WO2023102406A1 - Vector genome design to express optimized cln7 transgene - Google Patents

Abstract

This technology relates to polynucleotides comprising optimized CLN7 open reading frame (ORF) sequences, viral vectors comprising the same, and methods of using the same for delivery of the ORF to a cell or a subject and to treat disorders associated with aberrant expression of CLN7, such as variant late infantile neuronal ceroid lipofuscinoses (vLINCL; CLN7 disease).

Description

VECTOR GENOME DESIGN TO EXPRESS OPTIMIZED CLN7 TRANSGENE

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63/284,852, filed December 1, 2021. The disclosure of the prior application is considered part of and is herein incorporated by reference in the disclosure of this application in its entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on December 1, 2021, is named “426871-000314.xml” and is about 27 bytes in size.

BACKGROUND OF THE DISCLOSURE

FIELD OF THE DISCLOSURE

[0003] The present disclosure related generally to CLN7 gene expressing expression cassettes, and more specifically to CLN7 gene expressing expression cassettes for use treating disorders associated with defective CLN7 expression such as Batten Disease.

BACKGROUND INFORMATION

[0004] CLN7 disease is caused by a mutation in the Major Facilitator Superfamily Domain Containing 8 (MFSD8) gene, also known as CLN7, resulting in a lysosomal storage disease (LSD). The CLN7 gene encodes a 518-amino acid polytopic lysosomal transmembrane protein with 12 membrane-spanning domains. Since the initial identification of a mutation in the gene in 2007, many different MFSD8 mutations and sequence variations have been reported in populations throughout the world. The types of mutations include missense, splice site, nonsense, frame shift, sequence deletion and/or insertion mutations. The autosomal recessive condition in children is inherited from healthy, carrier parents each contributing a defective copy.

[0005] Dysfunction of the CLN7 protein results in the accumulation of lysosomal storage material or autofluorescent ceroid lipopigments in the neuronal and peripheral tissues. CLN7 patients with mutations in the CLN7 gene exhibit massive accumulation of subunit c of mitochondrial ATP synthase (SCMAS) in the brain and in peripheral organs. The ultrastructure neuronal storage material in CLN7 patients consists of rectilinear complexes and fingerprint profiles. There is elevated expression of lysosomal proteins including CtsD, CtsB and CtsZ in CLN7 storage phenotype. The buildup of storage material in CLN7 disease leads to the destabilization and increased permeability of the lysosomal membrane potentially resulting in apoptosis and neurodegeneration. [0006] There are currently no approved treatments available for patients suffering from CLN7 disease. Management of the condition is limited to symptomatic intervention to treat seizures, dystonia, anxiety, sleep disorders and spasms. Surgery may be required in patients that have difficulty swallowing. There remains a need in the art for an effective treatment that targets the cause of the disease, i.e., CLN7 gene mutations.

SUMMARY

[0007] The present disclosure is based, in part, on the development of optimized CLN7 genes, expression cassettes, and vectors capable of providing therapeutic levels of CLN7 expression for treating disorders associated with defective CLN7 expression such as Batten Disease.

[0008] Thus, one aspect of the disclosure relates to a polynucleotide comprising a human CLN7 open reading frame, wherein the nucleotide sequence has been depleted of CpG dinucleotides for expression in human cells.

[0009] A further aspect of the disclosure relates to an expression cassette comprising a polynucleotide comprising a human CLN7 open reading frame and vectors, transformed cells, and transgenic animals comprising polynucleotides disclosed herein.

[0010] Another aspect of the disclosure relates to a pharmaceutical formulation comprising polynucleotides, expression cassettes, vectors, and/or transformed cells as described herein in a pharmaceutically acceptable carrier.

[0011] An additional aspect relates to a method of expressing a CLN7 open reading frame in a cell, comprising contacting the cell with a polynucleotide, expression cassette, and/or vector described herein, thereby expressing a CLN7 open reading frame in the cell.

[0012] A further aspect relates to a method of expressing a CLN7 open reading frame in a subject, comprising delivering to the subject the polynucleotide, expression cassette, vector, and/or transformed cell, thereby expressing the CLN7 open reading frame in the subject.

[0013] An additional aspect relates to a method of treating a disorder associated with aberrant expression of a CLN7 gene or aberrant activity of a CLN7 gene product in a subject in need thereof, comprising delivering to the subject a therapeutically effective amount of the polynucleotide, expression cassette, vector, and/or transformed cell, thereby treating the disorder associated with aberrant expression of the CLN7 gene in the subject. Another aspect relates to a polynucleotide, expression cassette, vector, and/or transformed cell for use in a method of treating a disorder associated with aberrant expression of a CLN7 gene or aberrant activity of a CLN7 gene product in a subject in need thereof.

[0014] Therefore, the methods and compositions described herein can overcome shortcomings in the art by providing a CLN7 coding sequence depleted of CpG dinucleotides, expression cassettes, and vectors capable of providing therapeutic levels of CLN7 expression for treating disorders associated with CLN7 expression such as vLINCL.

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIG. 1 is a schematic representation of a CLN7 v2 construct.

[0016] FIG. 2 illustrates the validation of vector quality.

[0017] FIGs 3A-3C show that CLN7 v2 induced similar level of CLN7 mRNA expression in HEK293 cells as CLN7 vl. FIG. 3A is a graph illustrating GFP mRNA expression. FIG. 3B is a graph illustrating CLN7 mRNA expression. FIG. 3C is a graph illustrating CLN7/GFP mRNA expression ratio. Values are presented as the mean ± SEM, *p<0.05 and ***p<0.001. The scatter plot represents measurements from individual culture wells.

[0018] FIGs 4A-4C show that CLN7 v2 induced similar level of CLN7 mRNA expression in Lec2 cells as CLN7 vl. FIG. 4A is a graph illustrating GFP mRNA expression. FIG. 4B is a graph illustrating CLN7 mRNA expression. FIG. 4C is a graph illustrating CLN7/GFP mRNA expression ratio. Values are presented as the mean ± SEM. The scatter plot represents measurements from individual culture wells.

DETAILED DESCRIPTION

[0019] The present disclosure provides, inter alia, isolated polynucleotides, recombinant adeno- associated virus (rAAV) vectors, and rAAV viral vectors comprising transgene nucleic acid molecules comprising nucleic acid sequences encoding for CLN7 polypeptides. The present disclosure also provides methods of manufacturing these isolated polynucleotides, rAAV vectors, and rAAV viral vectors, as well as their use to deliver transgenes to treat or prevent a disease or disorder, including diseases associated with loss, misfunction and/or deficiency of a CLN7 gene.

[0020] Overview

[0021] The neuronal ceroid lipofuscinosis type 7 (CLN7) disease is a lysosomal storage disease caused by mutations in the gene named Major Facilitator Superfamily Domain Containing 8 (MFSD8), which encodes the membrane-bound lysosomal protein MFSD8 (or CLN7 protein). It is characterized by the accumulation of lysosomal storage materials including subunit c of mitochondrial ATP synthase (SCMAS). The clinical presentation of CLN7 disease varies from a mild, late-onset with non-syndromic visual deficits to a severe, early-onset with progressive neurological signs. There is no approved treatment for CLN7 disease.

[0022] An AAV9/CLN7 vector construct (CLN7 vl) was designed and was evaluated in CLN7 patient fibroblasts for efficacy as well as in mice for safety and efficacy. This construct was composed of a mutated (self-complementary, sc) AAV2 inverted terminal revert (ITR), the JeT promoter, human codon-optimized CLN7 cDNA, SV40 poly adenylation signal (SV40pA), and wildtype (WT) AAV2 ITR. An in vitro study demonstrated that scAAV2/CLN7 dose-dependently rescued lysosomal function in cultured CLN7 patient fibroblasts. In an efficacy study, intrathecal (IT) administration of scAAV9/CLN7 to Mfsd8 knockout (KO) mice at p7- 10 or pl20 with high or low doses led to clear age- and dose-dependent effects with early intervention and high dose achieving the best therapeutic outcomes. IT high dose of scAAV9/CLN7 at p7-10 resulted in 1) widespread CLN7 mRNA expression in all tissues assessed; 2) amelioration of SCMAS immunoreactivity in all affected brain regions and spinal cord; 3) nearly complete normalization of impaired open field and rotarod performance at 6- and 9-months post injection; 4) more than doubled median lifespan (16.82 vs 7.77 months in untreated KO mice); and 5) preservation of normal body weight. A one-year, non-good laboratory practice (GLP) toxicology study in WT mice and a three-months, GLP toxicology study in WT rats each concluded that IT administration of AAV9/CLN7 is safe and well-tolerated. An investigation new drug (IND) application to the United States Food and Drug Administration (FDA) to initiate a Phase I/II clinical trial of scAAV9/CLN7 was approved in December 2020 (clinicaltrials.gov identifier NCT04737460). The clinical trial is ongoing at Children’s Health in Dallas, TX in collaboration with UTSW Medical Center.

[0023] Provided herein is a 2nd generation construct (CLN7 v2) carrying the human CLN7 gene and to assess its comparability to our original CLN7 vector design (CLN7 vl) being used in an investigator- sponsored Phase I clinical trial (clinicaltrials.gov identifier NCT04737460).

[0024] AAV viral vectors

[0025] In an embodiment, provided herein is a recombinant adeno-associated virus (rAAV) vector comprising in 5’ to 3’ direction: a) a first AAV ITR sequence; b) a promoter sequence; c) a transgene nucleic acid molecule, wherein the transgene nucleic acid molecule comprises a nucleic acid sequence encoding a CLN7 polypeptide; d) a polyA sequence; and e) a second AAV ITR sequence.

[0026] 1. AAV viral vector, structure and function

[0027] A "viral vector" is defined as a recombinantly produced virus or viral particle that contains a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenovirus vectors, alphavirus vectors and the like. Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virusbased vectors, have also been developed for use in gene therapy and immunotherapy. See, e.g., Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying, et al. (1999) Nat. Med. 5(7): 823-827.

[0028] An "AAV virion" or "AAV viral particle" or "AAV viral vector" or “rAAV viral vector” or "AAV vector particle" or “AAV particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide rAAV vector. Thus, production of an rAAV viral vector necessarily includes production of an rAAV vector, as such a vector is contained within an rAAV vector. [0029] The term "adeno-associated virus" or "AAV" as used herein refers to a member of the class of viruses associated with this name and belonging to the genus Dependoparvovirus, family Parvoviridae. Adeno-associated virus is a single-stranded DNA virus that grows in cells in which certain functions are provided by a co-infecting helper virus. General information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169- 228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). It is fully expected that the same principles described in these reviews will be applicable to additional AAV serotypes characterized after the publication dates of the reviews because it is well known that the various serotypes are quite closely related, both structurally and functionally, even at the genetic level. See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J. R. Pattison, ed.; and Rose, Comprehensive Virology 3: 1-61 (1974). For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all bear three related capsid proteins such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis which reveals extensive crosshybridization between serotypes along the length of the genome; and the presence of analogous selfannealing segments at the termini that correspond to "inverted terminal repeat sequences" (ITRs). The similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from various tissue types. At least 11 sequentially numbered AAV serotypes are known in the art. Non-limiting exemplary serotypes useful in the methods disclosed herein include any of the 11 serotypes, e.g., AAV2, AAV8, AAV9, or variant serotypes, e.g., AAV-DJ and AAV PHP.B. The AAV particle comprises, consists essentially of, or consists of three major viral proteins: VP1, VP2 and VP3. In some aspects, AAV refers to the serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVPHP.B, AAVrh74, or AAVrh.10.

[0030] Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to all serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVPHP.B, AAVrh74, and AAVrh.10). Exemplary adeno- associated viruses and recombinant adeno-associated viruses include, but are not limited to, self- complementary AAV (sc A AV) and AAV hybrids containing the genome of one serotype and the capsid of another serotype (e.g., AAV2/5. AAV-DJ and AAV-DJ8). Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, rAAV-LK03, AAV-KP-1 (described in detail in Rerun et al. JCI Insight, 2019; 4(22): el31610) and AAV-NP59 (described in detail in Paulk et al. Molecular Therapy, 2018; 26(1): 289-303).

[0031] AAV is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length, including two 145 -nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively; the AAV-9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004). The sequence of the AAV rh.74 genome is provided in U.S. Patent 9,434,928. U.S. Patent No. 9,434,928 also provides the sequences of the capsid proteins and a self-complementary genome. In one aspect, an AAV genome is a self-complementary genome. Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging, and host cell chromosome integration are contained within AAV ITRs (SEQ ID NO:2). Three AAV promoters (named p5, pl9, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and pl 9), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome.

[0032] The cap gene is expressed from the p40 promoter and encodes the three capsid proteins, VP1, VP2, and VP3. As used herein, the term "viral capsid" or "capsid" refers to the proteinaceous shell or coat of a viral particle. Capsids function to encapsidate, protect, transport, and release into the host cell a viral genome. Capsids are generally comprised of oligomeric structural subunits of protein ("capsid proteins"). As used herein, the term "encapsidated" means enclosed within a viral capsid. The viral capsid of AAV is composed of a mixture of three viral capsid proteins: VP1, VP2, and VP3. The mixture of VP 1, VP2 and VP3 contains 60 monomers that are arranged in a T =1 icosahedral symmetry in a ratio of 1: 1: 10 (VP1:VP2:VP3) or 1: 1:20 (VP1:VP2:VP3) as described in Sonntag F et al., (June 2010). "A viral assembly factor promotes AAV2 capsid formation in the nucleolus". Proceedings of the National Academy of Sciences of the United States of America. 107 (22): 10220-5, and Rabinowitz JE, Samulski RJ (December 2000). "Building a better vector: the manipulation of AAV virions". Virology. 278 (2): 301-8, each of which is incorporated herein by reference in its entirety.

[0033] Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. More specifically, after the single mRNA from which each of the VP1, VP2 and VP3 proteins are translated is transcribed, it can be spliced in two different manners: either a longer or shorter intron can be excised, resulting in the formation of two pools of mRNAs: a 2.3 kb- and a 2.6 kb-long mRNA pool. The longer intron is often preferred and thus the 2.3-kb-long mRNA can be called the major splice variant. This form lacks the first AUG codon, from which the synthesis of VP 1 protein starts, resulting in a reduced overall level of VP 1 protein synthesis. The first AUG codon that remains in the major splice variant is the initiation codon for the VP3 protein. However, upstream of that codon in the same open reading frame lies an ACG sequence (encoding threonine) which is surrounded by an optimal Kozak (translation initiation) context. This contributes to a low level of synthesis of the VP2 protein, which is actually the VP3 protein with additional N terminal residues, as is VP1, as described in Becerra SP et al., (December 1985). "Direct mapping of adeno-associated virus capsid proteins B and C: a possible ACG initiation codon". Proceedings of the National Academy of Sciences of the United States of America. 82 (23): 7919-23, Cassinotti P et al., (November 1988). "Organization of the adeno-associated virus (AAV) capsid gene: mapping of a minor spliced mRNA coding for virus capsid protein 1". Virology. 167 (1): 176-84, Muralidhar S et al., (January 1994). "Site- directed mutagenesis of adeno-associated virus type 2 structural protein initiation codons: effects on regulation of synthesis and biological activity". Journal of Virology. 68 (1): 170-6, and Trempe JP, Carter BJ (September 1988). "Alternate mRNA splicing is required for synthesis of adeno-associated virus VP1 capsid protein". Journal of Virology. 62 (9): 3356-63, each of which is herein incorporated by reference. A single consensus polyA site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).

[0034] Each VP1 protein contains a VP1 portion, a VP2 portion, and a VP3 portion. The VP1 portion is the N-terminal portion of the VP1 protein that is unique to the VP1 protein. The VP2 portion is the amino acid sequence present within the VP1 protein that is also found in the N-terminal portion of the VP2 protein. The VP3 portion and the VP3 protein have the same sequence. The VP3 portion is the C- terminal portion of the VP1 protein that is shared with the VP1 and VP2 proteins.

[0035] The VP3 protein can be further divided into discrete variable surface regions I-IX (VR-I-IX). Each of the variable surface regions (VRs) can comprise or contain specific amino acid sequences that either alone or in combination with the specific amino acid sequences of each of the other VRs can confer unique infection phenotypes (e.g., decreased antigenicity, improved transduction and/or tissuespecific tropism relative to other AAV serotypes) to a particular serotype as described in DiMatta et al., “Structural Insight into the Unique Properties of Adeno-Associated Virus Serotype 9” J. Virol., Vol. 86 (12): 6947-6958, June 2012, the contents of which are incorporated herein by reference.

[0036] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA in plasmids, which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA to generate AAV vectors. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0037] Multiple studies have demonstrated long-term (> 1.5 years) recombinant AAV-mediated protein expression in muscle. See, Clark et al., Hum Gene Ther, 8: 659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA, 93: 14082-14087 (1996); and Xiao et al., J Virol, 70: 8098-8108 (1996). See also, Chao et al., Mol Ther, 2:619-623 (2000) and Chao et al., Mol Ther, 4:217-222 (2001). Moreover, because muscle is highly vascularized, recombinant AAV transduction has resulted in the appearance of transgene products in the systemic circulation following intramuscular injection as described in Herzog et al., Proc Natl Acad Sci USA, 94: 5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA, 94: 13921- 13926 (1997). Moreover, Lewis et al., J Virol, 76: 8769-8775 (2002) demonstrated that skeletal myofibers possess the necessary cellular factors for correct antibody glycosylation, folding, and secretion, indicating that muscle is capable of stable expression of secreted protein therapeutics. Recombinant AAV (rAAV) genomes comprise, consist essentially of, or consist of a nucleic acid molecule encoding a therapeutic protein (e.g., CLN7) and one or more AAV ITRs flanking the nucleic acid molecule (e.g., SEQ ID NO:2, 6-14, ). Production of pseudotyped rAAV is disclosed in, for example, WO2001083692. Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, e.g., Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0038] 2, Isolated polynucleotides comprising transgene sequences

[0039] The present disclosure provides isolated polynucleotides comprising at least one transgene nucleic acid molecule.

[0040] Transgene nucleic acid molecules can comprise, consist essentially of, or consist of any of the transgene nucleic acid molecules described herein under the heading.

[0041] In some aspects, a transgene nucleic acid molecule present in an rAAV vector can be under transcriptional control of a promoter sequence also present in the same rAAV vector.

[0042] In some aspects, a transgene nucleic acid molecule can comprise a nucleic acid sequence encoding a CLN7 polypeptide, or at least one fragment thereof. In some aspects, a transgene nucleic acid molecule can comprise a nucleic acid sequence encoding a biological equivalent of a CLN7 polypeptide.

[0043] In some aspects, a CLN7 polypeptide comprises, consists essentially of, or consists of an amino acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the amino acid sequence set forth in SEQ ID NO:4, or a fragment thereof. In some aspects, a CLN7 polypeptide comprises, consists essentially of, or consists of an amino acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to at least one portion of the amino acid sequence set forth in SEQ ID NO:4, or a fragment thereof. In some embodiments, the fragment is a functional fragment, e.g., a fragment that retains at least one function of wildtype CLN7.

[0044] In some aspects, a nucleic acid sequence encoding a CLN7 polypeptide comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in SEQ ID NO:4.

[0045] In some aspects, a nucleic acid sequence encoding a CLN7 polypeptide can have the number of CpG dinucleotides reduced by 1, 2, 3, 4, 5, 10 or more CpG dinucleotides. CpG nucleotides are located within regions of DNA where a cytosine nucleotide is followed by a guanine nucleotide in the linear sequence of bases along its 5' — > 3' direction. A nucleic acid sequence that encodes for a CLN7 polypeptide but has had the number of CpG dinucleotides reduced is a CpG dinucleotide optimized CLN7 nucleic acid sequence. A CpG dinucleotide optimized CLN7 nucleic acid sequence can comprise, consist essentially of, or consist of a nucleic acid sequence that is no more than 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (or any percentage in between) identical to a wildtype human nucleic acid sequence encoding a CLN7 polypeptide. As used herein, a “wildtype human nucleic acid sequence encoding a CLN7 polypeptide” refers to a nucleic acid sequence that encodes a healthy CLN7 polypeptide in a human genome (e.g., SEQ ID NO:29). An exemplary CpG dinucleotide optimized CLN7 nucleic acid sequence is set forth in SEQ ID NO:4.

[0046] In some aspects, a CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide, such as shown in SEQ ID NO:4, can comprise no donor splice sites. In some aspects, a CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide can comprise no more than about one, or about two, or about three, or about four, or about five, or about six, or about seven, or about eight, or about nine, or about ten donor splice sites. In some aspects, a CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten fewer donor splice sites as compared to a wildtype human nucleic acid sequence encoding a CLN7 polypeptide. Without wishing to be bound by theory, the removal of donor splice sites in the optimized nucleic acid sequence can unexpectedly and unpredictably increase expression of the CLN7 polypeptide in vivo, as cryptic splicing is prevented. Moreover, cryptic splicing may vary between different subjects, meaning that the expression level of the CLN7 polypeptide comprising donor splice sites may unpredictably vary between different subjects.

[0047] In some aspects, a CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide, such as those put forth in SEQ ID NO:4, can have a GC content that differs from the GC content of a wildtype human nucleic acid sequence encoding a CLN7 polypeptide. In some aspects, the GC content of a CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide is more evenly distributed across the entire nucleic acid sequence, as compared to a wildtype human nucleic acid sequence encoding a CLN7 polypeptide. Without wishing to be bound by theory, by more evenly distributing the GC content across the entire nucleic acid sequence, the nucleic acid sequence exhibits a more uniform melting temperature (“Tm”) across the length of the transcript. The uniformity of melting temperature results unexpectedly in increased expression of the nucleic acid in a human subject, as transcription and/or translation of the nucleic acid sequence occurs with less stalling of the polymerase and/or ribosome.

[0048] In some aspects, the CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide, such as shown SEQ ID NO:4, exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased expression in a human subject relative to a wild-type or non-optimized nucleic acid sequence encoding a CLN7 polypeptide. In some aspects, the CpG dinucleotide optimized CLN7 nucleic acid sequence encoding a CLN7 polypeptide, such as shown SEQ ID NO:4, has increased potency and increased safety.

[0049] In some aspects, a CLN7 polypeptide can further comprise a protein tag. Without wishing to be bound by theory, the inclusion of a protein tag can allow for the detection and/or visualization of the exogenous CLN7 polypeptide. As would be appreciated by the skilled artisan, non-limiting examples of protein tags include Myc tags, poly -histidine tags, FLAG-tags, HA -tags, SBP-tags or any other protein tag known in the art.

[0050] 3, AAV vectors

[0051] In some aspects, the isolated polynucleotides comprising at least one transgene nucleic acid molecule described herein can be a recombinant AAV (rAAV) vector.

[0052] As used herein, the term "vector" refers to a nucleic acid comprising, consisting essentially of, or consisting of an intact replicon such that the vector may be replicated when placed within a cell, for example by a process of transfection, infection, or transformation. A vector can comprise a signal peptide or signal polypeptide. It is understood in the art that once inside a cell, a vector may replicate as an extrachromosomal (episomal) element or may be integrated into a host cell chromosome. Vectors may include nucleic acids derived from retroviruses, adenoviruses, herpesvirus, baculoviruses, modified baculoviruses, papovaviruses, or otherwise modified naturally occurring viruses. Exemplary non-viral vectors for delivering nucleic acid include naked DNA; DNA complexed with cationic lipids, alone or in combination with cationic polymers; anionic and cationic liposomes; DNA-protein complexes and particles comprising, consisting essentially of, or consisting of DNA condensed with cationic polymers such as heterogeneous polylysine, defmed-length oligopeptides, and polyethyleneimine, in some cases contained in liposomes; and the use of ternary complexes comprising, consisting essentially of, or consisting of a virus and polylysine-DNA.

[0053] With respect to general recombinant techniques, vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo and are commercially available from sources such as Agilent Technologies (Santa Clara, Calif) and Promega Biotech (Madison, Wis.). In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of cloned transgenes to eliminate extra, potential inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites can be inserted immediately 5' of the start codon to enhance expression.

[0054] An "rAAV vector" as used herein refers to a vector comprising, consisting essentially of, or consisting of one or more transgene nucleic acid molecules and one or more AAV inverted terminal repeat sequences (ITRs). Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that provides the functionality of rep and cap gene products; for example, by transfection of the host cell. In some aspects, AAV vectors contain a promoter, at least one nucleic acid that may encode at least one protein or RNA, and/or an enhancer and/or a terminator within the flanking ITRs that is packaged into the infectious AAV particle. The encapsidated nucleic acid portion may be referred to as the AAV vector genome. Plasmids containing rAAV vectors may also contain elements for manufacturing purposes, e.g., antibiotic resistance genes, origin of replication sequences etc., but these are not encapsidated and thus do not form part of the AAV particle.

[0055] In some aspects, an rAAV vector can comprise at least one transgene nucleic acid molecule. In some aspects, an rAAV vector can comprise at least one AAV inverted terminal (ITR) sequence. In some aspects, an rAAV vector can comprise at least one promoter sequence. In some aspects, an rAAV vector can comprise at least one enhancer sequence. In some aspects, an rAAV vector can comprise at least one polyA sequence. In some aspects, an rAAV vector can comprise a RepCap sequence.

[0056] In some aspects, an rAAV vector can comprise a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule and a second AAV ITR sequence. In some aspects, an rAAV vector can comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule and a second AAV ITR sequence.

[0057] In some aspects, an rAAV vector can comprise a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule, a polyA sequence and a second AAV ITR sequence. In some aspects, an rAAV vector can comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule, a polyA sequence and a second AAV ITR sequence.

[0058] In some aspects, an rAAV vector can comprise more than one transgene nucleic acid molecule. In some aspects, an rAAV vector can comprise at least two transgene nucleic acid molecules, such that the rAAV vector comprises a first transgene nucleic acid molecule and an at least second transgene nucleic acid molecule. In some aspects, the first and the at least second transgene nucleic acid molecule can comprise the same nucleic acid sequence. In some aspects, the first and the at least second transgene nucleic acid molecules can comprise different nucleic acid sequences. In some aspects, the first and the at least second transgene nucleic acid sequences can be adjacent to each other.

[0059] In some aspects, an rAAV vector can comprise more than one promoter sequence. In some aspects, an rAAV vector can comprise at least two promoter sequences, such that the rAAV vector comprises a first promoter sequence and an at least second promoter sequence. In some aspects, the first and the at least second promoter sequences can comprise the same sequence. In some aspects, the first and the at least second promoter sequences can comprise different sequences. In some aspects, the first and the at least second promoter sequences can be adjacent to each other. In some aspects wherein an rAAV vector also comprises a first transgene nucleic acid molecule and an at least second transgene nucleic acid molecule, the first promoter can be located upstream (5’) of the first transgene nucleic acid molecule and the at least second promoter can be located between the first transgene nucleic acid molecule and the at least second transgene nucleic acid molecule, such that the at least second promoter is downstream (3’) of the first transgene nucleic acid molecule and upstream (5’) of the at least second transgene nucleic acid molecule.

[0060] Any of the preceding rAAV vectors can further comprise at least one enhancer. The at least one enhancer can be located anywhere in the rAAV vector. In some aspects, the at least one enhancer can be located immediately upstream (5’) of a promoter. Thus, an rAAV vector can comprise, in the 5’ to 3 ’ direction, a first AAV ITR sequence, an enhancer, a promoter sequence, a transgene nucleic acid molecule, a polyA sequence, and a second AAV ITR sequence. In some aspects, the at least one enhancer can be located immediately downstream (3’) of a promoter. Thus, an rAAV vector can comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, an enhancer, a transgene nucleic acid molecule, a polyA sequence, and a second AAV ITR sequence. In some aspects, the at least one enhancer can be located immediately downstream of a transgene nucleic acid molecule. Thus, an rAAV vector can comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule, an enhancer, a polyA sequence, and a second AAV ITR sequence.

[0061] 4, AAV ITR sequences

[0062] In some aspects, an AAV ITR sequence can comprise any AAV ITR sequence known in the art. In some aspects, an AAV ITR sequence can be an AAV1 ITR sequence, an AAV2 ITR sequence, an AAV4 ITR sequence, an AAV5 ITR sequence, an AAV6 ITR sequence, an AAV7 ITR sequence, an AAV8 ITR sequence, an AAV9 ITR sequence, an AAV10 ITR sequence, an AAV11 ITR sequence, an AAV12 ITR sequence, an AAV13 ITR sequence, an AAVrh74 ITR sequence or an AAVrh. 10 ITR sequence.

[0063] Thus, in some aspects, an AAV ITR sequence can comprise, consist essentially of, or consist of an AAV1 ITR sequence, an AAV2 ITR sequence, an AAV4 ITR sequence, an AAV5 ITR sequence, an AAV6 ITR sequence, an AAV7 ITR sequence, an AAV8 ITR sequence, an AAV9 ITR sequence, an AAV 10 ITR sequence, an AAV11 ITR sequence, an AAV12 ITR sequence, an AAV13 ITR sequence, an AAVrh74 ITR sequence, or an AAVrh. 10 ITR sequence. In some embodiments, an AAV ITR sequence is a wildtype AAV ITR sequence. In some embodiments, an AAV ITR sequence is modified (e.g., mutated) AAV ITR sequence. In some embodiments, an rAAV vector described herein comprises one mutated AAV ITR and one wildtype AAV ITR.

[0064] In some aspects, an AAV ITR can comprise consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in any one of SEQ ID NOs:2, 6- 14.

[0065] In some aspects, an AAV ITR can comprise consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:2 or 6-14.

[0066] In some aspects, an AAV ITR can comprise consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:2, or 6-14.

[0067] In some aspects, an rAAV provided herein comprises a first and a second AAV ITR sequence, wherein the first AAV ITR sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO: 2 and the second AAV ITR sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:6.

[0068] V Promoter sequence and enhancers [0069] The term "promoter" and “promoter sequence” as used herein means a control sequence that is a region of a polynucleotide sequence at which the initiation and rate of transcription of a coding sequence, such as a gene or a transgene, are controlled. Promoters can be constitutive, inducible, repressible, or tissue-specific, for example. Promoters can contain genetic elements at which regulatory proteins and molecules such as RNA polymerase and transcription factors may bind. Non-limiting exemplary promoters include Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), a cytomegalovirus (CMV) promoter, an SV40 promoter, a dihydrofolate reductase promoter, a [3-actin promoter, a phosphoglycerol kinase (PGK) promoter, a U6 promoter, a synapsin promoter, an Hl promoter, a hybrid chicken beta-actin (CBA) promoter, a ubiquitous chicken [3-actin hybrid (CBh) promoter, a small nuclear RNA (Ula or Ulb) promoter, an M EC 2 promoter, an MeP418 promoter, an MeP426 promoter, a human variant of the MeP426 promoter, a minimal MECP2 promoter, a VMD2 promoter, an mRho promoter, or an EF 1 promoter.

[0070] Additional non-limiting exemplary promoters provided herein include, but are not limited to EFla, Ubc, human p-actin, CAG, TRE, Ac5, Polyhedrin, CaMKIIa, Gall, TEF1, GDS, ADH1, Ubi, and a- 1 -antitrypsin (hAAT). Nucleotide sequences of promoters can be modified to increase or decrease the efficiency of mRNA transcription. For example, the TATA box of 7SK, U6 and Hl promoters can be modified to abolish RNA polymerase III transcription and stimulate RNA polymerase Il-dependent mRNA transcription. Synthetically-derived promoters can be used for ubiquitous or tissue specific expression. Furthermore, virus-derived promoters, some of which are noted above, can be useful in the methods disclosed herein, e.g., CMV, HIV, adenovirus, and AAV promoters. In some aspects, a promoter is used together with at least one enhancer to increase the transcription efficiency. Nonlimiting examples of enhancers include an interstitial retinoid-binding protein (IRBP) enhancer, an RSV enhancer or a CMV enhancer.

[0071] In some aspects, a promoter sequence can comprise, consist essentially of, or consist of a Rous sarcoma virus (RSV) LTR promoter sequence (optionally with the RSV enhancer), a cytomegalovirus (CMV) promoter sequence, an SV40 promoter sequence, a dihydrofolate reductase promoter sequence, a JeT promoter sequence (SEQ ID NOG), a strong a [3-actin promoter sequence, a phosphoglycerol kinase (PGK) promoter sequence, a U6 promoter sequence (SEQ ID NO: 17), synapsin I promoter (SEQ ID NO: 18), synapsin II promoter (SEQ ID NO: 19), an Hl promoter sequence, a hybrid chicken betaactin (CBA) promoter sequence (SEQ ID NO:20), a ubiquitous chicken [3-actin hybrid (CBh) promoter sequence (SEQ ID NO: 16), a small nuclear RNA (Ula or Ulb) promoter sequence, an MECP2 promoter sequence, an MeP418 promoter, an MeP426 promoter sequence, a small ubiquitous promoter sequence (also known as a Jet+I promoter sequence (SEQ ID NO: 15) MECP2 promoter sequence, a VMD2 promoter sequence, an mRho promoter sequence, an EFI promoter sequence, an EFla promoter sequence, a Ubc promoter sequence, a human [3-actin promoter sequence, a CAG promoter sequence, a TRE promoter sequence, an Ac5 promoter sequence, a Polyhedrin promoter sequence, a CaMKIIa promoter sequence, a Gall promoter sequence, a TEF1 promoter sequence, a GDS promoter sequence, an ADH1 promoter sequence, a Ubi promoter sequence, a MeP426 promoter, or an a- 1 -antitrypsin (hAAT) promoter sequence.

[0072] An enhancer is a regulatory element that increases the expression of a target sequence. A "promoter/enhancer" is a polynucleotide that contains sequences capable of providing both promoter and enhancer functions. For example, the long terminal repeats of retroviruses contain both promoter and enhancer functions. The enhancer/promoter may be "endogenous" or "exogenous" or "heterologous." An "endogenous" enhancer/promoter is one which is naturally linked with a given gene in the genome. An "exogenous" or "heterologous" enhancer/promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) or synthetic techniques such that transcription of that gene is directed by the linked enhancer/promoter. Non-limiting examples of linked enhancer/promoter for use in the methods, compositions and constructs provided herein include a PDE promoter plus IRBP enhancer or a CMV enhancer plus Ula promoter. It is understood in the art that enhancers can operate from a distance and irrespective of their orientation relative to the location of an endogenous or heterologous promoter. It is thus further understood that an enhancer operating at a distance from a promoter is thus “operably linked” to that promoter irrespective of its location in the vector or its orientation relative to the location of the promoter.

[0073] As used throughout the disclosure, the term "operably linked" refers to the expression of a gene (i.e. a transgene) that is under the control of a promoter with which it is spatially connected. A promoter can be positioned 5' (upstream) or 3' (downstream) of a gene under its control. A promoter can be positioned 5 ’(upstream) of a gene under its control. The distance between a promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. Variation in the distance between a promoter and a gene can be accommodated without loss of promoter function.

[0074] In some aspects, a promoter sequence can comprise, consist essentially of, or consist of a JeT promoter sequence (e.g., SEQ ID NO:3). A JeT promoter sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:3.

[0075] In some aspects, a promoter sequence can comprise, consist essentially of, or consist of a Jet+I promoter sequence. A Jet+I promoter sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO: 15. [0076] In some aspects, a promoter sequence can comprise, consist essentially of, or consist of a hybrid chicken [3-actin promoter sequence. A hybrid chicken [3-actin promoter sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO: 16.

[0077] A hybrid chicken [3-actin promoter sequence can comprise a CMV sequence (e.g., SEQ ID NO:21), a chicken [3- act in promoter sequence, a chicken [3-act i n exon 1 sequence (e.g., SEQ ID NO:22), a chicken [3-actin intron 1 sequence (e.g., SEQ ID NO:23), a minute virus of mice (MVM) intron sequence (e.g., SEQ ID NO:24), or any combination thereof. In some aspects, a hybrid chicken [3-acti n promoter sequence can comprise, in the 5' to 3' direction, a CMV sequence (e.g., SEQ ID NO:21), a chicken [3-actin promoter sequence, chicken [3-actin exon 1 sequence, a chicken [3-actin intron 1 sequence and a minute virus of mice (MVM) intron sequence.

[0078] In some aspects, a CMV sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:21. The [3-actin exon 1 sequence may comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:22. The chicken [3-act i n intron 1 sequence may comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:23. The MVM intron sequence may comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO:24.

[0079] In some aspects, a promoter sequence can comprise, consist essentially of, or consist of a U6 promoter sequence. A U6 promoter sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO: 17.

[0080] In some aspects, a promoter sequence can comprise, consist essentially of, or consist of a synapsin promoter sequence. A synapsin promoter sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO: 18. A synapsin promoter sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence put forth in SEQ ID NO: 19. [0081] 6, poly A sequences

[0082] In some aspects, a polyadenylation (polyA) sequence can comprise any polyA sequence known in the art. The polyA sequence may be a synthetic polyA sequence or a polyA sequence derived from a naturally occurring protein. Non-limiting examples of polyA sequences include, but are not limited to, mJvlECP2 polyA sequence, a retinol dehydrogenase 1 (RDH1) polyA sequence, a bovine growth hormone (BGH) polyA sequence, an SV40 polyA sequence (e.g., SEQ ID NO:5), a SPA49 polyA sequence, a sNRP-TK65 polyA sequence, a sNRP polyA sequence, or a TK65 polyA sequence.

[0083] Thus, a polyA sequence can comprise, consist essentially of, or consist of an MeCP2 polyA sequence, a retinol dehydrogenase 1 (RDH1) polyA sequence, a bovine growth hormone (BGH) polyA sequence, an SV40 polyA sequence, a SPA49 polyA sequence, a sNRP-TK65 polyA sequence, a sNRP polyA sequence, or a TK65 polyA sequence.

[0084] In some aspects, a polyA sequence can comprise, consist essentially of, or consist of an SV40pA sequence. In some aspects, an SV40pA sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical the sequence set forth in SEQ ID NO:5.

[0085] In certain embodiments, an rAAV vector disclosed herein comprises a Kozak sequence. In some aspects, an Kozak sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the sequence set forth in SEQ ID NO:25.

[0086] In certain embodiments, an rAAV vector disclosed herein comprises a Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE). In some aspects, a WPRE sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the sequence set forth in SEQ ID NO:26.

[0087] In certain embodiments, an rAAV vector described herein comprises, in 5 ’ to 3 ’ order, a first AAV2 ITR of SEQ ID NO:2; a Jet+I promoter of SEQ ID NO:3; an optimized transgene encoding CLN7 of SEQ ID NO:4; an SV40 polyA sequence of SEQ ID NO: 5; and a second AAV2 ITR of SEQ ID NO: 6. [0088] 7, Bacterial Plasmids

[0089] In some aspects, the rAAV vectors of the present disclosure can be contained within a bacterial plasmid to allow for propagation of the rAAV vector in vitro. Thus, the present disclosure provides bacterial plasmids comprising any of the rAAV vectors described herein. A bacterial plasmid can further comprise an origin of replication sequence. A bacterial plasmid can further comprise an antibiotic resistance gene. A bacterial plasmid can further comprise a resistance gene promoter. A bacterial plasmid can further comprise a prokaryotic promoter. In some aspects, a bacterial plasmid of the present disclosure can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to any of the nucleic acid sequence put forth in SEQ ID NO: 1.

[0090] 8, Origin of replication sequence

[0091] In some aspects, an origin of replication sequence can comprise, consist essentially of, or consist of any origin of replication sequence known in the art. The origin of replication sequence can be a bacterial origin of replication sequence, thereby allowing the rAAV vector comprising said bacterial origin of replication sequence to be produced, propagated and maintained in bacteria, using methods standard in the art.

[0092] 9, Antibiotic resistance genes

[0093] In some aspects, bacterial plasmids, rAAV vectors and/or rAAV viral vectors of the disclosure can comprise an antibiotic resistance gene.

[0094] In some aspects, an antibiotic resistance gene can comprise, consist essentially of, or consist of any antibiotic resistance genes known in the art. Examples of antibiotic resistance genes known in the art include, but are not limited to kanamycin resistance genes, spectinomycin resistance genes, streptomycin resistance genes, ampicillin resistance genes, carbenicillin resistance genes, bleomycin resistance genes, erythromycin resistance genes, polymyxin B resistance genes, tetracycline resistance genes and chloramphenicol resistance genes.

[0095] In some aspects, an antibiotic resistance gene can be a kanamycin resistance gene. In some aspects, a kanamycin resistance gene can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to any of the nucleic acid sequence put forth in SEQ ID NO:27.

[0096] 10. Resistance gene promoter

[0097] In some aspects, bacterial plasmids, rAAV vectors and/or rAAV viral vectors of the disclosure can comprise a resistance gene promoter. In some aspects, a resistance gene promoter can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to any of the nucleic acid sequence put forth in SEQ ID NO: 28.

[0098] The present disclosure provides an rAAV viral vector comprising: a) any of the rAAV vectors described herein, or complement thereof; and b) an AAV capsid protein.

[0099] The present disclosure provides an rAAV viral vector comprising: a) any of the rAAV vectors described herein; and b) an AAV capsid protein.

[0100] An AAV capsid protein can be any AAV capsid protein known in the art. An AAV capsid protein can be an AAV1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV 10 capsid protein, an AAV 11 capsid protein, an AAV 12 capsid protein, an AAV 13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein or an AAVrh.10 capsid protein.

[0101] Alternative rAAV vector and rAAV viral vector embodiments

1. An rAAV vector, comprising, in the 5 ’ to 3 ’ direction a. a first AAV ITR sequence; b. a promoter sequence; c. a transgene nucleic acid molecule, wherein the transgene nucleic acid molecule comprises a nucleic acid sequence encoding for a CLN7 polypeptide; d. a polyA sequence; and e. a second AAV ITR sequence.

2. The rAAV vector of embodiment 1, wherein the CLN7 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:4.

3. The rAAV vector of any of the preceding embodiments where the vector comprises SEQ ID NO: 1

4. The rAAV vector of any one of the preceding embodiments, wherein the first AAV ITR sequence comprises the nucleic acid sequence set forth in any one of SEQ ID NOs:2, 6, 7, 8, 9, 10, 11, 12, 13, or 14.

5. The rAAV vector of any one of the preceding embodiments, wherein the first AAV ITR sequence comprises the nucleic acid sequence set forth in SEQ ID NO:2.

6. The rAAV vector of any one of the preceding embodiments, wherein the second AAV ITR sequence comprises the nucleic acid sequence set forth in any one of SEQ ID NOs:2, 6, 7, 8, 9, 10. 11, 12, 13, or 14.

7. The rAAV vector of any one of the preceding embodiments, wherein the second AAV ITR sequence comprises the nucleic acid sequence set forth in SEQ ID NO:6.

8. The rAAV vector of any one of the preceding embodiments, wherein the promoter sequence comprises the nucleic acid sequence set forth in any one of SEQ ID NOs:3, 15, 16, 17, 18, 19, or 20.

9. The rAAV vector of any one of the preceding embodiments, wherein the promoter sequence comprises a synapsin promoter sequence.

10. The rAAV vector of any one of the preceding embodiments, wherein the synapsin promoter sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 18.

11. The rAAV vector of any one of the preceding embodiments, wherein the synapsin promoter sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 19. The rAAV vector of any one of the preceding embodiments, wherein the promoter sequence comprises a Jet+I promoter sequence. The rAAV vector of any one of the preceding embodiments, wherein the Jet+I promoter sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 15. The rAAV vector of any one of the preceding embodiments, wherein the polyA sequence comprises the nucleic acid sequence set forth in SEQ ID NO:5. The rAAV vector of any one of the preceding embodiments, wherein the polyA sequence comprises a SV40polyA sequence. An rAAV vector of any one of the preceding embodiments, comprising, in the 5’ to 3’ direction a. a first AAV ITR sequence comprising the nucleic acid sequence of SEQ ID NO:2; b. a promoter sequence comprising the nucleic acid sequence of SEQ ID NO:3; c. a transgene nucleic acid molecule, wherein the transgene nucleic acid molecule comprises a nucleic acid sequence encoding for a CLN7 polypeptide, wherein the CLN7 polypeptide comprises the amino acid sequence of SEQ ID NO:4; d. a second AAV ITR sequence comprising the nucleic acid sequence of SEQ ID NO:6. An rAAV viral vector comprising: a. an rAAV vector of any one of the preceding embodiments, or complement thereof; and b. an AAV capsid protein. An rAAV viral vector comprising: a. an rAAV vector of any one of the preceding embodiments; and b. an AAV capsid protein. The rAAV viral vector of any one of the preceding embodiments, wherein the AAV capsid protein is an AAV 1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein or an AAVrh. 10 capsid protein. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV1 capsid protein. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV2 capsid protein. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV3 capsid protein. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV4 capsid protein. 24. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV5 capsid protein.

25. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV6 capsid protein.

26. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV7 capsid protein.

27. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV8 capsid protein.

28. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV9 capsid protein.

29. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV 10 capsid protein.

30. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV 11 capsid protein.

31. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV 12 capsid protein.

32. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAV13 capsid protein.

33. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAVPHP.B capsid protein.

34. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAVrh74 capsid protein.

35. The rAAV viral vector of embodiment 19, wherein the AAV capsid protein is an AAVrh. 10 capsid protein.

[0102] Compositions and Pharmaceutical Compositions

[0103] The present disclosure provides compositions comprising any of the isolated polynucleotides, rAAV vectors, and/or rAAV viral vectors described herein. In some aspects, the compositions can be pharmaceutical compositions. Accordingly, the present disclosure provides pharmaceutical compositions comprising any of the isolated polynucleotides, rAAV vectors, and/or rAAV viral vectors described herein.

[0104] The pharmaceutical composition, as described herein, may be formulated by any methods known or developed in the art of pharmacology, which include but are not limited to contacting the active ingredients (e.g., viral particles or recombinant vectors) with an excipient and/or additive and/or other accessory ingredient, dividing or packaging the product to a dose unit. The viral particles of this disclosure may be formulated with desirable features, e.g., increased stability, increased cell transfection, sustained or delayed release, biodistributions or tropisms, modulated or enhanced translation of encoded protein in vivo, and the release profde of encoded protein in vivo.

[0105] As such, the pharmaceutical composition may further comprise saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics or combinations thereof. In some aspects, the pharmaceutical composition is formulated as a nanoparticle. In some aspects, the nanoparticle is a self-assembled nucleic acid nanoparticle.

[0106] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. The formulations can include one or more excipients and/or additives, each in an amount that together increases the stability of the viral vector, increases cell transfection or transduction by the viral vector, increases the expression of viral vector encoded protein, and/or alters the release profile of viral vector encoded proteins. In some aspects, the pharmaceutical composition comprises an excipient and/or additive. Non limiting examples of excipients and/or additives include solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, or combination thereof. [0107] In some aspects, the pharmaceutical composition comprises a cryoprotectant. The term "cryoprotectant" refers to an agent capable of reducing or eliminating damage to a substance during freezing. Non-limiting examples of cryoprotectants include sucrose, trehalose, lactose, glycerol, dextrose, raffinose and/or mannitol.

[0108] As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see Martin (1975) Remington's Pharm. Sci., 15th Ed. (Mack Publ. Co., Easton).

[0109] In some aspects, a pharmaceutical composition of the present disclosure can comprise phosphate-buffered saline (PBS), D-sorbitol or any combination thereof.

[0110] In some aspects, a pharmaceutical composition can comprise PBS, wherein the PBS is present at a concentration of about 100 mM to about 500 mM, or about 200 mM to about 400 mM, or about 300 mM to about 400 mM. In some aspects, the sodium chloride can be present at a concentration of about 350 mM. [0111] In some aspects, a pharmaceutical composition can comprise D-sorbitol, wherein the D-sorbitol is present at a concentration of about 1% to about 10%, or about 2.5% to about 7.5%. In some aspects, the D-sorbitol can be present at a concentration of about 5%.

[0112] Thus, the present disclosure provides a pharmaceutical composition comprising an rAAV vector and/or rAAV viral vector of the present disclosure in a 350 mM phosphate-buffered saline solution comprising D-sorbitol at a concentration of 5%.

[0113] Methods of Using the Compositions of the Disclosure

[0114] The present disclosure provides the use of a disclosed composition or pharmaceutical composition for the treatment of a disease or disorder in a cell, tissue, organ, animal, or subject, as known in the art or as described herein, using the disclosed compositions and pharmaceutical compositions, e.g., administering or contacting the cell, tissue, organ, animal, or subject with a therapeutic effective amount of the composition or pharmaceutical composition. In one aspect, the subject is a mammal. The subject can be human.

[0115] This disclosure provides methods of preventing or treating a disease and/or disorder, comprising, consisting essentially of, or consisting of administering to a subject a therapeutically effective amount of any one of the rAAV vectors, rAAV viral vectors, compositions and/or pharmaceutical compositions disclosed herein.

[0116] In some aspects, the disease and/or disorder can be a genetic disorder involving the CLN7 gene. A genetic disorder involving the CLN7 gene can be CLN7 loss, misfunction and/or deficiency. Genetic disorders involving the CLN7 gene include, but are not limited to, epileptic encephalopathies, such as neonatal epileptic encephalopathy. In some aspects, the disease and/or disorder involving an CLN7 gene is Batten Disease.

[0117] In some aspects, the disease can be a disorder involving the CLN7 protein. A genetic disorder involving the CLN7 protein can be CLN7 loss, misfunction and/or deficiency.

[0118] In some aspects, a disease can be a disease that is characterized by the loss-of-function of at least one copy of the CLN7 gene in the genome of a subject. In some aspects, a disease can be a disease that is characterized by a decrease in function of at least one copy of the CLN7 gene in the genome of a subject. In some aspects, a disease can be a disease that is characterized by at least one mutation in at least one mutation in at least one copy of the CLN7 gene in the genome of the subject.

[0119] A subject in the methods provided herein can be deficient in CLN7 and/or CLN7. As used herein, "CI.N7 deficiency” means that a subject can have one or more mutations in the CLN7 gene or lacks a functional CLN7 gene. As used herein, “CLN7 deficiency” means that a subject can have one or more mutations in the SLC135 protein or lacks a functional CLN7 protein.

[0120] A mutation in a CLN7 gene or CLN7 protein can be any type of mutation that is known in the art. Non-limiting examples of mutations include somatic mutations, single nucleotide variants (SNVs), nonsense mutations, insertions, deletions, duplications, frameshift mutations, repeat expansions, short insertions and deletions (INDELs), long INDELs, alternative splicing, the products of alternative splicing, altered initiation of translation, the products of altered initiation of translation, proteomic cleavage, the products of proteomic cleavage.

[0121] In some aspects, a disease can be a disease that is characterized by a decrease in expression of the CLN7 gene in a subject as compared to a control subject that does not have the disease. In some aspects, the decrease in expression can be at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 99%, or at least about 100%.

[0122] In some aspects, a disease can be a disease that is characterized by a decrease in the amount of CLN7 protein in a subject as compared to a control subject that does not have the disease. In some aspects, the decrease in the amount of CLN7 protein can be at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 99%, or at least about 100%.

[0123] In some aspects, a disease can be a disease that is characterized by a decrease in the activity of CLN7 protein in a subject as compared to a control subject that does not have the disease. In some aspects, the decrease in the activity of CLN7 protein can be at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 99%, or at least about 100%.

[0124] Methods of treatment can alleviate one or more symptoms of a disease and/or disorder described herein. In an embodiment, delivery of compositions described herein can prevent or delay development of detectable symptoms, if administered to a subject carrying a mutation in the CLN7 gene before symptoms become detectable. Therefore, treatment can be therapeutic or prophylactic. Therapy refers to inhibition or reversal of established symptoms or phenotype. Therapy can also mean delay of onset of symptoms or phenotype. Prophylaxis means inhibiting or preventing development of symptoms in subjects not already displaying overt symptoms. Subjects not displaying overt symptoms can be identified early in life as carrying a loss of function mutation in the CLN7 gene by appropriate genetic testing performed before 18 months, 12 months, or 6 months of age.

[0125] A subject to be treated using the methods, compositions, pharmaceutical compositions, rAAV vectors or rAAV viral vectors of the present disclosure can have any of the diseases and/or symptoms described herein. [0126] In some aspects, a subject can be less than 0.5 years of age, or less than 1 year of age, or less than 1.5 years of age, or less than 2 years of age, or at less than 2.5 years of age, or less than 3 years of age, or less than 3.5 years of age, or less than 3.5 years of age, or less than 4 years of age, or less than 4.5 years of age, or less than 5 years of age, or less than 5.5 years of age, or less than 6 years of age, or less than 6.5 years of age, or less than 7 years of age, or less than 7.5 years of age, or less than 8 years of age, or less than 8.5 years of age, or less than 9 years of age, or less than 9.5 years of age, or less than 10 years of age. In some aspects the subject can be less than 11 years of age, less than 12 years of age, less than 13 years of age, less than 14 years of age, less than 15 years of age, less than 20 years of age, less than 30 years of age, less than 40 years of age, less than 50 years of age, less than 60 years of age, less than 70 years of age, less than 80 years of age, less than 90 years of age, less than 100 years of age, less than 110 years of age, or less than 120 years of age. In some aspects, a subject can be less than 0.5 years of age. In some aspects, a subject can be less than 4 years of age. In some aspects, a subject can be less than 10 years of age.

[0127] The methods of treatment and prevention disclosed herein may be combined with appropriate diagnostic techniques to identify and select patients for the therapy or prevention.

[0128] The disclosure provides methods of increasing the level of a protein in a host cell, comprising contacting the host cell with any one of the rAAV viral vectors disclosed herein, wherein the rAAV viral vectors comprises any one of the rAAV vectors disclosed herein, comprising a transgene nucleic acid molecule encoding the protein. In some aspects, the protein is a therapeutic protein. In some aspects, the host cell is in vitro, in vivo, or ex vivo. In some aspects, the host cell is derived from a subject. In some aspects, the subject suffers from a disorder, which results in a reduced level and/or functionality of the protein, as compared to the level and/or functionality of the protein in a normal subject.

[0129] In some aspects, the level of the protein is increased to level of about 1 xlO"⁷ ng, about 3 xlO"⁷ ng, about 5 xlO"⁷ ng, about 7 xlO"⁷ ng, about 9 xlO"⁷ ng, about 1 xlO"⁶ ng, about 2 xlO"⁶ ng, about 3 x10" ⁶ ng, about 4 xlO"⁶ ng, about 6 xlO"⁶ ng, about 7 xlO"⁶ ng, about 8 xlO"⁶ ng, about 9 xlO"⁶ ng, about 10 xlO"⁶ ng, about 12 xlO"⁶ ng, about 14 xlO"⁶ ng, about 16 xlO"⁶ ng, about 18 xlO"⁶ ng, about 20 xlO"⁶ ng, about 25 xlO"⁶ ng, about 30 xlO"⁶ ng, about 35 xlO"⁶ ng, about 40 xlO"⁶ ng, about 45 xlO"⁶ ng, about 50 xlO"⁶ ng, about 55 xlO"⁶ ng, about 60 xlO"⁶ ng, about 65 xlO"⁶ ng, about 70 xlO"⁶ ng, about 75 xlO"⁶ ng, about 80 xlO"⁶ ng, about 85 xlO"⁶ ng, about 90 xlO"⁶ ng, about 95 xlO"⁶ ng, about 10 xlO"⁵ ng, about 20 xlO"⁵ ng, about 30 xlO"⁵ ng, about 40 xlO"⁵ ng, about 50 xlO"⁵ ng, about 60 xlO"⁵ ng, about 70 xlO"⁵ ng, about 80 xlO"⁵ ng, or about 90 xlO"⁵ ng in the host cell.

[0130] The expression levels of a gene (e.g., CI.N7) or a protein (e.g., CLN7) may be determined by any suitable method known in the art or described herein. Protein levels may be determined, for example, by Western Blotting, immunohistochemistry and flow cytometry. Gene expression may be determined, for example, by quantitative PCR, gene sequencing, and RNA sequencing.

[0131] The disclosure provides methods of introducing a gene of interest to a cell in a subject comprising contacting the cell with an effective amount of any one of the rAAV viral vectors disclosed herein, wherein the rAAV viral vectors contain any one of the rAAV vectors disclosed herein, comprising the gene of interest.

[0132] In some aspects of the methods of the present disclosure, a subject can also be administered a prophylactic immunosuppressant treatment regimen in addition to being administered an rAAV vector or rAAV viral vector of the present disclosure. In some aspects, an immunosuppressant treatment regimen can comprise administering at least one immunosuppressive therapeutic. Non limiting examples of immunosuppressive therapeutics include, but are not limited to, Sirolimus (rapamycin), acetaminophen, diphenhydramine, IV methylprednisolone, prednisone, or any combination thereof. An immunosuppressive therapeutic can be administered prior to the day of administration of the rAAV vector and/or rAAV viral vector, on the same day as the administration of the rAAV vector and/or rAAV viral vector, or any day following the administration of the rAAV vector and/or rAAV viral vector.

[0133] A "subject" of diagnosis or treatment is a cell or an animal such as a mammal, or a human. The terms “subject” and “patient” are used interchangeably herein. A subject is not limited to a specific species and includes non-human animals subject to diagnosis or treatment and those subject to infections or animal models, including, without limitation, simian, murine, rat, canine, or leporid species, as well as other livestock, sport animals, or pets. In some aspects, the subject is a human. In some embodiments, the subject is a human child, e.g., a child of less than five years of age. In some embodiments, the subject is a human newborn, e.g., a newborn of less than one month, less than two months, less than three months, or less than four months of age.

[0134] As used herein, "treating" or "treatment" of a disease in a subject refers to (1) inhibiting the disease or arresting its development; or (2) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, "treatment" is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable.

[0135] As used herein, "preventing" or "prevention" of a disease refers to preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease. [0136] In some aspects, the effective amount will depend on the size and nature of the application in question. It will also depend on the nature and sensitivity of the target subject and the methods in use. The skilled artisan will be able to determine the effective amount based on these and other considerations. The effective amount may comprise, consist essentially of, or consist of one or more administrations of a composition depending on the embodiment.

[0137] As used herein, the term "administer" or "administration" intends to mean delivery of a substance to a subject such as an animal or human. Administration can be effected in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, as well as the age, health or gender of the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician or in the case of pets and other animals, treating veterinarian.

[0138] Methods of determining the most effective means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. It is noted that dosage may be impacted by the route of administration. Suitable dosage formulations and methods of administering the agents are known in the art. Non-limiting examples of such suitable dosages may be as low as 10⁹ vector genomes to as much as 10¹⁷ vector genomes per administration.

[0139] In some aspects of the methods described herein, the number of viral particles (e.g., rAAV viral vectors) administered to the subject ranges from about 10⁹ to about 10¹⁸. In some aspects, about 10¹⁰ to about 10¹², about 10¹¹ to about 10¹³, about 10¹¹ to about 10¹², about 10¹¹ to about 10¹⁴, about 10¹² to about 10¹⁶, about 10¹³ to about 10¹⁶, about 10¹⁴ to about 10¹⁵, about 5 x 10¹¹ to about 5 x 10¹², about 10¹¹ to about 10¹⁸, about 10¹³ to about 10¹⁶, or about 10¹² to about 10¹³ viral particles are administered to the subject.

[0140] In some aspects of the methods described herein, the number of viral particles (e.g., rAAV viral vectors) administered to the subject is at least about 10¹⁰, or at least about 10¹¹, or at least about 10¹², or at least about 10¹³, or at least about 10¹⁴, or at least about 10¹⁵, or at least about 10¹⁶, or at least about 10¹⁷ viral particles.

[0141] In some aspects of the methods described herein, the number of viral particles (e.g., rAAV viral vectors) administered to the subject can depend on the age of the subject. In non-limiting examples, a subject that is 7 years of age or older can be administered about 10xl0¹⁴ viral particles, a subject that is about 4 years of age to about 7 years of age can be administered about 10xl0¹⁴ viral particles, a subject that is about 3 years of age to about 4 years of age can be administered about 9xl0¹⁴ viral particles, a subject that is about 2 years of age to about 3 years of age can be about 8.2xl0¹⁴ viral particles, a subject that is about 1 year of age to about 2 years of age can be administered about 7.3xl0¹⁴ viral particles, a subject that is about 0.5 years of age to about 1 year of age can be administered about 4xl0¹⁴ viral particles, or a subject that is less than 0.5 years of age can be administered 3xl0¹⁴ viral particles.

[0142] In some aspects, the amounts of viral particles in a composition, pharmaceutical composition, or the amount of viral particles administered to a patient can calculated based on the percentage of viral particles that are predicted to contain viral genomes.

[0143] In some aspects, rAAV viral vectors of the present disclosure can be introduced to the subject intravenously, intrathecally (IT), intracistema-magna (ICM) intracerebrally, intraventricularly, intranasally, intratracheally, intra-aurally, intra-ocularly, or peri-ocularly, orally, rectally, transmucosally, inhalationally, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracistemally, intranervally, intrapleurally, topically, intralymphatically, intraci stemally; such introduction may also be intra-arterial, intracardiac, subventricular, epidural, intracerebral, intracerebroventricular, sub-retinal, intravitreal, intraarticular, intraperitoneal, intrauterine, intranerve or any combination thereof. In some aspects, the viral particles are delivered to a desired target tissue, e.g., to the lung, eye, or CNS, as non-limiting examples. In some aspects, delivery of viral particles is systemic. The intracistemal route of administration involves administration of a drug directly into the cerebrospinal fluid of the brain ventricles. It could be performed by direct injection into the cistema magna or via a permanently positioned tube. In some aspects, the rAAV viral vectors of the present disclosure are administered intrathecally (IT). In some aspects, the rAAV viral vectors of the present disclosure are administered intracistema-manga (ICM).

[0144] In some aspects, the rAAV viral vectors of the present disclosure repair a gene deficiency in a subject. In some aspects, the ratio of repaired target polynucleotide or polypeptide to unrepaired target polynucleotide or polypeptide in a successfully treated cell, tissue, organ or subject is at least about 1.5: 1, about 2: 1, about 3: 1, about 4: 1, about 5: 1, about 6: 1, about 7: 1, about 8: 1, about 9: 1, about 10: 1, about 20: 1, about 50: 1, about 100: 1, about 1000: 1, about 10,000: 1, about 100,000: 1, or about 1,000,000: 1. The amount or ratio of repaired target polynucleotide or polypeptide can be determined by any method known in the art, including but not limited to western blot, northern blot, Southern blot, PCR, sequencing, mass spectrometry, flow cytometry, immunohistochemistry, immunofluorescence, fluorescence in situ hybridization, next generation sequencing, immunoblot, and ELISA.

[0145] Administration of the rAAV vectors, rAAV viral vectors, compositions or pharmaceutical compositions of this disclosure can be effected in one dose, continuously or intermittently throughout the course of treatment. In some aspects, the rAAV vectors, rAAV viral vectors, compositions, or pharmaceutical compositions of this disclosure are parenterally administered by injection, infusion, or implantation. [0146] In some embodiments, the subject is administered one single dose of a recombinant rAAV provided herein in its lifetime. In some embodiments, the subject is administered repeat doses of the recombinant rAAV provided herein. These repeat doses may contain the same amount of rAAV particles or they may contain different amounts of rAAV particles. In some embodiments, the subject is administered repeat doses of the rAAV about every 6 months, about every 9 months, about every 12 months, about every 15 months, about every 18 months, about every 2 years, about every 3 years, about every 4 years, about every 5 years, about every 6 years, about every 7 years, about every 8 years, about every 9 years, or about every 10 years.

[0147] Methods of Manufacture

[0148] A variety of approaches may be used to produce rAAV viral vectors of the present disclosure. In some aspects, packaging is achieved by using a helper virus or helper plasmid and a cell line. The helper virus or helper plasmid contains elements and sequences that facilitate viral vector production. In another aspect, the helper plasmid is stably incorporated into the genome of a packaging cell line, such that the packaging cell line does not require additional transfection with a helper plasmid.

[0149] In some aspects, the cell is a packaging or helper cell line. In some aspects, the helper cell line is eukaryotic cell; for example, an HEK 293 cell or 293T cell. In some aspects, the helper cell is a yeast cell or an insect cell.

[0150] In some aspects, the cell comprises a nucleic acid encoding a tetracycline activator protein; and a promoter that regulates expression of the tetracycline activator protein. In some aspects, the promoter that regulates expression of the tetracycline activator protein is a constitutive promoter. In some aspects, the promoter is a phosphoglycerate kinase promoter (PGK) or a CMV promoter.

[0151] A helper plasmid can comprise, for example, at least one viral helper DNA sequence derived from a replication-incompetent viral genome encoding in trans all virion proteins required to package a replication incompetent AAV, and for producing virion proteins capable of packaging the replicationincompetent AAV at high titer, without the production of replication- competent AAV.

[0152] Helper plasmids for packaging AAV are known in the art, see, e.g., U.S. Patent Pub. No. 2004/0235174 Al, incorporated herein by reference. As stated therein, an AAV helper plasmid may contain as helper virus DNA sequences, by way of non-limiting example, the Ad5 genes E2A, E4 and VA, controlled by their respective original promoters or by heterologous promoters. AAV helper plasmids may additionally contain an expression cassette for the expression of a marker protein such as a fluorescent protein to permit the simple detection of transfection of a desired target cell.

[0153] The disclosure provides methods of producing rAAV viral vectors comprising transfecting a packaging cell line with any one of the AAV helper plasmids disclosed herein; and any one of the rAAV vectors disclosed herein. In some aspects, the AAV helper plasmid and rAAV vector are co-transfected into the packaging cell line. In some aspects, the cell line is a mammalian cell line, for example, human embryonic kidney (HEK) 293 cell line. The disclosure provides cells comprising any one of the rAAV vectors and/or rAAV viral vectors disclosed herein.

[0154] As used herein, the term "helper" in reference to a virus or plasmid refers to a virus or plasmid used to provide the additional components necessary for replication and packaging of any one of the rAAV vectors disclosed herein. The components encoded by a helper virus may include any genes required for virion assembly, encapsidation, genome replication, and/or packaging. For example, the helper virus or plasmid may encode necessary enzymes for the replication of the viral genome. Nonlimiting examples of helper viruses and plasmids suitable for use with AAV constructs include pHELP (plasmid), adenovirus (virus), or herpesvirus (virus). In some aspects, the pHELP plasmid may be the pHELPK plasmid, wherein the ampicillin expression cassette is exchanged with a kanamycin expression cassette.

[0155] As used herein, a packaging cell (or a helper cell) is a cell used to produce viral vectors. Producing recombinant AAV viral vectors requires Rep and Cap proteins provided in trans as well as gene sequences from Adenovirus that help AAV replicate. In some aspects, Packaging/helper cells contain a plasmid is stably incorporated into the genome of the cell. In other aspects, the packaging cell may be transiently transfected. Typically, a packaging cell is a eukaryotic cell, such as a mammalian cell or an insect cell.

[0156] Kits

[0157] The isolated polynucleotides, rAAV vectors, rAAV viral vectors, compositions, and/or pharmaceutical compositions described herein may be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic, or research applications. In some aspects, the kits of the present disclosure include any one of the isolated polynucleotides, rAAV vectors, rAAV viral vectors, compositions, pharmaceutical compositions, host cells, isolated tissues, as described herein.

[0158] In some aspects, a kit further comprises instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In some aspects, the kit may include instructions for mixing one or more components of the kit and/or isolating and mixing a sample and applying to a subject. In some aspects, agents in a kit are in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes can contain the components in appropriate concentrations or quantities for running various experiments.

[0159] The kit may be designed to facilitate use of the methods described herein and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. In some aspects, the compositions may be provided in a preservation solution (e.g., cryopreservation solution). Non-limiting examples of preservation solutions include DMSO, paraformaldehyde, and CryoStor® (Stem Cell Technologies, Vancouver, Canada). In some aspects, the preservation solution contains an amount of metalloprotease inhibitors.

[0160] In some aspects, the kit contains any one or more of the components described herein in one or more containers. Thus, in some aspects, the kit may include a container housing agents described herein. The agents may be in the form of a liquid, gel or solid (powder). The agents may be prepared sterilely, packaged in a syringe and shipped refrigerated. Alternatively, they may be housed in a vial or other container for storage. A second container can have other agents prepared sterilely. Alternatively, the kit can include the active agents premixed and shipped in a syringe, vial, tube, or other container. The kit can have one or more or all of the components required to administer the agents to a subject, such as a syringe, topical application devices, or IV needle tubing and bag.

[0161] Further definitions

[0162] Unless the context indicates otherwise, it is specifically intended that the various features described herein can be used in any combination. Moreover, the disclosure also contemplates that, in some aspects, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.

[0163] Unless explicitly indicated otherwise, all specified aspects, embodiments, features, and terms intend to include both the recited aspect, embodiment, feature, or term and biological equivalents thereof.

[0164] The practice of the present technology will employ, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edition (1989); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds., (1987)); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (RI. Freshney, ed. (1987)).

[0165] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but do not exclude others. As used herein, the transitional phrase "consisting essentially of' (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic (s) of the recited embodiment. Thus, the term "consisting essentially of as used herein should not be interpreted as equivalent to "comprising." "Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions disclosed herein. Aspects defined by each of these transition terms are within the scope of the present disclosure. In each instance herein any of the terms "comprising," "consisting essentially of," and "consisting of can be replaced with either of the other two terms, while retaining their ordinary meanings. Any single term, single element, single phrase, group of terms, group of phrases, or group of elements described herein can each be specifically excluded from the claims.

[0166] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (-) by increments of 1.0 or 0.1, as appropriate, or, alternatively, by a variation of +/- 15%, 10%, 5%, 2%. It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term "about". It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art. The term "about," as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

[0167] The terms "acceptable" or "effective," when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.

[0168] Also, as used herein, "and/or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0169] Unless specifically recited, the term "host cell" includes a eukaryotic host cell, including, for example, fungal cells, yeast cells, higher plant cells, insect cells and mammalian cells. Non-limiting examples of eukaryotic host cells include simian, bovine, porcine, murine, rat, avian, reptilian and human, e.g., HEK293 cells and 293T cells.

[0170] The term "isolated" as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials.

[0171] As used herein, the terms "nucleic acid sequence" and "polynucleotide" are used interchangeably to refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising, consisting essentially of, or consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. [0172] A "gene" refers to a polynucleotide containing at least one open reading frame (ORF) that is capable of encoding a particular polypeptide or protein. A "gene product" or, alternatively, a "gene expression product" refers to the amino acid sequence (e.g., peptide or polypeptide) generated when a gene is transcribed and translated.

[0173] As used herein, "expression" refers to the two-step process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0174] "Under transcriptional control" is a term well understood in the art and indicates that transcription of a polynucleotide sequence, usually a DNA sequence, depends on its being operatively linked to an element that contributes to the initiation of, or promotes, transcription. "Operatively linked" intends that the polynucleotides are arranged in a manner that allows them to function in a cell. In one aspect, promoters can be operatively linked to the downstream sequences.

[0175] The term "encode" as it is applied to polynucleotides and/or nucleic acid sequences refers to a polynucleotide and/or nucleic acid sequence which is said to "encode" a polypeptide if its base sequence is identical to the base sequence of the RNA transcript (e.g. mRNA transcript) that is translated into the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

[0176] The term "protein", "peptide" and "polypeptide" are used interchangeably and in their broadest sense to refer to a compound of two or more subunits of amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another aspect, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids which may comprise, consist essentially of, or consist of a protein's or peptide's sequence. As used herein the term "amino acid" refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.

[0177] As used herein, the term "signal peptide" or "signal polypeptide" intends an amino acid sequence usually present at the N-terminal end of newly synthesized secretory or membrane polypeptides or proteins. It acts to direct the polypeptide to a specific cellular location, e.g. across a cell membrane, into a cell membrane, or into the nucleus. In some aspects, the signal peptide is removed following localization. Examples of signal peptides are well known in the art. Non-limiting examples are those described in U.S. Patent Nos. 8,853,381, 5,958,736, and 8,795,965. In some aspects, the signal peptide can be an IDUA signal peptide.

[0178] The terms "equivalent" or "biological equivalent" are used interchangeably when referring to a particular molecule, biological material, or cellular material and intend those having minimal homology while still maintaining desired structure or functionality. Non-limiting examples of equivalent polypeptides include a polypeptide having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identity or at least about 99% identity to a reference polypeptide (for instance, a wildtype polypeptide); or a polypeptide which is encoded by a polynucleotide having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identity, at least about 97% sequence identity or at least about 99% sequence identity to the reference polynucleotide (for instance, a wild-type polynucleotide).

[0179] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Percent identity can be determined by comparing a position in each sequence that may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of identity between sequences is a function of the number of matching positions shared by the sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity, with one of the sequences of the present disclosure. Alignment and percent sequence identity may be determined for the nucleic acid or amino acid sequences provided herein by importing said nucleic acid or amino acid sequences into and using ClustalW (available at https://genome.jp/tools-bin/clustalw/). For example, the ClustalW parameters used for performing the protein sequence alignments found herein were generated using the Gonnet (for protein) weight matrix. In some aspects, the ClustalW parameters used for performing nucleic acid sequence alignments using the nucleic acid sequences found herein are generated using the ClustalW (for DNA) weight matrix.

[0180] As used herein, amino acid modifications may be amino acid substitutions, amino acid deletions or amino acid insertions. Amino acid substitutions may be conservative amino acid substitutions or nonconservative amino acid substitutions. A conservative replacement (also called a conservative mutation, a conservative substitution or a conservative variation) is an amino acid replacement in a protein that changes a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity or size). As used herein, “conservative variations” refer to the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another; or the substitution of one charged or polar residue for another, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, glutamine for asparagine, and the like. Other illustrative examples of conservative substitutions include the changes of: alanine to serine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine, or glutamate; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the like.

[0181] A polynucleotide disclosed herein can be delivered to a cell or tissue using a gene delivery vehicle. "Gene delivery," "gene transfer," "transducing," and the like as used herein, are terms referring to the introduction of an exogenous polynucleotide (sometimes referred to as a "transgene") into a host cell, irrespective of the method used for the introduction. Such methods include a variety of well-known techniques such as vector-mediated gene transfer (by, e.g., viral infection/transfection, or various other protein-based or lipid-based gene delivery complexes) as well as techniques facilitating the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery and various other techniques used for the introduction of polynucleotides). The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contains an origin of replication compatible with the host cell or integrates into a replicon of the host cell such as an extrachromosomal replicon (e.g., a plasmid) or a nuclear or mitochondrial chromosome. A number of vectors are known to be capable of mediating transfer of genes to mammalian cells, as is known in the art and described herein.

[0182] A "plasmid" is a DNA molecule that is typically separate from and capable of replicating independently of the chromosomal DNA. In many cases, it is circular and double-stranded. Plasmids provide a mechanism for horizontal gene transfer within a population of microbes and typically, provide a selective advantage under a given environmental state. Plasmids may carry genes that provide resistance to naturally occurring antibiotics in a competitive environmental niche, or, alternatively, the proteins produced may act as toxins under similar circumstances. It is known in the art that while plasmid vectors often exist as extrachromosomal circular DNA molecules, plasmid vectors may also be designed to be stably integrated into a host chromosome either randomly or in a targeted manner, and such integration may be accomplished using either a circular plasmid or a plasmid that has been linearized prior to introduction into the host cell.

[0183] " Plasmids" used in genetic engineering are called "plasmid vectors". Many plasmids are commercially available for such uses. The gene to be replicated is inserted into copies of a plasmid containing genes that make cells resistant to particular antibiotics, and a multiple cloning site (MCS, or polylinker), which is a short region containing several commonly used restriction sites allowing the easy insertion of DNA fragments at this location. Another major use of plasmids is to make large amounts of proteins. In this case, researchers grow bacteria or eukaryotic cells containing a plasmid harboring the gene of interest, which can be induced to produce large amounts of proteins from the inserted gene. [0184] In aspects where gene transfer is mediated by a DNA viral vector, such as an adenovirus (Ad) or adeno-associated virus (AAV), a vector construct refers to the polynucleotide comprising, consisting essentially of, or consisting of the viral genome or part thereof, and a transgene.

[0185] The term "tissue" is used herein to refer to tissue of a living or deceased organism or any tissue derived from or designed to mimic a living or deceased organism. The tissue may be healthy, diseased, and/or have genetic mutations. The biological tissue may include any single tissue (e.g., a collection of cells that may be interconnected), or a group of tissues making up an organ or part or region of the body of an organism. The tissue may comprise, consist essentially of, or consist of a homogeneous cellular material or it may be a composite structure such as that found in regions of the body including the thorax which for instance can include lung tissue, skeletal tissue, and/or muscle tissue. Exemplary tissues include, but are not limited to those derived from liver, lung, thyroid, skin, pancreas, blood vessels, bladder, kidneys, brain, biliary tree, duodenum, abdominal aorta, iliac vein, heart and intestines, including any combination thereof.

[0186] The compositions and methods are more particularly described below, and the Examples set forth herein are intended as illustrative only, as numerous modifications and variations therein will be apparent to those skilled in the art. The terms used in the specification generally have their ordinary meanings in the art, within the context of the compositions and methods described herein, and in the specific context where each term is used. Some terms have been more specifically defined herein to provide additional guidance to the practitioner regarding the description of the compositions and methods.

[0187] As used in the description herein and throughout the claims that follow, the meaning of “a”, “an”, and “the” includes plural reference as well as the singular reference unless the context clearly dictates otherwise. The term “about” in association with a numerical value means that the value varies up or down by 5%. For example, for a value of about 100, means 95 to 105 (or any value between 95 and 105).

[0188] All patents, patent applications, and other scientific or technical writings referred to anywhere herein are incorporated by reference herein in their entirety. The embodiments illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are specifically or not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising," "consisting essentially of," and "consisting of' can be replaced with either of the other two terms, while retaining their ordinary meanings. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claims. Thus, it should be understood that although the present methods and compositions have been specifically disclosed by embodiments and optional features, modifications and variations of the concepts herein disclosed can be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of the compositions and methods as defined by the description and the appended claims.

[0189] Any single term, single element, single phrase, group of terms, group of phrases, or group of elements described herein can each be specifically excluded from the claims.

[0190] Whenever a range is given in the specification, for example, a temperature range, a time range, a composition, or concentration range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. It will be understood that any subranges or individual values in a range or subrange that are included in the description herein can be excluded from the aspects herein. It will be understood that any elements or steps that are included in the description herein can be excluded from the claimed compositions or methods.

[0191] In addition, where features or aspects of the compositions and methods are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the compositions and methods are also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.

[0192] The following are provided for exemplification purposes only and are not intended to limit the scope of the embodiments described in broad terms above.

EXAMPLES

[0193] EXAMPLE 1: Comparison of CLN7 v2 and CLN7 vl vectors in patient fibroblasts

[0194] This comparison consisted of in vitro studies to compare CLN7 expression between both designs in HEK293 and Lec2 cell cultures and to compare their relative ability to correct lysosomal abnormalities in patient fibroblasts.

[0195] Materials and methods

[0196] Plasmid development and Vector preparation

[0197] A 2nd generation version of the CLN7 vector construct, named JeT-hCLN7opt(v2)-SV40pA, or CLN7 v2 for short, was created to remove as many CpG dinucleotides as possible within the CLN7 coding region (FIG. 1). As illustrated in the schematic diagram the CLN7 v2 construct comprises a mutant AAV2 inverted terminal repeat (ITR) with the D element deleted (A ITR), the JeT promoter, the human CLN7 codon-optimized coding sequence version2 (hCLN7(v2)opt), the synthetic polyadenylation SV40pA signal, and WT AAV2 ITR. ATUM was used to codon-optimize the human CLN7 coding sequence, to utilize common tRNAs, to remove cryptic start sites and splice sites, and to minimize the presence of CpG dinucleotides. This optimized CLN7 coding sequence was cloned into a custom-made scAAV ITR plasmid construct developed in the Gray lab and using the same promoter (JeT) and polyA (SV40pA) combination as the original design CLN7 vl.

[0198] After verifying the expression of the CLN7 v2 plasmid construct in HEK293 cells, both the original construct (CLN7 vl) and CLN7 v2 were packaged within both scAAV2 and scAAV9 capsids. An scAAV2/JeT-GFP-SV40pA vector and an scAAV9/JeT-GFP-SV40pA vector was also produced for use as controls. All vectors were prepared and confirmed with alkaline gel (FIG. 2). Specifically, 2.5E 10 vg/lane of each vector was prepared and loaded on an alkaline gel, run at 12V for 16 hours in a cold room, and stained with SYBR Gold.

[0199] CLN7 expression in HEK293 or Lec2 cells transduced with CLN7 vl or CLN7 v2 vector

[0200] NHCLN7 vl or NHCLN7 v2 was mixed 1: 1 with NUGFP and used to transfect HEK293 cells in triplicate at doses of 1E3, 1E4, and 1E5 vg per cell for 48 hours. The same experimental design was conducted in Lec2 cells, except using AAV9 vectors in place of AAV2.

[0201] Total RNA was extracted with PureLink™ RNA Mini Kit (12183018A, ThermoFisher) and cDNA was synthesized with SuperScript™ IV VILO™ Master Mix with ezDNase™ Enzyme (11766050, ThermoFisher). Expression of CLN7 mRNA was assessed by RT-qPCR and normalized to GFP expression to compare the expression of the two CLN7 transgene versions.

[0202] For Western blotting, cells were lysed in cold Pierce RIPA Buffer (89901, ThermoFisher) containing a Halt™ Protease Inhibitor Cocktail (78429, ThermoFisher). The lysates were centrifuged at 4°C for 15 min at 15000g. A Pierce BCA protein assay kit (23235, ThermoFisher) was used to determine protein concentration in the supernatant. 50 ug of protein was run on a 10% tris-glycine gel (456-1033, Bio-Rad) and transferred onto an PVDF-membrane (1704156, Bio-Rad) using a Trans-Blot Turbo Transfer System (Bio-Rad). The membrane was then blocked in PBST with 5% non-fat dry milk for 1 h at RT. Primary antibodies were incubated overnight at 4°C with Anti-MFSD8 diluted 1: 1000 (HPA044802, Atlas Antibodies or 24298- 1-AP, Proteintech), or anti-Tubulin diluted 1: 1000 (2144, Cell Signaling). For detection, an anti-mouse IgG DyLight 488 Conjugated (35502, Invitrogen) or an antirabbit IgG DyLight 680 Conjugated (35568, Invitrogen) was used. The blots were scanned using ChemDoc MP Imaging System (Bio-Rad). No bands were detected on Western blots using either of the Anti-MFSD8 antibody but detected bands using anti-Tubulin antibody.

[0203] Measurement of lysosomal function in CLN7 patient fibroblasts

[0204] To compare KKNHCLN7 vl and KKNHCLN7 v2 in CLN7 patient fibroblasts for their relative ability to resolve lysosomal dysfunction, AAV2/CLV7 vl or AAV2/CLV7 v2 was mixed 1: 1 with AAV2/GFP and used to transfect two different patient fibroblast cell lines in quadruplicate at doses of 1E3, 1E4, and 1E5 vg per cell. GFP expression was used as a positive internal control to verify and normalize transduction efficiency. [0205] An assay to measure lysosomal function in patient fibroblasts was developed. In brief, the fibroblasts from peripheral tissue biopsies of two human CLN7 patients were seeded at the density of 1E4 cells per well, treated with the AAV2 vectors at the MOIs of 2E4 or 5E4 vg, and loaded with cascade blue dextran at 1 mg/mL (D-1976, Life Technologies) 24 h before the measurement of enzyme activity. On the day of the assay (6 days after application of the AAV vectors), cells were treated with dimethylsulfoxide (DMSO) or 200 nM bafilomycin A 1 (bafAl, EMD Millipore) for 1 h and loaded with the GCase substrate, PFB-FDGluc (P 11947, ThermoFisher) after washing out the Dextran blue dextran. Cells were washed with warm media for 3 times after loading and replaced with phenol red-free neurobasal media. Fluorescence intensity was recorded every 30 min for 3-4 h in a Spectramax i3 plate reader (Molecular Devices) (Ex = 485 nm and Em = 530 nm for all enzyme substrates, Ex = 400 nm and Em = 430 nm for cascade dextran blue). After the final read, cells were fixed in 4% formaldehyde/PBS, stained with CellTag700 to measure cell volume, and scanned on an Odyssey infrared imager (Li-cor). The stain accumulated in the cytoplasm and nucleus of cells and provided an accurate indicate of cell number and cell volume. Fluorescence intensities of enzymatic substrates were normalized to cell volume, graphed as normalized fluorescence intensity vs time, and analyzed by measuring the area under the DMSO and bafAl curve (AUG). Total cellular activity was obtained by calculating the AUG of the DMSO curve; lysosomal activity was obtained by subtracting the AUG of bafAl from DMSO curves. All enzymatic assays were performed with n=4-6 separate culture wells and in 2-3 different passages of fibroblasts.

[0206] Statistical Analysis

[0207] All quantitative data in this report were presented as mean ± SEM, analyzed, and graphed using GraphPad Prism Software (v. 9.2.0, GraphPad Software). Data were tested for normal distribution (Shapiro-Wilk normality test) and homogeneity of variance (Brown-Forsythe test). Data sets that passed these two tests were analyzed using one-way AN OVA for equal or more than three groups comparison with Dunnett’s correction for relevant pairwise comparisons. Data sets that did not pass tests for normality or homogeneity of variance were analyzed using the Mann-Whitley test for two groups comparison or Kruskal -Wallis test with Dunn’s correction for relevant pairwise comparisons. A p < 0.05 was considered as significant for all statistical analyses.

[0208] Results and Discussion

[0209] Compared to a total of 93 CpG dinucleotides in the original CLN7 vl sequence, there are a total of 66 CpG dinucleotides in the CLN7 v2 sequence. This is about 29% reduction in CpG content.

[0210] To determine whether AAV2/CLV7 v2 mediates similar level of CLN7 mRNA expression in HEK293 cells compared to NHCLN7 vl, NHCLN7 v2 or NHCLN7 vl was mixed 1: 1 with KJAVUGFP and used to transfect HEK293 cells in triplicate at doses of 1E3, 1E4, and 1E5 vg per cell for 48 hours. RT-PCR results demonstrated very similar CT values for GFP mRNA expression (FIG. 3A), lower CT values for CLN7 mRNA expression (FIG. 3B), and similar CLN7/GFP ratios in HEK293 cells treated with kkNHCLN7 v2 compared to kkNHCLN7 vl at the same dose (FIG. 3C).

[0211] To confirm the results that CLN7 v2 mediates similar level of CLN7 mRNA expression compared to CLN7 vl, kkN9/CLN7 v2 or kkM9/CLN7 vl was mixed 1 : 1 with kkN9/GFP and used to transfect Lec2 cells in triplicate at doses of 1E3, 1E4, and 1E5 vg per cell for 48 hours. RT-PCR results again demonstrated very similar CT values for GFP mRNA expression (FIG. 4A), very similar CT values for CLN7 mRNA expression (FIG. 4B), and very similar CLN7/GFP ratios in Lec2 cells treated with kkN9/CLN7 v2 compared to kkN9/CLN7 vl at the same dose (FIG. 4C).

[0212] Conclusions

[0213] It was found that CLN7 v2 induced similar level of CLN7 mRNA expression in HEK293 cells as CLN7 vl at the doses tested when packaged into AAV2 capsids. The same results were seen when packaged into AAV9 capsids and transduced Lec2 cells.

[0214] The efficacy of kkNHCLN7 v2 and kkNHCLN7 vl at improving lysosomal function in cultured fibroblasts from two CLN7 patients is currently being investigated.

[0215] REFERENCES

Chen X, Dong T, Hu Y, Shaffo FC, Belur NR, Mazzulli JR, et al. AAV9/MFSD8 gene therapy is effective in preclinical models of neuronal ceroid lipofuscinosis type 7 disease. J Clin Invest. 2022; 132(5):el46286.

Mazzulli JR, Zunke F, Isacson O, Studer L, and Krainc D. alpha-Synuclein-induced lysosomal dysfunction occurs through disruptions in protein trafficking in human midbrain synucleinopathy models. Proc Natl Acad Sci USA. 2016; 113(7): 1931-6.

Valenzano KJ, Khanna R, Powe AC, Boyd R, Lee G, Flanagan JJ, et al. Identification and characterization of pharmacological chaperones to correct enzyme deficiencies in lysosomal storage disorders. Assay Drug Dev Technol. 2011 ;9(3):213-35.

[0216] SEQUENCES

SEP ID NO:1 Nucleic acid sequence of an expression cassette comprising an optimized CLN7 open reading frame: CTGCGCGCTCGCTCGCTCACTGAGGCCGCCGGCCCAAAGGGCCGGCGTCGGGCGACCTTTGGTCGCCCGGCC TCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAGATCTGAATTCGGTACCTATCGCCGGCGGGGCGGAG TTAGGGCGGAGCCAATCAGCGTGCGCCGTTCCGAAAGTTGCCTTTTATGGCTGGGCGGAGAATGGGCGGTGA ACGCCGATGATTATATAAGGACGCGCCGGGTGTGGCACAGCTAGTTCCGTCGCAGCCGGGATTTGGGTCGCG GTTCTTGTTTGTCGCGCGCGCGTCGACGCCACCATGGCCGGCCTTCGCAACGAATCGGAGCAGGAACCGCTG TTGGGAGACACCCCTGGTTCCCGGGAATGGGACATCCTGGAAACTGAGGAACACTACAAGTCGCGGTGGAG GTCAATTCGGATTTTGTACCTGACCATGTTCCTGAGCTCCGTGGGATTCTCTGTGGTCATGATGTCCATTTGG CCGTACCTCCAAAAGATTGACCCCACCGCGGACACCTCCTTCCTGGGATGGGTCATTGCCAGCTACTCCCTG GGTCAGATGGTGGCCAGCCCAATCTTCGGCCTGTGGAGCAACTACAGGCCCAGAAAGGAGCCTCTGATCGTG TCCATCCTGATTTCGGTGGCGGCCAATTGCCTGTACGCCTACCTACACATCCCGGCCTCCCATAACAAGTACT ACATGCTCGTGGCCCGGGGGCTCCTGGGCATTGGCGCCGGAAACGTGGCAGTGGTCCGCTCGTACACCGCTG GAGCTACCAGCCTGCAGGAACGGACGTCATCCATGGCGAACATCTCAATGTGTCAGGCACTGGGGTTCATCC TGGGTCCGGTGTTCCAAACCTGTTTCACTTTCCTGGGAGAGAAGGGTGTCACTTGGGACGTGATCAAGCTCC AAATCAACATGTACACCACCCCGGTGCTGCTTAGTGCCTTCCTGGGCATCCTGAACATTATCCTGATCCTTGC AATCCTGAGAGAGCACCGGGTGGACGATTCCGGTAGACAGTGCAAGAGCATCAACTTTGAGGAAGCCTCCA CCGATGAAGCCCAAGTGCCACAGGGAAACATAGACCAGGTCGCAGTGGTGGCGATCAATGTGCTGTTCTTCG TGACTCTGTTTATCTTTGCCCTGTTCGAGACTATCATCACTCCCCTGACCATGGATATGTACGCCTGGACTCA

GGAGCAAGCTGTGCTGTACAACGGCATTATCCTGGCTGCTCTGGGAGTGGAGGCCGTGGTCATTTTCCTTGG

G _CTG_TT_TC_TA_TA_CA_AC_TT_TG_TT_TT_GG_CT_TC_CA_CA_CA_TTG_GA_GA_GG_GA_AT_AC_AG_TG_CT_AG_GA_TA_TC_CG_CC_CG_CC_AG_AA_AT_AC_TC_TT_CC_AC_GT_TG_GG_GG_GA_AG_GG_GC_AC_CT_CC_TA_CT_CC_AG_CT_AG_AGT_CACT_AG_CG_AG_GT_CC_AG_TG_C

CCTAACACTACCTTCGGGGAAATCATCATCGGACTCTGGAAGTCCCCCATGGAAGATGACAACGAACGGCCA

ACCGGGTGCAGCATTGAGCAGGCCTGGTGCCTCTATACGCCGGTCATTCACCTGGCACAGTTCCTGACCTCC

GCGGTGTTAATTGGCTTGGGATACCCTGTGTGCAACCTCATGTCCTACACCCTGTACTCCAAGATCCTTGGAC

CCAAGCCGCAGGGAGTGTACATGGGATGGCTGACAGCCTCCGGCTCCGGGGCCCGCATCCTGGGGCCCATGT

TCATTTCGCAAGTGTATGCCCATTGGGGCCCTAGATGGGCCTTCTCACTGGTCTGCGGAATCATCGTGCTCAC

CATCACTCTCCTGGGAGTGGTGTACAAGCGACTGATTGCCCTCTCGGTGCGCTATGGCCGCATTCAGGAATG

ATAAGCGATCGCCAGAAGATTTAAATCACCTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCA

TCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCT

TATCATGACGGCGCGCCTTTGCACAACTTAATTAAGGCACGCGTGCATGCAGATCTAGGAACCCCTAGTGAT

GGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCG

GCCCTTTGGGCCGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAAGATGGAGTCAGCTG

CTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCG

CGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTC

AGGGTTTAAACCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACA

ATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGCCATATTCAACGGGAAACGTCTTG

CTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGG

GCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAA

AGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCC

GACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAAACAGC

ATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCG

GTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGTGTATTTCGTCTCGCTCAGGCGCAATCAC

GAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCT

GGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAA

CCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCA

GGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATAT

GGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGTTTAAACCT

GTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTA

CATGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAG

ACCCCGGCGGCCGCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTAC

CAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGC

AGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTAC

ATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGAC

TCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTT

GGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAG

GGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG

GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGC

TCGTCAGGGGGGCGGAGCCTATGGAAAGCGGCCGCAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCT

TTTGCTGGCCTTTTGCTCACGTGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTT

GAGTGAGCTGATACCGCTCGCCGCAGCCGAACGAGACAGCTGAAACGTTA

SEO ID NO:2 Nucleic acid sequence of AITR; nucleotides 1-106 of SEO ID NO:1 :

CTGCGCGCTCGCTCGCTCACTGAGGCCGCCGGCCCAAAGGGCCGGCGTCGGGCGACCTTTGGTCGCCCGGCC

TCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG

SEP ID NO:3 Nucleic acid sequence of Jet Promoter; nucleotides 136-299 of SEQ ID NO: 1:

GGGCGGAGTTAGGGCGGAGCCAATCAGCGTGCGCCGTTCCGAAAGTTGCCTTTTATGGCTGGGCGGAGAAT

GGGCGGTGAACGCCGATGATTATATAAGGACGCGCCGGGTGTGGCACAGCTAGTTCCGTCGCAGCCGGGAT

TTGGGTCGCGGTTCTTGTTTGT

SEQ ID NO:4 Nucleic acid sequence of optimized CLN7 nucleic acid molecule; nucleotides 321-

1877 of SEO ID NON:

ATGGCCGGCCTTCGCAACGAATCGGAGCAGGAACCGCTGTTGGGAGACACCCCTGGTTCCCGGGAATGGGA

CATCCTGGAAACTGAGGAACACTACAAGTCGCGGTGGAGGTCAATTCGGATTTTGTACCTGACCATGTTCCT

GAGCTCCGTGGGATTCTCTGTGGTCATGATGTCCATTTGGCCGTACCTCCAAAAGATTGACCCCACCGCGGA

CACCTCCTTCCTGGGATGGGTCATTGCCAGCTACTCCCTGGGTCAGATGGTGGCCAGCCCAATCTTCGGCCTG

TGGAGCAACTACAGGCCCAGAAAGGAGCCTCTGATCGTGTCCATCCTGATTTCGGTGGCGGCCAATTGCCTG

TACGCCTACCTACACATCCCGGCCTCCCATAACAAGTACTACATGCTCGTGGCCCGGGGGCTCCTGGGCATT

GGCGCCGGAAACGTGGCAGTGGTCCGCTCGTACACCGCTGGAGCTACCAGCCTGCAGGAACGGACGTCATC CATGGCGAACATCTCAATGTGTCAGGCACTGGGGTTCATCCTGGGTCCGGTGTTCCAAACCTGTTTCACTTTC

CTGGGAGAGAAGGGTGTCACTTGGGACGTGATCAAGCTCCAAATCAACATGTACACCACCCCGGTGCTGCTT

AGTGCCTTCCTGGGCATCCTGAACATTATCCTGATCCTTGCAATCCTGAGAGAGCACCGGGTGGACGATTCC

GGTAGACAGTGCAAGAGCATCAACTTTGAGGAAGCCTCCACCGATGAAGCCCAAGTGCCACAGGGAAACAT

AGACCAGGTCGCAGTGGTGGCGATCAATGTGCTGTTCTTCGTGACTCTGTTTATCTTTGCCCTGTTCGAGACT

ATCATCACTCCCCTGACCATGGATATGTACGCCTGGACTCAGGAGCAAGCTGTGCTGTACAACGGCATTATC

CTGGCTGCTCTGGGAGTGGAGGCCGTGGTCATTTTCCTTGGGGTCAAACTGTTGTCAAAGAAGATCGGTGAA

CGCGCGATCCTCCTGGGAGGCCTCATCGTGGTCTGGGTCGGCTTTTTCATTTTGCTCCCTTGGGGAAATCAGT

TCCCCAAAATTCAGTGGGAGGACCTCCACAACAACAGCATCCCTAACACTACCTTCGGGGAAATCATCATCG

GACTCTGGAAGTCCCCCATGGAAGATGACAACGAACGGCCAACCGGGTGCAGCATTGAGCAGGCCTGGTGC

CTCTATACGCCGGTCATTCACCTGGCACAGTTCCTGACCTCCGCGGTGTTAATTGGCTTGGGATACCCTGTGT

GCAACCTCATGTCCTACACCCTGTACTCCAAGATCCTTGGACCCAAGCCGCAGGGAGTGTACATGGGATGGC

TGACAGCCTCCGGCTCCGGGGCCCGCATCCTGGGGCCCATGTTCATTTCGCAAGTGTATGCCCATTGGGGCC

CTAGATGGGCCTTCTCACTGGTCTGCGGAATCATCGTGCTCACCATCACTCTCCTGGGAGTGGTGTACAAGCG

ACTGATTGCCCTCTCGGTGCGCTATGGCCGCATTCAGGAATGA

SEO ID NO:5 Nucleic acid sequence of SV40pA; nucleotides 1907-2029 of SEO ID NO: 1 :

TGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTC

ACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG

SEP ID NO:6 Nucleic acid sequence of a second AAV ITR sequence; nucleotides 2079-2223 of

SEO ID NO: 1:

AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAA

AGGTCGCCCGACGCCGGCCCTTTGGGCCGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC

AA

[0217] Although the invention has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.

Claims

WHAT IS CLAIMED IS:

1. A recombinant adeno-associated vims (rAAV) vector comprising in 5’ to 3’ direction: a) a first AAV ITR sequence; b) a promoter sequence; c) a transgene nucleic acid molecule, wherein the transgene nucleic acid molecule comprises a nucleic acid sequence encoding a CLN7 polypeptide; d) a polyA sequence; and e) a second AAV ITR sequence.

2. The rAAV vector of claim 1, wherein the transgene nucleic acid molecule comprises the nucleic acid sequence set forth in SEQ ID NO:4.

3. The rAAV vector of claim 1, wherein the vector comprises SEQ ID NO: 1.

4. The rAAV vector of any one of the preceding claims, wherein the nucleic acid sequence encoding for a CLN7 polypeptide has fewer CpG dinucleotides than a wild-type nucleic acid sequence encoding for a CLN7 polypeptide.

5. The rAAV vector of any one of the preceding claims, wherein the transgene nucleic acid sequence encoding for a CLN7 polypeptide exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased expression in a human subject relative to a wild-type CLN7 nucleic acid sequence.

6. The rAAV vector of any one of the preceding claims, wherein the first AAV ITR sequence comprises the nucleic acid sequence set forth in SEQ ID NO:2.

7. The rAAV vector of any one of the preceding claims, wherein the second AAV ITR sequence comprises the nucleic acid sequence set forth in SEQ ID NO:6.

8. The rAAV vector of any one of the preceding claims, wherein the promoter sequence comprises a Rous sarcoma vims (RSV) LTR promoter (optionally with an RSV enhancer), a cytomegalovims (CMV) promoter, an SV40 promoter, a dihydrofolate reductase promoter, a beta-actin promoter, a phosphoglycerol kinase (PGK) promoter, a U6 promoter, a Jetl promoter, an Hl promoter, a CAG promoter, a hybrid chicken beta-actin (CBA) promoter, an MeCP2 promoter, an EFl promoter, a ubiquitous chicken p-actin hybrid (CBh) promoter, a Ula promoter, a Ulb promoter, an MeCP2 promoter, an MeP418 promoter, an MeP426 promoter, a minimal MeCP2 promoter, a VMD2 promoter, an mRho promoter, EFla promoter, Ubc promoter, human p-actin promoter, a synapsin (hSyn) promoter

43 sequence, TRE promoter, Ac5 promoter, Polyhedrin promoter, CaMKIIa promoter, Gall promoter, TEF1 promoter, GDS promoter, ADH1 promoter, Ubi promoter, or a- 1 -antitrypsin (hAAT) promoter.

9. The rAAV vector of any one of the preceding claims, wherein the promoter sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 3.

10. The rAAV vector of any one of the preceding claims, wherein the polyA sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 5.

11. An rAAV vector of any one of the preceding claims, comprising, in the 5’ to 3’ direction: a) a first AAV ITR sequence comprising the nucleic acid sequence set forth in SEQ ID NO:2; b) a promoter sequence comprising the nucleic acid sequence set forth in SEQ ID NO:3; c) a transgene nucleic acid molecule, wherein the transgene nucleic acid molecule comprises a nucleic acid sequence encoding for an CLN7 polypeptide, wherein the nucleic acid sequence encoding for an CLN7 polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO:4; d) a polyA sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 5; and e) a second AAV ITR sequence comprising the nucleic acid sequence set forth in SEQ ID NO:6.

12. An rAAV viral vector comprising:

(i) an AAV capsid protein; and

(ii) an rAAV vector of any one of the preceding claims.

13. The rAAV viral vector of claim 12, wherein the AAV capsid protein is an AAV 1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV 10 capsid protein, an AAV 11 capsid protein, an AAV 12 capsid protein, an AAV 13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein or an AAVrh. 10 capsid protein.

14. The rAAV viral vector of claim 13, wherein the AAV capsid protein is an AAV9 capsid protein.

15. A pharmaceutical composition comprising: a) the rAAV viral vector of any one of claims 12-14; and at least one pharmaceutically acceptable excipient and/or additive.

44

16. A method for treating a subject having a disease and/or disorder involving an CLN7 gene, the method comprising administering to the subject at least one therapeutically effective amount of the rAAV viral vector of any one of claims 12-14 or the pharmaceutical composition of claim 15.

17. The method of claim 16, wherein the disease and/or disorder involving an CLN7 gene is Batten Disease.

18. The method of claim 16 or claim 17, wherein the rAAV viral vector or the pharmaceutical composition is administered to the subject at a dose ranging from about 10¹¹ to about 10¹⁸ viral vector particles.

19. The method of claim 18, wherein the rAAV viral vector or the pharmaceutical composition is administered to the subject at a dose ranging from about 10¹³ to about 10¹⁶ viral vector particles.

20. The method of any one of claims 16-19, wherein the rAAV viral vector or the pharmaceutical composition is administered to the subject intravenously, intrathecally, intracistema-magna, intracerebrally, intraventricularly, intranasally, intratracheally, intra-aurally, intra-ocularly, or peri- ocularly, orally, rectally, transmucosally, inhalationally, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracistemally, intranervally, intrapleurally, topically, intralymphatically, intracistemally or intranerve.

21. The method of claim 20, wherein the rAAV viral vector or pharmaceutical composition is administered intrathecally.

22. The method of claim 20, wherein the rAAV viral vector or pharmaceutical composition is administered intracistemamagna.

23. The rAAV viral vector of any one of claims 13-15 or the pharmaceutical composition of claim 16 for use in treating a disease and/or disorder involving an CLN7 gene in a subject in need thereof.

24. The rAAV viral vector for use according to claim 23, wherein the disease and/or disorder involving a CLN7 gene is Batten Disease.

25. The rAAV viral vector for use according to claim 23 or claim 24, wherein the rAAV viral vector or the pharmaceutical composition is for administration to the subject at a dose ranging from about 10¹¹ to about 10¹⁸ viral vector particles.

26. The rAAV viral vector for use according to any of claims 23-25, wherein the rAAV viral vector or the pharmaceutical composition is for administration to the subject at a dose ranging from about 10¹³ to about 10¹⁶ viral vector particles.

45

27. The rAAV viral vector for use according to any one of claims 24-27, wherein the rAAV viral vector or the pharmaceutical composition is for administration to the subject intravenously, intrathecally, intracisterna-magna, intracerebrally, intraventricularly, intranasally, intratracheally, intra-aurally, intra-ocularly, or peri-ocularly, orally, rectally, transmucosally, inhalationally, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracistemally, intranervally, intrapleurally, topically, intralymphatically, intracistemally or intranerve.

28. The rAAV viral vector for use according to claim 27 , wherein the rAAV viral vector or pharmaceutical composition is for administration intrathecally.

29. The rAAV viral vector for use according to claim 27 , wherein the rAAV viral vector or pharmaceutical composition is for administration intracisterna-magna.