includes one or more surfactants such as polysorbate 80 (Tween 80), Triton X-100, Polyethylene glycol tert- octylphenyl ether t-Octylphenoxypolyethoxyethanol 4-( 1 , 1 ,3 ,3 -Tetramethylbutyl)phenyl-poly ethylene glycol (TRITON X-100); Polyoxyethylenesorbitan monolaurate Polyethylene glycol sorbitan monolaurate (TWEEN 20); and 4-(l,l,3,3-Tetramethylbutyl)phenol polymer with formaldehyde and oxirane (TYLOXAPOL).
  • a surfactant can be ionic or nonionic.
  • the vaccine formulation or immunogenic composition includes one or more salts such as sodium chloride, ammonium chloride, calcium chloride, or potassium chloride.
  • a preservative is included in the vaccine or immunogenic composition. In other embodiments, no preservative is used. A preservative is most often used in multi-dose vaccine vials, and is less often needed in single-dose vaccine vials.
  • the preservative is 2-phenoxyethanol, methyl and propyl parabens, benzyl alcohol, and/or sorbic acid.
  • the vaccine formulation or immunogenic composition is a controlled release formulation.
  • the vaccine can comprise at least one immunogen of the sequences listed in Table 1 , or an immunogen which is a functional fragment or has substantial identity to an immunogen listed in Table 1.
  • S. pneumoniae antigens as disclosed herein for combination vaccines include conjugated S. pneumoniae polysaccharides.
  • the conjugated polysaccharides may be, for example, as described in U.S. Pat. No. 5,623,057, U.S. Pat. No. 5,371,197, or
  • the pneumococcal antigens described herein may be used with or without modification.
  • a pneumococcal antigen may be modified to elicit the desired immune response.
  • a pneumococcal antigen is conjugated to an appropriate immunogenic carrier such as tetanus toxin, pneumolysin, keyhole limpet hemocyanin, or the like.
  • one or more pneumococcal antigen is present in a scaffold, such as a fusion-conjugate (e.g., a fusion with a pneumolysoid and conjugation to a polysaccharide as proposed in Lu et al, Infection and Immunity, 2009), or using a scaffold, as disclosed in PCT/US 12/37412, WO 2012/155007 and US2011/0206716, which are incorporated herein in its entirety by reference.
  • a fusion-conjugate e.g., a fusion with a pneumolysoid and conjugation to a polysaccharide as proposed in Lu et al, Infection and Immunity, 2009
  • a scaffold such as disclosed in PCT/US 12/37412, WO 2012/155007 and US2011/0206716, which are incorporated herein in its entirety by reference.
  • a pneumococcal polypeptide antigen is fused to PdT.
  • PdT represents a nonhemolytic variant of pneumolysin, or a nonhemolytic variant of pneumolysin (PdT) (W433F, D385N, and C428G).
  • a pneumococcal polypeptide antigen can exist as a conjugate to provide for a synergistic immunogenic reaction to an antigenic sugar moiety.
  • the Vi polysaccharide of Salmonella typhi could be used.
  • Vi capsular polysaccharide has been developed against bacterial enteric infections, such as typhoid fever (Robbins et al., 150(3) J. Infect. Dis. 436-49 (1984); Levine et al., 7 Baillieres Clin. Gastroenterol. 501-17 (1993)).
  • Vi is a polymer of a-l ⁇ 4- galacturonic acid with an N acetyl at position C-2 and variable O-acetylation at C-3.
  • the virulence of S. typhi correlates with the expression of this molecule (Sharma et al., 101 P.N.A.S. USA 17492-97 (2004)).
  • the Vi polysaccharide vaccine ofS. typhi has several advantages: Side effects are infrequent and mild, a single dose yields consistent immunogenicity and efficacy. Vi polysaccharide may be reliably standardized by physicochemical methods verified for other polysaccharide vaccines, Vi is stable at room temperature and it may be administered simultaneously with other vaccines without affecting immunogenicity and tolerability (Azze et al, 21 Vaccine 2758-60 (2003)).
  • the Vi polysaccharide of Salmonella typhi may be conjugated to a fusion protein of a pneumococcal polypeptide antigen, where the pneumococcal polypeptide antigen is fused to PdT or another protein, such that the resulting vaccine confers immunity against one pathogen, or two different pathogens: where the pneumococcal polypeptide antigen confers protection against pneumococcus, a Vi-pneumococcal antigen:PdT construct raises an immunogenic response against S. typhi and pneumococcus.
  • Other examples include combining sugars from encapsulated bacteria (such as meningococcus, S. aureus, pneumococcus, etc.) and tuberculous protein, to provide a vaccine that protects against two different pathogens.
  • PS polysaccharide
  • CWPS pneumococcal cell wall polysaccharide
  • carbohydrate antigens of cancers include carbohydrate antigens of cancers.
  • the Tn antigen an oligosaccharide expressed exclusively by cancer cells (Buskus et al., 44 Angew Chem. Int'l Ed. 5985-88 (2005)).
  • the present invention provides for an immunogenic composition comprising a fusion protein of a truncated pneumococcal antigen and a nonhemolytic pneumolysin PdT protein, conjugated with CWPS.
  • the polysaccharide has a molecular mass of ⁇ 500 kDa. In another aspect of the invention, the PS has a molecular mass of ⁇ 70 kDa.
  • a pneumococcal antigen as disclosed herein is present in an immunogenic multiple antigen presenting system (MAPS) as disclosed in WO 2012/155007, which is incorporated herein in its entirety by reference, where the pneumococcal antigen as disclosed herein in present in an immunogenic complex comprising at least one type of polymer, e.g., a polysaccharide, that can, optionally, be antigenic; at least one pneumococcal antigen as disclosed herein; and at least one complementary affinity-molecule pair comprising (i) a first affinity molecule that associates with the polymer, and (ii) a complementary affinity molecule that associates with the protein or peptide; such that the first and complementary affinity molecules serve as an indirect link between the polymer with the antigenic protein or peptide.
  • MAPS immunogenic multiple antigen presenting system
  • the polymer can attach at least 1, or at least 2, or a plurality of the same or different protein or peptide antigens.
  • the polymer is antigenic, e.g., the polymer is a pneumococcal capsular polysaccharide.
  • the pneumococcal antigens are recombinant pneumococcal antigens.
  • one aspect of the present invention relates to an immunogenic composition
  • an immunogenic composition comprising a polymer, at least one pneumococcal antigen , and at least one complementary affinity-molecule pair, where the complementary affinity-molecule pair comprises a first affinity molecule that associates with the polymer and a complementary affinity molecule that associates with the pneumococcal antigen , so that when the first affinity molecule associates with the complementary affinity molecule, it indirectly links the antigen to the polymer .
  • a first affinity molecule in a immunogenic complex is cross-linked to the polymer with a cross-linking reagent, for example, a cross-linking reagent selected from CDAP(l-cyano-4-dimethylaminopyridinium tetrafluoroborate), EDC (l-Ethyl-3-[3- dimethylaminopropyl] carbodiimide hydrochloride), sodium cyanoborohydride; cyanogen bromide; or ammonium bicarbonate/iodoacetic acid.
  • a cross-linking reagent selected from CDAP(l-cyano-4-dimethylaminopyridinium tetrafluoroborate), EDC (l-Ethyl-3-[3- dimethylaminopropyl] carbodiimide hydrochloride), sodium cyanoborohydride; cyanogen bromide; or ammonium bicarbonate/iodoacetic acid.
  • the first affinity molecule is cross- linked to carboxyl, hydroxyl, amino, phenoxyl, hemiacetal, and mecapto functional groups of the polymer. In some embodiments, the first affinity molecule is covalently bonded to the polymer. In some embodiments, the first affinity molecule is biotin or a derivative thereof, or a molecule with similar structure or physical property as biotin, for example, an amine-PEG3 -biotin ((+)-biotinylation- 3-6,9-trixaundecanediamine) or derivative thereof.
  • a pneumococcal antigen of the immunogenic complex is a fusion protein comprising a pneumococcal antigenic protein or peptide fused to the complementary affinity- binding molecule.
  • the fusion can be a genetic construct, i.e., a recombinant fusion peptide or protein.
  • a pneumococcal antigen can be covalently attached as a fusion protein to the complementary affinity molecule.
  • the antigen is non-covalently attached to the complementary affinity molecule.
  • a complementary affinity molecule in an immunogenic complex is a biotin-binding protein or a derivative or a functional portion thereof.
  • a complementary affinity molecule is an avidin-like protein or a derivative or a functional portion thereof, for example but not limited to, rhizavidin or a derivative thereof.
  • a complementary affinity molecule is avidin or streptavidin or a derivative or a functional portion thereof.
  • a polymer of the immunogenic complex is branched chain polymer, e.g., a branched polysaccharide, or alternatively, can be a straight chain polymer, e.g., a single chain polymer, e.g., polysaccharide.
  • the polymer is a polysaccharide, for example, dextran or a derivative thereof.
  • a polymer, e.g., dextran polysaccharide can be of average molecular weight of 425kD 500kDa, inclusive, or in some embodiments, greater than 500kDa.
  • a polymer e.g., dextran polysaccharide can be of average molecular weight of 60kD-90kDa, inclusive, or in some embodiments, smaller than 70 kDa.
  • the dextran polymer can be derived from a bacterium, such as Leuconostoc mesenteroides.
  • an immunogenic composition as disclosed herein comprises at least 2 antigens, or at 3 least antigens, or at least 5 antigens, or between 2-10 antigens, or between 10- 15 antigens, or between 15-20 antigens, or between 20-50 antigens, or between 50 100 antigens, or more than 100 antigens, inclusive.
  • the antigens can be the same antigen or at least 2 different antigens.
  • the antigens can be from the same or different pathogens, or can be different epitopes or parts of the same antigenic protein, or can be the same antigen which is specific to different serotypes or seasonal variations of the same pathogen (e.g., influenza virus A, B, and C).
  • influenza virus A, B, and C e.g., influenza virus A, B, and C.
  • a pneumococcal antigen as disclosed herein when present alone, or in an immunogenic complex can elicit both humoral and cellular responses to one or multiple antigens at the same time.
  • the immunogenic compositions provide for a long-lasting memory response, potentially protecting a subject from future infection. This allows for a single immunogenic composition that raises a high titer of functional anti-polysaccharide antibody, and is similar or compares favorably with the antibody level induced by conventional conjugate vaccine
  • an immunogenic composition can comprise a fusion protein polysaccharide conjugate, consisting of a pneumococcal antigen selected from Table 1, fused to PdT, where the pneumococcal antigen:PdT fusion protein is conjugated to a
  • the polysaccharide may be dextran, a Vi polysaccharide of Salmonella typhi, or pneumococcal cell wall polysaccharide (CWPS), or another polysaccharide of prokaryotic or eukaryotic origin.
  • CWPS pneumococcal cell wall polysaccharide
  • Nucleic acids encoding truncated and/or mutated forms of a S. pneumoniae protein antigens can be fused to nucleotide sequences encoding (1) other pneumococcal proteins, such as autolysin, surface protein A, neuraminidase, hyaluronate lysate, choline binding protein A, or (2) non- pneumococcal proteins from organisms such as hemophilus influenza b, meningococcus group A, B, or C, or streptococcus group B.
  • the nucleic acids encoding such fused protein are expressed in the expression systems.
  • Pneumolysin truncates can be useful carriers of polysaccharides, as hosts may lacking preexisting antibodies to such a carrier polypeptide.
  • Pneumolysin is a virulence factor in pneumococcal infections and there is little antigenic variation of the pneumolysin among pneumococci with different subtypes.
  • the polysaccharide -protein conjugate when administered to a mammal such as a human, induces immune response that exceeds in magnitude, type, and/or duration the immune response induced by administration to a mammal of only the polysaccharide component. Accordingly, the polypeptide component must be of a length sufficient to induce such an enhanced immune response.
  • the fragments are at least 8, 10, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 425, 450, 460, 465, 460, 465, or more amino acids in length.
  • polypeptides varying in sequence from a naturally occurring pneumococcal antigens, the polypeptide can be at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to a naturally occurring pneumococcal antigens listed in Table 1.
  • the polysaccharide component of the conjugate can be any S. pneumoniae capsular polysaccharide, including but not limited to, any of subtypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 19A, 20, 22F, 23A, 23F, 24F, 27, 33F, or 34.
  • the capsular polysaccharide is selected from subtypes 4, 6B, 9V, 14, 18C, 19F, or 23F.
  • the polysaccharide is serotype 14. In other embodiments, the polysaccharide is serotype 18C.
  • One or more of different capsular polysaccharides can be conjugated to a single polypeptide or a plurality of polypeptides.
  • a multivalent conjugate can include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different capsular polysaccharides.
  • Polysaccharides can be conjugated to polypeptides, for example, via a monomelic linkage (only one end of the polysaccharide is attached to the polypeptide), a looped linkage (a single polypeptide is attached to looped polysaccharides), or cross-linked (multiple polysaccharides attached to multiple polypeptides).
  • conjugates or polypeptides described herein can be administered to a mammal to elicit an immune response (a prophylactic and/or therapeutic immune response) against S.
  • a pharmaceutical composition containing a conjugate or polypeptide can be delivered in a pharmaceutically acceptable carrier, buffer, or preservative which is suitable for a vaccine including, but not limited to physiological saline or other injectable liquids.
  • Additives customary in vaccines may also be present, for example stabilizers such as lactose or sorbitol, and adjuvants to enhance the immunogenic response such as aluminum phosphate, hydroxide, or sulphate and stearyl tyrosine.
  • the vaccine produced may also be used as components of multivalent vaccines which elicit an immune response against a plurality of infectious agents.
  • a pneumococcal polypeptide antigen is post-translationally modified, e.g. by phosphorylation, myristoylation, acylation, glycosylation, glycation, and the like.
  • a pneumococcal polypeptide antigen is lipidated. Conjugation to the lipid moiety may be direct or indirect (e.g., via a linker). The lipid moiety may be synthetic or naturally produced.
  • a pneumococcal polypeptide antigen is chemically conjugated to a lipid moiety.
  • a DNA construct encoding a pneumococcal polypeptide antigen comprises a lipidation sequence.
  • a lipidation sequence may be N-terminal or C-terminal to the polypeptide, and may be embedded in a signal or other sequence.
  • An exemplary lipidation sequence is the signal sequence of the E. coli gene RlpB.
  • a pneumococcal polypeptide antigen is covalently bound to another molecule. This may, for example, increase the half-life, solubility, bioavailability, or immunogenicity of the antigen.
  • Molecules that may be covalently bound to the antigen include a carbohydrate, biotin, poly( ethylene glycol) (PEG), polysialic acid, N-propionylated polysialic acid, nucleic acids, polysaccharides, and PLGA.
  • the naturally produced form of a polypeptide is covalently bound to a moiety that stimulates the immune system.
  • An example of such a moiety is a lipid moiety.
  • lipid moieties are recognized by a Toll-like receptor (TLR) such as TLR2 or TLR4 and activate the innate immune system.
  • TLR Toll-like receptor
  • the vaccine comprises one or more of the nucleic acids disclosed herein or corresponding to the polypeptides described herein.
  • the corresponding gene product such as a desired antigen
  • nucleic acid vaccine vectors that include optimized recombinant
  • polynucleotides can be delivered to a mammal (including humans) to induce a therapeutic or prophylactic immune response.
  • the nucleic acid may be, for example, DNA, RNA, or a synthetic nucleic acid.
  • the nucleic acid may be single stranded or double stranded.
  • a composition includes a vector suitable for expression in vitro (whether in a cell or in a cell-free system), e.g., for producing a polypeptide composition.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked and can include, for example, a plasmid, cosmid or viral vector.
  • the vector can be capable of autonomous replication or it can integrate into a host DNA.
  • Viral vectors include, e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses. Other types of viral vectors are known in the art.
  • Nucleic acid vaccine vectors e.g., adenoviruses, liposomes, papillomaviruses, retroviruses, etc.
  • the nucleic acid vaccines can be formulated as pharmaceutical compositions for administration in any suitable manner, including parenteral administration. Plasmid vectors are typically more efficient for gene transfer to muscle tissue. The potential to deliver DNA vectors to mucosal surfaces by oral administration has also been reported (PLGA encapsulated Rotavirus and Hepatitis B) and DNA plasmids have been utilized for direct introduction of genes into other tissues.
  • DNA vaccines have been introduced into animals primarily by intramuscular injection, by gene gun delivery, or by electroporation. After being introduced, the plasmids are generally maintained episomally without replication. Expression of the encoded proteins has been shown to persist for extended time periods, providing stimulation of B and T cells.
  • the physician evaluates vector toxicities, progression of the disease, and the production of anti-vector antibodies, if any.
  • the dose equivalent of a naked nucleic acid from a vector is from about 1 ⁇ g to 1 mg for a typical 70 kilogram patient, and doses of vectors used to deliver the nucleic acid are calculated to yield an equivalent amount of therapeutic nucleic acid.
  • Administration can be accomplished via single or divided doses.
  • the toxicity and therapeutic efficacy of the nucleic acid vaccine vectors can be determined using standard
  • a nucleic acid vaccine can contain DNA, RNA, a modified nucleic acid, or a combination thereof.
  • the vaccine comprises one or more cloning or expression vectors; for instance, the vaccine may comprise a plurality of expression vectors each capable of autonomous expression of a nucleotide coding region in a mammalian cell to produce at least one immunogenic polypeptide.
  • An expression vector often includes a eukaryotic promoter sequence, such as the nucleotide sequence of a strong eukaryotic promoter, operably linked to one or more coding regions.
  • the compositions and methods herein may involve the use of any particular eukaryotic promoter, and a wide variety are known; such as a CMV or RSV promoter.
  • the promoter can be heterologous with respect to the host cell.
  • the promoter used may be a constitutive promoter.
  • a vector useful in the present compositions and methods can be circular or linear, single- stranded or double stranded and can be a plasmid, cosmid, or episome.
  • each nucleotide coding region is on a separate vector; however, it is to be understood that one or more coding regions can be present on a single vector, and these coding regions can be under the control of a single or multiple promoters.
  • nucleic acid vaccines Numerous plasmids may be used for the production of nucleic acid vaccines. Suitable embodiments of the nucleic acid vaccine employ constructs using the plasmids VR1012 (Vical Inc., San Diego Calif), pCMVI.UBF3/2 (S. Johnston, University of Texas) or pcDNA3.1 (InVitrogen Corporation, Carlsbad, Calif.) as the vector. In addition, the vector construct can contain
  • ISS immunostimulatory sequences
  • the nucleic acid vaccine can also encode a fusion product containing the immunogenic polypeptide.
  • Plasmid DNA can also be delivered using attenuated bacteria as delivery system, a method that is suitable for DNA vaccines that are administered orally. Bacteria are transformed with an independently replicating plasmid, which becomes released into the host cell cytoplasm following the death of the attenuated bacterium in the host cell.
  • DNA vaccines including the DNA encoding the desired antigen, can be introduced into a host cell in any suitable form including, the fragment alone, a linearized plasmid, a circular plasmid, a plasmid capable of replication, an episome, RNA, etc.
  • the gene is contained in a plasmid.
  • the plasmid is an expression vector.
  • Individual expression vectors capable of expressing the genetic material can be produced using standard recombinant techniques. See e.g., Maniatis et al., 1985 Molecular Cloning: A Laboratory Manual or DNA Cloning, Vol. I and II (D. N. Glover, ed., 1985) for general cloning methods.
  • Routes of administration include, but are not limited to, intramuscular, intranasal, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as topically, transdermally, by inhalation or suppository or to mucosal tissue such as by lavage to vaginal, rectal, urethral, buccal and sublingual tissue.
  • Typical routes of administration include intramuscular, intraperitoneal, intradermal and subcutaneous injection.
  • Genetic constructs may be administered by means including, but not limited to, traditional syringes, needleless injection devices, "microprojectile bombardment gene guns", or other physical methods such as electroporation ("EP”), "hydrodynamic method", or ultrasound.
  • DNA vaccines can be delivered by any method that can be used to deliver DNA as long as the DNA is expressed and the desired antigen is made in the cell.
  • a DNA vaccine is delivered via known transfection reagents such as cationic liposomes, fluorocarbon emulsion, cochleate, tubules, gold particles, biodegradable microspheres, or cationic polymers.
  • Cochleae delivery vehicles are stable phospholipid calcium precipitants consisting of phosphatidyl serine, cholesterol, and calcium; this nontoxic and
  • Noninflammatory transfection reagent can be present in a digestive system.
  • Biodegradable microspheres comprise polymers such as poly(lactide-co-glycolide), a polyester that can be used in producing microcapsules of DNA for transfection.
  • Lipid-based microtubes often consist of a lipid of spirally wound two layers packed with their edges joined to each other. When a tubule is used, the nucleic acid can be arranged in the central hollow part thereof for delivery and controlled release into the body of an animal.
  • DNA vaccine is delivered to mucosal surfaces via microspheres.
  • Bioadhesive microspheres can be prepared using different techniques and can be tailored to adhere to any mucosal tissue including those found in eye, nasal cavity, urinary tract, colon and gastrointestinal tract, offering the possibilities of localized as well as systemic controlled release of vaccines.
  • an alternative approach for mucosal vaccine delivery is the direct administration to mucosal surfaces of a plasmid DNA expression vector which encodes the gene for a specific protein antigen.
  • DNA plasmid vaccines according to the present invention are formulated according to the mode of administration to be used.
  • DNA plasmid vaccines are injectable compositions, they are sterile, and/or pyrogen free and/or particulate free.
  • an isotonic formulation is preferably used.
  • additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • isotonic solutions such as phosphate buffered saline are preferred.
  • stabilizers include gelatin and albumin.
  • a vasoconstriction agent is added to the formulation.
  • a stabilizing agent that allows the formulation to be stable at room or ambient temperature for extended periods of time, such as LGS or other polycations or polyanions is added to the formulation.
  • the DNA vaccine may further comprises a pharmacologically acceptable carrier or diluent.
  • Suitable carriers for the vaccine are well known to those skilled in the art and include but are not limited to proteins, sugars, etc. Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous carriers are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like.
  • Preservatives and antimicrobials include antioxidants, chelating agents, inert gases and the like.
  • Preferred preservatives include formalin, thimerosal, neomycin, polymyxin B and amphotericin B.
  • An alternative approach to delivering the nucleic acid to an animal involves the use of a viral or bacterial vector.
  • suitable viral vectors include adenovirus, polio virus, pox viruses such as vaccinia, canary pox, and fowl pox, herpes viruses, including catfish herpes virus, adenovirus- associated vector, and retroviruses.
  • exemplary bacterial vectors include attenuated forms of
  • the nucleic acid is a vector, such as a plasmid, that is capable of autologous expression of the nucleotide sequence encoding the immunogenic polypeptide.
  • a vector can include a nucleic acid encoding a pneumococcal antigen in a form suitable for expression of the nucleic acid in a host cell.
  • a recombinant expression vector typically includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed.
  • Regulatory sequences include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence, as well as tissue-specific regulatory and/or inducible sequences.
  • a sequence encoding a pneumococcal antigen can include a sequence encoding a signal peptide (e.g., a heterologous signal peptide) such that the antigen is secreted from a host cell.
  • the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like.
  • Recombinant expression vectors can be designed for expression and production of pneumococcal antigens in prokaryotic or eukaryotic cells.
  • antigens can be expressed in E. coli, insect cells (e.g., using baculovirus expression vectors), yeast cells or mammalian cells.
  • a recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Fusion vectors add a number of amino acids to a protein encoded therein, e.g., to the amino terminus or carboxy terminus of the recombinant protein, e.g., to increase expression of recombinant protein; to increase the solubility of the recombinant protein; and/or to aid in the purification of the recombinant antigen by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant antigen to enable separation of the recombinant antigen from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D. B. and Johnson, K. S.
  • Pneumococcal antigen expression vectors include yeast expression vectors, vectors for expression in insect cells (e.g., a baculovirus expression vector) and vectors suitable for expression in mammalian cells.
  • An expression vector for use in mammalian cells can include viral regulatory elements.
  • promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
  • a vector can include an inducible promoter, e.g., a promoter regulated by a steroid hormone, by a polypeptide hormone (e.g., by means of a signal transduction pathway), or by a heterologous polypeptide (e.g., the tetracycline-inducible systems, "Tet-On” and "Tet-Off '; see, e.g., Clontech Inc., CA, Gossen and Bujard, Proc. Natl. Acad. Sci. USA 89:5547, 1992, and Paillard, Human Gene Therapy 9:983, 1989).
  • an inducible promoter e.g., a promoter regulated by a steroid hormone, by a polypeptide hormone (e.g., by means of
  • a host cell can be any prokaryotic or eukaryotic cell.
  • a pneumococcal antigen can be expressed in bacterial cells (such as E. coli), insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells (African green monkey kidney cells CV-1 origin SV40 cells; Gluzman, Cell 23: 175-182, 1981).
  • bacterial cells such as E. coli
  • insect cells such as E. coli
  • yeast or mammalian cells such as Chinese hamster ovary cells (CHO) or COS cells (African green monkey kidney cells CV-1 origin SV40 cells; Gluzman, Cell 23: 175-182, 1981).
  • COS cells African green monkey kidney cells CV-1 origin SV40 cells; Gluzman, Cell 23: 175-182, 1981.
  • Other suitable host cells are known to those skilled in the art.
  • Vector DNA can be introduced into host cells via conventional transformation or transfection techniques.
  • a host cell can be used to produce (i.e., express) a pneumococcal antigen. Accordingly, the invention further provides methods for producing a pneumococcal antigen using host cells. In one embodiment, the method includes culturing a host cell (into which a recombinant expression vector encoding a pneumococcal antigen has been introduced) in a suitable medium such that a
  • pneumococcal antigen is produced.
  • the method further includes isolating a pneumococcal antigen from the medium or the host cell.
  • Purified pneumococcal antigens can be used for administration to mammals to induce an immune response, and/or to generate antibodies specific for the antigens.
  • the present invention also provides nucleic acid compositions that encode pneumococcal antigens for administration to a subject in vivo, e.g., to elicit an immune response to the antigen.
  • a nucleic acid composition for administration in vivo includes a naked DNA plasmid encoding a pneumococcal antigen.
  • Bacterial vectors, replicon vectors, live attenuated bacteria, and viral vectors for expression of heterologous genes also can be used.
  • Live attenuated viral vectors e.g., recombinant vaccinia (e.g., modified vaccinia Ankara (MVA), IDT Germany), recombinant adenovirus, avian poxvirus (e.g., canarypox (e.g., ALVACTM, Aventis Pasteur) or fowlpox), poliovirus, and alphavirus virion vectors) have been successful in inducing cell-mediated immune response to antigens.
  • Avian poxviruses are defective in mammalian hosts, but can express inserted heterologous genes under early promoters.
  • Attenuated bacteria can also be used as a vehicle for DNA vaccine delivery.
  • suitable bacteria include S. enterica, S. tymphimurium, Listeria, and BCG.
  • S. enterica, S. tymphimurium, Listeria, and BCG suitable bacteria
  • the use of mutant bacteria with weak cell walls can aid the exit of DNA plasmids from the bacterium.
  • Nucleic acid compositions used for immunization can include an adjuvant (e.g., an adjuvant such as a polymer, a saponin, muramyl dipeptide, liposomes, immunomodulatory oligonucleotide, or another adjuvant described herein) to promote nucleic acid uptake.
  • adjuvants can be administered before, during, or after administration of the nucleic acid.
  • an adjuvant increases the uptake of nucleic acid into host cells and/or increases expression of the antigen from the nucleic acid within the cell, induce antigen-presenting cells to infiltrate the region of tissue where the antigen is being expressed, or increase the antigen-specific response provided by lymphocytes.
  • homology refers to the degree of sequence similarity between two peptides or between two optimally aligned nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which can be aligned for purposes of comparison. For example, it is based upon using a standard homology software in the default position, such as BLAST, version 2.2.14.
  • a pneumococcal antigen is a variant of a penumococcal antigen of Table 1 which is substantial identical to a sequence of SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • the term "substantial identity" as used herein denotes a characteristic of a polynucleotide or amino acid sequence, wherein the polynucleotide or amino acid comprises a sequence that has at least 85% sequence identity, preferably at least 90% to 95% sequence identity, more usually at least 99% sequence identity as compared to a reference sequence over a comparison window of at least 18 nucleotide (6 amino acid) positions, frequently over a window of at least 24-48 nucleotide (8-16 amino acid) positions, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the sequence which can include deletions or additions which total 20 percent or less of the reference sequence over the comparison window.
  • the reference sequence can be a subset of a larger sequence.
  • similarity when used to describe a polypeptide, is determined by comparing the amino acid sequence and the conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
  • a pneumococcal antigen is homologous to a sequence of SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • the terms "homologous” or “homologues” are used interchangeably, and when used to describe a polynucleotide or polypeptide, indicates that two polynucleotides or polypeptides, or designated sequences thereof, when optimally aligned and compared, for example using BLAST, version 2.2.14 with default parameters for an alignment (see herein) are identical, with appropriate nucleotide insertions or deletions or amino-acid insertions or deletions, in at least 60% of the nucleotides, usually from about 75% to 99%, and more preferably at least about 98 to 99% of the nucleotides.
  • homolog or “homologous” as used herein also refers to homology with respect to structure and/or function. With respect to sequence homology, sequences are homologs if they are at least 60 at least 70%, at least 80%, at least 90%, at least 95% identical, at least 97% identical, or at least 99% identical. Determination of homologs of the genes or peptides of the present invention can be easily ascertained by the skilled artisan.
  • An embodiment of the present method comprises identifying a protein, "X" of interest, then removing the gene encoding for X from the organism, then replacing that gene with a gene encoding for a tagged version of the X protein (e.g., tagged with His, HA, OVA peptide, among others), which can be detected readily with monoclonal or polyclonal antibodies.
  • a tagged version of the X protein e.g., tagged with His, HA, OVA peptide, among others
  • the organism is then grown, stained with an antibody that recognizes the tag (and is also fused to a fluorophore). Flow cytometry is then used to evaluate whether the antibodies are attached to the surface of the organism, in which case, the antigen can be deduced to be surface-expressed.
  • pneumococcus for example, the organism can be evaluated in its encapsulated or unencapsulated form.
  • An antigen can be surface expressed, but hidden under the capsule, for selection of antigen purposes, it may be advantageous to select an antigen that is both surface expressed and accessible despite capsulation.
  • the identified immunogenic proteins or mixtures thereof may be used in a multivalent or individual vaccine, which can be administered in many forms (intramuscularly, subcutaneously, mucosally, transdermally). For example, combinations or permutations of the twelve pneumococcal immunogens may be more efficacious against colonization versus disease. A combination of several immunogens with both characteristics may provide a superior vaccine.
  • Antibodies directed against a pneumococcal antigen or functional fragment thereof as disclosed in Table 1 may be used in a prophylactic or therapeutic application to confer immunity from a first individual to a second individual (e.g., to augment the second individual's immune response against S. pneumoniae or to provide a response if the second individual is an immunocompromised patient).
  • Antibodies directed against a a pneumococcal antigen as disclosed herein can be generated in an immunocompetent host (e.g., by administering to the immunocompetent host a conjugate described herein), harvested from the host and transfused into a recipient in need of treatment or prophylaxis, thereby conferring resistance to the recipient against not only the pneumolysin toxin, but also against S. pneumoniae and any possibly other bacteria which bind antibodies elicited by the pneumococcal antigen.
  • Antibodies elicited by a composition described herein can be formulated as a pharmaceutical composition and be used to confer a prophylactic or therapeutic immune response to an individual. Suitable components and methods of administration for pharmaceutical compositions are described herein.
  • the pharmaceutical composition may contain polyclonal antibodies or monoclonal antibodies or their derivatives of fragments.
  • a pharmaceutical composition contains a prophylactically or therapeutically effective amount of an antibody, fragment, or derivative, as determined by standard clinical techniques.
  • this invention provides, inter alia, antibodies, or antigen-binding fragments thereof, to a novel pneumococcal antigen described herein, e.g., those listed in Table 1, or a SP0785 polypeptide antigen, a SP1500 polypeptide antigen, a SP0346 polypeptide antigen, a SP1386 polypeptide antigen, a SP0084 polypeptide antigen, a SP1479polypeptide antigen, a CT067 polypeptide antigen, a CT476 polypeptide antigen, a p6 polypeptide antigen, a SP2145 polypeptide antigen, or any pneumococcal antigen listed in Table 1, e.g., SEQ ID NO: 1 -76 or SEQ ID NO: 153- 234), or functional fragments or variants thereof.
  • a novel pneumococcal antigen described herein e.g., those listed in Table 1, or a SP0785 polypeptide antigen, a SP1500 poly
  • the antibodies can be of the various isotypes, including: IgG (e.g., IgGl, IgG2, IgG3, IgG4), IgM, IgAl, IgA2, IgD, or IgE.
  • an antibody is an IgG isotype, e.g., IgGl .
  • An antibody against a pneumococcal antigen can be full- length (e.g., an IgGl or IgG4 antibody) or can include only an antigen-binding fragment (e.g., a Fab, F(ab) 2 , Fv or a single chain Fv fragment).
  • Monoclonal antibodies can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495, 1975. Polyclonal antibodies can be produced by immunization of animal or human subjects. See generally, Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988. Antibodies against pneumococcal antigens described herein can be used, e.g., for diagnostic assays, or for therapeutic applications.
  • a subject's response to an immunogenic composition described herein is evaluated, e.g., to determine efficacy of the composition, and/or to compare responses elicited by the composition to responses elicited by a different composition.
  • Nucleic acids encoding a pneumococcal polypeptide antigen or a fragment or variant of pneumococcal polypeptide can be administered to a mammal (e.g., a human) to generate a prophylactic and/or therapeutic immune response in the mammal.
  • the immune response can be an anti-pneumococcal humoral and/or a cellular immune response.
  • Polypeptides that can be encoded by the nucleic acid constructs include one or more pneumococcal polypeptide antigens, alone or fused to a fusion polypeptide, e.g. PdT and/or a polysaccharide and/or another antigen, e.g., Vi.
  • a nucleic acid can encode a combination of two or more such polypeptides, fragments, or variants.
  • Nucleic acid expression constructs can be prepared by using standard recombinant DNA methods. Regulatory elements can be included in a construct to facilitate expression of the nucleic acid encoding the polypeptide. These elements include sequences for enhancing expression in human or other mammalian cells, e.g., promoters, RNA stabilization sequences 5' and/or 3' to the coding sequence, introns (which can be placed at any location within or adjacent to the encoded sequence), and poly(A) addition sites, as well as an origin of replication and one or more genes encoding selectable markers enabling the constructs to replicate and be selected in prokaryotic and/or eukaryotic hosts.
  • Regulatory elements can be included in a construct to facilitate expression of the nucleic acid encoding the polypeptide. These elements include sequences for enhancing expression in human or other mammalian cells, e.g., promoters, RNA stabilization sequences 5' and/or 3' to the coding sequence, introns (which can be placed at any
  • a T7 polymerase promoter or other type of promoter is optionally present at the 5' end of the coding sequence, and a sequence encoding a FLAG or other mAb determinant is optionally present at the 3' end of the coding sequence.
  • the construct may also contain other transcriptional and translational signals, such as a Kozak sequence.
  • the construct may in addition include a sequence encoding a targeting signal that directs the encoded polypeptide to a desired intracellular compartment, the targeting signal being linked to the polypeptide.
  • Targeting signals can direct the encoded polypeptide to endoplasmic reticulum (ER), the golgi, the nucleus, a lysosome, a class II peptide loading compartment, or an endosome, and include signal peptides, ER retention peptides, and lysosome -targeting peptides.
  • ER endoplasmic reticulum
  • the nucleic acids can be used in any vector that allows for expression in cells of a mammal.
  • the vector can be, e.g., a non-viral vector such as a plasmid or bacterial vector, an integrating viral vector, or a non-integrating viral vector.
  • a non-viral vector such as a plasmid or bacterial vector
  • an integrating viral vector or a non-integrating viral vector.
  • An example of a suitable vector is the family of pcDNA mammalian expression vectors (Invitrogen), which permit direct and rapid cloning of PCR products.
  • nucleic acids encoding polypeptides into appropriate cells.
  • the nucleic acids encoding the polypeptides can be delivered in a pharmaceutically acceptable carrier such as saline, or as colloidal suspensions, or as powders, with or without diluents.
  • the nucleic acids can be "naked" or associated with delivery vehicles and delivered using delivery systems known in the art, such as lipids, liposomes, microspheres, microparticles or microcapsules, gold particles, ISCOMS, nanoparticles, polymers, condensing agents, polysaccharides, polyamino acids, dendrimers, saponins, QS21, adsorption enhancing materials, adjuvants, or fatty acids. Nucleic acids can also be delivered to a cell, e.g., a skeletal muscle cell, either in vitro or in vivo, using electroporation.
  • delivery systems known in the art such as lipids, liposomes, microspheres, microparticles or microcapsules, gold particles, ISCOMS, nanoparticles, polymers, condensing agents, polysaccharides, polyamino acids, dendrimers, saponins, QS21, adsorption enhancing materials, adjuvants, or fatty
  • the nucleic acids can be administered using standard methods, e.g., those described in Donnelly et al., J. Immunol. Methods 176: 145, 1994, and Vitiello et al., J. Clin. Invest. 95:341, 1995, and can be delivered into subjects in any manner known in the art, e.g., orally intramuscularly, intravenously, intraarterially, intrathecally, intradermally, intraperitoneally, intranasally,
  • intrapulmonarily, intraocularly, intravaginally, intrarectally or subcutaneously can be introduced into the gastrointestinal tract or the respiratory tract, e.g., by inhalation of a solution or powder containing the nucleic acids. Administration can be local or systemic.
  • vaccination regimens can include, e.g., intramuscular, intradermal, inhalation, or subcutaneous administrations of 10-1000 ⁇ g of a plasmid DNA when delivered in a microparticle, or of about 10-2500 ⁇ g, e.g., 100 to 2000, or 500 to 1000 ⁇ g, of naked plasmid DNA delivered intramuscularly or intradermally, repeated 3-6 times.
  • dosage for any given patient depends upon many factors, including the patient's size, general health, sex, body surface area, age, the particular compound to be administered, time and route of administration, and other drugs being administered concurrently. Determination of optimal dosage is well within the abilities of a pharmacologist of ordinary skill.
  • APCs antigen presenting cells
  • dendritic cells peripheral blood mononuclear cells
  • bone marrow cells can be obtained from a patient or an appropriate donor and activated ex vivo with the nucleic acid, and then implanted or reinfused into the patient.
  • the nucleic acids can be administered alone or in combination with other therapies known in the art, e.g., antimicrobial agents.
  • the nucleic acids can be administered in combination with other treatments designed to enhance immune responses, e.g., by co-administration with adjuvants, cytokines (or nucleic acids encoding cytokines), or CpG oligonucleotides, as is well known in the art.
  • the ability of a nucleic acid to elicit an immune response in a host mammal can be assayed by using methods for measuring immune responses that are well known in the art.
  • the generation of cytotoxic T cells can be demonstrated in a standard .sup.51Cr release assay, by measuring intracellular cytokine expression or secretion, or by using MHC tetramers.
  • Standard assays such as ELISA or ELISPOT, can be used to measure cytokine profiles attributable to T cell activation.
  • T cell proliferation can be measured using assays such as .sup.3H-thymidine uptake and other assays known in the art.
  • B cell responses can be measured using art recognized assays such as ELISA.
  • Other methodologies can also be used to evaluate the effects of the nucleic acids on pathogen-associated lesions or on other pathogen levels generally (e.g., pneumococci clearance in challenged mice treated with the conjugate).
  • nucleic acids described herein can be used in the manufacture of a medicament for the prevention or treatment of an infection with S. pneumoniae or conditions associated with such infection.
  • various assays can be utilized in order to characterize an antigen or composition and/or to determine whether an immune response has been stimulated in a T cell or group of T cells.
  • assays are used to characterize a T cell response in a subject that has been administered an immunogenic composition to elicit an anti-pneumococcal response (e.g., to evaluate whether a detectable T cell response has been elicited and/or to evaluate the potency of the response).
  • the novel pneumococcal antigens described herein also provide diagnostic agents to evaluate exposure to pneumococcal infections (e.g., in non-vaccinated subjects).
  • assays are used to characterize a T cell response in a subject to determine whether the subject has been infected with a pneumococcal organism.
  • the subject can be a subject suspected of exposure to a pneumococcal organism recently (i.e., an assay to detect a response can be performed with a sample taken from the subject about 3, 4, 5, 6, 7, 8, 9, 10, 14, 30, or more days after suspected exposure to apneumococcalorganism).
  • the subject can be a subject suspected of exposure to a pneumococcal organism weeks, months, or years prior to the assay.
  • novel pneumococcal antigens described herein also provide prognostic agents to evaluate outcomes of exposure to a pneumococcal organism (e.g., in subjects known to be, or to have been, infected with a pneumococcal organism).
  • assays are used to characterize a T cell response in a subject to assess the likelihood of sequelae (e.g., sepsis) to infection with a pneumococcal organism.
  • stimulation of an immune response in T cells is determined by measuring antigen-induced production of cytokines by T cells.
  • stimulation of an immune response in T cells can be determined by measuring antigen-induced production of IFN- ⁇ , IL-4, IL-2, IL-6, IL-10, IL-17 and/or TNF-a by T cells.
  • antigen-induced production of cytokines by T cells can be measured by intracellular cytokine staining followed by flow cytometry. Other suitable methods include surface capture staining followed by flow cytometry, or methods that determine cytokine concentration in supernatants of activated T cell cultures, such as ELISA or ELISPOT assays.
  • antigen-produced production of cytokines by T cells is measured by ELISPOT assay.
  • ELISPOT assays typically employ a technique very similar to the sandwich enzyme- linked immunosorbent assay (ELISA) technique.
  • An antibody e.g. monoclonal antibody, polyclonal antibody, etc.
  • PVDF polyvinylidene fluoride
  • Antibodies are chosen for their specificity for the cytokine of interest.
  • the plate is blocked (e.g., with a serum protein that is non-reactive with any of the antibodies in the assay).
  • Cells to be tested for cytokine production are plated out at varying densities, along with antigen or mitogen, and then placed in a humidified 37° C C0 2 incubator for a specified period of time. Cytokine secreted by activated cells is captured locally by the coated antibody on the high surface area PVDF membrane.
  • a secondary antibody e.g. a biotinylated polyclonal antibody
  • This antibody is reactive with a distinct epitope of the target cytokine and thus is employed to detect the captured cytokine.
  • the detected cytokine is then visualized using an avidin-HRP, and a precipitating substrate (e.g., AEC, BCIP/NBT).
  • the colored end product typically represents an individual cytokine -producing cell. Spots can be counted manually (e.g., with a dissecting microscope) or using an automated reader to capture the microwell images and to analyze spot number and size. In some embodiments, each spot correlates to a single cytokine -producing cell.
  • an immune response in T cells is said to be stimulated if between about 1% and about 100% of antigen-specific T cells produce cytokines. In some embodiments, an immune response in T cells is said to be stimulated if at least about 1%, at least about 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, at least about 95%), at least about 99%, or about 100%> of antigen-specific T cells produce cytokines.
  • an immune response in T cells is said to be stimulated if immunized subjects comprise at least about 10-fold, at least about 50-fold, at least about 100-fold, at least about 500-fold, at least about 1000-fold, at least about 5000-fold, at least about 10.000-fold, at least about 50.000-fold, at least about 100.000-fold, or greater than at least about 100.000-fold more cytokine- producing cells than do naive controls.
  • stimulation of an immune response in T cells can be determined by measuring antigen-induced proliferation of T cells.
  • antigen-induced proliferation may be measured as uptake of H 3 -thymidine in dividing T cells (sometimes referred to as "lymphocyte transformation test, or "LTT").
  • antigen-induced proliferation is said to have occurred if .sup.3H-thymidine uptake (given as number of counts from a .gamma, counter) is at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, at least about 100-fold, at least about 500-fold, at least about 1000-fold, at least about 5000-fold, at least about 10.000-fold, or greater than at least about 10.000-fold higher than a naive control.
  • antigen-induced proliferation may be measured by flow cytometry.
  • antigen-induced proliferation may be measured by a carboxyfluorescein succinimidyl ester (CFSE) dilution assay.
  • CFSE is a non-toxic, fluorescent, membrane -permeating dye that binds the amino groups of cytoplasmic proteins with its succinimidyl-reactive group (e.g., T cell proteins). When cells divide, CFSE-labeled proteins are equally distributed between the daughter cells, thus halving cell fluorescence with each division.
  • antigen-specific T cells lose their fluorescence after culture in the presence of the respective antigen (CFSE.sup.low) and are distinguishable from other cells in culture (CFSE.sup.high).
  • antigen-induced proliferation is said to have occurred if CFSE dilution (given as the percentage of CFSE low cells out of all CFSE + cells) is at least about 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, at least about 95%, or at least about 100%.
  • an immune response in T-cells is said to be stimulated if cellular markers of T cell activation are expressed at different levels (e.g., higher or lower levels) relative to unstimulated cells.
  • CD1 la, CD27, CD25, CD40L, CD44, CD45RO, and/or CD69 are more highly expressed in activated T cells than in unstimulated T cells.
  • L-selectin (CD62L), CD45RA, and/or CCR7 are less highly expressed in activated T cells than in unstimulated T cells.
  • an immune response in T cells is measured by assaying cytotoxicity by effector CD8+ T cells against antigen-pulsed target cells.
  • a 51 chromium ( 51 Cr) release assay can be performed.
  • effector CD8+ T cells bind infected cells presenting virus peptide on class I MHC and signal the infected cells to undergo apoptosis. If the cells are labeled with 51 Cr before the effector CD8+ T cells are added, the amount of 51 Cr released into the supernatant is proportional to the number of targets killed.
  • an immune response in T cells is measured by an in vivo cytotoxicity assay in which target cells are antigen pulsed and labeled with a fluorescent dye, then transferred into immunized animals.
  • Specific cytolytic T cells cause the disappearance of fluorescently labeled cells that are pulsed with a relevant antigen, but no decrease in cells pulsed with a control antigen.
  • an immune response in T cells is measured by detecting expression of one or more of Perforin, Granzyme B, or CD 107a (e.g., by ELISPOT or flow cytometry). See, e.g., Betts et al., J. Immunol. Meth. 281(l-2):65-78, 2003.
  • an immunogenic composition may be characterized (e.g., to assess efficacy in inducing a beneficial response in animal models) by infecting groups of immunized and non-immunized mice (e.g., 3 or more weeks after vaccination) with a dose of a chlamydia organism that typically produces a particular pathology (e.g., upper urogenital tract infection) or bacterial burden. The magnitude and duration of pathology or bacterial burden due to infection of both groups is monitored and compared.
  • B cell responses are characterized by transferring serum from immune mice as a "passive vaccine" to assess protection of non-immune mice from pathological effects or burden of infection.
  • infiltrating leukocyte populations are characterized (e.g., to assess the number and type cells in a region of infection, e.g., whether
  • CD4.sup.+ T cells, CD8.sup.+ T cells, or other cell types are present).
  • Animal models for chlamydial urogenital infection have been described.
  • a chlamydia organism is applied as an intravaginal inoculum, and infection and pathology of one or more of lower and upper genital tracts of the infected animal is characterized. See, e.g., Barron et al. (J. Infect. Dis. 143(l):63-6, 1981), which describes an intravaginal infection model in mice.
  • clearance of primary infection is a measure of protective immunity in this model.
  • detection of CD4+ T cell responses of a Thl subtype correlate with protection (Morrison et al., Infect. Immun 70:2741-2751, 2002).
  • an immunogenic composition is assessed in an animal model of pneumococcal infection.
  • lower urogenital tract infection by pneumococcus is assessed in the model (e.g., lower tract bacterial burden and/or inflammation due to infection is assessed).
  • upper tract infection by chlamydia is assessed in the model (e.g., one or more of upper tract bacterial burden, inflammation, infertility, collagen deposition, scarring due to infection, are assessed).
  • an ability to prevent ascension of a chlamydia infection from the lower tract to the upper genital tract is assessed.
  • rate of bacterial clearance from the lower tract is assessed.
  • rate of bacterial clearance from the upper tract is assessed.
  • rate of bacterial clearance from the nose is assessed.
  • an immunogenic composition is assessed in an animal model in multiple strains of the animal of interest (e.g., multiple mouse strains).
  • presence and size of hydrosalpinx is assessed.
  • desirable immunogenic compositions are characterized as having one or more of the above effects in vivo (e.g., in an animal model).
  • an immunogenic composition reduces lower urogenital tract infection by chlamydia bacteria.
  • an immunogenic composition reduces lower tract bacterial burden.
  • an immunogenic composition reduces lower tract inflammation due to infection.
  • an immunogenic composition reduces upper tract infection by pneumococcus.
  • an immunogenic composition reduces ascension of a pneumococcal infection from the lower tract to the upper genital tract.
  • an immunogenic composition increases the rate of bacterial clearance from the lower tract and/or the upper tract.
  • an immunogenic composition has one or more of the above effects in multiple animal strains (e.g., multiple mouse strains).
  • pneumococcal antigens of Table 1 or functional fragments thereof for use in the immunogenic compositions as disclosed herein elicits an IL-17A response in mouse splenocytes or human PBMCs in vitro as disclosed in Example 2, and/or protects colonization in vivo in a mouse colonization model, where mice are challenged with a serotype of pneumococcal strain (e.g., serotypes 6B, 14F or 19F) after biweekly immunization with a pneumococcal antigen (or functional fragment), and assessing for presence of pneumococcal colonization in the nose, as disclosed in Example 3.
  • a serotype of pneumococcal strain e.g., serotypes 6B, 14F or 19F
  • a pneumococcal antigen e.g., an antigen listed in Table 1, or a homologue or functional fragment or variant of an antigen listed in Table 1 to elicit an immune response in vivo, by measuring a CMI response to the target antigen.
  • CMI assays are known in the art and described, for example, in United States Patent Application 2005/0014205, WO/1987/005400, United States Patent 5,674,698 and commercially available kits such as IMMUNK OW® CYLEX Immune cell function assay Product No. 4400, which are incorporated in their entirety by reference herein for use in the present invention.
  • the S. pneumoniae vaccines described herein may be used for prophylactic and/or therapeutic treatment of S. pneumoniae. Accordingly, this application provides a method for treating a subject suffering from or susceptible to S. pneumoniae infection, comprising administering an effective amount of any of the vaccine formulations described herein. In some aspects, the method inhibits S. pneumoniae colonization in an individual. In some aspects, the method inhibits S.
  • the subject receiving the vaccination may be a male or a female, and may be a child or adult.
  • the subject being treated is a human. In other embodiments, the subject is a non-human animal.
  • the immunogenic compositions and methods described herein can be used for the prophylaxis and/or treatment of any pneumococcal infection, pneumococcal disease, disorder, and/or condition, or a pneumococcal infection, such as sepsis.
  • "prophylaxis” refers to uses before onset of symptoms due to a pneumococcal infection, pneumococcal disease, disorder, and/or condition and/or before known exposure to a Streptococcus pneumoniae organism.
  • Subjects include, but are not limited to, humans and/or other primates; and other animals susceptible to infection by S. pneumoniae organisms, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and/or dogs; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys.
  • a vaccine or immunogenic composition as disclosed herein is administered to a subject to induce an immune response that can help protect against the establishment of S. pneumoniae, for example by protecting against colonization, the first and necessary step in disease.
  • the method inhibits infection by S. pneumoniae in a non-colonized or uninfected subject.
  • the method may reduce the duration of colonization in an individual who is already colonized.
  • a vaccine or immunogenic composition as disclosed herein confer protective immunity, allowing a vaccinated individual to exhibit delayed onset of symptoms or sequelae, or reduced severity of symptoms or sequelae, as the result of his or her exposure to the vaccine.
  • the reduction in severity of symptoms or sequelae is at least 25%, 40%, 50%), 60%), 70%), 80%o or even 90%>.
  • vaccinated individuals may display no symptoms or sequelae upon contact with S. pneumoniae, do not become colonized by S. pneumoniae, or both.
  • Protective immunity is typically achieved by one or more of the following mechanisms: mucosal, humoral, or cellular immunity.
  • Mucosal immunity is primarily the result of secretory IgA (sIGA) antibodies on mucosal surfaces of the respiratory, gastrointestinal, and genitourinary tracts.
  • the sIGA antibodies are generated after a series of events mediated by antigen- processing cells, B and T lymphocytes, that result in sIGA production by B lymphocytes on mucosa- lined tissues of the body.
  • Humoral immunity is typically the result of IgG antibodies and IgM antibodies in serum.
  • Cellular immunity can be achieved through cytotoxic T lymphocytes or through delayed-type hypersensitivity that involves macrophages and T lymphocytes, as well as other mechanisms involving T cells without a requirement for antibodies.
  • cellular immunity may be mediated by TH1 or TH17 cells.
  • a vaccine formulation as described herein e.g., a composition comprising one or more polypeptides from Table 1 or 2, or nucleic acids encoding the polypeptides, or antibodies reactive with the polypeptides
  • a vaccine formulation as described herein is administered to patients that are immunocompromised.
  • An immunocompromising condition arising from a medical treatment is likely to expose the individual in question to a higher risk of infection with S. pneumoniae. It is possible to treat an infection prophylactically in an individual having the immunocompromised condition before or during treatments known to compromise immune function.
  • an antigenic composition e.g., two or more antigens from Table 1 or 2, or nucleic acids encoding the antigens
  • antibodies reactive to two or more antigens from Table 1 or 2 before or during a treatment known to compromise immune function
  • the following groups are at increased risk of pneumococcal disease or its complications, and therefore it is advantageous for subjects falling into one or more of these groups to receive a vaccine formulation described herein: children, especially those from 1 month to 5 years old or 2 months to 2 years old; children who are at least 2 years of age with asplenia, splenic dysfunction or sickle-cell disease; children who are at least 2 years of age with nephrotic syndrome, chronic cerebrospinal fluid leak, HIV infection or other conditions associated with immunosuppression.
  • At least one dose of the pneumococcal antigen composition is given to adults in the following groups at increased risk of pneumococcal disease or its complications: all persons 65 years of age; adults with asplenia, subjects with Job's syndrome (subject lacking Th-17 cell-mediated response), subjects with aggamaglobunemia (a subject lacking antibody-mediated response), splenic dysfunction or sickle-cell disease; adults with the following conditions: chronic cardiorespiratory disease, cirrhosis, alcoholism, chronic renal disease, nephrotic syndrome, diabetes mellitus, chronic cerebrospinal fluid leak, HIV infection, AIDS and other conditions associated with immunosuppression (Hodgkin's disease, lymphoma, multiple myeloma, immunosuppression for organ transplantation), individuals with cochlear implants; individuals with long-term health problems such as heart disease and lung disease, as well as individuals who are taking any drug or treatment that lowers the body's resistance to infection, such as long-term steroids
  • a vaccine or immunogenic composition as disclosed herein may be administered to a patient suffering from S. pneumoniae infection, in an amount sufficient to treat the patient. Treating the patient, in this case, refers to reducing S. pneumoniae symptoms and/or bacterial load and/or sequelae bin an infected individual. In some embodiments, treating the patient refers to reducing the duration of symptoms or sequelae, or reducing the intensity of symptoms or sequelae. In some embodiments, the vaccine reduces transmissibility of S. pneumoniae from the vaccinated patient. In certain embodiments, the reductions described above are at least 25%, 30%, 40%, 50%, 60%, 70%, 80% or even 90%. [00279] In therapeutic embodiments, the vaccine is administered to an individual post-infection. The vaccine may be administered shortly after infection, e.g. before symptoms or sequelae manifest, or may be administered during or after manifestation of symptoms or sequelae.
  • a therapeutic S. pneumoniae vaccine can reduce the intensity and/or duration of the various symptoms or sequelae of S. pneumoniae infection.
  • Symptoms or sequelae of S. pneumoniae infection can take many forms.
  • Invasive pneumococcal diseases include acute sinusitis, otitis media, meningitis, bacteremia, sepsis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, cellulitis, and brain abscess.
  • an infected patient develops pneumonia, acute sinusitis, otitis media (ear infection), meningitis, bacteremia, sepsis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, cellulitis, or brain abscess.
  • Sepsis is a rare but life-threatening complication of S. pneumoniae infection, where the bacterium invades the bloodstream and systemic inflammation results. Typically, fever is observed and white blood cell count increases.
  • Goldstein, B. et al. International pediatric sepsis consensus conference: definitions for sepsis and organ dysfunction in pediatrics.” Pediatr Crit. Care Med. January 2005; 6 (l):2-8.
  • immunogenic compositions in accordance with the present invention may be used to treat, alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce risk of infection by, and reduce severity of, and/or reduce incidence of one or more symptoms or features of a pneumococcal disease, disorder, and/or condition.
  • inventive an immunogenic composition may be used to treat, alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of one or more symptoms or features of pneumococcal infection (e.g., but not limited to sepsis, pneumonia,acute otitis media, bacteremia and bacterial meningitis).
  • a method for the prophylaxis and/or treatment of pneumococcal infection comprises administering a therapeutically effective amount of an
  • a "therapeutically effective amount" of an inventive immunogenic composition is that amount effective for reducing risk of infection by, or treating, alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of pneumococcal infection.
  • a therapeutically effective amount may be determined on a population basis, and is not required to be an amount that naturally induces a protective response in a particular subject.
  • inventive prophylactic and/or therapeutic protocols involve administering a therapeutically effective amount of one or more inventive immunogenic compositions to a healthy subject (i.e., a subject who does not display any symptoms of chlamydia infection and/or who has not been diagnosed with pneumococcal infection).
  • healthy individuals may be vaccinated using inventive immunogenic compositions prior to development of pneumococcal infection and/or onset of symptoms of pneumococcal infection; at risk individuals (e.g., patients exposed to individuals suffering from pneumococcal infection, patients with HIV or a compromised immune system, or a subject who is susceptible is to pneumococcal infection such as a subject with Job's syndrome (subject lacking Th-17 cell-mediated response) or a subject with aggamaglobunemic (a subject lacking antibody-mediated response)) can be treated substantially contemporaneously with (e.g., within 48 hours, within 24 hours, or within 12 hours of) the onset of symptoms of and/or exposure to pneumococcal infection.
  • individuals known to have pneumococcal infection or sepsis may receive treatment at any time.
  • inventive prophylactic and/or therapeutic protocols involve administering a therapeutically effective amount of one or more inventive immunogenic compositions to a subject such that an immune response is stimulated in both T cells and B cells.
  • immune responses e.g. T cell and/or B cell responses
  • immune responses can be tailored to preferentially elicit the most desirable type of immune response for a given indication, e.g., humoral response, Thl T cell response, Thl7 T cell response, IFN- ⁇ secretion by antigen-specific T cells, cytotoxic T cell response, antibody response, B cell response, innate immune response, or a combination of these responses.
  • the efficacy of vaccination with the a vaccine or immunogenic composition as disclosed herein may be determined in a number of ways, in addition to the clinical outcomes described above.
  • the IL-17 levels may be compared to IL-17 levels in the same subject before vaccination.
  • Increased IL-17 (e.g., IL-17A) levels such as a 1.5 fold, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold or 100-fold or more increase, would indicate an increased response to the vaccine.
  • Increased pneumococcal killing such as a 1.5 fold, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold or 100-fold or more increase, would indicate an increased response to the vaccine.
  • one may measure T.sub.H17 cell activation where increased T.sub.H17 cell activation, such as a 1.5 fold, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold or 100-fold or more increase, correlates with an increased response to the vaccine.
  • two or more of these assays are used. For example, one may measure IL-17 levels and the levels of vaccine-specific antibody.
  • epidemiological markers such as incidence of, severity of, or duration of pneumococcal infection in vaccinated individuals compared to unvaccinated individuals.
  • Vaccine efficacy may also be assayed in various model systems such as the mouse model. For instance, BALB/c or C57BL/6 strains of mice may be used. After administering the test vaccine to a subject (as a single dose or multiple doses), the experimenter administers a challenge dose of S. pneumoniae. In some cases, a challenge dose administered intranasally is sufficient to cause S.
  • pneumoniae colonization (especially nasal colonization) in an unvaccinated animal, and in some cases a challenge dose administered via aspiration is sufficient to cause sepsis and a high rate of lethality in unvaccinated animals.
  • the efficacy of polypeptides of Table 1 in inhibiting S. pneumoniae nasal colonization following intranasal challenge in the mouse model can be assessed.
  • Examples 3 and 4 show the efficacy of polypeptides of Table 1 in protecting against sepsis and death following infection with S. pneumoniae via aspiration in the mouse model.
  • an immunogenic composition as disclosed herein can comprise a pharmaceutically acceptable carrier.
  • the vaccine composition described herein is formulated for administering to a mammal. Suitable formulations can be found in Remington's Pharmaceutical Sciences, 16th and 18th Eds., Mack Publishing, Easton, Pa. (1980 and 1990), and Introduction to Pharmaceutical Dosage Forms, 4th Edition, Lea & Febiger, Philadelphia (1985), each of which is incorporated herein by reference.
  • a vaccine compositions as described herein comprise pharmaceutically acceptable carriers that are inherently nontoxic and nontherapeutic.
  • carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts, or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, and polyethylene glycol.
  • depot forms are suitably used.
  • Such forms include, for example, microcapsules, nano-capsules, liposomes, plasters, inhalation forms, nose sprays, sublingual tablets, and sustained release preparations.
  • sustained release compositions see U.S. Patent Nos. 3,773,919, 3,887,699, EP 58,481 A, EP 158,277A, Canadian Patent No. 1176565; U. Sidman et al., Biopolymers 22:547 (1983) and R. Langer et al., Chem. Tech. 12:98 (1982).
  • the proteins will usually be formulated at a concentration of about 0.1 mg/ml to 100 mg/ml per application per patient.
  • antioxidants e.g., ascorbic acid
  • low molecular weight polypeptides e.g., polyarginine or tripeptides
  • proteins such as serum albumin, gelatin, or immunoglobulins
  • hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; and sugar alcohols such as mannitol or sorbitol.
  • a vaccine composition as described herein for administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • a vaccine composition as described herein further comprises pharmaceutical excipients including, but not limited to biocompatible oils, physiological saline solutions, preservatives, carbohydrate, protein , amino acids, osmotic pressure controlling agents, carrier gases, pH-controlling agents, organic solvents, hydrophobic agents, enzyme inhibitors, water absorbing polymers, surfactants, absorption promoters and anti-oxidative agents.
  • pharmaceutical excipients including, but not limited to biocompatible oils, physiological saline solutions, preservatives, carbohydrate, protein , amino acids, osmotic pressure controlling agents, carrier gases, pH-controlling agents, organic solvents, hydrophobic agents, enzyme inhibitors, water absorbing polymers, surfactants, absorption promoters and anti-oxidative agents.
  • carbohydrates include soluble sugars such as hydropropyl cellulose, carboxymethyl cellulose, sodium carboxyl cellulose, hyaluronic acid, chitosan, alginate, glucose, xylose, galactose, fructose, maltose, saccharose, dextran, chondroitin sulfate, etc.
  • proteins include albumin, gelatin, etc.
  • amino acids include glycine, alanine, glutamic acid, arginine, lysine, and their salts.
  • the immunogens as described herein can be solubilized in water, a solvent such as methanol, or a buffer.
  • Suitable buffers include, but are not limited to, phosphate buffered saline Ca 2+ /Mg 2+ free (PBS), normal saline (150 mM NaCl in water), and Tris buffer.
  • Antigen not soluble in neutral buffer can be solubilized in 10 mM acetic acid and then diluted to the desired volume with a neutral buffer such as PBS.
  • a neutral buffer such as PBS.
  • acetate-PBS at acid pH may be used as a diluent after solubilization in dilute acetic acid.
  • Glycerol can be a suitable non-aqueous buffer for use in the present invention.
  • the immunogen as disclosed herein is not soluble per se, the immunogen can be present in the formulation in a suspension or even as an aggregate.
  • hydrophobic antigen can be solubilized in a detergent, for example a polypeptide containing a membrane-spanning domain.
  • an antigen in a detergent solution e.g., a cell membrane extract
  • liposomes then may be formed by removal of the detergent by dilution, dialysis, or column chromatography.
  • a vaccine composition is administered in combination with other therapeutic ingredients including, e.g., ⁇ -interferon, cytokines, chemotherapeutic agents, or antiinflammatory or anti-viral agents.
  • other therapeutic ingredients including, e.g., ⁇ -interferon, cytokines, chemotherapeutic agents, or antiinflammatory or anti-viral agents.
  • a vaccine composition is administered in a pure or substantially pure form, but it is preferable to present it as a pharmaceutical composition, formulation or preparation.
  • Such formulation comprises polypeptides described herein together with one or more pharmaceutically acceptable carriers and optionally other therapeutic ingredients.
  • Other therapeutic ingredients include compounds that enhance antigen presentation, e.g., gamma interferon, cytokines, chemotherapeutic agents, or anti-inflammatory agents.
  • the formulations can conveniently be presented in unit dosage form and may be prepared by methods well known in the pharmaceutical art. For example, Plotkin and Mortimer (In 'Vaccines', 1994, W.B. Saunders Company; 2nd edition) describes vaccination of animals or humans to induce an immune response specific for particular pathogens, as well as methods of preparing antigen, determining a suitable dose of antigen, and assaying for induction of an immune response.
  • a vaccine composition as described herein further comprises an adjuvant, as described herein.
  • Formulations of vaccine compositions suitable for intravenous, intramuscular, intranasal, oral, subcutaneous, or intraperitoneal administration conveniently comprise sterile aqueous solutions of the active ingredient with solutions which are preferably isotonic with the blood of the recipient.
  • Such formulations may be conveniently prepared by dissolving solid active ingredient in water containing physiologically compatible substances such as sodium chloride (e.g., 0.1-2.0 M), glycine, and the like, and having a buffered pH compatible with physiological conditions to produce an aqueous solution, and rendering the solution sterile.
  • physiologically compatible substances such as sodium chloride (e.g., 0.1-2.0 M), glycine, and the like
  • physiologically compatible substances such as sodium chloride (e.g., 0.1-2.0 M), glycine, and the like
  • physiologically compatible substances such as sodium chloride (e.g., 0.1-2.0 M), glycine, and the like
  • physiologically compatible substances such as sodium chloride (e.g.,
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U. S. Patent No. 4,522,811.
  • Formulations for an intranasal delivery are described in US Patent Nos. 5,427,782, 5,843,451 and 6,398,774, which are incorporated herein in their entirety by reference. Other means of mucosal administration are also encompassed herein.
  • the formulations of a vaccine composition as disclosed herein can also incorporate a stabilizer.
  • Illustrative stabilizers are polyethylene glycol, proteins, saccharide, amino acids, inorganic acids, and organic acids which may be used either on their own or as admixtures.
  • Two or more stabilizers may be used in aqueous solutions at the appropriate concentration and/or pH.
  • the specific osmotic pressure in such aqueous solution is generally in the range of 0.1-3.0 osmoses, preferably in the range of 0.80-1.2.
  • the pH of the aqueous solution is adjusted to be within the range of 5.0-9.0, preferably within the range of 6-8.
  • a vaccine composition can be combined with typical carriers, such as lactose, sucrose, starch, talc magnesium stearate, crystalline cellulose, methyl cellulose, carboxymethyl cellulose, glycerin, sodium alginate or gum arabic among others.
  • typical carriers such as lactose, sucrose, starch, talc magnesium stearate, crystalline cellulose, methyl cellulose, carboxymethyl cellulose, glycerin, sodium alginate or gum arabic among others.
  • the present invention provides immunogenic compositions (e.g., vaccines) comprising a novel pneumococcal antigen, e.g., one or more of a polypeptide antigen selected from Table 1 or functional fragments thereof and any combinations thereof, and one or more pharmaceutically acceptable excipients.
  • a method of administering an inventive immunogenic composition to a subject in need thereof is provided.
  • inventive compositions are administered to humans.
  • the phrase "active ingredient" generally refers to an inventive immunogenic composition comprising at least one chlamydia antigen and optionally comprising one or more additional agents, such as an adjuvant.
  • immunogenic compositions are principally directed to compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of immunogenic compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
  • Subjects to which administration of the immunogenic compositions of the invention is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as domestic animals, cattle, pigs, horses, sheep, cats, and/or dogs; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys.
  • the formulations of the immunogenic compositions described herein may be prepared by any method known or hereafter developed in the art of vaccines.
  • such preparatory methods include the step of bringing the antigen(s) (or nucleic acids encoding the antigens, for nucleic acid based applications) into association with one or more excipients and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping and/or packaging the product into a desired single- or multi-dose unit.
  • An immunogenic composition of the invention may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a "unit dose" is discrete amount of the immunogenic composition comprising a predetermined amount of the antigen(s).
  • compositions of the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • Immunogenic formulations of the present invention may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • a pharmaceutically acceptable excipient includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • Remington's The Science and Practice of Pharmacy, 21.sup.st Edition, A. R. Gennaro, discloses various excipients used in formulating pharmaceutical compositions and known techniques for the preparation thereof.
  • the pharmaceutically acceptable excipient is at least 95%, 96%>, 97%, 98%), 99%o, or 100% pure.
  • the excipient is approved for use in humans and for veterinary use.
  • the excipient is approved by United States Food and Drug Administration.
  • the excipient is pharmaceutical grade.
  • the excipient meets the standards of the United States Pharmacopoeia (USP), the European
  • compositions used in the manufacture of immunogenic compositions include, but are not limited to, inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Such excipients may optionally be included in the inventive formulations.
  • Injectable formulations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • a sterile injectable preparation may be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3- butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution.
  • sterile, fixed oils are examples of the acceptable vehicles and solvents that may be employed.
  • any bland fixed oil can be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid are used in the preparation of injectables.
  • Injectable formulations can be sterilized, for example, by filtration through a bacterial- retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • an immunogenic composition is administered to a mucosal surface.
  • Compositions for rectal or vaginal administration can include suppositories which can be prepared by mixing immunogenic compositions of this invention with suitable excipients such as cocoa butter, polyethylene glycol or a suppository wax, which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release antigen.
  • an immunogenic composition is administered orally.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.
  • the antigen can be mixed with at least one inert, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents
  • Suitable devices for use in delivering immunogenic compositions by an intradermal route described herein include short needle devices such as those described in U.S. Pat. Nos. 4,886,499; 5,190,521; 5,328,483; 5,527,288; 4,270,537; 5,015,235; 5,141,496; and 5,417,662. Jet injection devices which deliver liquid immunogenic compositions to the dermis via a liquid jet injector and/or via a needle which pierces the stratum corneum and produces a jet which reaches the dermis are suitable. Jet injection devices are described, for example, in U.S. Pat. Nos.
  • the vaccine formulation or immunogenic composition may be suitable for administration to a human patient, and vaccine or immunogenic composition preparation may conform to USFDA guidelines.
  • the vaccine formulation or immunogenic composition is suitable for administration to a non-human animal.
  • the vaccine or immunogenic composition is substantially free of either endotoxins or exotoxins. Endotoxins may include pyrogens, such as lipopolysaccharide (LPS) molecules.
  • LPS lipopolysaccharide
  • the vaccine or immunogenic composition may also be substantially free of inactive protein fragments which may cause a fever or other side effects.
  • the composition contains less than 1%, less than 0.1%, less than 0.01%, less than 0.001%), or less than 0.0001%) of endotoxins, exotoxins, and/or inactive protein fragments.
  • the vaccine or immunogenic composition has lower levels of pyrogens than industrial water, tap water, or distilled water.
  • Other vaccine or immunogenic composition components may be purified using methods known in the art, such as ion-exchange chromatography, ultrafiltration, or distillation.
  • the pyrogens may be inactivated or destroyed prior to
  • raw materials for vaccines such as water, buffers, salts and other chemicals may also be screened and depyrogenated. All materials in the vaccine may be sterile, and each lot of the vaccine may be tested for sterility.
  • the endotoxin levels in the vaccine fall below the levels set by the USFDA, for example 0.2 endotoxin (EU)/kg of product for an intrathecal injectable composition; 5 EU/kg of product for a non-intrathecal injectable composition, and 0.25-0.5 EU/mL for sterile water.
  • EU endotoxin
  • the preparation comprises less than 50%, 20%, 10%>, or 5% (by dry weight) contaminating protein.
  • the desired molecule is present in the substantial absence of other biological macromolecules, such as other proteins (particularly other proteins which may substantially mask, diminish, confuse or alter the characteristics of the component proteins either as purified preparations or in their function in the subject reconstituted mixture).
  • the vaccine or immunogenic composition comprising purified subunit proteins contains less than 5%, 2%, 1%), 0.5%), 0.2%), 0.1%) of protein from host cells in which the subunit proteins were expressed, relative to the amount of purified subunit.
  • the desired polypeptides are substantially free of nucleic acids and/or carbohydrates.
  • the vaccine or immunogenic composition contains less than 5%, less than 2%, less than 1%, less than 0.5%), less than 0.2%, or less than 0.1% host cell DNA and/or RNA.
  • At least 80%), 90%), 95%), 99%), or 99.8% (by dry weight) of biological macromolecules of the same type are present in the preparation (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present).
  • the vaccine or immunogenic composition has low or no toxicity, within a reasonable risk-benefit ratio.
  • the vaccine or immunogenic composition comprises ingredients at concentrations that are less than LD.50 measurements for the animal being vaccinated. LD50 measurements may be obtained in mice or other experimental model systems, and extrapolated to humans and other animals. Methods for estimating the LD50 of compounds in humans and other animals are well-known in the art.
  • a vaccine formulation or immunogenic composition, and any component within it, might have an LD50 value in rats of greater than 100 g/kg, greater than 50 g/kg, greater than 20 g/kg, greater than 10 g/kg, greater than 5 g/kg, greater than 2 g/kg, greater than 1 g/kg, greater than 500 mg/kg, greater than 200 mg/kg, greater than 100 mg/kg, greater than 50 mg/kg, greater than 20 mg/kg, or greater than 10 mg/kg.
  • a vaccine formulation or immunogenic composition that comprises a toxin such as botulinum toxin (which can be used as an adjuvant) should contain significantly less than the LD50 of botulinum toxin.
  • formulations suitable for introduction of the vaccine formulations or pharmaceutical composition vary according to route of administration.
  • Formulations suitable for parenteral administration such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, intranasal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and nonaqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials.
  • Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • the cells can be administered intravenously or parenterally.
  • Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the polypeptides or packaged nucleic acids suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
  • liquid solutions such as an effective amount of the polypeptides or packaged nucleic acids suspended in diluents, such as water, saline or PEG 400
  • capsules, sachets or tablets each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin
  • suspensions in an appropriate liquid and (d) suitable emulsions.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers.
  • Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.
  • the pharmaceutical compositions can be encapsulated, e.g., in liposomes, or in a formulation that provides for slow release of the active ingredient.
  • the antigens can be made into aerosol formulations (e.g., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. Aerosol formulations can be delivered orally or nasally.
  • Suitable formulations for vaginal or rectal administration include, for example, suppositories, which consist of the polypeptides or packaged nucleic acids with a suppository base.
  • Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons.
  • gelatin rectal capsules which consist of a combination of the polypeptides or packaged nucleic acids with a base, including, for example, liquid triglycerides, polyethylene glycols, and paraffin hydrocarbons.
  • the amount of antigen in each vaccine or immunogenic composition dose is selected as an effective amount, which induces a prophylactic or therapeutic response, as described above, in either a single dose or over multiple doses.
  • the dose is without significant adverse side effects in typical vaccinees. Such amount will vary depending upon which specific antigen is employed.
  • a dose will comprise 1-1000 ⁇ g of each protein, in some instances 2-100 ⁇ g, for instance 4-40 ⁇ g.
  • the vaccine formulation comprises 1-1000 ⁇ g of the polypeptide and 1-250 ⁇ g of the adjuvant.
  • the appropriate amount of antigen to be delivered will depend on the age, weight, and health (e.g. immunocompromised status) of a subject.
  • typically an adjuvant will be present in amounts from 1 ⁇ g-250 ⁇ g per dose, for example 50-150 ⁇ g, 75-125 ⁇ g or 100 ⁇ g.
  • only one dose of the vaccine is administered to achieve the results described above.
  • subjects receive one or more boost vaccinations, for a total of two, three, four or five vaccinations.
  • the number is three or fewer.
  • a boost vaccination may be administered, for example, about 1 month, 2 months, 4 months, 6 months, or 12 months after the initial vaccination, such that one vaccination regimen involves administration at 0, 0.5-2 and 4-8 months. It may be advantageous to administer split doses of vaccines which may be administered by the same or different routes.
  • the vaccines and immunogenic compositions described herein may take on a variety of dosage forms.
  • the composition is provided in solid or powdered (e.g., lyophilized) form; it also may be provided in solution form.
  • a dosage form is provided as a dose of lyophilized composition and at least one separate sterile container of diluent.
  • the composition will be administered in a dose escalation manner, such that successive administrations of the composition contain a higher concentration of composition than previous administrations. In some embodiments, the composition will be administered in a manner such that successive administrations of the composition contain a lower concentration of composition than previous administrations.
  • a therapeutically effective amount of an inventive immunogenic composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after exposure to a chlamydia organism or diagnosis with a chlamydial disease, disorder, and/or condition.
  • a therapeutic amount of an inventive composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after onset of symptoms of a chlamydial disease, disorder, and/or condition.
  • the amount of an immunogenic composition is sufficient to reduce risk of infection by, or treat, alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of one or more symptoms or features of the chlamydial disease, disorder, and/or condition.
  • Immunogenic compositions may be administered using any amount and any route of administration effective for treatment.
  • the exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the infection, the particular composition, its mode of administration, its mode of activity, and the like.
  • the specific effective dose level for any particular subject or organism will depend upon a variety of factors including the immunogenicity of the antigen composition employed; the specific composition employed; the nature of adjuvant used; the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and like factors well known in the medical arts.
  • compositions are administered to a patient suffering from a disease in an amount sufficient to treat the patient.
  • Therapeutic applications of a composition described herein include reducing transmissibility, slowing disease progression, reducing bacterial viability or replication, or inhibiting the expression of proteins required for toxicity, such as by 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of the levels at which they would occur in individuals who are not treated with the composition.
  • compositions are administered to a human or other mammal to induce an immune response that can inhibit the establishment of an infectious disease or other condition.
  • a composition may partially block the bacterium from establishing an infection.
  • the compositions are administered in combination with antibiotics.
  • antibiotics are used to treat pneumococcal infections, including penicillin, amoxicillin, amoxicillin/clavulanate, cefuroxime, cefotaxime, ceftriaxone, and vancomycin.
  • the appropriate antibiotic may be selected based on the type and severity of the infection, as well as any known antibiotic resistance of the infection (Jacobs M R "Drug-resistant Streptococcus pneumoniae: rational antibiotic choices" Am J. Med. 1999 May 3; 106 (5A): 19S-25S).
  • a method of immunization or vaccinating a mammal against pneumococcal infections comprises administering a vaccine composition described herein.
  • the immunogenic compositions or vaccine compositions as described herein can be administered intravenously, intranasally, intramuscularly, subcutaneously,
  • a preferred route of administration is intranasal or by other mucosal route.
  • Vaccination can be conducted by conventional methods.
  • an immunogen as polypeptide as disclosed in Table 1 can be used in a suitable diluent such as saline or water, and optionally with complete or incomplete adjuvants.
  • the vaccine can be administered by any route appropriate for eliciting an immune response.
  • the vaccine can be administered once or at periodic intervals until an immune response is elicited.
  • Immune responses can be detected by a variety of methods known to those skilled in the art, including but not limited to, antibody production, cytotoxicity assay, proliferation assay and cytokine release assays.
  • samples of blood can be drawn from the immunized mammal, and analyzed for the presence of antibodies against the immunogen protein used in the vaccination by ELISA and the titer of these antibodies can be determined by methods known in the art.
  • Immunogenic compositions of the present invention may be administered by any route that elicits an immune response.
  • an immunogenic composition is administered subcutaneously.
  • an immunogenic composition is administered intramuscularly.
  • the immunogenic compositions of the present invention are administered by a variety of routes, including oral, intravenous, intra-arterial, intramedullary, intrathecal,
  • the vaccine formulations and pharmaceutical compositions herein can be delivered by administration to an individual, typically by systemic administration (e.g., intravenous,
  • the route of administration is
  • the route of administration is intramuscular. In other embodiments, the route of administration is subcutaneous. In yet other embodiments, the route of administration is mucosal. In certain embodiments, the route of administration is transdermal or intradermal
  • transdermal administration is one suitable route of administration for S. pneumoniae vaccines comprising toxins (e.g. cholera toxin or labile toxin); in other embodiments, the administration is intranasal.
  • Vaccines formulated with Alphavirus replicons may be administered, for example, by the intramuscular or the subcutaneous route.
  • Vaccines comprising Monophosphory Lipid A (MPL), Trehalose Dicoynomycolate (TDM), and dioctadecyldimethylammonium bromide (DDA) are suitable (inter alia) for intramuscular and subcutaneous administration.
  • a vaccine comprising resiquimod may be administered topically or subcutaneously, for example.
  • an immunogenic composition of the invention may be administered in amounts that include a protein antigen in ranges of ⁇ g-50C ⁇ g. In some embodiments, a dose of about lC ⁇ g, 20, 30 ⁇ g, 50 ⁇ g, or 100 ⁇ g is administered to a human.
  • an immunogenic composition is administered more than once (e.g., twice, three times, four times, five times).
  • a boost is given about one week, two weeks, three weeks, one month, three months, six months, one year, or longer after an initial immunization.
  • the S. pneumoniae vaccines and immunogenic compositions described herein may be produced using a variety of techniques.
  • a polypeptide may be produced using recombinant DNA technology in a suitable host cell.
  • a suitable host cell may be bacterial, yeast, mammalian, or other type of cell.
  • the host cell may be modified to express an exogenous copy of one of the relevant polypeptide genes.
  • the gene is operably linked to appropriate regulatory sequences such as a strong promoter and a polyadenylation sequence.
  • the promoter is inducible or repressible.
  • the gene may be present on an extrachromosomal plasmid, or may be integrated into the host genome.
  • One of skill in the art will recognize that it is not necessary to use a nucleic acid 100% identical to the naturally-occurring sequence. Rather, some alterations to these sequences are tolerated and may be desirable.
  • the nucleic acid may be altered to take advantage of the degeneracy of the genetic code such that the encoded polypeptide remains the same.
  • the gene is codon-optimized to improve expression in a particular host.
  • the nucleic acid may be produced, for example, by PCR or by chemical synthesis.
  • a polypeptide may be isolated from it.
  • the isolation may be accomplished, for example, by affinity purification techniques or by physical separation techniques (e.g., a size column).
  • a method of manufacture comprising mixing one or more polypeptides or an immunogenic fragment or variant thereof with a carrier and/or an adjuvant.
  • antigens for inclusion the vaccine formulations and immunogenic compositions may be produced in cell culture.
  • One method comprises providing one or more expression vectors and cloning nucleotides encoding one or more polypeptides selected from polypeptides having an amino acid sequence of Table 1, such as SEQ ID NO: 1 -76 or 153-234, then expressing and isolating the polypeptides.
  • the immunogenic polypeptides described herein, and nucleic acid compositions that express the polypeptides can be packaged in packs, dispenser devices, and kits for administering nucleic acid compositions to a mammal.
  • packs or dispenser devices that contain one or more unit dosage forms are provided.
  • instructions for administration of the compounds will be provided with the packaging, along with a suitable indication on the label that the compound is suitable for treatment of an indicated condition, such as those disclosed herein.
  • compositions described herein may stimulate an antibody response or a cell-mediated immune response, or both, in the mammal to which it is administered.
  • the composition stimulates a TH1 -biased CD4+ T cell response, a TH17-biased CD4+ T cell response and/or a CD8+ T cell response.
  • the composition stimulates an antibody response.
  • the composition stimulates a TH1 -biased CD4+ T cell response, TH17-biased CD4+ T cell response and/or a CD8+ T cell response, and an antibody response.
  • the composition (e.g., one comprising one or more polypeptides of Table 1 or 2, or nucleic acids encoding the polypeptides, or antibodies reactive with the peptides) includes a cytokine or nucleotide coding region encoding a cytokine such as IL-17, to provide additional stimulation to the immune system of the mammal.
  • the composition comprises a cytokine such as IL-17.
  • a T.sub.Hl 7 cell response is desirable in mounting an immune response to the compositions disclosed herein, e.g., ones comprising one or more polypeptides of Table 1 or 2.
  • an active T.sub.H17 response is beneficial in clearing a pneumococcal infection. For instance, mice lacking the IL-17A receptor show decreased whole cell vaccine -based protection from a pneumococcal challenge (Lu et al.,
  • compositions described herein e.g., ones comprising one or more polypeptides of Table 1 or 2
  • this application provides a method of activating T.sub.H17 cells by
  • IL-17A levels result in increased pneumococcal killing by neutrophils or neutrophil-like cells, for instance by inducing recruitment and activation of neutrophils of neutrophil-like cells.
  • this pneumococcal killing is independent of antibodies and complement.
  • specific antibody production and complement activation may be useful additional mechanisms that contribute to clearing of a pneumococcal infection.
  • Immunogenic compositions containing immunogenic polypeptides or polynucleotides encoding immunogenic polypeptides together with a pharmaceutical carrier are also provided.
  • the immunogenic composition comprises one or more nucleic acids encoding one or more polypeptides of SEQ ID NOS: 1-76, such as one or more nucleic acids selected from SEQ ID Nos. 77-152.
  • these nucleic acids are expressed in the immunized individual, producing the encoded S. pneumoniae antigens, and the S. pneumoniae antigens so produced can produce an immunostimulatory effect in the immunized individual.
  • Such a nucleic acid-containing immunostimulatory composition may comprise, for example, an origin of replication, and a promoter that drives expression of one or more nucleic acids encoding one or more polypeptides of SEQ ID NOS: 1-76.
  • Such a composition may also comprise a bacterial plasmid vector into which is inserted a promoter (sometimes a strong viral promoter), one or more nucleic acids encoding one or more polypeptides of SEQ ID NOS: 1 -76, and a promoter (sometimes a strong viral promoter), one or more nucleic acids encoding one or more polypeptides of SEQ ID NOS: 1 -76, and a promoter (sometimes a strong viral promoter), one or more nucleic acids encoding one or more polypeptides of SEQ ID NOS: 1 -76, and a promoter (sometimes a strong viral promoter), one or more nucleic acids encoding one or more polypeptides of SEQ ID NOS: 1 -76
  • nucleic acid is DNA. Diagnostic Uses
  • This application provides, inter alia, a rapid, inexpensive, sensitive, and specific method for detection of S. pneumoniae in patients. In this respect it should be useful to all hospitals and physicians examining and treating patients with or at risk for S. pneumoniae infection. Detection kits can be simple enough to be set up in any local hospital laboratory, and the antibodies and antigen- binding portions thereof can readily be made available to all hospitals treating patients with or at risk for S. pneumoniae infection.
  • "patient” refers to an individual (such as a human) that either has an S. pneumoniae infection or has the potential to contract an S. pneumoniae infection.
  • a patient may be an individual (such as a human) that has an S. pneumoniae infection, has the potential to contract an S. pneumoniae infection, who has recovered from S. pneumoniae infection, and/or an individual whose infection status is unknown.
  • one of the antigens for use in a diagnostic is any pneumococcal antigen selected from SEQ ID NO: 1 -76.
  • the instant disclosure also provides a method of phenotyping biological samples from patients suspected of having a S.
  • pneumoniae infection (a) obtaining a biological sample from a patient; (b) contacting the sample with two or more S. pneumoniae-specific antibodies or antigen-binding portions thereof under conditions that allow for binding of the antibody or antigen-binding portion to an epitope of S. pneumoniae; where binding indicates the presence of S. pneumoniae in the sample.
  • the binding to the biological sample is compared to binding of the same antibody to a negative control tissue, wherein if the biological sample shows the presence of S. pneumoniae as compared to the negative control tissue, the patient is identified as likely having a S. pneumoniae infection.
  • binding of one antibody indicates the presence of S. pneumoniae; in other cases, the binding of two or more antibodies indicates the presence of S. pneumoniae.
  • the aforementioned test may be appropriately adjusted to detect other bacterial infections, for instance by using an antibody immunoreactive a homolog (from another bacterial species) of one of the proteins described in Table 1.
  • the antibodies raised against a S. pneumoniae protein in Table 1 will also bind the homolog in another Streptococcus species, especially if the homologs have a high percentage sequence identity.
  • an antigen of Table 1 such as SEQ ID NO: 1 -76
  • the instant disclosure also provides a method of phenotyping biological samples from patients suspected of having a S. pneumoniae infection: (a) obtaining a biological sample from a patient; (b) contacting the sample with two or more S.
  • the binding to the biological sample is compared to binding of the same antigen to a negative control tissue, wherein if the biological sample shows the presence of anti-S.
  • the patient is identified as likely either (1) having a S. pneumoniae infection, or (2) having had a S. pneumoniae infection in the past.
  • detecting one antibody indicates a current or past infection with S. pneumoniae; in other cases, detecting two or more antibodies indicates a current or past infection with S. pneumoniae.
  • the aforementioned test may be appropriately adjusted to detect other bacterial infections, for instance by using a homolog (from another bacterial species (e.g., a Streptococcal species) of the proteins described in Table 1.
  • the immune cell response of a mammalian cell may be quantified ex vivo.
  • a method for such quantification comprises administering the compositions herein disclosed to a mammalian T cell ex vivo, and quantifying the change in cytokine production of the mammalian T cell in response to the composition.
  • the cytokine may be, for example, IL-17.
  • an S. pneumoniae antibody to an antigen may be measured using any appropriate method.
  • antigen e.g., a polypeptide of Table 1, such as SEQ ID NO: 1 -76
  • ELISA enzyme-linked immunosorbent assay
  • Western blotting Western blotting
  • competition assay competition assay
  • spot-blot spot-blot.
  • the detection step may be, for instance, chemiluminescent, fluorescent, or colorimetric.
  • One suitable method for measuring antibody-protein binding is the Luminex xMAP system, where peptides are bound to a dye-containing microsphere. Certain systems, including the xMAP system, are amenable to measuring several different markers in multiplex, and could be used to measure levels of antibodies at once.
  • other systems are used to assay a plurality of markers in multiplex.
  • profiling may be performed using any of the following systems: antigen microarrays, bead microarrays, nanobarcodes particle technology, arrayed proteins from cDNA expression libraries, protein in situ array, protein arrays of living transformants, universal protein array, lab-on-a- chip microfluidics, and peptides on pins.
  • Another type of clinical assay is a chemiluminescent assay to detect antibody binding.
  • antibodies are bound to a solid-phase support made up of microparticles in liquid suspension, and a surface fluorometer is used to quantify the enzymatic generation of a fluorescent product.
  • the biological sample shows the presence of S. pneumoniae (e.g., by detecting one or more polypeptide of Table 1, such as SEQ ID NO: 1 -76, or an antibody that binds one of said polypeptides), one may administer a therapeutically effective amount of the compositions and therapies described herein to the patient.
  • the biological sample may comprise, for example, blood, semen, urine, vaginal fluid, mucus, saliva, feces, urine, cerebrospinal fluid, or a tissue sample.
  • the biological sample is an organ intended for transplantation.
  • the biological sample before the detection step, is subject to culture conditions that promote the growth of S. pneumoniae.
  • the diagnostic tests herein may be used to detect S. pneumoniae in a variety of samples, including samples taken from patients and samples obtained from other sources.
  • the diagnostic tests may be used to detect S. pneumoniae in food, drink, or ingredients for food and drink; on objects such as medical instruments, medical devices such as cochlear implants and pacemakers, shoes, clothing, furniture including hospital furniture, and drapes including hospital drapes; or in samples taken from the environment such as plant samples.
  • the tests herein may be performed on samples taken from animals such as agricultural animals (cows, pigs, chickens, goats, horses and the like), companion animals (dogs, cats, birds, and the like), or wild animals.
  • the tests herein may be performed on samples taken from cell cultures such as cultures of human cells that produce a therapeutic protein, cultures of bacteria intended to produce a useful biological molecule, or cultures of cells grown for research purposes.
  • This disclosure also provides a method of determining the location of a S. pneumoniae infection in a patient comprising: (a) administering a pharmaceutical composition comprising a labeled S. pneumoniae antibody or antigen-binding portion thereof to the patient, and (b) detecting the label, wherein binding indicates a S. pneumoniae infection in a particular location in the patient.
  • a diagnostic may also comprise comparing the levels of binding in the patient to a control.
  • the method further comprises, if the patient has a S. pneumoniae infection, treating the infection by administering a therapeutically effective amount of a S. pneumoniae-binding antibody or antigen-binding portion thereof to the patient.
  • the method further comprises, if the patient has a S. pneumoniae infection, treating the infection by administering a therapeutically effective amount of a S. pneumoniae protein of Table 1 or 2, or immunogenic portion thereof, to the patient.
  • the method may further comprise determining the location and/or volume of the S.
  • This method may be used to evaluate the spread of S. pneumoniae in the patient and determine whether a localized therapy is appropriate.
  • the anti-S. pneumoniae antibodies or T cells described herein may be used to make a prognosis of the course of infection.
  • the anti-S. pneumoniae antibodies or T cells herein may be detected in a sample taken from a patient. If antibodies or T cells are present at normal levels, it would indicate that the patient has raised an immune response against anti-S. pneumoniae. If antibodies or T cells are absent, or present at reduced levels, it would indicate that the patient is failing to raise a sufficient response against anti-S. pneumoniae, and a more aggressive treatment would be recommended.
  • antibodies or T cells present at reduced levels refers to antibodies that are present at less than 50%, 20%, 10%>, 5%, 2%, or 1% the level of antibodies or T cells typical in a patient with a normal immune system.
  • Antibodies may be detected by affinity for any of the antigens described herein (e.g., those in Table 1 and/or 2), for example using ELISA.
  • T cells may be detected by ex vivo responses for any of the antigens described herein (e.g., those in Table 1 and/or 2), for example using ELISA or ELISPOT assays.
  • detection of specific S. pneumoniae antigens may be used to predict the progress and symptoms of S. pneumoniae infection in a patient. It will be understood by one of skill in the art that the methods herein are not limited to detection of S. pneumoniae.
  • Other embodiments include the detection of related bacteria including bacteria with proteins homologous to the proteins described in Table 1 or 2. Such related bacteria include, for example, other strains of Streptococcus.
  • pneumococcal antigen proteins of Table 1 or immunogen mixtures may be useful in diagnostics.
  • kits comprising one or more of the pneumococcal antigens as described herein.
  • the invention provides a kit including a novel pneumococcal antigen and instructions for use.
  • a kit may include multiple different pneumococcal antigens.
  • a kit may include any of a number of additional components or reagents in any combination. All of the various combinations are not set forth explicitly but each combination is included in the scope of the invention.
  • kits may include, for example, (i) an immunogenic composition including at least one of the following chlamydia antigens:
  • kits that include nucleic acids encoding chlamydia antigens are also provided.
  • a kit may include, for example, (i) a composition including a nucleic acid encoding a pneumococcal antigen; (ii) instructions for use of the nucleic acid compositing (e.g., instructions for expressing the nucleic acid for producing the antigen, or instructions for administering the composition to a subject in need thereof to elicit a response against pneumococcus).
  • kits may, for example, include protocols and/or describe conditions for production of immunogenic compositions and/or administration of immunogenic compositions, to a subject in need thereof, etc.
  • Kits generally include one or more vessels or containers so that some or all of the individual components and reagents may be separately housed.
  • Kits may also include a means for enclosing individual containers in relatively close confinement for commercial sale, e.g., a plastic box, in which instructions, packaging materials such as styrofoam, etc., may be enclosed.
  • An identifier e.g., a bar code, radio frequency identification (ID) tag, etc., may be present in or on the kit or in or one or more of the vessels or containers included in the kit.
  • An identifier can be used, e.g., to uniquely identify the kit for purposes of quality control, inventory control, tracking, movement between workstations, etc.
  • An immunogenic composition comprising at least one isolated pneumococcal antigen or fragment thereof with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234, and wherein the composition elicits an immune response against Streptococcus pneumoniae when administered to a mammal.
  • CWPS pneumococcal cell wall polysaccharide
  • composition induces a IL-17A (Thl7-cell) response in a subject.
  • IL-17A Thl7-cell
  • composition is further prepared as a vaccine that reduces or protects a mammal against pneumococcal colonization.
  • immunogenic composition of any of paragraphs 1 to 7, wherein the immunogenic composition further comprises an adjuvant.
  • immunogenic composition of any of paragraphs 1 to 9, wherein the immunogenic composition comprises at least 2 pneumococcal antigens or fragments with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • immunogenic composition of any of paragraphs 1 to 10, wherein the immunogenic composition comprises at least 3 pneumococcal antigens or fragments with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • immunogenic composition of any of paragraphs 1 to 11, wherein the immunogenic composition comprises at least 5 pneumococcal antigens or fragments with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • immunogenic composition of any of paragraphs 1 to 12, wherein the immunogenic composition comprises between 5 and 20 pneumococcal antigens or fragments thereof with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • immunogenic composition of any of paragraphs 1 to 13, wherein the immunogenic composition comprises more than 20 pneumococcal antigens or fragments thereof with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234.
  • a pneumococcal protein or protein fragment is at least one of the pneumococcal proteins SP0785, SP1500 and SP2145.
  • a method of inducing an IL-17A response in a subject comprising administering to the subject at least one immunogenic composition of any of paragraphs 1 - 17 effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • a method to protect against pneumococcal colonization comprising administering to the subject at least one immunogenic composition of any of paragraphs 1 - 17.
  • a method to elicit an immune response against Streptococcus pneumoniae in a mammal comprising administering to the mammal at least one immunogenic composition comprising one or more isolated pneumococcal antigen or fragment thereof with the amino acid sequence selected from SEQ ID NO: 1-76 or SEQ ID NO: 153-234 in an effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • a method to protect against Streptococcus penumoniae or Salmonaell typhii colonization in a mammal comprising administering to the mammal at least one immunogenic composition of any of paragraphs 1 - 17 in effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • a method to protect against an invasive disease of Streptococcus pneumoniae in a subject comprising administering to the subject an immunogenic composition of any of paragraphs 1 - 17 in effective to induce an immune response against Streptococcus pneumoniae in the subject.
  • the immunogenic composition comprises at least one isolated pneumococcal antigen or fragment thereof is SP1386, SP1500, SP0084 and SP1479 and SP0346.
  • IP intraperitoneal
  • Aluminum hydroxide (alum) was from Brenntag North America (2%
  • Ni-NTA resin was purchased from Qiagen. CloneEZ PCR cloning kit was obtained from Genscript Inc. All other reagents were obtained from Sigma or Thermo Fisher Scientific.
  • Vi was resuspended to 5 mg/ml in buffer A (0.2 M MES, 150 mM NaCl, pH 5.9), and l-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and NHS-Sulfo was added into solution as powder for 30 minutes at 4°C .
  • Reaction buffer was raised to pH7.5 by addtion of 1M Na 2 HP0 4 . Proteins were then added to the reaction as 2mg/mg, protein/sugar. The reaction was carried out at 4°C for 48 hours with rotation. Conjugates were separated by elution through a Sephacryl S500 gel filtration column and collection of the void volume fractions.
  • mice splenocytes and human peripheral blood mononuclear cells were harvested from either whole cell vaccine (WCV) immunized C57BL/6 mice or mice have been repeatedly colonized with S. pneumoniae were processed into a cellular suspension and stimulated with different concentration of recombinant proteins. Splenocytes were incubated for 3 days; plates were then spun to pellet cells, after which the supematants were collected and assayed for IL-17A using a mouse IL-17A ELISA kit (R&D Systems, Inc).
  • Human PBMC were separated from healthy adult volunteers and cultured in 96 well plates. Cells were stimulated with different concentration of recombinant proteins for 4 days and then analyzed for IL-17A in the supernatant using a human IL-17A ELISA kit (ebioscience).
  • Vaccines were prepared the same day of immunization by mixing purified proteins (5 ⁇ g) with 1 ⁇ g Cholera toxin (CT) per mouse in a final 20 ⁇ of saline.
  • CT Cholera toxin
  • alum aluminum hydroxide
  • IP challenge was given 1000 cfu of strain WU2-ply (an engineered strain that replaced ply with His-tagged ply) in 200 ⁇ PBS, and sickness or death of mice was monitored twice daily for 14 days. All animal studies were approved by our local animal ethics committees.
  • Enzyme-linked immunosorbent assay (ELISA) and IL-17A production in whole blood samples. Assays for murine antibodies for individual protein and IL-17A production in whole blood were carried out as previously described [2].
  • S. pneumoniae sequences available from the integrated microbial genomes website (world wide web: "//img.jgi.doe.gov/cgi-bin/w/main.cgi"). Beginning with the sequenced TIGR4 strain, the inventors analyzed the genome for predicted secretion signal peptides and cell wall anchor motifs. The inventors identified 335 proteins with a secretion signal peptide in TIGR4 and 15 proteins with possible cell wall anchor motifs.
  • SpO 107-1 AATCATCAACTTACAC (SEQ ID NO:
  • SP0402 (29-end) signal peptidase.
  • Sp0402-1 CGGGATCCGAATTCGAGCTCCTGGA (SEQ ID NO: 167)
  • Serine peptidase GCAATGTTCGCGTAG (SEQ ID NO: 167)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2014/015254 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease Ceased WO2014124228A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA2900008A CA2900008C (en) 2013-02-07 2014-02-07 PROTEIN ANTIGENS THAT CONFER PROTECTION AGAINST COLONIZATION AND/OR PNEUMOCOCCAL DISEASE
ES14748672T ES2959258T3 (es) 2013-02-07 2014-02-07 Antígenos proteicos que proporcionan protección contra la colonización y/o la enfermedad neumocócicas
JP2015557089A JP6494527B2 (ja) 2013-02-07 2014-02-07 肺炎球菌のコロニー形成および/または疾患からの保護を提供するタンパク質抗原
EP14748672.4A EP2953638B1 (en) 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease
AU2014214844A AU2014214844B2 (en) 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease
US14/766,252 US11576958B2 (en) 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease
EP23182914.4A EP4272750A3 (en) 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease
AU2018201768A AU2018201768B2 (en) 2013-02-07 2018-03-13 Protein antigens that provide protection against pneumococcal colonization and/or disease
US17/834,865 US12083173B2 (en) 2013-02-07 2022-06-07 Protein antigens that provide protection against pneumococcal colonization and/or disease
US18/799,550 US20250114443A1 (en) 2013-02-07 2024-08-09 Protein antigens that provide protection against pneumococcal colonization and/or disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361762062P 2013-02-07 2013-02-07
US61/762,062 2013-02-07

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/766,252 A-371-Of-International US11576958B2 (en) 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease
US17/834,865 Division US12083173B2 (en) 2013-02-07 2022-06-07 Protein antigens that provide protection against pneumococcal colonization and/or disease

Publications (1)

Publication Number Publication Date
WO2014124228A1 true WO2014124228A1 (en) 2014-08-14

Family

ID=51300148

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/015254 Ceased WO2014124228A1 (en) 2013-02-07 2014-02-07 Protein antigens that provide protection against pneumococcal colonization and/or disease

Country Status (7)

Country Link
US (3) US11576958B2 (cg-RX-API-DMAC7.html)
EP (2) EP4272750A3 (cg-RX-API-DMAC7.html)
JP (2) JP6494527B2 (cg-RX-API-DMAC7.html)
AU (2) AU2014214844B2 (cg-RX-API-DMAC7.html)
CA (2) CA3247431A1 (cg-RX-API-DMAC7.html)
ES (1) ES2959258T3 (cg-RX-API-DMAC7.html)
WO (1) WO2014124228A1 (cg-RX-API-DMAC7.html)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019211477A1 (en) * 2018-05-04 2019-11-07 Roger Karlsson Biomarkers for detecting microbial infection
US11013793B2 (en) 2018-09-12 2021-05-25 Affinivax, Inc. Multivalent pneumococcal vaccines
WO2022031087A1 (ko) * 2020-08-07 2022-02-10 (주)셀트리온 폐렴구균 다당류-세포벽 유래 물질 접합체를 포함하는 면역원성 조성물
US11305001B2 (en) 2017-03-28 2022-04-19 The Children's Medical Center Corporation Multiple antigen presenting system (MAPS)-based Staphylococcus aureus vaccine, immunogenic composition, and uses thereof
EP3849599A4 (en) * 2018-09-12 2022-06-29 The Children's Medical Center Corporation Pneumococcal fusion protein vaccines
US11560410B2 (en) 2011-05-11 2023-01-24 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
WO2023039223A1 (en) 2021-09-09 2023-03-16 Affinivax, Inc. Multivalent pneumococcal vaccines
US11612647B2 (en) 2017-06-23 2023-03-28 University Of Maryland, Baltimore Immunogenic compositions
RU2815390C2 (ru) * 2018-09-12 2024-03-14 Аффинивакс, Инк. Поливалентные пневмококковые вакцины
US12083173B2 (en) 2013-02-07 2024-09-10 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
WO2024229176A1 (en) 2023-05-04 2024-11-07 Affinivax, Inc. Rhizavidin variants
WO2025193903A1 (en) 2024-03-15 2025-09-18 Affinivax, Inc. Pneumococcal polysaccharide compositions and uses thereof

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3436061A4 (en) * 2016-03-31 2019-12-04 Liffey Biotech Limited Saccharide-polypeptide-conjugate compositions and methods of use thereof
US10738338B2 (en) 2016-10-18 2020-08-11 The Research Foundation for the State University Method and composition for biocatalytic protein-oligonucleotide conjugation and protein-oligonucleotide conjugate
MX2019009869A (es) 2017-02-24 2019-10-02 Merck Sharp & Dohme Formulaciones de vacunas de conjugado de neumococos.
WO2018183666A1 (en) 2017-03-31 2018-10-04 Boston Medical Center Corporation Methods and compositions using highly converved pneumococcal surface proteins
US12090198B2 (en) * 2017-05-22 2024-09-17 The Children's Medical Center Corporation Combined vaccine against mycobacterium tuberculosis
CN111093650B (zh) 2017-09-07 2024-03-01 默沙东有限责任公司 肺炎球菌多糖及其在免疫原性多糖-载体蛋白缀合物中的用途
WO2019070994A1 (en) 2017-10-04 2019-04-11 Liffey Biotech Limited SACCHARIDE-POLYPEPTIDE CONJUGATE COMPOSITIONS AND METHODS OF USE
GB201807303D0 (en) * 2018-05-03 2018-06-20 London School Of Hygeine & Tropical Medicine Glyconjugate vaccines
AU2019336940B2 (en) * 2018-09-06 2025-09-11 Bavarian Nordic A/S Storage improved poxvirus compositions
JP7759333B2 (ja) * 2020-03-03 2025-10-23 マヨ ファウンデーション フォー メディカル エデュケーション アンド リサーチ ジカウイルスポリペプチド
JP2026509511A (ja) * 2023-03-16 2026-03-19 アフィニバックス、インコーポレイテッド 免疫原性組成物

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000006737A2 (en) * 1998-07-27 2000-02-10 Microbial Technics Limited Streptococcus pneumoniae proteins and nucleic acid molecules
WO2002077021A2 (en) * 2001-03-27 2002-10-03 Chiron Srl. Streptococcus pneumoniae proteins and nucleic acids
WO2009143413A1 (en) * 2008-05-22 2009-11-26 Children'smedical Center Corporation Synergistic immunogenic fusion protein-polysaccharide conjugate

Family Cites Families (145)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3887699A (en) 1969-03-24 1975-06-03 Seymour Yolles Biodegradable polymeric article for dispensing drugs
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
GB1502774A (en) 1974-06-25 1978-03-01 Nat Res Dev Immunological preparations
US4242501A (en) 1979-08-08 1980-12-30 American Cyanamid Company Purification of pneumococcal capsular polysaccharides
US4270537A (en) 1979-11-19 1981-06-02 Romaine Richard A Automatic hypodermic syringe
PH19942A (en) 1980-11-18 1986-08-14 Sintex Inc Microencapsulation of water soluble polypeptides
IE52535B1 (en) 1981-02-16 1987-12-09 Ici Plc Continuous release pharmaceutical compositions
US4436727A (en) 1982-05-26 1984-03-13 Ribi Immunochem Research, Inc. Refined detoxified endotoxin product
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4987237A (en) 1983-08-26 1991-01-22 Ribi Immunochem Research, Inc. Derivatives of monophosphoryl lipid A
DE3413608A1 (de) 1984-04-11 1985-10-24 Hoechst Ag, 6230 Frankfurt Implantierbare zubereitungen von regulatorischen peptiden mit gesteuerter freisetzung und verfahren zu ihrer herstellung
US4686102A (en) 1984-04-12 1987-08-11 American Cyanamid Company Multivalent pneumococcal vaccine and preparation thereof
US6090406A (en) 1984-04-12 2000-07-18 The Liposome Company, Inc. Potentiation of immune responses with liposomal adjuvants
US5916588A (en) 1984-04-12 1999-06-29 The Liposome Company, Inc. Peptide-containing liposomes, immunogenic liposomes and methods of preparation and use
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
CA1299099C (en) 1986-03-06 1992-04-21 Paul Richard Wood In vitro assay for detecting cell-mediated immune responses
CA1283827C (en) 1986-12-18 1991-05-07 Giorgio Cirelli Appliance for injection of liquid formulations
GB8704027D0 (en) 1987-02-20 1987-03-25 Owen Mumford Ltd Syringe needle combination
NZ224422A (en) 1987-05-05 1990-11-27 Molecular Eng Ass Composition adapted for intranasal immunisation against viral infection comprising a glycoprotein complexed with a lipid
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
US4940460A (en) 1987-06-19 1990-07-10 Bioject, Inc. Patient-fillable and non-invasive hypodermic injection device assembly
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
US5339163A (en) 1988-03-16 1994-08-16 Canon Kabushiki Kaisha Automatic exposure control device using plural image plane detection areas
FR2638359A1 (fr) 1988-11-03 1990-05-04 Tino Dalto Guide de seringue avec reglage de la profondeur de penetration de l'aiguille dans la peau
GB8906795D0 (en) 1989-03-23 1989-05-10 Carroll Noel Method of preparing vaccines
CA2017507C (en) 1989-05-25 1996-11-12 Gary Van Nest Adjuvant formulation comprising a submicron oil droplet emulsion
JPH0372423A (ja) 1989-05-26 1991-03-27 Green Cross Corp:The パーフルオロカーボン化合物含有乳化製剤
US5064413A (en) 1989-11-09 1991-11-12 Bioject, Inc. Needleless hypodermic injection device
US5312335A (en) 1989-11-09 1994-05-17 Bioject Inc. Needleless hypodermic injection device
US5190521A (en) 1990-08-22 1993-03-02 Tecnol Medical Products, Inc. Apparatus and method for raising a skin wheal and anesthetizing skin
US5527288A (en) 1990-12-13 1996-06-18 Elan Medical Technologies Limited Intradermal drug delivery device and method for intradermal delivery of drugs
CA2059692C (en) 1991-01-28 2004-11-16 Peter J. Kniskern Pneumoccoccal polysaccharide conjugate vaccine
GB9118204D0 (en) 1991-08-23 1991-10-09 Weston Terence E Needle-less injector
SE9102652D0 (sv) 1991-09-13 1991-09-13 Kabi Pharmacia Ab Injection needle arrangement
US5371197A (en) 1991-09-24 1994-12-06 Merck & Co., Inc. Protein-dimeric polysaccharide conjugate vaccine
US5328483A (en) 1992-02-27 1994-07-12 Jacoby Richard M Intradermal injection device with medication and needle guard
US5383851A (en) 1992-07-24 1995-01-24 Bioject Inc. Needleless hypodermic injection device
US5674698A (en) 1992-09-14 1997-10-07 Sri International Up-converting reporters for biological and other assays using laser excitation techniques
US5569189A (en) 1992-09-28 1996-10-29 Equidyne Systems, Inc. hypodermic jet injector
US5334144A (en) 1992-10-30 1994-08-02 Becton, Dickinson And Company Single use disposable needleless injector
US5500161A (en) 1993-09-21 1996-03-19 Massachusetts Institute Of Technology And Virus Research Institute Method for making hydrophobic polymeric microparticles
GB9326253D0 (en) 1993-12-23 1994-02-23 Smithkline Beecham Biolog Vaccines
IL112372A (en) 1994-02-07 2001-08-26 Res Dev Foundation Non-viral vector for the delivery of genetic information to cells
WO1995024176A1 (en) 1994-03-07 1995-09-14 Bioject, Inc. Ampule filling device
US5466220A (en) 1994-03-08 1995-11-14 Bioject, Inc. Drug vial mixing and transfer device
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US5565204A (en) 1994-08-24 1996-10-15 American Cyanamid Company Pneumococcal polysaccharide-recombinant pneumolysin conjugate vaccines for immunization against pneumococcal infections
US5599302A (en) 1995-01-09 1997-02-04 Medi-Ject Corporation Medical injection system and method, gas spring thereof and launching device using gas spring
NZ304715A (en) 1995-03-22 1999-07-29 Jackson H M Found Military Med Production of immunogenic constructs using organic cyanylating reagents to activate carbohydrates and then coupling the carbohydrate to a protein, peptide or hapten
US5730723A (en) 1995-10-10 1998-03-24 Visionary Medical Products Corporation, Inc. Gas pressured needle-less injection device and method
US5893397A (en) 1996-01-12 1999-04-13 Bioject Inc. Medication vial/syringe liquid-transfer apparatus
KR100365986B1 (ko) 1996-02-09 2003-02-20 스미스클라인 비이참 바이오로지칼즈 에스.에이. 수두대상포진바이러스유전자63생성물에대한백신
SE9600647D0 (sv) 1996-02-21 1996-02-21 Bror Morein Ny användning
GB9607549D0 (en) 1996-04-11 1996-06-12 Weston Medical Ltd Spring-powered dispensing device
JP4469026B2 (ja) 1996-10-31 2010-05-26 ヒューマン ジノーム サイエンシーズ,インコーポレイテッド Streptococcus pneumoniaeの抗原およびワクチン
DK1005368T3 (da) 1997-03-10 2010-01-04 Ottawa Hospital Res Inst Anvendelse af nukleinsyrer, der indeholder ikke-metyleret CpG dinukleotid i kombination med alun som hjælpestoffer
EP0977588B1 (en) 1997-04-24 2004-10-06 Henry M. Jackson Foundation For The Advancement Of Military Medicine Coupling of unmodified proteins to haloacyl or dihaloacyl derivatized polysaccharides for the preparation of protein-polysaccharide vaccines
US5993412A (en) 1997-05-19 1999-11-30 Bioject, Inc. Injection apparatus
US6800744B1 (en) 1997-07-02 2004-10-05 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
EP0998557A2 (en) 1997-07-21 2000-05-10 North American Vaccine, Inc. Modified immunogenic pneumolysin, compositions and their use as vaccines
WO1999012416A1 (en) 1997-09-09 1999-03-18 The Trustees Of Columbia University In The City Of New York T-independent conjugate-vaccines
US6562798B1 (en) 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US20040247662A1 (en) 1998-06-25 2004-12-09 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
CN1318103A (zh) * 1998-07-27 2001-10-17 微生物技术有限公司 肺炎链球菌的核酸和蛋白质
GB9817052D0 (en) 1998-08-05 1998-09-30 Smithkline Beecham Biolog Vaccine
EP1140157B1 (en) 1998-12-21 2009-02-18 MedImmune, Inc. Streptococcus pneumoniae proteins and immunogenic fragments for vaccines
SE9900496D0 (sv) 1999-02-12 1999-02-12 Pharmatrix Ab Vaccine formulation
GB9928678D0 (en) 1999-12-03 2000-02-02 Provalis Uk Ltd Streptococcus pneumoniae antigens
US6398774B1 (en) 1999-09-29 2002-06-04 Heska Corporation Intranasal delivery system
US8246945B2 (en) 2000-04-06 2012-08-21 University Of Arkansas Methods and reagents for decreasing clinical reaction to allergy
DK2116257T3 (da) 2000-08-09 2013-02-04 Alk Abello As Parenterale vaccineformuleringer og anvendelser deraf
AU2001294750C1 (en) 2000-09-26 2008-09-18 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes
SE0003538D0 (sv) 2000-09-29 2000-09-29 Isconova Ab New immunogenic complex
GB0118249D0 (en) 2001-07-26 2001-09-19 Chiron Spa Histidine vaccines
DE60234375D1 (de) 2001-09-14 2009-12-24 Cytos Biotechnology Ag VERPACKUNG VON IMMUNSTIMULIERENDEM CpG IN VIRUSÄHNLICHEN PARTIKELN: HERSTELLUNGSVERFAHREN UND VERWENDUNG
CA2492823A1 (en) 2001-09-14 2003-03-27 Cytos Biotechnology Ag In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
AU2002364783A1 (en) 2001-11-21 2003-06-10 Affinium Pharmaceuticals, Inc. Purified polypeptides involved in general metabolism
NZ536859A (en) 2002-05-14 2007-11-30 Chiron Srl Mucosal combination vaccines for bacterial meningitis
SE0202110D0 (sv) 2002-07-05 2002-07-05 Isconova Ab Iscom preparation and use thereof
US20060121058A1 (en) 2002-08-08 2006-06-08 Children's Medical Center Corporation Anti-pneumococcal preparations
AU2003291365B2 (en) 2002-11-07 2009-06-11 Synergy America, Inc. Compositions and methods for treating or preventing pneumococcal infection
AU2002952548A0 (en) 2002-11-08 2002-11-21 Cellestis Limited Diagnostic assay
US20060251675A1 (en) 2003-03-17 2006-11-09 Michael Hagen Mutant cholera holotoxin as an adjuvant and an antigen carrier protein
EP2311988A1 (en) 2003-04-15 2011-04-20 Intercell AG S. pneumoniae antigens
BRPI0410423A (pt) 2003-05-07 2006-06-06 Sanofi Pasteur Inc processo de imunogenicidade melhorada para vacinação meningocócica
SE0301998D0 (sv) 2003-07-07 2003-07-07 Isconova Ab Quil A fraction with low toxicity and use thereof
US20050013812A1 (en) 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
GB0318688D0 (en) 2003-08-08 2003-09-10 Chiron Srl Streptococcus pneumoniae knockout mutants
CA2537900A1 (en) 2003-09-03 2005-04-28 Dendritherapeutics, Inc. Multiplex vaccines
US20050112139A1 (en) 2003-10-23 2005-05-26 Nmk Research, Llc Immunogenic composition and method of developing a vaccine based on factor H binding sites
US20050181035A1 (en) 2004-02-17 2005-08-18 Dow Steven W. Systemic immune activation method using non CpG nucleic acids
US20050226899A1 (en) 2004-04-08 2005-10-13 Mauro Castiglioni Cosmetic mask composition
US20070128183A1 (en) 2004-04-27 2007-06-07 Intercell Ag Td antigens
GB0410220D0 (en) 2004-05-07 2004-06-09 Kirkham Lea Ann Mutant pneumolysin proteins
EP1791961B1 (en) 2004-08-18 2011-06-08 The Governors of the University of Alberta Protein production method utilizing yebf
FI20041396A0 (fi) 2004-10-29 2004-10-29 Vesa Pekka Hytoenen Uudet mikrobiavidiinit
GB0428394D0 (en) 2004-12-24 2005-02-02 Chiron Srl Saccharide conjugate vaccines
US8007806B2 (en) 2005-01-20 2011-08-30 Isconova Ab Vaccine composition comprising a fibronectin binding protein or a fibronectin binding peptide
WO2006084467A1 (en) 2005-02-11 2006-08-17 Ace Biosciences A/S Surface-located streptococcus pneumoniae polypeptides
US20090148894A1 (en) 2005-08-15 2009-06-11 Broedel Sheldon E Methods for optimizing the secretion of protein in prokaryotes
JP5135220B2 (ja) 2005-09-01 2013-02-06 ノバルティス ヴァクシンズ アンド ダイアグノスティクス ゲーエムベーハー アンド カンパニー カーゲー 血清群c髄膜炎菌を含む複数ワクチン接種
MX2008007292A (es) 2005-12-08 2008-10-17 Univ Louisville Res Found Composiciones inmunoestimuladoras y metodos.
WO2007081583A2 (en) 2006-01-04 2007-07-19 Children's Medical Center Corporation Anti-pneumococcal preparations and methods of use
US7943133B2 (en) 2006-02-02 2011-05-17 Boston Biocom Llc Mesothelin antibody protein fusions and methods of use
EP1988918A4 (en) 2006-02-22 2010-04-28 Novavax Inc ADJUVANZ AND VACCINE COMPOSITIONS
US20080032340A1 (en) 2006-06-09 2008-02-07 University Of Arizona Peptide motifs for binding avidin or neutravidin
US8148084B2 (en) 2006-06-22 2012-04-03 Dana-Farber Cancer Institute, Inc. Diagnosis of autoimmune disease
CA2690973A1 (en) 2006-06-23 2007-12-27 Paul M. Simon Targeted immune conjugates
US7452985B2 (en) 2006-08-17 2008-11-18 Visgeneer, Inc. Human Ron-related gene variant associated with cancers
ES2746960T3 (es) 2006-09-12 2020-03-09 Alphavax Inc Partículas de replicón de alfavirus que codifican IL-12 como adyuvantes inmunológicos
CA2663295C (en) 2006-09-12 2020-03-10 Alphavax, Inc. Alphavirus replicon particles matched to protein antigens as immunological adjuvants
DK2099485T3 (en) 2006-11-03 2018-05-22 Alphavax Inc Alphavirus and alphavirus replica particle formulations and associated methods
WO2008061243A2 (en) 2006-11-16 2008-05-22 Novavax, Inc. Respiratory syncytial virus-virus like particle (vlps)
WO2008152448A2 (en) 2006-12-21 2008-12-18 Emergent Product Development Uk Limited Streptococcus proteins, and their use in vaccination
CN100579152C (zh) 2007-01-29 2010-01-06 华为技术有限公司 一种播放集团彩铃的方法、系统及装置
EP2468869B1 (en) 2007-01-31 2015-03-18 Pfenex Inc. Bacterial leader sequences for increased expression
WO2008119358A2 (en) 2007-03-30 2008-10-09 Ace Biosciences A/S Surface-located streptococcus pneumoniae polypeptides for use in vaccine compositions
AU2008287286B2 (en) 2007-04-13 2013-10-10 The Board Of Regents Of The University Of Oklahoma Mutants of cholesterol-dependent cytolysins and uses thereof
CA2690708A1 (en) 2007-06-26 2008-12-31 Glaxosmithkline Biologicals S.A. Vaccine
GB0714963D0 (en) * 2007-08-01 2007-09-12 Novartis Ag Compositions comprising antigens
WO2009021548A1 (en) 2007-08-10 2009-02-19 Wacker Chemie Ag Expression of full length igg and secretion into the culture medium of prokaryotic cells
JP5658564B2 (ja) 2007-08-31 2015-01-28 ザ・ユニバーシティ・オブ・シカゴThe University Of Chicago ブドウ球菌肺疾患および状態に対する免疫に関連した方法および組成物
US20090068288A1 (en) 2007-09-07 2009-03-12 Wayne Kruger Topical antiseptic veterinary solution
JP2012512257A (ja) 2008-12-17 2012-05-31 ジェノセア バイオサイエンシーズ, インコーポレイテッド クラミジア抗原およびその使用
MX2011006922A (es) 2008-12-24 2012-06-12 Netherlands Vaccine Inst Polipeptidos de neumolisina (ply) modificada a partir de streptococcus pneumonia.
EP2208787A1 (en) 2009-01-19 2010-07-21 Université de Liège A recombinant alpha-hemolysin polypeptide of Staphylococcus aureus, having a deletion in the stem domain and heterologous sequences inserted
US8828953B2 (en) 2009-04-20 2014-09-09 NaZura BioHealth, Inc. Chemosensory receptor ligand-based therapies
EP3756684A1 (en) 2009-05-22 2020-12-30 Genocea Biosciences, Inc. Vaccines against herpes simplex virus type 2: compositions and methods for eliciting an immune response
RU2580299C2 (ru) 2009-06-29 2016-04-10 Дженосеа Биосайенсиз, Инк. Вакцины и композиции, направленные против streptococcus pneumoniae
CN102648003B (zh) 2009-10-09 2016-01-13 儿童医疗中心有限公司 选择性裂解的全细胞疫苗
EP2335721A1 (en) 2009-12-21 2011-06-22 Institut Pasteur Streptavidin and Biotin-based antigen delivery system
US20110159040A1 (en) 2009-12-30 2011-06-30 Children's Medical Center Corporation Novel immunogens and methods for discovery and screening thereof
EP2563396A2 (en) 2010-04-30 2013-03-06 Augmenta Biologicals LLC Delivery proteins
WO2012054755A1 (en) 2010-10-20 2012-04-26 Genocea Biosciences, Inc. Chlamydia antigens and uses thereof
WO2012100233A1 (en) 2011-01-20 2012-07-26 Genocea Biosciences, Inc. Vaccines and compositions against streptococcus pneumoniae
CN103648489A (zh) 2011-05-11 2014-03-19 儿童医疗中心有限公司 多抗原提呈免疫原性组合物及其方法和用途
CA2897020A1 (en) 2012-01-20 2013-07-25 Genocea Biosciences, Inc. Fused antigen vaccines and compositions against streptococcus pneumoniae
WO2014018904A1 (en) 2012-07-26 2014-01-30 Genocea Biosciences, Inc. Fused antigen vaccines and compositions against streptococcus pneumoniae
US11576958B2 (en) 2013-02-07 2023-02-14 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
KR102225282B1 (ko) 2015-07-21 2021-03-10 화이자 인코포레이티드 접합된 캡슐형 사카라이드 항원을 포함하는 면역원성 조성물, 그를 포함하는 키트 및 그의 용도
SG11202101973YA (en) 2018-09-12 2021-03-30 Childrens Medical Ct Corp Pneumococcal fusion protein vaccines
CN112969474A (zh) 2018-09-12 2021-06-15 艾芬尼维克斯公司 多价肺炎球菌疫苗

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000006737A2 (en) * 1998-07-27 2000-02-10 Microbial Technics Limited Streptococcus pneumoniae proteins and nucleic acid molecules
WO2002077021A2 (en) * 2001-03-27 2002-10-03 Chiron Srl. Streptococcus pneumoniae proteins and nucleic acids
WO2009143413A1 (en) * 2008-05-22 2009-11-26 Children'smedical Center Corporation Synergistic immunogenic fusion protein-polysaccharide conjugate

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LU ET AL.: "A Bivalent Vaccine to Protect against Streptococcus pneumoniae and Salmonella typhi.", VACCINE., vol. 30, no. 23, 14 May 2012 (2012-05-14), pages 3405 - 3412, XP028412710 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12545710B2 (en) 2011-05-11 2026-02-10 Children's Medical Center Corporation Multiple antigen presenting immunogenic composition, and methods and uses thereof
US11981708B2 (en) 2011-05-11 2024-05-14 Children's Medical Center Corporation Multiple antigen presenting immunogenic composition, and methods and uses thereof
US11976097B2 (en) 2011-05-11 2024-05-07 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US11560410B2 (en) 2011-05-11 2023-01-24 Children's Medical Center Corporation Modified biotin-binding protein, fusion proteins thereof and applications
US12083173B2 (en) 2013-02-07 2024-09-10 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
US11305001B2 (en) 2017-03-28 2022-04-19 The Children's Medical Center Corporation Multiple antigen presenting system (MAPS)-based Staphylococcus aureus vaccine, immunogenic composition, and uses thereof
US11612647B2 (en) 2017-06-23 2023-03-28 University Of Maryland, Baltimore Immunogenic compositions
US11740237B2 (en) 2018-05-04 2023-08-29 Roger Karlsson Biomarkers for detecting microbial infection
WO2019211477A1 (en) * 2018-05-04 2019-11-07 Roger Karlsson Biomarkers for detecting microbial infection
US11701416B2 (en) 2018-09-12 2023-07-18 Affinivax, Inc. Multivalent pneumococcal vaccines
RU2815390C2 (ru) * 2018-09-12 2024-03-14 Аффинивакс, Инк. Поливалентные пневмококковые вакцины
EP3849599A4 (en) * 2018-09-12 2022-06-29 The Children's Medical Center Corporation Pneumococcal fusion protein vaccines
EP3849587A4 (en) * 2018-09-12 2022-06-29 Affinivax, Inc. Multivalent pneumococcal vaccines
US12370247B2 (en) 2018-09-12 2025-07-29 Affinivax, Inc. Multivalent pneumococcal vaccines
US11013793B2 (en) 2018-09-12 2021-05-25 Affinivax, Inc. Multivalent pneumococcal vaccines
WO2022031087A1 (ko) * 2020-08-07 2022-02-10 (주)셀트리온 폐렴구균 다당류-세포벽 유래 물질 접합체를 포함하는 면역원성 조성물
US20230091255A1 (en) * 2021-09-09 2023-03-23 Affinivax, Inc. Multivalent pneumococcal vaccines
WO2023039223A1 (en) 2021-09-09 2023-03-16 Affinivax, Inc. Multivalent pneumococcal vaccines
US12036276B2 (en) * 2021-09-09 2024-07-16 Affinivax, Inc. Multivalent pneumococcal vaccines
US12377140B2 (en) 2021-09-09 2025-08-05 Affinivax, Inc. Multivalent pneumococcal vaccines
WO2024229176A1 (en) 2023-05-04 2024-11-07 Affinivax, Inc. Rhizavidin variants
WO2025193903A1 (en) 2024-03-15 2025-09-18 Affinivax, Inc. Pneumococcal polysaccharide compositions and uses thereof

Also Published As

Publication number Publication date
US20250114443A1 (en) 2025-04-10
CA2900008C (en) 2025-10-07
JP6916828B2 (ja) 2021-08-11
EP4272750A2 (en) 2023-11-08
EP2953638B1 (en) 2023-07-05
ES2959258T3 (es) 2024-02-22
JP6494527B2 (ja) 2019-04-03
US20150374811A1 (en) 2015-12-31
JP2019108375A (ja) 2019-07-04
CA2900008A1 (en) 2014-08-14
AU2014214844B2 (en) 2017-12-14
AU2018201768A1 (en) 2018-04-05
EP4272750A3 (en) 2024-01-24
EP2953638A4 (en) 2016-08-03
AU2014214844A1 (en) 2015-08-13
AU2018201768B2 (en) 2020-03-12
US11576958B2 (en) 2023-02-14
US20230081705A1 (en) 2023-03-16
EP2953638A1 (en) 2015-12-16
JP2016509011A (ja) 2016-03-24
CA3247431A1 (en) 2026-03-02
US12083173B2 (en) 2024-09-10

Similar Documents

Publication Publication Date Title
US12083173B2 (en) Protein antigens that provide protection against pneumococcal colonization and/or disease
US11207375B2 (en) Vaccines and compositions against Streptococcus pneumoniae
US10188717B2 (en) Vaccines and compositions against Streptococcus pneumoniae
AU2019338448B2 (en) Pneumococcal fusion protein vaccines
US20150079132A1 (en) Evoking protection against streptotoccus pneumoniae incorporating b-cell and t-cell pneumococcal protein antigens and pneumococcal polysaccharides delivered concomitantly
WO2024259229A2 (en) Fusion proteins generating protective antibodies and protective th17 responses for pseudomonas aeruginosa

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14748672

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2014748672

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2900008

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2015557089

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14766252

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2014214844

Country of ref document: AU

Date of ref document: 20140207

Kind code of ref document: A