WO2020065062A1

WO2020065062A1 - Off-target activity inhibitors for guided endonucleases

Info

Publication number: WO2020065062A1
Application number: PCT/EP2019/076301
Authority: WO
Inventors: Richard Alexander NOTEBAART; Tim Andreas KÜNNE; Stan Johan Jozef BROUNS; John Van Der Oost
Original assignee: Wageningen Universiteit
Priority date: 2018-09-28
Filing date: 2019-09-27
Publication date: 2020-04-02
Also published as: GB201815820D0

Abstract

Incidence of off-target DNA cleavage when using CRISPR Cas systems for gene modification are lessened or avoided by using oligonucleotides of rational design and which are antisense to target sequence of the guide RNA or other targeting nucleic acid sequence. Whether in vitro or in vivo, a target nucleic acid comprising a targeted sequence is exposed to the CRISPR enzyme and relevant guiding RNA (or ribonucleoprotein complex) with the antisense oligonucleotide. The antisense oligonucleotide is exposed to the target nucleic acid substantially simultaneously, separately or sequentially together with the CRISPR enzyme or ribonucleoprotein complex.

Description

Off-target activity inhibitors for guided endonucleases

This invention relates to a field of gene editing using RNA guided endonucleases, well known examples of which are CRISPR enzymes, but also including the Cascade protein complex.

BACKGROUND

The nucleases Cas9 and Cas12a (previously known as Cpf1 ) provide a bedrock of the recently established field of genome editing. These nucleases are guided by an RNA molecule which forms a ribonucleoprotein which undertakes cleavage of desired target genome sequences. A continuing problem with these guided nucleases is that despite the relative specificity of their cleavage of genomic sequences, there are still off-target effects. Such off-target effects are reviewed in Razzouk, S. (2018) CRISPR-Cas9: A cornerstone for the evolution of precision medicine. Ann Hum Genet. 16^th July 2018; and also Wu,

W.Y., Lebbink, J.H.G., Kanaar, R., Geijsen, N. and van der Oost, J. (2018) Genome editing by natural and engineered CRISPR-associated nucleases. Nat Chem Biol, 14, 642- 651.)

The risk for off-target effects is highly dependent on the chosen target, cell type/organism and the experimental approach. Especially medical applications, such as the correction of genetic errors in patients, require absolute safety of the technique with regard to unwanted modifications of a patient genome.

Steps are being made by researchers towards a safe gene editing toolbox, by optimizing delivery, creating recombinant proteins with improved specificity and by finding ways to control the activity of the proteins with external stimuli. The latter category includes controlled inhibition of protein activity.

Already known are phage-encoded anti-CRISPR (ACR) proteins. Chaudhary, K.,

Chattopadhyay, A. and Pratap, D. (2018) Anti-CRISPR proteins: Counterattack of phages on bacterial defense (CRISPR/Cas) system. J Cell Physiol, 233, 57-59 is a review article which collates the findings of a number of individual scientific papers and proposes a molecular mechanism of anti-CRISPR proteins.

Shin, J., Jiang, F., Liu, J.J., Bray, N.L., Rauch, B.J., Baik, S.H., Nogales, E., Bondy- Denomy, J., Corn, J.E. and Doudna, J.A. (2017) Disabling Cas9 by an anti-CRISPR DNA mimic. Sci Adv, 3, e 1701620 describes an ACR protein (ACRII-A4) which is able to inhibit Cas9 activity. What was shown is that a timely delivery of the ACR into a human cell line, after delivery of a targeting Cas9, allowed on-target editing, while reducing off-target effects. ACR proteins are, however, not an ideal inhibitor for medical applications because they are relatively difficult to produce, store and deliver into cells.

Li B. et al. (2018)“Phosphorothioate-modified DNA oligonucleotides inactivate CRISPR- Cpfl mediated genome editing” bioRxiv 253757; doi: https ://doi .orq/10.1101/253757 identify that phosphorothioate (PS)-modified DNA-crRNA duplex completely blocks the function of Cpf1 mediated gene editing. Also, without prehybridization, this PS-modified DNA was able to regulate Cpf1 activity in a time- and dose-dependent manner. The suggestion is using the PS-modified DNA as an“antidote” to Cpf1 -mediated genome editing.

BRIEF SUMMARY OF THE DISCLOSURE

The inventors have discovered that in connection with a nucleic acid modification protocol involving a CRISPR enzyme and guide RNA targeting a particular nucleic acid sequence, an oligonucleotide which is antisense to the target (and to the guide) can be used so as to reduce off-target effects.

Accordingly, the present invention provides a method of modifying a nucleic acid by a CRISPR enzyme or a Cascade protein complex guided to a predetermined target sequence comprised in the target nucleic acid by a targeting RNA molecule, wherein the method reduces off-target nucleic acid modification, comprising exposing the nucleic acid to: (a) (i) the CRISPR enzyme or Cascade protein complex and the targeting RNA molecule, or (ii) a ribonucleoprotein complex of the CRISPR enzyme or Cascade protein complex and the targeting RNA molecule, and (b) an oligonucleotide comprising a nucleic acid sequence antisense to the sequence of the target nucleic acid.

In preferred aspect, the antisense oligonucleotide is exposed to the nucleic acid substantially simultaneously together with the guided CRISPR enzyme or Cascade protein complex. Therefore, in connection with the main aspect of the invention above, the antisense oligonucleotide may be exposed to the nucleic acid simultaneously, separately or sequentially with the guide, CRISPR enzyme or Cascade protein complex, also whereby the antisense oligonucleotide may be exposed to the nucleic acid before or after the guide, CRISPR enzyme or Cascade protein complex.

Also, the invention provides a method of modifying a nucleic acid by a CRISPR enzyme or a Cascade protein complex guided to a predetermined target sequence comprised in the target nucleic acid by a targeting RNA molecule, wherein the method reduces off-target nucleic acid modification, comprising exposing the nucleic acid to (a) the CRISPR enzyme or Cascade protein complex and the targeting RNA molecule, or (b) a ribonucleoprotein complex of the Cas enzyme or Cascade protein complex and the targeting RNA molecule, such that modification proceeds, and then exposing the nucleic acid to an oligonucleotide comprising a nucleic acid sequence antisense to the sequence of the target nucleic acid.

Advantageously the exposure of the nucleic acid to the antisense oligonucleotide has the effect of reducing off-target modification by the CRISPR enzyme or Cascade complex. Without wishing to be bound by any particular theory, the inventors envisage that the antisense oligonucleotide interacts with the targeting RNA molecule whether free or as part of a ribonucleoprotein complex so as to prevent the interaction of the ribonucleoprotein complex with the nucleic acid whether in an in vitro reaction mixture or in a cell in vivo or ex vivo. Again, without wishing to be bound by any particular theory, it is envisaged that reduction of off-target modifications may be achieved through prevention of protracted activity of the CRISPR enzyme or Cascade complex, which can lead to off-target modification events, and/or through competitive binding, which preferentially interferes with binding of the CRISPR enzyme or Cascade complex at off-target sites.

As described herein, the off-target effect(s) can be reduced or eliminated completely. In terms of reduction of off-target effect, this may be at least a 50% reduction compared to a reference example of nucleic acid modification (same components and conditions) but minus the antisense oligonucleotide. Optionally such a reduction in off-target effect may be a reduction selected from 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%. 100%.

The nucleic acid to be modified may be comprised in DNA, e.g. chromosomal DNA.

Alternatively, the target sequence to be modified may be or may be comprised within an RNA sequence; optionally wherein the RNA molecule is selected from the group consisting of messenger RNA (mRNA), pre-mRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro-RNA (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), double stranded RNA (dsRNA), non-coding RNA (ncRNA), long non-coding RNA (IncRNA), and small cytoplasmic RNA (scRNA).

The modifying of a nucleic acid in accordance with the invention has a wide variety of utility including deleting, inserting, translocating, inactivating or activating a target DNA or RNA in any kind of cell from any kind of organism, including prokaryote or eukaryote. As such the nucleic acid-targeting of the invention with reduced off-target effect has a broad spectrum of applications for example in gene therapy, drug screening, disease diagnosis, and prognosis. An exemplary nucleic acid-targeting complex comprises a DNA or RNA- targeting effector protein complexed with a guide RNA hybridized to a target sequence within the target locus of interest. The target nucleic acid sequence noted herein may equate with being the target locus of interest in various aspects of the invention. An off-target effect is readily determined in the absence of an antisense oligonucleotide as used in the present invention in conjunction with genomic analysis and/or phenotypic and/or biochemical analysis of the cell, organism or in vitro system.

The CRISPR enzyme may be a Cas protein. Non-limiting examples of Cas proteins include Cas1 , Cas1 B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas 12a (Cpf1 ), Csy1 , Csy2, Csy3, Cse1 , Cse2, Csd , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1 , Cmr3, Cmr4, Cmr5, Cmr6, Csb1 , Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1 , Csx15, Csf1 , Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. Indeed, the terms“Cas enzyme”,“CRISPR enzyme”,“CRISPR protein”,“Cas protein” and“CRISPR Cas” may generally be used interchangeably.

The Cascade protein complex may be as described in WO2013/098244 A1

WAGENINGEN UNIVERSITEIT, for example.

The targeting RNA molecule is designed to have complementarity, where hybridization between a target sequence and the RNA targeting molecule promotes the formation of a RNA-targeting complex. Targeting RNA molecules in accordance with the invention may include mature crRNA, guide RNA (gRNA) or single guide RNA (sgRNA) and these terms can be used interchangeably. In general, a targeting RNA has a sufficient

complementarity with the target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of the CRISPR enzyme or Cascade complex to the target sequence. The degree of complementarity between a targeting RNA and its corresponding target sequence may be more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more, with optimal algorithmic alignment. Throughout this specification in any context, optimal alignment may be determined using, for example, any of the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (lllumina, San Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

Where individual components are pre-assembled as a ribonucleoprotein (RNP), this can be used to achieve target locus modifications. Such RNPs may be introduced directly into plant cells for example by electroporation or by bombardment using RNP-coated particles; also chemical transfection or by some other means of transport across a cell membrane of a protoplast. Methods of the invention may be in vitro, for example they are performed using a synthetic mix of the reaction components of: target nucleic acid, CRISPR enzyme or Cascade complex, the targeting RNA (usually a guide RNA (gRNA)) in a suitable buffer system. In some in vitro embodiments there is used a cell-free transcription/translation system.

Methods of the invention are preferably employed occurring ex vivo, for example in a cell or cell culture. In ex vivo treatments, diseased cells are removed from the body, edited and then transplanted back into the patient. Ex vivo editing has an advantage of allowing the target cell population to be well defined and the specific dosage of therapeutic molecules delivered to cells to be specified. In one aspect, the invention provides therapeutic methods for organisms (humans or animals), whereby a single cell or a population of cells is sampled or cultured and then that cell or cells are modified ex vivo, as described herein, and then re- introduced into the organism. The cells modified ex vivo may be stem cells, whether embryonic or induce pluri potent or totipotent stem cells, including totipotent stem cells, which may preferably be non-human totipotent stem cells.

In vivo embodiments are also provided. In vivo editing can be used advantageously from this disclosure and the knowledge in the art.

In preferred aspect of the invention, the predetermined sequence in the target nucleic acid is modified before being exposed to the antisense oligonucleotide. In this context, the exposing of antisense oligonucleotide with target nucleic acid, i.e. the target locus, means that the antisense oligonucleotide is also exposed to all other elements of the system, whether in vitro or within a cell. When a eukaryotic cell is involved, the antisense oligonucleotide may be injected directly into the nucleus. The timing of this step is therefore more particular in that the desired modification of target locus has gone to near completion. In vitro or ex vivo, for example in the context of individual cells, the earliest time point of completion of nucleic acid modification at the locus of interest is determinable experimentally using methods well known to a person of average skill in the art. This then allows the timing of exposure of the cell, tissue or cell-free system with the antisense oligonucleotide to be carried out, using whichever method of delivery is chosen as appropriate. The time taken from delivery to exposure of the antisense oligonucleotide with the target nucleic acid is itself readily determined by the average skilled person using common techniques known in the field of art.

In preferred ways of carrying out the invention as described herein, the antisense oligonucleotide can have any suitable chemical modification to the phosphodiester backbone to improve antisense oligonucleotide (ASO) pharmacokinetic properties, tolerability profile, and target binding affinity. Phosphorothioate DNA, phosphorodiamidate morpholino (PMO), and peptide nucleic acid designs all confer resistance to nucleases and enhanced uptake in cells, resulting in increased potency of the ASO. Tricyclo-DNAs (tcDNA) are conformationally constrained DNA analogues with increased potency and enhanced uptake in tissues after systemic administration. Ribose substitutions, including 2'-0-methyl (2'-OMe), 2'-0-methoxyethyl (2'-MOE), and locked nucleic acid, are frequently used in combination to further increase stability, enhance target binding, and generally confer less toxicity than unmodified designs.

Thus, the invention includes any, animal or cell, produced by the present methods, or a progeny thereof. The progeny may be a clone of the produced plant or animal or may result from sexual reproduction by crossing with other individuals of the same species to introgress further desirable traits into their offspring. The cell may be in vivo or ex vivo in the cases of multicellular organisms, particularly animals or plants.

The invention also provides a kit for CRISPR or Cascade complex targeted gene modification with reduced off-target effects, comprising one or more containers comprising one or more vectors comprising:

a. a polynucleotide sequence encoding a CRISPR enzyme or Cascade protein complex,

b. a polynucleotide sequence encoding a targeting RNA molecule; and

c. a polynucleotide sequence encoding an antisense oligonucleotide,

wherein each vector also comprises regulatory elements so as to result in transcription of the polynucleotide sequences in a cell or cell-free expression system, so that each of the CRISPR enzyme or Cascade proteins, the targeting RNA molecule and the antisense oligonucleotide are produced, wherein the targeting RNA molecule has base pairing affinity with a desired target nucleic acid sequence, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to a portion of the nucleotide sequence of the targeting RNA molecule.

Also provided is a kit for CRISPR or Cascade complex targeted gene modification with reduced off-target effects, comprising one or more containers comprising one or more vectors comprising:

a. a polynucleotide sequence encoding a CRISPR enzyme or Cascade protein complex, and

b. a polynucleotide sequence encoding a targeting RNA molecule; and

a container comprising a synthetic antisense oligonucleotide;

wherein each vector also comprises regulatory elements so as to result in transcription of the polynucleotide sequences in a cell or cell-free expression system, so that each of the CRISPR enzyme or Cascade proteins and the targeting RNA molecule are produced, wherein the targeting RNA molecule has base pairing affinity with a desired target nucleic acid sequence, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to a portion of the nucleotide sequence of the targeting RNA molecule.

The invention further provides a kit for CRISPR or Cascade complex targeted gene modification with reduced off-target effects, comprising one or more containers comprising: a. a CRISPR enzyme or Cascade protein complex;

b. a targeting RNA molecule; and

c. a synthetic antisense oligonucleotide;

wherein the targeting RNA molecule has base pairing affinity with a desired target nucleic acid sequence and forms a ribonucleoprotein complex with the CRISPR enzyme or Cascade protein complex, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to the nucleotide sequence of the targeting RNA molecule.

The invention yet further provides a kit for CRISPR or Cascade complex targeted gene modification with reduced off-target effects, comprising one or more containers comprising: a. a ribonucleoprotein complex comprising a CRISPR enzyme or Cascade protein complex and a targeting RNA molecule; and

b. a synthetic antisense oligonucleotide;

wherein the targeting RNA molecule in the ribonucleoprotein complex has base pairing affinity with a desired target nucleic acid sequence, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to the nucleotide sequence of the targeting RNA molecule.

Kits of the invention may comprise instructions for operation and use, wherein such instructions can be in the form of accompanying leaflet in a package comprising the kit components and/or the instruction materials can be available in any format online.

The kits may also include additional components to assist with sample preparation such as buffers or reagent mixes. Additionally or alternatively kits may include additional components to assist in the transfection of vectors into cells or the direct take up of oligonucleotides into cells.

Accordingly, the invention also provides a synthetic composition comprising a ribonucleoprotein complex and an antisense oligonucleotide, wherein the ribonucleoprotein complex comprises a CRISPR enzyme or a Cascade protein and a targeting RNA molecule, and wherein the targeting RNA molecule has base pairing affinity with a desired target nucleic acid sequence, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to a portion of the nucleotide sequence of the targeting RNA molecule.

The invention further provides a synthetic composition comprising a vector system, wherein the vector system comprises one or more vectors, the one or more vectors comprising: a. a polynucleotide sequence encoding a CRISPR enzyme or a Cascade protein complex,

b. a polynucleotide sequence encoding a targeting RNA molecule for the CRISPR enzyme or Cascade protein; and

c. a polynucleotide sequence encoding an antisense oligonucleotide,

wherein each vector also comprises regulatory elements so as to result in transcription of the polynucleotide sequences in a cell or cell-free expression system, so that each of the CRISPR enzyme or Cascade proteins, the targeting RNA molecule and the antisense oligonucleotide are produced, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to a portion of the nucleotide sequence of the targeting RNA molecule, and wherein the targeting RNA molecule has base pairing affinity with a desired target nucleic acid sequence.

The polynucleotide sequences (a), (b) and (c) may be comprised in the same or different vectors. In some preferred embodiments, the polynucleotide sequences (a), (b) and (c) are comprised in the same vector.

In another embodiment, the polynucleotide sequences (a), (b) may be comprised in a first vector and polynucleotide sequence (c) is comprised in a second vector.

In yet another embodiment, the polynucleotide sequence (a) is comprised in a first vector and polynucleotide sequences (b) and (c) are comprised in a second vector.

In yet another embodiment, the polynucleotide sequence (a) is comprised in a first vector, polynucleotide sequence (b) is comprised in a second vector, and polynucleotide (c) is comprised in a third vector.

In advantageous aspect, the expression vector carrying the coding sequence of the antisense oligonucleotide may comprise an inducible promoter so that the antisense oligonucleotide expression can be switched on at the desired time, preferably subsequent to the CRISPR enzyme (or Cascade protein complex) and targeting RNA expression. Such a chemical or temperature inducible expression of the antisense oligonucleotide in a cell or cell-free system can be used to provide a highly sensitivity way of timed antisense activity consistent with achieving reduction or inhibition of off-target effects.

In accordance with the invention in any of the aspects described herein, a synthetic composition is something which does not occur naturally and/or requires some non-natural component or non-natural activity to have taken place. A synthetic composition may include naturally occurring components and so may be a combination of natural and non-natural components. Included within the meaning of a synthetic composition is a cell which includes an artificial or non-naturally occurring molecule or molecules in the context of that cell.

The antisense oligonucleotide has particular affinity for and therefore preferably binds to the targeting RNA molecule in the ribonucleoprotein complex.

In any of the aforementioned aspects of the invention, “base pairing affinity” and “complementarity" may be used interchangeably and refer to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson- Crick base pairing or other non-traditional types. A percent identity (i.e. complementarity) indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% identity). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence, and this is a preferred condition for antisense oligonucleotide binding to the targeting RNA which corresponds to 100% identity for a length of targeting RNA molecule which is the same length as the antisense oligonucleotide. Also, the term "substantially complementary" as used herein refers to a degree of identity that is at least 90%, 95%, 97%, 98%, 99%, or 100% between the portion of the antisense oligonucleotide and the equivalent length of targeting RNA molecule. This may also correspond to nucleic acids that hybridize under stringent conditions.

As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions surrounding the nucleic acids, temperature, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001 ); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993), each of which are incorporated herein by reference. The T_m is the temperature at which more than 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand. The following is an exemplary set of hybridization conditions and is not limiting:

Very High Stringency (allows sequences that share at least 90% identity to hybridize) Hybridization: 5x SSC at 65 °C for 16 hours; wash twice: 2x SSC at room temperature (RT) for 15 minutes each; wash twice: 0.5x SSC at 65°C for 20 minutes each.

High Stringency (allows sequences that share at least 80%> identity to hybridize) Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours; wash twice: 2x SSC at RT for 5-20 minutes each; wash twice: lx SSC at 55°C-70°C for 30 minutes each.

Low Stringency (allows sequences that share at least 50%> identity to hybridize); hybridization: 6x SSC at RT to 55°C for 16-20 hours; wash at least twice: 2x-3x SSC at RT to 55 °C for 20-30 minutes each.

In the aforementioned kits of the invention, the vectors and constructs may be as described in more detail, for example in WO2013/176772 A1 or WO2014/093595 A1 , both of which are incorporated herein by reference.

In any such systems comprising vectors, the one or more vectors may comprise one or more viral vectors, such as one or more retrovirus, lentivirus, adenovirus, adeno-associated virus or herpes simplex virus. Also, in any such systems comprising regulatory elements, at least one of said regulatory elements may comprise a tissue-specific promoter, whether or animal including human, or plant.

The invention includes a synthetic composition comprising two more compositions as hereinbefore defined. As will be appreciated, this means that the invention includes a multiplexed approach whereby 2 or more antisense oligonucleotides are used together with 2 or more targeting RNA oligonucleotides whereby a multiplicity of loci are targeted for modification at the same time.

In any preferred ex vivo aspects of the invention, the synthetic composition may be comprised in any organ, part, tissue or cell of a human, animal or plant; preferably a eukaryotic cell; optionally a human cell. Likewise, in any preferred in vivo aspects of the invention, the synthetic composition may be comprised in a human, animal, plant or prokaryote, e.g. bacterium.

In any of the aspects of the invention, the antisense oligonucleotides have at least 8 contiguous nucleotides complementary to nucleotides of the targeting RNA. The particular minimum number of contiguous nucleotides depends on the particular CRISPR enzyme or Cascade complex being used, but this number can be determined without undue burden by a person of average skill in the art. For example, where Cas12a is used there are (excluding the PAM) at least the 8 complementary nucleotides referred to above. For example, where Cas9 is used then at least 15 complementary nucleotides may be used. Therefore, the antisense oligonucleotides used in the present invention may have at least 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34 or 35 contiguous nucleotides.

Also, in any of the aspects of the invention, the antisense oligonucleotide may further comprise a Protospacer Adjacent Motif (PAM) sequence recognised by the CRISPR enzyme or Cascade complex. The PAM sequence is readily determinable for an average skilled person and is a 2 - 6, often 3 base sequence. Preferably the PAM is comprised in a hairpin loop as part of the antisense oligonucleotide. For example, for Cas12a, the antisense oligonucleotide consists of 8 nucleotides plus 12 nucleotides of the PAM which forms a hairpin loop.

The PAM may be at the 5’ end or the 3’ end of the antisense oligonucleotide, appropriate for the CRISPR enzyme being employed.

In any aspect of the invention, the antisense oligonucleotide is preferably not more than 32 nucleotides long. The length of the antisense oligonucleotide when it is not synthesized from a vector system in a cell but rather introduced as a synthetic oligonucleotide into a cell is assisted by the shortest possible length. Therefore, the antisense oligonucleotide may be not more than 32, 31 , 30, 29, 28, 27, 26, 25 ,24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10 or 9 nucleotides.

Preferred CRISPR enzymes for use in connection with any aspect of the invention are Cas9 or Cas12a (formerly known as Cpf1 ).

In some aspects of the kit or synthetic composition of the invention, there may be a Nuclear Localisation Signal (NLS) in proximity to the N- or C-terminus of the CRISPR enzyme or Cascade protein. This naturally targets the nucleic acid modification to the nucleus of a eukaryotic cell. Allied to this the antisense oligonucleotide may be inserted directly via pronuclear injection.

BRIEF DESCRIPTION OF THE DRAWINGS

Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which: Figure 1 is a schematic diagram showing an overview of antisense oligo inhibitor strategy and design.

Figure 2 is a photograph of a 1 % agarose gel showing the results of in vitro activity assays for four test inhibitory oligonucleotides acting against a pre-assembled Cas12a-guide RNA complex which cleaves at a target sequence in a DNA substrate. Oligo inhibitors were first incubated with pre-assembled Cas12a-guide RNA complex, then the target DNA was added. The top band is the 1 kb DNA target. Cleavage produces two similar sized products. Reactions were sampled at t = 0 min, 1 min, 10 min, 30 min.

Figure 3 is a photograph of a 1 % agarose gel showing the results of in vitro assays for test inhibitory oligonucleotides acting pre-assembled Cas12a-guide RNA complex which cleaves at a target sequence in a DNA substrate. Oligos were added simultaneously with target (panel A) or after target (panel B). The top band is the 1 kb DNA target. Cleavage produces two similar sized products. Reactions were sampled at t = 0 min, 1 min, 10 min, 30 min.

Figure 4 is a photograph of a 1% agarose gel showing the results of in vitro activity assays for test inhibitory oligonucleotides of various lengths, acting against a pre- assembled Cas12a-guide RNA complex which cleaves at a target sequence in a DNA substrate. A PAM plus 8 nt oligo was lengthened in steps of 1 nt, and a PAM plus 23 nt oligo was shortened in steps of 1 to provide the test oligos. The top band is the 1 kb DNA target. Cleavage produces two similar sized products. Inhibitors were premixed with target DNA and added to the Cas12a-guide RNA complex.

Figure 5 is a photograph of a 1 % agarose gel showing the results of in vitro activity assays for test inhibitory oligonucleotides of various lengths, acting against a pre- assembled Cas9-guide RNA complex which cleaves at a target sequence in a DNA substrate. Oligo inhibitors were premixed with target DNA and added to Cas9-guide RNA complex. The top band is the 1 kb DNA target. Cleavage produces one large and one small fragment.

Figure 6 is a schematic representation of the CRISPR-Cas9/Cas12a double PAM (dPAM) reporter system.

Figure 7 shows the percentage of dTomato positive events as measured by reduction of red cellular fluorescence events in FACS analysis of KBM7 dPAM cells transduced with Cas9/sgRNA iTOP mix in the presence of ssDNA oligo inhibitors and control oligos.

Figure 8 shows the percentage of dTomato positive events as measured by reduction of red cellular fluorescence events in FACS analysis of KBM7 dPAM cells transduced with Cas12a/crRNA iTOP mix in the presence of ssDNA oligo inhibitors and control oligos.

DETAILED DESCRIPTION

In other aspect, the invention also includes a method of modifying a nucleic acid by a CRISPR enzyme or a Cascade protein complex guided to a predetermined target sequence comprised in the target nucleic acid by a targeting RNA molecule, comprising exposing the nucleic acid to (a) the CRISPR enzyme or Cascade protein complex and the targeting RNA molecule, or (b) a ribonucleoprotein complex of the Cas enzyme or

Cascade protein complex and the targeting RNA molecule, and exposing the nucleic acid to an oligonucleotide comprising a nucleic acid sequence antisense to the sequence of the target nucleic acid. Such methods may be in vitro, ex vivo or in vivo as previously described. Advantageously the antisense oligonucleotide provides a degree of control or modulation of the CRISPR or Cascade complex targeted activity in modifying the target nucleic acid.

In such methods, the CRISPR enzyme or Cascade complex may be exposed to the targeting RNA molecule and to the antisense oligonucleotide substantially simultaneously.

Alternatively, the CRISPR enzyme or Cascade complex are in the form of a ribonucleoprotein complex with the targeting RNA molecule when exposed to the antisense oligonucleotide.

In another aspect, the CRISPR enzyme or Cascade complex may be exposed to the targeting RNA molecule and to the antisense oligonucleotide separately. In one possibility, the oligonucleotide is present first and the targeting RNA molecule is present subsequently. In another possibility the targeting RNA molecule is present first and the antisense oligonucleotide is present subsequently.

Generally, the term "vector" herein refers to a nucleic acid molecule capable of

transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g., circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art.

A plasmid may be vector in accordance with this description, which is a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.

Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Some vectors are able to direct expression of genes to which they are operatively-linked. Such vectors are "expression vectors" and there will usually be regulatory elements, which may be selected on the basis of the host cells in which the expression takes place. This means the nucleic acid to be expressed is operably linked to the regulatory elements thereby resulting in expression of the nucleotide sequence whether in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell.

Suitable regulatory elements include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). For more information the average skilled person would refer to, for example, in Goeddel, (1990), Gene Expression

Technology in Methods in Enzymology vol 185, Academic Press. Regulatory elements include those giving direct constitutive expression in many types of host cell and those that direct expression of the nucleotide sequence only in certain cells (i.e., tissue-specific regulatory sequences).

A tissue-specific promoter directs expression primarily in a desired tissue of interest, such as blood, specific organs (e.g., liver, pancreas), or particular cell types. Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell- cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. Examples of promoters include pol I, pol II, pol III (e.g. U6 and H1 promoters). Examples of pol II promoters include, but are not limited to, retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), the SV40 promoter, the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1a promoter.

As well as promoters, regulatory elements may include enhancer elements, such as WPRE; CMV enhancers; the R-U5' segment in LTR of HTLV-I; SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit b-globin. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. Methods of non-viral delivery of nucleic acids may include lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid ucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of

polynucleotides include those of Feigner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration.

The invention encompasses methods of modifying a genomic locus of interest to change gene expression in a cell by introducing into the cell any of the compositions described herein. This may include medical uses in humans for therapeutic or non-therapeutic purposes. Furthermore, any of the methods described herein may be applied in vitro and ex vivo. For therapeutic purposes, these may be gene or genome editing, or gene therapy. The invention also encompasses methods of modifying genomic loci for non- medical uses in animals, plants, algae or fungi; or in prokaryotes including bacteria and archaea.

For any of the aspects of the invention described herein, the antisense oligonucleotides may be other than (a) a phosphorothioate DNA or RNA; and/or (b) 2’ fluoro RNA. A Also, separately or in addition, for any of the aspects of the invention described herein, the CRISPR enzyme may be other than Cas12a (formerly called Cpf1 ).

Also, optionally, not of the invention are any antisense oligonucleotides with any one or more of the following sequences:

UAAUUUCUACUCUUGUAGAUCUGAUGGUCCAUGUCUGUUACUC (SEQ ID NO: 1 ); GAGT AACAGACATGGACCAT CAGAAATT A (SEQ ID NO: 2);

GAGT AACAGACAT GGACCAT CAGAT CT ACAAGAGT AGAAATT A (SEQ ID NO: 3);

AT CT ACAAG AGT AG AAATT A (SEQ ID NO: 4);

GTAGAAATTA (SEQ ID NO: 5);

ATCTACAAGA (SEQ ID NO: 6);

GAGT AACAGACAT GGACCAT CAG (SEQ ID NO: 7);

GG AC CATC AG (SEQ ID NO: 8);

GAGTAACAGACAT (SEQ ID NO: 9);

T AACAGACAT G G AC CAT CAG (SEQ ID NO: 10);

T AACAGACAT (SEQ ID NO: 1 1 );

GAGT AACAGACAT G GACCAT CAGAT CT ACAAGAGT AGAAATT A (S EQ ID NO: 12); AT CT AC AAG AGT AG AAATT A (SEQ I D NO: 13);

GAGT AACAGACAT GGACCAT CAG (SEQ I D NO: 14);

GAG U AACAG ACAU G GACCAU CAG AU C U ACAAGAG U AG AAAU U A (SEQ I D NO: 15);

AU C U AC AAGAG U AG AAAU U A (SEQ ID NO: 16);

GAG U AACAGACAU (SEQ I D NO: 17);

AU C U AC AAGAG U AG AAAU U A (SEQ ID NO: 18);

GAG U AACAGACAU (SEQ I D NO: 19);

AU C U AC AAGAG U AG AAAU U A (SEQ ID NO: 20);

GAG U AACAGACAU (SEQ I D NO: 21 );

GAG U AACAG ACAU G GACCAU CAG AU C U ACAAGAG U AG AAAU U A (SEQ I D NO: 22);

U AAU U U C U AC U C U U G U AG AU C U U ACGAU G GAG CCAG AGAG GAU (SEQ ID NO: 23); ATCCTCTCTGGCTC CAT C GT AAG AT CT AC AAG AGT AG AAATT A (SEQ I D NO: 24);

UAAUUUCUACUCUUGUAGAUGUCGGCAUGGCCCCAUUCGCACG (SEQ I D NO: 25);

C GTG C G AAT G G G G C CAT G C C G AC AT CT AC AAG AGT AG AAATT A (SEQ I D NO: 26); AAUUUCUACUAAGUGUAGAUCUGAUGGUCCAUGUCUGUUACUC (SEQ ID NO: 27); or GAGT AACAGACAT GGACCAT CAG AT CT AC AAG AGT AG AAATT A (SEQ I D NO: 28).

EXAMPLES

In order to assess the efficacy of antisense oligonucleotide inhibitors for Cas9 and Cas12a, the inventors performed in vitro assays with purified protein. Streptococcus pyogenes Cas9 (SpyCas9) and Acidaminococcus Cas12a (AsCas12a) are the currently the most frequently used genome editing nucleases. The target sites chosen are in human genes that are frequently reported in related literature. These are the DNMT1 gene for Cas12a, and the VDR gene for Cas9.

Four different antisense oligos were designed as shown schematically in Figure 1 , having different lengths to determine the minimal/optimal length for an inhibitor. These are the 23 nt full length oligo (primer 1 1 , see Table 1 below), covering the entire basepairing segment of the guide, a 15 nt (primer 13) and a 12 nt (primer 15) intermediate, and an 8 nt oligo that carries a double stranded PAM sequence via a hairpin loop (primer 9). The PAM sequence is known to be vital for target identification and binding by Cas9/Cas12a.

Approximately 8 nt next to the PAM are known as the seed sequence of the gRNA and are of higher importance for basepairing with a target than the rest of the guide. It is therefore possible that the PAM distal part of the guide can be omitted in the inhibitors without sacrificing efficacy.

Materials and Methods Primers and oligonucleotides

All primers and oligonucleotides used are listed in table 1 below: Table 1

Protein production

E. coli Rosetta strains (with pRARE: Rosetta™(DE3) Competent Cells - Novagen®) were obtained from Merck and used with either pET21 a-AsCas12a-His6 (Merck) or pET28b- SpyCas9-His6 (Addgene). The pET-21 (+) DNA - Novagen® plasmid was obtained from Merck. 10 ml starter cultures were inoculated from glycerol stocks and grown overnight at 37 °C in LB with the appropriate antibiotics. The next day, 1 I medium with the appropriate antibiotics was inoculated (1 :100) and grown to an Oϋboo of 0.8 at 37°C. Next, cells were cold shocked for 30 min and protein expression was induced by adding IPTG (0.2 mM). Cells were incubated at 20 °C overnight. The next day, cells were collected by

centrifugation and resuspended in ice cold Buffer L (50 mM NahhPCU, 500 mM NaCI, 5 mM Imidazol, 1 mM b-mercaptoethanol, pH 8). Next, cells were lyzed with a sonicator (4 °C; 1s pulse, 2s pause, 10 min, amplitude 30). Lysate was cleared by centrifugation at 18.000 g at 4 °C for 30 min. Cleared lysate was incubated with His-select NiNTA beads for 20 min at 4 °C (rotating) and loaded onto a gravity column. Beads were washed with 20-30 column volumes of buffer W (50 mM NaH₂P0₄, 500 mM NaCI, 10 mM Imidazol, 1 mM b-mercaptoethanol, pH 8). Protein was eluted with buffer E (50 mM NaH₂P0₄, 500 mM NaCI, 250 mM Imidazol, 1 mM b-mercaptoethanol, pH 8). Elutions were pooled and buffer exchanged into buffer S (250 mM TRIS-HCI, 500 mM NaCI, 5% glycerol, pH 8) using a Millipore Amicon Ultra 50.000 MWCO centrifugal filter. Protein solution was brought to 50% glycerol and stored at -20 °C.

Guide RNA production

Guide RNAs for Cas9 and Cas12a were produced by in vitro transcription (IVT). Cas9 sgRNA targeting the human VDR1 gene was produced by PCR amplifying the IVT template from a plasmid (pT7-VDR1 , primers 2/3). Cas12a guides were produced from oligo templates by annealing primers 1/39. IVT was performed using the NEB high yield IVT kit according to manufacturer’s instructions. Guide RNAs were purified using

Zymogen RNA purification columns. RNAs were diluted to 100 ng/mI and stored at -20 °C.

In vitro activity assays (agarose)

Target DNA was produced by PCR from plasmids (Cas9: pFUhygro-VDR, primer 6/7; Cas12a: pTS005-DNMT1 , primer 4/5). 1 kb fragments were used for regular assays. Protein was pre-incubated with guide RNAs in reaction buffer (20 mM HEPES pH 6.5, 100 mM NaCI, 5 mM MgCh, 0.1 mM EDTA) for 20 min. Target DNA was added and reactions were allowed to take place at 37 °C for up to 30 min. Reactions were stopped by adding 6x DNA loading dye on ice. Reactions were analysed on 1 % agarose gels. For antisense inhibitor assays, oligos were premixed with the DNA targets before adding the mixture to the pre-incubated protein-RNA mix (unless stated otherwise). The following

concentrations were used: 0.008 mM 1 kb DNA target, 0.08 mM Cas9/Cas12a, 0.32 mM guide RNA, 1 mM antisense oligo, 20 pi total reaction volume.

Example 1: Efficacy of antisense oligonucleotide inhibitors of Cas12a nuclease activity

The following four inhibitor oligos were tested by adding them to pre-assembled Cas123- guide RNA complex (RNP). The 23 nt full length oligo (primer 11 , see Table 1 above), covering the entire base pairing segment of the guide, a 15 nt (primer 13) and a 12 nt (primer 15) intermediate, and an 8 nt oligo that carries a double stranded PAM sequence via a hairpin loop (primer 9). After inhibitor binding to the RNP, target DNA was added and the cleavage reaction was followed over time. The time course of resulting cleavage fragments of the target is shown in Figure 2.

Without any inhibitor, cleavage proceeds rapidly and most target is degraded between 1 and 10 min. The full length (23 nt) inhibitor and the PAM+8 nt inhibitor nearly completely inhibit cleavage, with the 23 nt oligo performing slightly better. The 15 nt and 12 nt oligos allow significant cleavage and are therefore not of interest. What this shows is that the base pairing of the full 23 nt guide sequence is required for optimal inhibition, unless a double stranded PAM is supplied.

Using a double stranded PAM provided by a hairpin loop, even an 8 nt base pairing segment is almost as effective as a 20 nt segment. Therefore, if necessary, a PAM can likely be added to any length of inhibitor to greatly increase its efficacy.

Example 2: Testing of antisense oligonucleotide inhibitors of Cas12a nuclease activity

In this experiment the timing of inhibitor application was changed. Adding inhibitor simultaneously with the target was compared with adding inhibitor after the target. Adding inhibitor simultaneously with the target allows direct competition of inhibitor and target and might reveal additional differences in performance. Adding inhibitor after the target may reveal the ability of the inhibitor to inhibit previously target bound RNPs.

Figure 3A shows how simultaneous addition of inhibitor and target still reveals highly effective inhibition of the 23 nt oligo and slightly less effective inhibition of the PAM+8 nt oligo. Figure 3B shows how addition of inhibitor after RNP-target binding reveals a lower efficacy of the inhibitors. This is to be expected in bulk in vitro assays, since the oligos are competitive inhibitors (as opposed to allosteric inhibitors) and can therefore only inhibit a RNP after replacing the target DNA. This result is not expected therefore to extrapolate to an in vivo/ex vivo situation because in such situations there is no surplus of perfect target DNA available to Cas9/Cas12a. Instead, these nuclease proteins are fully expected to be scanning the available DNA in the cell and so will be receptive for inhibitor molecules.

Example 3: Adjusting the lengths of antisense oligonucleotide inhibitors of Cas12a nuclease activity

In this experiment the length of the oligo inhibitors was fine tuned. The PAM+8 nt oligo was extended in 1 nt steps up to 12 nt (primers 16-19 in Table 1 above). Also, the 23 nt oligo was shortened in 1 nt steps down to 20 nt (primers 22-24 in Table 1 above). The latter is relevant since the guide segment of Cas12a is technically 23 nt, however, crystal structures suggest that only 20 nt are involved in base pairing. (See: Gao, P., Yang, H., Rajashankar, K.R., Huang, Z. and Patel, D.J. (2016) Type V CRISPR-Cas Cpf1 endonuclease employs a unique mechanism for crRNA-mediated target DNA recognition. Cell Res, 26, 901-913; and Yamano, T., Nishimasu, H., Zetsche, B., Hirano, H.,

Slaymaker, I.M., Li, Y., Fedorova, I., Nakane, T., Makarova, K.S., Koonin, E.V. et al. (2016) Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA. Cell, 165, 949-962).

Figure 4 shows no noteworthy difference in efficacy between 20 and 23 nt length oligo inhibitors. Elongating the PAM containing oligos shows an improvement from 8 to 9 nt. No additional benefit was observed above 9 nt of length.

Example 4: Testing of antisense oligonucleotide inhibitors of Cas9 nuclease activity

A set of the oligo inhibitors was applied to Cas9, including the 20 nt full length (primer 25 as shown in Table 1 above), 15 nt (primer 26) and 12 nt (primer 27), and PAM+8/10/12 nt (primers 28-30). Referring to Figure 5, surprisingly, the 20 nt and 15 nt oligos show similarly high efficacies, while 12 nt does not perform well. The PAM carrying oligos perform well, with a slight increase in efficacy for the longer oligos.

Overall, the experiments show how antisense oligo inhibitors can inhibit activity of Cas9 and Cas12a by competitive inhibition of target DNA binding in vitro. Full length (20 nt) oligos work best, but efficacy can be increased by adding a PAM containing hairpin. If size is irrelevant a PAM+20 nt oligo may work best. If size is relevant, a 20 nt oligo is may be better.

Example 5: Ex vivo modulation of gene disruption by Cas9 ribonucleoprotein targeting of cellular genetic material

In this example, Cas9, an sgRNA and optionally the antisense oligonucleotides were conjugated to cell penetrating proteins (CPP). The three components are thereby delivered to several human cell types.

Human embryonic kidney cell line (HEK293T), HeLa, human embryonal carcinoma cell line (NCCIT), and human dermal fibroblast cells are cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum and a

penicillin/streptomycin mix. Human embryonic stem cell line (H9); WiCell Research Institute) cells is cultured in DMEM/F12 medium supplemented with 20% serum

replacement, 1% nonessential amino acids, 1% penicillin-streptomycin, 0.1 mM b- mercaptoethanol, and 4 ng/ml_ basic fibroblast growth factor (all from Gibco) in the presence of mitomycin C-treated mouse embryonic fibroblasts as feeder cells. HEK293T cells are transfected using polyethyleneimine (linear; MW, ~25,000; Polysciences).

A template sequence encoding Cas9 with a cysteine at the C terminus is prepared by PCR amplification using a previously described Cas9 plasmid (see Cho et al. (2013a) Nat Biotechnol 31: 230-232.). The template is cloned into pET28-(a) (Novagen, Merk

Millipore), which includes a sequence encoding a His-tag at the N terminus. To induce Cas9 protein expression, E. coli BL21 cells are transformed with the pET28-(a) vector encoding Cas9 and cultured overnight at 30°C in the presence of 0.5 mM isopropyl-3-D- thiogalactopyranoside (IPTG; Promega). Cells are collected by centrifugation and lysed by sonication (40% duty, 10-sec pulse, 30-sec rest, for a total of 10 min, on ice) in a lysis buffer (20 mM Tris-CI at pH 8.0, 300 mM NaCI, 20 mM imidazole, 1 * protease inhibitor cocktail, 1 mg/ml_ lysozyme). After centrifugation at 20,000 for 20 min at 4°C, the Cas9 protein is purified from the soluble fraction by using a column containing Ni-NTA agarose resin (Qiagen) and an AKTA prime instrument (AKTA prime; GE Healthcare) at 4°C. The column-bound protein is eluted with an elution buffer (20 mM Tris-CI at pH 8.0, 300 mM NaCI, 250 mM imidazole, 1 * protease inhibitor cocktail) and dialyzed against a storage buffer (50 mM Tris-HCI at pH 8.0, 200 mM KCI, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol). Purity of eluted proteins was analyzed using SDS-PAGE, and the protein concentration is quantitated using the Bradford assay (Bio-Rad).

Guide RNA (gRNA) is in vitro transcribed through run-off reactions by T7 RNA polymerase. Templates for the gRNA transcription were generated by annealing and extension of two complementary oligonucleotides. Transcribed RNA is resolved on an 8% denaturing urea- PAGE gel. RNA is recovered in nuclease-free water followed by phenohchloroform extraction, chloroform extraction, and ethanol precipitation. Purified RNA is quantified by spectrometry.

To conjugate the Cas9 protein with a maleimide-linked cell penetrating peptide (CPP) that consists of four Glycine, nine Arginine, and four Leucine (4-maleimidobutyryl-4G9R4L; termed“m9R”), isolated Cas9 protein is simply incubated with the m9R.

To conjugate the gRNA to a CPP that consists of one Cysteine, three Glycine, nine Arginine, four Leucine, and one Cysteine (“9R”), the gRNA is simply incubated with the 9R.

Antisense oligonucleotides as described for Examples above may be conjugated to 9R by simple incubation.

The CPP approach provides for successful direct delivery of Cas9 and sgRNA to cells as reported in Ramakrishna et al (2014) Genome Res. 24: 1020 - 1027. The separate delivery of antisense oligonucleotides permits suppression of subsequent off-target activity of the sgRNA-Cas9 RNP.

Example 6: In vivo test of CRISPR-Cas9/Cas12a antisense oiigo inhibitors Antisense oligo inhibitors were designed and then tested in vivo in immortal human reporter cell line KBM7 (see Table 2 below for sequences used in this example). The immortal human cell line KBM7 was transduced with a lentiviral vector containing CRISPR- Cas9/Cas12a target sequences followed by an out-of-frame sequence of dTomato gene. In operation, CRISPR-Cas9/Cas12a induces DNA double-strand breaks in the target sequences, followed by NHEJ repairs that induce DNA deletions and/or insertions (indels). These indels may restore the dTomato open reading frame, producing red cellular fluorescence. A reduction in FACS red cellular fluorescence shows an inhibition of CRISPR Cas9 or Cas12a activity in vivo.

The CRISPR-Cas9/Cas12a double PAM (dPAM) reporter system is shown in Figure 6 and consists of the PAM (protospacer-adjacent motif) sequence of Cas9 (TGG), and the PAM sequence of Cas12a (TTTC). The DNA sequence covered by the upper line is the“target sequence” of Cas12a. The DNA sequence covered by the lower line is the“target sequence of Cas9). The sequence shown in Figure 6 is:

TTTCtggggccactagggacaggatTGG [SEQ ID NO: 52]

Table 2. Designed antisense oligo inhibitors of Cas9/12a for in vivo iTOP experiments (target dTOMATO gene, PAM sequence in uppercase characters).

KBM7 dPAM cells were transduced with Cas9/sgRNA iTOP mix for 45 minutes in the presence of ssDNA oligo inhibitors and control oligos. The iTOP transduction of cells was as described in D'Astolfo D. S. et al. (2015) Cell, 161 (3): 674 - 690. FACS analysis was performed 24 hours after transduction. Figure 7 is a bar chart showing the results of the percentages of dTomato positive events (mean ± SD; n = 3). Figure 7 shows that designed antisense oligos inhibit CRISPR-Cas9 activity in vivo.

KBM7 dPAM cells were also transduced with Cas12a/crRNA iTOP mix for 45 minutes in the presence of ssDNA oligo inhibitors and control oligos. FACS analysis was performed 24 hours after transduction. Figure 8 is a bar chart showing the results of the percentages of dTomato positive events (mean ± SD; n = 3). Figure 8 shows that designed antisense oligos inhibit CRISPR-Cas12a activity in vivo.

Throughout the description and claims of this specification, the words“comprise” and “contain” and variations of them mean“including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

Claims

1 . A method of modifying a nucleic acid by a CRISPR enzyme or a Cascade protein complex guided to a predetermined target sequence comprised in the target nucleic acid by a targeting RNA molecule, wherein the method reduces off-target nucleic acid modification, comprising exposing the nucleic acid to: (a) (i) the CRISPR enzyme or Cascade protein complex and the targeting RNA molecule, or (ii) a ribonucleoprotein complex of the CRISPR enzyme or Cascade protein complex and the targeting RNA molecule, and (b) an oligonucleotide comprising a nucleic acid sequence antisense to the sequence of the target nucleic acid.

2. A method as claimed in claim 1 , wherein the antisense oligonucleotide is exposed to the nucleic acid substantially simultaneously together with the guided CRISPR enzyme or Cascade protein complex.

3. A method as claimed in claim 1 , wherein the predetermined sequence in the target nucleic acid is modified before the nucleic acid is exposed to the antisense oligonucleotide.

4. A method as claimed in any of claims 1 to 3, wherein the antisense oligonucleotide is a locked nucleic acid (LNA), a peptide nucleic acid (PNA) or a morpholino.

5. A kit for CRISPR or Cascade complex targeted gene modification with reduced off- target effects, comprising one or more containers comprising one or more vectors comprising:

b. a polynucleotide sequence encoding a targeting RNA molecule; and

c. a polynucleotide sequence encoding an antisense oligonucleotide,

6. A kit for CRISPR or Cascade complex targeted gene modification with reduced off- target effects, comprising one or more containers comprising one or more vectors comprising:

b. a polynucleotide sequence encoding a targeting RNA molecule; and

a container comprising a synthetic antisense oligonucleotide;

7. A kit for CRISPR or Cascade complex targeted gene modification with reduced off- target effects, comprising one or more containers comprising:

a. a CRISPR enzyme or Cascade protein complex;

b. a targeting RNA molecule; and

c. a synthetic antisense oligonucleotide;

8. A kit for CRISPR or Cascade complex targeted gene modification with reduced off- target effects, comprising one or more containers comprising: a. a ribonucleoprotein complex comprising a CRISPR enzyme or Cascade protein complex and a targeting RNA molecule; and

b. a synthetic antisense oligonucleotide;

9. A synthetic composition comprising a ribonucleoprotein complex and an antisense oligonucleotide, wherein the ribonucleoprotein complex comprises a CRISPR enzyme or a Cascade protein and a targeting RNA molecule, and wherein the targeting RNA molecule has base pairing affinity with a desired target nucleic acid sequence, and wherein at least a portion of the nucleotide sequence of the antisense oligonucleotide is substantially complementary to a portion of the nucleotide sequence of the targeting RNA molecule.

10. A synthetic composition as claimed in claim 9, wherein the antisense oligonucleotide is bound to the targeting RNA molecule in the ribonucleoprotein complex.

1 1 . A synthetic composition comprising a vector system, wherein the vector system comprises one or more vectors, the one or more vectors comprising:

a. a polynucleotide sequence encoding a CRISPR enzyme or a Cascade protein complex,

c. a polynucleotide sequence encoding an antisense oligonucleotide,

12. A synthetic composition as claimed in claim 11 , wherein polynucleotide sequences (a), (b) and (c) are comprised in the same or different vectors.

13. A synthetic composition as claimed in claim 11 or claim 12, wherein polynucleotide sequences (a), (b) and (c) are comprised in the same vector.

14. A synthetic composition as claimed in claim 11 or claim 12, wherein polynucleotide sequences (a), (b) are comprised in a first vector and polynucleotide sequence (c) is comprised in a second vector.

15. A synthetic composition as claimed in claim 11 or claim 12, wherein polynucleotide sequence (a) is comprised in a first vector and polynucleotide sequences (b) and (c) are comprised in a second vector.

16. A synthetic composition as claimed in claim 11 or claim 12, wherein polynucleotide sequence (a) is comprised in a first vector, polynucleotide sequence (b) is comprised in a second vector, and polynucleotide (c) is comprised in a third vector.

17. A synthetic composition comprising two more compositions as claimed in any preceding claim.

18. A synthetic composition as claimed in any preceding claim, comprised in a cell; preferably a eukaryotic cell; optionally a human cell.

19. A synthetic composition as claimed in any preceding claim, comprised in a non- human organism, organ, part, tissue or cell thereof.

20. A method as claimed in any of claims 1 to 4, a kit as claimed in any of claims 5 to 8 or a synthetic composition as claimed in any of claims 9 to 19, wherein the antisense oligonucleotide has at least 8 contiguous nucleotides complementary to nucleotides of the targeting RNA.

21. A method or a kit or a synthetic composition as claimed in claim 20, wherein the antisense oligonucleotide further comprises a PAM sequence recognised by the CRISPR enzyme or Cascade complex; preferably wherein the PAM is in the form of a hairpin loop.

22. A method or a kit or a synthetic composition as claimed in claim 20 or claim 21 , wherein the antisense oligonucleotide is not more than 32 nucleotides long.

23. A method or a kit or a synthetic composition as claimed in any preceding claim, wherein the CRISPR enzyme is Cas9 or Cas12a.

24. A method or a kit or a synthetic composition as claimed in any preceding claim, wherein there is a Nuclear Localisation Signal (NLS) in proximity to the N- or C-terminus of the CRISPR enzyme or Cascade protein.

25. A method or a kit or a synthetic composition as claimed in any preceding claim, wherein the targeting RNA molecule is at least 15 nucleotides long.