WO2014093595A1 - Crispr-cas component systems, methods and compositions for sequence manipulation - Google Patents
Crispr-cas component systems, methods and compositions for sequence manipulation Download PDFInfo
- Publication number
- WO2014093595A1 WO2014093595A1 PCT/US2013/074611 US2013074611W WO2014093595A1 WO 2014093595 A1 WO2014093595 A1 WO 2014093595A1 US 2013074611 W US2013074611 W US 2013074611W WO 2014093595 A1 WO2014093595 A1 WO 2014093595A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- crispr
- tracr
- target
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/30—Detection of binding sites or motifs
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/50—Mutagenesis
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/10—Sequence alignment; Homology search
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1082—Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
Definitions
- the present invention generally relates to systems, methods and compositions used for the control of gene expression involving sequence targeting, such as genome perturbation or gene-editing, that may use vector systems related to Clustered Regularly Interspaced Short Palindromic Repeats (CRJSPR) and components thereof,
- sequence targeting such as genome perturbation or gene-editing
- CRJSPR Clustered Regularly Interspaced Short Palindromic Repeats
- the CRISPR/Cas or the CRISPR-Cas system does not require the generation of customized proteins to target specific sequences but rather a single Cas enzyme can be programmed by a short RNA molecule to recognize a specific DNA target, in other words the Cas enzyme can be recruited to a specific DNA target using said short RNA molecule.
- Adding the CRISPR-Cas system to the repertoire of genome sequencing techniques a d analysis methods may significantly simplify the methodology and accelerate the ability to catalog and map genetic factors associated with a diverse range of biological functions and diseases.
- the invention provides a vector system comprising one or more vectors.
- the system comprises: (a) a first regulatory element operabl linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR.
- component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
- component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
- the system comprises the tracr sequence under the control of a third regulatory element, such as a polymerase III promoter.
- the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. Determining optimal alignment is within the purview of one of skill in the art.
- the CRISPR complex comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR complex in a detectable amount in the nucleus of a eukaryotic cell.
- a nuclear localization sequence is not necessary for CRISPR complex activity in eukaryotes, but that including such sequences enhances activity of the system, especially as to targeting nucleic acid .molecules in the nucleus.
- the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S, pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homoiog or ortholog. In some embodiments, the CRISPR enzyme is codon- optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity.
- the first regulatory element is a polymerase III promoter.
- the second regulatory element is a polymerase ⁇ promoter.
- the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15- 20 nucleotides in length.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partial ly double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g.
- vectors refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
- viral vector wherein vira!iy-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication detective adenoviruses, and adeno-associated viruses).
- Viral vectors also include polynucleotides carried by a vims for traiisfection into a host cell.
- Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
- Other vectors e.g., non-episomal mammalian vectors
- certain vectors are capable of directing the expression of genes to which they are operatively-linked.
- Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
- operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory elemeiit(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro trail scription/translation system or in a host cell when the vector is introduced into the host ceil).
- regulatory element is intended to include promoters, enhancers, internal ribosomal entry sites (RES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
- RES internal ribosomal entry sites
- other expression control elements e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences.
- transcription termination signals such as polyadenylation signals and poly-U sequences.
- regulatory elements are described, for example, in Goeddei, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
- Regulator ⁇ .' elements include those that direct constitutive expression of a nucleotide sequence in many types of host ceil and those that direct expression of the nucleotide sequence only in certain host ceils (e.g., tissue-specific regulator ⁇ ' sequences).
- a tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific.
- a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g.
- pol III promoters include, but are not limited to, U6 and HI promoters.
- pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with, the CMV enhancer) [see, e.g., Boshari et al, Cell, 41 :521 -530 (1985)], the SV40 promoter, the dihydro folate reductase promoter, the ⁇ -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter.
- RSV Rous sarcoma virus
- CMV cytomegalovirus
- PGK phosphoglycerol kinase
- promoter ⁇ ' element also encompassed by the term "regulator ⁇ ' element” are enhancer elements, such as WPRE; CMV enhancers; the R-U5' segment in LTR of HTLV-I (Mol. Cell. Biol, Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit ⁇ -globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31 , 1981). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc.
- a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly Interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
- CRISPR clustered regularly Interspersed short palindromic repeats
- Advantageous vectors include lentivirases and adeno-assoeiated viruses, and types of such vectors can al so be selected for targeting particul ar types of cells.
- the invention provides a vector comprising a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme comprising one or more nuclear localization sequences.
- said regulatory element drives transcription of the CRISPR enzyme in a eukaryotic cell such that said CRISPR enzyme accumulates in a detectable amount in the nucleus of the eukaryotic cell.
- the regulatory element is a polymerase II promoter.
- the CRISPR enzyme is a type II CRISPR system enzyme.
- the CRISPR enzyme is a Cas9 enzyme.
- the Cas9 enzyme is 5. pneumoniae, S. pyogenes or S.
- thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
- the CRISPR enzyme is codon-optimized for expression in a eukaryotic cell.
- the CRISPR enzyme directs cleavage of one or two strands at the locationo of the target sequence.
- the CRISPR enzyme lacks DNA strand cleavage activity.
- the invention provides a CRISPR enzyme comprising one or more uclear localization sequences of sufficient stre gth to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell.
- the CRISPR enzyme is a type II CRISPR system enzyme.
- the CRISPR enzyme is a Cas9 enzyme.
- the Cas9 enzyme is S. pneumoniae, S. pyogenes or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms.
- the enzyme may be a Cas9 homolog or ortholog.
- the CRISPR e zyme lacks the ability to cleave one or more strands of a target sequence to which it binds.
- the invention provides a eukaryotic host cell comprising (a) a first regulatory element operably linked to a tract mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR comple to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CR ISPR enzyme compiexed with (1) the guide sequence that is hybridized to the target sequence, a d (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
- the host cell comprises components (a) and (b).
- component (a), component (b), or components (a) and (b) are stably integrated into a genome of the host eukaryotic cell.
- component (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
- component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
- the eukaryotic host cell further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence.
- the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic ceil.
- the CRISPR enzyme is a type ⁇ CRISPR system enzyme.
- the CRISPR enzyme is a Cas9 enzyme.
- the Cas9 enzyme is 5. pneumoniae, S. pyogenes or S, thermophilus Cas9, and may include mutated Cas9 derived from these organisms.
- the enzyme may be a Cas9 homolog or ortholog.
- the CRISPR enzyme is codon -optimized for expression in a eukaryotic cell.
- the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
- the CRISPR enzyme lacks DNA strand cleavage activity.
- the first regulatory element is a polymerase ( II promoter.
- the second regulatory element is a polymerase II promoter.
- the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15- 20 nucleotides in length.
- the invention provides a non-human eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments.
- the invention provides a eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments.
- the organism in some embodiments of these aspects may be an animal; for example a mammal. Also, the organism may be an arthropod such as an insect. The organism also may be a plant. Further, the organism may be a fungus.
- the invention provides a kit comprising one or more of the components described herein.
- the kit comprises a vector system and instructions for using the kit.
- the vector system comprises (a) a first regulatory elemen operably linked to a tracr mate sequence and one or more insertion sites for inserting one or more guide sequences upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR comple to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and'Or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR.
- the kit comprises components (a) and (b) located on the same or different vectors of the system.
- componen (a) further comprises the tracr sequence downstream of the tracr mate sequence under the control of the first regulatory element.
- component (a) further comprises two or more guide sequences operably linked to the first regulatory element, wherein when expressed, each of the two or more guide sequences direct sequence specific binding of a CRISPR complex to a different target sequence in a eukaryotic cell.
- the system further comprises a third regulatory element, such as a polymerase III promoter, operably linked to said tracr sequence.
- the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell.
- the CRISPR enzyme is a type II CRISPR system enzyme
- the CRISP R enzyme is a Cas9 enzyme.
- the Cas9 enzyme is S. pneumoniae, S. pyogenes or S.
- thermophilus Cas9 and may include mutated Cas9 derived from these organisms.
- the enzyme may be a Cas9 homolog or ortholog.
- the CRISPR enzyme is codo -optimized, for expression in a eukaryotic cell.
- the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence.
- the CRISPR enzyme lacks DNA strand cleavage activity.
- the first regulator)? element is a polymerase III promoter.
- the second regulatory element is a polymerase II promoter.
- the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15-20 nucleotides in length.
- the invention provides a method of modifying a target polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.
- the method further comprises delivering one or more vectors to said eukaryotic cell, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
- said vectors are delivered to the eukaryotic cell in a subject.
- said modifying takes place in said eukaryotic cell in a cell culture.
- the method further comprises isolating said eukaryotic cell from a subject prior to said modifying.
- the method further comprises returning said eukaryotic cell and/or cells derived therefrom to said subject.
- the invention provides a method of modifying expression of a polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- the method further comprises delivering one or more vectors to said eukaryotic cells, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.
- the invention provides a method of generating a model eukaryotic cell comprising a mutated disease gene
- a disease gene is any gene associated an increase in the risk of having or developing a disease.
- the method comprises (a) introducing one or more vectors into a eukaryotic cell, wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence; and (b) allowing a CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said disease gene, wherein the CRISPR complex comprises the CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence within the target polynucleotide, and (2) the tracr mate sequence that is hybridized to the tracr sequence, thereby generating a model eukaryotic
- said cleavage comprises cleaving one or two strands at the location of the target sequence by said CRISPR enzyme. In some embodiments, said cleavage results in decreased transcription of a target gene. In some embodiments, the method further comprises repairing said cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein said repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of said target polynucleotide. In some embodiments, said mutation results in one or more amino acid changes in a protein expression from a gene comprising the target sequence.
- the invention provides a method for developing a biologically active agent that modulates a cell signaling event associated with a disease gene.
- a disease gene is any gene associated an increase in the risk of having or developing a disease.
- the method comprises (a) contacting a test compound wit a model cell of any one of the described embodiments; and (b) detecting a change in a readout that is indicative of a reduction or a augmentatio of a cell signaling event associated with said mutation in said disease gene, thereby developing said biologically active agent that modulates said cell signaling event associated with said disease gene.
- the invention provides a recombinant polynucleotide comprising a guide sequence upstream of a tracr mate sequence, wherein the guide sequence when expressed directs sequence-specific binding of a CRJSPR complex to a corresponding target sequence present in a eukaryotic cell.
- the target sequence is a viral sequence present in a eukaryotic cell.
- the target sequence is a proto -oncogene or an oncogene.
- the invention provides for a method of selecting one or more prokaryotic cell(s) by introducing one or more mutations in a gene in the one or more prokaryotic cell (s), the method comprising: introducing one or more vectors into the prokaryotic cell (s), wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, a tracr sequence, and a editing template; wherein the editing template comprises the one or more mutations that abolish CRISPR enzyme cleavage; al lowing homologous recombination of the editing template with the target polynucleotide in the cell(s) to be selected; allowing a CRJSPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within said gene, wherein the CRJSPR complex comprises the CRJSPR enzyme complexed with (1) the guide sequence that is hybridized to the
- the CRJSPR enzyme is Cas9.
- the cell to be selected may be a eukaryotic cell. Aspects of the invention allow for selection of specific cells without requiring a selection marker or a two-step process that may include a counter-selection system. [0022] Accordingly, it is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product- such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method.
- the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. ⁇ 1 12, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product,
- FIG. 1 shows a schematic model of the CRISPR system.
- the Cas9 nuclease from Streptococcus pyogenes (yellow) is targeted to genomic DNA by a synthetic guide RNA (sgRNA) consisting of a 20-nt guide sequence (blue) and a scaffold (red).
- the guide sequence base-pairs with the DNA target (blue), directly upstream of a requisite 5 '-NGG protospacer adjacent motif (PAM; magenta), and Cas9 mediates a double-stranded break (DSB) ⁇ 3 bp upstream of the PAM (red triangle).
- Figure 2A-F shows an exemplary CRISPR system, a possible mechanism of action, an example adaptation for expression in eukaryotic cells, and results of tests assessing nuclear localization and CRISPR activity.
- Figure 3 shows an exemplary expression cassette for expression of CRISPR. system elements in eukaryotic cells, predicted structures of example guide sequences, and CRISPR system activity as measured in eukaryotic and prokaryotic cells.
- Figure 4A-0 shows results of an evaluation of SpCas9 specificity for an example target.
- Figure 5A-G show an exemplary vector system and results for its use in directing homologous recombination in eukaryotic ceils.
- Figure 6 provides a table of protospacer sequences and summarizes modification efficiency results for protospacer targets designed based on exemplary S. pyogenes and S. thermophilus CRISPR systems with corresponding PAMs against loci in human and mouse genomes.
- Figure 7A-C shows a comparison of different tracr NA transcripts for Cas9- mcdiated gene targeting.
- Figure 8 shows a schematic of a surveyor nuclease assay for detection of double strand break-induced micro-insertions and --deletions.
- Figure 9A-B shows exemplary bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells.
- Figure 10 shows a bacterial plasmid transformation interference assay, expression cassettes and plasmids used therein, and transformation efficiencies of cells used therein .
- Figure 11A-C shows histograms of distances between adjacent S. pyogenes SF370 locus I PAM (NGG) ( Figure 10A) and S. thermophilus LMD9 locus 2 PA..VI (NNAGAAW) ( Figure 10B) in the human genome; and distances for each PAM by chromosome (Chr) ( Figure IOC).
- Figure 12A-C shows an exemplary CRISPR system, an example adaptation for expression in eukaryotic cells, and results of tests assessing CRISPR activity.
- Figure 13A-C shows exemplary manipulations of a CRISPR system for targeting of genomic loci in mammalian cells.
- Figure 14A-B shows the results of a Northern blot analysis of erRNA processing in mammalian cel ls.
- Figure 15 shows an exemplary selection of protospacers in the human PVALB and mouse Th loci.
- Figure J 6 shows example protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus.
- Figure 17 provides a table of sequences for primers and probes used for Surveyor, RFLP, genomic sequencing, and Northern blot assays.
- Figure 18A-C shows exemplary manipulation of a CRISPR system with chimeric RNAs and results of SURVEYOR assays for system activity in eukaryotic cells.
- Figure 19A-B shows a graphical representation of the results of SURVEYOR assays for CRJSPR system activity in eukaryotic cells.
- Figure 20 shows an exemplary visualization of some S. pyogenes Cas9 target sites in the human genome using the i CSC genome browser.
- Figure 21 shows predicted secondary structures for exemplary chimeric RNAs comprising a guide sequence, tracr mate sequence, and tracr sequence.
- Figure 22 shows exemplaiy bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells.
- FIG. 23 shows that Cas9 nuclease activity against endogenous targets may be exploited for genome editing
- the CRISPR targeting construct directed cleavage of a chromosomal locus and was co -transformed with an editing template that recombined with the target to prevent cleavage.
- Kanamycin- resistant transformants that survived CRISPR attack contained modifications introduced by the editing template, tracr, ir ws-activating CRISPR RNA; aphA-3, kanamycin resistance gene,
- Figure 24 shows analysis of PAM and seed sequences that eliminate Cas9 cleavage,
- PGR. products with, randomized PAM sequences or randomized seed sequences were transformed in crR6 cells. These cells expressed Cas9 loaded with a crRNA that, targeted a chromosomal region of R6' "" " "J ceils (highlighted in pink) that is absent from the R6 genome. More than 2* 105 chloramphenicoi-resistant transform arsts, carrying inactive PAM or seed sequences, were combined for amplification and deep sequencing of the target region, (b) Relative proportion of number of reads after transformation of the random PAM constructs in crR6 cells (compared to number of reads in R6 transformants).
- the relative abundance for each 3 -nucleotide PAM sequence is shown. Severely underrepresented sequences (NGG) are shown in red; partially underrepresented one in orange ( NAG) (c) Relative proportion of number of reads after transformation of the random seed sequence constructs in crR6 cells (compared to number of reads in R6 trail sformants). The relative abundance of each nucleotide for each position of the first 20 nucleotides of the protospacer sequence is shown. High abundance indicates lack of cleavage by Cas9, i.e. a CR ISPR inactivating mutation. The grey line shows the level of the WT sequence. The dotted line represents the level above which a mutation significantly disrupts cleavage (See section "Analysis of deep sequencing data" in Example 5)
- Figure 25 shows introduction of single and multiple mutations using the CRISPR system in S. pneumoniae, (a) Nucleotide and amino acid sequences of the wild-type and edited (green nucleotides; underlined amino acid residues) bgaA. The protospacer, PAM and restriction sites are shown, (b) Transformation efficiency of ceils transformed with targeting constructs in the presence of an editing template or control, (c) PGR analysis for 8 transformants of each editing experiment followed by digestion with BtgZI (R ⁇ A) and Tsel (NE ⁇ AA).
- bgaA Deletion of bgaA was revealed as a smaller PGR product, (d) Miller assay to measure the ⁇ -galactosidase activity of WT and edited strains, (e) For a single-step, double deletion the targeting construct contained two spacers (in this case matching srtA and bgaA) and was co-transformed with two different editing templates (f) PGR analysis for 8 transformants to detect deletions in srtA and bgaA loci. 6/8 transformants contained deletions of both genes.
- Figure 26 provides mechanisms underlying editing using the CRISPR system
- a stop codon was introduced in the erythromycin resistance gene ermAM to generate strain JENS 3.
- the wild-type sequence can be restored by targeting the stop codon with the CRISPR: :ermA (stop) construct, and using the ermAM wild-type sequence as an editing template
- (b) Mutant and wild-type ermAM sequences (c) Fraction of erythromicyn-resistant (erm R ) cfu calculated from total or kanamycin-resistant (kan R ) cfu.
- FIG. 27 illustrates genome editing with the CRISPR system in E. coli.
- a kanamycin-resistant plasmid carrying the CRISPR array (pCRISPR) targeting the gene to edit may be transformed in the HME63 reeombmeering strain containing a chloramphenicol-resistant plasmid harboring cas9 and tracr (pCas9), together with an oligonucleotide specifying the mutation,
- pCas9 chloramphenicol-resistant plasmid harboring cas9 and tracr
- a &42T mutation conferring streptomycin resistance was introduced in the rpsL gene
- FIG. 28 illustrates the transformation of crR.6 genomic DNA leads to editing of the targeted locus
- the IS 1167 element of S. pneumoniae R6 was replaced by the CRISPROl locus of S. pyogenes SF370 to generate crR6 strain.
- This locus encodes for the Cas9 nuclease, a CRISPR array with six spacers, the tracrRNA that is required for crRNA biogenesis and Casl , Cas2 and Csii2, proteins not necessary for targeting.
- Strain crR6M contains a minimal functional CRISPR system without casl, casl and csn2.
- the aphA-3 gene encodes kanamycin resistance.
- Protospacers from the streptococcal bacteriophages ⁇ 8232.5 and ⁇ 370.1 were fused to a chloramphenicol resistance gene (cat) and integrated, in the srtA gene of strain R6 to generate strains R68232.5 and R6370.1.
- Right panel PC analysis of 8 R6 823 transformants with crR6 genomic DNA. Primers that amplify the srtA locus were used for PCR.
- Figure 29 provides chromatograms of DNA sequences of edited cells obtained in this study. In all cases the wild-type and mutant protospacer and PAM sequences (or their reverse complement) are indicated. When relevant, the amino acid sequence encoded by the protospacer is provided. For each editing experiment, all strains for which PCR and restriction analysis corroborated the introduction of the desired modification were sequenced. A representative chromatogram is show , (a) Chromatogram for the introduction of a PAM mutation into the R6 S ",2,J target ( Figure 23d).
- Figure 30 illustrates CRISPR immunity against random S. pneumoniae targets containing different PAMs.
- FIG 31 provides a general scheme for targeted genome editing.
- crR6M was further engineered to contain tracrR A, Cas9 and only one repeat of the CRISPR array followed by kanamycin resistance marker (aphA-3), generating strain crR6Rk.
- DNA from this strain is used as a template for PCR with primers designed to introduce a new spacer (green box designated with N).
- the left and right PCRs are assembled using the Gibson method to create the targeting construct.
- Both the targeting and editing constructs are then transformed into strain crR6Rc, which is a strain equivalent to crR6Rk but has the kanamycin resistance marker replaced by a chloramphenicol resistance marker (cat).
- Figure 32 illustrates the distribution of distances between PAMs. NGG and CCN that are considered to be valid PAMs. Data is shown for the S. pneumoniae R6 genome as well as for a random sequence of the same length and with the same GC-content (39.7 %). The dotted line represents the average distance (12) between PAMs in the R6 genome.
- Figure 33 il lustrates CRISPR-mediated editing of the ermAM locus using genomic DNA as targeting construct.
- genomic DNA To use genomic DNA as targeting construct it is ecessary to avoid CRISPR autoimmunity, and therefore a spacer against a sequence not present in the chromosome must be used (in this case the ermAM erythromycin resistance gene), (a) Nucleotide and ami o acid sequences of the wild-type and mutated (red letters) ermAM gene. The protospacer and PAM sequences are shown, (b) A schematic for CRISPR-mediated editing of the ermAM locus using genomic DNA.
- a construct carrying an ermAM-targetmg spacer (blue box) is made by PCR and Gibson assembly, and transformed into strain crR6Rc, generating strain JEN37.
- the genomic DNA of JEN37 was then used as a targeting constmct, and was co -transformed with the editing template into JEN38, a strain in which the srtA gene was replaced by a wild-type copy of ermAM, anamycin-resistant transformants contai the edited genotype (JEN43).
- Figiire 34 illustrates sequential introduction of mutations by CRISPR-mediated genome editing
- R6 is engineered to generate crR6Rk.
- crR6Rk is co-transformed with a srtA -targeting construct fused to cat for chloramphenicol selection of edited cells, along with an editing construct for a AsrtA in-frame deletion.
- Strain crR6 AsrtA is generated by selection on chlramphenicol.
- the AsrtA strain is co-transformed with a bgaA -targeting construct fused to aphA-3 for kanamycin selection of edited cells, and an editing constmct containing a AbgaA in-frame deletion.
- the engineered CRISPR locus can be erased from the chromosome by first co-transforming R.6 DNA containing the wild-type IS 1167 locus and a plasmid carrying a bgaA protospacer (pDB97), and selection on spectinomycin.
- Figure 35 illustrates the background mutation frequency of CRISPR in S. pneumoniae, (a) Transformation of the CRISPR: :0 or CRISPR: :erm(stop) targeting constructs in JEN53, with or without the ermAM editing template. The difference in kan R CFU between CRISPR: :0 and CRJSPR: :erm(stop) indicates that Cas9 cleavage kills non-edited cells. Mutants that escape CRISPR interference in the absence of editing template are observed at a frequency of 3 ⁇ 10 ⁇ ' ⁇ (b) PCR analysis of the CRISPR locus of escapers shows that 7/8 have a spacer deletio , (c) Escaper #2 carries a point mutation in cas9.
- Figure 36 il lustrates that the essential elements of the S. pyogenes CRISPR locus 1 are reconstituted in E. coli using pCas9.
- the plasmid contained tracrRNA, Cas9, as well as a leader sequence driving the crRNA array.
- the pCRISPR plasmids contained the leader and the array only. Spacers may be inserted into the crRNA array between Bsal sites using annealed oligonucleotides. Oligonucleotide design is shown at bottom.
- pCas9 carried chloramphenicol resistance (CmR) and is based on the low-copy pACYC184 plasmid backbone.
- CmR chloramphenicol resistance
- pCRISPR is based on the high-copy number pZE21 plasmid. Two plasmids were required because a pCRISPR plasmid containing a spacer targeting the E. coli chromosome may not be constructed using this organism as a cloning host if Cas9 is also present (it will kill the host).
- FIG 37 illustrates CRISP -directed editing in E.coli MG1655.
- An oligonucleotide (W542) carrying a point mutation that both confers streptomycin resistance and abolishes CRISPR immunity, together with a plasmid targeting rpsL (pCRISPR: :rpsL) or a control plasmid (pCRISPR: :0) were co-transformed into wild-type E.coli strain MG1655 containing pCas9. Transformants were selected on media containing either streptomycin or kanamycin. Dashed line indicates limi t of detection of the transformation assay.
- Figure 38 illustrates the background mutation frequency of CRISPR in E.
- Figure 39A-D shows a circular depiction of the phylo genetic analysis revealing five families of Cas9s, including three groups of large Cas9s (- 1400 amino acids) and two of small Cas9s ( ⁇ 1100 amino acids),
- Figure 40A-F shows the linear depiction of the phylogenetic analysis revealing five families of Cas9s, including three groups of large Cas9s ( ⁇ 1400 amino acids) and two of small Cas9s ( ⁇ 1 100 amino acids).
- Figure 41A-M shows sequences where the mutation points are located within the SpCas9 gene.
- Figure 42 shows a schematic construct in which the transcriptional activation domain (VP64) is fused to Cas9 with two mutations in the catalytic domains (D10 and H840).
- Figure 43A-D shows genome editing via homologous recombination
- (a) Schematic of SpCas9 nickase, with D10A mutation in the RuvC I catalytic domain (b) Schematic representing homologous recombination (HR) at the human EMXl locus using either sense or antisense single stranded oligonucleotides as repair templates.
- Red arrow above indicates sgRNA cleavage site; PCR primers for genotyping (Tables J and ) are indicated as arrows in right panel
- Figure 44A-B shows single vector designs for SpCas9.
- Figure 45 shows quantification of cleavage of NLS-Csnl constructs NLS-Csnl , Csnl, Csnl-NLS, NLS-Csnl-NLS, NLS-Csnl -GFP-NLS and UnTFN.
- Figure 46 shows index frequency of NLS-Cas9, Cas9, Cas9-NLS and NLS-Cas9- NLS.
- Figure 47 shows a gel demonstrating that SpCas9 with nickase mutations (individually) do not induce double strand breaks.
- Figure 48 shows a design of the oligo DNA used as Homologous Recombination (HR) template in this experiment and a comparison of HR efficiency induced by different combinations of Cas9 protein and HR template.
- HR Homologous Recombination
- Figure 49A shows the Conditional Cas9, Rosa.26 targeting vector map.
- Figure 49B shows the Constitutive Cas9, Rosa26 targeting vector map.
- Figure 50A-H show the sequences of each element present in the vector maps of
- Figure 51 shows a schematic of the important elements in the Constitutive and Conditional Cas9 constructs.
- Figure 52 shows the functional validation of the expression of Constitutive and Conditional Cas9 constructs.
- Figure 53 shows the validation of Cas9 nuclease activity by Surveyor.
- Figure 54 shows the quantification of Cas9 nuclease activity.
- Figure 55 shows construct design and homologous recombination (HR) strategy.
- Figure 56 shows the genomic PCR genotyping results for the constitutive (Right) and conditional (Lett) constructs at two different gel exposure times (top row for 3 min and bottom row for 1 min).
- Figure 57 shows Cas9 activation in mESCs.
- Figure 58 shows a schematic of the strategy used to mediate gene knockout via NHEJ using a nickase version of Cas9 along with two guide RNAs.
- Figure 59 shows how DNA double-strand break (DSB) repair promotes gene editing.
- DSB DNA double-strand break
- NHEJ error-prone non-homologous end joining
- Indel random insertion'tieietion
- a repair template in the form of a plasmid or single-stranded oligodeoxynucleotides can be supplied to leverage the homology-directed repair (HDR) pathway, which allows high fidelity and precise editing.
- Figure 60 shows the timeline and overview of experiments. Steps for reagent design, construction, validation, and cell line expansion. Custom sgRNAs (Sight blue bars) for each target, as well as genotyping primers, are designed in siiico via our online design tool (available at the website genome-engineering.org/tools). sgRNA expression vectors are then cloned into a plasmid containing Cas9 (PX330) and verified via DNA sequencing. Completed plasmids (pCRISPRs), and optional repair templates for facilitating homology directed repair, are then transfected into cells and assayed for ability to .mediate targeted cleavage. Finally, transfected cel ls can be clonally expanded to derive isogenic cel l lines with defined mutations.
- Custom sgRNAs Light blue bars
- genotyping primers are designed in siiico via our online design tool (available at the website genome-engineering.org/tools).
- sgRNA expression vectors are then clon
- Figiire 61A-C shows Target selection and reagent preparation
- 20-bp targets (highlighted in blue) must be followed by 5' ⁇ NGG, which can occur in either strand on genomic DNA. We recommend using the online tool described in this protocol in aiding target selection (www.genome-mgineering.org tools).
- U6 Fwd U6 reverse primer
- U6 Rev U6 reverse primer
- extended DNA oligo Ultramer oiigos from IDT
- guide sequence (blue N's) in U6 Rev- is the reverse complement of the 5'-NGG flanking target sequence
- the guide oligos (blue N's) contain overhangs for ligation into the pair of Bbsl sites on PS330, with the top and bottom strand orientations matching those of the genomic target (i.e. top oligo is the 20-bp sequence preceding 5'-NGG in genomic DNA). Digestion of PX330 with Bbsl allows the replacement of the Type lis restriction sites (blue outline) with direct insertion of annealed oiigos. It is worth noting that an extra G was placed before the first base of the guide sequence. Applicants have found that an extra G in front of the guide sequence does not adversely affect targeting efficiency.
- Figure 62A-D shows the anticipated results for multiple NHEJ.
- Cas9-mediated cleavage efficiency (% indel) is calculated based on the fraction of cleaved DNA, as determined by integrated intensity of gel ba ds, (b) Two sgRNAs (orange a d blue bars) are designed to target the human GRIN2B and DYRKIA loci. SURVEYOR gel shows modification at both loci in transfecied cells. Colored arrows indicated expected fragment sizes for each locus, (c) A pair of sgRNAs (light blue and green bars) are designed to excise an exon (dark blue) in the human EMX1 locus. Target sequences and PAMs (red) are shown in respective colors, and sites of cleavage indicated by red triangle.
- Predicted junction is shown below, individual clones isolated from cell populations transfecied with sgRNA 3, 4, or both are assayed by PCR (OUT Fwd, OUT Rev), reflecting a deletion of ⁇ 270-bp. Representative clones with no modification (12/23), mono- allelic (10/23), and bi-allelic (1/23) modifications are shown. IN Fwd and IN Rev primers are used to screen for inversion events (Fig. 6d). (d) Quantification of clonal lines with EMX1 exon deletions.
- Two pairs of sgRNAs (3.1, 3.2 left-flanking sgRNAs; 4.1, 4.2, right flanking sgRNAs) are used to mediate deletions of variable sizes around one EMX1 exon.
- Transfecied cells are clonaily isolated and expanded for genotyping analysis for deletions and inversion events. Of the 105 clones are screened, 51 (49%) and 11 (10%) carrying heterozygous and homozygous deletions, respectively. Approximate deletion sizes are given since junctions may be variable.
- Figure 63A-C shows the application of ssODNs and targeting vector to mediate HR with both wifdtype and nickase mutant of Cas9 in HEK293FT and HUES9 cells with efficiencies ranging from 1.0-27%.
- Figure 64 shows a schematic of a PCR-based .method for rapid and efficient CRISPR targeting in mammalian ceils.
- a plasmid containing the human RNA polymerase III promoter U6 is PCR-amplified using a U6-specific forward primer and a reverse primer carrying the reverse complement of part of the U6 promoter, the sgRNA(+85) scaffold with guide sequence, and 7 T nucleotides for transcriptional termination.
- the resulting PCR product is purified and co- delivered with a plasmid carrying Cas9 driven by the CBh promoter.
- Figure 65 shows SURVEYOR Mutation Detection Kit from Transgenomlcs results for each gRNA and respective controls.
- a positive SURVEY R result is one large band corresponding to the genomic PCR and two smaller bands that are the product of the SURVEYOR nuclease making a double-strand break at the site of a mutation.
- Each gRNA was validated in the mouse cell line, Neuro-N2a, by liposomal transient co-transfection with hSpCas9. 72 hours post-transfection genomic DNA was purified using QuickExtract DNA from Epicentre. PCR was performed to amplify the locus of interest.
- Figure 66 shows Surveyor results for 38 live pups (lanes 1-38) 1 dead pup (lane 39) and 1 wild-type pup for comparison (lane 40). Pups 1-19 were injected with gRNA Chd.8.2 and pups 20-38 were injected with gRNA Chd8.3. Of the 38 live pups, 13 were positive for a mutation. The one dead pup also had a mutation. There was no mutation detected in the wild- type sample. Genomic PCR sequencing was consistent with the SURVEYOR assay findings.
- FIG. 67 shows a design of different Cas9 NLS constructs. All Cas9 were the human-codon-optimized version of the Sp Cas9. LS sequences are linked to the cas9 gene at either N-terminus or C-teraiinus. All Cas9 variants with different NLS designs were cloned into a backbone vector containing so it is driven by EFla promoter. On the same vector there is a chimeric RNA targeting human EMX1 locus driven by U6 promoter, together forming a two- eomponent system.
- Figure 69A shows a design of the CRISPR-TF (Transcription Factor) with transcriptional activation activity.
- the chimeric RNA is expressed by U6 promoter, while a human-codon-optimized, double-mutant version of the Cas9 protein (hSpCas9m), operabiy linked to triple NLS and a VP64 functional domain is expressed by a EF l a promoter.
- the double mutations, DIOA and H840A renders the cas9 protein unable to introduce any cleavage but maintained its capacity to bind to target DNA when guided by the chimeric R NA.
- Figure 69B shows transcriptional activation of the human SOX2 ge e with CRISPR- TF system (Chimeric RNA and the Cas9-NLS-VP64 fusion protein).
- 293FT cells were transfected with piasmids bearing two components: (I) U6-driven different chimeric RNAs targeting 20-bp sequences within or around the human SOX2 genomic locus, and (2) EF la- driven hSpCas9m (double mutant)-NLS-VP64 fusion protein.
- 96 hours post transfection 293FT cells were harvested and the level of activation is measured by the induction of mRNA expression using a qRT-PCR assay.
- Figure 70 depicts NLS architecture optimization for SpCas9.
- Figure 71 shows a QQ plot for NGGNN sequences.
- Figure 72 shows a histogram of the data density with fitted normal distribution (black line) and ,99 quantile (dotted line).
- FIG. 73A-C shows RNA-guided repression of bgaA expression by dgRNA::cas9**.
- the Cas9 protein binds to the tracrR A, and to the precursor CRISPR RNA which is processed by RNAselll to form the crRNA.
- the crRNA directs binding of Cas9 to the bgaA promoter and represses transcription, b.
- the targets used to direct Cas9** to the bgaA promoter are represented. Putative -35, -10 as well as the bgaA start codon are in bold.
- Betagaiactosidase activity as measure by Miller assay in the absence of targeting and for the four different targets.
- Figure 74A-E shows characterization of Cas9** mediated repression, a.
- the gfpmui2 gene and its promoter, including the -35 and -10 signals are represented together with the position of the different target sites used the study, b.
- Relative fluorescence upon targeting of the coding strand c.
- Relative fluorescence upon targeting of the non-coding strand d.
- polynucleotide refers to a polymeric form of nucleotides of any length, either deoxyribonueleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown.
- polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (niRNA), transfer RNA, ribosomai RNA, short interfering RNA (siRNA), short-hairpin RNA (shR A), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers,
- a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs.
- modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
- the sequence of nucleotides may be interrupted by non-nuc!eotide components.
- a polynucleotide may be further modified after polymerizatio , such as by conjugation with a labeling component.
- chimeric RNA In aspects of the i ve tion the terms “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA” and “synthetic guide RNA” are used interchangeably and refer to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence.
- guide sequence refers to the about 20bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or "spacer”.
- tracr mate sequence may also be used interchangeably with the term “direct repeat(s)”.
- wild type is a term of the art understood by skilled perso s and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
- variable should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
- nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
- Complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non- traditional types.
- a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100%) complementary).
- Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
- Substantially complementary refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under strirs gen t condi tion s .
- stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes wit the target sequence, and substantially does not hybridize to non-target sequences.
- Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.
- Non -limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology- Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.
- Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
- the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
- the complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self hybridizing strand, or any combination of these.
- a hybridization reaction may constitute a step in a more extensive process, such as the initiation of PGR, or the cleavage of a polynucleotide by an enzyme.
- a sequence capable of hybridizing with a given sequence is referred to as the "compl ement" of the given sequence.
- expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins.
- Transcripts and encoded polypeptides may be collectively referred to as "gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic ceil.
- polypeptide refers to polymers of amino acids of any length.
- the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non amino acids.
- the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
- amino acid includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or I, optical isomers, and amino acid analogs and peptidomimetics.
- subject preferably a mammal, more preferably a human.
- Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
- therapeutic agent refers to a molecule or compound that confers some beneficial effect upon administration to a subject.
- the beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
- treatment or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit.
- therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment.
- the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet bee manifested .
- the term "effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results.
- the therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be detennined by one of ordinary skill in the art.
- the term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein.
- the specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
- Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells.
- CRISPR transcripts e.g. nucleic acid transcripts, proteins, or enzymes
- CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in GoeddeL GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
- the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
- Vectors may be introduced and propagated in a prokaryote.
- a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system).
- a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism.
- Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein.
- Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protem to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
- Such enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
- Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988.
- GST glutathione S-transferase
- E. coli expression vectors examples include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET l id (Studier et al, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).
- a vector is a yeast expression vector.
- yeast Saccharomyces cerivisae examples include pYepSecl (Baldari, et al., 1987. EMBO J. 6: 229-234), pMFa ( uijan and Herskowitz, 1982. Cell 30: 933-943), pJRY88 (Schultz et al, 1987. Gene 54: 1 13-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif).
- a vector drives protein expression in insect cells using baculovirus expression vectors.
- Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31-39).
- a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector.
- mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195).
- the expression vector's control functions are typically provided by one or more regulatory elements.
- commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
- the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
- tissue-specific regulatory- elements are known in the art.
- suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1 : 268-277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T ceil receptors (Winoto and Baltimore, 1989. EMBO J.
- promoters are also encompassed, e.g., the murine hox promoters ( essel. and Grass, 1990. Science 249: 374-379) and the a-fetoprotein promoter ⁇ Cam pes and Tiighman, 1989. Genes Dev. 3: 537-546).
- a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expressio of the one or more elements of the CRISPR system
- C ISPRs Clustered Regularly Interspaced Short Palindromic Repeats
- SPIDRs Sacer Interspersed Direct Repeats
- the CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacterid., 169:5429-5433 [1987]; and Nakata et al, J.
- the CRISPR loci typically differ from other SSRs by the stmcture of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OM1CS J. Meg. Biol, 6:23-33 [2002]; and Mojica et al, Mol. Microbiol, 36:244-246 [2000]).
- SRSRs short regularly spaced repeats
- the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra).
- CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol.
- CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas") genes, including sequences encoding a Cas gene, a tracr (trans -activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrR A), a tracr-mate sequence (encompassing a "direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
- a tracr trans -activating CRISPR
- tracr-mate sequence encompassing a "direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system
- guide sequence also referred to as a "spacer” in the context of an endogenous CRIS
- one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
- target sequence refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence a d a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
- a target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.
- a target sequence is located in the nucleus or cytoplasm of a ceil.
- the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chlorop!ast.
- a sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an "editing template” or “editing polynucleotide” or “editing sequence”.
- an exogenous template poly ucleotide may be referred to as a editing template.
- the recombination is homologous recombination.
- a CRISPR complex comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins
- formation of a CRISPR complex results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence.
- the tracr sequence which may comprise or consist of al l or a portion of a wild- type tracr sequence (e.g.
- a wild-type tracr sequence may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operabiy linked to the guide sequence.
- the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional.
- the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
- one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites.
- a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operabiy linked to separate regulatory elements on separate vectors.
- two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector.
- CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5" with respect to ("upstream” of) or 3' with, respect to ("downstream” of) a second element.
- the coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction.
- a single promoter drives expression of a transcript encoding a C ISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron).
- the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.
- a vector comprises one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a "cloning site").
- one or more insertion sites e.g. about or more than about I, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites are located upstream and/or downstream of one or more sequence elements of one or more vectors.
- a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulator ⁇ ' element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic ceil.
- a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to al low insertion of a guide sequence at each site.
- the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these.
- a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell.
- a single vector may comprise about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about .1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequenee-containing vectors may be provided, and optionally delivered to a cell.
- a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein.
- Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Cmrl , Cmr3, Cmr4, Cmr5, Cnrr6, Csbl , Csb2, Csb3, Csxl7, CsxM, Csx lO, Cs l6, CsaX, Csx3, Cs l, Csxl5, Csfl , Csf2, CsO
- the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9.
- the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae.
- the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence.
- the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.
- a vector encodes a CRISPR enzyme that is mutated to with respect to a corresponding wifd-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence.
- D10A aspartate -to-a!anine substitution
- pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand).
- Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A.
- a Cas9 nickase may be used in combination with guide sequenc(es), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ.
- Applicants have demonstrated (data not shown) the efficacy of two nickase targets (i.e., sgRNAs targeted at the same location but to different strands of DNA) in inducing mutagenic NHEJ.
- a single nickase (Cas9-D10A with a single sgRNA) is unable to induce NBEJ and create indels but Applicants have shown that double nickase (Cas9 ⁇ D10A and two sgRNAs targeted to different strands at the same location) can do so in human embryonic stem cells (hESCs).
- the efficiency is about 50% of nuclease (i.e., regular Cas9 without D10 mutation) in hESCs.
- two or more catalytic domains of Cas9 may be mutated to produce a mutated Cas9 substantial ly lacking all DNA cleavage activity.
- a DI0A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity.
- a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01 %, or lower with respect to its non-mutated form.
- Other mutations may be useful; where the Cas9 or other CRISPR enzyme is from a species other than S. pyogenes, mutations in corresponding amino acids may be made to achieve similar effects.
- an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular ceils, such as eukaryotic cells.
- the eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate.
- codon optimization refers to a process of modifying a nucleic acid sequence for enhan ced expression in the host cells of interest by replacing at least one codon (e.g.
- Codon bias differences in codon usage between organisms
- mRNA messenger RNA
- tRNA transfer RNA
- genes can be tailored for optimal gene expression in a given organism based on codon optimization.
- Codon usage tables are readily available, for example, at the "Codon Usage Database", and these tables can be adapted in a number of ways. See Nakamura, Y., et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nuci. Acids Res, 28:292 (2000), Computer algorithms for codon optimizing a particular sequence for expression in a particular host ceil are also available, such as Gene Forge (Aptagen: Jacobus, PA), are also available.
- one or more codons e.g. 1 , 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons
- one or more codons in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
- a vector encodes a CR ISPR enzyme comprising one or more nuclear localization sequences (NLSs), such as about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs.
- the CRISPR enzyme comprises about or more than about 1. 2, 3, 4, 5, 6, 7, 8, 9, 10. or more NLSs at or near the ami no -terminus, about or more tha about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more N LSs at or near the carboxy-terminus, or a combination of these (e.g. one or more NLS at the ammo-terminus and one or more NLS at the earboxy terminus).
- the CRISPR enzyme comprises at most 6 NLSs, In some embodiments, an NLS is considered near the N- or C-terminus when the nearest amino acid of the NLS is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more amino acids along the polypeptide chain from the N- or C-terminus.
- an NLS consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface, but other types of NLS are known.
- Non- limiting examples of NLSs include an NLS sequence derived from: the NLS of the SV40 virus large T-antigen, having the amino acid sequence PKKKRKV ; the NLS from nucleopSasmin (e.g. the nucleoplasmin bipartite NLS with the sequence KRPAATKKAGQAKKKK); the c-myc NLS having the amino acid sequence PAAKRV LD or RQRRNELKRSP; the hRNPAl M9 NLS having the sequence NQSSNFGPM GGNFGGRSSGPYGGGGQYFAKPRNQGGY; the sequence R RIZFKNKGKDTA:ELRRRRVE 7 S 7 ELRKAKKDEQILKRRNV of the IBB domain from importin-alpha; the sequences VSR RPRP and PPKKARED of the myoma T protein; the sequence POP KKPL of human p53; the sequence SAIJKKKKK AP of mouse c- abl IV; the sequences
- the one or more NLSs are of sufficient strength to drive accumulation of the CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell.
- strength of nuclear localization activity may derive from the number of NLSs in the CRISPR enzyme, the particular NLS(s) used, or a combination of these factors.
- Detection of accumulation in the nucleus may be performed by any suitable technique.
- a detectable marker may be fused to the CRISPR enzyme, such that location within a cell may be visualized, such as in combination with a means for detecting the location of the nucleus (e.g. a stain specific for the nucleus such as DAPI).
- detectable markers include fluorescent proteins (such as Green fluorescent proteins, or GFP; RFP; CFP), and epitope tags (HA tag, flag tag, SNAP lag).
- Cell nuclei may also be isolated from cells, the contents of which may then be analyzed by any suitable process for detecting protein, such as immunohistochemistry, Western blot, or e zyme activity assay. Accumulation in the nucleus may also be determined indirectly, such as by an assay for the effect of CRISPR complex formation (e.g.
- a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence.
- the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm is about or more than about 50%. 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
- Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith -Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Ciustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, Sa Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
- Burrows-Wheeler Transform e.g. the Burrows Wheeler Aligner
- ClustalW ClustalW
- Ciustal X Ciustal X
- BLAT BLAT
- Novoalign Novoalign
- ELAND Illumina, Sa Diego, CA
- SOAP available at soap.genomics.org.cn
- Maq available at maq.sourceforge.net
- a guide sequence Is about or more tha about 5, 10, I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence- specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay.
- the components of a CRISPR system sufficient to form a CRISPR complex may be provided to a host ceil having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein.
- cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
- Other assays are possible, and will occur to those skilled in the art.
- a guide sequence may be selected to target any target sequence.
- the target sequence is a sequence within a genome of a cel l.
- Exemplar ⁇ ' target sequences include those that are u ique in the target genome.
- a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNNNXGG where NNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
- a unique target sequence in a genome may include an S.
- a unique target sequence in a genome may include a Cas9 target site of the form MMMMM MMMNNNNNNNNNNXXAGAAW where NNNNNNNNNNXXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome.
- a unique target sequence in a genome may include an S. thermophilus CRISPRl Cas9 target site of the form MM MMMMMMMN N N NNNNNXXAGAAW where
- a unique target sequence in a genome may include a Cas9 target site of the form MMMMMM MMNNNNNNNNNNNNNNNNXGGXG where NNNNNNNNNNNNXG GX G (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome,
- a unique target sequence in a genome may include an S.
- N is A, G, T, or C; and can be anything
- M may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
- a guide sequence is selected to reduce the degree of secondary structure within the guide sequence.
- Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFo!d, as described by Zuker and Stiegier (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfokl, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A.R. Gruber et ., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62). Further algorithms may be found in U.S. application Serial No. TBA (attorney docket 44790.11.2022; Broad Reference BI-2013/004A); incorporated herein by reference.
- a tracr mate sequence includes any sequence that has sufficient complementarity with a tracr sequence to promote one or more of: (1) excision of a guide sequence flanked by tracr mate sequences in a cell containing the corresponding tracr sequence; and (2) formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the tracr mate sequence hybridized to the tracr sequence.
- degree of complementarity is with reference to the optimal alignment of the tracr mate sequence and tracr sequence, along the length of the shorter of the two sequences.
- Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the tracr sequence or tracr mate sequence.
- the degree of complementarity between the tracr sequence and tracr mate sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher.
- Example illustrations of optimal alignment between a tracr sequence and a tracr mate sequence are provided in Figures 12B and I3B.
- the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length.
- the tracr sequence and tracr mate sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin.
- Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences.
- the sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G).
- loop forming sequences include CAAA and AAAG.
- the transcript or transcribed polynucleotide sequence has at least two or more hairpins.
- the transcript has two, three, four or five hairpins.
- the transcript has at most five hairpins.
- the single transcript further includes a transcription termination sequence; preferably this is a polyT sequence, for example six T nucleotides. An example illustration of such a hairpin structure is provided in the lower portion of Figure 13B, where the portion of the sequence 5' of the final "N" and upstream of the loop corresponds to the tracr mate sequence, and the portion of the sequence 3' of the loop corresponds to the tracr sequence.
- Non-limiting examples of single polynucleotides comprisi g a guide sequence, a tracr mate sequence, and a tracr sequence are as follows (listed 5' to 3'), where "N" represents a base of a guide sequence, the first block of lower case letters represent the tracr mate sequence, and the second block of lower case letters represent the tracr sequence, and the final poly-T sequence represents the transcription terminator: (1 ) catgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT; (2) isnsnsnsnsnsnsnsnsnsns ⁇
- sequences (1) to (3) are used in combinatio with Cas9 from S. thermophilus CRJSPR1.
- sequences (4) to (6) are used in combination with Cas9 from S. pyogenes.
- the tracr sequence is a separate transcript from a transcript comprising the tracr mate sequence (suc as illustrated in the top portion of Figure 13B).
- a recombination template is also provided.
- a recombination template may be a component of another vector as described herein, contained in a separate vector, or provided as a separate polynucleotide.
- a recombination template is designed to serve as a template in homologous recombination, such as within or near a target sequence nicked or cleaved by a CRISPR enzyme as a part of a CRISPR complex.
- a template polynucleotide may be of any suitable length, such as about or more than about 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, or more nucleotides in length.
- the template polynucleotide is complementary to a portion of a polynucleotide comprising the target sequence.
- a template polynucleotide might overlap with one or more nucleotides of a target sequences (e.g. about or more than about 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more ucleotides).
- the nearest nucleotide of the template polynucleotide is within about 1 , 5, 10, 15, 20, 25, 50, 75, 100, 200, 300, 400, 500, 1000, 5000, 10000, or more nucleotides from the target sequence.
- the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme).
- a CR ISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains.
- epitope tags include histidme (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
- reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).
- GST glutathione-S-transferase
- HRP horseradish peroxidase
- CAT chloramphenicol acetyltransferase
- beta-galactosidase beta-galactosidase
- beta-glucuronidase beta-galactosidase
- luciferase green fluorescent protein
- GFP green fluorescent protein
- HcRed HcRed
- DsRed cyan fluorescent protein
- a CRISPR enzyme may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP! 6 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US201 10059502, incorporated herein by reference. In some embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
- MBP maltose binding protein
- DBD Lex A DNA binding domain
- HSV herpes simplex virus
- the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host. cell.
- the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cel ls.
- a CRISPR enzyme in combi ation with (and optionally compiexed with) a guide sequence is delivered to a cell.
- Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues.
- Non-viral vector delivery systems include DNA plasniids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid compiexed with a delivery vehicle, such as a liposome.
- Viral vector delivery systems include DN A and RNA viruses, which have either episomal or integrated genomes after delivery to the ceil.
- Methods of non-viral delivery of ucleic acids mciude lipoiection, nucleofeetion, microinjection, biolistics, virosomes, liposomes, immunoliposomes, poiycation or lipid :nucleic acid co jugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
- Lipoiection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM).
- Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administratio ) or target tissues (e.g. in vivo administration).
- RNA or DNA viral based systems for the deliveiy of nucleic acids takes advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
- Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo).
- Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associaied and herpes simplex virus vectors for gene transfer.
- Retroviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral tilers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LT s are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cel l to provide permanent transgene expression.
- Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia vims (GaLV), Simian Immuiio deficiency vims (SIV), human immuno deficiency vims (HIV), and combinations thereof (see, e.g., Buchscher et al, J. Virol. 66:2731 -2739 (1992); Johann et al, J. Virol. 66: 1635-1640 (1992); Sommnerfelt ei al., Virol 176:58-59 (1990); Wilson et al, J. Virol 63:2374-2378 (1989); Miller et al, J. Virol.
- MiLV murine leukemia virus
- GaLV gibbon ape leukemia vims
- SIV Simian Immuiio deficiency vims
- HV human immuno deficiency vims
- adenoviral based systems may be used.
- Adenoviral based vectors are capable of very high transduction efficiency in man)? cell types and do not require ceil division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
- Adeno-associated vims may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al,, Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641 ; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94: 1351 (1994), Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No.
- Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
- Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide ⁇ ) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess 1TR sequences from the AAV genome which are required for packaging and integration into the host genome.
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line may also be infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination wit adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US200300878 1 7, incorporated herein by reference.
- a host cell is transiently or non-transiently transfecte with one or more vectors described herein.
- a cell is transfected as it naturally occurs in a subject.
- a cell that Is transfected is taken from a subject.
- the cell is derived from cells taken from a subject, such as a cell line.
- ceil lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161 , CCRF-CEM, MOLT, mlMCD-3, NHDF, HeLa-S3, Huhl , Huh4, Huh7, Nl . ' V LC .
- HASMC HASMC, HEKn, HEKa, MiaPaCell, Panel , PC-3, TF1 , CTLL-2, C 1 R, Rat6, CV 1, RPTE, A10, T24, J82, A375, ARH-77, Calul, SW480, SW620, S OV3, SK-UT, CaCo2, P388D1 , SEM-K2, WEHI-231 , HB56, TIB55, Jurkat, J45.01 , LRMB, Bcl-1 , BC-3, IC21 , DLD2, R.aw264.7, NRK, NRK-52E, MR.C5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial, BALB/ 3T3 mouse embryo fibroblast, 3T3 Swiss, 3T3-L1 , 132-d5 human fetal fibroblasts;
- a cell transfeeted with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences.
- a cel l transiently transfeeted with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CR1SPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence.
- cells transiently or non-transiently transfeeted with one or more vectors described herein, or cell lines derived from such ceils are used in assessing one or more test compounds.
- one or more vectors described herein are used to produce a non-human transgenic animal or transgenic plant.
- the transgenic animal is a mammal, such as a mouse, rat, or rabbit.
- the organism or subject is a plant.
- the organism or subject or plant is algae. Methods for producing transgenic plants and animals are known in the art, and generally begin with a method of cell transfeciion, such as described herein.
- the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell.
- the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- the invention provides a method of modifying expression of a polynucleotide in a eukaryotic ceil.
- the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence which in turn hybridizes to a tracr sequence.
- the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo or in vitro.
- the method comprises sampling a cell or population of cells from a human or non- human animal or plant (including micro-algae), and modifying the cell or cells. C alluring may occur at any stage ex vivo. The cell or cells may even be re-introduced into the non-human animal or plant (including micro-algae).
- pathogens are often host-specific.
- Fusarium oxysporum f. sp. lycopersici causes tomato wilt but attacks only tomato
- Plants have existing and induced defenses to resist most pathogens. Mutations and recombination events across plant generations lead to genetic variability that gives rise to susceptibility, especially as pathogens reproduce with more frequency than plants.
- there can be non-host resistance e.g., the host and pathogen are incompatible.
- Horizontal Resistance e.g., partial resistance against all races of a pathogen, typically controlled by many genes
- Vertical Resistance e.g., complete resistance to some races of a pathogen but not to other races, typically controlled by a few genes.
- Plant and pathogens evolve together, and the genetic changes in one balance changes in other. Accordingly, using Natural Variability, breeders combine most useful genes for Yield, Quality, Uniformity, Hardiness, Resistance.
- the sources of resistance genes include native or foreign Varieties, Heirloom Varieties, Wild Plant Relatives, and Induced Mutations, e.g., treating plant material with mutagenic agents.
- plant breeders are provided with a new tool to induce mutations. Accordingly, one skilled in the art can analyze the genome of sources of resistance genes, and in Varieties having desired characteristics or traits employ the present invention to induce the rise of resistance genes, with more precision than previous mutagenic agents and hence accelerate and improve plant breeding programs.
- the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions.
- the kit comprises a vector system and instructions for using the kit.
- the vector system comprises (a) a first regulatory element operabiy linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a CRISPR enzyme eompiexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence; and/or (b) a second regulatory element operably linked to an enzyme-coding sequence encoding said CRISPR enzyme comprising a nuclear localization sequence.
- Elements may be provide individual ly or in combinations, and may be provided in any suitable container,
- a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein.
- Reagents may be provided in any suitable container.
- a kit may provide one or more reaction or storage buffers.
- Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyopiiiiized form).
- a buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof.
- the buffer is alkaline.
- the buffer has a pH from about 7 to about 10.
- the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element, in some embodiments, the kit comprises a homologous recombination template polynucleotide.
- the invention provides methods for using one or more elements of a CRISPR system.
- the CRISPR complex of the invention provides an effective means for modifying a target polynucleotide.
- the CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types.
- modifying e.g., deleting, inserting, translocating, inactivating, activating
- the CRISPR complex of the invention has a broad spectrum of applications in, e.g., gene therapy, drug screening, disease diagnosis, and prognosis.
- An exemplary CRISPR complex comprises a CRISPR enzyme eompiexed with a guide sequence hybridized to a target sequence within the target polynucleotide.
- the guide sequence is linked to a tracr mate sequence, which in turn hybridizes to a tracr sequence.
- the target polynucleotide of a CRISPR complex can be any polynucleotide endogenous or exogenous to the eukaryotic cell.
- the target polynucleotide can be a polynucleotide residing in the nucleus of the eukaryotic cell.
- the target polynucleotide can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a junk DNA).
- a gene product e.g., a protein
- a non-coding sequence e.g., a regulatory polynucleotide or a junk DNA.
- PAM protospacer adjacent motif
- PAMs are typically 2-5 base pair sequences adjacent the protospacer (thai is, the target sequence) Examples of PAM sequences are given in the examples section beiow r , and the skilled person will be able to identify further PAM sequences for use with a given CRISPR enzyme.
- the target polynucleotide of a CRISPR complex may include a number of disease- associated genes and polynucleotides as well as signaling biochemical pathway-associated genes and polynucleotides as listed in US provisional patent applications 61 /736,527 and 61/748,427 having Broad reference BI-2011/008/WSGR Docket No. 44063-701.1 Gland BI- 201 1/008/WSGR Docket No. 44063-701 .102 respectively, both entitled SYSTEMS METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION filed on December 12, 2012 and January 2, 2013, respectively, the contents of all of which are herein incorporated by reference in their entirety.
- target polynucleotides include a sequence associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide.
- target polynucleotides include a disease associated gene or polynucleotide.
- a "disease-associated" gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cel ls of a non disease control.
- a disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease.
- the transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.
- Parkinson's Disease x-Synuclein DJ-1; 1.RR 2: Parkin; PINK!
- Hernophagocytic lynrphohistiocyiosis disorders PRF1, HPLH2,
- BCL7A BCL7
- Leukemia TALI, and oncology TCL5, SCL, TAL2, FLT3, NBS i, NBS, ZNFN1A1 , IKi, LYFi, diseases and disorders HOXD4, HQX4B, BCR, CML, PHL, ALL, ARNT, KRAS2.
- RASK2 B-cell non-Hodgkin lymphoma
- GMPS GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPM1, NUP214, D9S46E, CAN, CAIN, RIJNXl , CBFA2, AM I i .
- CMKBR5, CCCKR5 CCR.5
- Immunodeficiencies CD3E, CD3G, A CDA, AID, HIGM2, TNFRSF5, CD40, IJNG, DGU, HIGM4, TNFSF5.
- CF CF, MRP7; Glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PTI, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); Hepatic adenoma, 142330 (TCFl, HNF1 A, MODY3), Hepatic failure, early onset, and neurologic disorder (SCOD1, SCOl), Hepatic lipase deficiency (LIPC), Hepatoblastoma, cancer and carcinomas (CTNNBl , PDGFRL, PDGRL, PRLTS, AX I I , AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; Medullary cystic kidney disease (UMOD, HNFJ, FJHN, MC D2, ADMCKD2); Phenylkeionuria (PAH, PKU1 ,
- Muscular / Skeletal Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne Muscular d seases and disorders Dystrophy (DMD, BMD); Eniery-Dreifuss muscular dystrophy (LMNA, LMN1, EMD2, FPU).
- EMD2, FPLD, CMD1A Facioscapulohumeral muscular dystrophy (FSHMD 1 A, FS HD 1 A); Muscular dystrophy (FKRP, MDC 1 C,
- LGMD2I L.AMA.2, LAMM, LARGE, KIAA0609, MDC ID, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCA.P, LGMD.2G, CMDIN, TRIM32, HT2A, LGMD2H, FKRP, MDC1C. LGMD2I, TTN.
- Neurological and ALS SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, neuronal, diseases and VEGF-c); Alzheimer disease i ' APP, AAA, CVAP, ADl, APOE, AD2, disorders PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE,
- DCPl ACEL MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3); Autism (Mecp2, B.ZRAP1, MDGA2, SemaSA, Neurexin 1, GLOl, MECP2, RTT, PPMX, MR 16, MRX79, NLGN3, NLGN4, IAA1260, AUTSX2); Fragile X Syndrome (F R2, FXR1, FXR2, mGLUR5); Huntington's disease and disease like disorders (HD, IT15, PRNP, PR1P, J PI 13.
- Autism Mecp2, B.ZRAP1, MDGA2, SemaSA, Neurexin 1, GLOl, MECP2, RTT, PPMX, MR 16, MRX79, NLGN3, NLGN4, IAA1260, AUTSX2
- Fragile X Syndrome F R2, FXR1, FXR2, mGLUR5
- Parkinson disease (NR4A2, NUR 1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK I, PARK4, DJ1, PARK7, LRRK2, PARKS, ⁇ 1, PARK6, UCHL1, PARKS, SNCA, NACP, PARK1, PARK4, PRKN, P.ARK2, PDJ, DBH, NDUFV.2); Rett, syndrome (MECP.2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, x-Synuclein, DJ-1); Schizophrenia (Neuregulinl (Nrgl), Erb4 (receptor for Neuregulin), Complexinl (Cplxl), Tphl Tnq3tophan hydroxylase, Tph2, Tryptophan hydroxylase 2, Neurexin 1,
- VLDLR VLDLR
- Occular diseases and Age-related macular degeneration Abcr, Ccl2, Cc2, cp (ceruloplasmin), disorders Ti.mp3, cathepsinD, Vidir, Ccr2); Cataract. (CRYAA, CRYA1, CRYBB2,
- IGF-1 Signaling IGF1; PRKCZ; ELK1; MAPKl; PTPN11; NEDD4; AKT2;
- PIK3CA PRKCI; PTK2; FOS; PIK3CB; PIK3C3; MAPK8;
- IGF1R insulin receptor
- IRS1 MAPK3
- IGFBP7 IGFBP7
- KRAS PIK3C2A
- PDPK1 MAP2K1; IGFBP2; SI N; JUN; CYR61; AKT3;
- NRF2 ⁇ mediated PRKCE EP300; SOD2; PRKCZ; MAPKl; SQSTMl;
- PRKDl PRKDl
- MAPK3 KRAS
- PRKCD PRKCD
- GSTP1 GSTP1; MAPK9; FTL;
- IGFIR insulin receptor RI
- IL6R RELA
- TLR4 PDGFRB
- TNF RELB
- IL8 IL8
- PDGFRA NFKBI
- TGFBR1 TGFBR1
- SMAD4 VEGFA
- BAX BAX
- NRJP1 KRAS
- PPARG RELA
- STATS A TRAF2;
- MAP2K1 MAP2K1; NFKBI; JUN; IL1R1; HSP90AA1
- PRKD1 MAPK3; MAPK10; KRAS; MAPKl 3; PRKCD;
- MAPK9 PIK3C2A
- BTK PIK3C2A
- MAPK14 TNF; RATI; FYN;
- MAP2K2 MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3;
- PIK3C3 MAPK3; KRAS; RELA; SRC; PIK3C2A; RAF1;
- PDPK1 PDPK1; STAT3; MAP2KI; NFKBI; BRAF; ATF4; AKT3;
- Inositol Phosphate PRKCE Inositol Phosphate PRKCE; IRAKI; PRKAA2; EIF2AK2; PTEN; GRK6;
- MAP2K1 MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK
- Glutathione Metabolism 11)1 12 GSTP1; ANPEP; ! l i l
- Methionine Metabolism DNMT1 ; DNMT3B; AHCY; DNMT3A
- Trpal Pome; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca;
- Prkacb Prkarl a
- Prkar2a Prkacb
- Wnt2b Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b;
- Embodiments of the invention also relate to methods and compositions related to knocking out genes, amplifying genes and repairmg particular mutations associated with DNA repeat instability and neurological disorders (Robert D, Wells, Tetsuo Ashizawa, Genetic Instabilities and Neurological Diseases, Second Edition, Academic Press, Oct 13, 2011 - Medical). Specific aspects of tandem repeat sequences have been found to be responsible for more than twenty human diseases (New insights into repeal instability: role of RNA 3 ⁇ 4 DNA hybrids. Mclvor EI, Polak U, Napierala M. RNA Biol. 2010 Sep-Oct;7(5):551-8). The CRISPR- Cas system may be harnessed to correct these defects of genomic instability.
- a further aspect of the invention relates to utilizing the CRISPR-Cas system for correcting defects in the EMP2A and EMP2B genes that have been identified to be associated with Lafora disease.
- Lafora disease is an autosomal recessive condition which is characterized by progressive myoclonus epilepsy which may start as epileptic seizures in adolescence, A few cases of the disease may be caused by mutations in genes yet to be identified. The disease causes seizures, muscle spasms, difficulty walking, dementia, and eventually death. There is currently no therapy that has proven effective against disease progression.
- the CRISPR-Cas system may be used to correct ocular defects that arise from several genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.
- the genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease, Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration, Fabry's Disease, Gerstmann-Straussier-Scheinker Disease, Huntington's Disease and other Triplet Repeat Disorders, Leigh's Disease, Lesch-Nyhan Syndrome, Menkes Disease, Mitochondrial Myopathies and NINDS Colpocephaly. These diseases are further described on the website of the National Institutes of Health under the subsection Genetic Brain Disorders.
- the condition may be neoplasia.
- the genes to be targeted are any of those listed in Table A (in this case PTEN and so forth).
- the condition may be Age-related Macular Degeneration,
- the condition may be a Schizophrenic Disorder.
- the condition may be a Trinucleotide Repeat Disorder.
- the condition may be Fragile X Syndrome.
- the condition may be a Secretase Related Disorder.
- the condition may be a Prion - related disorder.
- the condition may be ALS.
- the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson 's Disease.
- proteins associated with Parkinson 's disease include but are not limited to a-synuclein, DJ ⁇ 1 , LRRK2, PIN 1 , Parkin, UCHL1 , Synphilin-1 , and XL RR i .
- Examples of addiction-related proteins may include ABAT for example.
- inflammation-related proteins may include the monocyte ehemoattraetant protein- 1 (MCP1 ) encoded by the Ccr2 gene, the C-C chemokine receptor type 5
- CCR5 encoded by the Ccr5 gene
- FCGR2b also termed CD32
- FCERl g Fc epsi lon Ri g
- cardiovascular diseases associated proteins may include IL1B (mterieiikm 1 , beta), XDH (xanthine dehydrogenase), TPS 3 (tumor protein p53 ), PTGIS (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin), TLA (interieukm 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP-binding cassette, sub-family G (WHITE), member 8), or CTS (cathepsin K), for example.
- Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme I (UBA1) encoded by the UBA1 gene, or the NEDD8 ⁇ activating enzyme El catalytic subunit protein (UBE1 C) encoded by the UBA3 gene, for example.
- VLDLR very low density lipoprotein receptor protein
- UBA1 ubiquitin-like modifier activating enzyme I
- UBE1 C El catalytic subunit protein
- proteins associated Autism Spectrum Disorder may include the benzodiazepine receptor (peripheral) associated protein 1 (BZRA P1 ) encoded by the BZRAP1 gene, the AF4/FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardation autosomal homolog 1 protein (FXR 1 ) encoded by the FXR1 gene, or the fragile X mental retardation autosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example.
- BZRA P1 benzodiazepine receptor (peripheral) associated protein 1
- AFF2 AF4/FMR2 family member 2 protein
- FXR 1 fragile X mental retardation autosomal homolog 1 protein
- FXR2 fragile X mental retardation autosomal homolog 2 protein
- proteins associated Macular Degeneration may include the ATP-binding cassette, sub-family A (ABCl) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C-C motif) Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example.
- ABCl sub-family A
- APOE apolipoprotein E protein
- CCL2 chemokine Ligand 2 protein
- proteins associated Schizophrenia may include NRG1 , ErbB4, CPLXl , TPHl , TPH2, NRXNl , GS 3A, BDNF, DISC I , GSK3B, and combinations thereof.
- proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homoiog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homoiog 3), ERBB4 (v-erb ⁇ b2 erythroblastic leukemia viral oncogene homoiog 4), Notch 1, Notch2, Notch 3, or Notch 4, for example.
- ATM ataxia telangiectasia mutated
- ATR ataxia telangiectasia and Rad3 related
- EGFR epidermatitise
- ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homoiog 2
- ERBB3 v-erb-b2 ery
- proteins associated with a secretase disorder may include PSENEN (presenilis enhancer 2 homoiog (C. elegans)), CTSB (cathepsin B), PSEN1 (preseniSin 1 ), APP (amyloid beta (A4) precursor protein), APH1B (anterior pharynx defective 1 homoiog B (C, elegans)), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example.
- proteins associated with Amyotrophic Lateral Sclerosis may include SODl (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascuiar endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- proteins associated with prion diseases may include SODl (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA. (vascular endothelial growth factor A), VAGFB (vascuiar endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- proteins related to neurodegenerative conditions in prion disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metailopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRAID (Alpha- ID adrenergic receptor for Alpha- I D adrenoreceptor), for example.
- A2M Alpha-2-Macroglobulin
- AATF Apoptosis antagonizing transcription factor
- ACPP Acid phosphatase prostate
- ACTA2 Actin alpha 2 smooth muscle aorta
- ADAM22 ADAM metailopeptidase domain
- ADORA3 Addenosine A3 receptor
- ADRAID Alpha- ID adrenergic receptor for Alpha- I D adrenoreceptor
- proteins associated with Immunodeficiency may include A2M [aipha-2- macroglobulinj; AANAT [arylalkylamine N-acetyltransferase] ; ABCA1 [ATP -binding cassette, sub-family A (ABC1), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABO), member 2]; or ABCA3 [ATP-binding cassette, sub-family A (ABC1), member 3]; for example.
- A2M aipha-2- macroglobulinj
- AANAT arylalkylamine N-acetyltransferase
- ABCA1 ATP -binding cassette, sub-family A (ABC1), member 1]
- ABCA2 ATP-binding cassette, sub-family A (ABO), member 2]
- ABCA3 [ATP-binding cassette, sub-family A (ABC1), member 3] for example.
- proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtm), or DMPK (dystrophia myotonic a-protem kinase), FXN (frataxin), ATXN2 (ataxin 2), for example.
- proteins associated with Neurotransmission Disorders include SST (somatostatin), NOSI (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, a!pha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamme (serotonin) receptor 2C), for example.
- neurodevelopmental-associated sequences include A2BP1 [ataxin 2- binding protein 1 ], AADAT [ammoadipate aminotransferase] , AANAT [arylalkyiamine N- acetyltransferase], ABAT [4-aminobutyrate aminotransferase], ABCA 1 [ATP-binding cassette, sub-family A (ABO), member 1], or ABC A i 3 [ATP-binding cassette, sub-family A (ABO), member 13], for example.
- A2BP1 ataxin 2- binding protein 1
- AADAT ammoadipate aminotransferase
- AANAT arylalkyiamine N- acetyltransferase
- ABAT 4-aminobutyrate aminotransferase
- ABCA 1 ATP-binding cassette, sub-family A (ABO), member 1
- ABC A i 3 ATP-binding cassette, sub-family A (ABO), member 13
- FIG. 1 Aieardi-Goutieres Syndrome; Alexander Disease; Allan-Herndon-Dudiey Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alstrom Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta- r rhalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS1]; Cerebrotcndinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Reiated Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dyst
- the present system can be used to target any polynucleotide sequence of interest.
- Some examples of conditions or diseases that might be usefully treated using the present system are included in the Tables above and examples of genes currently associated with those conditions are also provided there. However, the genes exemplified are not exhaustive.
- Example I CRISP R Complex Activity in the Nucleus of a Eukaryotic Cell
- An example type II CRISPR system is the type II CRISPR locus from Streptococcus pyogenes SF370, which contains a cluster of four genes Cas9, Casl, Cas2, and Csnl, as well as two non-coding RNA elements, tracrRNA and a characteristic array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers, about 30bp each).
- DSB targeted DNA double-strand break
- Figure 2A First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus.
- tracrRNA hybridizes to the direct repeats of pre- crRNA, which is then processed into mature crRNAs containing individual spacer sequences.
- the mature crRNA:tracrRNA complex directs Cas9 to the DNA target consisting of the protospacer and the corresponding PAM via heterodupiex formation between the spacer region of the crRNA and the protospacer DNA.
- Cas9 mediates cleavage of target DNA upstream of PAM to create a DSB within the protospacer ( Figure 2A).
- This example describes an example process for adapting this RNA-programmable nuclease system to direct CRISPR complex activity in the nuclei of eukaryotic cel ls.
- HEK cell line HEK 293FT Human embryonic kidney (HEK) cell line HEK 293FT (Life Technologies) was maintained in Duibeeeo's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2 m VI GlutaMAX ( Life Technologies), lOOU/mL penicillin, and 100p.g/mL streptomycin at 37°C with 5% C0 2 incubation.
- DMEM Duibeeeo's modified Eagle's Medium
- HyClone fetal bovine serum
- 2 m VI GlutaMAX Life Technologies
- streptomycin 100p.g/mL streptomycin at 37°C with 5% C0 2 incubation.
- N2A cell line ATCC was maintained with DMEM supplemented with 5% fetal bovine semm (HyClone), 2mM GlutaMAX (Life Technologies), lOOU/mL penicillin, and l OQ g/mL streptomycin at 37°C with 5% CO;.
- HEK 293 FT or N2A cells were seeded into 24-wel! plates (Corning) one day prior to transfection at a density of 200,000 ceils per well. Cells were transfected using Lipofectamine
- HEK 293FT or N2A cells were transfected with plasmid DNA as described above.
- the cells were incubated at 37°C for 72 hours before genomic DNA extraction.
- the genomic region surrounding a CRISPR target site for each gene was PGR amplified, and products were purified using QiaQuick Spin Column (Qiagen) following manufacturer's protocol.
- a total of 00ng of the purified PGR products were mixed with 2 ⁇ 1 10 Taq polymerase PGR buffer (Enzymaties) and ultrapure water to a final volume of 20 ⁇ 1, and subjected to a re-annealing process to enable heterodupiex formation: 95°C for lOmin, 95°C to 85°C ramping at - 2°C/s, 85°C to 25°C at - 0.25°C/s, and 25°C hold for 1 minute.
- HE 293FT and N2A cells were transfected with plasmid DNA, and incubated at 37°C for 72 hours before genomic DNA extraction as described above.
- the target genomic region was PGR amplified using primers outside the homology arms of the homologous recombination (HR) template.
- PGR products were separated on a 1% agarose gel and extracted with MinElute GelExtraetion Kit (Qiagen). Purified products were digested with Hmdlll (Fermentas) and analyzed on a 6% Novex TBE poly-acrylamide gel (Life Technologies).
- RNA secondary structure prediction was performed using the online webserver RNAfold developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A.R. Gruber et at, 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62).
- Elements of the S. pyogenes CRISPR locus 1 sufficient for CRISPR activity were reconstituted in E. coli using pCRISPR plasmid (schematically illustrated in Figure 10A), pCRISPR contained tracrRNA, SpCas9, and a leader sequence driving the crRNA array.
- Spacers also referred to as "guide sequences” were inserted into the crRNA array between Bsal sites using annealed oligonucleotides, as illustrated.
- Challenge plasmids used in the interference assay were constructed by inserting the protospacer (also referred to as a "target sequence") sequence along with an adjacent CRISPR motif sequence (PAM) into pUC19 (see Figure 10B).
- FIG. 1 provides a schematic representation of the interference assay.
- Chemical ly competent E. coli strains already carrying pCRISPR and the appropriate spacer were transformed with the challenge plasmid containing the corresponding protospacer-PAM sequence.
- pUC19 was used to assess the transformation efficiency of each pCRIS PR-carrying competent strain.
- CRISPR activity resulted in cleavage of the pPSP piasmid carrying the protospacer, precluding ampicillin resistance otherwise conferred by pUC19 lacking the protospacer.
- Figure ! OD illustrates competence of each pCRISPR- carrying E. cofi strain used in assays illustrated in Figure 4C.
- FJEK 293FT cells were maintained and transfected as stated above. Cells were harvested by trypsinization followed by washing in phosphate buffered saline (PBS). Total cell RNA was extracted with TRI reagent (Sigma) following manufacturer's protocol. Extracted total RNA was quantified using Naonodrop (Thermo Scientific) and normalized to same concentration.
- RNAs were mixed with equal volumes of 2X loading buffer (Ambion), heated to 95°C for 5 min, chilled on ice for 1 min, and then loaded onto 8% denaturing polyacrylamide gels (SequaGel, National Diagnostics) after pre-running the gel for at least 30 minutes. The samples were electrophoresed for 1.5 hours at 40W limit. Afterwards, the RNA was transferred to Hybond N+ membrane (GE Healthcare) at 300 mA in a semi-dry transfer apparatus (Bio-rad) at room temperature for 1 .5 hours. The RNA was crosslinked to the membrane using autocrossiink button on Stratagene UV Crosslinker the Stratalinker (Stratagene).
- the membrane was pre-hyhridized in ULTRAhyb-Oligo Hybridization Buffer (Ambion) for 30 min with rotation at 42°C, and probes were then added and hybridized overnight. Probes were ordered from IDT and labeled with [gamma- "" ?] ATP s erk in Elmer) with T4 polynucleotide kinase (New England Biolabs). The membrane was washed once with pre-warmed (42°C) 2xSSC, 0.5% SDS for 1 min followed by two 30 minute washes at 42°C. The membrane was exposed to a phosphor screen for one hour or overnight at room temperature and then scanned with a phosphorimager (Typhoon).
- CRISPR locus elements including tracrRNA, Cas9, and leader were PGR amplified from Streptococcus pyogenes SF370 genomic DNA with flanking homology arms for Gibson. Assembly. Two Bsal type IIS sites were introduced in between two direct repeats to facilitate easy insertion of spacers ( Figure 9). PGR products were cloned into EcoRV-digested pACYC184 downstream of the tet promoter using Gibson Assembly Master Mix (NEB). Other endogenous CRISPR system elements were omitted, with the exception of the last 50bp of Csn2.
- Oligos Integrated DNA Technology encoding spacers with complimentary overhangs were cloned into the i&al-digested vector pDCOOO (NEB) and then ligated with T7 ligase (Enzymatics) to generate pCRISPR plasmids.
- Challenge pfasmids containing spacers with PAM sequences also referred to herein as "CRISPR motif sequences" were created by ligating hybridized oligos carrying compatible overhangs (Integrated DNA Technology) into BanMl- digested pUC19. Cloning for all constructs was performed in E. coli strai JM109 f'Zymo Research).
- pCRJSPR-carrying cells were made competent using the Z-Competent E. coli Transformation Kit and Buffer Set (Zymo Research, T3001 ) according to manufacturer's instructions. In the transformation assay, 50uL aliquots of competent cells carrying pCRISPR were thawed on ice and tra sformed with lug of spacer plasmid or pUC19 on ice for 30 minutes, followed by 45 second heat shock at 42°C and 2 minutes on ice.
- a version of SpCas9 with an NLS attached to both N- and C-termini (2xNLS-SpCas9) was also generated. Constructs containing NLS-fused SpCas9 and SpRNase III were transfected into 293FT human embryonic kidney (HEK) cells, and the relative positioning of the NLS to SpCas9 and SpRNase III was found to affect their nuclear localization efficiency. Whereas the C -terminal NLS was sufficient to target SpRNase II I to the nucleus, attachment of a single copy of these particular NLS's to either the N- or C -terminus of SpCas9 was unable to achieve adequate nuclear localization in this system. In this example, the C-terminal.
- NLS was that of nucleoplasmin (KRPAAT KAGQAKKKK), and the C-terminal NLS was that of the SV40 large T-antigen (P KKRKV).
- P KKRKV SV40 large T-antigen
- the tracrRNA from the CRISPR locus of S. pyogenes SF370 has two transcriptional start sites, giving rise to two transcripts of 89 ⁇ nucleotid.es (nt) and 171nt that are subsequently processed into identical 75nt mature tracrR As.
- the shorter 89nt tracrRNA was selected for expression in mammalian cells (expressio constructs illustrated in Figure 7 A, with functionality as determined by results of the Surveyor assay shown in Figure 7B). Transcription start, sites are marked as +1, and transcription terminator and the sequence probed by northern blot are also indicated. Expression of processed tracrRNA was also confirmed by Northern blot.
- Figure 7C shows results of a Northern blot analysis of total RNA extracted from 293FT cells transfected with U6 expression constructs carrying long or short tracrRNA, as well as SpCas9 and DR- EMX1(1)-DR.
- Left and right panels are from 293FT cells transfected without or with SpRNase III, respectively.
- U6 indicate loading control blotted with a probe targeting human U6 snRNA.
- Transfection of the short tracrRNA expression construct led to abundant levels of the processed form of tracrRNA ( ⁇ 75bp). Very low amounts of long tracrRNA are detected on the Northern blot.
- RNA polymerase Ill-based U6 promoter was selected to drive the expression of tracrRNA ( Figure 2C).
- a U6 promoter-based construct was developed to express a pre-crRNA array consisting of a single spacer flanked by two direct repeats (DRs, also encompassed by the term "tracr-mate sequences"; Figure 2C).
- the initial spacer was designed to target a 33-base-pair (bp) target site (30-bp proto spacer plus a 3 -bp CRISPR motif (PAM) sequence satisfying the NGG recognition motif of Cas9) in the human EMXl locus ( Figure 2C), a key gene in the development of the cerebral cortex.
- bp 33-base-pair
- PAM 3 -bp CRISPR motif
- HEK 293FT cells were transfected with combinations of CRISPR components. Since DSBs in mammalian nuclei are partially repaired by the non-homologous end joining (NHEJ) pathway, which leads to the formation of indels, the Surveyor assay was used to detect potential cleavage activity at the target.
- NHEJ non-homologous end joining pathway
- Figure 14 provides an additional Northern blot analysis of crRNA processing in mammalian ceils.
- Figure 14A illustrates a schematic showing the expression vector for a single spacer flanked by two direct repeats (DR-EMXl(i)-DR). The 30bp spacer targeting the human EMX1 locus protospacer 1 (see Figure 6) and the direct repeat sequences are shown in the sequence beneath Figure 14 A. The line indicates the region whose reverse-complement sequence was used to generate Northern blot probes for EMX1(1) crRNA detection.
- Figure 14B shows a Northern blot analysis of total RNA extracted from 293 FT cells transtected with U6 expression constructs carrying DR-EMX 1(1 )-DR.
- DR-EMX1 (1 )-DR was processed into mature crRNAs only in the presence of SpCas9 and short tracrRNA and was not dependent on the presence of SpRNase III.
- the mature crRNA detected from traiisfected 293FT total RNA is ⁇ 33bp and is shorter than the 39-42bp mature crRNA from S, pyogenes.
- Figure 2 illustrates the bacterial CRISPR system described in this example.
- Figure 2 A illustrates a schematic showing the CRISPR locus 1 from Streptococcus pyogenes SF370 and a proposed mechanism of CRISPR -mediated DNA cleavage by this system.
- Mature crRNA processed from the direct repeat-spacer array directs Cas9 to genomic targets consisting of complimentary protospacers and a protospacer-adjacent motif (PAM).
- PAM protospacer-adjacent motif
- Cas9 mediates a double-strand break in the target DNA.
- Figure 2B illustrates engineering of S.
- FIG. 2C illustrates mammalian expression of SpCas9 and SpRNase 111 driven by the constitutive EFla promoter and tracrRNA and pre-crRNA array (DR-Spacer-DR) driven by the RNA Pol3 promoter U6 to promote precise transcription initiation and termination.
- DR-Spacer-DR pre-crRNA array
- FIG. 2D illustrates surveyor nuclease assay for SpCas9-mediated minor insertions and deletions.
- SpCas9 was expressed with and without SpRNase III, tracrRNA, and a pre-crRNA array carrying the EMX1- target spacer.
- Figure 2E illustrates a schematic representation of base pairing between target locus and EMXl -targeting crRNA, as well as an example chromatogram showing a micro deletion adjacent to the SpCas9 cleavage site.
- Figure 2F illustrates mutated alleles identified from sequencing analysis of 43 clonal amplicons showing a " variety of micro insertions and deletions. Dashes indicate deleted bases, and non-aligned or mismatched bases indicate insertions or mutations. Scale bar ::: lOjim.
- a chimeric crRNA-tracrRNA hybrid desig was adapted, where a mature crRNA (comprising a guide sequence) is fused to a partial tracrRNA via a stem-loop to mimic the natural crRNA:tracrRNA duplex (Figure 3A).
- a bicistronic expression vector was created to drive co- expression of a chimeric RNA and SpCas9 in transfected ceils ( Figures 3 A and 8).
- Figure 9 provides schematic illustrations of bicistronic expression vectors for pre- crRNA array ( Figure 9 A) or chimeric crRNA (represented by the short line downstream of the guide sequence insertion site and upstream of the EF l a promoter in Figure 9B) with hSpCas9, showing locationo of various elements and the point of guide sequence insertion.
- the expanded sequence around the location of the guide sequence insertion site in Figure 9B also shows a partial DR sequence (GTTTAGAGCTA) and a partial tracrRNA sequence (TAGCAAGTTAAAATAAGGCTAGTCCGTTTTT).
- Guide sequences can be inserted between Bbsl sites using annealed oligonucleotides. Sequence design for the oligonucleotides are shown below the schematic illustrations in Figure 9, with appropriate ligation adapters indicated.
- WPRE represents the Woodchuck hepatitis virus post-transcription al regulatory element. The efficiency of chimeric RNA-mediated cleavage was tested by targeting the same EMXl locus described above. Using both Surveyor assay and Sanger sequencing of amplicons, Applicants confirmed that the chimeric RNA design facilitates cleavage of human EMXl locus with approximately a 4.7% modification rate (Figure 4).
- Protospacers on the sense and anti-sense strands are indicated above and below the DNA sequences, respectively.
- a modification rate of 6.3% and 0.75% was achieved for the human P VALB and mouse Th loci respectively, demonstrating the broad applicabi lity of the CRISPR system in modifying different loci across multiple organisms ( Figures 3B and 6). While cleavage was only detected with one out of three spacers for each locus using the chimeric constructs, all target sequences were cleaved with efficiency of indel production reaching 27%> when using the co-expressed pre-crRNA arrangement (Figure 6).
- Figure 13 provides a further illustration that SpCas9 can be reprogrammed to target multiple genomic loci in mammalian cells.
- Figure 13A provides a schematic of the human EMXl Socus showing the location of five protospacers, indicated by the underlined sequences.
- Figure 13B provides a schematic of the pre-crRNA/trcrRNA complex showing hybridization between the direct repeat region of the pre-crRNA and tracrRNA (top), and a schematic of a chimeric RNA design comprising a 20bp guide sequence, and tracr mate and tracr sequences consisting of partial direct repeat and tracrRNA sequences hybridized in a hairpin structure (bottom).
- Figure 3 illustrates example expression vectors.
- Figure 3 A provides a schematic of a bi-cistronic vector for driving the expression of a synthetic crRNA-tracrRNA chimera (chimeric RNA) as well as SpCas9.
- the chimeric guide RNA contains a 20-bp guide sequence corresponding to the protospacer in the genomic target site.
- the folding algorithm produced an output with each base colored according to its probability of assuming the predicted secondary structure, as indicated by a rainbow scale that is reproduced in Figure 3B in gray scale.
- FIG 44 Further vector designs for SpCas9 are shown in Figure 44, which illustrates single expression vectors incorporating a U6 promoter linked to an insertion site for a guide oligo, and a Cbh promoter linked to SpCas9 coding sequence.
- the vector shown in Figure 44b includes a tracrRNA coding sequence linked to an HI promoter.
- Figure 4A illustrates results of a Surveyor nuclease assay comparing the cleavage efficiency of Cas9 when paired with different mutant chimeric RNAs, Single-base mismatch up to 12-bp 5' of the PAM substantially abrogated genomic cleavage by SpCas9, whereas spacers with mutations at farther upstream positions retained activity against the original protospacer target ( Figure 4B).
- SpCas9 has single-base specificity within the last 12-bp of the spacer. Furthermore, CRISPR is able to mediate genomic cleavage as efficiently as a pair of TALE nucleases (TALEN) targeting the same EMXl protospacer.
- RNA to program sequence-specific DNA cleavage defines a new class of genome engineering tools for a variety of research and industrial applications.
- CRISPR system can be further improved to increase the efficiency and versatility
- Optimal Cas9 activity may depend on the availability of free Mg " at levels higher than that present in the mammalian nucleus (see e.g. Jinek et al, 2012, Science, 337:816), and the preference for an NGG motif immediately downstream of the protospacer restricts the ability to target on average every 12-bp in the human genome ( Figure 1 1 , evaluating both plus and minus strands of human chromosomal sequences).
- FIG. 12 illustrates adaptation of the Type II CRISPR system from CRISPR 1 of Streptococcus thennophilus LMD-9 for heterologous expression in mammalian cells to achieve CRISPR-mediated genome editing.
- Figure 12A provides a Schematic il lustration of CRISPR 1 from S. thennophilus LMD-9.
- Figure 12B illustrates the design of an expression system for the S. thermophilus CRISPR system. Human eodon-optimized hSiCas is expressed using a constitutive EFla promoter.
- tracrRNA and crRNA are expressed using the U6 promoter to promote precise transcription initiation. Sequences from the mature crRNA and tracrRNA are illustrated. A single base indicated by the lower case "a" in the crRNA sequence is used to remove the polyU sequence, which serves as a RNA polIII transcriptional terminator.
- Figure 12C provides a schematic showing guide sequences targeting the human EMX1 locus as well as their predicted secondary structures. The modification efficiency at each target site is indicated below the RNA secondary structures. The algorithm generating the structures colors each base according to its probability of assuming the predicted secondary structure, which is indicated by a rainbow scale reproduced in Figure 12C in gray scale.
- Figure 12D shows the results of hStCas9-mediated cleavage in the target locus using the Surveyor assay.
- RNA guide spacers 1 and 2 induced 14% and 6.4%, respectively.
- Statistical analysis of cleavage activity across biological replica at these two protospacer sites is also provided in Figure 6.
- Figure 16 provides a schematic of additional protospacer and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX! locus. Two protospacer sequences are highlighted and their corresponding PAM sequences satisfying NNAGAAW motif are indicated by underlining 3' with respect to the corresponding highlighted sequence. Both protospacers target the anti-sense strand.
- Example 3 Sample target sequence selection algorithm.
- a software program is designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (PAM) for a specified CRISPR enzyme.
- PAM CRISPR motif sequence
- target sites for Cas9 from S. pyogenes, with PAM sequences NGG may be identified by searching for 5'-N x -NGG-3' both on the input sequence and on the reverse-complement of the input.
- target sites for Cas9 of S. thermophilus CRISPR 1, with PAM sequence NNAGAAW may be identified by searching for 5 '-N x -N AGAAW-3 ' both on the input sequence and on the reverse-complement of the input.
- target sites for Cas9 of S. thermophihis CRISPR3, with PAM sequence NGGNG may be identified by searching for 5'-N x - GGNG-3' both on the input sequence and on the reverse-complement of the input.
- the value "x" in N x . may be fixed by the program or specified by the user, such as 20.
- the program filters out sequences based on the number of times they appear in the relevant reference genome.
- the filtering step may be based on the seed sequence.
- results are filtered based on the number of occurrences of the seed:PA sequence in the relevant genome. The user may be allowed to choose the length of the seed sequence.
- the user may also be allowed to specify the number of occurrences of the seed:PAM sequence in a genome for purposes of passing the filter.
- the default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome.
- the program may in addition or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s).
- chimeric RNAs comprising a guide sequence, a tracr mate sequence, and a tracr sequence in a single transcript
- Figure 18a illustrates a schematic of a bicistronic expression vector for chimeric RNA.
- Cas9 is driven by the CBh promoter and the chimeric RNA is driven by a U6 promoter.
- the chimeric guide RNA consists of a 20bp guide sequence (Ns) joined to the tracr sequence (running from the first "U" of the lower strand to the end of the transcript), which is truncated at various positions as indicated.
- Protospacer IDs and their corresponding genomic target, protospacer sequence, PAM sequence, and strand location are provided in Table D. Guide sequences were designed to be com lementary to the entire protospacer sequence in the case of separate transcripts in the hybrid system, or only to the underlined portion in the case of chimeric RNAs.
- HEK cell line 293FT Human embryonic kidney (HEK) cell line 293FT (Life Technologies) was maintained in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2mM GlutaMAX (Life Technologies), lQQU/mL penicillin, and IQQjig/mL streptomycin at 37°C with 5% C0 2 incubation. 293FT cells were seeded onto 24-well plates (Coming) 24 hours prior to transfection at a density of 150,000 ceils per well. Cells were transfected using Lipofectamine 2000 (Life Technologies) following the manufacturer's recommended protocol. For each well of a 24- well plate, a total of 500ng plasmid was used.
- DMEM Dulbecco's modified Eagle's Medium
- HyClone fetal bovine serum
- 2mM GlutaMAX Life Technologies
- lQQU/mL penicillin lQQU/mL penicillin
- SURV EY OR assay for genome modification [00229] 293 FT cells were transfected with plasmid DNA as described above. Cells were incubated at 37°C for 72 hours post-transfection prior to genomic DNA extraction. Genomic DNA was extracted using the QuickExtract DNA Extraction Solution (Epicentre) following the manufacturer's protocol. Briefly, pelleted cells were resuspended in QuickExtract solution and incubated at 65°C for 15 minutes and 98°C for 10 minutes. The genomic region flanking the CRISPR target site for each gene was PGR amplified (primers listed in Table E), and products were purified using QiaQuick Spin Column (Qiagen) following the manufacturer ' s protocol.
- 400ng total of the purified PCR products were mixed with 2 ⁇ 1 10X Taq DNA Polymerase PGR buffer (Enzymatics) and ultrapure water to a final volume of 20 ⁇ 1, and subjected to a re- annealing process to enable heteroduplex formation: 95°C for lOmin, 95°C to 85°C ramping at - 2°C/s, 85°C to 25°C at - 0.25°C/s, and 25°C hold for 1 minute.
- products were treated with SURVEYOR nuclease and SURVEYOR enhancer S (Transgcnomies) following the manufacturer's recommended protocol, and analyzed on 4-20% Novex TBE poly-acrylamide gels (Life Technologies). Gels were stained with SYBR Gold DNA stain (Life Technologies) for 30 minutes and imaged with a Gel Doc gel imaging system (Bio-rad). Quantification was based on relative band intensities.
- each SpCas9 target site was operationally defined as a 20bp sequence followed by an NGG protospacer adjacent motif (PAM) sequence, and we identified all sequences satisfying this 5'-N2o-NGG-3' definition on all chromosomes.
- PAM NGG protospacer adjacent motif
- a 'seed' sequence which can be, for example, approximately 1 1 -12bp sequence 5' from the PAM sequence
- 5 '-NNNNNNN N -NGG-3 ' sequences were selected to be unique in the relevant genome. All genomic sequences were downloaded from the UCSC Genome Browser (Human genome hgl9, Mouse genome mm9, Rat genome rn5, Zebrafish genome danRer?, D. melanogaster genome dm4 and C. elegans genome cel O). The full search results are available to browse using UCSC Genome Browser information. An example vi sualization of some target si tes in the human genome is provided in Figure 21.
- Chimeric RNAs containing longer fragments of wild-type tracrRN A (chiRNA(+67) and chiRNA(+85)) mediated DNA cleavage at all three EMX1 target sites, with chiRNA(+85) in particular demonstrating significantly higher levels of DNA cleavage than the corresponding crRNA/tracrRNA hybrids that expressed guide and tracr sequences in separate transcripts ( Figures 18b and 19a).
- Two sites in the PVALB locus that yielded no detectable cleavage using the hybrid system (guide sequence and tracr sequence expressed as separate transcripts) were also targeted using chiRNAs.
- chiRNA(+67) and chiRNA(+85) were able to mediate significant cleavage at the two PVALB protospacers ( Figures 1 8c and 19b).
- chimeric RNA may be loaded onto Cas9 more efficiently than its native hybrid counterpart.
- all predicted unique target sites for the S. pyogenes Cas9 were computationally identified in the human, mouse, rat, zebra fish, C. elegans, and D. melanogaster genomes.
- Chimeric RNAs can be designed for Cas9 enzymes from other microbes to expand the target space of CR ISPR RNA -programmable nucleases.
- Figure 22 illustrates an exemplary bicistro ic expression vector for expression of chimeric RNA including up to the +85 nucleotide of wild-type tracr RNA sequence, and SpCas9 with nuclear localization sequences.
- SpCas9 is expressed from a CBh promoter and terminated with the bGH po yA signal (bGH pA).
- the expanded sequence illustrated immediately below the schematic corresponds to the region surrounding the guide sequence insertion site, and includes, from 5' to 3', 3 '-portion of the U6 promoter (first shaded region), Bbsl cleavage sites (arrows), partial direct repeat (tracr mate sequence GTTTTAGAGCTA, underlined), loop sequence GAAA, and +85 tracr sequence (underlined sequence following loop sequence).
- An exemplary guide sequence insert is illustrated below the guide sequence insertion site, with nucleotides of the guide sequence for a selected target represented by an "N".
- NLS-SpCas9-EGFP NLS-SpCas9-EGFP
- GMRKPAFLSGEQKKATvT LLFKTTSIRKV KQLKEDYFKK]ECFDSVEISGVEDRFNASL
- GIRD QSG ILDFL SDGFANRNFMQLJHDDSL FKEDIQKAQ ⁇ SGQGDSLHEH:IANLA
- GEGRPYEGTQTAKLKYT GGPLPFAWDILSPQFMYGS AYVKHPADIPDYL LSFPEGF
- NLS-SpCas9ii-NLS (the D10A nickase mutation is lowercase):
- N guide sequence; first underline :::: tracr mate sequence; second underline ::: tracr sequence; bold ::::: terminator)
- Example chimeric RNA for S. thermophilus LMD-9 CRISPRl Cas9 (with PA M of
- N guide sequence; first underline :::: tracr mate sequence; second underline ::: tracr sequence; bold :::: terminator)
- Example chimeric RNA for S. thennophilus LMD-9 CRISPR1 Cas9 (with PAM of NNAGAAW)
- N guide sequence
- Example chimeric RNA for S. thermophilus LMD-9 CRISPR1 Cas9 (with PAM of
- Example chimeric RNA for S. thermophilus LMD-9 CRISP 3 Cas9 (with PAM of NGGNG)
- Example 5 RNA-guided editing of bacterial genomes using CRISPR-Cas systems
- Applicants used the CRIS PR-associated endonuclease Cas9 to introduce precise mutations in the genomes of Streptococcus pneumoniae and Escherichia coli.
- the approach relied on Cas9-directed cleavage at the targeted site to kill unmutated cells and circumvented the need for selectable markers or counter-selection systems.
- Cas9 specificity was reprogrammed by changing the sequence of short CRISPR RNA (crRNA) to make si gle- and muiti-iiucieotide changes carried on editing templates. Simultaneous use of two erRNAs enabled multiplex mutagenesis. In S.
- mutagenesis in eukaryotes is achieved by the use of sequence-specific nucleases that promote homologous recombination of a template DNA containing the mutation of interest.
- Zinc finger nucleases ZFNs
- transcription activator-like effector nucleases TALE s
- mutagenesis methods either introduce a selection marker in the edited locus or require a two-step process that includes a counter- selection system.
- phage recombination proteins have been used for recombineering, a tech ique that promotes homologuous recombination of linear DNA or oligonucleotides.
- recombineering efficiency can be relatively low (0.1 -10% for point mutations down to 10 "5 -10 "6 for larger modifications), in many cases requiring the screening of a large number of colonies. Therefore new technologies that are affordable, easy to use and efficient are still in need for the genetic engineering of both eukaryottc and prokaryotic organisms.
- CRISPR loci are composed of a series of repeats separated by 'spacer' sequences that match the genomes of bacteriophages and other mobile genetic elements.
- the repeat-spacer array is transcribed as a long precursor and processed within repeat sequences to generate small crRNA that specify the target sequences (also known as protospacers) cleaved by CRISPR systems.
- Cas9 is a dsDNA endonuclease that uses a crRNA guide to specify the site of cleavage. Loading of the crRNA guide onto Cas9 occurs during the processing of the crRNA precursor and requires a small R A amisense to the precursor, the tracrRNA, and RNAse III. In contrast to genome editing with ZFNs or TALENs, changing Cas9 target specificity does not require protein engineering but only the design of the short crRNA guide.
- Applicants recently showed in S. pneumoniae that the introduction of a CRISPR system targeting a chromosomal locus leads to the killing of the transformed cells. It was observed that occasional survivors contained mutations in the target region, suggesting that Cas9 dsDNA endonuclease activity against endogenous targets could be used for genome editing. Applicants showed that marker-less mutations can be introduced through the transformation of a template DNA fragment that will recombine in the genome and eliminate Cas9 target recognition. Directing the specificity of Cas9 with several different crR As allows for the introduction of multiple mutations at the same time. Applicants also characterized in detail the sequence requirements for Cas9 targeting and show that the approach can be combined with recombmeering for genome editing in E. coli.
- RESULTS Genome editing by Cas9 cleavage of a chromosomal target
- S. pneumoniae strain crR6 contains a Cas9-based CRISPR system that cleaves a target sequence present in the bacteriophage ⁇ 8232.5. This target was integrated into the srtA chromosomal locus of a second strain R6 b2j2' ⁇ An altered target sequence containing a mutation in the PAM region was integrated into the srtA locus of a third strain R6 i /lJ i , rendering this strain 'immune' to CR1SPR cleavage ( Figure 28a).
- Another way to disrupt Cas9 ⁇ mediated cleavage is to introduce mutations in the protospacer region of the editing template. It is known that point mutations within the 'seed sequence' (the 8 to 10 protospacer nucleotides immediately adjacent to the PAM) can abolish cleavage by CRISPR nucleases. However, the exact length of this region is not known, and it is unclear whether mutations to any nucleotide in the seed can disrupt Cas9 target recognition. Applicants followed the same deep sequencing approach described above to randomize the entire protospacer sequence involved in base pair contacts with the crRNA and to determine all sequences that disrupt targeting.
- Cas9-mediated editing can also be used to generate multiple mutations for the study of biological pathways. Applicants decided to illustrate this for the sortase-dependent pathway that anchors surface proteins to the envelope of Gram-positive bacteria. Applicants introduced a .sona.se deletion by co-transformation of a chloramphenicol-resistant targeting construct and a AsrtA editing template ( Figure 33a,b), followed by a AbgaA deletion using a kanamycin-resistant targeting construct that replaced the previous one. In S, pneumoniae, ⁇ -galactosidase is covalentiy linked to the cell wall by sortase.
- deletion of srtA results in the release of the surface protein into the supernatant, whereas the double deletion has no detectable ⁇ - galactosidase activity ( Figure 34c).
- Such a sequential selection can be iterated as many times as required to generate multiple mutations.
- Spectinomycin-resistant transformants that retain the plasmid eliminated the CRISPR sequences ( Figure 34a,d).
- Mechanism and efficiency of editing To understand the mechanisms underlying genome editing with Cas9, Applicants designed an experiment in which the editing efficiency was measured independently of Cas9 cleavage. Applicants integrated the ermAM erythromycin resistance gene in the srtA locus, and introduced a premature stop codon using Cas9-mediated editing ( Figure 33). The resulting strain (JEN53) contains an ermAM(stop) allele and is sensitive to erythromycin. This strain may be used to assess the efficiency at which the ermAM gene is repaired by measuring the fraction of cells that restore antibiotic resistance with or without the use of Cas9 cleavage.
- JENS 3 was transformed with an editing template that restores the wild- type allele, together with either a kanamycin-resistant CRISPR construct targeting the ermAM(stop) allele (CRISPR: : ermAM (stop)) or a control construct without a spacer (CRISPR: :0) ( Figure 26a,b).
- CRISPR: : ermAM (stop) CRISPR: : ermAM (stop)
- CRISPR: :0 spacer
- Transformation of the CRISPR: : ermAM (stop) construct followed by kanamycin selection resulted in an increase of the fraction of erythromycin-resistant, edited cells to 99 % ( Figure 26c).
- Figure 26c To determine if this increase is caused by the killing of non-edited cells, Applicants compared the kanamycin- resistant colony forming units (cfu) obtained after co-transformation of JEN53 cells with the CRISPR: :ermAM(stop) or CRISPR: :0 constructs.
- This background frequency may be calculated as the ratio of CRISPR: :ermAM(stop)/CRISPR : :0 cfu, 2.6* 10 "3 (7.J xl0V2.7xl0 4 ) in this experiment, meaning that if the recombination frequency of the editing template is less than this value, CRISPR selection may not efficiently recover the desired mutants above the background.
- Applicants sought to introduce an A to C transversion in the rpsL gene that confers streptomycin resistance.
- the pCas9 plasmid was first introduced into E.
- CRISPR-Cas systems may be used for targeted genome editing in bacteria by the co-introduction of a targeting constmct that killed wild-type cells and an editing template that both eliminated CRISPR cleavage and introduced the desired mutations.
- Different types of mutations insertions, deletions or sear-less single-nucleoiide substitutions
- Multiple mutations may be introduced at the same time.
- the specificity and versatility of editing using the CRISPR system relied on several unique properties of the Cas9 endonuclease: (i) its target specificity may be programmed with a small RNA, without the need for enzyme engineering, (ii) target specificity was very high, determined by a 20 bp RNA-DNA interaction with low probability of no -target recognition, (iii) almost any sequence may be targeted, the only requirement being the presence of an adjacent NGG sequence, (iv) almost any mutation in the NGG sequence, as well as mutations in the seed sequence of the protospacer, eliminates targeting.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Analytical Chemistry (AREA)
- Theoretical Computer Science (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Medical Informatics (AREA)
- Evolutionary Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Veterinary Medicine (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Virology (AREA)
Abstract
Description
Claims
Priority Applications (36)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111233527.5A CN114634950A (en) | 2012-12-12 | 2013-12-12 | CRISPR-CAS component systems, methods, and compositions for sequence manipulation |
| HK15106920.5A HK1206388B (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| EP23192260.0A EP4286402A3 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| CA2894668A CA2894668A1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas systems and methods for altering expression of gene products in eukaryotic cells |
| EP25158803.4A EP4570817A3 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| JP2015547530A JP2016505256A (en) | 2012-12-12 | 2013-12-12 | CRISPR-Cas component system, method and composition for sequence manipulation |
| BR112015013786-5A BR112015013786B1 (en) | 2012-12-12 | 2013-12-12 | crispr-cas component systems, methods and compositions for sequence manipulation |
| EP23161559.2A EP4234696A3 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| EP20198492.9A EP3825401A1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| EP23192949.8A EP4286403A3 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| CN201380072868.6A CN105658796B (en) | 2012-12-12 | 2013-12-12 | CRISPR-CAS component systems, methods, and compositions for sequence manipulation |
| BR122021008308-8A BR122021008308B1 (en) | 2012-12-12 | 2013-12-12 | CRISPR-CAS COMPONENT SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION |
| AU2013359262A AU2013359262C1 (en) | 2012-12-12 | 2013-12-12 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| RU2015128102A RU2701662C9 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas system components, methods and compositions for sequence manipulation |
| EP13812430.0A EP2825654B1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| DK13812430.0T DK2825654T3 (en) | 2012-12-12 | 2013-12-12 | SYSTEMS, PROCEDURES, AND COMPOSITIONS WITH CRISPR-CAS COMPONENTS FOR SEQUENCE MANIPULATION. |
| EP23192951.4A EP4286404A3 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| ES13812430.0T ES2635244T3 (en) | 2012-12-12 | 2013-12-12 | CRISPR-Cas systems, methods and component compositions for sequence manipulation |
| EP14188820.6A EP2840140B2 (en) | 2012-12-12 | 2013-12-12 | Crispr-Cas based method for mutation of prokaryotic cells |
| EP17162030.5A EP3252160B1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| EP14190376.5A EP2848690B1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| KR1020267010790A KR20260055511A (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| KR1020157018662A KR102955556B1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| CN201910829026.XA CN110982844B (en) | 2012-12-12 | 2013-12-12 | CRISPR-CAS component systems, methods and compositions for sequence manipulation |
| US14/497,627 US20150031134A1 (en) | 2012-12-12 | 2014-09-26 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US14/523,799 US9840713B2 (en) | 2012-12-12 | 2014-10-24 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| US14/990,444 US9822372B2 (en) | 2012-12-12 | 2016-01-07 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| US14/991,083 US20160115489A1 (en) | 2012-12-12 | 2016-01-08 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US15/838,064 US20180305704A1 (en) | 2012-12-12 | 2017-12-11 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US15/887,377 US20180179547A1 (en) | 2012-12-12 | 2018-02-02 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US16/178,551 US20190292550A1 (en) | 2012-12-12 | 2018-11-01 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| AU2019280394A AU2019280394B2 (en) | 2012-12-12 | 2019-12-16 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| US16/906,580 US20200318123A1 (en) | 2012-12-12 | 2020-06-19 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US17/503,928 US20220135985A1 (en) | 2012-12-12 | 2021-10-18 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| AU2022203763A AU2022203763B2 (en) | 2012-12-12 | 2022-06-01 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| AU2025203777A AU2025203777A1 (en) | 2012-12-12 | 2025-05-22 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
Applications Claiming Priority (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261736527P | 2012-12-12 | 2012-12-12 | |
| US61/736,527 | 2012-12-12 | ||
| US201361748427P | 2013-01-02 | 2013-01-02 | |
| US61/748,427 | 2013-01-02 | ||
| US201361768959P | 2013-02-25 | 2013-02-25 | |
| US61/768,959 | 2013-02-25 | ||
| US201361791409P | 2013-03-15 | 2013-03-15 | |
| US61/791,409 | 2013-03-15 | ||
| US201361835931P | 2013-06-17 | 2013-06-17 | |
| US61/835,931 | 2013-06-17 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/497,627 Continuation-In-Part US20150031134A1 (en) | 2012-12-12 | 2014-09-26 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US14/497,627 Continuation US20150031134A1 (en) | 2012-12-12 | 2014-09-26 | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US14/523,799 Continuation US9840713B2 (en) | 2012-12-12 | 2014-10-24 | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014093595A1 true WO2014093595A1 (en) | 2014-06-19 |
| WO2014093595A9 WO2014093595A9 (en) | 2015-08-06 |
Family
ID=49881125
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/074611 Ceased WO2014093595A1 (en) | 2012-12-12 | 2013-12-12 | Crispr-cas component systems, methods and compositions for sequence manipulation |
Country Status (10)
| Country | Link |
|---|---|
| US (27) | US20140189896A1 (en) |
| EP (9) | EP2825654B1 (en) |
| JP (5) | JP2016505256A (en) |
| KR (2) | KR102955556B1 (en) |
| CN (3) | CN114634950A (en) |
| AU (4) | AU2013359262C1 (en) |
| BR (2) | BR112015013786B1 (en) |
| CA (1) | CA2894668A1 (en) |
| DK (1) | DK3252160T3 (en) |
| WO (1) | WO2014093595A1 (en) |
Cited By (364)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2784162B1 (en) | 2012-12-12 | 2015-04-08 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| WO2015065964A1 (en) | 2013-10-28 | 2015-05-07 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, screens and applications thereof |
| WO2015089419A2 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
| WO2015089364A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Crystal structure of a crispr-cas system, and uses thereof |
| WO2015089351A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders |
| WO2015089277A1 (en) * | 2013-12-12 | 2015-06-18 | The Regents Of The University Of California | Methods and compositions for modifying a single stranded target nucleic acid |
| WO2015089486A2 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Systems, methods and compositions for sequence manipulation with optimized functional crispr-cas systems |
| WO2015089465A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders |
| US9068179B1 (en) | 2013-12-12 | 2015-06-30 | President And Fellows Of Harvard College | Methods for correcting presenilin point mutations |
| EP2764103B1 (en) | 2012-12-12 | 2015-08-19 | The Broad Institute, Inc. | Crispr-cas systems and methods for altering expression of gene products |
| WO2015153780A1 (en) * | 2014-04-02 | 2015-10-08 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating primary open angle glaucoma |
| US9163284B2 (en) | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
| WO2015168800A1 (en) * | 2014-05-09 | 2015-11-12 | UNIVERSITé LAVAL | Prevention and treatment of alzheimer's disease by genome editing using the crispr/cas system |
| US9228207B2 (en) | 2013-09-06 | 2016-01-05 | President And Fellows Of Harvard College | Switchable gRNAs comprising aptamers |
| US9228208B2 (en) | 2013-12-11 | 2016-01-05 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for the targeted modification of a genome |
| US9234213B2 (en) | 2013-03-15 | 2016-01-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
| CN105296518A (en) * | 2015-12-01 | 2016-02-03 | 中国农业大学 | Homologous arm vector construction method used for CRISPR/Cas 9 technology |
| US9260723B2 (en) | 2012-12-17 | 2016-02-16 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| EP2931898B1 (en) | 2012-12-12 | 2016-03-09 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| EP2898075B1 (en) | 2012-12-12 | 2016-03-09 | The Broad Institute, Inc. | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| WO2016036754A1 (en) | 2014-09-02 | 2016-03-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification |
| WO2016049251A1 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling mutations in leukocytes |
| WO2016049163A2 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Use and production of chd8+/- transgenic animals with behavioral phenotypes characteristic of autism spectrum disorder |
| GB2530831A (en) * | 2014-04-17 | 2016-04-06 | Green Biologics Ltd | Targeted mutations |
| WO2016061073A1 (en) * | 2014-10-14 | 2016-04-21 | Memorial Sloan-Kettering Cancer Center | Composition and method for in vivo engineering of chromosomal rearrangements |
| US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
| US9322006B2 (en) | 2011-07-22 | 2016-04-26 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| WO2016069591A2 (en) | 2014-10-27 | 2016-05-06 | The Broad Institute Inc. | Compositions, methods and use of synthetic lethal screening |
| WO2016049024A3 (en) * | 2014-09-24 | 2016-05-12 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo |
| WO2016086197A1 (en) | 2014-11-25 | 2016-06-02 | The Brigham And Women's Hospital, Inc. | Method of identifying and treating a person having a predisposition to or afflicted with a cardiometabolic disease |
| WO2016086227A2 (en) | 2014-11-26 | 2016-06-02 | The Regents Of The University Of California | Therapeutic compositions comprising transcription factors and methods of making and using the same |
| WO2016083811A1 (en) | 2014-11-27 | 2016-06-02 | Imperial Innovations Limited | Genome editing methods |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| WO2016094880A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs) |
| WO2016094867A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Protected guide rnas (pgrnas) |
| WO2016094872A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Dead guides for crispr transcription factors |
| WO2016094874A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Escorted and functionalized guides for crispr-cas systems |
| WO2016100974A1 (en) | 2014-12-19 | 2016-06-23 | The Broad Institute Inc. | Unbiased identification of double-strand breaks and genomic rearrangement by genome-wide insert capture sequencing |
| WO2016106236A1 (en) | 2014-12-23 | 2016-06-30 | The Broad Institute Inc. | Rna-targeting system |
| WO2016106244A1 (en) | 2014-12-24 | 2016-06-30 | The Broad Institute Inc. | Crispr having or associated with destabilization domains |
| WO2016108926A1 (en) | 2014-12-30 | 2016-07-07 | The Broad Institute Inc. | Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis |
| JP2016520317A (en) * | 2013-05-29 | 2016-07-14 | セレクティスCellectis | Method for producing precise DNA cleavage using CAS9 nickase activity |
| WO2016138488A2 (en) | 2015-02-26 | 2016-09-01 | The Broad Institute Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
| WO2016138574A1 (en) | 2015-03-02 | 2016-09-09 | Sinai Health System | Homologous recombination factors |
| EP2840140B1 (en) | 2012-12-12 | 2016-11-16 | The Broad Institute, Inc. | Crispr-Cas component systems, methods and compositions for sequence manipulation |
| WO2016183438A1 (en) * | 2015-05-14 | 2016-11-17 | Massachusetts Institute Of Technology | Self-targeting genome editing system |
| WO2016182893A1 (en) | 2015-05-08 | 2016-11-17 | Teh Broad Institute Inc. | Functional genomics using crispr-cas systems for saturating mutagenesis of non-coding elements, compositions, methods, libraries and applications thereof |
| WO2016200263A1 (en) * | 2015-06-12 | 2016-12-15 | Erasmus University Medical Center Rotterdam | New crispr assays |
| WO2016198500A1 (en) * | 2015-06-10 | 2016-12-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for rna-guided treatment of human cytomegalovirus (hcmv) infection |
| WO2016205745A2 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Cell sorting |
| WO2016205764A1 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Novel crispr enzymes and systems |
| WO2016205728A1 (en) | 2015-06-17 | 2016-12-22 | Massachusetts Institute Of Technology | Crispr mediated recording of cellular events |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| WO2017027910A1 (en) | 2015-08-14 | 2017-02-23 | The University Of Sydney | Connexin 45 inhibition for therapy |
| EP3041498A4 (en) * | 2013-09-05 | 2017-04-12 | Massachusetts Institute of Technology | Tuning microbial populations with programmable nucleases |
| WO2017069958A2 (en) | 2015-10-09 | 2017-04-27 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
| WO2017070605A1 (en) | 2015-10-22 | 2017-04-27 | The Broad Institute Inc. | Type vi-b crispr enzymes and systems |
| WO2017068077A1 (en) | 2015-10-20 | 2017-04-27 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| EP3003392A4 (en) * | 2013-06-04 | 2017-05-03 | President and Fellows of Harvard College | Rna-guideded transcriptional regulation |
| WO2017075294A1 (en) | 2015-10-28 | 2017-05-04 | The Board Institute Inc. | Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction |
| WO2017074788A1 (en) | 2015-10-27 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for targeting cancer-specific sequence variations |
| WO2017075451A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting pou2af1 |
| WO2017075465A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting gata3 |
| WO2017075478A2 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by use of immune cell gene signatures |
| EP2800811B1 (en) | 2012-05-25 | 2017-05-10 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| GB2544382A (en) * | 2014-02-11 | 2017-05-17 | The Regents Of The Univ Of Colorado A Body Corp (Existing Under The Laws Of The State Of Colorado) | CRISPR enabled multiplexed genome engineering |
| WO2017087708A1 (en) | 2015-11-19 | 2017-05-26 | The Brigham And Women's Hospital, Inc. | Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity |
| WO2017064566A3 (en) * | 2015-10-16 | 2017-05-26 | Astrazeneca Ab | Inducible modification of a cell genome |
| WO2017090761A1 (en) * | 2015-11-27 | 2017-06-01 | 国立大学法人神戸大学 | Method for converting monocot plant genome sequence in which nucleic acid base in targeted dna sequence is specifically converted, and molecular complex used therein |
| WO2017114497A1 (en) | 2015-12-30 | 2017-07-06 | Novartis Ag | Immune effector cell therapies with enhanced efficacy |
| WO2017147196A1 (en) | 2016-02-22 | 2017-08-31 | Massachusetts Institute Of Technology | Methods for identifying and modulating immune phenotypes |
| EP3219799A1 (en) | 2016-03-17 | 2017-09-20 | IMBA-Institut für Molekulare Biotechnologie GmbH | Conditional crispr sgrna expression |
| WO2017161325A1 (en) | 2016-03-17 | 2017-09-21 | Massachusetts Institute Of Technology | Methods for identifying and modulating co-occurant cellular phenotypes |
| WO2017165655A1 (en) * | 2016-03-23 | 2017-09-28 | Dana-Farber Cancer Institute, Inc. | Methods for enhancing the efficiency of gene editing |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9834786B2 (en) | 2012-04-25 | 2017-12-05 | Regeneron Pharmaceuticals, Inc. | Nuclease-mediated targeting with large targeting vectors |
| WO2017219027A1 (en) | 2016-06-17 | 2017-12-21 | The Broad Institute Inc. | Type vi crispr orthologs and systems |
| WO2018013840A1 (en) | 2016-07-13 | 2018-01-18 | Vertex Pharmaceuticals Incorporated | Methods, compositions and kits for increasing genome editing efficiency |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US9888673B2 (en) | 2014-12-10 | 2018-02-13 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| WO2018035364A1 (en) | 2016-08-17 | 2018-02-22 | The Broad Institute Inc. | Product and methods useful for modulating and evaluating immune responses |
| WO2018035250A1 (en) | 2016-08-17 | 2018-02-22 | The Broad Institute, Inc. | Methods for identifying class 2 crispr-cas systems |
| WO2018049025A2 (en) | 2016-09-07 | 2018-03-15 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses |
| WO2018054911A1 (en) | 2016-09-23 | 2018-03-29 | Bayer Cropscience Nv | Targeted genome optimization in plants |
| KR20180034402A (en) * | 2015-06-18 | 2018-04-04 | 더 브로드 인스티튜트, 인코퍼레이티드 | New CRISPR Enzymes and Systems |
| KR20180034404A (en) * | 2015-06-18 | 2018-04-04 | 더 브로드 인스티튜트, 인코퍼레이티드 | CRISPR enzyme mutations that reduce the target effect |
| US9938521B2 (en) | 2014-03-10 | 2018-04-10 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10) |
| WO2018067991A1 (en) | 2016-10-07 | 2018-04-12 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
| WO2018083606A1 (en) | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
| US9982277B2 (en) | 2013-06-11 | 2018-05-29 | The Regents Of The University Of California | Methods and compositions for target DNA modification |
| US9982279B1 (en) | 2017-06-23 | 2018-05-29 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10011849B1 (en) | 2017-06-23 | 2018-07-03 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10017760B2 (en) | 2016-06-24 | 2018-07-10 | Inscripta, Inc. | Methods for generating barcoded combinatorial libraries |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| WO2018170515A1 (en) | 2017-03-17 | 2018-09-20 | The Broad Institute, Inc. | Methods for identifying and modulating co-occurant cellular phenotypes |
| WO2018170333A1 (en) | 2017-03-15 | 2018-09-20 | The Broad Institute, Inc. | Novel cas13b orthologues crispr enzymes and systems |
| WO2018191750A2 (en) | 2017-04-14 | 2018-10-18 | The Broad Institute Inc. | Novel delivery of large payloads |
| WO2018191520A1 (en) | 2017-04-12 | 2018-10-18 | The Broad Institute, Inc. | Respiratory and sweat gland ionocytes |
| WO2018191553A1 (en) | 2017-04-12 | 2018-10-18 | Massachusetts Eye And Ear Infirmary | Tumor signature for metastasis, compositions of matter methods of use thereof |
| WO2018191388A1 (en) | 2017-04-12 | 2018-10-18 | The Broad Institute, Inc. | Novel type vi crispr orthologs and systems |
| WO2018195486A1 (en) | 2017-04-21 | 2018-10-25 | The Broad Institute, Inc. | Targeted delivery to beta cells |
| WO2018195019A1 (en) | 2017-04-18 | 2018-10-25 | The Broad Institute Inc. | Compositions for detecting secretion and methods of use |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| EP3138911B1 (en) | 2012-12-06 | 2018-12-05 | Sigma Aldrich Co. LLC | Crispr-based genome modification and regulation |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10166255B2 (en) | 2015-07-31 | 2019-01-01 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
| WO2019005884A1 (en) | 2017-06-26 | 2019-01-03 | The Broad Institute, Inc. | Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing |
| WO2019003193A1 (en) | 2017-06-30 | 2019-01-03 | Novartis Ag | Methods for the treatment of disease with gene editing systems |
| WO2019018440A1 (en) | 2017-07-17 | 2019-01-24 | The Broad Institute, Inc. | Cell atlas of the healthy and ulcerative colitis human colon |
| WO2019060746A1 (en) | 2017-09-21 | 2019-03-28 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| WO2019070755A1 (en) | 2017-10-02 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer |
| WO2019071054A1 (en) | 2017-10-04 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
| WO2019087113A1 (en) | 2017-11-01 | 2019-05-09 | Novartis Ag | Synthetic rnas and methods of use |
| US10300138B2 (en) | 2016-06-05 | 2019-05-28 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10337001B2 (en) | 2014-12-03 | 2019-07-02 | Agilent Technologies, Inc. | Guide RNA with chemical modifications |
| EP2828386B1 (en) | 2012-03-20 | 2019-07-10 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| WO2019138083A1 (en) | 2018-01-12 | 2019-07-18 | Basf Se | Gene underlying the number of spikelets per spike qtl in wheat on chromosome 7a |
| EP3514246A1 (en) | 2014-02-27 | 2019-07-24 | The Broad Institute Inc. | T cell balance gene expression and methods of use thereof |
| WO2019143675A1 (en) | 2018-01-17 | 2019-07-25 | Vertex Pharmaceuticals Incorporated | Dna-pk inhibitors |
| WO2019143678A1 (en) | 2018-01-17 | 2019-07-25 | Vertex Pharmaceuticals Incorporated | Dna-pk inhibitors |
| US10385359B2 (en) | 2013-04-16 | 2019-08-20 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| US10428319B2 (en) | 2017-06-09 | 2019-10-01 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
| WO2019204585A1 (en) | 2018-04-19 | 2019-10-24 | Massachusetts Institute Of Technology | Single-stranded break detection in double-stranded dna |
| US10457960B2 (en) | 2014-11-21 | 2019-10-29 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for targeted genetic modification using paired guide RNAs |
| EP3560330A1 (en) | 2018-04-24 | 2019-10-30 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
| WO2019210268A2 (en) | 2018-04-27 | 2019-10-31 | The Broad Institute, Inc. | Sequencing-based proteomics |
| US10463049B2 (en) | 2015-05-06 | 2019-11-05 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| WO2019213660A2 (en) | 2018-05-04 | 2019-11-07 | The Broad Institute, Inc. | Compositions and methods for modulating cgrp signaling to regulate innate lymphoid cell inflammatory responses |
| WO2019232542A2 (en) | 2018-06-01 | 2019-12-05 | Massachusetts Institute Of Technology | Methods and compositions for detecting and modulating microenvironment gene signatures from the csf of metastasis patients |
| WO2020002592A1 (en) | 2018-06-29 | 2020-01-02 | Stichting Het Nederlands Kanker Instituut - Antoni Van Leeuwenhoek Ziekenhuis | Traf2 inhibitors for use in the treatment of a cancer |
| WO2020006036A1 (en) | 2018-06-26 | 2020-01-02 | Massachusetts Institute Of Technology | Crispr effector system based amplification methods, systems, and diagnostics |
| WO2020006049A1 (en) | 2018-06-26 | 2020-01-02 | The Broad Institute, Inc. | Crispr/cas and transposase based amplification compositions, systems and methods |
| US10544405B2 (en) | 2013-01-16 | 2020-01-28 | Emory University | Cas9-nucleic acid complexes and uses related thereto |
| US10550396B2 (en) | 2014-04-17 | 2020-02-04 | Green Biologics Limited | Deletion mutations |
| WO2020028555A2 (en) | 2018-07-31 | 2020-02-06 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| WO2020033601A1 (en) | 2018-08-07 | 2020-02-13 | The Broad Institute, Inc. | Novel cas12b enzymes and systems |
| WO2020041380A1 (en) | 2018-08-20 | 2020-02-27 | The Broad Institute, Inc. | Methods and compositions for optochemical control of crispr-cas9 |
| WO2020041387A1 (en) | 2018-08-20 | 2020-02-27 | The Brigham And Women's Hospital, Inc. | Degradation domain modifications for spatio-temporal control of rna-guided nucleases |
| US10577630B2 (en) | 2013-06-17 | 2020-03-03 | The Broad Institute, Inc. | Delivery and use of the CRISPR-Cas systems, vectors and compositions for hepatic targeting and therapy |
| WO2020051507A1 (en) | 2018-09-06 | 2020-03-12 | The Broad Institute, Inc. | Nucleic acid assemblies for use in targeted delivery |
| AU2014274840B2 (en) * | 2013-06-05 | 2020-03-12 | Duke University | RNA-guided gene editing and gene regulation |
| WO2020065062A1 (en) | 2018-09-28 | 2020-04-02 | Wageningen Universiteit | Off-target activity inhibitors for guided endonucleases |
| WO2020077236A1 (en) | 2018-10-12 | 2020-04-16 | The Broad Institute, Inc. | Method for extracting nuclei or whole cells from formalin-fixed paraffin-embedded tissues |
| WO2020081730A2 (en) | 2018-10-16 | 2020-04-23 | Massachusetts Institute Of Technology | Methods and compositions for modulating microenvironment |
| US10640789B2 (en) | 2013-06-04 | 2020-05-05 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| WO2020093025A1 (en) * | 2018-11-01 | 2020-05-07 | Synthego Corporation | Methods for knock-out of a target sequence through introduction of a premature stop codon |
| US10655123B2 (en) | 2014-03-05 | 2020-05-19 | National University Corporation Kobe University | Genomic sequence modification method for specifically converting nucleic acid bases of targeted DNA sequence, and molecular complex for use in same |
| EP3653229A1 (en) | 2013-12-12 | 2020-05-20 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for genome editing |
| US10676726B2 (en) | 2015-02-09 | 2020-06-09 | Duke University | Compositions and methods for epigenome editing |
| US10676735B2 (en) | 2015-07-22 | 2020-06-09 | Duke University | High-throughput screening of regulatory element function with epigenome editing technologies |
| WO2020131862A1 (en) | 2018-12-17 | 2020-06-25 | The Broad Institute, Inc. | Crispr-associated transposase systems and methods of use thereof |
| WO2020131586A2 (en) | 2018-12-17 | 2020-06-25 | The Broad Institute, Inc. | Methods for identifying neoantigens |
| US10711256B2 (en) | 2012-04-27 | 2020-07-14 | Duke University | Genetic correction of mutated genes |
| US10711285B2 (en) | 2013-06-17 | 2020-07-14 | The Broad Institute, Inc. | Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation |
| EP3686279A1 (en) | 2014-08-17 | 2020-07-29 | The Broad Institute, Inc. | Genome editing using cas9 nickases |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| AU2015248621B2 (en) * | 2014-04-14 | 2020-08-27 | Nemesis Bioscience Ltd | Therapeutic |
| US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US10767175B2 (en) | 2016-06-08 | 2020-09-08 | Agilent Technologies, Inc. | High specificity genome editing using chemically modified guide RNAs |
| US10767173B2 (en) | 2015-09-09 | 2020-09-08 | National University Corporation Kobe University | Method for converting genome sequence of gram-positive bacterium by specifically converting nucleic acid base of targeted DNA sequence, and molecular complex used in same |
| US10781444B2 (en) | 2013-06-17 | 2020-09-22 | The Broad Institute, Inc. | Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof |
| WO2020206036A1 (en) | 2019-04-01 | 2020-10-08 | The Broad Institute, Inc. | Novel nucleic acid modifier |
| WO2020229241A1 (en) | 2019-05-10 | 2020-11-19 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2020229533A1 (en) | 2019-05-13 | 2020-11-19 | KWS SAAT SE & Co. KGaA | Drought tolerance in corn |
| WO2020236967A1 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Random crispr-cas deletion mutant |
| WO2020236972A2 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Non-class i multi-component nucleic acid targeting systems |
| US10851380B2 (en) | 2012-10-23 | 2020-12-01 | Toolgen Incorporated | Methods for cleaving a target DNA using a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein |
| WO2020243661A1 (en) | 2019-05-31 | 2020-12-03 | The Broad Institute, Inc. | Methods for treating metabolic disorders by targeting adcy5 |
| WO2020239680A2 (en) | 2019-05-25 | 2020-12-03 | KWS SAAT SE & Co. KGaA | Haploid induction enhancer |
| CN112080587A (en) * | 2020-08-31 | 2020-12-15 | 上海海关动植物与食品检验检疫技术中心 | RAA-CRISPR amplification primer group, kit and method for efficiently detecting novel coronavirus |
| WO2021001534A1 (en) | 2019-07-03 | 2021-01-07 | Wageningen Universiteit | Crispr type v-u1 system from mycobacterium mucogenicum and uses thereof |
| WO2021003432A1 (en) | 2019-07-02 | 2021-01-07 | Fred Hutchinson Cancer Research Center | Recombinant ad35 vectors and related gene therapy improvements |
| US10912797B2 (en) | 2016-10-18 | 2021-02-09 | Intima Bioscience, Inc. | Tumor infiltrating lymphocytes and methods of therapy |
| EP3772542A1 (en) | 2019-08-07 | 2021-02-10 | KWS SAAT SE & Co. KGaA | Modifying genetic variation in crops by modulating the pachytene checkpoint protein 2 |
| US10930367B2 (en) | 2012-12-12 | 2021-02-23 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for Cas enzymes or CRISPR-Cas systems for target sequences and conveying results thereof |
| WO2021041922A1 (en) | 2019-08-30 | 2021-03-04 | The Broad Institute, Inc. | Crispr-associated mu transposase systems |
| US10946108B2 (en) | 2013-06-17 | 2021-03-16 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for targeting disorders and diseases using viral components |
| WO2021048316A1 (en) | 2019-09-12 | 2021-03-18 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021055874A1 (en) | 2019-09-20 | 2021-03-25 | The Broad Institute, Inc. | Novel type vi crispr enzymes and systems |
| EP3636753A4 (en) * | 2017-06-08 | 2021-03-31 | Osaka University | PROCESS FOR MANUFACTURING A DNA-EDITED EUKARYOTE CELL, AND KIT USED IN THE PROCESS |
| WO2021069387A1 (en) | 2019-10-07 | 2021-04-15 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021074367A1 (en) | 2019-10-17 | 2021-04-22 | KWS SAAT SE & Co. KGaA | Enhanced disease resistance of crops by downregulation of repressor genes |
| US11001829B2 (en) | 2014-09-25 | 2021-05-11 | The Broad Institute, Inc. | Functional screening with optimized functional CRISPR-Cas systems |
| US11008588B2 (en) | 2013-06-17 | 2021-05-18 | The Broad Institute, Inc. | Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation |
| WO2021105191A1 (en) | 2019-11-29 | 2021-06-03 | Basf Se | Increasing resistance against fungal infections in plants |
| US11028388B2 (en) | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
| WO2021111466A1 (en) * | 2019-12-02 | 2021-06-10 | Council Of Scientific & Industrial Research | Method and kit for detection of polynucleotide |
| WO2021110582A1 (en) | 2019-12-03 | 2021-06-10 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| US11041173B2 (en) | 2012-12-12 | 2021-06-22 | The Broad Institute, Inc. | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| WO2021122687A1 (en) | 2019-12-19 | 2021-06-24 | Basf Se | Increasing space-time-yield, carbon-conversion-efficiency and carbon substrate flexibility in the production of fine chemicals |
| WO2021122528A1 (en) | 2019-12-20 | 2021-06-24 | Basf Se | Decreasing toxicity of terpenes and increasing the production potential in micro-organisms |
| US11092607B2 (en) | 2015-10-28 | 2021-08-17 | The Board Institute, Inc. | Multiplex analysis of single cell constituents |
| US11098325B2 (en) | 2017-06-30 | 2021-08-24 | Intima Bioscience, Inc. | Adeno-associated viral vectors for gene therapy |
| EP3872190A1 (en) | 2020-02-26 | 2021-09-01 | Antibodies-Online GmbH | A method of using cut&run or cut&tag to validate crispr-cas targeting |
| US11111521B2 (en) | 2011-12-22 | 2021-09-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| WO2021202938A1 (en) | 2020-04-03 | 2021-10-07 | Creyon Bio, Inc. | Oligonucleotide-based machine learning |
| US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US11180793B2 (en) | 2015-04-24 | 2021-11-23 | Editas Medicine, Inc. | Evaluation of Cas9 molecule/guide RNA molecule complexes |
| US11180751B2 (en) | 2015-06-18 | 2021-11-23 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| WO2021239986A1 (en) | 2020-05-29 | 2021-12-02 | KWS SAAT SE & Co. KGaA | Plant haploid induction |
| US11214800B2 (en) | 2015-08-18 | 2022-01-04 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
| EP3036333B1 (en) | 2013-08-22 | 2022-01-19 | E. I. du Pont de Nemours and Company | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US11236313B2 (en) | 2016-04-13 | 2022-02-01 | Editas Medicine, Inc. | Cas9 fusion molecules, gene editing systems, and methods of use thereof |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11299767B2 (en) | 2013-03-12 | 2022-04-12 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11306309B2 (en) | 2015-04-06 | 2022-04-19 | The Board Of Trustees Of The Leland Stanford Junior University | Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11332736B2 (en) | 2017-12-07 | 2022-05-17 | The Broad Institute, Inc. | Methods and compositions for multiplexing single cell and single nuclei sequencing |
| US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| EP4001429A1 (en) | 2020-11-16 | 2022-05-25 | Antibodies-Online GmbH | Analysis of crispr-cas binding and cleavage sites followed by high-throughput sequencing (abc-seq) |
| US11345932B2 (en) | 2018-05-16 | 2022-05-31 | Synthego Corporation | Methods and systems for guide RNA design and use |
| US11352647B2 (en) | 2016-08-17 | 2022-06-07 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US11384383B2 (en) | 2017-08-08 | 2022-07-12 | Depixus | In vitro isolation and enrichment of nucleic acids using site-specific nucleases |
| US11390884B2 (en) | 2015-05-11 | 2022-07-19 | Editas Medicine, Inc. | Optimized CRISPR/cas9 systems and methods for gene editing in stem cells |
| WO2022155265A2 (en) | 2021-01-12 | 2022-07-21 | Mitolab Inc. | Context-dependent, double-stranded dna-specific deaminases and uses thereof |
| EP4039816A1 (en) * | 2015-05-29 | 2022-08-10 | North Carolina State University | Methods for screening bacteria, archaea, algae, and yeast using crispr nucleic acids |
| US11414657B2 (en) | 2015-06-29 | 2022-08-16 | Ionis Pharmaceuticals, Inc. | Modified CRISPR RNA and modified single CRISPR RNA and uses thereof |
| US11427817B2 (en) | 2015-08-25 | 2022-08-30 | Duke University | Compositions and methods of improving specificity in genomic engineering using RNA-guided endonucleases |
| US11447527B2 (en) | 2018-09-18 | 2022-09-20 | Vnv Newco Inc. | Endogenous Gag-based capsids and uses thereof |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11466271B2 (en) | 2017-02-06 | 2022-10-11 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
| WO2022221699A1 (en) | 2021-04-16 | 2022-10-20 | Beam Therapeutics, Inc. | Genetic modification of hepatocytes |
| US11499151B2 (en) | 2017-04-28 | 2022-11-15 | Editas Medicine, Inc. | Methods and systems for analyzing guide RNA molecules |
| US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
| WO2022256440A2 (en) | 2021-06-01 | 2022-12-08 | Arbor Biotechnologies, Inc. | Gene editing systems comprising a crispr nuclease and uses thereof |
| US11542554B2 (en) | 2015-11-03 | 2023-01-03 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11547614B2 (en) | 2017-10-31 | 2023-01-10 | The Broad Institute, Inc. | Methods and compositions for studying cell evolution |
| US11549126B2 (en) | 2015-06-03 | 2023-01-10 | Board Of Regents Of The University Of Nebraska | Treatment methods using DNA editing with single-stranded DNA |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11566263B2 (en) | 2016-08-02 | 2023-01-31 | Editas Medicine, Inc. | Compositions and methods for treating CEP290 associated disease |
| WO2023006933A1 (en) | 2021-07-30 | 2023-02-02 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
| US11578312B2 (en) | 2015-06-18 | 2023-02-14 | The Broad Institute Inc. | Engineering and optimization of systems, methods, enzymes and guide scaffolds of CAS9 orthologs and variants for sequence manipulation |
| US11578118B2 (en) | 2017-10-20 | 2023-02-14 | Fred Hutchinson Cancer Center | Systems and methods to produce B cells genetically modified to express selected antibodies |
| US11591601B2 (en) | 2017-05-05 | 2023-02-28 | The Broad Institute, Inc. | Methods for identification and modification of lncRNA associated with target genotypes and phenotypes |
| US11597924B2 (en) | 2016-03-25 | 2023-03-07 | Editas Medicine, Inc. | Genome editing systems comprising repair-modulating enzyme molecules and methods of their use |
| US11603544B2 (en) | 2017-06-05 | 2023-03-14 | Fred Hutchinson Cancer Center | Genomic safe harbors for genetic therapies in human stem cells and engineered nanoparticles to provide targeted genetic therapies |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| WO2023093862A1 (en) | 2021-11-26 | 2023-06-01 | Epigenic Therapeutics Inc. | Method of modulating pcsk9 and uses thereof |
| US11667911B2 (en) | 2015-09-24 | 2023-06-06 | Editas Medicine, Inc. | Use of exonucleases to improve CRISPR/CAS-mediated genome editing |
| US11680296B2 (en) | 2017-10-16 | 2023-06-20 | Massachusetts Institute Of Technology | Mycobacterium tuberculosis host-pathogen interaction |
| US11680268B2 (en) | 2014-11-07 | 2023-06-20 | Editas Medicine, Inc. | Methods for improving CRISPR/Cas-mediated genome-editing |
| US11713485B2 (en) | 2016-04-25 | 2023-08-01 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| EP4219699A1 (en) | 2013-12-12 | 2023-08-02 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11739156B2 (en) | 2019-01-06 | 2023-08-29 | The Broad Institute, Inc. Massachusetts Institute of Technology | Methods and compositions for overcoming immunosuppression |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| EP4268831A2 (en) | 2018-09-12 | 2023-11-01 | Fred Hutchinson Cancer Center | Reducing cd33 expression to selectively protect therapeutic cells |
| AU2019372642B2 (en) * | 2018-10-29 | 2023-11-23 | China Agricultural University | Novel CRISPR/Cas12f enzyme and system |
| US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US11866697B2 (en) | 2017-05-18 | 2024-01-09 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
| US11884915B2 (en) | 2021-09-10 | 2024-01-30 | Agilent Technologies, Inc. | Guide RNAs with chemical modification for prime editing |
| US11897953B2 (en) | 2017-06-14 | 2024-02-13 | The Broad Institute, Inc. | Compositions and methods targeting complement component 3 for inhibiting tumor growth |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11913075B2 (en) | 2017-04-01 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer |
| US11911415B2 (en) | 2015-06-09 | 2024-02-27 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for improving transplantation |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2024042199A1 (en) | 2022-08-26 | 2024-02-29 | KWS SAAT SE & Co. KGaA | Use of paired genes in hybrid breeding |
| US11920128B2 (en) | 2013-09-18 | 2024-03-05 | Kymab Limited | Methods, cells and organisms |
| AU2022200130B2 (en) * | 2018-02-15 | 2024-03-07 | Sigma-Aldrich Co. Llc | Engineered Cas9 systems for eukaryotic genome modification |
| WO2024064824A2 (en) | 2022-09-21 | 2024-03-28 | Yale University | Compositions and methods for identification of membrane targets for enhancement of nk cell therapy |
| US11957695B2 (en) | 2018-04-26 | 2024-04-16 | The Broad Institute, Inc. | Methods and compositions targeting glucocorticoid signaling for modulating immune responses |
| WO2024080067A1 (en) | 2022-10-14 | 2024-04-18 | 株式会社インプランタイノベーションズ | Genome editing method and composition for genome editing |
| US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
| US11963966B2 (en) | 2017-03-31 | 2024-04-23 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for treating ovarian tumors |
| WO2024083579A1 (en) | 2022-10-20 | 2024-04-25 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| US11970710B2 (en) | 2015-10-13 | 2024-04-30 | Duke University | Genome engineering with Type I CRISPR systems in eukaryotic cells |
| US11981922B2 (en) | 2019-10-03 | 2024-05-14 | Dana-Farber Cancer Institute, Inc. | Methods and compositions for the modulation of cell interactions and signaling in the tumor microenvironment |
| US11994512B2 (en) | 2018-01-04 | 2024-05-28 | Massachusetts Institute Of Technology | Single-cell genomic methods to generate ex vivo cell systems that recapitulate in vivo biology with improved fidelity |
| US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US12036240B2 (en) | 2018-06-14 | 2024-07-16 | The Broad Institute, Inc. | Compositions and methods targeting complement component 3 for inhibiting tumor growth |
| US12049643B2 (en) | 2017-07-14 | 2024-07-30 | The Broad Institute, Inc. | Methods and compositions for modulating cytotoxic lymphocyte activity |
| US12058986B2 (en) | 2017-04-20 | 2024-08-13 | Egenesis, Inc. | Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements |
| WO2024168265A1 (en) | 2023-02-10 | 2024-08-15 | Possible Medicines Llc | Aav delivery of rna guided recombination system |
| WO2024168253A1 (en) | 2023-02-10 | 2024-08-15 | Possible Medicines Llc | Delivery of an rna guided recombination system |
| WO2024173645A1 (en) | 2023-02-15 | 2024-08-22 | Arbor Biotechnologies, Inc. | Gene editing method for inhibiting aberrant splicing in stathmin 2 (stmn2) transcript |
| US12076375B2 (en) | 2022-06-29 | 2024-09-03 | Snipr Biome Aps | Treating and preventing E coli infections |
| US12091709B2 (en) | 2015-06-18 | 2024-09-17 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US12098425B2 (en) | 2018-10-10 | 2024-09-24 | Readcoor, Llc | Three-dimensional spatial molecular indexing |
| US12098399B2 (en) | 2022-06-24 | 2024-09-24 | Tune Therapeutics, Inc. | Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression |
| WO2024206911A2 (en) | 2023-03-30 | 2024-10-03 | Children's Hospital Medical Center | Clinical-grade organoids |
| US12110545B2 (en) | 2017-01-06 | 2024-10-08 | Editas Medicine, Inc. | Methods of assessing nuclease cleavage |
| WO2024220741A1 (en) | 2023-04-19 | 2024-10-24 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for the production of libraries |
| WO2024238977A2 (en) | 2023-05-18 | 2024-11-21 | Children's Hospital Medical Center | Liver organoids with intrahepatic sympathetic nerves, and methods of use thereof |
| WO2024236547A1 (en) | 2023-05-18 | 2024-11-21 | Inceptor Bio, Llc | Modified phagocytic cells expressing chimeric antigen receptors comprising a herpes virus entry mediator (hvem) co-stimulatory domain and uses thereof |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12165743B2 (en) | 2018-11-09 | 2024-12-10 | The Broad Institute, Inc. | Compressed sensing for screening and tissue imaging |
| US12161694B2 (en) | 2017-03-24 | 2024-12-10 | The Broad Institute, Inc. | Methods and compositions for regulating innate lymphoid cell inflammatory responses |
| US12171783B2 (en) | 2017-11-13 | 2024-12-24 | The Broad Institute, Inc. | Methods and compositions for targeting developmental and oncogenic programs in H3K27M gliomas |
| WO2024263961A2 (en) | 2023-06-23 | 2024-12-26 | Children's Hospital Medical Center | Methods of matrix-free suspension culture |
| WO2025006419A1 (en) | 2023-06-26 | 2025-01-02 | Flagship Pioneering Innovations Vii, Llc | Engineered plasmodia and related methods |
| US12201699B2 (en) | 2014-10-10 | 2025-01-21 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| US12203136B2 (en) | 2020-08-17 | 2025-01-21 | Readcoor, Llc | Methods and systems for spatial mapping of genetic variants |
| US12214054B2 (en) | 2015-11-30 | 2025-02-04 | Duke University | Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use |
| US12215345B2 (en) | 2013-03-19 | 2025-02-04 | Duke University | Compositions and methods for the induction and tuning of gene expression |
| US12214056B2 (en) | 2016-07-19 | 2025-02-04 | Duke University | Therapeutic applications of CPF1-based genome editing |
| WO2025027165A1 (en) | 2023-08-01 | 2025-02-06 | Basf Plant Science Company Gmbh | Increased resistance by expression of an ics protein |
| WO2025027166A1 (en) | 2023-08-01 | 2025-02-06 | Basf Plant Science Company Gmbh | Increased resistance by expression of msbp1 protein |
| US12221720B2 (en) | 2017-11-13 | 2025-02-11 | The Broad Institute, Inc. | Methods for determining spatial and temporal gene expression dynamics during adult neurogenesis in single cells |
| US12227742B2 (en) | 2017-10-23 | 2025-02-18 | The Broad Institute, Inc. | Nucleic acid modifiers |
| US12227578B2 (en) | 2016-11-11 | 2025-02-18 | The Broad Institute, Inc. | Modulation of intestinal epithelial cell differentiation, maintenance and/or function through T cell action |
| US12226479B2 (en) | 2017-05-11 | 2025-02-18 | The General Hospital Corporation | Methods and compositions of use of CD8+ tumor infiltrating lymphocyte subtypes and gene signatures thereof |
| EP4512819A2 (en) | 2015-08-12 | 2025-02-26 | The General Hospital Corporation | Compositions and methods that promote hypoxia or the hypoxia response for treatment and prevention of mitochondrial dysfunction and oxidative stress disorders |
| US12239646B2 (en) | 2017-07-19 | 2025-03-04 | Dana-Farber Cancer Institute, Inc. | Cancer diagnostic and treatment |
| US12241090B2 (en) | 2014-05-28 | 2025-03-04 | Children's Hospital Medical Center | Methods and systems for converting precursor cells into gastric tissues through directed differentiation |
| WO2025046513A1 (en) | 2023-08-29 | 2025-03-06 | Inceptor Bio, Llc | Methods of manufacturing myeloid-derived cells from hematopoietic stem cells and compositions and uses thereof |
| US12258584B2 (en) | 2010-05-06 | 2025-03-25 | Children's Hospital Medical Center | Methods and systems for converting precursor cells into intestinal tissues through directed differentiation |
| US12264323B2 (en) | 2018-12-17 | 2025-04-01 | The Broad Institute, Inc. | CRISPR CPF1 direct repeat variants |
| WO2025072803A1 (en) | 2023-09-29 | 2025-04-03 | Children's Hospital Medical Center | Ntrk2 signaling-mediated alveolar capillary injury and repair |
| US12269804B2 (en) | 2018-01-17 | 2025-04-08 | Vertex Pharmaceuticals Incorporated | Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12281334B2 (en) | 2017-04-14 | 2025-04-22 | Children's Hospital Medical Center | Multi donor stem cell compositions and methods of making same |
| US12286727B2 (en) | 2016-12-19 | 2025-04-29 | Editas Medicine, Inc. | Assessing nuclease cleavage |
| US12286624B2 (en) | 2018-06-08 | 2025-04-29 | Johann Wolfgang Goethe-Universität Frankfurt am Main | Method for generating a gene editing vector with fixed guide RNA pairs |
| US12297457B2 (en) | 2017-10-10 | 2025-05-13 | Children's Hospital Medical Center | Esophageal tissue and/or organoid compositions and methods of making same |
| US12297436B2 (en) | 2017-05-18 | 2025-05-13 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| US12305204B2 (en) | 2016-08-17 | 2025-05-20 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| US12331347B2 (en) | 2014-07-11 | 2025-06-17 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| US12338436B2 (en) | 2018-06-29 | 2025-06-24 | Editas Medicine, Inc. | Synthetic guide molecules, compositions and methods relating thereto |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| WO2025158400A1 (en) | 2024-01-24 | 2025-07-31 | Yale University | Compositions and methods of natural killer cell hyperboosts for enhancement of nk cell therapy |
| US12379372B2 (en) | 2017-12-21 | 2025-08-05 | Children's Hospital Medical Center | Digitalized human organoids and methods of using same |
| WO2025162985A1 (en) | 2024-01-30 | 2025-08-07 | Basf Plant Science Company Gmbh | Increased plant disease resistance by expression of a glycine-rich protein |
| WO2025171210A1 (en) | 2024-02-09 | 2025-08-14 | Arbor Biotechnologies, Inc. | Compositions and methods for gene editing via homology-mediated end joining |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12404514B2 (en) | 2016-12-09 | 2025-09-02 | The Broad Institute, Inc. | CRISPR-systems for modifying a trait of interest in a plant |
| US12402610B2 (en) | 2018-11-09 | 2025-09-02 | The Broad Institute, Inc. | Methods and compositions for modulating innate lymphoid cell pathogenic effectors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12414967B2 (en) | 2016-11-04 | 2025-09-16 | Children's Hospital Medical Center | Compositions and methods of treating liver disease |
| US12421500B2 (en) | 2018-07-26 | 2025-09-23 | Children's Hospital Medical Center | Hepato-biliary-pancreatic tissues and methods of making same |
| US12428631B2 (en) | 2016-04-13 | 2025-09-30 | Duke University | CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use |
| US12428622B2 (en) | 2018-09-12 | 2025-09-30 | Children's Hospital Medical Center | Organoid compositions for the production of hematopoietic stem cells and derivatives thereof |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| WO2025212920A1 (en) | 2024-04-03 | 2025-10-09 | Children's Hospital Medical Center | Multi-zonal liver organoids |
| WO2025217202A1 (en) | 2024-04-08 | 2025-10-16 | Children's Hospital Medical Center | Bile duct organoid |
| EP4636083A2 (en) | 2015-10-20 | 2025-10-22 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Methods and products for genetic engineering |
| US12454687B2 (en) | 2012-12-12 | 2025-10-28 | The Broad Institute, Inc. | Functional genomics using CRISPR-Cas systems, compositions, methods, knock out libraries and applications thereof |
| US12467086B2 (en) | 2011-10-14 | 2025-11-11 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12497597B2 (en) | 2019-05-31 | 2025-12-16 | Children's Hospital Medical Center | Methods of generating and expanding hematopoietic stem cells |
| US12499971B2 (en) | 2016-09-28 | 2025-12-16 | The Broad Institute, Inc. | Systematic screening and mapping of regulatory elements in non-coding genomic regions, methods, compositions, and applications thereof |
| US12505549B1 (en) | 2020-05-22 | 2025-12-23 | Insitro, Inc. | Microscopy image analyses for disease modeling |
| US12509492B2 (en) | 2018-01-19 | 2025-12-30 | Duke University | Genome engineering with CRISPR-Cas systems in eukaryotes |
| WO2026006542A2 (en) | 2024-06-26 | 2026-01-02 | Yale University | Compositions and methods for crispr/cas9 based reactivation of human angelman syndrome |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| WO2026015829A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Small reverse transcriptases and gene editing systems comprising such |
| WO2026015832A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Reverse transcriptases and gene editing systems comprising such |
| US12534714B2 (en) | 2019-03-18 | 2026-01-27 | The Broad Institute, Inc. | Type VII CRISPR proteins and systems |
| US12534709B2 (en) | 2019-05-31 | 2026-01-27 | Children's Hospital Medical Center | Shaped organoid compositions and methods of making same |
| US12534715B2 (en) | 2015-04-16 | 2026-01-27 | Wageningen Universiteit | Nucleic acids for nuclease-mediated genome editing |
| US12559790B2 (en) | 2020-01-29 | 2026-02-24 | 10X Genomics, Inc. | Compositions and methods for analyte detection |
| US12565671B2 (en) | 2016-08-31 | 2026-03-03 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| WO2026047626A1 (en) | 2024-08-30 | 2026-03-05 | Inceptor Bio, Llc | Compositions and methods involving immune cells engineered for binding bispecific antibodies for use in cell therapy |
| US12589115B2 (en) | 2018-03-29 | 2026-03-31 | The University Court Of The University Of Edinburgh | Haematopoietic stem cell treatment |
| US12590288B2 (en) | 2017-04-12 | 2026-03-31 | The Broad Institute, Inc. | Method of treating an inflammatory disease by administering an agent which binds a surface receptor on a tuft cell that induces an ILC class 2 inflammatory response |
| US12595478B2 (en) | 2016-06-29 | 2026-04-07 | The Broad Institute, Inc. | Crispr-Cas systems having destabilization domain |
| US12600943B2 (en) | 2019-02-01 | 2026-04-14 | The University Of Hong Kong | Innervated organoid compositions and methods of making same |
| US12617822B2 (en) | 2018-09-18 | 2026-05-05 | Aera Therapeutics, Inc. | Arc-based capsids and uses thereof |
| US12629428B2 (en) | 2020-04-14 | 2026-05-19 | Duke University | AAV vector-mediated deletion of large mutational hotspot for treatment of Duchenne muscular dystrophy |
Families Citing this family (588)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2449112A1 (en) | 2009-07-01 | 2012-05-09 | Transposagen Biopharmaceuticals, Inc. | Genetically modified rat models for severe combined immunodeficiency (scid) |
| US9528124B2 (en) | 2013-08-27 | 2016-12-27 | Recombinetics, Inc. | Efficient non-meiotic allele introgression |
| US10920242B2 (en) | 2011-02-25 | 2021-02-16 | Recombinetics, Inc. | Non-meiotic allele introgression |
| EP2689019A2 (en) | 2011-03-23 | 2014-01-29 | Pioneer Hi-Bred International Inc. | Methods for producing a complex transgenic trait locus |
| WO2013119602A1 (en) | 2012-02-06 | 2013-08-15 | President And Fellows Of Harvard College | Arrdc1-mediated microvesicles (armms) and uses thereof |
| US20150225734A1 (en) | 2012-06-19 | 2015-08-13 | Regents Of The University Of Minnesota | Gene targeting in plants using dna viruses |
| US10648001B2 (en) | 2012-07-11 | 2020-05-12 | Sangamo Therapeutics, Inc. | Method of treating mucopolysaccharidosis type I or II |
| CA2875618C (en) | 2012-07-11 | 2021-04-27 | Sangamo Biosciences, Inc. | Methods and compositions for the treatment of lysosomal storage diseases |
| JP2015527889A (en) * | 2012-07-25 | 2015-09-24 | ザ ブロード インスティテュート, インコーポレイテッド | Inducible DNA binding protein and genomic disruption tools and their applications |
| WO2014071182A1 (en) | 2012-11-01 | 2014-05-08 | Massachusetts Institute Of Technology | Directed evolution of synthetic gene cluster |
| US11135273B2 (en) | 2013-02-07 | 2021-10-05 | The Rockefeller University | Sequence specific antimicrobials |
| US10660943B2 (en) * | 2013-02-07 | 2020-05-26 | The Rockefeller University | Sequence specific antimicrobials |
| WO2014204578A1 (en) | 2013-06-21 | 2014-12-24 | The General Hospital Corporation | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing |
| US10378027B2 (en) | 2013-03-15 | 2019-08-13 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US10760064B2 (en) | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US20140364333A1 (en) * | 2013-03-15 | 2014-12-11 | President And Fellows Of Harvard College | Methods for Live Imaging of Cells |
| JP2016522679A (en) | 2013-04-04 | 2016-08-04 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Therapeutic use of genome editing with the CRISPR / Cas system |
| US11414695B2 (en) | 2013-05-29 | 2022-08-16 | Agilent Technologies, Inc. | Nucleic acid enrichment using Cas9 |
| JP2016528890A (en) | 2013-07-09 | 2016-09-23 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Therapeutic use of genome editing using the CRISPR / Cas system |
| WO2015054507A1 (en) | 2013-10-10 | 2015-04-16 | Pronutria, Inc. | Nutritive polypeptide production systems, and methods of manufacture and use thereof |
| WO2015070062A1 (en) | 2013-11-07 | 2015-05-14 | Massachusetts Institute Of Technology | Cell-based genomic recorded accumulative memory |
| CA2931684C (en) | 2013-12-19 | 2024-02-20 | Novartis Ag | Human mesothelin chimeric antigen receptors and uses thereof |
| WO2015103153A1 (en) * | 2013-12-31 | 2015-07-09 | The Regents Of The University Of California | Cas9 crystals and methods of use thereof |
| EP3107999A4 (en) | 2014-02-18 | 2017-10-04 | Duke University | Compositions for the inactivation of virus replication and methods of making and using the same |
| EP3971283A1 (en) | 2014-02-27 | 2022-03-23 | Monsanto Technology LLC | Compositions and methods for site directed genomic modification |
| EP3593812A3 (en) | 2014-03-15 | 2020-05-27 | Novartis AG | Treatment of cancer using chimeric antigen receptor |
| JP6815986B2 (en) | 2014-03-26 | 2021-01-20 | ユニバーシティ オブ メリーランド, カレッジ パーク | Targeted genome editing in zygotes of large livestock |
| IL322264A (en) | 2014-04-07 | 2025-09-01 | Novartis Ag | Treatment of cancer using anti-cd19 chimeric antigen receptor |
| US20160029604A1 (en) | 2014-04-28 | 2016-02-04 | Recombinetics, Inc. | Multiplex gene editing |
| KR102149572B1 (en) | 2014-05-19 | 2020-08-28 | 화이자 인코포레이티드 | Substituted-6,8-dioxabicyclo[3.2.1]octane-2,3-diol compounds as targeting agents of asgpr |
| RU2704283C9 (en) * | 2014-06-06 | 2020-02-07 | Регенерон Фармасьютикалз, Инк. | Methods and compositions for modifying target locus |
| EP3154694B1 (en) | 2014-06-13 | 2025-01-29 | Children's Medical Center Corporation | Products and methods to isolate mitochondria |
| EP3919621A1 (en) | 2014-06-23 | 2021-12-08 | The General Hospital Corporation | Genomewide unbiased identification of dsbs evaluated by sequencing (guide-seq) |
| WO2016007948A1 (en) * | 2014-07-11 | 2016-01-14 | Pioneer Hi-Bred International, Inc. | Agronomic trait modification using guide rna/cas endonuclease systems and methods of use |
| CN106687594A (en) | 2014-07-11 | 2017-05-17 | 纳幕尔杜邦公司 | Compositions and methods for producing plants resistant to glyphosate herbicide |
| WO2016011203A1 (en) | 2014-07-15 | 2016-01-21 | Life Technologies Corporation | Compositions with lipid aggregates and methods for efficient delivery of molecules to cells |
| US11542488B2 (en) | 2014-07-21 | 2023-01-03 | Novartis Ag | Sortase synthesized chimeric antigen receptors |
| MY181834A (en) | 2014-07-21 | 2021-01-08 | Novartis Ag | Treatment of cancer using humanized anti-bcma chimeric antigen receptor |
| US9777061B2 (en) | 2014-07-21 | 2017-10-03 | Novartis Ag | Treatment of cancer using a CD33 chimeric antigen receptor |
| WO2016014530A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Combinations of low, immune enhancing. doses of mtor inhibitors and cars |
| US20170209492A1 (en) | 2014-07-31 | 2017-07-27 | Novartis Ag | Subset-optimized chimeric antigen receptor-containing t-cells |
| US10513711B2 (en) | 2014-08-13 | 2019-12-24 | Dupont Us Holding, Llc | Genetic targeting in non-conventional yeast using an RNA-guided endonuclease |
| WO2016025880A1 (en) | 2014-08-14 | 2016-02-18 | Novartis Ag | Treatment of cancer using gfr alpha-4 chimeric antigen receptor |
| SG11201700770PA (en) | 2014-08-19 | 2017-03-30 | Novartis Ag | Anti-cd123 chimeric antigen receptor (car) for use in cancer treatment |
| CA2959070C (en) * | 2014-08-27 | 2020-11-10 | Caribou Biosciences, Inc. | Methods for increasing cas9-mediated engineering efficiency |
| US10450584B2 (en) | 2014-08-28 | 2019-10-22 | North Carolina State University | Cas9 proteins and guiding features for DNA targeting and genome editing |
| BR112017003757A2 (en) | 2014-09-12 | 2017-12-26 | Du Pont | ? corn plants, parts of corn plants or corn seeds? |
| ES2891332T3 (en) | 2014-09-17 | 2022-01-27 | Novartis Ag | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
| US9616114B1 (en) | 2014-09-18 | 2017-04-11 | David Gordon Bermudes | Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity |
| AU2015320738B2 (en) | 2014-09-23 | 2021-12-02 | Acceligen, Inc. | Materials and methods for producing animals with short hair |
| US10040048B1 (en) | 2014-09-25 | 2018-08-07 | Synthego Corporation | Automated modular system and method for production of biopolymers |
| CN105602935B (en) * | 2014-10-20 | 2020-11-13 | 聂凌云 | A novel mitochondrial genome editing tool |
| GB201418965D0 (en) | 2014-10-24 | 2014-12-10 | Ospedale San Raffaele And Fond Telethon | |
| US9816080B2 (en) | 2014-10-31 | 2017-11-14 | President And Fellows Of Harvard College | Delivery of CAS9 via ARRDC1-mediated microvesicles (ARMMs) |
| EP3215623A4 (en) | 2014-11-06 | 2018-09-26 | President and Fellows of Harvard College | Cells lacking b2m surface expression and methods for allogeneic administration of such cells |
| JP6823593B2 (en) | 2014-11-06 | 2021-02-03 | イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニーE.I.Du Pont De Nemours And Company | Peptide-mediated transport of RNA-induced endonucleases to cells |
| WO2016082135A1 (en) * | 2014-11-27 | 2016-06-02 | 中国农业科学院北京畜牧兽医研究所 | Method for porcine h11 site-specific insertion by using site-specific cleavage system |
| US20170327834A1 (en) | 2014-12-15 | 2017-11-16 | Syngenta Participations Ag | Pesticidal microrna carriers and use thereof |
| DK3234150T3 (en) * | 2014-12-16 | 2025-11-03 | Danisco Us Inc | SYSTEMS FOR FUNGAL GENOMODIFICATION AND METHODS FOR THEIR USE |
| JP6839082B2 (en) * | 2014-12-17 | 2021-03-03 | イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニーE.I.Du Pont De Nemours And Company | E. using a guide RNA / CAS endonuclease system in combination with a cyclic polynucleotide modification template. Compositions and methods for efficient gene editing in E. coli |
| US20190054117A1 (en) | 2014-12-19 | 2019-02-21 | Novartis Ag | Dimerization switches and uses thereof |
| US10190106B2 (en) | 2014-12-22 | 2019-01-29 | Univesity Of Massachusetts | Cas9-DNA targeting unit chimeras |
| EP3237624B1 (en) | 2014-12-23 | 2020-01-29 | Syngenta Participations AG | Methods and compositions for identifying and enriching for cells comprising site specific genomic modifications |
| CA2972454C (en) | 2014-12-31 | 2024-09-10 | Phykion Inc. | Compositions and methods for high efficiency in vivo genome editing |
| EP3245232B1 (en) | 2015-01-12 | 2021-04-21 | The Regents of The University of California | Heterodimeric cas9 and methods of use thereof |
| US11180792B2 (en) | 2015-01-28 | 2021-11-23 | The Regents Of The University Of California | Methods and compositions for labeling a single-stranded target nucleic acid |
| SI3250691T1 (en) | 2015-01-28 | 2023-10-30 | Caribou Biosciences, Inc. | Crispr hybrid dna/rna polynucleotides and methods of use |
| JP6817215B2 (en) | 2015-03-03 | 2021-01-20 | ザ ジェネラル ホスピタル コーポレイション | Genetically engineered CRISPR-Cas9 nuclease with modified PAM specificity |
| CN104673816A (en) * | 2015-03-05 | 2015-06-03 | 广东医学院 | PCr-NHEJ (non-homologous end joining) carrier as well as construction method of pCr-NHEJ carrier and application of pCr-NHEJ carrier in site-specific knockout of bacterial genes |
| EP3553178A1 (en) | 2015-03-27 | 2019-10-16 | E. I. du Pont de Nemours and Company | Soybean u6 small nuclear rna gene promoters and their use in constitutive expression of small rna genes in plants |
| WO2016168594A1 (en) * | 2015-04-16 | 2016-10-20 | President And Fellows Of Harvard College | Sensor systems for target ligands and uses thereof |
| EP3286211A1 (en) | 2015-04-23 | 2018-02-28 | Novartis AG | Treatment of cancer using chimeric antigen receptor and protein kinase a blocker |
| EP3289104B1 (en) | 2015-04-29 | 2020-11-04 | New York University | Method for treating high-grade gliomas |
| CN106191040B (en) * | 2015-04-30 | 2021-09-14 | 杭州菁因康生物科技有限公司 | Gene targeting method |
| CA2988854A1 (en) | 2015-05-08 | 2016-11-17 | President And Fellows Of Harvard College | Universal donor stem cells and related methods |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| EP3294878A1 (en) | 2015-05-15 | 2018-03-21 | Pioneer Hi-Bred International, Inc. | Guide rna/cas endonuclease systems |
| WO2016187904A1 (en) * | 2015-05-22 | 2016-12-01 | 深圳市第二人民医院 | Method for pig cmah gene specific knockout by means of crispr-cas9 and sgrna for specially targeting cmah gene |
| US20180148711A1 (en) * | 2015-05-28 | 2018-05-31 | Coda Biotherapeutics, Inc. | Genome editing vectors |
| EP3919622A1 (en) | 2015-06-01 | 2021-12-08 | Temple University - Of The Commonwealth System of Higher Education | Methods and compositions for rna-guided treatment of hiv infection |
| EP3303634B1 (en) | 2015-06-03 | 2023-08-30 | The Regents of The University of California | Cas9 variants and methods of use thereof |
| EP3302525A2 (en) | 2015-06-05 | 2018-04-11 | Novartis AG | Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders |
| IL256175B2 (en) | 2015-06-10 | 2024-10-01 | Univ Texas | Use of exosomes for the treatment of disease |
| JP7051438B2 (en) | 2015-06-15 | 2022-04-11 | ノース カロライナ ステート ユニバーシティ | Methods and Compositions for Efficient Delivery of Nucleic Acid and RNA-Based Antibacterial Agents |
| JP2018518182A (en) | 2015-06-17 | 2018-07-12 | ザ ユーエービー リサーチ ファンデーション | CRISPR / CAS9 complex for genome editing |
| CA2989858A1 (en) | 2015-06-17 | 2016-12-22 | The Uab Research Foundation | Crispr/cas9 complex for introducing a functional polypeptide into cells of blood cell lineage |
| KR102197507B1 (en) | 2015-07-13 | 2020-12-31 | 피벗 바이오, 인크. | Methods and compositions for improving plant traits |
| JP7044373B2 (en) | 2015-07-15 | 2022-03-30 | ラトガース,ザ ステート ユニバーシティ オブ ニュージャージー | Nuclease-independent targeted gene editing platform and its uses |
| US9580727B1 (en) | 2015-08-07 | 2017-02-28 | Caribou Biosciences, Inc. | Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides |
| US11667691B2 (en) | 2015-08-07 | 2023-06-06 | Novartis Ag | Treatment of cancer using chimeric CD3 receptor proteins |
| AU2016316845B2 (en) | 2015-08-28 | 2022-03-10 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| IL241462A0 (en) | 2015-09-10 | 2015-11-30 | Yeda Res & Dev | Heterologous engineering of betalain pigments in plants |
| CN108350453A (en) | 2015-09-11 | 2018-07-31 | 通用医疗公司 | The rough complete querying of nuclease DSB and sequencing (FIND-SEQ) |
| JP2018529353A (en) | 2015-09-30 | 2018-10-11 | ザ ジェネラル ホスピタル コーポレイション | Comprehensive in vitro reporting of cleavage events by sequencing (CIRCLE-seq) |
| WO2017062412A1 (en) | 2015-10-05 | 2017-04-13 | Massachusetts Institute Of Technology | Nitrogen fixation using refactored nif clusters |
| FI4144844T3 (en) | 2015-10-12 | 2025-11-24 | Dupont Us Holding Llc | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
| CN108138155A (en) | 2015-10-20 | 2018-06-08 | 先锋国际良种公司 | Restoring the function of a non-functional gene product via a guided CAS system and methods of use |
| EP3350327B1 (en) | 2015-10-23 | 2018-09-26 | Caribou Biosciences, Inc. | Engineered crispr class 2 cross-type nucleic-acid targeting nucleic acids |
| JP2018532415A (en) * | 2015-11-06 | 2018-11-08 | ザ ジャクソン ラボラトリー | Large genomic DNA knock-ins and uses thereof |
| WO2017083368A1 (en) * | 2015-11-12 | 2017-05-18 | Pfizer Inc. | Tissue-specific genome engineering using crispr-cas9 |
| US11306308B2 (en) | 2015-11-13 | 2022-04-19 | Massachusetts Institute Of Technology | High-throughput CRISPR-based library screening |
| WO2017083852A1 (en) | 2015-11-13 | 2017-05-18 | MOORE, Tara | Methods for the treatment of corneal dystrophies |
| EP3377042A4 (en) | 2015-11-16 | 2019-05-29 | The Research Institute at Nationwide Children's Hospital | SUBSTANCES AND METHODS FOR THE TREATMENT OF MYOPATHIES BASED ON TITINE AND OTHER TITINOPATHIES |
| US11905521B2 (en) | 2015-11-17 | 2024-02-20 | The Chinese University Of Hong Kong | Methods and systems for targeted gene manipulation |
| US12282014B2 (en) | 2015-11-19 | 2025-04-22 | Dana-Farber Cancer Institute, Inc. | Methods of identifying compounds that interfere with ERG-driven misguidance of BAF complexes in TMPRSS2-ERG driven prostate cancers |
| EP3383411B1 (en) | 2015-11-30 | 2025-07-09 | Sana Biotechnology, Inc. | Sub-mitochondrial particles for use in treating metabolic conditions |
| DK3371310T3 (en) | 2015-12-04 | 2019-08-05 | Caribou Biosciences Inc | NUCLEIC ACID CONSTRUCTED TARGET NUCLEIC ACIDS |
| CA3007635A1 (en) | 2015-12-07 | 2017-06-15 | Zymergen Inc. | Promoters from corynebacterium glutamicum |
| US11208649B2 (en) | 2015-12-07 | 2021-12-28 | Zymergen Inc. | HTP genomic engineering platform |
| US9988624B2 (en) | 2015-12-07 | 2018-06-05 | Zymergen Inc. | Microbial strain improvement by a HTP genomic engineering platform |
| DK3387134T3 (en) | 2015-12-11 | 2020-12-21 | Danisco Us Inc | PROCEDURES AND COMPOSITIONS FOR INCREASED NUCLEASE MEDIATED GENERAL MODIFICATION AND REDUCED EFFECTS OUTSIDE THE OBJECTIVE |
| US12110490B2 (en) | 2015-12-18 | 2024-10-08 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| DK3390631T3 (en) | 2015-12-18 | 2020-07-13 | Danisco Us Inc | METHODS AND COMPOSITIONS FOR T-RNA-BASED GUIDE RNA EXPRESSION |
| WO2017112620A1 (en) | 2015-12-22 | 2017-06-29 | North Carolina State University | Methods and compositions for delivery of crispr based antimicrobials |
| IL304088A (en) | 2016-01-11 | 2023-08-01 | Univ Leland Stanford Junior | Chimeric Proteins- Containing Systems and Uses Thereof in Regulating Gene Expression |
| MX2018008345A (en) | 2016-01-11 | 2018-12-06 | Univ Leland Stanford Junior | Chimeric proteins and methods of immunotherapy. |
| ES3057779T3 (en) | 2016-01-15 | 2026-03-04 | Childrens Medical Ct Corp | Therapeutic use of mitochondria and combined mitochondrial agents |
| BR112018015348A2 (en) | 2016-01-26 | 2018-12-18 | Pioneer Hi Bred Int | method for obtaining a waxy maize plant, plant, seed, guide polynucleotide and method for producing a hybrid waxy maize plant |
| WO2017139309A1 (en) | 2016-02-12 | 2017-08-17 | Ceres, Inc. | Methods and materials for high throughput testing of mutagenized allele combinations |
| EP3417061B1 (en) | 2016-02-18 | 2022-10-26 | The Regents of the University of California | Methods and compositions for gene editing in stem cells |
| US10973930B2 (en) | 2016-02-18 | 2021-04-13 | The Penn State Research Foundation | Generating GABAergic neurons in brains |
| WO2017151444A1 (en) | 2016-02-29 | 2017-09-08 | Agilent Technologies, Inc. | Methods and compositions for blocking off-target nucleic acids from cleavage by crispr proteins |
| WO2017152023A1 (en) | 2016-03-04 | 2017-09-08 | Indoor Biotechnologies Inc. | Fel d 1 knockouts and associated compositions and methods based on crispr-cas9 genomic editing |
| WO2017155715A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| EP3426780A1 (en) | 2016-03-11 | 2019-01-16 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| CA3010628A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| WO2017161043A1 (en) | 2016-03-16 | 2017-09-21 | The J. David Gladstone Institutes | Methods and compositions for treating obesity and/or diabetes and for identifying candidate treatment agents |
| EP3443096B1 (en) | 2016-04-15 | 2023-03-01 | Novartis AG | Compositions and methods for selective expression of chimeric antigen receptors |
| SG11201810179RA (en) | 2016-04-19 | 2018-12-28 | Broad Inst Inc | Novel crispr enzymes and systems |
| AU2017253107B2 (en) | 2016-04-19 | 2023-07-20 | Massachusetts Institute Of Technology | CPF1 complexes with reduced indel activity |
| CN105861485B (en) * | 2016-04-20 | 2021-08-17 | 上海伊丽萨生物科技有限公司 | Method for improving gene replacement efficiency |
| CN109641063B (en) | 2016-04-20 | 2022-11-15 | 能源环境和技术研究中心O.A., M.P. | Compositions and methods for enhancing gene expression of PKLR |
| WO2017201425A1 (en) * | 2016-05-20 | 2017-11-23 | The Trustees Columbia University In The City Of New York | Anabolic enhancers for ameliorating neurodegeneration |
| EP3463371B1 (en) | 2016-05-24 | 2022-02-23 | Indiana University Research & Technology Corporation | Ku inhibitors and their use |
| US11202840B2 (en) | 2016-06-21 | 2021-12-21 | The Curators Of The University Of Missouri | Modified dystrophin proteins |
| WO2018005445A1 (en) | 2016-06-27 | 2018-01-04 | The Broad Institute, Inc. | Compositions and methods for detecting and treating diabetes |
| WO2018005793A1 (en) | 2016-06-30 | 2018-01-04 | Zymergen Inc. | Methods for generating a glucose permease library and uses thereof |
| JP2019519242A (en) | 2016-06-30 | 2019-07-11 | ザイマージェン インコーポレイテッド | Method for generating a bacterial hemoglobin library and its use |
| US11359234B2 (en) * | 2016-07-01 | 2022-06-14 | Microsoft Technology Licensing, Llc | Barcoding sequences for identification of gene expression |
| EP3478852B1 (en) | 2016-07-01 | 2020-08-12 | Microsoft Technology Licensing, LLC | Storage through iterative dna editing |
| US20180004537A1 (en) | 2016-07-01 | 2018-01-04 | Microsoft Technology Licensing, Llc | Molecular State Machines |
| SG11201900344YA (en) | 2016-07-15 | 2019-02-27 | Novartis Ag | Treatment and prevention of cytokine release syndrome using a chimeric antigen receptor in combination with a kinase inhibitor |
| US11078481B1 (en) | 2016-08-03 | 2021-08-03 | KSQ Therapeutics, Inc. | Methods for screening for cancer targets |
| JP7215808B2 (en) * | 2016-08-12 | 2023-01-31 | ツールゲン インコーポレイテッド | Engineered immunoregulatory elements and altered immunity |
| WO2018030874A1 (en) * | 2016-08-12 | 2018-02-15 | 주식회사 툴젠 | Manipulated immunoregulatory element and immunity altered thereby |
| EP3500677A4 (en) | 2016-08-20 | 2020-04-01 | Avellino Lab USA, Inc. | UNIQUE GUIDE RNA, CRISPR / CAS9 SYSTEMS AND METHODS OF USE |
| WO2020225754A1 (en) | 2019-05-06 | 2020-11-12 | Mcmullen Tara | Crispr gene editing for autosomal dominant diseases |
| US11078483B1 (en) | 2016-09-02 | 2021-08-03 | KSQ Therapeutics, Inc. | Methods for measuring and improving CRISPR reagent function |
| JP7215994B2 (en) | 2016-09-06 | 2023-01-31 | ザ チルドレンズ メディカル センター コーポレーション | Immune cells derived from induced pluripotent stem cells |
| WO2018049009A2 (en) | 2016-09-07 | 2018-03-15 | Sangamo Therapeutics, Inc. | Modulation of liver genes |
| IL247752A0 (en) | 2016-09-11 | 2016-11-30 | Yeda Res & Dev | Compositions and methods for regulating gene expression for targeted mutagenesis |
| WO2018064387A1 (en) | 2016-09-28 | 2018-04-05 | Novartis Ag | Porous membrane-based macromolecule delivery system |
| JP2019532644A (en) | 2016-09-30 | 2019-11-14 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア | RNA-induced nucleic acid modifying enzyme and method of using the same |
| WO2018064352A1 (en) | 2016-09-30 | 2018-04-05 | The Regents Of The University Of California | Rna-guided nucleic acid modifying enzymes and methods of use thereof |
| WO2018067546A1 (en) | 2016-10-03 | 2018-04-12 | President And Fellows Of Harvard College | Delivery of therapeutic rnas via arrdc1-mediated microvesicles |
| US10669539B2 (en) | 2016-10-06 | 2020-06-02 | Pioneer Biolabs, Llc | Methods and compositions for generating CRISPR guide RNA libraries |
| CA3037560A1 (en) | 2016-10-13 | 2018-04-19 | Pioneer Hi-Bred International, Inc. | Generating northern leaf blight resistant maize |
| GB201617559D0 (en) | 2016-10-17 | 2016-11-30 | University Court Of The University Of Edinburgh The | Swine comprising modified cd163 and associated methods |
| US10738338B2 (en) | 2016-10-18 | 2020-08-11 | The Research Foundation for the State University | Method and composition for biocatalytic protein-oligonucleotide conjugation and protein-oligonucleotide conjugate |
| WO2018078134A1 (en) * | 2016-10-28 | 2018-05-03 | Genethon | Compositions and methods for the treatment of myotonic dystrophy |
| WO2018081531A2 (en) | 2016-10-28 | 2018-05-03 | Ariad Pharmaceuticals, Inc. | Methods for human t-cell activation |
| WO2018076335A1 (en) | 2016-10-31 | 2018-05-03 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Compositions and methods for enhancing abiotic stress tolerance |
| CA3042259A1 (en) | 2016-11-04 | 2018-05-11 | Flagship Pioneering Innovations V. Inc. | Novel plant cells, plants, and seeds |
| CN110168102A (en) | 2016-11-15 | 2019-08-23 | 基因组影像公司 | The method of the gene editing event of modified nucleic acid enzyme induction is monitored using molecule combing |
| WO2018100431A1 (en) | 2016-11-29 | 2018-06-07 | Genomic Vision | Method for designing a set of polynucleotide sequences for analysis of specific events in a genetic region of interest |
| US9816093B1 (en) | 2016-12-06 | 2017-11-14 | Caribou Biosciences, Inc. | Engineered nucleic acid-targeting nucleic acids |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US20180179553A1 (en) | 2016-12-14 | 2018-06-28 | Ligandal, Inc. | Compositions and methods for nucleic acid and/or protein payload delivery |
| CA3047163A1 (en) | 2016-12-22 | 2018-06-28 | Monsanto Technology Llc | Genome editing-based crop engineering and production of brachytic plants |
| JP7219972B2 (en) | 2017-01-05 | 2023-02-09 | ラトガース,ザ ステート ユニバーシティ オブ ニュー ジャージー | DNA double-strand break-independent targeted gene editing platform and its applications |
| EP3346001A1 (en) | 2017-01-06 | 2018-07-11 | TXCell | Monospecific regulatory t cell population with cytotoxicity for b cells |
| WO2018127585A1 (en) | 2017-01-06 | 2018-07-12 | Txcell | Monospecific regulatory t cell population with cytotoxicity for b cells |
| US11519009B2 (en) | 2017-01-09 | 2022-12-06 | University Of Massachusetts | Complexes for gene deletion and editing |
| UA129256C2 (en) | 2017-01-12 | 2025-03-05 | Півот Байо, Інк. | Methods and compositions for improving plant traits |
| EP3574005B1 (en) | 2017-01-26 | 2021-12-15 | Novartis AG | Cd28 compositions and methods for chimeric antigen receptor therapy |
| SG11201906795SA (en) | 2017-01-28 | 2019-08-27 | Inari Agriculture Inc | Novel plant cells, plants, and seeds |
| JP2020506700A (en) | 2017-01-31 | 2020-03-05 | ノバルティス アーゲー | Cancer treatment using multispecific chimeric T cell receptor protein |
| CA3049989A1 (en) | 2017-02-10 | 2018-08-16 | Zymergen Inc. | A modular universal plasmid design strategy for the assembly and editing of multiple dna constructs for multiple hosts |
| US10828330B2 (en) | 2017-02-22 | 2020-11-10 | IO Bioscience, Inc. | Nucleic acid constructs comprising gene editing multi-sites and uses thereof |
| AU2018225180B2 (en) | 2017-02-22 | 2024-09-12 | Io Biosciences, Inc. | Nucleic acid constructs comprising gene editing multi-sites and uses thereof |
| US20200048359A1 (en) | 2017-02-28 | 2020-02-13 | Novartis Ag | Shp inhibitor compositions and uses for chimeric antigen receptor therapy |
| US20180265887A1 (en) | 2017-03-16 | 2018-09-20 | Jacobs Farm Del Cabo | Basil Plants With High Tolerance to Downy Mildew |
| EP3601579B1 (en) | 2017-03-31 | 2023-10-04 | Pioneer Hi-Bred International, Inc. | Expression modulating elements and use thereof |
| US11834670B2 (en) | 2017-04-19 | 2023-12-05 | Global Life Sciences Solutions Usa Llc | Site-specific DNA modification using a donor DNA repair template having tandem repeat sequences |
| ES2992912T3 (en) | 2017-04-21 | 2024-12-19 | Massachusetts Gen Hospital | Variants of cpf1 (cas12a) with altered pam specificity |
| US20200179511A1 (en) | 2017-04-28 | 2020-06-11 | Novartis Ag | Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor |
| US20200055948A1 (en) | 2017-04-28 | 2020-02-20 | Novartis Ag | Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor |
| CN110914431B (en) | 2017-05-08 | 2024-04-19 | 株式会社图尔金 | Human-manipulated immune cells |
| WO2019103857A1 (en) | 2017-11-22 | 2019-05-31 | Iovance Biotherapeutics, Inc. | Expansion of peripheral blood lymphocytes (pbls) from peripheral blood |
| AU2018273986A1 (en) | 2017-05-25 | 2019-12-12 | The General Hospital Corporation | Bipartite base editor (BBE) architectures and type-II-C-Cas9 zinc finger editing |
| EP3409104A1 (en) | 2017-05-31 | 2018-12-05 | Vilmorin et Cie | Tomato plant resistant to tomato yellow leaf curl virus, powdery mildew, and nematodes |
| EP3409106A1 (en) | 2017-06-01 | 2018-12-05 | Vilmorin et Cie | Tolerance in plants of solanum lycopersicum to the tobamovirus tomato brown rugose fruit virus (tbrfv) |
| WO2020249996A1 (en) | 2019-06-14 | 2020-12-17 | Vilmorin & Cie | Resistance in plants of solanum lycopersicum to the tobamovirus tomato brown rugose fruit virus |
| AU2018280116B2 (en) | 2017-06-05 | 2025-03-27 | Research Institute At Nationwide Children's Hospital | Enhanced modified viral capsid proteins |
| KR20200026874A (en) | 2017-06-06 | 2020-03-11 | 지머젠 인코포레이티드 | HTP Genome Engineering Platform for E. Coli Improvement |
| KR20200026878A (en) | 2017-06-06 | 2020-03-11 | 지머젠 인코포레이티드 | HTP Genome Engineering Platform to Improve Fungal Strains |
| EP3635119A4 (en) | 2017-06-09 | 2021-04-14 | Vilmorin & Cie | COMPOSITIONS AND PROCEDURES FOR GENOMIC EDITING |
| IL271275B1 (en) | 2017-06-13 | 2026-04-01 | Flagship Pioneering Innovations V Inc | Compositions comprising curons and uses thereof |
| SG11201912179SA (en) | 2017-06-15 | 2020-01-30 | Univ California | Targeted non-viral dna insertions |
| US10392616B2 (en) | 2017-06-30 | 2019-08-27 | Arbor Biotechnologies, Inc. | CRISPR RNA targeting enzymes and systems and uses thereof |
| US10510743B2 (en) * | 2017-07-18 | 2019-12-17 | Hong Kong Applied Science and Technology Research Institute Company, Limited | Step fin field-effect-transistor (FinFET) with slim top of fin and thick bottom of fin for electro-static-discharge (ESD) or electrical over-stress (EOS) protection |
| DK3655532T3 (en) * | 2017-07-18 | 2021-11-08 | Genovie Ab | TWO-COMPONENT VECTOR LIBRARY FOR QUICK COMPOSITION AND DIVERSIFICATION OF OPEN FULL-LENGTH T-CELL RECEPTOR READING FRAMES |
| WO2019023291A2 (en) | 2017-07-25 | 2019-01-31 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for making and decoding paired-guide rna libraries and uses thereof |
| US10476825B2 (en) | 2017-08-22 | 2019-11-12 | Salk Institue for Biological Studies | RNA targeting methods and compositions |
| US11970720B2 (en) | 2017-08-22 | 2024-04-30 | Salk Institute For Biological Studies | RNA targeting methods and compositions |
| CA3073448A1 (en) | 2017-08-23 | 2019-02-28 | The General Hospital Corporation | Engineered crispr-cas9 nucleases with altered pam specificity |
| MX2020001790A (en) | 2017-08-25 | 2020-07-22 | Codiak Biosciences Inc | Preparation of therapeutic exosomes using membrane proteins. |
| CN111315889A (en) | 2017-09-08 | 2020-06-19 | 生命技术公司 | Methods and compositions for enhancing homologous recombination |
| US20190076814A1 (en) | 2017-09-11 | 2019-03-14 | Synthego Corporation | Biopolymer synthesis system and method |
| ES3050594T3 (en) | 2017-09-15 | 2025-12-22 | Covercress Inc | Low fiber pennycress meal and methods of making |
| WO2019056099A1 (en) | 2017-09-19 | 2019-03-28 | The University Of British Columbia | Anti-hla-a2 antibodies and methods of using the same |
| JP7317023B2 (en) | 2017-09-20 | 2023-07-28 | ザ・ユニバーシティ・オブ・ブリティッシュ・コロンビア | Novel anti-HLA-A2 antibodies and uses thereof |
| CN109517820B (en) | 2017-09-20 | 2021-09-24 | 北京宇繁生物科技有限公司 | A gRNA targeting HPK1 and an HPK1 gene editing method |
| US11917978B2 (en) | 2017-09-21 | 2024-03-05 | The Conard Pyle Company | Miniature rose plant named ‘meibenbino’ |
| US11252928B2 (en) | 2017-09-21 | 2022-02-22 | The Condard-Pyle Company | Miniature rose plant named ‘Meibenbino’ |
| WO2019060759A1 (en) | 2017-09-21 | 2019-03-28 | Dana-Farber Cancer Institute, Inc. | Isolation, preservation, compositions and uses of extracts from justicia plants |
| BR112020005803A2 (en) | 2017-09-25 | 2020-12-01 | Agrospheres, Inc. | compositions and methods for the modular production and administration of biological products |
| WO2019075197A1 (en) | 2017-10-11 | 2019-04-18 | The General Hospital Corporation | Methods for detecting site-specific and spurious genomic deamination induced by base editing technologies |
| SG11202002263TA (en) | 2017-10-16 | 2020-04-29 | Centro De Investigaciones Energeticas Medioambientales Y Tecnologicas | Lentiviral vectors for delivery of pklr to treat pyruvate kinase deficiency |
| JP7420712B2 (en) | 2017-10-25 | 2024-01-23 | ピボット バイオ, インコーポレイテッド | Methods and compositions for improving engineered microorganisms that fix nitrogen |
| US12151988B2 (en) | 2017-10-25 | 2024-11-26 | Pivot Bio, Inc. | Gene targets for nitrogen fixation targeting for improving plant traits |
| WO2019084552A1 (en) | 2017-10-27 | 2019-05-02 | The Regents Of The University Of California | Targeted replacement of endogenous t cell receptors |
| WO2019089798A1 (en) | 2017-10-31 | 2019-05-09 | Novartis Ag | Anti-car compositions and methods |
| AU2018358051B2 (en) | 2017-11-01 | 2025-01-09 | The Regents Of The University Of California | CasZ compositions and methods of use |
| US12227753B2 (en) | 2017-11-01 | 2025-02-18 | The Regents Of The University Of California | CasY compositions and methods of use |
| WO2019090173A1 (en) | 2017-11-02 | 2019-05-09 | Arbor Biotechnologies, Inc. | Novel crispr-associated transposon systems and components |
| WO2019084958A1 (en) | 2017-11-06 | 2019-05-09 | Shenzhen Cell Inspire Biotechnology Co., Ltd. | Novel human induced pluripotent stem cell lines for modeling alzheimer's disease and usage thereof |
| EP3710039A4 (en) | 2017-11-13 | 2021-08-04 | The Broad Institute, Inc. | METHODS AND COMPOSITIONS FOR CANCER TREATMENT BY TARGETING THE CLEC2D-KLRB1 PATH |
| CN111601883B (en) | 2017-11-17 | 2024-06-21 | 艾欧凡斯生物治疗公司 | Expansion of TILs from fine needle aspirates and small biopsies |
| WO2019112982A1 (en) * | 2017-12-05 | 2019-06-13 | Synthetic Genomics, Inc | Improving algal lipid productivity via genetic modification of a signaling protein |
| CA3082956A1 (en) | 2017-12-08 | 2019-06-13 | Synthetic Genomics, Inc. | Improving algal lipid productivity via genetic modification of a tpr domain containing protein |
| WO2019118463A1 (en) | 2017-12-15 | 2019-06-20 | Danisco Us Inc | Cas9 variants and methods of use |
| WO2019118893A1 (en) | 2017-12-15 | 2019-06-20 | Dana-Farber Cancer Institute, Inc. | Stabilized peptide-mediated targeted protein degradation |
| KR20200108275A (en) | 2017-12-28 | 2020-09-17 | 코디악 바이오사이언시즈, 인크. | Exosomes for immuno-oncology and anti-inflammatory therapy |
| WO2019133881A1 (en) | 2017-12-29 | 2019-07-04 | Rubius Therapeutics, Inc. | Gene editing and targeted transcriptional modulation for enginerering erythroid cells |
| EP3740061A4 (en) | 2018-01-19 | 2022-06-29 | Covercress Inc. | Low glucosinolate pennycress meal and methods of making |
| WO2019147743A1 (en) | 2018-01-26 | 2019-08-01 | Massachusetts Institute Of Technology | Structure-guided chemical modification of guide rna and its applications |
| US11926835B1 (en) | 2018-01-29 | 2024-03-12 | Inari Agriculture Technology, Inc. | Methods for efficient tomato genome editing |
| US11497752B2 (en) | 2018-01-30 | 2022-11-15 | Foghorn Therapeutics Inc. | Compounds and uses thereof |
| KR102136132B1 (en) * | 2018-01-31 | 2020-07-22 | 서울대학교 산학협력단 | A method for producing avian leukosis virus(alv)-resistant avian line using crispr/cas9 system |
| AR114350A1 (en) | 2018-01-31 | 2020-08-26 | Res Institute At Nationwide ChildrenS Hospital | GENETIC THERAPY FOR TYPE 2C MUSCULAR WAIST DYSTROPHY |
| WO2019157326A1 (en) | 2018-02-08 | 2019-08-15 | Zymergen Inc. | Genome editing using crispr in corynebacterium |
| EP3755792A4 (en) | 2018-02-23 | 2021-12-08 | Pioneer Hi-Bred International, Inc. | NEW CASE ORTHOLOGISTS9 |
| WO2019173125A1 (en) | 2018-03-09 | 2019-09-12 | Pioneer Hi-Bred International, Inc. | Compositions and methods for modification of fatty acids in soybean |
| AU2019236210B2 (en) | 2018-03-14 | 2025-07-03 | Arbor Biotechnologies, Inc. | Novel CRISPR DNA targeting enzymes and systems |
| PT3765616T (en) | 2018-03-14 | 2023-08-28 | Arbor Biotechnologies Inc | Novel crispr dna and rna targeting enzymes and systems |
| CN116536272A (en) | 2018-04-06 | 2023-08-04 | 儿童医疗中心有限公司 | Compositions and methods for reprogramming and adjusting imprinting of somatic cells |
| JP7576754B2 (en) | 2018-04-11 | 2024-11-01 | スペースクラフト セブン リミテッド ライアビリティ カンパニー | Compositions and methods for stem cell transplantation |
| SG11202010116PA (en) | 2018-04-13 | 2020-11-27 | Sangamo Therapeutics France | Chimeric antigen receptor specific for interleukin-23 receptor |
| EP3781585A4 (en) | 2018-04-17 | 2022-01-26 | The General Hospital Corporation | SENSITIVE IN VITRO ASSAYS FOR SUBSTRATE AND SITE PREFERENCES OF NUCLEIC ACID BINDERS, MODIFIERS AND CLEAVATORS |
| GB2587970B (en) | 2018-04-19 | 2023-02-08 | Univ California | Compositions and methods for gene editing |
| EP3784351A1 (en) | 2018-04-27 | 2021-03-03 | Novartis AG | Car t cell therapies with enhanced efficacy |
| JP7568511B2 (en) | 2018-04-27 | 2024-10-16 | ジーンエディット インコーポレイテッド | Cationic polymers and their use for biomolecule delivery - Patents.com |
| EP3784254A1 (en) | 2018-04-27 | 2021-03-03 | Iovance Biotherapeutics, Inc. | Closed process for expansion and gene editing of tumor infiltrating lymphocytes and uses of same in immunotherapy |
| US12522812B2 (en) | 2018-05-16 | 2026-01-13 | Arbor Biotechnologies, Inc. | CRISPR-associated systems and components |
| AU2019274597B2 (en) | 2018-05-25 | 2025-11-13 | Pioneer Hi-Bred International, Inc. | Systems and methods for improved breeding by modulating recombination rates |
| CN108707628B (en) * | 2018-05-28 | 2021-11-23 | 上海海洋大学 | Preparation method of zebra fish notch2 gene mutant |
| US11866719B1 (en) | 2018-06-04 | 2024-01-09 | Inari Agriculture Technology, Inc. | Heterologous integration of regulatory elements to alter gene expression in wheat cells and wheat plants |
| US20220403001A1 (en) | 2018-06-12 | 2022-12-22 | Obsidian Therapeutics, Inc. | Pde5 derived regulatory constructs and methods of use in immunotherapy |
| AU2019284911B2 (en) | 2018-06-13 | 2026-04-09 | Novartis Ag | BCMA chimeric antigen receptors and uses thereof |
| CA3102264A1 (en) | 2018-06-19 | 2019-12-26 | Lunella Biotech, Inc. | "energetic" cancer stem cells (e-cscs): a new hyper-metabolic and proliferative tumor cell phenotype, driven by mitochondrial energy |
| EP3814302A4 (en) | 2018-06-27 | 2022-06-29 | Pivot Bio, Inc. | Agricultural compositions comprising remodeled nitrogen fixing microbes |
| EP3813511A4 (en) | 2018-06-27 | 2022-08-03 | Pivot Bio, Inc. | GUIDED MICROBIAL REMODELING, PLATFORM FOR THE RATIONAL IMPROVEMENT OF MICROBIAL SPECIES FOR AGRICULTURE |
| WO2020006458A1 (en) | 2018-06-29 | 2020-01-02 | Research Institute At Nationwide Children's Hospital | Recombinant adeno-associated virus products and methods for treating limb girdle muscular dystrophy 2a |
| US12391624B2 (en) | 2018-07-11 | 2025-08-19 | Pivot Bio, Inc. | Temporally and spatially targeted dynamic nitrogen delivery by remodeled microbes |
| JP2021530212A (en) | 2018-07-13 | 2021-11-11 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニアThe Regents Of The University Of California | Retrotransposon-based delivery medium and how to use it |
| WO2020018142A1 (en) | 2018-07-16 | 2020-01-23 | Arbor Biotechnologies, Inc. | Novel crispr dna targeting enzymes and systems |
| WO2020028729A1 (en) | 2018-08-01 | 2020-02-06 | Mammoth Biosciences, Inc. | Programmable nuclease compositions and methods of use thereof |
| US20210292389A1 (en) | 2018-08-10 | 2021-09-23 | Sangamo Therapeutics France | New car constructs comprising tnfr2 domains |
| EP3607819A1 (en) | 2018-08-10 | 2020-02-12 | Vilmorin et Cie | Resistance to xanthomonas campestris pv. campestris (xcc) in cauliflower |
| EP3821020A4 (en) | 2018-08-15 | 2022-05-04 | Zymergen Inc. | APPLICATIONS OF CRISPRI IN HIGH-THROUGHPUT METABOLIC ENGINEERING |
| EP3841205A4 (en) | 2018-08-22 | 2022-08-17 | The Regents of The University of California | VARIANT TYPE V CRISPR/CAS EFFECTOR POLYPEPTIDES AND METHODS OF USE THEREOF |
| EP3841204A4 (en) | 2018-08-23 | 2022-05-18 | Sangamo Therapeutics, Inc. | Engineered target specific base editors |
| KR102913044B1 (en) | 2018-08-30 | 2026-01-16 | 더 유니버시티 오브 노쓰 캐롤라이나 엣 채플 힐 | Feedback-enabled synthetic genes, target seed match cassettes, and uses thereof |
| US11459551B1 (en) | 2018-08-31 | 2022-10-04 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| US12545910B2 (en) | 2018-08-31 | 2026-02-10 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| US12534743B2 (en) | 2018-08-31 | 2026-01-27 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| CN109265562B (en) * | 2018-09-26 | 2021-03-30 | 北京市农林科学院 | Nicking enzyme and application thereof in genome base replacement |
| WO2020072250A1 (en) | 2018-10-01 | 2020-04-09 | North Carolina State University | Recombinant type i crispr-cas system and uses thereof for genome modification and alteration of expression |
| US10711267B2 (en) | 2018-10-01 | 2020-07-14 | North Carolina State University | Recombinant type I CRISPR-Cas system |
| WO2020072253A1 (en) | 2018-10-01 | 2020-04-09 | North Carolina State University | Recombinant type i crispr-cas system and uses thereof for screening for variant cells |
| US12264330B2 (en) | 2018-10-01 | 2025-04-01 | North Carolina State University | Recombinant type I CRISPR-Cas system and uses thereof for killing target cells |
| US11851663B2 (en) | 2018-10-14 | 2023-12-26 | Snipr Biome Aps | Single-vector type I vectors |
| WO2020081588A1 (en) | 2018-10-17 | 2020-04-23 | Dana-Farber Cancer Institute, Inc. | Swi/snf family chromatin remodeling complexes and uses thereof |
| WO2020086742A1 (en) | 2018-10-24 | 2020-04-30 | Obsidian Therapeutics, Inc. | Er tunable protein regulation |
| US12116458B2 (en) | 2018-10-24 | 2024-10-15 | Genedit Inc. | Cationic polymer with alkyl side chains and use for biomolecule delivery |
| US11407995B1 (en) | 2018-10-26 | 2022-08-09 | Inari Agriculture Technology, Inc. | RNA-guided nucleases and DNA binding proteins |
| SG11202104409YA (en) | 2018-10-31 | 2021-05-28 | Zymergen Inc | Multiplexed deterministic assembly of dna libraries |
| JP2022505671A (en) | 2018-10-31 | 2022-01-14 | パイオニア ハイ-ブレッド インターナショナル, インコーポレイテッド | Compositions and Methods for Ocrobactram-Mediated Gene Editing |
| US11434477B1 (en) | 2018-11-02 | 2022-09-06 | Inari Agriculture Technology, Inc. | RNA-guided nucleases and DNA binding proteins |
| CR20210295A (en) | 2018-11-05 | 2021-07-09 | Iovance Biotherapeutics Inc | Processes for production of tumor infiltrating lymphocytes and uses of the same in immunotherapy |
| TW202039831A (en) | 2018-11-05 | 2020-11-01 | 美商艾歐凡斯生物治療公司 | Treatment of nsclc patients refractory for anti-pd-1 antibody |
| CA3118493A1 (en) | 2018-11-05 | 2020-05-14 | Iovance Biotherapeutics, Inc. | Expansion of tils utilizing akt pathway inhibitors |
| TW202039829A (en) | 2018-11-05 | 2020-11-01 | 美商艾歐凡斯生物治療公司 | Selection of improved tumor reactive t-cells |
| EP3877517A4 (en) | 2018-11-09 | 2022-09-07 | Inari Agriculture, Inc. | RNA-GUIDED NUCLEASES AND DNA-BINDING PROTEINS |
| WO2020102659A1 (en) | 2018-11-15 | 2020-05-22 | The Broad Institute, Inc. | G-to-t base editors and uses thereof |
| JP7590968B2 (en) | 2018-12-05 | 2024-11-27 | アビオナ・セラピュ―ティクス・インコーポレイテッド | Recombinant adeno-associated virus vectors for gene delivery |
| US11166996B2 (en) | 2018-12-12 | 2021-11-09 | Flagship Pioneering Innovations V, Inc. | Anellovirus compositions and methods of use |
| CN113166744B (en) | 2018-12-14 | 2025-02-07 | 先锋国际良种公司 | Novel CRISPR-Cas system for genome editing |
| WO2020128618A2 (en) | 2018-12-18 | 2020-06-25 | Braskem S.A. | Co-production pathway for 3-hp and acetyl-coa derivatives from malonate semialdehyde |
| CN113396326A (en) | 2018-12-19 | 2021-09-14 | 核酸有限责任公司 | Apparatus and method for molecular diagnostics |
| WO2020131547A1 (en) | 2018-12-19 | 2020-06-25 | Iovance Biotherapeutics, Inc. | Methods of expanding tumor infiltrating lymphocytes using engineered cytokine receptor pairs and uses thereof |
| US20220017911A1 (en) | 2018-12-21 | 2022-01-20 | Pivot Bio, Inc. | Methods, compositions, and media for improving plant traits |
| EP3880807A2 (en) | 2018-12-28 | 2021-09-22 | Braskem S.A. | Modulation of carbon flux through the meg and c3 pathways for the improved production of monoethylene glycol and c3 compounds |
| WO2020141199A1 (en) | 2019-01-03 | 2020-07-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for enhancing cd8+ t cell-dependent immune responses in subjects suffering from cancer |
| EP3931313A2 (en) | 2019-01-04 | 2022-01-05 | Mammoth Biosciences, Inc. | Programmable nuclease improvements and compositions and methods for nucleic acid amplification and detection |
| US12421519B2 (en) | 2019-01-07 | 2025-09-23 | Pivot Bio, Inc. | Plant colonization assays using natural microbial barcodes |
| EP3911746A1 (en) | 2019-01-14 | 2021-11-24 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Methods and kits for generating and selecting a variant of a binding protein with increased binding affinity and/or specificity |
| WO2020160196A1 (en) | 2019-01-29 | 2020-08-06 | Foghorn Therapeutics Inc. | Compounds and uses thereof |
| WO2020160100A1 (en) | 2019-01-29 | 2020-08-06 | Foghorn Therapeutics Inc. | Compounds and uses thereof |
| EP3921417A4 (en) | 2019-02-04 | 2022-11-09 | The General Hospital Corporation | ADENINE DNA BASE EDITOR VARIANTS WITH REDUCED OFF-TARGET RNA EDITING |
| WO2020163528A1 (en) * | 2019-02-06 | 2020-08-13 | TearClear Corp. | Systems and methods for preservative removal from ophthalmic formulations comprising complexing agents |
| US12180487B2 (en) | 2019-02-06 | 2024-12-31 | Fred Hutchinson Cancer Center | Minicircle producing bacteria engineered to differentially methylate nucleic acid molecules therein |
| WO2020163856A1 (en) | 2019-02-10 | 2020-08-13 | The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone | Modified mitochondrion and methods of use thereof |
| CA3131390A1 (en) | 2019-02-26 | 2020-09-03 | Research Institute Of Nationwide Children's Hospital | Adeno-associated virus vector delivery of b-sarcoglycan and the treatment of muscular dystrophy |
| CN110177061B (en) * | 2019-03-01 | 2023-04-07 | 致讯科技(天津)有限公司 | Coordination method for signal interference in heterogeneous network |
| CN113748211A (en) | 2019-03-01 | 2021-12-03 | 布拉斯科公司 | Method for in vivo synthesis of 4-hydroxymethylfurfural and derivatives thereof |
| KR20210136050A (en) | 2019-03-01 | 2021-11-16 | 이오반스 바이오테라퓨틱스, 인크. | Expansion of tumor-infiltrating lymphocytes from liquid tumors and their therapeutic use |
| WO2020181193A1 (en) | 2019-03-06 | 2020-09-10 | The Broad Institute, Inc. | T:a to a:t base editing through adenosine methylation |
| WO2020181178A1 (en) | 2019-03-06 | 2020-09-10 | The Broad Institute, Inc. | T:a to a:t base editing through thymine alkylation |
| WO2020181195A1 (en) | 2019-03-06 | 2020-09-10 | The Broad Institute, Inc. | T:a to a:t base editing through adenine excision |
| WO2020181180A1 (en) | 2019-03-06 | 2020-09-10 | The Broad Institute, Inc. | A:t to c:g base editors and uses thereof |
| WO2020181202A1 (en) | 2019-03-06 | 2020-09-10 | The Broad Institute, Inc. | A:t to t:a base editing through adenine deamination and oxidation |
| EP4219700A1 (en) | 2019-03-07 | 2023-08-02 | The Regents of the University of California | Crispr-cas effector polypeptides and methods of use thereof |
| US11053515B2 (en) | 2019-03-08 | 2021-07-06 | Zymergen Inc. | Pooled genome editing in microbes |
| KR20210149251A (en) | 2019-03-08 | 2021-12-08 | 옵시디안 테라퓨틱스, 인크. | Human carbonic anhydrase 2 compositions and methods for tunable modulation |
| CA3129871A1 (en) | 2019-03-08 | 2020-09-17 | Zymergen Inc. | Iterative genome editing in microbes |
| US11845931B2 (en) | 2019-03-18 | 2023-12-19 | Regeneron Pharmaceuticals, Inc. | CRISPR/Cas screening platform to identify genetic modifiers of tau seeding or aggregation |
| CA3127814C (en) | 2019-03-18 | 2024-05-14 | Regeneron Pharmaceuticals, Inc. | Crispr/cas dropout screening platform to reveal genetic vulnerabilities associated with tau aggregation |
| WO2020190363A1 (en) | 2019-03-19 | 2020-09-24 | Massachusetts Institute Of Technology | Control of nitrogen fixation in rhizobia that associate with cereals |
| RU2710731C1 (en) * | 2019-04-02 | 2020-01-10 | Общество с ограниченной ответственностью "Зеленые линии" | YEAST GENOME EDITING SYSTEM DEBARYOMYCES HANSENII BASED ON CRISPR/Cas9 |
| JP7715636B2 (en) | 2019-04-04 | 2025-07-30 | ブラスケム エス.エー. | Metabolic engineering for simultaneous consumption of xylose and glucose to produce chemicals from second-generation sugars |
| WO2020208185A1 (en) * | 2019-04-12 | 2020-10-15 | Astrazeneca Ab | Compositions and methods for improved gene editing |
| WO2020219776A1 (en) | 2019-04-23 | 2020-10-29 | Genedit Inc. | Cationic polymer with alkyl side chains |
| EP3959320A1 (en) | 2019-04-24 | 2022-03-02 | Novartis AG | Compositions and methods for selective protein degradation |
| CN114364788A (en) | 2019-04-24 | 2022-04-15 | 皮沃特生物股份有限公司 | Gene targets for targeting nitrogen fixation to improve plant traits |
| CN114008221A (en) | 2019-04-25 | 2022-02-01 | 皮沃特生物股份有限公司 | High throughput method for isolating and characterizing pools of ammonium secreting mutants generated by chemical mutagenesis |
| US11162079B2 (en) | 2019-05-10 | 2021-11-02 | The Regents Of The University Of California | Blood type O Rh-hypo-immunogenic pluripotent cells |
| WO2020232029A1 (en) | 2019-05-13 | 2020-11-19 | Iovance Biotherapeutics, Inc. | Methods and compositions for selecting tumor infiltrating lymphocytes and uses of the same in immunotherapy |
| US12116583B2 (en) | 2019-05-14 | 2024-10-15 | Yield10 Bioscience, Inc. | Modified plants comprising a polynucleotide comprising a non-cognate promoter operably linked to a coding sequence that encodes a transcription factor |
| EP3973054A1 (en) | 2019-05-20 | 2022-03-30 | The Broad Institute Inc. | Aav delivery of nucleobase editors |
| JP2022533713A (en) | 2019-05-21 | 2022-07-25 | サンガモ セラピューティクス, インコーポレイテッド | Regulated transgene expression in regulatory T cells |
| JP7805789B2 (en) | 2019-05-28 | 2026-01-26 | ジーンエディット インコーポレイテッド | Polymers containing multiple functionalized side chains for biomolecule delivery |
| MX2021014528A (en) | 2019-05-29 | 2022-01-06 | Monsanto Technology Llc | Methods and compositions for generating dominant alleles using genome editing. |
| CA3142425A1 (en) * | 2019-06-01 | 2020-12-10 | Sivec Biotechnologies, Llc | A bacterial platform for delivery of gene-editing systems to eukaryotic cells |
| WO2020244759A1 (en) | 2019-06-05 | 2020-12-10 | Klemm & Sohn Gmbh & Co. Kg | New plants having a white foliage phenotype |
| KR20220024053A (en) | 2019-06-14 | 2022-03-03 | 리제너론 파마슈티칼스 인코포레이티드 | model of tauopathy |
| WO2020254850A1 (en) | 2019-06-21 | 2020-12-24 | Vilmorin & Cie | Improvement of quality and permanence of green color of peppers at maturity and over-maturity |
| AU2020308448B2 (en) | 2019-06-24 | 2026-04-30 | Promega Corporation | Modified polyamine polymers for delivery of biomolecules into cells |
| CN120665955A (en) | 2019-06-25 | 2025-09-19 | 伊纳瑞农业技术有限公司 | Improved homology dependent repair genome editing |
| JP7627255B2 (en) | 2019-07-08 | 2025-02-05 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | ANTIBODY COMPOSITIONS FOR DISRUPTION OF BIOFILM - Patent application |
| CN110387405A (en) * | 2019-07-17 | 2019-10-29 | 浙江善测禾骑士生物科技有限公司 | A kind of (RT) RAA-CRISPR system of quick detection nucleic acid |
| CN110452966A (en) * | 2019-07-17 | 2019-11-15 | 浙江善测禾骑士生物科技有限公司 | It is a kind of to utilize RAA-CRISPR protease system rapid detection method |
| WO2021009299A1 (en) | 2019-07-17 | 2021-01-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Bcl-xl:fkbp12 fusion proteins suitable for screening agents capable of slowing down the aging process |
| US11746354B2 (en) | 2019-07-19 | 2023-09-05 | Inari Agriculture Technology, Inc. | Homology dependent repair genome editing |
| WO2021019272A1 (en) | 2019-07-31 | 2021-02-04 | Vilmorin & Cie | Tolerance to tolcndv in cucumber |
| WO2021026294A1 (en) | 2019-08-06 | 2021-02-11 | Children's Medical Center Corporation | Methods and compositions for reconstituting microglia |
| WO2021028359A1 (en) | 2019-08-09 | 2021-02-18 | Sangamo Therapeutics France | Controlled expression of chimeric antigen receptors in t cells |
| WO2021030666A1 (en) | 2019-08-15 | 2021-02-18 | The Broad Institute, Inc. | Base editing by transglycosylation |
| US20220282284A1 (en) * | 2019-08-15 | 2022-09-08 | The Rockefeller University | Crispr genome editing with cell surface display to produce homozygously edited eukaryotic cells |
| EP4488287A3 (en) | 2019-08-21 | 2025-03-05 | Research Institute at Nationwide Children's Hospital | Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy |
| WO2021046451A1 (en) | 2019-09-06 | 2021-03-11 | Obsidian Therapeutics, Inc. | Compositions and methods for dhfr tunable protein regulation |
| CA3150454A1 (en) | 2019-09-09 | 2021-03-18 | Arbor Biotechnologies, Inc. | Novel crispr dna targeting enzymes and systems |
| CN110541001A (en) * | 2019-09-20 | 2019-12-06 | 福建上源生物科学技术有限公司 | Gene knock-out method combining precise large-fragment gene deletion with stop codon insertion |
| CN114391040A (en) | 2019-09-23 | 2022-04-22 | 欧米茄治疗公司 | Compositions and methods for modulating apolipoprotein B (APOB) gene expression |
| AU2020352552A1 (en) | 2019-09-23 | 2022-03-17 | Omega Therapeutics, Inc. | Compositions and methods for modulating hepatocyte nuclear factor 4-alpha (HNF4α) gene expression |
| JP2022550130A (en) | 2019-09-26 | 2022-11-30 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Minimal arrestin domain-containing protein 1 (ARRDC1) construct |
| EP3808766A1 (en) | 2019-10-15 | 2021-04-21 | Sangamo Therapeutics France | Chimeric antigen receptor specific for interleukin-23 receptor |
| WO2021081378A1 (en) | 2019-10-25 | 2021-04-29 | Iovance Biotherapeutics, Inc. | Gene editing of tumor infiltrating lymphocytes and uses of same in immunotherapy |
| WO2021094805A1 (en) | 2019-11-14 | 2021-05-20 | Vilmorin & Cie | Resistance to acidovorax valerianellae in corn salad |
| WO2021102084A1 (en) | 2019-11-22 | 2021-05-27 | President And Fellows Of Harvard College | Ionic liquids for drug delivery |
| US20230086199A1 (en) | 2019-11-26 | 2023-03-23 | The Broad Institute, Inc. | Systems and methods for evaluating cas9-independent off-target editing of nucleic acids |
| BR112022011372A2 (en) | 2019-12-10 | 2022-08-23 | Univ Indiana Trustees | REPLICATION PROTEIN A (RPA)-DNA INTERACTION INHIBITORS |
| WO2021118990A1 (en) | 2019-12-11 | 2021-06-17 | Iovance Biotherapeutics, Inc. | Processes for the production of tumor infiltrating lymphocytes (tils) and methods of using the same |
| EP4074821A4 (en) | 2019-12-13 | 2024-01-17 | Chugai Seiyaku Kabushiki Kaisha | SYSTEM FOR DETECTION OF EXTRACELLULAR PURINERGICAL RECEPTOR LIGAND AND NON-HUMAN ANIMAL TO WHICH THE LATTER WAS TRANSFERRED |
| EP4706689A2 (en) | 2019-12-19 | 2026-03-11 | Entrada Therapeutics, Inc. | Compositions for delivery of antisense compounds |
| CN116234906A (en) | 2020-01-13 | 2023-06-06 | 萨那生物技术股份有限公司 | Modification of blood group antigens |
| WO2021221690A1 (en) | 2020-05-01 | 2021-11-04 | Pivot Bio, Inc. | Modified bacterial strains for improved fixation of nitrogen |
| IL294715A (en) | 2020-01-23 | 2022-09-01 | Childrens Medical Ct Corp | Inducible t-cell differentiation from human pluripotent stem cells |
| WO2021151073A2 (en) | 2020-01-24 | 2021-07-29 | The General Hospital Corporation | Unconstrained genome targeting with near-pamless engineered crispr-cas9 variants |
| WO2021151085A2 (en) | 2020-01-24 | 2021-07-29 | The General Hospital Corporation | Crispr-cas enzymes with enhanced on-target activity |
| BR112022015004A2 (en) | 2020-01-29 | 2022-09-20 | Foghorn Therapeutics Inc | COMPOUND, PHARMACEUTICAL COMPOSITION, METHODS TO DECREASE THE ACTIVITY OF A BAF COMPLEX, INDUCE APOPTOSIS, REDUCE TUMOR GROWTH, SUPPRESS PROGRESSION AND METASTATIC COLONIZATION OF CANCER, AND REDUCE THE LEVEL AND/OR ACTIVITY OF BRG1 AND/OR BRM IN A CANCER AND METHODS OF TREATMENT AND INHIBITION OF BRM AND BRG1 |
| EP4100519A2 (en) | 2020-02-05 | 2022-12-14 | The Broad Institute, Inc. | Adenine base editors and uses thereof |
| US12116580B2 (en) | 2020-02-21 | 2024-10-15 | The Board Of Trustees Of The University Of Illinois | Genetic toolbox for metabolic engineering of non-conventional yeast |
| EP4118230A4 (en) | 2020-03-09 | 2024-04-24 | Nuclein, LLC | MOLECULAR DIAGNOSIS APPARATUS AND METHODS |
| WO2021183720A1 (en) | 2020-03-11 | 2021-09-16 | Omega Therapeutics, Inc. | Compositions and methods for modulating forkhead box p3 (foxp3) gene expression |
| AU2021237790A1 (en) | 2020-03-20 | 2022-10-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Chimeric antigen receptor specific for human CD45RC and uses thereof |
| US20230165909A1 (en) | 2020-04-21 | 2023-06-01 | Aspen Neuroscience, Inc. | Gene editing of lrrk2 in stem cells and method of use of cells differentiated therefrom |
| US20250263752A1 (en) | 2020-04-21 | 2025-08-21 | Aspen Neuroscience, Inc. | Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom |
| WO2021217082A1 (en) | 2020-04-23 | 2021-10-28 | Genedit Inc. | Polymer with cationic and hydrophobic side chains |
| CA3172322A1 (en) | 2020-05-01 | 2021-11-04 | Karsten TEMME | Modified bacterial strains for improved fixation of nitrogen |
| WO2021222643A1 (en) | 2020-05-01 | 2021-11-04 | Pivot Bio, Inc. | Stable liquid formulations for nitrogen-fixing microorganisms |
| AU2020445067A1 (en) | 2020-05-01 | 2022-12-01 | Pivot Bio, Inc. | Measurement of nitrogen fixation and incorporation |
| CA3176826A1 (en) | 2020-05-04 | 2021-11-11 | Iovance Biotherapeutics, Inc. | Processes for production of tumor infiltrating lymphocytes and uses of the same in immunotherapy |
| EP4146797A1 (en) | 2020-05-06 | 2023-03-15 | Orchard Therapeutics (Europe) Limited | Treatment for neurodegenerative diseases |
| EP4149245A2 (en) | 2020-05-13 | 2023-03-22 | Pivot Bio, Inc. | De-repression of nitrogen fixation in gram-positive microorganisms |
| US12383555B2 (en) | 2020-05-20 | 2025-08-12 | Foghorn Therapeutics Inc. | Methods of treating cancers |
| GB202007943D0 (en) | 2020-05-27 | 2020-07-08 | Snipr Biome Aps | Products & methods |
| WO2021245435A1 (en) | 2020-06-03 | 2021-12-09 | Vilmorin & Cie | Melon plants resistant to scab disease, aphids and powdery mildew |
| EP4161552A1 (en) | 2020-06-05 | 2023-04-12 | The Broad Institute, Inc. | Compositions and methods for treating neoplasia |
| BR112022024738A2 (en) | 2020-06-05 | 2023-03-07 | Vilmorin & Cie | PLANT, PLANT CELL, TISSUE CULTURE OF CELLS, PLANT PART, SEED, USE OF A PLANT, METHODS FOR DETECTING AND/OR SELECTING PLANTS, CONFERRING TOBRFV RESISTANCE, IMPROVING TOMATO YIELD AND REDUCING TOMATO PRODUCTION LOSS AND USES OF A MARKER |
| CN116096862A (en) | 2020-06-11 | 2023-05-09 | 诺华股份有限公司 | ZBTB32 inhibitors and uses thereof |
| WO2022008935A1 (en) | 2020-07-10 | 2022-01-13 | Horizon Discovery Limited | Method for producing genetically modified cells |
| US20230287458A1 (en) | 2020-07-14 | 2023-09-14 | Abeona Therapeutics Inc. | Recombinant adeno-associated viral vectors for multipartite gene delivery |
| EP4189071A1 (en) | 2020-08-03 | 2023-06-07 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Population of treg cells functionally committed to exert a regulatory activity and their use for adoptive therapy |
| CN116096378A (en) | 2020-08-10 | 2023-05-09 | 诺华股份有限公司 | Treatment of Retinal Degenerative Diseases |
| US20220056470A1 (en) | 2020-08-18 | 2022-02-24 | Pioneer Hi-Bred International, Inc. | Multiple disease resistance genes and genomic stacks thereof |
| WO2022040454A1 (en) | 2020-08-20 | 2022-02-24 | A2 Biotherapeutics, Inc. | Compositions and methods for treating mesothelin positive cancers |
| EP4097486A4 (en) | 2020-08-20 | 2023-09-06 | A2 Biotherapeutics, Inc. | COMPOSITIONS AND METHODS FOR TREATING CEACAM POSITIVE CANCER |
| EP4058474B1 (en) | 2020-08-20 | 2024-05-08 | A2 Biotherapeutics, Inc. | Compositions and methods for treating egfr positive cancers |
| KR102424351B1 (en) * | 2020-09-21 | 2022-08-05 | 한국과학기술원 | CRISPR/Cas9 system for suppressing of parvalbumin gene expression and use thereof |
| US11944063B2 (en) | 2020-09-30 | 2024-04-02 | Spring Meadow Nursery, Inc. | Hydrangea ‘SMNHPH’ |
| WO2022068912A1 (en) | 2020-09-30 | 2022-04-07 | Huigene Therapeutics Co., Ltd. | Engineered crispr/cas13 system and uses thereof |
| WO2022188039A1 (en) | 2021-03-09 | 2022-09-15 | Huigene Therapeutics Co., Ltd. | Engineered crispr/cas13 system and uses thereof |
| JP7830442B2 (en) | 2020-10-02 | 2026-03-16 | ビルモラン エ コンパニー | Melons with extended shelf life |
| EP4225330A1 (en) | 2020-10-06 | 2023-08-16 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
| WO2022076606A1 (en) | 2020-10-06 | 2022-04-14 | Iovance Biotherapeutics, Inc. | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
| EP4321015A3 (en) | 2020-10-16 | 2024-04-17 | Klemm & Sohn GmbH & Co. KG | Double-flowering dwarf calibrachoa |
| US11155884B1 (en) | 2020-10-16 | 2021-10-26 | Klemm & Sohn Gmbh & Co. Kg | Double-flowering dwarf Calibrachoa |
| WO2022093977A1 (en) | 2020-10-30 | 2022-05-05 | Fortiphyte, Inc. | Pathogen resistance in plants |
| MX2023005609A (en) | 2020-11-13 | 2023-05-29 | Novartis Ag | Combination therapies with chimeric antigen receptor (car)-expressing cells. |
| EP4255172A1 (en) | 2020-12-03 | 2023-10-11 | Vilmorin & Cie | Tomato plants resistant to tobrfv, tmv, tomv and tommv and corresponding resistance genes |
| US20240123067A1 (en) | 2020-12-17 | 2024-04-18 | Iovance Biotherapeutics, Inc. | Treatment of cancers with tumor infiltrating lymphocyte therapies |
| CA3202483A1 (en) | 2020-12-17 | 2022-06-23 | Maria Fardis | Treatment with tumor infiltrating lymphocyte therapies in combination with ctla-4 and pd-1 inhibitors |
| KR20230124682A (en) | 2020-12-23 | 2023-08-25 | 플래그쉽 파이어니어링 이노베이션스 브이, 인크. | In vitro assembly of anellovirus capsid encapsulating RNA |
| CA3207144A1 (en) | 2021-01-05 | 2022-07-14 | Horizon Discovery Limited | Method for producing genetically modified cells |
| WO2022150776A1 (en) * | 2021-01-11 | 2022-07-14 | Vedere Bio Ii, Inc. | OPTOGENETIC COMPOSITIONS COMPRISING A CBh PROMOTER SEQUENCE AND METHODS FOR USE |
| WO2022165260A1 (en) | 2021-01-29 | 2022-08-04 | Iovance Biotherapeutics, Inc. | Methods of making modified tumor infiltrating lymphocytes and their use in adoptive cell therapy |
| US12171813B2 (en) | 2021-02-05 | 2024-12-24 | Christiana Care Gene Editing Institute, Inc. | Methods of and compositions for reducing gene expression and/or activity |
| WO2022177979A1 (en) | 2021-02-16 | 2022-08-25 | A2 Biotherapeutics, Inc. | Compositions and methods for treating her2 positive cancers |
| CN115427561B (en) | 2021-03-09 | 2024-06-04 | 辉大(上海)生物科技有限公司 | Engineered CRISPR/Cas13 system and uses thereof |
| JP2024509268A (en) | 2021-03-09 | 2024-02-29 | フォグホーン セラピューティクス インコーポレイテッド | Crystal forms, compositions containing them, and methods of using them |
| JP2024510505A (en) | 2021-03-19 | 2024-03-07 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Methods for tumor-infiltrating lymphocyte (TIL) expansion and gene knockout in TILs associated with CD39/CD69 selection |
| WO2022204564A2 (en) | 2021-03-25 | 2022-09-29 | Iovance Biotherapeutics, Inc. | Methods and compositions for t-cell coculture potency assays and use with cell therapy products |
| US20250243244A1 (en) | 2021-03-31 | 2025-07-31 | Entrada Therapeutics, Inc. | Cyclic cell penetrating peptides |
| WO2022208489A1 (en) | 2021-04-02 | 2022-10-06 | Vilmorin & Cie | Semi-determinate or determinate growth habit trait in cucurbita |
| KR20240037185A (en) | 2021-04-19 | 2024-03-21 | 이오반스 바이오테라퓨틱스, 인크. | Chimeric costimulatory receptors, chemokine receptors, and their uses in cellular immunotherapy |
| CA3217862A1 (en) | 2021-05-05 | 2022-11-10 | Radius Pharmaceuticals, Inc. | Animal model having homologous recombination of mouse pth1 receptor |
| AU2022271873A1 (en) | 2021-05-10 | 2024-01-04 | Entrada Therapeutics, Inc. | Compositions and methods for intracellular therapeutics |
| EP4337261A2 (en) | 2021-05-10 | 2024-03-20 | Entrada Therapeutics, Inc. | Compositions and methods for modulating mrna splicing |
| WO2022240721A1 (en) | 2021-05-10 | 2022-11-17 | Entrada Therapeutics, Inc. | Compositions and methods for modulating interferon regulatory factor-5 (irf-5) activity |
| US20240352456A1 (en) | 2021-05-13 | 2024-10-24 | The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Compositions and methods for treating sickle cell diseases |
| JP2024519029A (en) | 2021-05-17 | 2024-05-08 | アイオバンス バイオセラピューティクス,インコーポレイテッド | PD-1 gene-edited tumor-infiltrating lymphocytes and their use in immunotherapy |
| WO2022261509A1 (en) | 2021-06-11 | 2022-12-15 | The Broad Institute, Inc. | Improved cytosine to guanine base editors |
| EP4352131A1 (en) | 2021-06-11 | 2024-04-17 | Genedit Inc. | Biodegradable polymer comprising side chains with polyamine and polyalkylene oxide groups |
| US20240271212A1 (en) * | 2021-06-14 | 2024-08-15 | The University Of Chicago | Characterization and treatment of asthma |
| GEAP202416440A (en) | 2021-06-23 | 2024-04-25 | Entrada Therapeutics Inc | Antisense compounds and methods for targeting cug repeats |
| AU2022301301A1 (en) | 2021-07-02 | 2023-12-14 | Pivot Bio, Inc. | Genetically-engineered bacterial strains for improved fixation of nitrogen |
| WO2023283359A2 (en) | 2021-07-07 | 2023-01-12 | Omega Therapeutics, Inc. | Compositions and methods for modulating secreted frizzled receptor protein 1 (sfrp1) gene expression |
| JP2024526898A (en) | 2021-07-22 | 2024-07-19 | アイオバンス バイオセラピューティクス,インコーポレイテッド | Methods for cryopreservation of solid tumor fragments |
| WO2023009716A1 (en) | 2021-07-28 | 2023-02-02 | Iovance Biotherapeutics, Inc. | Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with kras inhibitors |
| KR20250160365A (en) | 2021-07-30 | 2025-11-12 | 헬라이나, 인크. | Methods and compositions for protein synthesis and secretion |
| MX2024001624A (en) | 2021-08-06 | 2024-04-30 | Vilmorin & Cie | RESISTANCE TO <i>LEVEILLULA TAURICA</i> IN PEPPER. |
| EP4396357A1 (en) | 2021-09-02 | 2024-07-10 | SESVanderHave NV | Methods and compositions for ppo herbicide tolerance |
| EP4596697A3 (en) | 2021-09-28 | 2025-08-27 | Acrigen Biosciences | Compositions and methods for nucleic acid modifications |
| JP2024536223A (en) | 2021-09-30 | 2024-10-04 | ザ ボード オブ リージェンツ オブ ザ ユニバーシティー オブ テキサス システム | SLC13A5 GENE THERAPY VECTORS AND USES THEREOF |
| IL311885A (en) | 2021-10-08 | 2024-06-01 | Harvard College | Ionic liquids for drug delivery |
| IL311570A (en) | 2021-10-14 | 2024-05-01 | Arsenal Biosciences Inc | Immune cells having co-expressed shrnas and logic gate systems |
| US12285497B2 (en) | 2021-10-15 | 2025-04-29 | Research Institute At Nationwide Children's Hospital | Self-complementary adeno-associated virus vector and its use in treatment of muscular dystrophy |
| CA3235824A1 (en) | 2021-10-27 | 2023-05-04 | Frederick G. Vogt | Systems and methods for coordinating manufacturing of cells for patient-specific immunotherapy |
| WO2023077148A1 (en) | 2021-11-01 | 2023-05-04 | Tome Biosciences, Inc. | Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo |
| EP4426832A1 (en) | 2021-11-03 | 2024-09-11 | The J. David Gladstone Institutes, A Testamentary Trust Established under The Will of J. David Gladstone | Precise genome editing using retrons |
| WO2023081762A2 (en) * | 2021-11-03 | 2023-05-11 | The Regents Of The University Of California | Serine recombinases |
| US20250032618A1 (en) | 2021-11-10 | 2025-01-30 | Iovance Biotherapeutics, Inc. | Methods of expansion treatment utilizing cd8 tumor infiltrating lymphocytes |
| US20250011781A1 (en) * | 2021-11-22 | 2025-01-09 | The Texas A&M University System | Methods and compositions targeting nucleus accumbens-associated protein-1 for treatment of autoimmune disorders and cancers |
| EP4430199A2 (en) | 2021-11-24 | 2024-09-18 | Research Institute at Nationwide Children's Hospital | Chimeric hsv expressing hil21 to boost anti-tumor immune activity |
| WO2023102406A1 (en) | 2021-12-01 | 2023-06-08 | The Board Of Regents Of The Univesity Of Texas System | Vector genome design to express optimized cln7 transgene |
| WO2023102518A1 (en) | 2021-12-03 | 2023-06-08 | The Board Of Regents Of The University Of Texas System | Gnao1 gene therapy vectors and uses thereof |
| GB202118058D0 (en) | 2021-12-14 | 2022-01-26 | Univ Warwick | Methods to increase yields in crops |
| US20230279442A1 (en) | 2021-12-15 | 2023-09-07 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
| WO2023115041A1 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae attachment glycoproteins |
| US20250059239A1 (en) | 2021-12-17 | 2025-02-20 | Sana Biotechnology, Inc. | Modified paramyxoviridae fusion glycoproteins |
| WO2023122805A1 (en) | 2021-12-20 | 2023-06-29 | Vestaron Corporation | Sorbitol driven selection pressure method |
| EP4452335A1 (en) | 2021-12-22 | 2024-10-30 | Tome Biosciences, Inc. | Co-delivery of a gene editor construct and a donor template |
| KR20240133725A (en) | 2021-12-23 | 2024-09-04 | 유니버시티 오브 매사추세츠 | Treatment of Fragile X-related disorders |
| WO2023133595A2 (en) | 2022-01-10 | 2023-07-13 | Sana Biotechnology, Inc. | Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses |
| WO2023141602A2 (en) | 2022-01-21 | 2023-07-27 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
| WO2023147488A1 (en) | 2022-01-28 | 2023-08-03 | Iovance Biotherapeutics, Inc. | Cytokine associated tumor infiltrating lymphocytes compositions and methods |
| EP4469582A1 (en) | 2022-01-28 | 2024-12-04 | The Board Of Regents Of The University Of Texas System | Transgene cassette designed to express the human codon-optimized gene |
| EP4472646A1 (en) | 2022-02-01 | 2024-12-11 | Sana Biotechnology, Inc. | Cd3-targeted lentiviral vectors and uses thereof |
| WO2023150647A1 (en) | 2022-02-02 | 2023-08-10 | Sana Biotechnology, Inc. | Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses |
| EP4479143A1 (en) | 2022-02-18 | 2024-12-25 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Use of tcr-deficient car-tregs in combination with anti-tcr complex monoclonal antibodies for inducing durable tolerance |
| EP4504925A1 (en) | 2022-04-04 | 2025-02-12 | The Broad Institute, Inc. | Cas9 variants having non-canonical pam specificities and uses thereof |
| EP4256950A1 (en) | 2022-04-06 | 2023-10-11 | Vilmorin et Cie | Tolerance to cgmmv in cucumber |
| CA3247638A1 (en) | 2022-04-06 | 2023-10-12 | Maria Fardis | Treatment of nsclc patients with tumor infiltrating lymphocyte therapies |
| WO2023201369A1 (en) | 2022-04-15 | 2023-10-19 | Iovance Biotherapeutics, Inc. | Til expansion processes using specific cytokine combinations and/or akti treatment |
| WO2023205744A1 (en) | 2022-04-20 | 2023-10-26 | Tome Biosciences, Inc. | Programmable gene insertion compositions |
| CN120456933A (en) | 2022-04-28 | 2025-08-08 | 布罗德研究所股份有限公司 | AAV vectors encoding base editors and their uses |
| WO2023215831A1 (en) | 2022-05-04 | 2023-11-09 | Tome Biosciences, Inc. | Guide rna compositions for programmable gene insertion |
| EP4522203A1 (en) | 2022-05-09 | 2025-03-19 | Synteny Therapeutics, Inc. | Erythroparvovirus with a modified capsid for gene therapy |
| WO2023219933A1 (en) | 2022-05-09 | 2023-11-16 | Entrada Therapeutics, Inc. | Compositions and methods for delivery of nucleic acid therapeutics |
| WO2023220035A1 (en) | 2022-05-09 | 2023-11-16 | Synteny Therapeutics, Inc. | Erythroparvovirus compositions and methods for gene therapy |
| EP4522210A1 (en) | 2022-05-09 | 2025-03-19 | Synteny Therapeutics, Inc. | Erythroparvovirus with a modified genome for gene therapy |
| US20250281537A1 (en) | 2022-05-10 | 2025-09-11 | Iovance Biotherapeutics, Inc. | Treatment of cancer patients with tumor infiltrating lymphocyte therapies in combination with an il-15r agonist |
| WO2023225670A2 (en) | 2022-05-20 | 2023-11-23 | Tome Biosciences, Inc. | Ex vivo programmable gene insertion |
| EP4532768A2 (en) | 2022-05-25 | 2025-04-09 | Flagship Pioneering Innovations VII, LLC | Compositions and methods for modulating circulating factors |
| CN119563038A (en) | 2022-05-25 | 2025-03-04 | 旗舰创业创新七公司 | Compositions and methods for modulating immune responses |
| CA3254044A1 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulation of tumor suppressors and oncogenes |
| WO2023230570A2 (en) | 2022-05-25 | 2023-11-30 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for modulating genetic drivers |
| JP2025517967A (en) | 2022-05-25 | 2025-06-12 | フラッグシップ パイオニアリング イノベーションズ セブン,エルエルシー | Compositions and methods for modulating cytokines |
| WO2024005863A1 (en) | 2022-06-30 | 2024-01-04 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| EP4299733A1 (en) | 2022-06-30 | 2024-01-03 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| GB2621813A (en) | 2022-06-30 | 2024-02-28 | Univ Newcastle | Preventing disease recurrence in Mitochondrial replacement therapy |
| EP4299739A1 (en) | 2022-06-30 | 2024-01-03 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| WO2024005864A1 (en) | 2022-06-30 | 2024-01-04 | Inari Agriculture Technology, Inc. | Compositions, systems, and methods for genome editing |
| EP4548351A1 (en) | 2022-06-30 | 2025-05-07 | Pioneer Hi-Bred International, Inc. | Artificial intelligence-mediated methods and systems for genome editing |
| CN120344660A (en) | 2022-07-18 | 2025-07-18 | 雷纳嘉德医疗管理公司 | Gene editing components, systems and methods of use |
| WO2024020587A2 (en) | 2022-07-22 | 2024-01-25 | Tome Biosciences, Inc. | Pleiopluripotent stem cell programmable gene insertion |
| WO2024023578A1 (en) | 2022-07-28 | 2024-02-01 | Institut Pasteur | Hsc70-4 in host-induced and spray-induced gene silencing |
| WO2024026406A2 (en) | 2022-07-29 | 2024-02-01 | Vestaron Corporation | Next Generation ACTX Peptides |
| WO2024036190A2 (en) | 2022-08-09 | 2024-02-15 | Pioneer Hi-Bred International, Inc. | Guide polynucleotide multiplexing |
| EP4573191A1 (en) | 2022-08-16 | 2025-06-25 | The Broad Institute, Inc. | Evolved cytosine deaminases and methods of editing dna using same |
| US20260055426A1 (en) | 2022-08-19 | 2026-02-26 | Generation Bio Co. | CLEAVABLE CLOSED-ENDED DNA (ceDNA) AND METHODS OF USE THEREOF |
| US20260055146A1 (en) | 2022-08-24 | 2026-02-26 | Sana Biotechnology, Inc. | Delivery of heterologous proteins |
| WO2024044723A1 (en) | 2022-08-25 | 2024-02-29 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
| CA3265262A1 (en) | 2022-09-01 | 2024-03-07 | SESVanderHave NV | Methods and compositions for ppo herbicide tolerance |
| WO2024050544A2 (en) | 2022-09-01 | 2024-03-07 | J.R. Simplot Company | Enhanced targeted knock-in frequency in host genomes through crispr exonuclease processing |
| EP4583905A1 (en) | 2022-09-06 | 2025-07-16 | Institut National de la Santé et de la Recherche Médicale | Novel dual split car-t cells for the treatment of cd38-positive hematological malignancies |
| WO2024064838A1 (en) | 2022-09-21 | 2024-03-28 | Sana Biotechnology, Inc. | Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof |
| WO2024081820A1 (en) | 2022-10-13 | 2024-04-18 | Sana Biotechnology, Inc. | Viral particles targeting hematopoietic stem cells |
| WO2024098024A1 (en) | 2022-11-04 | 2024-05-10 | Iovance Biotherapeutics, Inc. | Expansion of tumor infiltrating lymphocytes from liquid tumors and therapeutic uses thereof |
| EP4612277A1 (en) | 2022-11-04 | 2025-09-10 | Iovance Biotherapeutics, Inc. | Methods for tumor infiltrating lymphocyte (til) expansion related to cd39/cd103 selection |
| WO2024102434A1 (en) | 2022-11-10 | 2024-05-16 | Senda Biosciences, Inc. | Rna compositions comprising lipid nanoparticles or lipid reconstructed natural messenger packs |
| KR20250122544A (en) | 2022-11-21 | 2025-08-13 | 이오반스 바이오테라퓨틱스, 인크. | A two-dimensional process for the expansion of tumor-infiltrating lymphocytes and therapies using the same |
| WO2024118836A1 (en) | 2022-11-30 | 2024-06-06 | Iovance Biotherapeutics, Inc. | Processes for production of tumor infiltrating lymphocytes with shortened rep step |
| WO2024119157A1 (en) | 2022-12-02 | 2024-06-06 | Sana Biotechnology, Inc. | Lipid particles with cofusogens and methods of producing and using the same |
| WO2024123786A1 (en) | 2022-12-06 | 2024-06-13 | Pioneer Hi-Bred International, Inc. | Methods and compositions for co-delivery of t-dnas expressing multiple guide polynucleotides into plants |
| WO2024138194A1 (en) | 2022-12-22 | 2024-06-27 | Tome Biosciences, Inc. | Platforms, compositions, and methods for in vivo programmable gene insertion |
| WO2024137259A1 (en) | 2022-12-23 | 2024-06-27 | Pivot Bio, Inc. | Combination of various nitrogen fixing bacteria with various biological products to achieve synergistic effects |
| WO2024141599A1 (en) | 2022-12-29 | 2024-07-04 | Vilmorin & Cie | Tomato plants resistant to resistance-breaking tswv strains and corresponding resistance genes |
| EP4652271A1 (en) | 2023-01-18 | 2025-11-26 | The Broad Institute, Inc. | Base editing-mediated readthrough of premature termination codons (bert) |
| EP4658061A1 (en) | 2023-02-01 | 2025-12-10 | United Beet Seeds | Beet yellows virus resistance |
| JP2026510998A (en) | 2023-03-20 | 2026-04-10 | パイオニア ハイ-ブレッド インターナショナル, インコーポレイテッド | Cas polypeptide with modified PAM recognition |
| US12383615B2 (en) | 2023-03-23 | 2025-08-12 | Carbon Biosciences, Inc. | Protoparvovirus compositions comprising a protoparvovirus variant VP1 capsid polypeptide and related methods |
| US12225874B2 (en) | 2023-03-27 | 2025-02-18 | Redsea Science And Technology Inc. | Tomato plant designated ‘X22-31’ |
| WO2024206687A1 (en) * | 2023-03-29 | 2024-10-03 | William Marsh Rice University | Methods and compostions for engineered mitochondrial biogenesis |
| WO2024211287A1 (en) | 2023-04-03 | 2024-10-10 | Seagen Inc. | Production cell lines with targeted integration sites |
| WO2024220560A1 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Engineered protein g fusogens and related lipid particles and methods thereof |
| WO2024220598A2 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Lentiviral vectors with two or more genomes |
| WO2024220719A1 (en) | 2023-04-18 | 2024-10-24 | Crystal Ronald G | Modified aav capsids for gene delivery |
| WO2024220574A1 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Universal protein g fusogens and adapter systems thereof and related lipid particles and uses |
| CN121443140A (en) | 2023-04-21 | 2026-01-30 | 非营利性组织佛兰芒综合大学生物技术研究所 | Allele combinations for crop yield enhancement |
| WO2024226499A1 (en) | 2023-04-24 | 2024-10-31 | The Broad Institute, Inc. | Compositions and methods for modifying fertility |
| WO2024223900A1 (en) | 2023-04-28 | 2024-10-31 | Vilmorin & Cie | Genetic determinants conferring improved tobrfv resistance |
| WO2024234006A1 (en) | 2023-05-11 | 2024-11-14 | Tome Biosciences, Inc. | Systems, compositions, and methods for targeting liver sinusodial endothelial cells (lsecs) |
| WO2024243438A2 (en) | 2023-05-23 | 2024-11-28 | Omega Therapeutics, Inc. | Compositions and methods for reducing cxcl9, cxcl10, and cxcl11 gene expression |
| AU2024274792A1 (en) | 2023-05-23 | 2025-10-23 | Sana Biotechnology, Inc. | Tandem fusogens and related lipid particles |
| EP4734755A1 (en) | 2023-06-28 | 2026-05-06 | Vilmorin & Cie | Pepper resistance to meloidogyne enterolobii |
| CN121548346A (en) | 2023-07-24 | 2026-02-17 | 维尔莫林公司 | Melon resistance to CYSDV |
| WO2025030048A2 (en) | 2023-08-03 | 2025-02-06 | J.R. Simplot Company | Fusarium wilt resistance genes |
| US20250059551A1 (en) | 2023-08-14 | 2025-02-20 | The Texas A&M University System | Corn endotype-derived polypeptides capable of metabolizing fumonisin |
| WO2025050069A1 (en) | 2023-09-01 | 2025-03-06 | Tome Biosciences, Inc. | Programmable gene insertion using engineered integration enzymes |
| WO2025049959A2 (en) | 2023-09-01 | 2025-03-06 | Renagade Therapeutics Management Inc. | Gene editing systems, compositions, and methods for treatment of vexas syndrome |
| WO2025054202A1 (en) | 2023-09-05 | 2025-03-13 | Sana Biotechnology, Inc. | Method of screening a sample comprising a transgene with a unique barcode |
| WO2025054540A1 (en) | 2023-09-08 | 2025-03-13 | Iovance Biotherapeutics, Inc. | Methods of gene-editing using programmable nucleases |
| WO2025064408A1 (en) | 2023-09-18 | 2025-03-27 | The Broad Institute, Inc. | Compositions and methods for treating cardiovascular disease |
| GB202314578D0 (en) | 2023-09-22 | 2023-11-08 | Univ Manchester | Methods of producing homoplasmic modified plants or parts thereof |
| EP4554371A4 (en) | 2023-10-03 | 2026-04-22 | Inari Agriculture Tech Inc | VIRAL RELEASE OF GRNA TO THE SCINE |
| AU2024357861A1 (en) | 2023-10-12 | 2026-04-23 | Renagade Therapeutics Management Inc. | Nickase-retron template-based precision editing system and methods of use |
| WO2025101484A1 (en) | 2023-11-06 | 2025-05-15 | Iovance Biotherapeutics, Inc. | Treatment of endometrial cancers with tumor infiltrating lymphocyte therapies |
| TW202523695A (en) | 2023-11-22 | 2025-06-16 | 美商旗艦先鋒創新有限責任(Vii)公司 | Methods and compositions for treating non-alcoholic fatty liver disease |
| WO2025151838A1 (en) | 2024-01-12 | 2025-07-17 | Sana Biotechnology, Inc. | Safety switches to control in vitro and in vivo proliferation of cell therapy products |
| WO2025155753A2 (en) | 2024-01-17 | 2025-07-24 | Renagade Therapeutics Management Inc. | Improved gene editing system, guides, and methods |
| WO2025155521A1 (en) | 2024-01-18 | 2025-07-24 | Pivot Bio, Inc. | Host cells for enhanced plant growth |
| WO2025155518A1 (en) | 2024-01-18 | 2025-07-24 | Pivot Bio, Inc. | Host cells for enhanced plant growth |
| WO2025168705A1 (en) | 2024-02-08 | 2025-08-14 | Vib Vzw | Means and methods for the production of saponins with endosomal escape-enhancing properties |
| WO2025174765A1 (en) | 2024-02-12 | 2025-08-21 | Renagade Therapeutics Management Inc. | Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents |
| WO2025184529A1 (en) | 2024-03-01 | 2025-09-04 | Sana Biotechnology, Inc. | Viral particles with fusogen display and related compositions and methods |
| WO2025184759A1 (en) | 2024-03-04 | 2025-09-12 | Pioneer Hi-Bred International, Inc. | Maize plants comprising resistance to gray leaf spot and compositions and methods for selecting and producing the same |
| WO2025186284A1 (en) | 2024-03-05 | 2025-09-12 | Vilmorin & Cie | Increased yield in cucumber |
| WO2025194019A1 (en) | 2024-03-14 | 2025-09-18 | Flagship Pioneering Innovations Vii, Llc | Methods for treating liver fibrosis and non-alcoholic fatty liver disease |
| WO2025202473A1 (en) | 2024-03-28 | 2025-10-02 | Revvity Discovery Limited | A nucleic acid deaminase, a base editor and uses thereof |
| EP4677108A1 (en) | 2024-04-22 | 2026-01-14 | Basecamp Research Ltd | Method and compositions for detecting off-target editing |
| WO2025224182A2 (en) | 2024-04-23 | 2025-10-30 | Basecamp Research Ltd | Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo |
| WO2025232898A1 (en) | 2024-05-10 | 2025-11-13 | Yoltech Therapeutics Co., Ltd | Lipid compounds and lipid nanoparticle compositions |
| WO2025240947A1 (en) | 2024-05-17 | 2025-11-20 | University Of Massachusetts | Therapeutic treatment for fragile x-associated disorder |
| WO2025245188A2 (en) | 2024-05-21 | 2025-11-27 | Flagship Pioneering Innovations Vii, Llc | Methods of treating liver steatosis and non-alcoholic fatty liver disease |
| WO2025259554A1 (en) | 2024-06-13 | 2025-12-18 | J.R. Simplot Company | Engineering remontant flowering in rosaceae |
| WO2026015523A1 (en) | 2024-07-09 | 2026-01-15 | Pioneer Hi-Bred International, Inc. | Methods and systems for use in plant breeding |
| WO2026017833A1 (en) | 2024-07-17 | 2026-01-22 | Vilmorin & Cie | Tswv-resistant pepper |
| WO2026036000A1 (en) | 2024-08-08 | 2026-02-12 | Invaio Sciences, Inc. | Nature-derived lipid particles for use in agriculture |
| WO2026072421A2 (en) | 2024-09-27 | 2026-04-02 | The Broad Institute, Inc. | Base editing methods and compositions for editing prnp in the treatment of prion disease |
| WO2026096383A1 (en) | 2024-10-28 | 2026-05-07 | The Broad Institute, Inc. | Compositions and methods for inducing phagocytosis |
| CN119601083A (en) * | 2024-11-16 | 2025-03-11 | 大连易康生物科技有限公司 | A gene sequencing data processing method and system |
| CN119874861B (en) * | 2025-01-10 | 2025-11-25 | 中国科学院遗传与发育生物学研究所 | Application of the SlABCG45 gene in improving broomrape resistance and yield in tomatoes |
Citations (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4186183A (en) | 1978-03-29 | 1980-01-29 | The United States Of America As Represented By The Secretary Of The Army | Liposome carriers in chemotherapy of leishmaniasis |
| US4217344A (en) | 1976-06-23 | 1980-08-12 | L'oreal | Compositions containing aqueous dispersions of lipid spheres |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4261975A (en) | 1979-09-19 | 1981-04-14 | Merck & Co., Inc. | Viral liposome particle |
| US4485054A (en) | 1982-10-04 | 1984-11-27 | Lipoderm Pharmaceuticals Limited | Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV) |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| EP0264166A1 (en) | 1986-04-09 | 1988-04-20 | Genzyme Corporation | Transgenic animals secreting desired proteins into milk |
| US4774085A (en) | 1985-07-09 | 1988-09-27 | 501 Board of Regents, Univ. of Texas | Pharmaceutical administration systems containing a mixture of immunomodulators |
| US4797368A (en) | 1985-03-15 | 1989-01-10 | The United States Of America As Represented By The Department Of Health And Human Services | Adeno-associated virus as eukaryotic expression vector |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US4873316A (en) | 1987-06-23 | 1989-10-10 | Biogen, Inc. | Isolation of exogenous recombinant proteins from the milk of transgenic mammals |
| US4897355A (en) | 1985-01-07 | 1990-01-30 | Syntex (U.S.A.) Inc. | N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US4946787A (en) | 1985-01-07 | 1990-08-07 | Syntex (U.S.A.) Inc. | N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US5049386A (en) | 1985-01-07 | 1991-09-17 | Syntex (U.S.A.) Inc. | N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| WO1991016024A1 (en) | 1990-04-19 | 1991-10-31 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| WO1991017424A1 (en) | 1990-05-03 | 1991-11-14 | Vical, Inc. | Intracellular delivery of biologically active substances by means of self-assembling lipid complexes |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| WO1993024641A2 (en) | 1992-06-02 | 1993-12-09 | The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Adeno-associated virus with inverted terminal repeat sequences as promoter |
| US20030087817A1 (en) | 1999-01-12 | 2003-05-08 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US6603061B1 (en) | 1999-07-29 | 2003-08-05 | Monsanto Company | Agrobacterium-mediated plant transformation method |
| US20090100536A1 (en) | 2001-12-04 | 2009-04-16 | Monsanto Company | Transgenic plants with enhanced agronomic traits |
| US7868149B2 (en) | 1999-07-20 | 2011-01-11 | Monsanto Technology Llc | Plant genome sequence and uses thereof |
| US20110059502A1 (en) | 2009-09-07 | 2011-03-10 | Chalasani Sreekanth H | Multiple domain proteins |
| US9405700B2 (en) | 2010-11-04 | 2016-08-02 | Sonics, Inc. | Methods and apparatus for virtualization in an integrated circuit |
Family Cites Families (59)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US44790A (en) | 1864-10-25 | Improvement in force-pumps | ||
| US2011A (en) | 1841-03-18 | Appabatxts for piling saws | ||
| US2011008A (en) | 1929-04-15 | 1935-08-13 | Rca Corp | Electric discharge tube |
| US7150982B2 (en) | 1991-09-09 | 2006-12-19 | Third Wave Technologies, Inc. | RNA detection assays |
| AU2003224897A1 (en) | 2002-04-09 | 2003-10-27 | Kenneth L. Beattie | Oligonucleotide probes for genosensor chips |
| WO2005070948A1 (en) | 2004-01-23 | 2005-08-04 | Intronn, Inc. | Correction of alpha-1-antitrypsin genetic defects using spliceosome mediated rna trans splicing |
| US20050220796A1 (en) | 2004-03-31 | 2005-10-06 | Dynan William S | Compositions and methods for modulating DNA repair |
| CA2606002A1 (en) | 2005-04-28 | 2006-11-02 | Benitec Limited | Multiple-rnai expression cassettes for simultaneous delivery of rnai agents related to heterozygotic expression patterns |
| US7892224B2 (en) | 2005-06-01 | 2011-02-22 | Brainlab Ag | Inverse catheter planning |
| WO2007014275A2 (en) | 2005-07-26 | 2007-02-01 | Sangamo Biosciences, Inc. | Targeted integration and expression of exogenous nucleic acid sequences |
| US9677123B2 (en) | 2006-03-15 | 2017-06-13 | Siemens Healthcare Diagnostics Inc. | Degenerate nucleobase analogs |
| WO2008093152A1 (en) * | 2007-02-01 | 2008-08-07 | Cellectis | Obligate heterodimer meganucleases and uses thereof |
| PT2126130E (en) | 2007-03-02 | 2015-08-03 | Dupont Nutrition Biosci Aps | Cultures with improved phage resistance |
| WO2009041832A2 (en) * | 2007-09-25 | 2009-04-02 | Pastoral Greenhouse Gas Research Ltd | Vaccines and vaccine components for inhibition of microbial cells |
| WO2010011961A2 (en) | 2008-07-25 | 2010-01-28 | University Of Georgia Research Foundation, Inc. | Prokaryotic rnai-like system and methods of use |
| US20100076057A1 (en) * | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| US9404098B2 (en) | 2008-11-06 | 2016-08-02 | University Of Georgia Research Foundation, Inc. | Method for cleaving a target RNA using a Cas6 polypeptide |
| US20110016540A1 (en) | 2008-12-04 | 2011-01-20 | Sigma-Aldrich Co. | Genome editing of genes associated with trinucleotide repeat expansion disorders in animals |
| AU2009322964B2 (en) | 2008-12-04 | 2014-10-09 | Sangamo Therapeutics, Inc. | Genome editing in rats using zinc-finger nucleases |
| WO2010075424A2 (en) * | 2008-12-22 | 2010-07-01 | The Regents Of University Of California | Compositions and methods for downregulating prokaryotic genes |
| US20110239315A1 (en) | 2009-01-12 | 2011-09-29 | Ulla Bonas | Modular dna-binding domains and methods of use |
| DE112010004582T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Optimized endonucleases and applications thereof |
| US10087431B2 (en) | 2010-03-10 | 2018-10-02 | The Regents Of The University Of California | Methods of generating nucleic acid fragments |
| EA024121B9 (en) | 2010-05-10 | 2017-01-30 | Дзе Реджентс Ов Дзе Юниверсити Ов Калифорния | COMPOSITIONS OF ENDORIBONUCLEAS AND METHODS OF THEIR USE |
| EP3156062A1 (en) | 2010-05-17 | 2017-04-19 | Sangamo BioSciences, Inc. | Novel dna-binding proteins and uses thereof |
| WO2012014988A1 (en) | 2010-07-29 | 2012-02-02 | タカラバイオ株式会社 | Method for manufacturing a probe containing rna for detecting a target base |
| US9081737B2 (en) | 2010-08-02 | 2015-07-14 | Integrated Dna Technologies, Inc. | Methods for predicting stability and melting temperatures of nucleic acid duplexes |
| WO2012149470A1 (en) * | 2011-04-27 | 2012-11-01 | Amyris, Inc. | Methods for genomic modification |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| US8555733B2 (en) | 2011-09-23 | 2013-10-15 | Airgas, Inc. | System and method for analyzing a refrigerant sample |
| EP2591770B1 (en) | 2011-11-14 | 2016-03-16 | Silenseed Ltd | Compositions for siRNA delivery and methods of manufacturing and using same |
| US8450107B1 (en) | 2011-11-30 | 2013-05-28 | The Broad Institute Inc. | Nucleotide-specific recognition sequences for designer TAL effectors |
| GB201122458D0 (en) | 2011-12-30 | 2012-02-08 | Univ Wageningen | Modified cascade ribonucleoproteins and uses thereof |
| NZ629427A (en) | 2012-02-29 | 2016-04-29 | Sangamo Biosciences Inc | Methods and compositions for treating huntington’s disease |
| US9637739B2 (en) * | 2012-03-20 | 2017-05-02 | Vilnius University | RNA-directed DNA cleavage by the Cas9-crRNA complex |
| WO2013141680A1 (en) * | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| LT3401400T (en) * | 2012-05-25 | 2019-06-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| PL4397760T3 (en) | 2012-10-23 | 2026-03-30 | Toolgen Incorporated | A COMPOSITION FOR CLEFULNING A TARGET DNA COMPRISING A GUIDE RNA SPECIFIC FOR A TARGET DNA AND A NUCLEIC ACID ENCODING A CAS PROTEIN OR A CAS PROTEIN, AND USE THEREOF |
| EP3135765A1 (en) | 2012-12-06 | 2017-03-01 | Sigma-Aldrich Co. LLC | Crispr-based genome modification and regulation |
| WO2014093479A1 (en) | 2012-12-11 | 2014-06-19 | Montana State University | Crispr (clustered regularly interspaced short palindromic repeats) rna-guided control of gene regulation |
| CN114634950A (en) | 2012-12-12 | 2022-06-17 | 布罗德研究所有限公司 | CRISPR-CAS component systems, methods, and compositions for sequence manipulation |
| EP3434776A1 (en) | 2012-12-12 | 2019-01-30 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| EP2931898B1 (en) | 2012-12-12 | 2016-03-09 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| JP2016504026A (en) | 2012-12-12 | 2016-02-12 | ザ・ブロード・インスティテュート・インコーポレイテッド | Engineering systems, methods and optimization guide compositions for sequence manipulation |
| WO2014093701A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| US20140310830A1 (en) | 2012-12-12 | 2014-10-16 | Feng Zhang | CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| IL239317B (en) | 2012-12-12 | 2022-07-01 | Broad Inst Inc | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| ES2576126T3 (en) | 2012-12-12 | 2016-07-05 | The Broad Institute, Inc. | Modification by genetic technology and optimization of improved enzyme systems, methods and compositions for sequence manipulation |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| EP2896697B1 (en) | 2012-12-12 | 2015-09-02 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| SG10201912991WA (en) | 2012-12-17 | 2020-03-30 | Harvard College | Rna-guided human genome engineering |
| US11135273B2 (en) * | 2013-02-07 | 2021-10-05 | The Rockefeller University | Sequence specific antimicrobials |
| US10660943B2 (en) * | 2013-02-07 | 2020-05-26 | The Rockefeller University | Sequence specific antimicrobials |
| JP2016522679A (en) * | 2013-04-04 | 2016-08-04 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Therapeutic use of genome editing with the CRISPR / Cas system |
| JP6665088B2 (en) | 2013-06-17 | 2020-03-13 | ザ・ブロード・インスティテュート・インコーポレイテッド | Optimized CRISPR-Cas double nickase system, method and composition for sequence manipulation |
| WO2014204724A1 (en) | 2013-06-17 | 2014-12-24 | The Broad Institute Inc. | Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation |
| CN105793425B (en) | 2013-06-17 | 2021-10-26 | 布罗德研究所有限公司 | Delivery, use and therapeutic applications of CRISPR-CAS systems and compositions for targeting disorders and diseases using viral components |
| BR112016013213A2 (en) | 2013-12-12 | 2017-12-05 | Massachusetts Inst Technology | administration, use and therapeutic applications of crisper systems and compositions for targeting disorders and diseases using particle delivery components |
| EP3215623A4 (en) * | 2014-11-06 | 2018-09-26 | President and Fellows of Harvard College | Cells lacking b2m surface expression and methods for allogeneic administration of such cells |
-
2013
- 2013-12-12 CN CN202111233527.5A patent/CN114634950A/en active Pending
- 2013-12-12 BR BR112015013786-5A patent/BR112015013786B1/en active IP Right Grant
- 2013-12-12 EP EP13812430.0A patent/EP2825654B1/en not_active Revoked
- 2013-12-12 EP EP23192949.8A patent/EP4286403A3/en active Pending
- 2013-12-12 EP EP23161559.2A patent/EP4234696A3/en active Pending
- 2013-12-12 CA CA2894668A patent/CA2894668A1/en active Pending
- 2013-12-12 BR BR122021008308-8A patent/BR122021008308B1/en active IP Right Grant
- 2013-12-12 EP EP25158803.4A patent/EP4570817A3/en active Pending
- 2013-12-12 KR KR1020157018662A patent/KR102955556B1/en active Active
- 2013-12-12 EP EP17162030.5A patent/EP3252160B1/en active Active
- 2013-12-12 US US14/105,035 patent/US20140189896A1/en not_active Abandoned
- 2013-12-12 AU AU2013359262A patent/AU2013359262C1/en active Active
- 2013-12-12 EP EP14188820.6A patent/EP2840140B2/en active Active
- 2013-12-12 EP EP20198492.9A patent/EP3825401A1/en active Pending
- 2013-12-12 CN CN201380072868.6A patent/CN105658796B/en active Active
- 2013-12-12 DK DK17162030.5T patent/DK3252160T3/en active
- 2013-12-12 EP EP23192260.0A patent/EP4286402A3/en active Pending
- 2013-12-12 CN CN201910829026.XA patent/CN110982844B/en active Active
- 2013-12-12 EP EP23192951.4A patent/EP4286404A3/en active Pending
- 2013-12-12 KR KR1020267010790A patent/KR20260055511A/en active Pending
- 2013-12-12 WO PCT/US2013/074611 patent/WO2014093595A1/en not_active Ceased
- 2013-12-12 JP JP2015547530A patent/JP2016505256A/en active Pending
-
2014
- 2014-02-18 US US14/183,486 patent/US8795965B2/en active Active
- 2014-04-23 US US14/259,420 patent/US8871445B2/en active Active
- 2014-09-26 US US14/497,627 patent/US20150031134A1/en not_active Abandoned
- 2014-10-24 US US14/523,799 patent/US9840713B2/en active Active
-
2016
- 2016-01-07 US US14/990,444 patent/US9822372B2/en active Active
- 2016-01-08 US US14/991,083 patent/US20160115489A1/en not_active Abandoned
- 2016-08-05 US US15/230,161 patent/US20180327756A1/en active Pending
-
2017
- 2017-12-11 US US15/838,064 patent/US20180305704A1/en not_active Abandoned
-
2018
- 2018-02-02 US US15/887,377 patent/US20180179547A1/en not_active Abandoned
- 2018-04-30 US US15/967,495 patent/US20190017058A1/en active Pending
- 2018-04-30 US US15/967,510 patent/US20190040399A1/en not_active Abandoned
- 2018-11-01 US US16/178,551 patent/US20190292550A1/en not_active Abandoned
-
2019
- 2019-04-22 JP JP2019080952A patent/JP6896786B2/en active Active
- 2019-06-18 US US16/445,156 patent/US20200032278A1/en not_active Abandoned
- 2019-06-18 US US16/445,150 patent/US20200032277A1/en not_active Abandoned
- 2019-08-05 US US16/532,442 patent/US20200063147A1/en active Pending
- 2019-08-07 US US16/535,043 patent/US20200080094A1/en active Pending
- 2019-12-16 AU AU2019280394A patent/AU2019280394B2/en active Active
-
2020
- 2020-06-19 US US16/906,580 patent/US20200318123A1/en active Pending
- 2020-09-28 US US17/034,754 patent/US20210079407A1/en active Pending
-
2021
- 2021-06-09 JP JP2021096264A patent/JP7269990B2/en active Active
- 2021-10-18 US US17/503,928 patent/US20220135985A1/en active Pending
-
2022
- 2022-06-01 AU AU2022203763A patent/AU2022203763B2/en active Active
-
2023
- 2023-02-14 US US18/109,550 patent/US20240182913A1/en active Pending
- 2023-03-29 US US18/128,122 patent/US20230340505A1/en active Pending
- 2023-04-13 US US18/134,317 patent/US20230374527A1/en active Pending
- 2023-04-24 JP JP2023070572A patent/JP7542681B2/en active Active
- 2023-08-23 US US18/454,343 patent/US20240117365A1/en active Pending
-
2024
- 2024-08-20 JP JP2024138377A patent/JP7847620B2/en active Active
-
2025
- 2025-01-17 US US19/028,841 patent/US20250250578A1/en active Pending
- 2025-01-17 US US19/028,666 patent/US20250304977A1/en active Pending
- 2025-05-22 AU AU2025203777A patent/AU2025203777A1/en active Pending
- 2025-09-29 US US19/342,889 patent/US20260022392A1/en active Pending
Patent Citations (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4217344A (en) | 1976-06-23 | 1980-08-12 | L'oreal | Compositions containing aqueous dispersions of lipid spheres |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4186183A (en) | 1978-03-29 | 1980-01-29 | The United States Of America As Represented By The Secretary Of The Army | Liposome carriers in chemotherapy of leishmaniasis |
| US4261975A (en) | 1979-09-19 | 1981-04-14 | Merck & Co., Inc. | Viral liposome particle |
| US4485054A (en) | 1982-10-04 | 1984-11-27 | Lipoderm Pharmaceuticals Limited | Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV) |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4897355A (en) | 1985-01-07 | 1990-01-30 | Syntex (U.S.A.) Inc. | N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US5049386A (en) | 1985-01-07 | 1991-09-17 | Syntex (U.S.A.) Inc. | N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US4946787A (en) | 1985-01-07 | 1990-08-07 | Syntex (U.S.A.) Inc. | N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US4797368A (en) | 1985-03-15 | 1989-01-10 | The United States Of America As Represented By The Department Of Health And Human Services | Adeno-associated virus as eukaryotic expression vector |
| US4774085A (en) | 1985-07-09 | 1988-09-27 | 501 Board of Regents, Univ. of Texas | Pharmaceutical administration systems containing a mixture of immunomodulators |
| EP0264166A1 (en) | 1986-04-09 | 1988-04-20 | Genzyme Corporation | Transgenic animals secreting desired proteins into milk |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US4873316A (en) | 1987-06-23 | 1989-10-10 | Biogen, Inc. | Isolation of exogenous recombinant proteins from the milk of transgenic mammals |
| WO1991016024A1 (en) | 1990-04-19 | 1991-10-31 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| WO1991017424A1 (en) | 1990-05-03 | 1991-11-14 | Vical, Inc. | Intracellular delivery of biologically active substances by means of self-assembling lipid complexes |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| WO1993024641A2 (en) | 1992-06-02 | 1993-12-09 | The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Adeno-associated virus with inverted terminal repeat sequences as promoter |
| US20030087817A1 (en) | 1999-01-12 | 2003-05-08 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US7868149B2 (en) | 1999-07-20 | 2011-01-11 | Monsanto Technology Llc | Plant genome sequence and uses thereof |
| US6603061B1 (en) | 1999-07-29 | 2003-08-05 | Monsanto Company | Agrobacterium-mediated plant transformation method |
| US20090100536A1 (en) | 2001-12-04 | 2009-04-16 | Monsanto Company | Transgenic plants with enhanced agronomic traits |
| US20110059502A1 (en) | 2009-09-07 | 2011-03-10 | Chalasani Sreekanth H | Multiple domain proteins |
| US9405700B2 (en) | 2010-11-04 | 2016-08-02 | Sonics, Inc. | Methods and apparatus for virtualization in an integrated circuit |
Non-Patent Citations (142)
| Title |
|---|
| "METHODS IN ENZYMOLOGY", ACADEMIC PRESS, INC. |
| A.R. GRUBER ET AL., CELL, vol. 106, no. 1, 2008, pages 23 - 24 |
| ALMAD ET AL., CANCER RES, vol. 52, 1992, pages 4817 - 4820 |
| AMRANN ET AL., GENE, vol. 69, 1988, pages 301 - 315 |
| ANDERSON, SCIENCE, vol. 256, 1992, pages 808 - 813 |
| BAE, T.; SCHNEEWIND, O.: "Allelic replacement in Staphylococcus aureus with inducible counter-selection", PLASMID, vol. 55, 2006, pages 58 - 63, XP024939950, DOI: doi:10.1016/j.plasmid.2005.05.005 |
| BALDARI ET AL., EMBO J., vol. 6, 1987, pages 229 - 234 |
| BANEIJI ET AL., CELL, vol. 33, 1981, pages 729 - 740 |
| BARRANGOU, R.: "RNA-mediated programmable DNA cleavage", NAT. BIOTECHNOL., vol. 30, 2012, pages 836 - 838, XP055118675, DOI: doi:10.1038/nbt.2357 |
| BEHR ET AL., BIOCONJUGATE CHEM., vol. 5, 1994, pages 382 - 389 |
| BIKARD, D.; HATOUM-ASLAN, A.; MUCIDA, D; MARRAFFINI, LA: "CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection", CELL HOST MICROBE, vol. 12, 2012, pages 177 - 186, XP028934538, DOI: doi:10.1016/j.chom.2012.06.003 |
| BLAESE ET AL., CANCER GENE THEI, vol. 2, 1995, pages 291 - 297 |
| BLAKE WIEDENHEFT ET AL: "RNA-guided genetic silencing systems in bacteria and archaea", NATURE, vol. 482, no. 7385, 15 February 2012 (2012-02-15), pages 331 - 338, XP055116249, ISSN: 0028-0836, DOI: 10.1038/nature10886 * |
| BOGDANOVE, A.J.; VOYTAS, D.F.: "TAL effectors: customizable proteins for DNA targeting", SCIENCE, vol. 333, 2011, pages 1843 - 1846, XP055093385, DOI: doi:10.1126/science.1204094 |
| BOSHART, CELL, vol. 41, 1985, pages 521 - 530 |
| BROUNS, S.J. ET AL.: "Small CRISPR RNAs guide antiviral defense in prokaryotes", SCIENCE, vol. 321, 2008, pages 960 - 964, XP002559962, DOI: doi:10.1126/science.1159689 |
| BROUNS. S: "A Swiss army knife of immunity Science", J MOLECULAR BIOLOGY, vol. 337, 2012, pages 808 - 809, XP055113718, DOI: doi:10.1126/science.1227253 |
| BUCHSCHER ET AL., J VIROL, vol. 66, 1992, pages 2731 - 2739 |
| BYRNE; RUDDLE, PROC NATL ACAD SCI. USA, vol. 86, 1989, pages 5473 - 5477 |
| CALAME; FATON, ADV. IMMUNOL, vol. 43, 1988, pages 235 - 275 |
| CAMPES; TILGHMAN, GENES DEV, vol. 3, 1989, pages 537 - 546 |
| CARROLL. D.: "A CRISPR Approach to Gene Targeting", MOL. THER., vol. 20, 2012, pages 1658 - 1660, XP055106489, DOI: doi:10.1038/mt.2012.171 |
| CARTE, J; WANG, R; LI, H.; TERNS, R.M; TERNS. M.P.: "Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes", GENES DEV, vol. 22, 2008, pages 3489 - 3496, XP055054069, DOI: doi:10.1101/gad.1742908 |
| CONG, L. ET AL.: "Multiplex Genome Engineering Using CRISPR/Cas Systems", SCIENCE, 2013 |
| COSTANTINO, N; COURT, D.L.: "Enhanced levels of lambda Red-mediated recombinants in mismatch repan mutants", PROC NATL. ACAD. SCI U.S.A., vol. 100, 2003, pages 15748 - 15753 |
| CRYSTAL, SCIENCE, vol. 270, 1995, pages 404 - 410 |
| DELTCHEVA, E. ET AL.: "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III", MATURE, vol. 471, 2011, pages 602 - 607, XP055308803, DOI: doi:10.1038/nature09886 |
| DEVEAU, H ET AL.: "Phage response to CRISPR-encoded resistance in Streptococcus thermophilus", J BACTERIOL., vol. 190, 2008, pages 1390 - 1400, XP002679468, DOI: doi:10.1128/JB.01412-07 |
| DEVEAU, H.; GARNEAU, J.E.; MOINEAU, S.: "CRISPR/Cas system and its role in phage- bacteria interactions", ANNU. REV. MICROBIOL., vol. 64, 2010, pages 475 - 493, XP055067789, DOI: doi:10.1146/annurev.micro.112408.134123 |
| DILLON, TIBTECH, vol. 11, 1993, pages 167 - 175 |
| EDGAR, R.; QIMRON, U.: "The Escherichia coli CRISPR system protects from lambda lysogenization. lysogens, and prophage induction", J BACTERIOL, vol. 192, 2010, pages 6291 - 6294 |
| EDLUND, SCIENCE, vol. 230, 1985, pages 912 - 916 |
| ELIAS I TRABOULSI,: "Genetic Diseases of the Fye, Second Edition,", 2012, OXFORD UNIVERSITY PRESS |
| ELITZA DELTCHEVA ET AL: "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III", NATURE, vol. 471, no. 7340, 31 March 2011 (2011-03-31), pages 602 - 607, XP055068535, ISSN: 0028-0836, DOI: 10.1038/nature09886 * |
| F. M. AUSUBEL, ET AL: "CURRENT PROTOCOLS IN MOLECULAR BIOI OGY", 1987 |
| FISCHER, S ET AL.: "An archaeal immune system can detect multiple Protospacer Adjacent Motifs (PAMs) to target invader DNA", J. BIOL. CHEM., vol. 287, 2012, pages 33351 - 33363 |
| G. GASIUNAS ET AL: "PNAS Plus: Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 109, no. 39, 25 September 2012 (2012-09-25), pages E2579 - E2586, XP055068588, ISSN: 0027-8424, DOI: 10.1073/pnas.1208507109 * |
| GAJ THOMAS ET AL: "ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering", TRENDS IN BIOTECHNOLOGY, vol. 31, no. 7, 1 July 2013 (2013-07-01), pages 397 - 405, XP028571313, ISSN: 0167-7799, DOI: 10.1016/J.TIBTECH.2013.04.004 * |
| GAO ET AL., GENE THERAPY, vol. 2, 1995, pages 710 - 722 |
| GASIUNAS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 109, 2012, pages E2579 |
| GASIUNAS, G.; BARRANGOU, R; HORVATH, P.; SIKSNYS, V: "Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bactena", PROC NATL. ACAD. SCI U.S.A., 2012 |
| GIBSON, D.G.: "Enzymatic assembly of DNA molecules up to several hundred kilobases", NAT METHODS, vol. 6, 2009, pages 343 - 345, XP055224105, DOI: doi:10.1038/nmeth.1318 |
| GIULIANO AVANZINI, JEFFREY L. NOEBELS,: "Genetics of Epilepsy and Genetic Epilepsies", vol. 20, 2009, MARIANI FOUNDATION PAEDIATRIC NEUROLOGY |
| GOEDDEL: "GENE EXPRESSION TECHNOLOGY METHODS IN ENZYMOLOGY", vol. 185, 1990, ACADEMIC PRESS |
| GROENEN, MOL MICROBIOL., vol. 10, 1993, pages 1057 - 1065 |
| GRUBER ET AL., NUCLEIC ACIDS RESEARCH, vol. 36, 2008, pages W70 |
| GUDBERGSDOTTIR, S ET AL.: "Dynamic properties of the Sulfolobus CRISPR/Cas and CRISPR/Cmr systems when challenged with vector-borne viral and plasmid genes and protospacers", MOL. MICROBIOL., vol. 79, 2011, pages 35 - 49 |
| GUSCHIN ET AL., METHODS MOL BIOL, vol. 649, 2010, pages 247 |
| HADDADA ET AL.: "m Current Topics in Microbiology and Immunology", 1995 |
| HARLOW AND LANE EDS: "ANTIBODIES, A LABORATORY MANUAL,", 1988 |
| HATOUM-ASLAN, A; MANIV, I.; MARRAFTIM, L A: "Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site", PROC NATL. ACAD SCI U.S.A., vol. 108, 2011, pages 21218 - 21222, XP055250498, DOI: doi:10.1073/pnas.1112832108 |
| HAURWITZ, R E.; JINEK, M.; WIEDENHEFT, B.; ZHOU, K.; DOUDNA, J A: "Sequence- and structure-specific RNA processing by a CRISPR endonuclease", SCIENCE, vol. 329, 2010, pages 1355 - 1358, XP055244668, DOI: doi:10.1126/science.1192272 |
| HAVARSTEIN, L.S.: "Coomaraswamy, G. & Morrison, D.A. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae", PROC. NATL. ACAD. SCI. U.S.A., vol. 92, 1995, pages 11140 - 11144 |
| HERMONAT; MUZYCZKA, PNAS, vol. 81, 1984, pages 6466 - 6470 |
| HOE ET AL., EMEIG INFECT DIS., vol. 5, 1999, pages 254 - 263 |
| HORINOUCHI, S.; WEISBLUM, B.: "Nucleotide sequence and functional map ofpC194, a plasmid that specifies inducible chloramphenicol resistance", J. BACTERIOL., vol. 150, 1982, pages 815 - 825 |
| HORTON, R.M.: "Vitro Recombination and Mutagenesis of DNA : SOEing Together Tailor-Made Genes", METHODS MOL. BIOL., vol. 15, 1993, pages 251 - 261 |
| HORVATH, P.; BARRANGOU, R.: "CRISPR/Cas, the immune system of bacteria and archaea", SCIENCE, vol. 327, 2010, pages 167 - 170, XP055016971, DOI: doi:10.1126/science.1179555 |
| HOSAKA, T ET AL.: "The novel mutation K87E m nbosomal protein S12 enhances protein synthesis activity during the late growth phase in Escherichia coli", MOL GENET. GENOMICS, vol. 271, 2004, pages 317 - 324 |
| HOSKINS, J. ET AL.: "Genome of the bacterium Streptococcus pneumoniae strain R6", J. BACTERIOL., vol. 183, 2001, pages 5709 - 5717, XP002231307, DOI: doi:10.1128/JB.183.19.5709-5717.2001 |
| HUSMANN, L.K.; SCOTT, J.R.; LINDAHL, G.; STENBERG. L.: "Expression of the Arp protein, a member of the M protein family, is not sufficient to inhibit phagocytosis of Streptococcus pyogenes", INFECTION AND IMMUNITY, vol. 63, 1995, pages 345 - 348 |
| ISHINO ET AL., J BACTENOL., vol. 169, 1987, pages 5429 - 5433 |
| JANSEN ET AL., MOL. MICROBIOL., vol. 43, 2002, pages 1565 - 1575 |
| JANSSEN ET AL., OMICS J INTEG. BIOL, vol. 6, 2002, pages 23 - 33 |
| JIANG WENYAN ET AL: "RNA-guided editing of bacterial genomes using CRISPR-Cas systems", NATURE BIOTECHNOLOGY,, vol. 31, no. 3, 29 January 2013 (2013-01-29), pages 233 - 239, XP002699849 * |
| JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 |
| JINEK, M. ET AL.: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, 2012, pages 816 - 821, XP055299674, DOI: doi:10.1126/science.1225829 |
| JOHANN ET AL., J. VIROL, vol. 66, 1992, pages 1635 - 1640 |
| KAUFMAN ET AL., EMBO, vol. 1 6, 1987, pages 187 - 195 |
| KESSEL; GRUSS, SCIENCE, vol. 249, 1990, pages 374 - 379 |
| KOTM, HUMAN GENE THERAPY, vol. 5, 1994, pages 793 - 801 |
| KREMER; PERRICAUDET, BRITISH MEDICAL BULLETIN, vol. 51, no. 1, 1995, pages 31 - 44 |
| KRZYSZTOF CHYLINSKI ET AL: "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems", RNA BIOLOGY, vol. 10, no. 5, 1 May 2013 (2013-05-01), pages 726 - 737, XP055116068, ISSN: 1547-6286, DOI: 10.4161/rna.24321 * |
| KUIJAN; HERSKOWITZ, CELL, vol. 30, 1982, pages 933 - 943 |
| L. CONG ET AL: "Multiplex Genome Engineering Using CRISPR/Cas Systems", SCIENCE, vol. 339, no. 6121, 15 February 2013 (2013-02-15), pages 819 - 823, XP055102030, ISSN: 0036-8075, DOI: 10.1126/science.1231143 * |
| L. CONG ET AL: "Supplementary Material to : Multiplex Genome Engineering Using CRISPR/Cas Systems", SCIENCE, vol. 339, no. 6121, 3 January 2013 (2013-01-03), pages 819 - 823, XP055067744, ISSN: 0036-8075, DOI: 10.1126/science.1231143 * |
| LUCKLOW; SUMMERS, VIROLOGY, vol. 170, 1989, pages 31 - 39 |
| LUKE A. GILBERT ET AL: "CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes", CELL, vol. 154, no. 2, 1 July 2013 (2013-07-01), pages 442 - 451, XP055115843, ISSN: 0092-8674, DOI: 10.1016/j.cell.2013.06.044 * |
| M. JINEK ET AL: "A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity (Supplementary Material)", SCIENCE, vol. 337, no. 6096, 28 June 2012 (2012-06-28), pages 816 - 821, XP055067747, ISSN: 0036-8075, DOI: 10.1126/science.1225829 * |
| M. JINEK ET AL: "A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity", SCIENCE, vol. 337, no. 6096, 17 August 2012 (2012-08-17), pages 816 - 821, XP055067740, ISSN: 0036-8075, DOI: 10.1126/science.1225829 * |
| M.J MACPHERSON, B D. HAMES AND G.R TAYLOR: "PCR 2. A PRACTICAL APPROACH", 1995 |
| MAKAROVA ET AL., NAT REV MICROBIOL, vol. 9, 2011, pages 467 |
| MAKAZOVA, K.S; ARAVIND, L.; WOLF, Y 1.; KOONIN, E.V.: "Unification of Cas protein families and a simple scenario for the origin and evolution of CRISPR-Cas systems", BIOL. DIRECT, vol. 6, 2011, pages 38 |
| MALI, P. ET AL.: "RNA-Guided Human Genome Engineering via Cas9", SCIENCE, 2013 |
| MARRAFFINI, L.A.; SONTHEIMER, E.J: "Self versus non-self discrimination dunng CRISPR RNA-directed immunity", NATURE, vol. 463, 2010, pages 568 - 571, XP055118462, DOI: doi:10.1038/nature08703 |
| MARRAFFINI, LA.; DEDENT, A C; SCHNEEWMD, O.: "Sortases and the art of anchoring proteins to the envelopes of gram-positive bactena", MICROBIOL. MOL. BIOL. REV., vol. 70, 2006, pages 192 - 221, XP002459580, DOI: doi:10.1128/MMBR.70.1.192-221.2006 |
| MASEPOHL ET AL., BIOCHIM BIOPHYS ACTA, vol. 1307, 1996, pages 26 - 30 |
| MCLVOR EI; POLAK U; NAPIERALA M: "New insights into repeat instability: role of RNA-DNA hybrids", RNA BIOL., vol. 7, no. 5, September 2010 (2010-09-01), pages 551 - 8 |
| MICHAEL P TERNS ET AL: "CRISPR-based adaptive immune systems", CURRENT OPINION IN MICROBIOLOGY, vol. 14, no. 3, 1 June 2011 (2011-06-01), pages 321 - 327, XP055097823, ISSN: 1369-5274, DOI: 10.1016/j.mib.2011.03.005 * |
| MILLER ET AL., J VIROL., vol. 65, 1991, pages 2220 - 2224 |
| MILLER, NATURE, vol. 357, 1992, pages 455 - 460 |
| MITANI; CASKEY, IIB'IECH, vol. 11, 1993, pages 162 - 166 |
| MOJICA ET AL., MOL MICROBIOL, vol. 17, 1995, pages 85 - 9 |
| MOJICA ET AL., MOL. MICROBIOL., vol. 36, 2000, pages 244 - 246 |
| MOL, CELL BIOL., vol. 8, no. 1, 1988, pages 466 - 472 |
| MORRELL ET AL.: "Crop genomics:advances and applications", NAT REV GENET., vol. 13, no. 2, 29 December 2011 (2011-12-29), pages 85 - 96 |
| MOTAMEDI, M R; SZIGETY, S K; ROSENBERG, S M: "Double-stiand-break repair recombination in Eschcr?chia coli. physical evidence for a DNA replication mechanism in vivo", GENES DEV., vol. 13, 1999, pages 2889 - 2903 |
| MUZYCZKA, J CLIN. INVEST., vol. 94, 1994, pages 1351 |
| NABEL; FELGNER, TIBTECH, vol. 12, 1993, pages 211 - 217 |
| NAKAMURA Y ET AL.: "Codon usage tabulated fiom the international DNA sequence databases status for the year 2000", NUCL. ACIDS RES, vol. 28, 2000, pages 292, XP002941557, DOI: doi:10.1093/nar/28.1.292 |
| NAKATA ET AL., T. BACTERIOL, vol. 171, 1989, pages 3553 - 3556 |
| PA CARR; GM CHURCH, NATURE BIOTECHNOLOGY, vol. 27, no. 12, 2009, pages 1151 - 62 |
| PINKERT, GENES DEV, vol. 1, 1987, pages 268 - 277 |
| PODBIELSKI, A.; SPELLERBERG, B.; WOISCHNIK, M.; POHL, B.; LUTTICKEN, R.: "Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS", GENE, vol. 177, 1996, pages 137 - 147, XP004043388, DOI: doi:10.1016/0378-1119(96)84178-3 |
| PROC NATL ACAD SCI USA, vol. 78, no. 3, 1981, pages 1527 - 31 |
| QUEEN; BALTIMORE, CELL, vol. 33, 1983, pages 741 - 748 |
| R.I FRESHNEY: "ANIMAL CELL CULTURE", 1987 |
| REMY ET AL., BIOCONJUGATE CHEM, vol. 5, 1994, pages 647 - 654 |
| ROBERT D. WELLS; TETSUO ASHIZAWA: "Genetic Instabilities and Neurological Diseases, Second Edition,", 13 October 2011, ACADEMIC PRESS |
| SAMBROOK ET AL.: "MOLECULAR CLONING A LABORATORY MANUAL 2nd ed.,", 1989, COLD SPRING HARBOR LABORATORY PI ESS |
| SAMBROOK; FRITSCH; MAMATIS: "MOLECULAR CLONING A LABORATORY MANUAL, 2nd edition", 1989 |
| SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 03822 - 3828 |
| SAPRANAUSKAS ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, 2011, pages 9275 |
| SAPRANAUSKAS, R ET AL.: "The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coil", NUCLEIC ACIDS RES., 2011 |
| SCHULTZ ET AL., GENE, vol. 54, 1987, pages 113 - 121 |
| SEED, NATURE, vol. 329, 1987, pages 840 |
| SEMENOVA, E. ET AL.: "Interference by clustered iegularly mteispaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence", PROC. NATL ACAD. SCI. U.S.A., 2011 |
| SHARAN, S.K.; THOMASON, L.C.; KUZNETSOV, S.G.; COURT, D.L.: "Recombineering: a homologous recombination-based method of genetic engineering", NAT. PROTOC., vol. 4, 2009, pages 206 - 223, XP001525689, DOI: doi:10.1038/nprot.2008.227 |
| SMITH ET AL., MOL. CELL. BIOL., vol. 3, 1983, pages 2156 - 2165 |
| SMITH; JOHNSON: "Gene", vol. 67, 1988, PHARMACIA BIOTECH INC, pages: 31 - 40 |
| SOMMNERFELT ET AL., VIROL., vol. 176, 1990, pages 58 - 59 |
| STODDARD, B.L.: "Homing endonuclease structure and function", Q. REV. BIOPHYS, vol. 38, 2005, pages 49 - 95, XP008065807, DOI: doi:10.1017/S0033583505004063 |
| STUDIER ET AL.: "GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY", vol. 185, 1990, ACADEMIC PRESS, pages: 60 - 89 |
| SUNG, C.K.; LI, H.; CLAVERYS, J.P.; MORRISON, D.A.: "An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae", APPL. ENVIRON. MICROBIOL., vol. 67, 2001, pages 5190 - 5196 |
| TERNS, M.P.; TERNS, R.M.: "CRISPR-based adaptive immune systems", CURR. OPIN. MICROBIOL, vol. 14, 2011, pages 321 - 327, XP055097823, DOI: doi:10.1016/j.mib.2011.03.005 |
| TIJSSEN: "Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assay" |
| TRATSCHIN ET AL., MOL. CELL BIOL., vol. 5, 1985, pages 3251 - 3260 |
| TRATSCHM ET AL., MOL. CELL. BIOL, vol. 4, 1984, pages 2072 - 2081 |
| URNOV, F.D.; REBAR, E.J.; HOLMES. M.C.; ZHANG, H.S.; GREGORY, P.D.: "Genome editing with engineered zinc finger nucleases", NAT. REV. GENET., vol. 11, 2010, pages 636 - 646, XP008150557, DOI: doi:10.1038/nrg2842 |
| VAN BRUNT, BIOTECHNOLOGY, vol. 6, no. 10, 1988, pages 1149 - 1154 |
| VAN DER OOST, J.; JORE, M.M.; WESTRA, E.R.; LUNDGREN, M.; BROUNS, S.J.: "CRISPR-based adaptive and heritable immunity in prokaiyotes", TRENDS. BIOCHEM. SCI., vol. 34, 2009, pages 401 - 407, XP002559963, DOI: doi:10.1016/j.tibs.2009.05.002 |
| VAN EMBDEN ET AL., J BACTERIOL., vol. 182, 2000, pages 2393 - 2401 |
| VIGNE, RESTORATIVE NEUROLOGY AND NEUROSCIENCE, vol. 8, 1995, pages 35 - 36 |
| WANG HAOYI ET AL: "One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering", CELL, vol. 153, no. 4, 9 May 2013 (2013-05-09), pages 910 - 918, XP028538358, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2013.04.025 * |
| WANG, H.H. ET AL.: "Genome-scale promoter engineering by coselection MAGE", NAT METHODS, vol. 9, 2012, pages 591 - 593 |
| WEST ET AL., VIROLOGY, vol. 160, 1987, pages 38 - 47 |
| WIEDENLIEFT, B ET AL.: "RNA-guided complex from a bactenal immune system enhances target recognition through seed sequence interactions", PROC NATL. ACAD SCI U.S.A., 2011 |
| WILSON ET AL., J. VIROL, vol. 63, 1989, pages 2374 - 2378 |
| WINOTO; BALTIMORE, EMBO J., vol. 8, 1989, pages 729 - 733 |
| YU ET AL., GENE THERAPY, vol. 1, 1994, pages 13 - 26 |
| ZAHNER, D; HAKENBECK, R: "The Streptococcus pneunioniae beta-galactosidase is a surface protein", J. BACTERIOL., vol. 182, 2000, pages 5919 - 5921, XP002529681, DOI: doi:10.1128/JB.182.20.5919-5921.2000 |
| ZUKER; STIEGLER, NUCLEIC ACIDS RES., vol. 9, 1981, pages 133 - 148 |
Cited By (765)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12258584B2 (en) | 2010-05-06 | 2025-03-25 | Children's Hospital Medical Center | Methods and systems for converting precursor cells into intestinal tissues through directed differentiation |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US9322006B2 (en) | 2011-07-22 | 2016-04-26 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12467086B2 (en) | 2011-10-14 | 2025-11-11 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US12618099B2 (en) | 2011-12-22 | 2026-05-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11566277B2 (en) | 2011-12-22 | 2023-01-31 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11111521B2 (en) | 2011-12-22 | 2021-09-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11976318B2 (en) | 2011-12-22 | 2024-05-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293051B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11639518B2 (en) | 2011-12-22 | 2023-05-02 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11566276B2 (en) | 2011-12-22 | 2023-01-31 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11549136B2 (en) | 2011-12-22 | 2023-01-10 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293052B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10435678B2 (en) | 2011-12-30 | 2019-10-08 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10954498B2 (en) | 2011-12-30 | 2021-03-23 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10711257B2 (en) | 2011-12-30 | 2020-07-14 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US11939604B2 (en) | 2011-12-30 | 2024-03-26 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| EP2828386B1 (en) | 2012-03-20 | 2019-07-10 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| US9834786B2 (en) | 2012-04-25 | 2017-12-05 | Regeneron Pharmaceuticals, Inc. | Nuclease-mediated targeting with large targeting vectors |
| US10301646B2 (en) | 2012-04-25 | 2019-05-28 | Regeneron Pharmaceuticals, Inc. | Nuclease-mediated targeting with large targeting vectors |
| US11976307B2 (en) | 2012-04-27 | 2024-05-07 | Duke University | Genetic correction of mutated genes |
| US20210040460A1 (en) | 2012-04-27 | 2021-02-11 | Duke University | Genetic correction of mutated genes |
| US10711256B2 (en) | 2012-04-27 | 2020-07-14 | Duke University | Genetic correction of mutated genes |
| US11473108B2 (en) | 2012-05-25 | 2022-10-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180504B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10227611B2 (en) | 2012-05-25 | 2019-03-12 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11186849B2 (en) | 2012-05-25 | 2021-11-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11814645B2 (en) | 2012-05-25 | 2023-11-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| EP3401400B1 (en) | 2012-05-25 | 2019-04-03 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US10113167B2 (en) | 2012-05-25 | 2018-10-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10774344B1 (en) | 2012-05-25 | 2020-09-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10793878B1 (en) | 2012-05-25 | 2020-10-06 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10676759B2 (en) | 2012-05-25 | 2020-06-09 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10266850B2 (en) | 2012-05-25 | 2019-04-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10669560B2 (en) | 2012-05-25 | 2020-06-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10640791B2 (en) | 2012-05-25 | 2020-05-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11242543B2 (en) | 2012-05-25 | 2022-02-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10626419B2 (en) | 2012-05-25 | 2020-04-21 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11274318B2 (en) | 2012-05-25 | 2022-03-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10982231B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10612045B2 (en) | 2012-05-25 | 2020-04-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11970711B2 (en) | 2012-05-25 | 2024-04-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11293034B2 (en) | 2012-05-25 | 2022-04-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10597680B2 (en) | 2012-05-25 | 2020-03-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10982230B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10577631B2 (en) | 2012-05-25 | 2020-03-03 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10988780B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11674159B2 (en) | 2012-05-25 | 2023-06-13 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10988782B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11001863B2 (en) | 2012-05-25 | 2021-05-11 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10301651B2 (en) | 2012-05-25 | 2019-05-28 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11634730B2 (en) | 2012-05-25 | 2023-04-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10570419B2 (en) | 2012-05-25 | 2020-02-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10563227B2 (en) | 2012-05-25 | 2020-02-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11332761B2 (en) | 2012-05-25 | 2022-05-17 | The Regenis of Wie University of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10550407B2 (en) | 2012-05-25 | 2020-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10308961B2 (en) | 2012-05-25 | 2019-06-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11008590B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10337029B2 (en) | 2012-05-25 | 2019-07-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10533190B2 (en) | 2012-05-25 | 2020-01-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10526619B2 (en) | 2012-05-25 | 2020-01-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12123015B2 (en) | 2012-05-25 | 2024-10-22 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10752920B2 (en) | 2012-05-25 | 2020-08-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10519467B2 (en) | 2012-05-25 | 2019-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180503B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10513712B2 (en) | 2012-05-25 | 2019-12-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10351878B2 (en) | 2012-05-25 | 2019-07-16 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11401532B2 (en) | 2012-05-25 | 2022-08-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10358659B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10487341B2 (en) | 2012-05-25 | 2019-11-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| EP3597749B1 (en) | 2012-05-25 | 2023-07-26 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US11479794B2 (en) | 2012-05-25 | 2022-10-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10358658B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10385360B2 (en) | 2012-05-25 | 2019-08-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| EP2800811B1 (en) | 2012-05-25 | 2017-05-10 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US12215343B2 (en) | 2012-05-25 | 2025-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10400253B2 (en) | 2012-05-25 | 2019-09-03 | The Regents Of The University Of California | Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10443076B2 (en) | 2012-05-25 | 2019-10-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| EP3241902B1 (en) | 2012-05-25 | 2018-02-28 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US10407697B2 (en) | 2012-05-25 | 2019-09-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10415061B2 (en) | 2012-05-25 | 2019-09-17 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11008589B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11549127B2 (en) | 2012-05-25 | 2023-01-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| EP4289948B1 (en) | 2012-05-25 | 2025-02-26 | The Regents of the University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US10421980B2 (en) | 2012-05-25 | 2019-09-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10900054B2 (en) | 2012-05-25 | 2021-01-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10428352B2 (en) | 2012-05-25 | 2019-10-01 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11028412B2 (en) | 2012-05-25 | 2021-06-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| EP4357457B1 (en) | 2012-10-23 | 2024-10-16 | Toolgen Incorporated | Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof |
| US12473559B2 (en) | 2012-10-23 | 2025-11-18 | Toolgen Incorporated | Cas9/RNA complexes for inducing modifications of target endogenous nucleic acid sequences in nucleuses of eukaryotic cells |
| US10851380B2 (en) | 2012-10-23 | 2020-12-01 | Toolgen Incorporated | Methods for cleaving a target DNA using a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein |
| US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
| US10745716B2 (en) | 2012-12-06 | 2020-08-18 | Sigma-Aldrich Co. Llc | CRISPR-based genome modification and regulation |
| EP3360964B1 (en) | 2012-12-06 | 2019-10-02 | Sigma Aldrich Co. LLC | Crispr-based genome modification and regulation |
| EP3363902B1 (en) | 2012-12-06 | 2019-11-27 | Sigma Aldrich Co. LLC | Crispr-based genome modification and regulation |
| EP2928496B1 (en) | 2012-12-06 | 2019-10-09 | Sigma Aldrich Co. LLC | Crispr-based genome modification and regulation |
| EP3138911B1 (en) | 2012-12-06 | 2018-12-05 | Sigma Aldrich Co. LLC | Crispr-based genome modification and regulation |
| US11041173B2 (en) | 2012-12-12 | 2021-06-22 | The Broad Institute, Inc. | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| EP2840140B1 (en) | 2012-12-12 | 2016-11-16 | The Broad Institute, Inc. | Crispr-Cas component systems, methods and compositions for sequence manipulation |
| EP2896697B1 (en) | 2012-12-12 | 2015-09-02 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US9840713B2 (en) | 2012-12-12 | 2017-12-12 | The Broad Institute Inc. | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| EP2898075B1 (en) | 2012-12-12 | 2016-03-09 | The Broad Institute, Inc. | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| EP2931898B1 (en) | 2012-12-12 | 2016-03-09 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| EP2921557B1 (en) | 2012-12-12 | 2016-07-13 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| EP2784162B1 (en) | 2012-12-12 | 2015-04-08 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US10930367B2 (en) | 2012-12-12 | 2021-02-23 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for Cas enzymes or CRISPR-Cas systems for target sequences and conveying results thereof |
| EP2764103B1 (en) | 2012-12-12 | 2015-08-19 | The Broad Institute, Inc. | Crispr-cas systems and methods for altering expression of gene products |
| US12252707B2 (en) | 2012-12-12 | 2025-03-18 | The Broad Institute, Inc. | Delivery, Engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| US12454687B2 (en) | 2012-12-12 | 2025-10-28 | The Broad Institute, Inc. | Functional genomics using CRISPR-Cas systems, compositions, methods, knock out libraries and applications thereof |
| EP2825654B1 (en) | 2012-12-12 | 2017-04-26 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US9822372B2 (en) | 2012-12-12 | 2017-11-21 | The Broad Institute Inc. | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| EP2931891A4 (en) * | 2012-12-17 | 2016-07-13 | Harvard College | MANIPULATION OF THE HUMAN GENOME GUIDED BY RNA |
| EP4282970A3 (en) * | 2012-12-17 | 2024-01-17 | President and Fellows of Harvard College | Rna-guided human genome engineering |
| US11359211B2 (en) | 2012-12-17 | 2022-06-14 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| EP4481048A3 (en) * | 2012-12-17 | 2025-02-26 | President and Fellows of Harvard College | Rna-guided human genome engineering |
| US11365429B2 (en) | 2012-12-17 | 2022-06-21 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11512325B2 (en) | 2012-12-17 | 2022-11-29 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US10435708B2 (en) | 2012-12-17 | 2019-10-08 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11535863B2 (en) | 2012-12-17 | 2022-12-27 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US9260723B2 (en) | 2012-12-17 | 2016-02-16 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US10717990B2 (en) | 2012-12-17 | 2020-07-21 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US12612643B2 (en) | 2012-12-17 | 2026-04-28 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| AU2021204024B2 (en) * | 2012-12-17 | 2023-12-14 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US12018272B2 (en) | 2012-12-17 | 2024-06-25 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| AU2013363194B2 (en) * | 2012-12-17 | 2019-05-16 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US9970024B2 (en) | 2012-12-17 | 2018-05-15 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11236359B2 (en) | 2012-12-17 | 2022-02-01 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| EP3553174A1 (en) * | 2012-12-17 | 2019-10-16 | President and Fellows of Harvard College | Rna-guided human genome engineering |
| US10273501B2 (en) | 2012-12-17 | 2019-04-30 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11312945B2 (en) | 2013-01-16 | 2022-04-26 | Emory University | CAS9-nucleic acid complexes and uses related thereto |
| US10544405B2 (en) | 2013-01-16 | 2020-01-28 | Emory University | Cas9-nucleic acid complexes and uses related thereto |
| US12264358B2 (en) | 2013-03-12 | 2025-04-01 | President And Fellows Of Harvard College | Method of selectively sequencing amplicons in a biological sample |
| US11299767B2 (en) | 2013-03-12 | 2022-04-12 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US9909122B2 (en) | 2013-03-14 | 2018-03-06 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9803194B2 (en) | 2013-03-14 | 2017-10-31 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9410198B2 (en) | 2013-03-14 | 2016-08-09 | Caribou Biosciences, Inc. | Compostions and methods of nucleic acid-targeting nucleic acids |
| US11312953B2 (en) | 2013-03-14 | 2022-04-26 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US10125361B2 (en) | 2013-03-14 | 2018-11-13 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9725714B2 (en) | 2013-03-14 | 2017-08-08 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9809814B1 (en) | 2013-03-14 | 2017-11-07 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9738908B2 (en) | 2013-03-15 | 2017-08-22 | System Biosciences, Llc | CRISPR/Cas systems for genomic modification and gene modulation |
| US10202619B2 (en) | 2013-03-15 | 2019-02-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
| US9234213B2 (en) | 2013-03-15 | 2016-01-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
| US12215345B2 (en) | 2013-03-19 | 2025-02-04 | Duke University | Compositions and methods for the induction and tuning of gene expression |
| US10975390B2 (en) | 2013-04-16 | 2021-04-13 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| US10385359B2 (en) | 2013-04-16 | 2019-08-20 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| US12037596B2 (en) | 2013-04-16 | 2024-07-16 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| JP2016520317A (en) * | 2013-05-29 | 2016-07-14 | セレクティスCellectis | Method for producing precise DNA cleavage using CAS9 nickase activity |
| JP7065564B2 (en) | 2013-05-29 | 2022-05-12 | セレクティス | Methods for Providing Accurate DNA Cleavage Using CAS9 Nickase Activity |
| EP3603679A1 (en) * | 2013-06-04 | 2020-02-05 | President and Fellows of Harvard College | Rna-guideded transcriptional regulation |
| US10767194B2 (en) | 2013-06-04 | 2020-09-08 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US10640789B2 (en) | 2013-06-04 | 2020-05-05 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US11981917B2 (en) | 2013-06-04 | 2024-05-14 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| EP3003392A4 (en) * | 2013-06-04 | 2017-05-03 | President and Fellows of Harvard College | Rna-guideded transcriptional regulation |
| EP4596565A3 (en) * | 2013-06-04 | 2025-11-05 | President And Fellows Of Harvard College | Rna-guided transcriptional regulation |
| AU2014274840B2 (en) * | 2013-06-05 | 2020-03-12 | Duke University | RNA-guided gene editing and gene regulation |
| US10704060B2 (en) | 2013-06-05 | 2020-07-07 | Duke University | RNA-guided gene editing and gene regulation |
| US10745714B2 (en) | 2013-06-05 | 2020-08-18 | Duke University | RNA-guided gene editing and gene regulation |
| US9982277B2 (en) | 2013-06-11 | 2018-05-29 | The Regents Of The University Of California | Methods and compositions for target DNA modification |
| US11008588B2 (en) | 2013-06-17 | 2021-05-18 | The Broad Institute, Inc. | Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation |
| US10577630B2 (en) | 2013-06-17 | 2020-03-03 | The Broad Institute, Inc. | Delivery and use of the CRISPR-Cas systems, vectors and compositions for hepatic targeting and therapy |
| US11597949B2 (en) | 2013-06-17 | 2023-03-07 | The Broad Institute, Inc. | Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation |
| US10781444B2 (en) | 2013-06-17 | 2020-09-22 | The Broad Institute, Inc. | Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof |
| US12553065B2 (en) | 2013-06-17 | 2026-02-17 | The Broad Institute, Inc. | Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation |
| US12018275B2 (en) | 2013-06-17 | 2024-06-25 | The Broad Institute, Inc. | Delivery and use of the CRISPR-CAS systems, vectors and compositions for hepatic targeting and therapy |
| US10711285B2 (en) | 2013-06-17 | 2020-07-14 | The Broad Institute, Inc. | Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation |
| US10946108B2 (en) | 2013-06-17 | 2021-03-16 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for targeting disorders and diseases using viral components |
| US12441995B2 (en) | 2013-06-17 | 2025-10-14 | The Broad Institute, Inc. | Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US9163284B2 (en) | 2013-08-09 | 2015-10-20 | President And Fellows Of Harvard College | Methods for identifying a target site of a Cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| EP3036333B1 (en) | 2013-08-22 | 2022-01-19 | E. I. du Pont de Nemours and Company | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US12378566B2 (en) | 2013-08-22 | 2025-08-05 | Pioneer Hi-Bred International, Inc. | Plant genome modification using guide RNA/Cas endonuclease systems and methods of use |
| US12428645B2 (en) | 2013-08-22 | 2025-09-30 | Pioneer Hi-Bred International, Inc. | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| EP3036333B2 (en) † | 2013-08-22 | 2025-03-12 | E. I. du Pont de Nemours and Company | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| EP4074330A1 (en) * | 2013-09-05 | 2022-10-19 | Massachusetts Institute of Technology | Tuning microbial populations with programmable nucleases |
| EP3041498A4 (en) * | 2013-09-05 | 2017-04-12 | Massachusetts Institute of Technology | Tuning microbial populations with programmable nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9340800B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
| US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US9228207B2 (en) | 2013-09-06 | 2016-01-05 | President And Fellows Of Harvard College | Switchable gRNAs comprising aptamers |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US11920128B2 (en) | 2013-09-18 | 2024-03-05 | Kymab Limited | Methods, cells and organisms |
| WO2015065964A1 (en) | 2013-10-28 | 2015-05-07 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, screens and applications thereof |
| US11149267B2 (en) | 2013-10-28 | 2021-10-19 | The Broad Institute, Inc. | Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof |
| US11390887B2 (en) | 2013-11-07 | 2022-07-19 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10640788B2 (en) | 2013-11-07 | 2020-05-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAs |
| US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9228208B2 (en) | 2013-12-11 | 2016-01-05 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for the targeted modification of a genome |
| US10711280B2 (en) | 2013-12-11 | 2020-07-14 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for the targeted modification of a mouse ES cell genome |
| US10208317B2 (en) | 2013-12-11 | 2019-02-19 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for the targeted modification of a mouse embryonic stem cell genome |
| US9546384B2 (en) | 2013-12-11 | 2017-01-17 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for the targeted modification of a mouse genome |
| US11820997B2 (en) | 2013-12-11 | 2023-11-21 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for the targeted modification of a genome |
| US12410435B2 (en) | 2013-12-12 | 2025-09-09 | The Broad Institute, Inc. | Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders |
| WO2015089354A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12421506B2 (en) | 2013-12-12 | 2025-09-23 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
| EP3653704A1 (en) | 2013-12-12 | 2020-05-20 | The Broad Institute, Inc. | Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders |
| EP3653229A1 (en) | 2013-12-12 | 2020-05-20 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for genome editing |
| US10494620B2 (en) | 2013-12-12 | 2019-12-03 | The Regents Of The University Of California | Methods and compositions for modifying a single stranded target nucleic acid |
| US11407985B2 (en) | 2013-12-12 | 2022-08-09 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for genome editing |
| EP3653703A1 (en) | 2013-12-12 | 2020-05-20 | The Broad Institute, Inc. | Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders |
| WO2015089419A2 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US12258595B2 (en) | 2013-12-12 | 2025-03-25 | The Broad Institute, Inc. | Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems |
| US10851357B2 (en) | 2013-12-12 | 2020-12-01 | The Broad Institute, Inc. | Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders |
| EP3470089A1 (en) | 2013-12-12 | 2019-04-17 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
| US12251450B2 (en) | 2013-12-12 | 2025-03-18 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for HBV and viral diseases and disorders |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| EP3540051A1 (en) | 2013-12-12 | 2019-09-18 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders |
| WO2015089364A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Crystal structure of a crispr-cas system, and uses thereof |
| EP4219699A1 (en) | 2013-12-12 | 2023-08-02 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
| EP4183876A1 (en) | 2013-12-12 | 2023-05-24 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10550372B2 (en) | 2013-12-12 | 2020-02-04 | The Broad Institute, Inc. | Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems |
| US9068179B1 (en) | 2013-12-12 | 2015-06-30 | President And Fellows Of Harvard College | Methods for correcting presenilin point mutations |
| WO2015089351A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders |
| US11155795B2 (en) | 2013-12-12 | 2021-10-26 | The Broad Institute, Inc. | CRISPR-Cas systems, crystal structure and uses thereof |
| WO2015089277A1 (en) * | 2013-12-12 | 2015-06-18 | The Regents Of The University Of California | Methods and compositions for modifying a single stranded target nucleic acid |
| US9994831B2 (en) | 2013-12-12 | 2018-06-12 | The Regents Of The University Of California | Methods and compositions for modifying a single stranded target nucleic acid |
| US11597919B2 (en) | 2013-12-12 | 2023-03-07 | The Broad Institute Inc. | Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems |
| WO2015089486A2 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Systems, methods and compositions for sequence manipulation with optimized functional crispr-cas systems |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| WO2015089465A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders |
| GB2544382A (en) * | 2014-02-11 | 2017-05-17 | The Regents Of The Univ Of Colorado A Body Corp (Existing Under The Laws Of The State Of Colorado) | CRISPR enabled multiplexed genome engineering |
| US10266849B2 (en) | 2014-02-11 | 2019-04-23 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US10351877B2 (en) | 2014-02-11 | 2019-07-16 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US9982278B2 (en) | 2014-02-11 | 2018-05-29 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US11795479B2 (en) | 2014-02-11 | 2023-10-24 | The Regents Of The University Of Colorado | CRISPR enabled multiplexed genome engineering |
| US10240167B2 (en) | 2014-02-11 | 2019-03-26 | Inscripta, Inc. | CRISPR enabled multiplexed genome engineering |
| GB2544382B (en) * | 2014-02-11 | 2018-05-30 | The Regents Of The Univ Of Colorado A Body Corporate Existing Under The Laws Of The State Of Colorad | CRISPR enabled multiplexed genome engineering |
| JP7232540B2 (en) | 2014-02-11 | 2023-03-03 | ザ リージェンツ オブ ザ ユニバーシティ オブ コロラド,ア ボディー コーポレイト | Multiple genome engineering enabled by CRISPR |
| US11345933B2 (en) | 2014-02-11 | 2022-05-31 | The Regents Of The University Of Colorado | CRISPR enabled multiplexed genome engineering |
| US11639511B2 (en) | 2014-02-11 | 2023-05-02 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US10364442B2 (en) | 2014-02-11 | 2019-07-30 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US11078498B2 (en) | 2014-02-11 | 2021-08-03 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US11702677B2 (en) | 2014-02-11 | 2023-07-18 | The Regents Of The University Of Colorado | CRISPR enabled multiplexed genome engineering |
| US10731180B2 (en) | 2014-02-11 | 2020-08-04 | The Regents Of The University Of Colorado | CRISPR enabled multiplexed genome engineering |
| US10669559B2 (en) | 2014-02-11 | 2020-06-02 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US10711284B2 (en) | 2014-02-11 | 2020-07-14 | The Regents Of The University Of Colorado | CRISPR enabled multiplexed genome engineering |
| JP2021087454A (en) * | 2014-02-11 | 2021-06-10 | ザ リージェンツ オブ ザ ユニバーシティ オブ コロラド,ア ボディー コーポレイトTHE REGENTS OF THE UNIVERSITY OF COLORADO,a body corporate | Crispr enabled multiplexed genome engineering |
| US10465207B2 (en) | 2014-02-11 | 2019-11-05 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| US10435715B2 (en) | 2014-02-11 | 2019-10-08 | The Regents Of The University Of Colorado, A Body Corporate | CRISPR enabled multiplexed genome engineering |
| JP2019205478A (en) * | 2014-02-11 | 2019-12-05 | ザ リージェンツ オブ ザ ユニバーシティ オブ コロラド,ア ボディー コーポレイトTHE REGENTS OF THE UNIVERSITY OF COLORADO,a body corporate | Crispr enabled multiplexed genome engineering |
| EP3514246A1 (en) | 2014-02-27 | 2019-07-24 | The Broad Institute Inc. | T cell balance gene expression and methods of use thereof |
| US11209440B2 (en) | 2014-02-27 | 2021-12-28 | The Broad Institute, Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
| US10655123B2 (en) | 2014-03-05 | 2020-05-19 | National University Corporation Kobe University | Genomic sequence modification method for specifically converting nucleic acid bases of targeted DNA sequence, and molecular complex for use in same |
| US11028388B2 (en) | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
| US11718846B2 (en) | 2014-03-05 | 2023-08-08 | National University Corporation Kobe University | Genomic sequence modification method for specifically converting nucleic acid bases of targeted DNA sequence, and molecular complex for use in same |
| US10253312B2 (en) | 2014-03-10 | 2019-04-09 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10) |
| US11268086B2 (en) | 2014-03-10 | 2022-03-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10) |
| US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US9938521B2 (en) | 2014-03-10 | 2018-04-10 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10) |
| US12234449B2 (en) | 2014-03-10 | 2025-02-25 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Leber's congenital amaurosis 10 (LCA10) |
| US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| EP3540061A1 (en) * | 2014-04-02 | 2019-09-18 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating primary open angle glaucoma |
| US12460231B2 (en) | 2014-04-02 | 2025-11-04 | Editas Medicine, Inc. | Crispr/CAS-related methods and compositions for treating primary open angle glaucoma |
| WO2015153780A1 (en) * | 2014-04-02 | 2015-10-08 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating primary open angle glaucoma |
| AU2015248621B2 (en) * | 2014-04-14 | 2020-08-27 | Nemesis Bioscience Ltd | Therapeutic |
| US10508271B2 (en) | 2014-04-17 | 2019-12-17 | Green Biologics Limited | Targeted mutations |
| GB2530831A (en) * | 2014-04-17 | 2016-04-06 | Green Biologics Ltd | Targeted mutations |
| GB2530831B (en) * | 2014-04-17 | 2016-11-30 | Green Biologics Ltd | Targeted mutations |
| US10550396B2 (en) | 2014-04-17 | 2020-02-04 | Green Biologics Limited | Deletion mutations |
| US10280419B2 (en) | 2014-05-09 | 2019-05-07 | UNIVERSITé LAVAL | Reduction of amyloid beta peptide production via modification of the APP gene using the CRISPR/Cas system |
| WO2015168800A1 (en) * | 2014-05-09 | 2015-11-12 | UNIVERSITé LAVAL | Prevention and treatment of alzheimer's disease by genome editing using the crispr/cas system |
| US12241090B2 (en) | 2014-05-28 | 2025-03-04 | Children's Hospital Medical Center | Methods and systems for converting precursor cells into gastric tissues through directed differentiation |
| US12331347B2 (en) | 2014-07-11 | 2025-06-17 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| EP3686279A1 (en) | 2014-08-17 | 2020-07-29 | The Broad Institute, Inc. | Genome editing using cas9 nickases |
| EP3188763A4 (en) * | 2014-09-02 | 2018-03-14 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification |
| WO2016036754A1 (en) | 2014-09-02 | 2016-03-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification |
| US11124796B2 (en) | 2014-09-24 | 2021-09-21 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for modeling competition of multiple cancer mutations in vivo |
| WO2016049163A2 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Use and production of chd8+/- transgenic animals with behavioral phenotypes characteristic of autism spectrum disorder |
| US11197467B2 (en) | 2014-09-24 | 2021-12-14 | The Broad Institute, Inc. | Delivery, use and therapeutic applications of the CRISPR-cas systems and compositions for modeling mutations in leukocytes |
| WO2016049251A1 (en) | 2014-09-24 | 2016-03-31 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling mutations in leukocytes |
| WO2016049163A3 (en) * | 2014-09-24 | 2016-05-12 | The Broad Institute Inc. | Use and production of chd8+/- transgenic animals with behavioral phenotypes characteristic of autism spectrum disorder |
| WO2016049024A3 (en) * | 2014-09-24 | 2016-05-12 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo |
| US11459557B2 (en) | 2014-09-24 | 2022-10-04 | The Broad Institute, Inc. | Use and production of CHD8+/− transgenic animals with behavioral phenotypes characteristic of autism spectrum disorder |
| US11001829B2 (en) | 2014-09-25 | 2021-05-11 | The Broad Institute, Inc. | Functional screening with optimized functional CRISPR-Cas systems |
| US12201699B2 (en) | 2014-10-10 | 2025-01-21 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| WO2016061073A1 (en) * | 2014-10-14 | 2016-04-21 | Memorial Sloan-Kettering Cancer Center | Composition and method for in vivo engineering of chromosomal rearrangements |
| WO2016069591A2 (en) | 2014-10-27 | 2016-05-06 | The Broad Institute Inc. | Compositions, methods and use of synthetic lethal screening |
| US11680268B2 (en) | 2014-11-07 | 2023-06-20 | Editas Medicine, Inc. | Methods for improving CRISPR/Cas-mediated genome-editing |
| US10457960B2 (en) | 2014-11-21 | 2019-10-29 | Regeneron Pharmaceuticals, Inc. | Methods and compositions for targeted genetic modification using paired guide RNAs |
| US11697828B2 (en) | 2014-11-21 | 2023-07-11 | Regeneran Pharmaceuticals, Inc. | Methods and compositions for targeted genetic modification using paired guide RNAs |
| EP3626832A2 (en) | 2014-11-25 | 2020-03-25 | The Brigham and Women's Hospital, Inc. | Method of identifying and treating a person having a predisposition to or afflicted with a cardiometabolic disease |
| WO2016086197A1 (en) | 2014-11-25 | 2016-06-02 | The Brigham And Women's Hospital, Inc. | Method of identifying and treating a person having a predisposition to or afflicted with a cardiometabolic disease |
| WO2016086227A2 (en) | 2014-11-26 | 2016-06-02 | The Regents Of The University Of California | Therapeutic compositions comprising transcription factors and methods of making and using the same |
| WO2016083811A1 (en) | 2014-11-27 | 2016-06-02 | Imperial Innovations Limited | Genome editing methods |
| US10337001B2 (en) | 2014-12-03 | 2019-07-02 | Agilent Technologies, Inc. | Guide RNA with chemical modifications |
| US10900034B2 (en) | 2014-12-03 | 2021-01-26 | Agilent Technologies, Inc. | Guide RNA with chemical modifications |
| US12465029B2 (en) | 2014-12-10 | 2025-11-11 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| US10278372B2 (en) | 2014-12-10 | 2019-05-07 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| US10993419B2 (en) | 2014-12-10 | 2021-05-04 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| US11234418B2 (en) | 2014-12-10 | 2022-02-01 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| US9888673B2 (en) | 2014-12-10 | 2018-02-13 | Regents Of The University Of Minnesota | Genetically modified cells, tissues, and organs for treating disease |
| EP3889260A1 (en) | 2014-12-12 | 2021-10-06 | The Broad Institute, Inc. | Protected guide rnas (pgrnas) |
| WO2016094880A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs) |
| EP3985115A1 (en) | 2014-12-12 | 2022-04-20 | The Broad Institute, Inc. | Protected guide rnas (pgrnas) |
| WO2016094867A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Protected guide rnas (pgrnas) |
| WO2016094874A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Escorted and functionalized guides for crispr-cas systems |
| US12571005B2 (en) | 2014-12-12 | 2026-03-10 | The Broad Institute, Inc. | Protected guide RNAs (pgRNAs) |
| WO2016094872A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Dead guides for crispr transcription factors |
| US10696986B2 (en) | 2014-12-12 | 2020-06-30 | The Board Institute, Inc. | Protected guide RNAS (PGRNAS) |
| US11624078B2 (en) | 2014-12-12 | 2023-04-11 | The Broad Institute, Inc. | Protected guide RNAS (pgRNAS) |
| WO2016100974A1 (en) | 2014-12-19 | 2016-06-23 | The Broad Institute Inc. | Unbiased identification of double-strand breaks and genomic rearrangement by genome-wide insert capture sequencing |
| US12215326B2 (en) | 2014-12-23 | 2025-02-04 | The Broad Institute, Inc. | RNA-targeting system |
| WO2016106236A1 (en) | 2014-12-23 | 2016-06-30 | The Broad Institute Inc. | Rna-targeting system |
| US12435320B2 (en) | 2014-12-24 | 2025-10-07 | The Broad Institute, Inc. | CRISPR having or associated with destabilization domains |
| WO2016106244A1 (en) | 2014-12-24 | 2016-06-30 | The Broad Institute Inc. | Crispr having or associated with destabilization domains |
| EP3702456A1 (en) | 2014-12-24 | 2020-09-02 | The Broad Institute, Inc. | Crispr having or associated with destabilization domains |
| US12116619B2 (en) | 2014-12-30 | 2024-10-15 | The Broad Institute, Inc. | CRISPR mediated in vivo modeling and genetic screening of tumor growth and metastasis |
| WO2016108926A1 (en) | 2014-12-30 | 2016-07-07 | The Broad Institute Inc. | Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis |
| US11155796B2 (en) | 2015-02-09 | 2021-10-26 | Duke University | Compositions and methods for epigenome editing |
| US12215366B2 (en) | 2015-02-09 | 2025-02-04 | Duke University | Compositions and methods for epigenome editing |
| US10676726B2 (en) | 2015-02-09 | 2020-06-09 | Duke University | Compositions and methods for epigenome editing |
| US11427869B2 (en) | 2015-02-26 | 2022-08-30 | The Broad Institute, Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
| WO2016138488A2 (en) | 2015-02-26 | 2016-09-01 | The Broad Institute Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
| WO2016138574A1 (en) | 2015-03-02 | 2016-09-09 | Sinai Health System | Homologous recombination factors |
| US11851652B2 (en) | 2015-04-06 | 2023-12-26 | The Board Of Trustees Of The Leland Stanford Junior | Compositions comprising chemically modified guide RNAs for CRISPR/Cas-mediated editing of HBB |
| US11535846B2 (en) | 2015-04-06 | 2022-12-27 | The Board Of Trustees Of The Leland Stanford Junior University | Chemically modified guide RNAS for CRISPR/Cas-mediated gene regulation |
| US11306309B2 (en) | 2015-04-06 | 2022-04-19 | The Board Of Trustees Of The Leland Stanford Junior University | Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation |
| US12534715B2 (en) | 2015-04-16 | 2026-01-27 | Wageningen Universiteit | Nucleic acids for nuclease-mediated genome editing |
| US11180793B2 (en) | 2015-04-24 | 2021-11-23 | Editas Medicine, Inc. | Evaluation of Cas9 molecule/guide RNA molecule complexes |
| US10561148B2 (en) | 2015-05-06 | 2020-02-18 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11612617B2 (en) | 2015-05-06 | 2023-03-28 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12502401B2 (en) | 2015-05-06 | 2025-12-23 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12226430B2 (en) | 2015-05-06 | 2025-02-18 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11147830B2 (en) | 2015-05-06 | 2021-10-19 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12514869B2 (en) | 2015-05-06 | 2026-01-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10624349B2 (en) | 2015-05-06 | 2020-04-21 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11517582B2 (en) | 2015-05-06 | 2022-12-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11844760B2 (en) | 2015-05-06 | 2023-12-19 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10582712B2 (en) | 2015-05-06 | 2020-03-10 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11400110B2 (en) | 2015-05-06 | 2022-08-02 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10506812B2 (en) | 2015-05-06 | 2019-12-17 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12514867B2 (en) | 2015-05-06 | 2026-01-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11547716B2 (en) | 2015-05-06 | 2023-01-10 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11642363B2 (en) | 2015-05-06 | 2023-05-09 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10524477B2 (en) | 2015-05-06 | 2020-01-07 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10463049B2 (en) | 2015-05-06 | 2019-11-05 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| WO2016182893A1 (en) | 2015-05-08 | 2016-11-17 | Teh Broad Institute Inc. | Functional genomics using crispr-cas systems for saturating mutagenesis of non-coding elements, compositions, methods, libraries and applications thereof |
| US11390884B2 (en) | 2015-05-11 | 2022-07-19 | Editas Medicine, Inc. | Optimized CRISPR/cas9 systems and methods for gene editing in stem cells |
| WO2016183438A1 (en) * | 2015-05-14 | 2016-11-17 | Massachusetts Institute Of Technology | Self-targeting genome editing system |
| EP4039816A1 (en) * | 2015-05-29 | 2022-08-10 | North Carolina State University | Methods for screening bacteria, archaea, algae, and yeast using crispr nucleic acids |
| US11555208B2 (en) | 2015-06-03 | 2023-01-17 | Board Of Regents Of The University Of Nebraska | DNA editing using relatively long single-stranded DNA and CRISPR/Cas9 to increase success rate in methods for preparing transgenic embryos and animals |
| US11549126B2 (en) | 2015-06-03 | 2023-01-10 | Board Of Regents Of The University Of Nebraska | Treatment methods using DNA editing with single-stranded DNA |
| US11911415B2 (en) | 2015-06-09 | 2024-02-27 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for improving transplantation |
| WO2016198500A1 (en) * | 2015-06-10 | 2016-12-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for rna-guided treatment of human cytomegalovirus (hcmv) infection |
| WO2016200263A1 (en) * | 2015-06-12 | 2016-12-15 | Erasmus University Medical Center Rotterdam | New crispr assays |
| US11643669B2 (en) | 2015-06-17 | 2023-05-09 | Massachusetts Institute Of Technology | CRISPR mediated recording of cellular events |
| WO2016205728A1 (en) | 2015-06-17 | 2016-12-22 | Massachusetts Institute Of Technology | Crispr mediated recording of cellular events |
| CN109207477A (en) * | 2015-06-18 | 2019-01-15 | 布罗德研究所有限公司 | Novel C RISPR enzyme and system |
| US11060115B2 (en) | 2015-06-18 | 2021-07-13 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| CN115572718A (en) * | 2015-06-18 | 2023-01-06 | 布罗德研究所有限公司 | Novel CRISPR enzymes and systems |
| US10494621B2 (en) | 2015-06-18 | 2019-12-03 | The Broad Institute, Inc. | Crispr enzyme mutations reducing off-target effects |
| WO2016205745A2 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Cell sorting |
| KR20180034402A (en) * | 2015-06-18 | 2018-04-04 | 더 브로드 인스티튜트, 인코퍼레이티드 | New CRISPR Enzymes and Systems |
| WO2016205764A1 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Novel crispr enzymes and systems |
| US11578312B2 (en) | 2015-06-18 | 2023-02-14 | The Broad Institute Inc. | Engineering and optimization of systems, methods, enzymes and guide scaffolds of CAS9 orthologs and variants for sequence manipulation |
| US11421250B2 (en) | 2015-06-18 | 2022-08-23 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| US11180751B2 (en) | 2015-06-18 | 2021-11-23 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| KR102613296B1 (en) | 2015-06-18 | 2023-12-13 | 더 브로드 인스티튜트, 인코퍼레이티드 | Novel CRISPR enzymes and systems |
| US10876100B2 (en) | 2015-06-18 | 2020-12-29 | The Broad Institute, Inc. | Crispr enzyme mutations reducing off-target effects |
| EP4159856A1 (en) | 2015-06-18 | 2023-04-05 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| KR20180034404A (en) * | 2015-06-18 | 2018-04-04 | 더 브로드 인스티튜트, 인코퍼레이티드 | CRISPR enzyme mutations that reduce the target effect |
| US20180127745A1 (en) * | 2015-06-18 | 2018-05-10 | The Broad Institute Inc. | Cell sorting |
| KR102840885B1 (en) | 2015-06-18 | 2025-07-30 | 더 브로드 인스티튜트, 인코퍼레이티드 | Crispr enzyme mutations reducing off-target effects |
| JP7280312B2 (en) | 2015-06-18 | 2023-05-23 | ザ・ブロード・インスティテュート・インコーポレイテッド | Novel CRISPR enzymes and systems |
| US12168789B2 (en) | 2015-06-18 | 2024-12-17 | The Broad Institute, Inc. | Engineering and optimization of systems, methods, enzymes and guide scaffolds of CAS9 orthologs and variants for sequence manipulation |
| EP3666895A1 (en) | 2015-06-18 | 2020-06-17 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| US12123032B2 (en) | 2015-06-18 | 2024-10-22 | The Broad Institute, Inc. | CRISPR enzyme mutations reducing off-target effects |
| US11773412B2 (en) | 2015-06-18 | 2023-10-03 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US11236327B2 (en) | 2015-06-18 | 2022-02-01 | The Broad Institute, Inc. | Cell sorting |
| JP2021151247A (en) * | 2015-06-18 | 2021-09-30 | ザ・ブロード・インスティテュート・インコーポレイテッド | New CRISPR enzymes and systems |
| US12091709B2 (en) | 2015-06-18 | 2024-09-17 | The Broad Institute, Inc. | Crispr enzymes and systems |
| CN109207477B (en) * | 2015-06-18 | 2021-07-16 | 布罗德研究所有限公司 | CRISPR enzymes and systems |
| KR102575342B1 (en) | 2015-06-18 | 2023-09-05 | 더 브로드 인스티튜트, 인코퍼레이티드 | CRISPR enzyme mutations that reduce off-target effects |
| KR20230132877A (en) * | 2015-06-18 | 2023-09-18 | 더 브로드 인스티튜트, 인코퍼레이티드 | Crispr enzyme mutations reducing off-target effects |
| US11414657B2 (en) | 2015-06-29 | 2022-08-16 | Ionis Pharmaceuticals, Inc. | Modified CRISPR RNA and modified single CRISPR RNA and uses thereof |
| US10676735B2 (en) | 2015-07-22 | 2020-06-09 | Duke University | High-throughput screening of regulatory element function with epigenome editing technologies |
| US10166255B2 (en) | 2015-07-31 | 2019-01-01 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
| US11266692B2 (en) | 2015-07-31 | 2022-03-08 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
| US11147837B2 (en) | 2015-07-31 | 2021-10-19 | Regents Of The University Of Minnesota | Modified cells and methods of therapy |
| US11903966B2 (en) | 2015-07-31 | 2024-02-20 | Regents Of The University Of Minnesota | Intracellular genomic transplant and methods of therapy |
| US10406177B2 (en) | 2015-07-31 | 2019-09-10 | Regents Of The University Of Minnesota | Modified cells and methods of therapy |
| US11583556B2 (en) | 2015-07-31 | 2023-02-21 | Regents Of The University Of Minnesota | Modified cells and methods of therapy |
| US11642374B2 (en) | 2015-07-31 | 2023-05-09 | Intima Bioscience, Inc. | Intracellular genomic transplant and methods of therapy |
| US11925664B2 (en) | 2015-07-31 | 2024-03-12 | Intima Bioscience, Inc. | Intracellular genomic transplant and methods of therapy |
| US11642375B2 (en) | 2015-07-31 | 2023-05-09 | Intima Bioscience, Inc. | Intracellular genomic transplant and methods of therapy |
| EP4512819A2 (en) | 2015-08-12 | 2025-02-26 | The General Hospital Corporation | Compositions and methods that promote hypoxia or the hypoxia response for treatment and prevention of mitochondrial dysfunction and oxidative stress disorders |
| WO2017027910A1 (en) | 2015-08-14 | 2017-02-23 | The University Of Sydney | Connexin 45 inhibition for therapy |
| EP4043074A1 (en) | 2015-08-14 | 2022-08-17 | The University of Sydney | Connexin 45 inhibition for therapy |
| US11214800B2 (en) | 2015-08-18 | 2022-01-04 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
| US11427817B2 (en) | 2015-08-25 | 2022-08-30 | Duke University | Compositions and methods of improving specificity in genomic engineering using RNA-guided endonucleases |
| EP4177346A3 (en) * | 2015-08-25 | 2023-07-26 | Duke University | Compositions and methods of improving specificity in genomic engineering using rna-guided endonucleases |
| US10767173B2 (en) | 2015-09-09 | 2020-09-08 | National University Corporation Kobe University | Method for converting genome sequence of gram-positive bacterium by specifically converting nucleic acid base of targeted DNA sequence, and molecular complex used in same |
| US11667911B2 (en) | 2015-09-24 | 2023-06-06 | Editas Medicine, Inc. | Use of exonucleases to improve CRISPR/CAS-mediated genome editing |
| WO2017069958A2 (en) | 2015-10-09 | 2017-04-27 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
| US11970710B2 (en) | 2015-10-13 | 2024-04-30 | Duke University | Genome engineering with Type I CRISPR systems in eukaryotic cells |
| CN108431225A (en) * | 2015-10-16 | 2018-08-21 | 阿斯特拉捷利康股份公司 | The induction type of cellular genome is modified |
| US10947559B2 (en) | 2015-10-16 | 2021-03-16 | Astrazeneca Ab | Inducible modification of a cell genome |
| US12509702B2 (en) | 2015-10-16 | 2025-12-30 | Astrazeneca Ab | Inducible modification of a cell genome |
| WO2017064566A3 (en) * | 2015-10-16 | 2017-05-26 | Astrazeneca Ab | Inducible modification of a cell genome |
| US12049480B2 (en) | 2015-10-20 | 2024-07-30 | Institut National De La Sante Et De La Recherche Medicale (INSERM) Paris, FRANCE | Methods and products for genetic engineering |
| US12365707B2 (en) | 2015-10-20 | 2025-07-22 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| US11649264B2 (en) | 2015-10-20 | 2023-05-16 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| WO2017068077A1 (en) | 2015-10-20 | 2017-04-27 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| US12202860B2 (en) | 2015-10-20 | 2025-01-21 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| EP4636083A2 (en) | 2015-10-20 | 2025-10-22 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Methods and products for genetic engineering |
| WO2017070605A1 (en) | 2015-10-22 | 2017-04-27 | The Broad Institute Inc. | Type vi-b crispr enzymes and systems |
| US12215318B2 (en) | 2015-10-22 | 2025-02-04 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US12234454B2 (en) | 2015-10-22 | 2025-02-25 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| WO2017074788A1 (en) | 2015-10-27 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for targeting cancer-specific sequence variations |
| WO2017075478A2 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by use of immune cell gene signatures |
| WO2017075451A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting pou2af1 |
| US11180730B2 (en) | 2015-10-28 | 2021-11-23 | The Broad Institute, Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting GATA3 |
| WO2017075294A1 (en) | 2015-10-28 | 2017-05-04 | The Board Institute Inc. | Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction |
| US11092607B2 (en) | 2015-10-28 | 2021-08-17 | The Board Institute, Inc. | Multiplex analysis of single cell constituents |
| US11186825B2 (en) | 2015-10-28 | 2021-11-30 | The Broad Institute, Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting POU2AF1 |
| WO2017075465A1 (en) | 2015-10-28 | 2017-05-04 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses by detecting and targeting gata3 |
| US11542554B2 (en) | 2015-11-03 | 2023-01-03 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging |
| US11884717B2 (en) | 2015-11-19 | 2024-01-30 | The Brigham And Women's Hospital, Inc. | Method of treating autoimmune disease with lymphocyte antigen CD5-like (CD5L) protein |
| WO2017087708A1 (en) | 2015-11-19 | 2017-05-26 | The Brigham And Women's Hospital, Inc. | Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity |
| US11001622B2 (en) | 2015-11-19 | 2021-05-11 | The Brigham And Women's Hospital, Inc. | Method of treating autoimmune disease with lymphocyte antigen CD5-like (CD5L) protein |
| JPWO2017090761A1 (en) * | 2015-11-27 | 2018-10-25 | 国立大学法人神戸大学 | Method for converting genome sequence of monocotyledonous plant, which specifically converts nucleobase of targeted DNA sequence, and molecular complex used therefor |
| US11220693B2 (en) | 2015-11-27 | 2022-01-11 | National University Corporation Kobe University | Method for converting monocot plant genome sequence in which nucleic acid base in targeted DNA sequence is specifically converted, and molecular complex used therein |
| CN108495932B (en) * | 2015-11-27 | 2022-08-09 | 国立大学法人神户大学 | Method for converting genomic sequence of monocotyledon for specifically converting nucleobase targeting DNA sequence, and molecular complex used therefor |
| WO2017090761A1 (en) * | 2015-11-27 | 2017-06-01 | 国立大学法人神戸大学 | Method for converting monocot plant genome sequence in which nucleic acid base in targeted dna sequence is specifically converted, and molecular complex used therein |
| CN108495932A (en) * | 2015-11-27 | 2018-09-04 | 国立大学法人神户大学 | The molecular complex converted the conversion method of the monocotyledonous genome sequence of the nucleic acid base of targeting DNA sequence dna for specificity and its used |
| US12214054B2 (en) | 2015-11-30 | 2025-02-04 | Duke University | Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use |
| CN105296518A (en) * | 2015-12-01 | 2016-02-03 | 中国农业大学 | Homologous arm vector construction method used for CRISPR/Cas 9 technology |
| EP4219689A2 (en) | 2015-12-30 | 2023-08-02 | Novartis AG | Immune effector cell therapies with enhanced efficacy |
| WO2017114497A1 (en) | 2015-12-30 | 2017-07-06 | Novartis Ag | Immune effector cell therapies with enhanced efficacy |
| WO2017147196A1 (en) | 2016-02-22 | 2017-08-31 | Massachusetts Institute Of Technology | Methods for identifying and modulating immune phenotypes |
| WO2017161325A1 (en) | 2016-03-17 | 2017-09-21 | Massachusetts Institute Of Technology | Methods for identifying and modulating co-occurant cellular phenotypes |
| EP3219799A1 (en) | 2016-03-17 | 2017-09-20 | IMBA-Institut für Molekulare Biotechnologie GmbH | Conditional crispr sgrna expression |
| US11427861B2 (en) | 2016-03-17 | 2022-08-30 | Massachusetts Institute Of Technology | Methods for identifying and modulating co-occurant cellular phenotypes |
| WO2017158153A1 (en) | 2016-03-17 | 2017-09-21 | Imba - Institut Für Molekulare Biotechnologie Gmbh | Conditional crispr sgrna expression |
| WO2017165655A1 (en) * | 2016-03-23 | 2017-09-28 | Dana-Farber Cancer Institute, Inc. | Methods for enhancing the efficiency of gene editing |
| US11421218B2 (en) | 2016-03-23 | 2022-08-23 | Dana-Farber Cancer Institute, Inc. | Methods for enhancing the efficiency of gene editing |
| US11597924B2 (en) | 2016-03-25 | 2023-03-07 | Editas Medicine, Inc. | Genome editing systems comprising repair-modulating enzyme molecules and methods of their use |
| US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
| US11236313B2 (en) | 2016-04-13 | 2022-02-01 | Editas Medicine, Inc. | Cas9 fusion molecules, gene editing systems, and methods of use thereof |
| US12049651B2 (en) | 2016-04-13 | 2024-07-30 | Editas Medicine, Inc. | Cas9 fusion molecules, gene editing systems, and methods of use thereof |
| US12428631B2 (en) | 2016-04-13 | 2025-09-30 | Duke University | CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use |
| US11713485B2 (en) | 2016-04-25 | 2023-08-01 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| US10300138B2 (en) | 2016-06-05 | 2019-05-28 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11471530B2 (en) | 2016-06-05 | 2022-10-18 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US12318445B2 (en) | 2016-06-05 | 2025-06-03 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10953090B2 (en) | 2016-06-05 | 2021-03-23 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11141481B2 (en) | 2016-06-05 | 2021-10-12 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10363308B2 (en) | 2016-06-05 | 2019-07-30 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10300139B2 (en) | 2016-06-05 | 2019-05-28 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10765740B2 (en) | 2016-06-05 | 2020-09-08 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11351252B2 (en) | 2016-06-05 | 2022-06-07 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11471531B2 (en) | 2016-06-05 | 2022-10-18 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11291723B2 (en) | 2016-06-05 | 2022-04-05 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10603379B2 (en) | 2016-06-05 | 2020-03-31 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10596255B2 (en) | 2016-06-05 | 2020-03-24 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US10767175B2 (en) | 2016-06-08 | 2020-09-08 | Agilent Technologies, Inc. | High specificity genome editing using chemically modified guide RNAs |
| US11788083B2 (en) | 2016-06-17 | 2023-10-17 | The Broad Institute, Inc. | Type VI CRISPR orthologs and systems |
| US12612620B2 (en) | 2016-06-17 | 2026-04-28 | The Broad Institute, Inc. | Type VI CRISPR orthologs and systems |
| WO2017219027A1 (en) | 2016-06-17 | 2017-12-21 | The Broad Institute Inc. | Type vi crispr orthologs and systems |
| US10287575B2 (en) | 2016-06-24 | 2019-05-14 | The Regents Of The University Of Colorado, A Body Corporate | Methods for generating barcoded combinatorial libraries |
| US10294473B2 (en) | 2016-06-24 | 2019-05-21 | The Regents Of The University Of Colorado, A Body Corporate | Methods for generating barcoded combinatorial libraries |
| US10017760B2 (en) | 2016-06-24 | 2018-07-10 | Inscripta, Inc. | Methods for generating barcoded combinatorial libraries |
| US11584928B2 (en) | 2016-06-24 | 2023-02-21 | The Regents Of The University Of Colorado, A Body Corporate | Methods for generating barcoded combinatorial libraries |
| US12595478B2 (en) | 2016-06-29 | 2026-04-07 | The Broad Institute, Inc. | Crispr-Cas systems having destabilization domain |
| US12031150B2 (en) | 2016-07-13 | 2024-07-09 | Vertex Pharmaceuticals Incorporated | Methods, compositions and kits for increasing genome editing efficiency |
| WO2018013840A1 (en) | 2016-07-13 | 2018-01-18 | Vertex Pharmaceuticals Incorporated | Methods, compositions and kits for increasing genome editing efficiency |
| EP4219462A1 (en) | 2016-07-13 | 2023-08-02 | Vertex Pharmaceuticals Incorporated | Methods, compositions and kits for increasing genome editing efficiency |
| US12214056B2 (en) | 2016-07-19 | 2025-02-04 | Duke University | Therapeutic applications of CPF1-based genome editing |
| US11566263B2 (en) | 2016-08-02 | 2023-01-31 | Editas Medicine, Inc. | Compositions and methods for treating CEP290 associated disease |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| WO2018035250A1 (en) | 2016-08-17 | 2018-02-22 | The Broad Institute, Inc. | Methods for identifying class 2 crispr-cas systems |
| US11352647B2 (en) | 2016-08-17 | 2022-06-07 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US12559774B2 (en) | 2016-08-17 | 2026-02-24 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| US12431216B2 (en) | 2016-08-17 | 2025-09-30 | Broad Institute, Inc. | Methods for identifying class 2 crispr-cas systems |
| US12305204B2 (en) | 2016-08-17 | 2025-05-20 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| WO2018035364A1 (en) | 2016-08-17 | 2018-02-22 | The Broad Institute Inc. | Product and methods useful for modulating and evaluating immune responses |
| US11630103B2 (en) | 2016-08-17 | 2023-04-18 | The Broad Institute, Inc. | Product and methods useful for modulating and evaluating immune responses |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12565671B2 (en) | 2016-08-31 | 2026-03-03 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| WO2018049025A2 (en) | 2016-09-07 | 2018-03-15 | The Broad Institute Inc. | Compositions and methods for evaluating and modulating immune responses |
| WO2018054911A1 (en) | 2016-09-23 | 2018-03-29 | Bayer Cropscience Nv | Targeted genome optimization in plants |
| US12499971B2 (en) | 2016-09-28 | 2025-12-16 | The Broad Institute, Inc. | Systematic screening and mapping of regulatory elements in non-coding genomic regions, methods, compositions, and applications thereof |
| WO2018067991A1 (en) | 2016-10-07 | 2018-04-12 | The Brigham And Women's Hospital, Inc. | Modulation of novel immune checkpoint targets |
| US12447213B2 (en) | 2016-10-07 | 2025-10-21 | The Broad Institute, Inc. | Modulation of novel immune checkpoint targets |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11154574B2 (en) | 2016-10-18 | 2021-10-26 | Regents Of The University Of Minnesota | Tumor infiltrating lymphocytes and methods of therapy |
| US10912797B2 (en) | 2016-10-18 | 2021-02-09 | Intima Bioscience, Inc. | Tumor infiltrating lymphocytes and methods of therapy |
| WO2018083606A1 (en) | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
| US12414967B2 (en) | 2016-11-04 | 2025-09-16 | Children's Hospital Medical Center | Compositions and methods of treating liver disease |
| US12227578B2 (en) | 2016-11-11 | 2025-02-18 | The Broad Institute, Inc. | Modulation of intestinal epithelial cell differentiation, maintenance and/or function through T cell action |
| US12404514B2 (en) | 2016-12-09 | 2025-09-02 | The Broad Institute, Inc. | CRISPR-systems for modifying a trait of interest in a plant |
| US12286727B2 (en) | 2016-12-19 | 2025-04-29 | Editas Medicine, Inc. | Assessing nuclease cleavage |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US12110545B2 (en) | 2017-01-06 | 2024-10-08 | Editas Medicine, Inc. | Methods of assessing nuclease cleavage |
| US12559748B2 (en) | 2017-02-06 | 2026-02-24 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
| US11466271B2 (en) | 2017-02-06 | 2022-10-11 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| EP4361261A2 (en) | 2017-03-15 | 2024-05-01 | The Broad Institute Inc. | Novel cas13b orthologues crispr enzymes and systems |
| WO2018170333A1 (en) | 2017-03-15 | 2018-09-20 | The Broad Institute, Inc. | Novel cas13b orthologues crispr enzymes and systems |
| US11739308B2 (en) | 2017-03-15 | 2023-08-29 | The Broad Institute, Inc. | Cas13b orthologues CRISPR enzymes and systems |
| US12180546B2 (en) | 2017-03-17 | 2024-12-31 | Massachusetts Institute Of Technology | Methods for identifying and modulating co-occurant cellular phenotypes |
| WO2018170515A1 (en) | 2017-03-17 | 2018-09-20 | The Broad Institute, Inc. | Methods for identifying and modulating co-occurant cellular phenotypes |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US12161694B2 (en) | 2017-03-24 | 2024-12-10 | The Broad Institute, Inc. | Methods and compositions for regulating innate lymphoid cell inflammatory responses |
| US11963966B2 (en) | 2017-03-31 | 2024-04-23 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for treating ovarian tumors |
| US11913075B2 (en) | 2017-04-01 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer |
| WO2018191520A1 (en) | 2017-04-12 | 2018-10-18 | The Broad Institute, Inc. | Respiratory and sweat gland ionocytes |
| US12331319B2 (en) | 2017-04-12 | 2025-06-17 | The Broad Institute, Inc. | Respiratory and sweat gland ionocytes |
| WO2018191553A1 (en) | 2017-04-12 | 2018-10-18 | Massachusetts Eye And Ear Infirmary | Tumor signature for metastasis, compositions of matter methods of use thereof |
| US12590288B2 (en) | 2017-04-12 | 2026-03-31 | The Broad Institute, Inc. | Method of treating an inflammatory disease by administering an agent which binds a surface receptor on a tuft cell that induces an ILC class 2 inflammatory response |
| WO2018191388A1 (en) | 2017-04-12 | 2018-10-18 | The Broad Institute, Inc. | Novel type vi crispr orthologs and systems |
| US12350368B2 (en) | 2017-04-14 | 2025-07-08 | The Broad Institute, Inc. | Delivery of large payloads |
| WO2018191750A2 (en) | 2017-04-14 | 2018-10-18 | The Broad Institute Inc. | Novel delivery of large payloads |
| US12281334B2 (en) | 2017-04-14 | 2025-04-22 | Children's Hospital Medical Center | Multi donor stem cell compositions and methods of making same |
| WO2018195019A1 (en) | 2017-04-18 | 2018-10-25 | The Broad Institute Inc. | Compositions for detecting secretion and methods of use |
| US12058986B2 (en) | 2017-04-20 | 2024-08-13 | Egenesis, Inc. | Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements |
| WO2018195486A1 (en) | 2017-04-21 | 2018-10-25 | The Broad Institute, Inc. | Targeted delivery to beta cells |
| US11499151B2 (en) | 2017-04-28 | 2022-11-15 | Editas Medicine, Inc. | Methods and systems for analyzing guide RNA molecules |
| US11591601B2 (en) | 2017-05-05 | 2023-02-28 | The Broad Institute, Inc. | Methods for identification and modification of lncRNA associated with target genotypes and phenotypes |
| US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
| US12226479B2 (en) | 2017-05-11 | 2025-02-18 | The General Hospital Corporation | Methods and compositions of use of CD8+ tumor infiltrating lymphocyte subtypes and gene signatures thereof |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12297436B2 (en) | 2017-05-18 | 2025-05-13 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| US11866697B2 (en) | 2017-05-18 | 2024-01-09 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| US12442021B2 (en) | 2017-06-05 | 2025-10-14 | Fred Hutchinson Cancer Center | Genomic safe harbors for genetic therapies in human stem cells and engineered nanoparticles to provide targeted genetic therapies |
| US11603544B2 (en) | 2017-06-05 | 2023-03-14 | Fred Hutchinson Cancer Center | Genomic safe harbors for genetic therapies in human stem cells and engineered nanoparticles to provide targeted genetic therapies |
| US12371713B2 (en) | 2017-06-08 | 2025-07-29 | Osaka University | Method for producing DNA-edited eukaryotic cell, and kit used in the same |
| EP4349973A3 (en) * | 2017-06-08 | 2024-06-26 | Osaka University | Method for manufacturing dna-edited eukaryotic cell |
| US11807869B2 (en) | 2017-06-08 | 2023-11-07 | Osaka University | Method for producing DNA-edited eukaryotic cell, and kit used in the same |
| EP3636753A4 (en) * | 2017-06-08 | 2021-03-31 | Osaka University | PROCESS FOR MANUFACTURING A DNA-EDITED EUKARYOTE CELL, AND KIT USED IN THE PROCESS |
| US10428319B2 (en) | 2017-06-09 | 2019-10-01 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
| US12297466B2 (en) | 2017-06-09 | 2025-05-13 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
| US11098297B2 (en) | 2017-06-09 | 2021-08-24 | Editas Medicine, Inc. | Engineered Cas9 nucleases |
| US11897953B2 (en) | 2017-06-14 | 2024-02-13 | The Broad Institute, Inc. | Compositions and methods targeting complement component 3 for inhibiting tumor growth |
| US12180502B2 (en) | 2017-06-23 | 2024-12-31 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10435714B2 (en) | 2017-06-23 | 2019-10-08 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US9982279B1 (en) | 2017-06-23 | 2018-05-29 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10011849B1 (en) | 2017-06-23 | 2018-07-03 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US12195749B2 (en) | 2017-06-23 | 2025-01-14 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11697826B2 (en) | 2017-06-23 | 2023-07-11 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10626416B2 (en) | 2017-06-23 | 2020-04-21 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10337028B2 (en) | 2017-06-23 | 2019-07-02 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| WO2019005884A1 (en) | 2017-06-26 | 2019-01-03 | The Broad Institute, Inc. | Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing |
| WO2019003193A1 (en) | 2017-06-30 | 2019-01-03 | Novartis Ag | Methods for the treatment of disease with gene editing systems |
| US11098325B2 (en) | 2017-06-30 | 2021-08-24 | Intima Bioscience, Inc. | Adeno-associated viral vectors for gene therapy |
| US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
| US12049643B2 (en) | 2017-07-14 | 2024-07-30 | The Broad Institute, Inc. | Methods and compositions for modulating cytotoxic lymphocyte activity |
| WO2019018440A1 (en) | 2017-07-17 | 2019-01-24 | The Broad Institute, Inc. | Cell atlas of the healthy and ulcerative colitis human colon |
| US12105089B2 (en) | 2017-07-17 | 2024-10-01 | The Broad Institute, Inc. | Cell atlas of the healthy and ulcerative colitis human colon |
| US12239646B2 (en) | 2017-07-19 | 2025-03-04 | Dana-Farber Cancer Institute, Inc. | Cancer diagnostic and treatment |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11384383B2 (en) | 2017-08-08 | 2022-07-12 | Depixus | In vitro isolation and enrichment of nucleic acids using site-specific nucleases |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| WO2019060746A1 (en) | 2017-09-21 | 2019-03-28 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| WO2019070755A1 (en) | 2017-10-02 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer |
| US12043870B2 (en) | 2017-10-02 | 2024-07-23 | The Broad Institute, Inc. | Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer |
| WO2019071054A1 (en) | 2017-10-04 | 2019-04-11 | The Broad Institute, Inc. | Methods and compositions for altering function and structure of chromatin loops and/or domains |
| US12297457B2 (en) | 2017-10-10 | 2025-05-13 | Children's Hospital Medical Center | Esophageal tissue and/or organoid compositions and methods of making same |
| US11680296B2 (en) | 2017-10-16 | 2023-06-20 | Massachusetts Institute Of Technology | Mycobacterium tuberculosis host-pathogen interaction |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12589145B2 (en) | 2017-10-20 | 2026-03-31 | Fred Hutchinson Cancer Center | Systems to produce B cells genetically modified to express selected antibodies |
| US11578118B2 (en) | 2017-10-20 | 2023-02-14 | Fred Hutchinson Cancer Center | Systems and methods to produce B cells genetically modified to express selected antibodies |
| US12227742B2 (en) | 2017-10-23 | 2025-02-18 | The Broad Institute, Inc. | Nucleic acid modifiers |
| US11547614B2 (en) | 2017-10-31 | 2023-01-10 | The Broad Institute, Inc. | Methods and compositions for studying cell evolution |
| US12433803B2 (en) | 2017-10-31 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for studying cell evolution |
| WO2019087113A1 (en) | 2017-11-01 | 2019-05-09 | Novartis Ag | Synthetic rnas and methods of use |
| US12221720B2 (en) | 2017-11-13 | 2025-02-11 | The Broad Institute, Inc. | Methods for determining spatial and temporal gene expression dynamics during adult neurogenesis in single cells |
| US12171783B2 (en) | 2017-11-13 | 2024-12-24 | The Broad Institute, Inc. | Methods and compositions for targeting developmental and oncogenic programs in H3K27M gliomas |
| US11332736B2 (en) | 2017-12-07 | 2022-05-17 | The Broad Institute, Inc. | Methods and compositions for multiplexing single cell and single nuclei sequencing |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12379372B2 (en) | 2017-12-21 | 2025-08-05 | Children's Hospital Medical Center | Digitalized human organoids and methods of using same |
| US11994512B2 (en) | 2018-01-04 | 2024-05-28 | Massachusetts Institute Of Technology | Single-cell genomic methods to generate ex vivo cell systems that recapitulate in vivo biology with improved fidelity |
| WO2019138083A1 (en) | 2018-01-12 | 2019-07-18 | Basf Se | Gene underlying the number of spikelets per spike qtl in wheat on chromosome 7a |
| US12005127B2 (en) | 2018-01-17 | 2024-06-11 | Vertex Pharmaceuticals Incorporated | DNA-PK inhibitors |
| US12121524B2 (en) | 2018-01-17 | 2024-10-22 | Vertex Pharmaceuticals Incorporated | DNA-PK inhibitors |
| US12269804B2 (en) | 2018-01-17 | 2025-04-08 | Vertex Pharmaceuticals Incorporated | Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency |
| WO2019143675A1 (en) | 2018-01-17 | 2019-07-25 | Vertex Pharmaceuticals Incorporated | Dna-pk inhibitors |
| WO2019143678A1 (en) | 2018-01-17 | 2019-07-25 | Vertex Pharmaceuticals Incorporated | Dna-pk inhibitors |
| US12509492B2 (en) | 2018-01-19 | 2025-12-30 | Duke University | Genome engineering with CRISPR-Cas systems in eukaryotes |
| AU2022200130B2 (en) * | 2018-02-15 | 2024-03-07 | Sigma-Aldrich Co. Llc | Engineered Cas9 systems for eukaryotic genome modification |
| US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US12589115B2 (en) | 2018-03-29 | 2026-03-31 | The University Court Of The University Of Edinburgh | Haematopoietic stem cell treatment |
| WO2019204585A1 (en) | 2018-04-19 | 2019-10-24 | Massachusetts Institute Of Technology | Single-stranded break detection in double-stranded dna |
| WO2019206927A1 (en) | 2018-04-24 | 2019-10-31 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
| EP3560330A1 (en) | 2018-04-24 | 2019-10-30 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
| US12180490B2 (en) | 2018-04-24 | 2024-12-31 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
| US11957695B2 (en) | 2018-04-26 | 2024-04-16 | The Broad Institute, Inc. | Methods and compositions targeting glucocorticoid signaling for modulating immune responses |
| WO2019210268A2 (en) | 2018-04-27 | 2019-10-31 | The Broad Institute, Inc. | Sequencing-based proteomics |
| US10920222B2 (en) | 2018-04-30 | 2021-02-16 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11485973B2 (en) | 2018-04-30 | 2022-11-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11421227B2 (en) | 2018-04-30 | 2022-08-23 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11788085B2 (en) | 2018-04-30 | 2023-10-17 | Snipr Biome Aps | Treating and preventing microbial infections |
| US12448619B2 (en) | 2018-04-30 | 2025-10-21 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11643653B2 (en) | 2018-04-30 | 2023-05-09 | Snipr Biome Aps | Treating and preventing microbial infections |
| WO2019213660A2 (en) | 2018-05-04 | 2019-11-07 | The Broad Institute, Inc. | Compositions and methods for modulating cgrp signaling to regulate innate lymphoid cell inflammatory responses |
| US11345932B2 (en) | 2018-05-16 | 2022-05-31 | Synthego Corporation | Methods and systems for guide RNA design and use |
| US11802296B2 (en) | 2018-05-16 | 2023-10-31 | Synthego Corporation | Methods and systems for guide RNA design and use |
| US11697827B2 (en) | 2018-05-16 | 2023-07-11 | Synthego Corporation | Systems and methods for gene modification |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| WO2019232542A2 (en) | 2018-06-01 | 2019-12-05 | Massachusetts Institute Of Technology | Methods and compositions for detecting and modulating microenvironment gene signatures from the csf of metastasis patients |
| US12286624B2 (en) | 2018-06-08 | 2025-04-29 | Johann Wolfgang Goethe-Universität Frankfurt am Main | Method for generating a gene editing vector with fixed guide RNA pairs |
| US12036240B2 (en) | 2018-06-14 | 2024-07-16 | The Broad Institute, Inc. | Compositions and methods targeting complement component 3 for inhibiting tumor growth |
| WO2020006036A1 (en) | 2018-06-26 | 2020-01-02 | Massachusetts Institute Of Technology | Crispr effector system based amplification methods, systems, and diagnostics |
| WO2020006049A1 (en) | 2018-06-26 | 2020-01-02 | The Broad Institute, Inc. | Crispr/cas and transposase based amplification compositions, systems and methods |
| US12338436B2 (en) | 2018-06-29 | 2025-06-24 | Editas Medicine, Inc. | Synthetic guide molecules, compositions and methods relating thereto |
| WO2020002592A1 (en) | 2018-06-29 | 2020-01-02 | Stichting Het Nederlands Kanker Instituut - Antoni Van Leeuwenhoek Ziekenhuis | Traf2 inhibitors for use in the treatment of a cancer |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12421500B2 (en) | 2018-07-26 | 2025-09-23 | Children's Hospital Medical Center | Hepato-biliary-pancreatic tissues and methods of making same |
| WO2020028555A2 (en) | 2018-07-31 | 2020-02-06 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| WO2020033601A1 (en) | 2018-08-07 | 2020-02-13 | The Broad Institute, Inc. | Novel cas12b enzymes and systems |
| WO2020041380A1 (en) | 2018-08-20 | 2020-02-27 | The Broad Institute, Inc. | Methods and compositions for optochemical control of crispr-cas9 |
| US12421507B2 (en) | 2018-08-20 | 2025-09-23 | The Broad Institute, Inc. | Methods and compositions for optochemical control of CRISPR-CAS9 |
| WO2020041387A1 (en) | 2018-08-20 | 2020-02-27 | The Brigham And Women's Hospital, Inc. | Degradation domain modifications for spatio-temporal control of rna-guided nucleases |
| WO2020051507A1 (en) | 2018-09-06 | 2020-03-12 | The Broad Institute, Inc. | Nucleic acid assemblies for use in targeted delivery |
| US12428622B2 (en) | 2018-09-12 | 2025-09-30 | Children's Hospital Medical Center | Organoid compositions for the production of hematopoietic stem cells and derivatives thereof |
| EP4268831A2 (en) | 2018-09-12 | 2023-11-01 | Fred Hutchinson Cancer Center | Reducing cd33 expression to selectively protect therapeutic cells |
| US11505578B2 (en) | 2018-09-18 | 2022-11-22 | Vnv Newco Inc. | Endogenous Gag-based capsids and uses thereof |
| US11447527B2 (en) | 2018-09-18 | 2022-09-20 | Vnv Newco Inc. | Endogenous Gag-based capsids and uses thereof |
| US12617822B2 (en) | 2018-09-18 | 2026-05-05 | Aera Therapeutics, Inc. | Arc-based capsids and uses thereof |
| WO2020065062A1 (en) | 2018-09-28 | 2020-04-02 | Wageningen Universiteit | Off-target activity inhibitors for guided endonucleases |
| US12098425B2 (en) | 2018-10-10 | 2024-09-24 | Readcoor, Llc | Three-dimensional spatial molecular indexing |
| WO2020077236A1 (en) | 2018-10-12 | 2020-04-16 | The Broad Institute, Inc. | Method for extracting nuclei or whole cells from formalin-fixed paraffin-embedded tissues |
| WO2020081730A2 (en) | 2018-10-16 | 2020-04-23 | Massachusetts Institute Of Technology | Methods and compositions for modulating microenvironment |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| AU2019372642B2 (en) * | 2018-10-29 | 2023-11-23 | China Agricultural University | Novel CRISPR/Cas12f enzyme and system |
| WO2020093025A1 (en) * | 2018-11-01 | 2020-05-07 | Synthego Corporation | Methods for knock-out of a target sequence through introduction of a premature stop codon |
| US11970733B2 (en) | 2018-11-01 | 2024-04-30 | Synthego Corporation | Methods for analyzing nucleic acid sequences |
| US12165743B2 (en) | 2018-11-09 | 2024-12-10 | The Broad Institute, Inc. | Compressed sensing for screening and tissue imaging |
| US12402610B2 (en) | 2018-11-09 | 2025-09-02 | The Broad Institute, Inc. | Methods and compositions for modulating innate lymphoid cell pathogenic effectors |
| WO2020131586A2 (en) | 2018-12-17 | 2020-06-25 | The Broad Institute, Inc. | Methods for identifying neoantigens |
| WO2020131862A1 (en) | 2018-12-17 | 2020-06-25 | The Broad Institute, Inc. | Crispr-associated transposase systems and methods of use thereof |
| US12264323B2 (en) | 2018-12-17 | 2025-04-01 | The Broad Institute, Inc. | CRISPR CPF1 direct repeat variants |
| US11384344B2 (en) | 2018-12-17 | 2022-07-12 | The Broad Institute, Inc. | CRISPR-associated transposase systems and methods of use thereof |
| US11739156B2 (en) | 2019-01-06 | 2023-08-29 | The Broad Institute, Inc. Massachusetts Institute of Technology | Methods and compositions for overcoming immunosuppression |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12600943B2 (en) | 2019-02-01 | 2026-04-14 | The University Of Hong Kong | Innervated organoid compositions and methods of making same |
| US12534714B2 (en) | 2019-03-18 | 2026-01-27 | The Broad Institute, Inc. | Type VII CRISPR proteins and systems |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12624354B2 (en) | 2019-03-19 | 2026-05-12 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12624353B2 (en) | 2019-03-19 | 2026-05-12 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| WO2020206036A1 (en) | 2019-04-01 | 2020-10-08 | The Broad Institute, Inc. | Novel nucleic acid modifier |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| WO2020229241A1 (en) | 2019-05-10 | 2020-11-19 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2020229533A1 (en) | 2019-05-13 | 2020-11-19 | KWS SAAT SE & Co. KGaA | Drought tolerance in corn |
| WO2020236972A2 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Non-class i multi-component nucleic acid targeting systems |
| WO2020236967A1 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Random crispr-cas deletion mutant |
| WO2020239680A2 (en) | 2019-05-25 | 2020-12-03 | KWS SAAT SE & Co. KGaA | Haploid induction enhancer |
| US12534709B2 (en) | 2019-05-31 | 2026-01-27 | Children's Hospital Medical Center | Shaped organoid compositions and methods of making same |
| WO2020243661A1 (en) | 2019-05-31 | 2020-12-03 | The Broad Institute, Inc. | Methods for treating metabolic disorders by targeting adcy5 |
| US12497597B2 (en) | 2019-05-31 | 2025-12-16 | Children's Hospital Medical Center | Methods of generating and expanding hematopoietic stem cells |
| WO2021003432A1 (en) | 2019-07-02 | 2021-01-07 | Fred Hutchinson Cancer Research Center | Recombinant ad35 vectors and related gene therapy improvements |
| WO2021001534A1 (en) | 2019-07-03 | 2021-01-07 | Wageningen Universiteit | Crispr type v-u1 system from mycobacterium mucogenicum and uses thereof |
| EP3772542A1 (en) | 2019-08-07 | 2021-02-10 | KWS SAAT SE & Co. KGaA | Modifying genetic variation in crops by modulating the pachytene checkpoint protein 2 |
| WO2021041922A1 (en) | 2019-08-30 | 2021-03-04 | The Broad Institute, Inc. | Crispr-associated mu transposase systems |
| WO2021048316A1 (en) | 2019-09-12 | 2021-03-18 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021055874A1 (en) | 2019-09-20 | 2021-03-25 | The Broad Institute, Inc. | Novel type vi crispr enzymes and systems |
| US11981922B2 (en) | 2019-10-03 | 2024-05-14 | Dana-Farber Cancer Institute, Inc. | Methods and compositions for the modulation of cell interactions and signaling in the tumor microenvironment |
| WO2021069387A1 (en) | 2019-10-07 | 2021-04-15 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| WO2021074367A1 (en) | 2019-10-17 | 2021-04-22 | KWS SAAT SE & Co. KGaA | Enhanced disease resistance of crops by downregulation of repressor genes |
| WO2021105191A1 (en) | 2019-11-29 | 2021-06-03 | Basf Se | Increasing resistance against fungal infections in plants |
| WO2021111466A1 (en) * | 2019-12-02 | 2021-06-10 | Council Of Scientific & Industrial Research | Method and kit for detection of polynucleotide |
| WO2021110582A1 (en) | 2019-12-03 | 2021-06-10 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2021122687A1 (en) | 2019-12-19 | 2021-06-24 | Basf Se | Increasing space-time-yield, carbon-conversion-efficiency and carbon substrate flexibility in the production of fine chemicals |
| WO2021122528A1 (en) | 2019-12-20 | 2021-06-24 | Basf Se | Decreasing toxicity of terpenes and increasing the production potential in micro-organisms |
| US12559790B2 (en) | 2020-01-29 | 2026-02-24 | 10X Genomics, Inc. | Compositions and methods for analyte detection |
| EP3872190A1 (en) | 2020-02-26 | 2021-09-01 | Antibodies-Online GmbH | A method of using cut&run or cut&tag to validate crispr-cas targeting |
| US12057197B2 (en) | 2020-04-03 | 2024-08-06 | Creyon Bio, Inc. | Oligonucleotide-based machine learning |
| US12400739B2 (en) | 2020-04-03 | 2025-08-26 | Creyon Bio, Inc. | Oligonucleotide-based machine learning |
| WO2021202938A1 (en) | 2020-04-03 | 2021-10-07 | Creyon Bio, Inc. | Oligonucleotide-based machine learning |
| US12629428B2 (en) | 2020-04-14 | 2026-05-19 | Duke University | AAV vector-mediated deletion of large mutational hotspot for treatment of Duchenne muscular dystrophy |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12505549B1 (en) | 2020-05-22 | 2025-12-23 | Insitro, Inc. | Microscopy image analyses for disease modeling |
| WO2021239986A1 (en) | 2020-05-29 | 2021-12-02 | KWS SAAT SE & Co. KGaA | Plant haploid induction |
| US12203136B2 (en) | 2020-08-17 | 2025-01-21 | Readcoor, Llc | Methods and systems for spatial mapping of genetic variants |
| CN112080587A (en) * | 2020-08-31 | 2020-12-15 | 上海海关动植物与食品检验检疫技术中心 | RAA-CRISPR amplification primer group, kit and method for efficiently detecting novel coronavirus |
| EP4001429A1 (en) | 2020-11-16 | 2022-05-25 | Antibodies-Online GmbH | Analysis of crispr-cas binding and cleavage sites followed by high-throughput sequencing (abc-seq) |
| WO2022155265A2 (en) | 2021-01-12 | 2022-07-21 | Mitolab Inc. | Context-dependent, double-stranded dna-specific deaminases and uses thereof |
| WO2022221699A1 (en) | 2021-04-16 | 2022-10-20 | Beam Therapeutics, Inc. | Genetic modification of hepatocytes |
| WO2022256440A2 (en) | 2021-06-01 | 2022-12-08 | Arbor Biotechnologies, Inc. | Gene editing systems comprising a crispr nuclease and uses thereof |
| WO2023006933A1 (en) | 2021-07-30 | 2023-02-02 | KWS SAAT SE & Co. KGaA | Plants with improved digestibility and marker haplotypes |
| US11884915B2 (en) | 2021-09-10 | 2024-01-30 | Agilent Technologies, Inc. | Guide RNAs with chemical modification for prime editing |
| WO2023093862A1 (en) | 2021-11-26 | 2023-06-01 | Epigenic Therapeutics Inc. | Method of modulating pcsk9 and uses thereof |
| US12098399B2 (en) | 2022-06-24 | 2024-09-24 | Tune Therapeutics, Inc. | Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression |
| US12076375B2 (en) | 2022-06-29 | 2024-09-03 | Snipr Biome Aps | Treating and preventing E coli infections |
| WO2024042199A1 (en) | 2022-08-26 | 2024-02-29 | KWS SAAT SE & Co. KGaA | Use of paired genes in hybrid breeding |
| WO2024064824A2 (en) | 2022-09-21 | 2024-03-28 | Yale University | Compositions and methods for identification of membrane targets for enhancement of nk cell therapy |
| WO2024080067A1 (en) | 2022-10-14 | 2024-04-18 | 株式会社インプランタイノベーションズ | Genome editing method and composition for genome editing |
| WO2024083579A1 (en) | 2022-10-20 | 2024-04-25 | Basf Se | Regulatory nucleic acid molecules for enhancing gene expression in plants |
| WO2024168253A1 (en) | 2023-02-10 | 2024-08-15 | Possible Medicines Llc | Delivery of an rna guided recombination system |
| WO2024168265A1 (en) | 2023-02-10 | 2024-08-15 | Possible Medicines Llc | Aav delivery of rna guided recombination system |
| WO2024173645A1 (en) | 2023-02-15 | 2024-08-22 | Arbor Biotechnologies, Inc. | Gene editing method for inhibiting aberrant splicing in stathmin 2 (stmn2) transcript |
| WO2024206911A2 (en) | 2023-03-30 | 2024-10-03 | Children's Hospital Medical Center | Clinical-grade organoids |
| WO2024220741A1 (en) | 2023-04-19 | 2024-10-24 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for the production of libraries |
| WO2024238977A2 (en) | 2023-05-18 | 2024-11-21 | Children's Hospital Medical Center | Liver organoids with intrahepatic sympathetic nerves, and methods of use thereof |
| WO2024236547A1 (en) | 2023-05-18 | 2024-11-21 | Inceptor Bio, Llc | Modified phagocytic cells expressing chimeric antigen receptors comprising a herpes virus entry mediator (hvem) co-stimulatory domain and uses thereof |
| US12630838B2 (en) | 2023-06-01 | 2026-05-19 | Egenesis, Inc. | Cells, tissues, organs, and animals having one or more modified genes for enhanced xenograft survival and tolerance |
| WO2024263961A2 (en) | 2023-06-23 | 2024-12-26 | Children's Hospital Medical Center | Methods of matrix-free suspension culture |
| WO2025006419A1 (en) | 2023-06-26 | 2025-01-02 | Flagship Pioneering Innovations Vii, Llc | Engineered plasmodia and related methods |
| WO2025027165A1 (en) | 2023-08-01 | 2025-02-06 | Basf Plant Science Company Gmbh | Increased resistance by expression of an ics protein |
| WO2025027166A1 (en) | 2023-08-01 | 2025-02-06 | Basf Plant Science Company Gmbh | Increased resistance by expression of msbp1 protein |
| WO2025046513A1 (en) | 2023-08-29 | 2025-03-06 | Inceptor Bio, Llc | Methods of manufacturing myeloid-derived cells from hematopoietic stem cells and compositions and uses thereof |
| WO2025072803A1 (en) | 2023-09-29 | 2025-04-03 | Children's Hospital Medical Center | Ntrk2 signaling-mediated alveolar capillary injury and repair |
| WO2025158400A1 (en) | 2024-01-24 | 2025-07-31 | Yale University | Compositions and methods of natural killer cell hyperboosts for enhancement of nk cell therapy |
| WO2025162985A1 (en) | 2024-01-30 | 2025-08-07 | Basf Plant Science Company Gmbh | Increased plant disease resistance by expression of a glycine-rich protein |
| WO2025171210A1 (en) | 2024-02-09 | 2025-08-14 | Arbor Biotechnologies, Inc. | Compositions and methods for gene editing via homology-mediated end joining |
| WO2025212920A1 (en) | 2024-04-03 | 2025-10-09 | Children's Hospital Medical Center | Multi-zonal liver organoids |
| WO2025217202A1 (en) | 2024-04-08 | 2025-10-16 | Children's Hospital Medical Center | Bile duct organoid |
| WO2026006542A2 (en) | 2024-06-26 | 2026-01-02 | Yale University | Compositions and methods for crispr/cas9 based reactivation of human angelman syndrome |
| WO2026015832A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Reverse transcriptases and gene editing systems comprising such |
| WO2026015829A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Small reverse transcriptases and gene editing systems comprising such |
| WO2026047626A1 (en) | 2024-08-30 | 2026-03-05 | Inceptor Bio, Llc | Compositions and methods involving immune cells engineered for binding bispecific antibodies for use in cell therapy |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20260022392A1 (en) | Crispr-cas component systems, methods and compositions for sequence manipulation | |
| US20200354742A1 (en) | CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes | |
| HK1247961A1 (en) | Crispr-cas component systems, methods and compositions for sequence manipulation | |
| HK1208056B (en) | Crispr-cas component systems, methods and compositions for sequence manipulation | |
| HK1206388B (en) | Crispr-cas component systems, methods and compositions for sequence manipulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13812430 Country of ref document: EP Kind code of ref document: A1 |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013812430 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013812430 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2894668 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015547530 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P789/2015 Country of ref document: AE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015013786 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20157018662 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2015128102 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2013359262 Country of ref document: AU Date of ref document: 20131212 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112015013786 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150611 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2013812430 Country of ref document: EP |
|
| WWR | Wipo information: refused in national office |
Ref document number: 1020157018662 Country of ref document: KR |
|
| WWC | Wipo information: continuation of processing after refusal or withdrawal |
Ref document number: 1020157018662 Country of ref document: KR |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 1020267010790 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020267010790 Country of ref document: KR |






















