CN104673816A - PCr-NHEJ (non-homologous end joining) carrier as well as construction method of pCr-NHEJ carrier and application of pCr-NHEJ carrier in site-specific knockout of bacterial genes - Google Patents

Abstract

The invention belongs to the technical field of gene engineering, in particular to a pCr-NHEJ (non-homologous end joining) carrier as well as a construction method of the pCr-NHEJ carrier and an application of the pCr-NHEJ carrier in site-specific knockout of bacterial genes. The sequence of the pCr-NHEJ carrier is shown as the SEQ ID NO.1. The application of the pCr-NHEJ carrier in site-specific knockout of the bacterial genes is provided. The technical principle is as follows: NHEJ and CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated protein 9) are jointly applied, so that after DNA (deoxyribonucleic acid) is broken when a CRISPR-Cas9 system cuts bacterial genomic DNA, the NHEJ system can be connected with a broken DNA end automatically, bacteria are survived, double-strand DNA having homology with a target sequence is not required to be introduced artificially to repair the broken DNA end, and the operation steps of the CRISPR-Cas9 technique are simplified.

Description

A kind of pCr-NHEJ carrier and construction process thereof and to fix a point the application that knocks out for bacterial gene

Technical field

[the present invention relates to gene engineering technology field, be specifically related to a kind of pCr-NHEJ carrier and construction process thereof and fix a point the application that knocks out for bacterial gene.

Background technology

" Science " that within 2013, publish reports a kind of simple, efficient gene site-directed editing technique---CRISPR-Cas9(clustered regularly interspaced short palindromic repeat; CRISPR-associated, CRISPR-Cas9).This technological system by a kind of from streptococcic Cas9 nuclease, tracrRNA(trans-activating crRNA that a sequence is constant) and one with the 20nt-crRNA(CRISPR RNAs of target gene specific complementation) form.The higher structure that the 3 ' end of tracrRNA is formed combines and activates Cas9, and 5 ' end and 3 ' of the crRNA of tracrRNA hold complementary connection, and 5 ' of crRNA end and target gene complementary pairing, guide Cas9 arrive and cut off target sequence thus.Two kinds of tiny RNA are fused into a RNA chain now, are called for short sgRNA(single guide RNA), adopt sgRNA carry out operating more convenient.Because this technology only needs to design one section of specific crRNA sequence for target gene, the fixed point that can realize gene quickly knocks out.This technology not only revolutionizes the concept of traditional genome fixed point editing technique, and carries out fixed point to the genome of multiple biology and knock out short being successfully applied in two years, knock in or suddenly change.

SgRNA molecule is by intervening sequence (spacer) and trancrRNA two sections of Sequence composition: 1) intervening sequence length is 20nt, complementary with the target site of gene, it is positioned at PAM(Protospacer-Adjacent Motif) sequence (NGG) 5 ' end, need to design separately according to target-gene sequence; 2) tracrRNA sequence is constant, can in conjunction with and activate Cas9 protein.Under the guiding of spacer, the DNA double-strand of target gene to the target site of gene, is cut off by sgRNA by the Cas9 protein band of activation between PAM Sequences upstream 3-8 base, forms the fracture of blunt end.In eukaryotic cell, after Cas9 cuts off double-stranded DNA, cell independently can produce homologous recombination (homologous recombination, or non-homologous end joining (Non-homologous End Joining HR), NHEJ) two kinds of mechanism repair damaged dna, produce insertion mutation, phase shift mutation, gene knock-in etc.

SgRNA and Cas9 gene and sgRNA coding DNA can be arranged in same or different plasmid, under the regulation and control of corresponding promotor, at cell inner expression.In addition, sgRNA also can be synthesized by in-vitro transcription, with Cas9 plasmid cotransformation host cell.

Before CRISPR-Cas9 technological invention, the gene knockout of bacterium mainly relies on based on homologous recombination technique.There is inefficiency in this technology, operating process is complicated, needs to expend the shortcomings such as long time screening positive clone.Research shows, compared with above-mentioned homologous recombination technique, CRISPR-Cas9 technology has a little following: 1) efficiency is high, and CRISPR-Cas9 technology knocks out 1000 times that goal gene is homologous recombination technique; 2) same CRISPR-Cas9 carrier can be adopted to knock out 3 to multiple target spot simultaneously or successively) easy and simple to handle, only need to design one or two sgRNA according to target gene, and the coding DNA of sgRNA is cloned into carrier, then transform bacteria can realize gene knockout.

But because Most bacterial does not possess autonomous nonhomologous end link system, the DSB that Cas9 Protein cleavage bacterial genomes DNA causes directly will cause bacterial death, gene knockout operation is failure thereupon also.Therefore, in prior art, for avoiding bacterial death, needing in bacterium, to import the linear dsdna with target sequence with high homology by Electroporation Transformation simultaneously, thus adding operation steps and expense.Need through repeatedly PCR owing to building homology linear dsdna and connect PCR primer, further increasing operation steps and expense.Therefore, there is complex operation, operation easier is large, gene knockout efficiency is still not high enough shortcoming in the CRISPR-Cas9 system of prior art.

Summary of the invention

An object of the present invention is for the deficiencies in the prior art, provides a kind of pCr-NHEJ carrier, and this pCr-NHEJ carrier can be used in bacterial gene and knocks out, and has the advantage that gene knockout efficiency is high.

Two of object of the present invention is for the deficiencies in the prior art, provides a kind of construction process of pCr-NHEJ carrier, and the construction process of this pCr-NHEJ carrier has simple to operate, that operation easier is low advantage.

Three of object of the present invention is for the deficiencies in the prior art, provides pCr-NHEJ carrier to fix a point the application that knocks out for bacterial gene.

One of to achieve these goals, the present invention adopts following technical scheme:

There is provided a kind of pCr-NHEJ carrier, the sequence of described pCr-NHEJ carrier has the sequence shown in SEQ ID NO:1.

To achieve these goals two, the present invention adopts following technical scheme:

The application of a kind of pCr-NHEJ carrier described above fixing a point to knock out in bacterial gene is provided.

To achieve these goals three, the present invention adopts following technical scheme:

A kind of construction process of pCr-NHEJ carrier is provided, comprises the steps:

(1) broad host range plasmid of gram-negative bacteria is adopted _pbBR1MCS-2(GI:773412) carrier based on; Cas9

(2) adopt and to increase respectively following three protein genes with the upstream primer of the prokaryotic promoter PLtetO-1 transcribed for mRNA and downstream primer: cas9(GI:674296984), ku(GI:444893469) and ligD(GI:444893469), obtain respectively cas9amplified production, kuamplified production and ligDamplified production; Wherein, cas9, kuwith ligDthe opening code-reading frame of three protein genes is all positioned at independently PLtetO-1 downstream, to make cas9, kuwith ligDthe expression of three protein genes is all by the regulation and control of this promotor; Described cas9amplified production, described in kuamplified production and described ligDoverlapping with the base of 15nt between amplified production;

(3) described in cas93 ' end of amplified production is with described ku5 ' end of amplified production, described in ku3 ' end of amplified production is with described ligDbetween amplified production 3 ' is held, the base all with 15nt is overlapping, described in being connected by in-fusion PCR cas9amplified production, described in kuamplified production and described ligDamplified production, obtains the first connector;

(4) double digestion carrier is carrier is carried out with restriction endonuclease KpnI and HindIII _pbBR1MCS-2, obtains the digestion products of carrier is carrier; Described digestion products through gel electrophoresis, cut glue and adopt DNA to reclaim kits digestion products; Then adopt in-fusion PCR to connect the digestion products after described purifying and the first connector, obtain carrier pNHEJ;

(5) utilize carrier pNHEJ described in NotI and SpeI double digestion, obtain the digestion products of carrier pNHEJ;

(6) in described carrier pNHEJ, introduce two adjacent inverted BsaI restriction enzyme sites and adjacent two inverted BsmAI restriction enzyme sites, for transcribing, formed can the sgRNA of simultaneously binding purposes gene two positions simultaneously; Wherein, the DNA fragmentation with adjacent two inverted BsaI restriction enzyme sites is DBsaI, and the DNA fragmentation with adjacent two inverted BsmAI restriction enzyme sites is DBsmAI;

(7) by in-fusion PCR, DBsaI, DBsmAI are linked, obtain the second connection product;

(8) by in-fusion PCR, the digestion products that described second connects product and carrier pNHEJ being coupled together, obtaining the CRISPR-Cas9 system for knocking out target gene, i.e. pCr-NHEJ carrier.

In technique scheme, in described step (2), adopt described in the primer PPLtetO-1-cas9U with sequence shown in SEQ ID NO:2 and the primer PCas9D with sequence shown in SEQ ID NO:3 amplification cas9protein gene, obtains cas9amplified production;

Adopt described in the primer PPLtetO-1-KuU with sequence shown in SEQ ID NO:4 and the primer PkuD with sequence shown in SEQ ID NO:5 amplification kuprotein gene, obtains kuamplified production;

Adopt described in the primer PLtetO-1-ligDU with sequence shown in SEQ ID NO:6 and the primer PligDD with sequence shown in SEQ ID NO:7 amplification ligDprotein gene, obtains ligDamplified production.

In technique scheme, in described step (6), the structure with the DNA fragmentation DBsaI of adjacent two inverted BsaI restriction enzyme sites is as follows:

First directly synthesis has the DNA sequence dna BsaIU of sequence shown in SEQ ID NO:8 and has the DNA sequence dna BsaID of sequence shown in SEQ ID NO:9, and wherein, the 3 ' end of BsaIU and the 5 ' end of BsaID have the overlap of 15nt; Wherein, BsaID contains tracrRNA sequence;

By in-fusion PCR, BsaIU and BsaID is coupled together; Then adopt and there is the primer PBsaIU of sequence shown in SEQ ID NO:10 and there is the primer PBsaID of sequence shown in SEQ ID NO:11, pcr amplification, namely obtain the DNA fragmentation DBsaI with adjacent two inverted BsaI restriction enzyme sites.

In technique scheme, in described step (6), the structure with the DNA fragmentation DBsmAI of adjacent two inverted BsmAI restriction enzyme sites is as follows:

First directly synthesis has the DNA sequence dna BsmAIU of sequence shown in SEQ ID NO:12 and has the DNA sequence dna BsmAID of sequence shown in SEQ ID NO:13; Wherein, BsmAID contains tracrRNA sequence;

By in-fusion PCR, described DNA sequence dna BsmAIU and described DNA sequence dna BsmAID is coupled together; Then adopt and there is the primer PBsmAIU of sequence shown in SEQ ID NO:14 and there is the primer PBsmAID of sequence shown in SEQ ID NO:15, carry out pcr amplification, namely obtain the DNA fragmentation DBsmAI with adjacent two inverted BsmAI restriction enzyme sites.

The pCr-NHEJ carrier constructed by construction process of a kind of pCr-NHEJ carrier described above is in the application of fixing a point to knock out in bacterial gene.

Compared with prior art, beneficial effect is in the present invention:

(1) a kind of pCr-NHEJ carrier of the present invention, this pCr-NHEJ carrier can be used in bacterial gene and knocks out, and has the advantage that gene knockout efficiency is high.

(2) construction process of a kind of pCr-NHEJ carrier of the present invention, the construction process of this pCr-NHEJ carrier has simple to operate, that operation easier is low advantage.

(3) the invention provides pCr-NHEJ carrier to fix a point the application that knocks out for bacterial gene, possess skills simple to operate, that operation easier is low and gene knockout efficiency is high advantage.

(4) for saving the Connection Step of PCR and PCR primer, the present invention is at a kind of broad host range plasmid _pon the basis of BBR1MCS-2, construct the pCr-NHEJ carrier being suitable for multiple gram-negative bacteria gene knockout, and in pCr-NHEJ carrier, introduce nonhomologous end link system (Non-homologous end joining, NHEJ)---ku and the ligD gene of mycobacterium tuberculosis.Wherein, Ku can be incorporated into the DNA broken ends of fractured bone and raise DNA ligase LigD, and LigD can not rely on template DNA, directly connects the end of DNA breakage.The broken ends of fractured bone that the application adopts the NHEJ system of mycobacterium tuberculosis connection Cas9 cutting DNA to be formed, the bacterial genomes DNA that receptor gene is knocked out recovers ring structure, and makes bacterium be survived (know-why is shown in Fig. 2).

(5) adopt technology of the present invention to realize only need building the CRIPR-Cas9 plasmid of target gene, and carry out Plastid transformation, build pCr-NHEJ carrier, without the need to transforming linear homologous dna simultaneously, can knocking out bacterial genomes be realized.Technological operation of the present invention is more simple, and operation easier reduces greatly, and the efficiency of gene knockout reaches 87.5% ~ 100%.

(6) construction process of a kind of pCr-NHEJ carrier of the present invention, in step (2), because cas9 amplified production, base with 15nt between ku amplified production and ligD amplified production are overlapping, so that adopt In-fusion PCR to connect to make cas9 amplified production, ku amplified production and ligD amplified production to be all positioned at independently under promoter regulation.

(7) know-why of the present invention is: NHEJ and CRISPR-Cas9 combined utilization, to realize after CRISPR-Cas9 system cutting bacterial genomes DNA causes DNA break, NHEJ system can be dynamically connected the DNA broken ends of fractured bone certainly, make bacteria living, and without the need to manually introducing the double-strand DAN DNA plerosis broken ends of fractured bone with target sequence with homology, thus simplify the operation steps of CRISPR-Cas9 technology.

Accompanying drawing explanation

Fig. 1 is the broad host range plasmid of gram-negative bacteria _pthe physical map of BBR1MCS-2.In accompanying drawing, MCS, multiple cloning sites, multiple clone site; KmR is kalamycin resistance gene; The sequence of mob needed for Plasmids conjugation transfer; Rep is plasmid self-replicating protein gene.

Fig. 2 is technical schematic diagram of the present invention.

Fig. 3 is the physical map of carrier pCr-NHEJ of the present invention.In Fig. 3, the multiple clone site of pBBR1MCS builds; Two BsaI and two BsmAI is spacer DNA sequence dna insertion point.

Fig. 4 is the electrophorogram in carrier pNHEJ building process of the present invention.In Fig. 4, A, B and C are cas9, kuwith ligD gene PCR product electrophorogram, swimming lane 1 is DNA marker, is followed successively by 2000,1000,750,500,250 and 100 from top to bottom; D, swimming lane 2 is cas9, kuwith lipCR primer after gD gene connects, swimming lane 3 is the double digestion result of KpnI and HindIII of plasmid pBBR1MCR; E, the electrophoresis result of plasmid pNHEJ, arrow indication DNA stripe size is 7500bp.

Fig. 5 is the electrophorogram in carrier pCr-NHEJ building process of the present invention.In Fig. 5, A, swimming lane 1-7 is respectively the PCR primer of BsaID, BsaIU, DBsaI, DBsmAI, BsmAIU and BsmAID; B is the product that DBsaI with DBsmAI is connected; C, the electrophorogram of plasmid pCr-NHEJ.

Fig. 6 knocks out efficiency PCR qualification result.In Fig. 6, A, B and C are respectively the bacterium colony PCR qualification result into intestinal bacteria, Pseudomonas aeruginosa and Acinetobacter bauamnnii; Clone's number of qualification is followed successively by 11,11 and 8; Swimming lane 12 in A and B is positive control, and the swimming lane 5 in C is positive control, and the positive rate of gene knockout is respectively 100%, 100% and 87.5%.

Embodiment

In order to make technical problem solved by the invention, technical scheme and beneficial effect clearly understand, below in conjunction with drawings and Examples, the present invention is further elaborated.Should be appreciated that specific embodiment described herein only in order to explain the present invention, be not intended to limit the present invention.

Wherein, the pCr-NHEJ carrier that the present invention builds, with two sgRNA frame sequences, successively can build the gene site-directed carrier knocked out by inserting spacer DNA fragmentation in BsaI or BsmAI site.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, in step (2), adopts the primer PPLtetO-1-cas9U(with sequence shown in SEQ ID NO:2 gctctagaactagtggA gATTGAcATCCCTATCAGTGATAGA gATACTgAGCACAAGGAGTATACC aTGGATAAGAAATACTCAATAGG), wherein, 5 ' the end underscore of primer PPLtetO-1-cas9U has 15nt identical with the end of the HindIII digestion products of pBBR1MCS-2, so that connect with in-fusion PCR; Boldface letter region is promotor PLtetO-1-1, underscore base zone is promotor-33 and-10 region.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, in step (2), adopts the primer cas9D(with sequence shown in SEQ ID NO:3 agggatgtcaatctctCAGTCACCTCCTAGCTGACTC), wherein, 5 ' the end underscore district of primer cas9D holds 15nt identical with 5 ' of primer PPLtetO-1-KuU, so that connect with in-fusion PCR.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, in step (2), adopts the primer PPLtetO-1-KuU(with sequence shown in SEQ ID NO:4 gctctagaactagtggA gATTGAcATCCCTATCAGTGATAGA gATACTgAGCACAAGGAGTATACC aTGCGAGCCATTTGGACGGGTT), wherein, boldface letter part is promotor PLtetO-1-1 sequence, and boldface letter region is promotor PLtetO-1-1, underscore base zone is promotor-33 and-10 region.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, in step (2), adopts the primer PLtetO-1-ligDU(with sequence shown in SEQ ID NO:6 gctctagaactagtggA gATTGAcATCCCTATCAGTGATAGA gATACTgAGCACAAGGAGTATACC aTGGGTTCGGCGTCGGAG), wherein, 5 ' the end underlined region of primer PLtetO-1-ligDU holds 15nt identical with 5 ' of PkuD, so that connect with in-fusion PCR; Boldface letter region is promotor PLtetO-1-1, underscore base zone is promotor-33 and-10 region.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, in step (2), adopts the primer PligDD(with sequence shown in SEQ ID NO:7 gGGAACAAAGCTGG cAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGtCATTCGCGCACCACCTCACT), wherein, 5 ' the end underlined region of primer PligDD has 15nt identical with the end of the KpnI digestion products of pBBR1MCS-2, so that connect with in-fusion PCR; Italics part is T7-transcription termination factor.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, is building in the process with the DNA fragmentation DBsaI of adjacent two inverted BsaI restriction enzyme sites, synthesized DNA sequence dna BsaIU( gA gATTGAcATCCCTATCAGTGATAGA gATACTgAGCAC gagacc aaa gGTCTC gttttagagctaGAAAtagcaagttaa, SEQ ID NO:8), wherein, boldface letter is the PLtetO-1-2 promoter sequence for rna transcription.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, building in the process with the DNA fragmentation DBsaI of adjacent two inverted BsaI restriction enzyme sites, synthesized DNA sequence dna BsaID (GAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTAT TTTAACTTGCTATTTC, SEQ ID NO:9, tracrRNA sequence), wherein, 3 ' the end of BsaIU and the 5 ' end of BsaID have the overlap of 15nt, so namely BsaIU and BsaID bis-gene fragments are coupled together by In-fusion PCR.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, is building in the process with the DNA fragmentation DBsmAI of adjacent two inverted BsmAI restriction enzyme sites, synthesized DNA sequence dna BsmAIU( gA gATTGAcATCCCTATCAGTGATAGA gATACTgAGCAC gagacaaa gtctcg ttttagagctaGAAAtagcaagttaa, SEQ ID NO:12), wherein, boldface letter is the PLtetO-1-2 promoter sequence for rna transcription.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, in the process digestion products of DBsaI, DBsmAI and carrier pNHEJ coupled together by In-fusion PCR, 5 ' the end due to PBsaID and PBsmAIU has the overlap of 15nt, so namely two gene fragments is coupled together by In-fusion PCR.And the 5 ' end of PBsaIU has the overlap of 15 bases respectively with the downstream with pNHEJ restriction enzyme site NotI, and there is the overlap of 15 bases the 5 ' end of PBsmAID and the upstream of pNHEJ restriction enzyme site SpeI, so namely, couple together by DBsaI and DBsmAI and through the pNHEJ fragment of NotI and SpeI double digestion by In-fusion PCR, thus the CRISPR-Cas9 system obtained for knocking out target gene, i.e. pCr-NHEJ carrier.

Wherein, the construction process of a kind of pCr-NHEJ carrier of the present invention, constructed pCr-NHEJ carrier is with two sgRNA frame sequences, and therefore, this pCr-NHEJ carrier successively can build the gene site-directed carrier knocked out by inserting spacer DNA fragmentation in BsaI or BsmAI site.

embodiment 1.

A kind of pCr-NHEJ carrier, the sequence of this pCr-NHEJ carrier has the sequence shown in SEQ ID NO:1.The pCr-NHEJ carrier of the present embodiment can be used in bacterial gene and knocks out, and has the advantage that gene knockout efficiency is high.

embodiment 2.

A kind of pCr-NHEJ carrier of embodiment 1 is in the application of fixing a point to knock out in bacterial gene.

embodiment 3.

The construction process of a kind of pCr-NHEJ carrier of embodiment 1, comprises the steps:

(1) broad host range plasmid of gram-negative bacteria is adopted _pbBR1MCS-2(GI:773412) carrier based on; Cas9

(2) adopt and to increase respectively following three protein genes with the upstream primer of the prokaryotic promoter PLtetO-1 transcribed for mRNA and downstream primer: cas9(GI:674296984), ku(GI:444893469) and ligD(GI:444893469), obtain respectively cas9amplified production, kuamplified production and ligDamplified production; Wherein, cas9, kuwith ligDthe opening code-reading frame of three protein genes is all positioned at independently PLtetO-1 downstream, to make cas9, kuwith ligDthe expression of three protein genes is all by the regulation and control of this promotor; cas9amplified production, kuamplified production and ligDoverlapping with the base of 15nt between amplified production;

(3) cas9amplified production 3 ' end with ku5 ' end of amplified production, kuamplified production 3 ' end with ligDbetween amplified production 3 ' is held, the base all with 15nt is overlapping, is connected by in-fusion PCR cas9amplified production, kuamplified production and ligDamplified production, obtains the first connector;

(4) double digestion carrier is carrier is carried out with restriction endonuclease KpnI and HindIII _pbBR1MCS-2, obtains the digestion products of carrier is carrier; Digestion products through gel electrophoresis, cut glue and adopt DNA to reclaim kits digestion products; Then adopt the digestion products after in-fusion PCR connection purifying and the first connector, obtain carrier pNHEJ;

(5) utilize NotI and SpeI double digestion carrier pNHEJ, obtain the digestion products of carrier pNHEJ;

(6) in carrier pNHEJ, introduce two adjacent inverted BsaI restriction enzyme sites and adjacent two inverted BsmAI restriction enzyme sites, for transcribing, formed can the sgRNA of simultaneously binding purposes gene two positions simultaneously; Wherein, the DNA fragmentation with adjacent two inverted BsaI restriction enzyme sites is DBsaI, and the DNA fragmentation with adjacent two inverted BsmAI restriction enzyme sites is DBsmAI;

(7) by in-fusion PCR, DBsaI, DBsmAI are linked, obtain the second connection product;

(8) by in-fusion PCR, the digestion products that second connects product and carrier pNHEJ being coupled together, obtaining the CRISPR-Cas9 system for knocking out target gene, i.e. pCr-NHEJ carrier.

Wherein, in step (2), the primer PPLtetO-1-cas9U with sequence shown in SEQ ID NO:2 and the primer PCas9D with sequence shown in SEQ ID NO:3 is adopted to increase cas9protein gene, obtains cas9amplified production;

The primer PPLtetO-1-KuU with sequence shown in SEQ ID NO:4 and the primer PkuD with sequence shown in SEQ ID NO:5 is adopted to increase kuprotein gene, obtains kuamplified production;

The primer PLtetO-1-ligDU with sequence shown in SEQ ID NO:6 and the primer PligDD with sequence shown in SEQ ID NO:7 is adopted to increase ligDprotein gene, obtains ligDamplified production.

Wherein, in step (6), the structure with the DNA fragmentation DBsaI of adjacent two inverted BsaI restriction enzyme sites is as follows:

First directly synthesis has the DNA sequence dna BsaIU of sequence shown in SEQ ID NO:8 and has the DNA sequence dna BsaID of sequence shown in SEQ ID NO:9, and wherein, the 3 ' end of BsaIU and the 5 ' end of BsaID have the overlap of 15nt; Wherein, BsaID contains tracrRNA sequence;

By in-fusion PCR, BsaIU and BsaID is coupled together; Then adopt and there is the primer PBsaIU of sequence shown in SEQ ID NO:10 and there is the primer PBsaID of sequence shown in SEQ ID NO:11, pcr amplification, namely obtain the DNA fragmentation DBsaI with adjacent two inverted BsaI restriction enzyme sites.

Wherein, in step (6), the structure with the DNA fragmentation DBsmAI of adjacent two inverted BsmAI restriction enzyme sites is as follows:

First directly synthesis has the DNA sequence dna BsmAIU of sequence shown in SEQ ID NO:12 and has the DNA sequence dna BsmAID of sequence shown in SEQ ID NO:13; Wherein, BsmAID contains tracrRNA sequence;

By in-fusion PCR, DNA sequence dna BsmAIU and DNA sequence dna BsmAID is coupled together; Then adopt and there is the primer PBsmAIU of sequence shown in SEQ ID NO:14 and there is the primer PBsmAID of sequence shown in SEQ ID NO:15, carry out pcr amplification, namely obtain the DNA fragmentation DBsmAI with adjacent two inverted BsmAI restriction enzyme sites.

embodiment 4.

The application that the pCr-NHEJ carrier of embodiment 1 knocks out bacterial gene is as follows:

For checking carrier knocks out the efficiency of different gram-negative bacteria gene, carrier is applied to the gene knockout to intestinal bacteria, Pseudomonas aeruginosa and Acinetobacter bauamnnii by the present invention.Respectively for three kinds of efflux pump genes of intestinal bacteria, Pseudomonas aeruginosa and Acinetobacter bauamnnii tolC(GI:224015931), RND family drug transporter(locus_tag=" A1S_1773 ") and RND type multidrug resistant efflux pump gene mexA(locus_tag=" OU9_00435 ") designs a pair spacer DNA sequence dna respectively.Adopt following methods design 20nt spacer sequence:

1) 250nt online software (http://crispr.dbcls.jp/) before above-mentioned three gene ORF is designed spacer DNA, and on PUBMED, by the genomic dna of BLAST comparison spacer DNA and corresponding bacterium, remove the spacer DNA repeated near PAM district 12nt, obtain the spacer sequence that possibility of missing the target is minimum.

2) for the sequence clone of two 20bp spacer coding DNAs is entered, need the forward and the reverse sequence that synthesize gcaagcacgccttagtaaccspacer DNA simultaneously, and add sequence " AGCAC " at 5 ' end of forward sequence, 3 ' end adds " G ", 5 ' end of reverse sequence adds " 5 '-AAAAC-3 ' ", and 3 ' end adds " G ".The sequence of Spacer DNA is as follows:

Intestinal bacteria spacer DNA:

Honest spacer DNA1:AGCACaaattgctccccattcttatG(SEQ ID.18)

Anti-large spacer DNA1:AAAACATAAGAATGGGGAGCAATTTG(SEQ ID.19)

Honest spacer DNA2:AGCACgcaagcacgccttagtaaccG(SEQ ID.20)

Anti-large spacer DNA2:AAAACGGTTACTAAGGCGTGCTTGCG(SEQ ID.21)

Pseudomonas aeruginosa spacer DNA:

Cupric spacer DNA1:AGCACAACGCCAGCCATGCGTGTACG(SEQ ID.22)

Anti-copper spacer DNA1:AAAACGTACACGCATGGCTGGCGTTG(SEQ ID.23)

Cupric spacer DNA2:AGCACCATCCTCAAGCGCCTGTTCAG(SEQ ID.24)

Anti-copper spacer DNA2:AAAACTGAACAGGCGCTTGAGGATGG(SEQ ID.25)

Acinetobacter bauamnnii spacer DNA:

Positive Bao spacer DNA1:AGCACTTAAGTTCTTAGGTCAACGGG(SEQ ID.26)

Anti-Bao spacer DNA2:AAAACCCGTTGACCTAAGAACTTAAG(SEQ ID.27)

Positive Bao spacer DNA2:AGCACTTGCCTGTGGCATTGTCTGGG(SEQ ID.28)

Anti-Bao spacer DNA2:AAAACCCAGACAATGCCACAGGCAAG(SEQ ID.29)

3) explain for large spacer1 and large spacer2 below, the synthetic method of other spacer DNA is identical:

1. composition sequence 5 '-AGCACaaattgctccccattcttat-3 ' and 5 '-GATAAGAATGGGGAGCAATTT-3 ', the two equal proportion is mixed, heat denatured after annealing, makes the two form complementary strand, obtains the double-stranded DNA of two ends with outstanding base---large spacerD1 ':

5’-AGCACaaattgctccccattcttat-3’

||||||||||||||||||||

3’-TTTAACGAGGGGTAAGAATAG-5’，

The double-stranded DNA obtained can insert BsaI or BsmAI restriction enzyme site.

2. composition sequence 5 '-AGCACgcaagcacgccttagtaacc-3 ' and 5 '-GGGTTACTAAGGCGTGCTTGC-3 ', the two equal proportion is mixed, heat denatured after annealing, makes the two form complementary strand, obtains the double-stranded DNA of two ends with outstanding base---large spacerD2 ':

5’-AGCACgcaagcacgccttagtaacc-3’

||||||||||||||||||||

3’-CGTTCGTGCGGAATCATTGGG-5’，

The double-stranded DNA obtained can insert BsaI or BsmAI restriction enzyme site.

4) large spacerD1 ' and large spacerD2 ' is successively cloned into pCr-NHEJ through BsaI or BsmAI restriction enzyme site, builds the CRISPR-Cas9 carrier of target goal gene.

5) after successfully constructing, adopt Electroporation Transformation Host Strains, microbiotic flat board screens resistance clone, and the primer adopting to be positioned to knock out region and one are positioned at the non-primer knocking out region carries out bacterium colony PCR, amplified target gene (electrophoresis result is shown in Fig. 6 A).As can not target gene be amplified, then prove to knock out successfully, otherwise represent that the goal gene of this bacterium colony does not knock out successfully.Primer pair sequence for three genes is as follows:

Colibacillary gene knock-out primers designed:

Large P1(SEQ ID.30): 5 '-CCCATTCTTATCGGCCTGAG-3 '

Large P2(SEQ ID.31): 5 '-CTTGGCGTTGTACAACGTGG-3 '

Pseudomonas aeruginosa gene knocks out primers designed:

Bao P1(SEQ ID32.): 5 '-AAGTTCTTAGGTCAACGGTG-3 '

Bao P2(SEQ ID.33): 5 '-TGTATGTACAGGCGAACTTC-3 '

Acinetobacter bauamnnii gene knockout primers designed:

Copper P1(SEQ ID.34): 5 '-AGCCATGCGTGTACTGGTTC-3 '

Copper P2(SEQ ID.35): 5 '-GCTGTCGGTTTTCGCCGGAG-3 '

Pseudomonas aeruginosa is identical for colibacillary gene knockout method with above-mentioned with the method for the preparation of Acinetobacter bauamnnii competence, Electroporation Transformation.The qualification result of intestinal bacteria, Pseudomonas aeruginosa and Acinetobacter bauamnnii gene knockout is shown in Fig. 6 A, B and C.

embodiment 5.

1. cas9, ku, ligDthe connection of the amplification of gene and three gene fragments.

1) cas9gene amplification: adopt primer PPLtetO-1-1-cas9U(SEQ ID.4; ) and cas9D(SEQ ID.5; ) amplification cas9gene, template is pCas9 plasmid (Addgene, GI:669193757).PCR reaction system: pfu high-fidelity DNA polymerase (sky, Beijing root) 1 μ L, 10 × PCR buffer 5 μ L, upstream primer (5 μMs) 1 μ L, downstream primer (5 μMs) 1 μ L, template DNA 10ng, supplement sterilizing ultrapure water to 50 μ L.

2) kugene amplification: adopt primer pPLtetO-1-1-KuU(SEQ ID.6; ) and PkuD(SEQ ID.7; ) amplification kugene, template is pET16b-MtKu plasmid (Science. 2002,6; 297 (5587): 1686-9).PCR reaction system: pfu high-fidelity DNA polymerase 1 μ L, 10 × PCR buffer 5 μ L, upstream primer (5 μMs) 1 μ L, downstream primer (5 μMs) 1 μ L, template DNA 10ng, supplement sterilizing ultrapure water to 50 μ L.PCR cycling condition: 98 DEG C of sex change 10 s, 68 DEG C extend 2min, totally 30 circulations, and 72 DEG C finally extend 5min.

3) ligDgene amplification: adopt primer pPLtetO-1-1-pligDU(SEQ ID.8; ) and PligDD(SEQ ID.9; ) amplification kugene, template is pET16b-MtligD plasmid [Science. 2002,6; 297 (5587): 1686-9].PCR reaction system: pfu high-fidelity DNA polymerase 1 μ L, 10 × PCR buffer 5 μ L, upstream primer (5 μMs) 1 μ L, downstream primer (5 μMs) 1 μ L, template DNA 10ng, supplement sterilizing ultrapure water to 50 μ L.PCR cycling condition: 98 DEG C of sex change 10 s, 68 DEG C extend 2min, totally 30 circulations, and 72 DEG C finally extend 5min.

4) pCR primer reclaims:adopt the PCR primer of QIAGEN company to reclaim test kit and reclaim above-mentioned three kinds of PCR primer.

5) cas9, ku, ligDthe in-fusion PCR of gene connects and amplification: get the PCR primer of the equivalent of three genes, connect by the In-fusion PCR kit of TBiotech.Reaction system: cas9, kuwith ligDpCR primer mix (DNA total amount is 1 μ g) according to the ratio of mol ratio 1:1:1,5 × In-Fusion HD Enzyme Premix(In-Fusion HD Cloning Plus, Clontech, TAKARA) 2 μ L, supplement sterilizing ultrapure water to 10 μ L, 37 DEG C of incubation 1h, to connect above-mentioned three PCR primer.Be that PPLtetO-1-cas9U with RPligDD increases and be above-mentionedly connected product with primer.PCR reaction system: pfu high-fidelity DNA polymerase 1 μ L, 10 × PCR buffer 5 μ L, upstream primer (5 μMs) 1 μ L, downstream primer (5 μMs) 1 μ L, template 1 μ L.Get 3 μ L PCR primer and carry out electrophoresis.

2. the Plastid transformation of broad host range plasmid PBBR1MCS-2, extraction and enzyme are cut.

1) calcium Chloride Method prepares bacillus coli DH 5 alpha competence:with the colibacillary DH5 of transfering loop picking mono-clonal αbacterium colony is in 2ml LB liquid nutrient medium, and 37 DEG C of shaking culture are spent the night.The bacterium of above-mentioned incubated overnight is forwarded to shaking culture 2-3 hour (OD in 5ml LB liquid nutrient medium in the ratio of 1:100 ₆₀₀about 0.2<0.4).The bacterium liquid of above-mentioned growth logarithmic phase is put 10 minutes on ice, 4 DEG C of centrifugal 8000rpm, 30 seconds, supernatant discarded.With the calcium chloride solution 400 μ L suspension thalline of 100mmol/L, ice bath 10 minutes, 4 DEG C centrifugal, 4000rpm, 5 minutes, supernatant discarded.Thalline is suspended in the 100mmol/L calcium chloride solution of 400 μ L precoolings on ice, this bacterium liquid is competence bacterium again, is divided in the Eppendorf pipe of having sterilized by 100 μ L, puts standby conversion in 4 DEG C of refrigerators and uses.

2) plastid transformation:be added to by plasmid DNA (100ng/ μ L) 1 μ L in 100 μ L competence bacteriums (being placed in 1.5mL centrifuge tube), mixing, puts 30 minutes on ice.Then to put in 42 DEG C of water-baths heat shock immediately 90 seconds, put immediately after taking-up in ice-water bath and cool 2 minutes.900 μ L SOC liquid nutrient medium (without kantlex) are added, gentle shake on 37 DEG C of shaking tables, rotating speed 200 rpm, 1 hour in bacterium.Get 10 μ L coatings with on LB Solid agar culture (containing the kantlex 50ug/ml) plate of 1.5%, cultivate 12 hours in 37 DEG C, grow single bacterium colony.

3) plasmid enlarged culturing and in a large number extraction:picking list bacterium colony, is inoculated in 3ml LB liquid nutrient medium (containing kantlex 50ug/ml), and put gentle shake on 37 DEG C of shaking tables, rotating speed 200 rpm, cultivates 12 hours.Plasmid extraction kit (high purity plasmid is little carries middle amount test kit, sky, Beijing root) is adopted to extract plasmid.

4) plasmid enzyme restriction:reaction system: plasmid 1 μ g, KpnI(NEB) and HindIII(NEB) each 1 μ L, 10 × damping fluid Cutsmart 1 μ L, make up water to 20 μ L, 37 DEG C of enzymes cut 2 hours.Digestion products adopts DNA glue to reclaim test kit and reclaims (QIAGEN).

3. cas9, ku, ligDthe connection of gene and carrier: get three gene junction fragments and enzyme cut after carrier pBBR1MCS-2 according to the mixed in molar ratio (DNA total amount is 1 μ g) of 1:1, add 5 × In-Fusion HD Enzyme Premix(In-Fusion HD Cloning Plus, Clontech, TAKARA) 2 μ L, supplement sterilizing ultrapure water to 10 μ L, 37 DEG C of incubation 1h, to connect above-mentioned two DNA fragmentations, namely successful connection obtains pNHEJ.

4. the design of sgRNA:first obtain on PUBMED tolC(GI:224015931), RND family drug transporter(locus_tag=" A1S_1773 ") and RND type multidrug resistant efflux pump gene mexAthe gene order of (locus_tag=" OU9_00435 "), the front 250nt sequence then choosing opening code-reading frame, as target site, uses online sgRNA design software (http://crispr.dbcls.jp/), target gene is found spacer sequence.Sequence pattern is 3 '-N ₂₀ nGG-5 ', spacer be into N ₂₀complementary sequence.Then on pubmed, pass through BLAST software, compare with the full-length genome of Pseudomonas aeruginosa PAO1, remove the spacer sequence that 3 ' end, 12 bases repeat completely, to avoid effect of missing the target.

5. the clone of Spacer DNA:

Because the structure of the carrier for three genes is identical, be only described for the example that is configured to of the knockout carrier of intestinal bacteria tolC gene at this, construction step, the experiment condition of other two kinds of carriers are identical.

the preparation of double-strand Spacer DNA:

Get synthetic honest spacer DNA1(SEQ ID.18) and anti-large spacer DNA1(SEQ ID.19) fragment, etc. volumetric molar concentration mixing, then carry out sex change, annealing.

Sex change, annealing system are:,

2.5 μ l forward spacer DNA (100 μMs)

The reverse spacer DNA of 2.5 μ l (100 μMs)

1μl NEB buffer2

4 μ l aqua sterilisas

Run according to following program in PCR instrument: 95 DEG C, 5min; 95 – 85 DEG C at-2 DEG C/s; 85 – 25 DEG C at-0.1 DEG C/s.After annealing, two DNA single chain complementations form double-strand.Honest spacer DNA2(SEQ ID.20) and anti-large spacer DNA1(SEQ ID.21) sex change annealing conditions the same.

the clone of double-strand Spacer DNA

6. first single endonuclease digestion is carried out to plasmid,reaction system: plasmid pNHEJ 1 μ g, BsaI(NEB) or BsmAI(NEB) 1 μ L, 10 × damping fluid Cutsmart 1 μ L, make up water to 20 μ L, 37 DEG C of enzymes cut 2 hours, then adopt DNA glue to reclaim test kit to digestion products and reclaim (QIAGEN).Double-strand Spacer DNA is mixed with the ratio of carrier recovery fragment according to 1:1, add 5 × In-Fusion HD Enzyme Premix(In-Fusion HD Cloning Plus, Clontech, TAKARA) 2 μ L, supplement sterilizing ultrapure water to 10 μ L, 37 DEG C of incubation 1h, to connect above-mentioned two DNA fragmentations.Connect product conversion bacillus coli DH 5 alpha and extract plasmid (preparation of Calcium Chloride Method competence, Plastid transformation, extraction are as previously mentioned).And then BsmAI(NEB is carried out to plasmid) or BsaI(NEB) single endonuclease digestion.Reaction system: 1 μ L, 10 × damping fluid Cutsmart 1 μ L, make up water to 20 μ L, 37 DEG C of enzymes cut 2 hours, then adopt DNA glue to reclaim test kit to digestion products and reclaim (QIAGEN).Double-strand Spacer DNA is carried out mixing (DNA total amount is 1 μ g) according to the ratio of 1:1 with carrier recovery fragment, add 5 × in-Fusion HD Enzyme Premix(In-Fusion HD Cloning Plus, Clontech, TAKARA) 2 μ L, supplement sterilizing ultrapure water to 10 μ L, 37 DEG C of incubation 1h, to connect above-mentioned two DNA fragmentations.Namely the gene site-directed plasmid vector knocked out is obtained after successful connection.Get and connect product conversion bacillus coli DH 5 alpha, and adopt preceding method to extract plasmid.

Note: because Host Strains DH5 α carries TolC gene, therefore, after accepting plasmid, its TolC gene has started acceptance and has knocked out, and the corresponding site of its target gene is cut open, and after the several base of excision, is connected by NHEJ system.As DH5 α acceptance is the gene knockout plasmid knocking out Pseudomonas aeruginosa or Acinetobacter bauamnnii, then in theory above-mentioned situation can not occur.

gene knockout experiment

Preparation (intestinal bacteria, Pseudomonas aeruginosa are identical with the preparation method of Acinetobacter bauamnnii, describe in the lump at this) for electroporated competence bacterium:

1) preparation of Electroporation-competent cells

1. get mono-clonal bacterium colony with rifle choicest, drop into and fill in the glass test tube of 2ml LB liquid nutrient medium.37 DEG C, 220rpm, cultivates 14-16 hour.

2. second day, turn with the ratio of volume ratio 1:100 and be inoculated in 100ml LB liquid nutrient medium, 37 DEG C, 220rpm, jolting 2-3 hour, surveyed an OD per half an hour, when OD value reaches 0.3-0.4, stops cultivating.

3. inoculum is placed in precooling on ice 30 minutes, subsequently bacterium liquid is dispensed in the centrifuge tube of 50ml precooling, 4 DEG C, centrifugal 10 minutes of 4000g.

4. abandon supernatant, in centrifuge tube, add a small amount of sterilizing ultrapure water, after precipitation is suspended, then add appropriate sterilizing ultrapure water, 4 DEG C, centrifugal 10 minutes of 4000rpm.

5. repeating step 4.

6., after abandoning supernatant, add 10% glycerine of a small amount of sterilizing, on ice precooling, resuspended bacterium, then fill it up with 10% glycerine, 4 DEG C, 4000rpm, centrifugal 10min.

7. abandon supernatant, in each centrifuge tube, add the glycerine of 2ml 10%, resuspended bacterium, namely transform for electricity.

2) electricity transforms

1. get 2 μ l for heterogeneic CRISPR-Cas9 carrier in the centrifuge tube of 1.5ml, it is placed in precooling on ice together with the pole cup of 0.1CM.

2. the competent cell that 40 μ L thaw is shifted in the centrifuge tube of so far 1.5ml, carefully mix, place 10min on ice.

3. this mixture is transferred in the pole cup of precooling, knocks pole cup gently and make mixture evenly enter the bottom of pole cup;

4. pole cup is pushed electric conversion instrument, carry out Electroporation Transformation (1.8kV, 6mS), after electric shock terminates, in electric shock cup, add the SOC liquid nutrient medium of 1000 μ l immediately, after re-suspended cell, transfer in the centrifuge tube of 1.5ml.

5. 37 DEG C, 220-250rpm recovers 1 hour.

6. get 10 μ L converted products to add on the LB flat board that 90 μ L SOC coat containing kantlex (50 μ g/ml), be put in 37 DEG C of greenhouses, incubated overnight.

7.choosing colony, carried out bacterium colony PCR identified gene and knocked out positive rate next day.

3) rate qualification is knocked out

Foregoing primers designed is adopted to carry out PCR.According to following condition mixing PCR reaction system in PCR pipe:

Pfu high-fidelity DNA polymerase 1 μ L, 10 × PCR buffer 5 μ L, upstream primer (5 μMs) 1 μ L, downstream primer (5 μMs) 1 μ L, supplement sterilizing ultrapure water to 50 μ L, then from 10 bacterium colonies of random selecting flat board, with connecing the microbionation of acicula point picking minute quantity in above-mentioned PCR reaction system.Then carry out pcr amplification: PCR cycling condition: 98 DEG C of sex change 10 s, 52 DEG C extend 2min, totally 30 circulations, and 72 DEG C finally extend 5min.

Qualification result shows, the efficiency that the method knocks out gene can reach 87.5% ~ 100%.

Finally should be noted that; above embodiment is only in order to illustrate technical scheme of the present invention; but not limiting the scope of the invention; although done to explain to the present invention with reference to preferred embodiment; those of ordinary skill in the art is to be understood that; can modify to technical scheme of the present invention or equivalent replacement, and not depart from essence and the scope of technical solution of the present invention.

gene order table

<110> Guangdong Medical College

<120> pCr-NHEJ carrier and construction process thereof and to fix a point the application that knocks out for bacterial gene

<160> 15

<210> SEQ ID NO: 1

<211> 12621

<212> DNA

<213> pCr-NHEJ

<400> SEQ ID NO: 1

ctcgggccgtctcttgggcttgatcggccttcttgcgcatctcacgcgctcctgcggcggcctgtagggcaggctcatacccctgccgaaccgcttttgtcagccggtcggccacggcttccggcgtctcaacgcgctttgagattcccagcttttcggccaatccctgcggtgcataggcgcgtggctcgaccgcttgcgggctgatggtgacgtggcccactggtggccgctccagggcctcgtagaacgcctgaatgcgcgtgtgacgtgccttgctgccctcgatgccccgttgcagccctagatcggccacagcggccgcaaacgtggtctggtcgcgggtcatctgcgctttgttgccgatgaactccttggccgacagcctgccgtcctgcgtcagcggcaccacgaacgcggtcatgtgcgggctggtttcgtcacggtggatgctggccgtcacgatgcgatccgccccgtacttgtccgccagccacttgtgcgccttctcgaagaacgccgcctgctgttcttggctggccgacttccaccattccgggctggccgtcatgacgtactcgaccgccaacacagcgtccttgcgccgcttctctggcagcaactcgcgcagtcggcccatcgcttcatcggtgctgctggccgcccagtgctcgttctctggcgtcctgctggcgtcagcgttgggcgtctcgcgctcgcggtaggcgtgcttgagactggccgccacgttgcccattttcgccagcttcttgcatcgcatgatcgcgtatgccgccatgcctgcccctcccttttggtgtccaaccggctcgacgggggcagcgcaaggcggtgcctccggcgggccactcaatgcttgagtatactcactagactttgcttcgcaaagtcgtgaccgcctacggcggctgcggcgccctacgggcttgctctccgggcttcgccctgcgcggtcgctgcgctcccttgccagcccgtggatatgtggacgatggccgcgagcggccaccggctggctcgcttcgctcggcccgtggacaaccctgctggacaagctgatggacaggctgcgcctgcccacgagcttgaccacagggattgcccaccggctacccagccttcgaccacatacccaccggctccaactgcgcggcctgcggccttgccccatcaatttttttaattttctctggggaaaagcctccggcctgcggcctgcgcgcttcgcttgccggttggacaccaagtggaaggcgggtcaaggctcgcgcagcgaccgcgcagcggcttggccttgacgcgcctggaacgacccaagcctatgcgagtgggggcagtcgaaggcgaagcccgcccgcctgccccccgagcctcacggcggcgagtgcgggggttccaagggggcagcgccaccttgggcaaggccgaaggccgcgcagtcgatcaacaagccccggaggggccactttttgccggagggggagccgcgccgaaggcgtgggggaaccccgcaggggtgcccttctttgggcaccaaagaactagatatagggcgaaatgcgaaagacttaaaaatcaacaacttaaaaaaggggggtacgcaacagctcattgcggcaccccccgcaatagctcattgcgtaggttaaagaaaatctgtaattgactgccacttttacgcaacgcataattgttgtcgcgctgccgaaaagttgcagctgattgcgcatggtgccgcaaccgtgcggcaccctaccgcatggagataagcatggccacgcagtccagagaaatcggcattcaagccaagaacaagcccggtcactgggtgcaaacggaacgcaaagcgcatgaggcgtgggccgggcttattgcgaggaaacccacggcggcaatgctgctgcatcacctcgtggcgcagatgggccaccagaacgccgtggtggtcagccagaagacactttccaagctcatcggacgttctttgcggacggtccaatacgcagtcaaggacttggtggccgagcgctggatctccgtcgtgaagctcaacggccccggcaccgtgtcggcctacgtggtcaatgaccgcgtggcgtggggccagccccgcgaccagttgcgcctgtcggtgttcagtgccgccgtggtggttgatcacgacgaccaggacgaatcgctgttggggcatggcgacctgcgccgcatcccgaccctgtatccgggcgagcagcaactaccgaccggccccggcgaggagccgcccagccagcccggcattccgggcatggaaccagacctgccagccttgaccgaaacggaggaatgggaacggcgcgggcagcagcgcctgccgatgcccgatgagccgtgttttctggacgatggcgagccgttggagccgccgacacgggtcacgctgccgcgccggtagcacttgggttgcgcagcaacccgtaagtgcgctgttccagactatcggctgtagccgcctcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacggggagagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagcaatagacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgcttattatcacttattcaggcgtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcagtcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattggagctccaccgcggtggcGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAGACCaaaGGTCTCgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcTTTTTTTGACGACGACGACGACGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACGAGACaaaGTCTCgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcTTTTTTTgatcccccgggctgcaggaattcgatatcaGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACAAGGAGTATACCATGGATAAGAAATACTCAATAGGCTTAGATATCGGCACAAATAGCGTCGGATGGGCGGTGATCACTGATGATTATAAGGTTCCGTCTAAAAAGTTCAAGGTTCTGGGAAATACAGACCGCCACAGTATCAAAAAAAATCTTATAGGGGCTCTTTTATTTGACAGTGGAGAGACAGCGGAAGCGACTCGTCTCAAACGGACAGCTCGTAGAAGGTATACACGTCGGAAGAATCGTATTTGTTATCTACAGGAGATTTTTTCAAATGAGATGGCGAAAGTAGATGATAGTTTCTTTCATCGACTTGAAGAGTCTTTTTTGGTGGAAGAAGACAAGAAGCATGAACGTCATCCTATTTTTGGAAATATAGTAGATGAAGTTGCTTATCATGAGAAATATCCAACTATCTATCATCTGCGAAAAAAATTGGCAGATTCTACTGATAAAGTGGATTTGCGCTTAATCTATTTGGCCTTAGCGCATATGATTAAGTTTCGTGGTCATTTTTTGATTGAGGGAGATTTAAATCCTGATAATAGTGATGTGGACAAACTATTTATCCAGTTGGTACAAACCTACAATCAATTATTTGAAGAAAACCCTATTAACGCAAGTAGAGTAGATGCTAAAGCGATTCTTTCTGCACGATTGAGTAAATCAAGACGATTAGAAAATCTCATTGCTCAGCTCCCCGGTGAGAAGAAAAATGGATTGTTTGGGAATCTCATTGCTTTGTCATTGGGATTGACCCCTAATTTTAAATCAAATTTTGATTTGGCAGAAGATACTAAATTACAGCTTTCAAAAGATACTTACGATGATGATTTAGATAATTTATTGGCGCAAATTGGAGATCAATATGCTGATTTGTTTTTGGCAGCTAAGAATTTATCAGATGCTATTTTACTTTCAGATATCCTAAGAGTAAATAGTGAAATAACTAAGGCTCCCCTATCAGCTTCAATGATTAAACGCTACGATGAACATCATCAAGACTTGACTCTTTTAAAAGCTTTAGTTCGACAACAACTTCCAGAAAAGTATAAAGAAATCTTTTTTGATCAATCAAAAAACGGATATGCAGGTTATATTGATGGGGGAGCTAGCCAAGAAGAATTTTATAAATTTATCAAACCAATTTTAGAAAAAATGGATGGTACTGAGGAATTATTGGCGAAACTAAATCGTGAAGATTTGCTGCGCAAGCAACGGACCTTTGACAACGGCTCTATTCCCTATCAAATTCACTTGGGTGAGCTGCATGCTATTTTGAGAAGACAAGAAGACTTTTATCCATTTTTAAAAGACAATCGTGAGAAGATTGAAAAAATCTTGACTTTTCGAATTCCTTATTATGTTGGTCCATTGGCGCGTGGCAATAGTCGTTTTGCATGGATGACTCGGAAGTCTGAAGAAACAATTACCCCATGGAATTTTGAAGAAGTTGTCGATAAAGGTGCTTCAGCTCAATCATTTATTGAACGCATGACAAACTTTGATAAAAATCTTCCAAATGAAAAAGTACTACCAAAACATAGTTTGCTTTATGAGTATTTTACGGTTTATAACGAATTGACAAAGGTCAAATATGTTACTGAGGGAATGCGAAAACCAGCATTTCTTTCAGGTGAACAGAAGAAAGCCATTGTTGATTTACTCTTCAAAACAAATCGAAAAGTAACCGTTAAGCAATTAAAAGAAGATTATTTCAAAAAAATAGAATGTTTTGATAGTGTTGAAATTTCAGGCGTTGAAGATCGGTTTAATACGTCATTAGGTACCTACCATGATTTGCTAAAAATTATCAAAGATAAAGATTTTTTGGATAATGAAGAAAATGAAGATATTTTAGAGGATATTGTTTTAACATTGACCTTATTTGAAGATAAGGAAATGATTGAGGAACGACTTAAAAAGTATGCTAACCTCTTTGATGATAAGGTGATGAAACAGCTTAAACGTCGCCATTATACTGGCTGGGGGCGTTTGTCTCGAAAATTGATTAATGGTATTAGGGATAAGCAATCTGGCAAAACAATATTAGATTTTTTGAAATCAGATGGTTTTGCCAATCGCAACTTTATGCAGCTTATCAATGATGATAGTTTAACATTCAAGGAAGCTATTCAAAAAGCACAGGTGTCTGGACAAGGCCATAGTTTACATGAACAGATTGCTAACTTAGCTGGCAGTCCTGCTATTAAAAAAGGTATTTTACAGACTGTAAAAATTGTTGATGAACTGGTCAAAGTAATGGGGCATAAGCCAGAAAATATCGTTATTGAAATGGCACGTGAAAATCAGACAACTCAAAAGGGCCAGAAAAATTCGCGAGAGCGTATGAAACGAATCGAAGAAGGTATCAAAGAATTAGGAAGTCAGATTCTTAAAGAGCATCCTGTTGAAAATACTCAATTGCAAAATGAAAAGCTCTATCTCTATTATCTCCAAAATGGAAGAGACATGTATGTGGACCAAGAATTAGATATTAATCGTTTAAGTGATTATGATGTCGATCACATTGTTCCACAAAGTTTCCTTAAAGACGATTCAATAGACAATAAGGTGCTAACACGTTCTGATAAAAATCGTGGTAAATCGGATAACGTTCCAAGTGAAGAAGTAGTCAAAAAGATGAAAAACTATTGGAGACAACTTCTAAACGCCAAGTTAATCACTCAACGTAAGTTTGATAATTTAACGAAAGCTGAACGTGGAGGTTTGAGTGAACTTGATAAAGCTGGTTTTATCAAACGCCAATTGGTTGAAACTCGCCAAATCACTAAGCATGTGGCACAAATTTTGGATAGTCGCATGAATACTAAATACGATGAAAATGATAAACTTATTCGAGAGGTTAAAGTGATTACCTTAAAATCTAAATTAGTTTCTGACTTCCGAAAAGATTTCCAATTCTATAAAGTACGTGAGATTAACAATTACCATCATGCCCATGATGCGTATCTTAATGCCGTCGTTGGAACTGCTTTGATTAAGAAATATCCAAAACTTGAATCGGAGTTTGTCTATGGTGATTATAAAGTTTATGATGTTCGTAAAATGATTGCTAAGTCTGAGCAGGAAATAGGCAAAGCAACCGCAAAATATTTCTTTTACTCTAATATCATGAACTTCTTCAAAACAGAAATTACACTTGCAAATGGAGAGATTCGCAAACGCCCTCTAATCGAAACTAATGGGGAAACTGGAGAAATTGTCTGGGATAAAGGGCGAGATTTTGCCACAGTGCGCAAAGTATTGTCCATGCCCCAAGTCAATATTGTCAAGAAAACAGAAGTACAGACAGGTGGATTCTCCAAGGAGTCAATTTTACCAAAAAGAAATTCGGACAAGCTTATTGCTCGTAAAAAAGACTGGGATCCAAAAAAATATGGTGGTTTTGATAGTCCAACGGTAGCTTATTCAGTCCTAGTGGTTGCTAAGGTGGAAAAAGGGAAATCGAAGAAGTTAAAATCCGTTAAAGAGTTACTAGGGATCACAATTATGGAAAGAAGTTCCTTTGAAAAAAATCCGATTGACTTTTTAGAAGCTAAAGGATATAAGGAAGTTAGAAAAGACTTAATCATTAAACTACCTAAATATAGTCTTTTTGAGTTAGAAAACGGTCGTAAACGGATGCTGGCTAGTGCCGGAGAATTACAAAAAGGAAATGAGCTGGCTTTGCCAAGCAAATATGTGAATTTTTTATATTTAGCTAGTCATTATGAAAAATTGAAGGGTAGTCCAGAAGATAACGAACAAAAACAATTGTTTGTGGAGCAGCATAAGCATTATTTAGATGAGATTATTGAGCAAATCAGTGAATTTTCTAAGCGTGTTATTTTAGCAGATGCCAATTTAGATAAAGTTCTTAGTGCATATAACAAACATAGAGACAAACCAATACGTGAACAAGCAAAAAATATTATTCATTTATTTACGTTGACGAATCTTGGAGCTCCCGCTGCTTTTAAATATTTTGATACAACAATTGAACGAAACCGTTACAAATCAATTAAGGAAGTCTTAGATGCAACCCTCATCCATCAATCCATCACTGGTCTTTATGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACTGAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACAAGGAGTATACCATGCGAGCCATTTGGACGGGTTCGATCGCCTTCGGGCTGGTGAACGTGCCGGTCAAGGTGTACAGCGCTACCGCAGACCACGACATCAGGTTCCACCAGGTGCACGCCAAGGACAACGGACGCATCCGGTACAAGCGCGTCTGCGAGGCGTGTGGCGAGGTGGTCGACTACCGCGATCTTGCCCGGGCCTACGAGTCCGGCGACGGCCAAATGGTGGCGATCACCGACGACGACATCGCCAGCTTGCCTGAAGAACGCAGCCGGGAGATCGAGGTGTTGGAGTTCGTCCCCGCCGCCGACGTGGACCCGATGATGTTCGACCGCAGCTACTTTTTGGAGCCTGATTCGAAGTCGTCGAAATCGTATGTGCTGCTGGCTAAGACACTCGCCGAGACCGACCGGATGGCGATCGTGCATTTCACGCTGCGCAACAAGACCAGGCTGGCGGCGTTGCGCGTCAAGGATTTCGGCAAGCGAGAGGTGATGATGGTGCACACGTTGCTGTGGCCCGATGAGATCCGCGACCCCGACTTCCCGGTGCTGGACCAGAAGGTGGAGATCAAACCCGCGGAACTCAAGATGGCCGGCCAGGTGGTGGACTCGATGGCCGACGACTTCAATCCGGACCGCTACCACGACACCTACCAGGAGCAGTTACAGGAGCTGATCGACACCAAACTCGAAGGTGGGCAGGCATAAGGTGGGCAGGCATGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACAAGGAGTATACCATGGGTTCGGCGTCGGAGCAACGGGTGACGCTGACCAACGCCGACAAGGTGCTCTATCCCGCCACCGGGACCACAAAGTCCGATATCTTCGACTACTACGCCGGTGTTGCCGAAGTCATGCTCGGCCACATCGCGGGACGGCCGGCGACGCGCAAGCGCTGGCCTAACGGCGTCGACCAACCCGCGTTCTTCGAAAAGCAGTTGGCGTTGTCGGCGCCGCCTTGGCTGTCACGTGCAACGGTGGCGCACCGGTCCGGGACGACGACCTATCCGATCATCGATAGCGCAACCGGGCTGGCCTGGATCGCCCAACAGGCGGCGCTGGAGGTGCACGTGCCGCAGTGGCGGTTTGTCGCCGAGCCCGGATCAGGTGAGTTAAATCCGGGCCCGGCAACGCGTTTGGTGTTCGACCTGGACCCGGGCGAAGGCGTGATGATGGCCCAGCTGGCCGAGGTGGCGCGCGCGGTTCGTGATCTTCTCGCCGATATCGGGTTGGTCACCTTCCCGGTCACCAGCGGCAGCAAGGGATTGCATCTGTACACACCGCTGGATGAGCCGGTGAGCAGCAGGGGAGCCACGGTGTTGGCCAAGCGCGTCGCGCAGCGATTGGAGCAGGCGATGCCCGCGTTGGTCACCTCGACCATGACCAAAAGCCTGCGGGCCGGGAAGGTGTTTGTGGACTGGAGCCAGAACAGCGGCTCGAAGACCACCATCGCGCCGTACTCACTACGTGGCCGGACGCATCCGACCGTCGCGGCGCCACGCACCTGGGCGGAGCTCGACGACCCCGCACTGCGTCAGCTCTCCTACGACGAGGTGCTGACCCGGATTGCCCGCGACGGCGATCTGCTCGAGCGGCTGGATGCCGACGCTCCGGTAGCGGACCGGTTGACCCGATACCGCCGCATGCGCGACGCATCGAAAACTCCCGAGCCGATTCCCACGGCGAAACCCGTTACCGGAGACGGCAATACGTTCGTCATCCAGGAGCATCACGCGCGTCGGCCGCACTACGATTTCCGGCTGGAATGCGACGGCGTGCTGGTCTCGTGGGCGGTACCGAAAAACCTGCCCGACAACACATCGGTTAACCATCTAGCGATACACACCGAGGACCACCCGCTGGAATACGCCACGTTCGAGGGCGCGATTCCCAGCGGGGAGTACGGCGCCGGCAAGGTGATCATCTGGGACTCCGGCACTTACGACACCGAGAAGTTCCACGATGACCCGCACACGGGGGAGGTCATCGTGAATCTGCACGGCGGCCGGATCTCTGGGCGTTATGCGCTGATTCGGACCAACGGCGATCGGTGGCTGGCGCACCGCCTAAAGAATCAGAAAGACCAGAAGGTGTTCGAGTTCGACAATCTGGCCCCAATGCTTGCCACGCACGGCACGGTGGCCGGTCTAAAGGCCAGCCAGTGGGCGTTCGAAGGCAAGTGGGACGGCTACCGGTTGCTGGTTGAGGCTGACCACGGCGCCGTGCGGCTGCGGTCCCGCAGCGGGCGCGATGTCACCGCCGAGTATCCGCAATTGCGGGCATTGGCGGAGGATCTCGCCGATCACCACGTGGTGCTGGACGGCGAGGCCGTCGTACTTGACTCCTCTGGTGTGCCCAGCTTCAGCCAGATGCAGAATCGGGGCCGCGACACCCGTGTCGAGTTCTGGGCGTTCGACCTGCTCTACCTCGACGGCCGCGCGCTGCTAGGCACCCGCTACCAAGACCGGCGTAAGCTGCTCGAAACCCTAGCTAACGCAACCAGTCTCACCGTTCCCGAGCTGCTGCCCGGTGACGGCGCCCAAGCGTTTGCGTGCTCGCGCAAGCACGGCTGGGAGGGCGTGATCGCCAAGAGGCGTGACTCGCGCTATCAGCCGGGCCGGCGCTGCGCGTCGTGGGTCAAGGACAAGCACTGGAACACCCAGGAAGTCGTCATTGGTGGCTGGCGCGCCGGGGAAGGCGGGCGCAGCAGTGGCGTCGGGTCGCTGCTCATGGGCATCCCCGGTCCAGGTGGGCTGCAGTTCGCCGGGCGGGTCGGTACCGGCCTCAGCGAACGCGAACTGGCCAACCTCAAGGAGATGCTGGCGCCGCTGCATACCGACGAGTCCCCCTTCGACGTACCACTGCCCGCGCGTGACGCCAAGGGCATCACATATGTCAAGCCGGCGCTGGTTGCAGAGGTGCGCTACAGCGAGTGGACTCCGGAGGGCCGGCTGCGTCAATCAAGCTGGCGTGGGCTGCGGCCGGACAAGAAACCCAGTGAGGTGGTGCGCGAATGAccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgcatgcataaaaactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatgggggtgggcgaagaactccagcatgagatccccgcgctggaggatcatccagccggcgtcccggaaaacgattccgaagcccaacctttcatagaaggcggcggtggaatcgaaatctcgtgatggcaggttgggcgtcgcttggtcggtcatttcgaaccccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccatgggtcacgacgagatcctcgccgtcgggcatgcgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacagctgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcctgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgcccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagcggccggagaacctgcgtgcaatccatcttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatccagtttactttgcagggcttcccaaccttaccagagggcgccccagctggcaattccggttcgcttgctgtccataaaaccgcccagtctagctatcgccatgtaagcccactgcaagctacctgctttctctttgcgcttgcgttttcccttgtccagatagcccagtagctgacattcatcccaggtggcacttttcggggaaatgtgcgcgcccgcgttcctgctggcgctgggcctgtttctggcgctggacttcccgctgttccgtcagcagcttttcgcccacggccttgatgatcgcggcggccttggcctgcatatcccgattcaacggccccagggcgtccagaacgggcttcaggcgctcccgaaggt

<210> SEQ ID NO: 2

<211> 89

<212> DNA

<213> PPLtetO-1-cas9U

<400> SEQ ID NO: 2

gctctagaactagtgGA GATTGACATCCCTATCAGTGATAGA GATACTGAGCACAAGGAGTATACC ATGGATAAGAAATACTCAATAGG

 

<210> SEQ ID NO: 3

<211> 37

<212> DNA

<213> cas9D

<400> SEQ ID NO: 3

agggatgtcaatctcTCAGTCACCTCCTAGCTGACTC

 

<210> SEQ ID NO: 4

<211> 88

<212> DNA

<213> PPLtetO-1-KuU

<400> SEQ ID NO: 4

gctctagaactagtgGA GATTGACATCCCTATCAGTGATAGA GATACTGAGCACAAGGAGTATACC ATGCGAGCCATTTGGACGGGTT

 

<210> SEQ ID NO: 5

<211> 23

<212> DNA

<213> PkuD

<400> SEQ ID NO: 5

ATGCCTGCCCACCTTCGAGTTTG

 

<210> SEQ ID NO: 6

<211> 84

<212> DNA

<213> PLtetO-1-ligDU

<400> SEQ ID NO: 6

gctctagaactagtgGA GATTGACATCCCTATCAGTGATAGA GATACTGAGCACAAGGAGTATACC ATGGGTTCGGCGTCGGAG

 

<210> SEQ ID NO: 7

<211> 83

<212> DNA

<213> PligDD

<400> SEQ ID NO: 7

GGGAACAAAGCTGG CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTCATTCGCGCACCACCTCACT

 

<210> SEQ ID NO: 8

<211> 81

<212> DNA

<213> BsaIU

<400> SEQ ID NO: 8

GA GATTGACATCCCTATCAGTGATAGA GATACTGAGCAC gagacc aaa GGTCTC gttttagagctaGAAAtagcaagttaa

 

<210> SEQ ID NO: 9

<211> 72

<212> DNA

<213> BsaID

<400> SEQ ID NO: 9

GAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTC

 

<210> SEQ ID NO: 10

<211> 33

<212> DNA

<213> PBsaIU

<400> SEQ ID NO: 10

ctccaccgcggtggcGAGATTGACATCCCTATC

 

<210> SEQ ID NO: 11

<211> 33

<212> DNA

<213> PBsaID

<400> SEQ ID NO: 11

GTCGTCGTCGTCGTCAAAAAAAGCACCGACTCG

 

<210> SEQ ID NO: 12

<211> 79

<212> DNA

<213> BsmAIU

<400> SEQ ID NO: 12

GA GATTGACATCCCTATCAGTGATAGA GATACTGAGCAC gagacaaa gtctcg ttttagagctaGAAAtagcaagttaa

 

<210> SEQ ID NO: 13

<211> 71

<212> DNA

<213> BsmAID

<400> SEQ ID NO: 13

GAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcTTTTTTT

 

<210> SEQ ID NO: 14

<211> 33

<212> DNA

<213> PBsmAIU

<400> SEQ ID NO: 14

GACGACGACGACGACGA GATTGACATCCCTATC

 

<210> SEQ ID NO: 15

<211> 33

<212> DNA

<213> PBsmAID

<400> SEQ ID NO: 15

GCCACCGCGGTGGAGAAAAAAAGCACCGACTCG

Claims (7)

1. a pCr-NHEJ carrier, is characterized in that: the sequence of described pCr-NHEJ carrier has the sequence shown in SEQ ID NO:1.

2. a kind of pCr-NHEJ carrier according to claim 1 is in the application of fixing a point to knock out in bacterial gene.

3. the construction process of a kind of pCr-NHEJ carrier according to claim 1, is characterized in that: comprise the steps:

(1) broad host range plasmid of gram-negative bacteria is adopted _pbBR1MCS-2(GI:773412) carrier based on;

(2) adopt and to increase respectively following three protein genes with the upstream primer of the prokaryotic promoter PLtetO-1 transcribed for mRNA and downstream primer: cas9(GI:674296984), ku(GI:444893469) and ligD(GI:444893469), obtain respectively cas9amplified production, kuamplified production and ligDamplified production; Wherein, cas9, kuwith ligDthe opening code-reading frame of three protein genes is all positioned at independently PLtetO-1 downstream, to make cas9, kuwith ligDthe expression of three protein genes is all by the regulation and control of this promotor; Described cas9amplified production, described in kuamplified production and described ligDoverlapping with the base of 15nt between amplified production;

(3) described in cas93 ' end of amplified production is with described ku5 ' end of amplified production, described in ku3 ' end of amplified production is with described ligDbetween amplified production 3 ' is held, the base all with 15nt is overlapping, described in being connected by in-fusion PCR cas9amplified production, described in kuamplified production and described ligDamplified production, obtains the first connector;

(4) double digestion carrier is carrier is carried out with restriction endonuclease KpnI and HindIII _pbBR1MCS-2, obtains the digestion products of carrier is carrier; Described digestion products through gel electrophoresis, cut glue and adopt DNA to reclaim kits digestion products; Then adopt in-fusion PCR to connect the digestion products after described purifying and the first connector, obtain carrier pNHEJ;

(5) utilize carrier pNHEJ described in NotI and SpeI double digestion, obtain the digestion products of carrier pNHEJ;

(6) in described carrier pNHEJ, introduce two adjacent inverted BsaI restriction enzyme sites and adjacent two inverted BsmAI restriction enzyme sites, for transcribing, formed can the sgRNA of simultaneously binding purposes gene two positions simultaneously; Wherein, the DNA fragmentation with adjacent two inverted BsaI restriction enzyme sites is DBsaI, and the DNA fragmentation with adjacent two inverted BsmAI restriction enzyme sites is DBsmAI;

(7) by in-fusion PCR, DBsaI, DBsmAI are linked, obtain the second connection product;

(8) by in-fusion PCR, the digestion products that described second connects product and carrier pNHEJ being coupled together, obtaining the CRISPR-Cas9 system for knocking out target gene, i.e. pCr-NHEJ carrier.

4. the construction process of a kind of pCr-NHEJ carrier according to claim 3, it is characterized in that: in described step (2), adopt described in the primer PPLtetO-1-cas9U with sequence shown in SEQ ID NO:2 and the primer PCas9D with sequence shown in SEQ ID NO:3 amplification cas9protein gene, obtains cas9amplified production;

Adopt described in the primer PPLtetO-1-KuU with sequence shown in SEQ ID NO:4 and the primer PkuD with sequence shown in SEQ ID NO:5 amplification kuprotein gene, obtains kuamplified production;

Adopt described in the primer PLtetO-1-ligDU with sequence shown in SEQ ID NO:6 and the primer PligDD with sequence shown in SEQ ID NO:7 amplification ligDprotein gene, obtains ligDamplified production.

5. the construction process of a kind of pCr-NHEJ carrier according to claim 3, it is characterized in that: in described step (6), the structure with the DNA fragmentation DBsaI of adjacent two inverted BsaI restriction enzyme sites is as follows:

First directly synthesis has the DNA sequence dna BsaIU of sequence shown in SEQ ID NO:8 and has the DNA sequence dna BsaID of sequence shown in SEQ ID NO:9, and wherein, the 3 ' end of BsaIU and the 5 ' end of BsaID have the overlap of 15nt; Wherein, BsaID contains tracrRNA sequence;

By in-fusion PCR, BsaIU and BsaID is coupled together; Then adopt and there is the primer PBsaIU of sequence shown in SEQ ID NO:10 and there is the primer PBsaID of sequence shown in SEQ ID NO:11, pcr amplification, namely obtain the DNA fragmentation DBsaI with adjacent two inverted BsaI restriction enzyme sites.

6. the construction process of a kind of pCr-NHEJ carrier according to claim 3, it is characterized in that: in described step (6), the structure with the DNA fragmentation DBsmAI of adjacent two inverted BsmAI restriction enzyme sites is as follows:

First directly synthesis has the DNA sequence dna BsmAIU of sequence shown in SEQ ID NO:12 and has the DNA sequence dna BsmAID of sequence shown in SEQ ID NO:13; Wherein, BsmAID contains tracrRNA sequence;

By in-fusion PCR, described DNA sequence dna BsmAIU and described DNA sequence dna BsmAID is coupled together; Then adopt and there is the primer PBsmAIU of sequence shown in SEQ ID NO:14 and there is the primer PBsmAID of sequence shown in SEQ ID NO:15, carry out pcr amplification, namely obtain the DNA fragmentation DBsmAI with adjacent two inverted BsmAI restriction enzyme sites.

7. the pCr-NHEJ carrier constructed by construction process of a kind of pCr-NHEJ carrier described in claim 3 to 6 any one is in the application of fixing a point to knock out in bacterial gene.