WO2014069823A1 - ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법 - Google Patents

ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법 Download PDF

Info

Publication number
WO2014069823A1
WO2014069823A1 PCT/KR2013/009311 KR2013009311W WO2014069823A1 WO 2014069823 A1 WO2014069823 A1 WO 2014069823A1 KR 2013009311 W KR2013009311 W KR 2013009311W WO 2014069823 A1 WO2014069823 A1 WO 2014069823A1
Authority
WO
WIPO (PCT)
Prior art keywords
frsa
strain
seq
gene
protein
Prior art date
Application number
PCT/KR2013/009311
Other languages
English (en)
French (fr)
Inventor
이경조
김유라
이정기
차선신
이규호
Original Assignee
서강대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020120129937A external-priority patent/KR101432072B1/ko
Application filed by 서강대학교 산학협력단 filed Critical 서강대학교 산학협력단
Priority to US14/439,317 priority Critical patent/US9567576B2/en
Publication of WO2014069823A1 publication Critical patent/WO2014069823A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/065—Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to an ethanol production strain expressing FrsA and an ethanol production method using the same.
  • the aspect of the process is largely directed to the conversion of biomass as a glucose source into a form that can be used in microorganisms, and to discover and improve enzymes involved in sugar metabolism for efficient ethanol production in cells. have.
  • ethanol is fermented with sugars such as hexose or pentose sugar using Saccharomyces cerevisiae , Zymomonas mobilis or Escherichia coli . Switch to
  • microorganisms are often genetically modified for efficient ethanol production, thereby expressing enzymes involved in the production of ethanol from outside.
  • Representative enzymes include pyruvate decarboxylase (PDC) and alcohol dehydrogenase (ADH), and pyruvate from Zymonas mobilis to convert pyruvate to ethanol when E. coli is used as host cell. Enzymes such as bait decarboxylase and alcohol dehydrogenase were used.
  • US Patent Publication No. 2009/0155871 discloses a nucleic acid construct comprising a photoreactive promoter, a PDC coding sequence from Zymonas mobilis and an ADH coding sequence and introducing it into a cyanobacterium. I disclose a method to produce,
  • Korean Unexamined Patent Publication No. 2011-0007981 discloses a novel alcohol dehydrogenase and a method of producing ethanol by introducing the same into a microorganism
  • Korean Unexamined Patent Publication No. 2011-0082141 discloses a method of producing ethanol by introducing PDC and ADH genes derived from Saccharomyces cerevisiae into a strain having reduced glycerol production capacity.
  • Vibrio bulnipicus-derived FrsA as a PDC to enhance the host ethanol production capacity has not been reported, there is a need to develop a new production strain.
  • Vibrio Bulnipicus frsA Provided are strains transformed with the gene or variants thereof.
  • the present application also discloses that the frsA gene is substituted with alanine for the wild-type FrsA amino acid sequence of SEQ ID NO: 2 or the amino acid sequence (SEQ ID NO: 6) in which the 131 th cysteine of the sequence is substituted with alanine, or the 131 th cysteine of the sequence It provides a strain that encodes the amino acid sequence of the sequence (SEQ ID NO: 8) having the amino acid residues 2 to 19th deleted based on the sequence of SEQ ID NO: 2.
  • the application also provides strains wherein said strain is a bacterium or yeast.
  • the present application also includes the strain E. coli, Corynebacterium glutamicum, Erwinia chrysanthemi, Zymomonas mobilis, Klebsiella spp, Bacillus stearothrermophilus, Kluveromyces spp., Pachysolen tanophilus, Lactic acid bacteria, Clostridium spp., Thermococcus Candi spda. , Saccharomyces eravisiae and Pichia stipitis .
  • the application also provides a strain wherein the strain is E. coli or Corynebacterium glutamicum .
  • the application provides a strain further transformed with an alcohol dehydrogenase gene.
  • the application also provides strains further transformed with the IIA Glc gene.
  • the present disclosure also provides a method for producing bioethanol using the strain.
  • the method herein comprises providing a microorganism expressing the FrsA herein; Contacting the microorganism with a carbon source; And it provides a bioethanol production method comprising the step of culturing the microorganism under fermentation conditions.
  • the present application also provides a method for producing bioethanol wherein the carbon source is at least one selected from the group consisting of starch, cellulose, hemi cellulose, pentose sugar, and hexose sugar.
  • the present application also provides a method for producing bioethanol wherein the carbon source is at least one selected from the group consisting of lactose, glucose, xylose, arabinose, galactose and mannose.
  • the present application also provides a production method, wherein the fermentation conditions are carried out through the control of oxygen or pH conditions.
  • the present application also provides a production method wherein the oxygen conditions are anaerobic or conditional anoxic conditions.
  • FrsA derived from Vibrio bulnipicus of the present application has high PDC enzyme activity against pyruvate, which is a substrate, and thus can be used for ethanol production.
  • overexpression of FrsA mutants with enhanced host intracellular stability with IIA Glc results in a higher ethanol production capacity of the host than with conventional PDCs derived from Zymomonas mobilis. More useful.
  • 1A is a graph showing the degradation activity of pyruvate using recombinant FrsA. Pyruvate (1 mM) was added to the reaction mixture in the presence of various concentrations of FrsA ranging from 0 to 50 nM. The concentration of pyruvate remaining after 5 minutes reaction was measured to represent the average value of the results of three replicate experiments.
  • FIG. 1B shows the results of experiments for the conversion of pyruvate to acetaldehyde by FrsA, pyruvate (5 mM) was added to 50 mM phosphate buffer D 2 O to react in the presence or absence of 2 ⁇ M FrsA and the reaction mixture.
  • Analysis by 1 H-NMR. [Abbreviation: A, acetaldehyde; AH, hydrated acetaldehyde; PYR, pyruvate; TMS, tetramethylsilane. Standard 1 H-NMR spectrum for acetaldehyde is in FIG. 4C]
  • 1C shows acetaldehyde and CO produced during pyruvate digestion of FrsA 2 Indicates the concentration of.
  • the acetaldehyde and CO 2 The concentration of was determined in a reaction mixture comprising 1 nM FrsA and pyruvate at various concentrations ranging from 0 to 1.0 mM.
  • Acetaldehyde and CO produced in each reaction mixture 2 Is Marked on the X and Y axes, respectively, followed by linear regression analysis.
  • 1D and 1E show the concentrations of pyruvate and acetaldehyde in bacteria comprising wild type and mutant frsA (cultivated in aerobic or anaerobic conditions in LBS-glucose medium), respectively, wherein the bacterium has a wide host range of vector pRK415. It includes. The amount of each compound used in the experiment was expressed as the average value and the standard deviation of the three experimental values. The asterisk is p -value ⁇ 0.0001 (Student t-test).
  • FIG. 3 is a graph showing the results of acetaldehyde production of wild type (black circle) and FrsA deletion mutant (white circle) Escherichia coli.
  • 4A is a 500 MHz 1 H-NMR spectrum of ⁇ -ketobutyrate and FrsA reaction mixture [abbreviated: KB, ⁇ -ketobutyrate; TMS, tetramethylsilane].
  • Figure 4b shows a 500MHz 1 H-NMR spectrum and the 1 H-NMR spectrum of a pure 500MHz acetaldehyde of ⁇ - toggle rate doubles with FrsA reaction mixture Ke [abbreviation: KG, - Kane toggle rutile rate; TMS, tetramethylsilane].
  • 4C shows a 500 MHz 1 H-NMR spectrum of pure acetaldehyde (abbreviations: A (acetaldehyde: 2.24 and 9.68 ppm) and HA (hydrated acetaldehyde: 1.33 and 5.25 ppm), HDO (heavy water)).
  • A acetaldehyde: 2.24 and 9.68 ppm
  • HA hydrated acetaldehyde: 1.33 and 5.25 ppm
  • HDO heavy water
  • Fig. 5 shows the result of aligning the amino acid sequence of FrsA of Vibrio bulnipicus and its ortholog.
  • Vibrio bulnipicus FrsA sequences were compared to GenBank's FrsA ortholog using the ClustalW program. Identical and similar amino acid residues are indicated with blue asterisks and green dots, respectively. Residues involved in the catalyst (R53, D203 and R272) are indicated in red. Amino acid residues were obtained from the NCBI database.
  • Vv Vibrio vulnificus ; NP_759330.1
  • Vp Vibrio parahaemolyticus ; EED26191
  • Vc Vibrio cholerae ; NP_231907)
  • Ec Escherichia coli ; AP_000892
  • Sf Shigella flexneri ; NP_706239
  • Se Salmonella enterica ; YP_001571692); And Yp ( Yersinia pestis ; AAM84545)].
  • FrsA 6 is an experimental result showing the pH dependence of the reaction catalyzed by FrsA.
  • Recombinant FrsA was measured using an enzyme kinetics alcohol dehydrogenase (ADH) assay kit in addition to the titrated reaction mixture at various ranges of pH 4-9.
  • ADH enzyme kinetics alcohol dehydrogenase
  • Figure 7a is introduced into E. coli K12 FrsA expression plasmids (pXMJ- pdc / adh , pXMJ- frsA / adh , pXMJ- frsA / crr / adh ) having a variety of gene constructs constructed in accordance with an embodiment of the present invention , It is a graph showing the ethanol production over time for each strain introduced plasmid.
  • Figure 7b is introduced into E. coli K12 FrsA expression plasmids (pXMJ- pdc / adh , pXMJ- frsA / adh , pXMJ- frsA / crr / adh ) having a variety of gene constructs constructed in accordance with an embodiment of the present invention
  • pH was adjusted by adding MES buffer during the cultivation of each plasmid introduced strain, ethanol production was increased.
  • FIG. 8A shows Corynebacterium glue of FrsA expression plasmids (pXMJ- pdc / adh , pXMJ- frsA / adh , pXMJ- frsA / crr / adh ) having various gene constructs constructed according to one embodiment of the present invention. It is a graph showing the ethanol production over time for each strain introduced into Tamicum and introduced into each plasmid.
  • FIG. 8D shows plasmids expressing FrsA [mt] mutant proteins having various gene constructs constructed in accordance with one embodiment of the present invention (pXMJ- pdc / adh , pXMJ- frsA [mt] / adh , pXMJ- frsA [ mt] / crr / adh ) was introduced into Corynebacterium glutamicum and a graph showing the ethanol production over time for each strain in which each plasmid was introduced.
  • FrsA Fermentation Respiration Switch
  • FrsA catalyzes the decarboxylation of pyruvate without catalysis and catalyzes it into acetaldehyde and carbon dioxide.
  • IIA Glc protein was found to increase the enzyme activity of FrsA.
  • FrsA and IIA Glc can be overexpressed in microorganisms to promote ethanol production of the host.
  • mutant FrsA and IIA Glc can be overexpressed in microorganisms to further promote the host's ethanol production ability.
  • the present disclosure provides the FrsA gene and protein.
  • FrsA genes and proteins include wild type and variants with biological equivalents. Variations at the nucleic acid level may or may not involve variations in amino acids, and when accompanied by variations at the amino acid level, various amino acid variants are included herein as long as they have biological equivalents.
  • the genes and proteins are from Vibrio bulnipicus.
  • the gene and protein may have the sequences of SEQ ID NOs: 1 and 2, respectively.
  • there is a substitution in the sequence of the SEQ ID NO but also includes sequence variants at the nucleic acid level and protein level having a biological equivalent.
  • the FrsA may have a mutated frsA gene sequence encoding a mutant protein in which the 131th amino acid of SEQ ID NO: 2 is substituted with alanine in cysteine, and the frsA in which the 131th amino acid is substituted with alanine in cysteine Gene and protein sequences are shown in SEQ ID NOs: 5 and 6, respectively.
  • the nucleic acid sequence encoding the protein of SEQ ID NO: 2 is represented by the sequence of SEQ ID NO: 1, but is not limited thereto, and variations of the nucleic acid sequence due to the presence of several codons encoding one amino acid are also provided herein. Included.
  • the present goes further From Vibrio Bulnipicus frsA Provided strains transformed with the gene.
  • said frsA The gene may be a sequence of SEQ ID NO: 1, a mutation encoding a mutant protein in which the 131th amino acid of SEQ ID NO: 2 is substituted for cysteine to alanine frsA May be a gene sequence.
  • the strain transformed with the frsA gene or its equivalent comprising the mutated frsA gene expresses the FrsA protein and can be expressed in excess or at a desired time by controlling expression as desired.
  • the strain may be further transformed with an alcohol dehydrogenas (ADH) gene and / or an IIA Glc gene for ethanol production.
  • ADH alcohol dehydrogenas
  • GenBank access numbers derived from Saccharomyces cerevisiae, NM_001183340, NM_001182812, NM_001181122 may be used, but are not limited to these.
  • IIA Glc Protein is crr It is known as a glucose-specific transporter encoded by the gene. It has the ability to bind to and regulate the activity of the target protein, one of which is FrsA characterized herein.
  • the inventor is IIA Glc It was found that the expression of FrsA in addition to can increase the enzymatic activity of FrsA by about twofold.
  • the IIA Glc Vibrio Bullipicus
  • the gene and protein sequences are represented by SEQ ID NOs: 3 and 4, respectively.
  • ADH and / or IIA Glc can be introduced and used in microorganisms to promote the activity of FrsA in the manner described above.
  • frsA gene herein is introduced into bacteria or yeast using various substrates including hexose, pentose and lactose as carbon sources as host microorganisms and can be used for the production of ethanol.
  • bacteria or yeast that can grow in anaerobic and facultative anaerobic environments can be used.
  • Anaerobicity can be developed in an environment without oxygen, and it is rather difficult to grow when oxygen is increased.
  • Conditional anaerobicity is also referred to as anaerobic anaerobic. .
  • anaerobic bacterium for example, Escherichia coli (Escherichia coli), Corynebacterium glutamicum, Erwinia chrysanthemi, Zymomonas mobilis, Klebsiella spp, Bactila stearmomorpho Bacillus stearothrermophilus, Kluveromyces spp., Pachysolen tanophilus, Lactobacillus, Clostridium spp., Candida shehatae, Saccharomyces as yeast Saccharomyces seravisiae, or Pichia stipitis may be used, but is not limited to these.
  • Archae may also be used, Euryarchaeota, Hyperthermophiles, Thermococcus spp. Or Pyrococcus spp., Thermococus onnurineus NA1 may be used.
  • Lactobacillus includes, for example, Streptococcus spp., Lactobacillus spp. And Lactococcus spp., Or Leuconostoc spp.
  • Microorganisms that can be used for ethanol production by introducing the FrsA of the present application must satisfy certain conditions in such items as temperature, pH range, alcohol resistance, osmo resistance, growth rate, yield, specificity, production efficiency, genetic stability, and inhibitor resistance.
  • Those skilled in the art will be able to select appropriate strains as desired.
  • S. cerevisiae, E. coli , Zymomonas mobilis are used.
  • Thermococcus onnurineus NA1 is used.
  • Corynebacterium glutamicum is used.
  • nucleotide sequences encoding FrsA can be obtained using routine methods in the art, such as PCR, and commonly used vectors such as pQE30, pGEM-T, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, Inserted into an expression vector such as pUC19 or pET, and then transformed into a suitable host cell comprising the microorganism described above. For ethanol production, these transgenic microorganisms can be overexpressed with FrsA protein.
  • the frsA gene herein may be incorporated into the genome of a bacterium or may be included in a plasmid and present independently of the genome. In one embodiment it is present in the genome for stable expression.
  • the frsA gene herein can also be introduced into bacteria in the form of operons.
  • the operon contains regulatory sequences for expression and regulation in the gene and cells of frsA . Regulatory sequences include promoters, inducers , operators and ribosomal binding sites. Examples of regulatory sequences included in such operons include, but are not limited to, those described in US Pat. No. 5,000,000.
  • the protein can be purified according to various purification methods known in the art. For example, crude extracts obtained by disrupting cultured transformed cells can be subjected to various chromatography to purify the FrsA protein.
  • the FrsA of the present invention has a similar Km value as compared with that of Zymomonas, which is a known PDC, but has about 8 times the Kcat and Kcat / km value, thereby having a very good catalytic efficiency. It can be evaluated as having. Compared to that of Saccharomyces cerevisiae, Kcat and Kcat / km values are about 19 times and about 110 times higher, respectively.
  • the present application also provides a method for producing a bioethanol, characterized by using a strain comprising the FrsA gene or a mutant gene according to the present application.
  • Bioethanol is ethanol produced through the sugar fermentation process using biomass as a kind of bioenergy.
  • FrsA or a variant thereof according to the present invention can produce ethanol with high efficiency through fermentation of sugars when introduced into a strain.
  • the strains used for the production of bioethanol herein may further comprise IIA Glc in addition to ADH, as mentioned above.
  • the method comprises providing a microorganism expressing FrsA according to the present disclosure; Contacting the microorganism with a carbon source; And it provides a bioethanol production method comprising the step of culturing the microorganism under fermentation conditions.
  • the medium used for the cultivation of the microorganisms for the production of bioethanol, the temperature conditions and the available carbon source, etc. depend on the type of microorganism used, and those skilled in the art will be able to easily select from those skilled in the art. For example, in the case of Escherichia coli, Peterson & Ingram et. al. Ann. N.Y. Acad. Sci. 1125: 36372 (2008).
  • the carbon source used in the present method is not particularly limited as long as it can produce bioethanol.
  • those derived from biomass can be used.
  • Biomass refers to live or recently dead plants that can be used for the manufacture of fuels and fuels.
  • Biomass consists of two types of carbohydrates and non-carbohydrates.
  • Carbohydrates are in turn a linear polymer composed of cellulose, i.e., ⁇ -1,4-linked glucose units, and hemicellulose, i.e., a ⁇ -1,4-linked xylose backbone, with branches of arabinose, galactose, mannose, and glucuronic acid. It can be classified into a composite branched polymer composed.
  • the non-hydrated material is lignin of a crosslinked phenylpropanoid structure.
  • Such biomass such as lignocellulosic, can be used in the methods herein and can be treated using known treatment methods, for example the methods described in WO2009 / 071996, before contacting the strains herein.
  • the present method may use, but is not limited to, glucose, xylose, arabinose, galactose and mannose which are present in the lactose and biomass as carbon sources.
  • the fermentation may be carried out through the control of oxygen or pH conditions.
  • the regulation of oxygen conditions ie anaerobic or facultaive anaerobic conditions and pH conditions, may vary depending on the type of microorganism for which the culture is intended, for example, by Appl Microbiol Biotechnol (2006) of Lin et al. Reference may be made to: 627642.
  • Culturable microorganisms in the anaerobic or conditions are, for example, S. Sherry Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), El Winiah Cri Sant hemi (Erwinia chrysanthemi), Eisai thigh eggplant Zymomonas mobilis, Klebsiella spp, Bacillus stearothrermophilus, Kluveromyces spp., Pachysolen tanophilus, Lactobacillus, Clostree Clostridium spp., Candida shehatae, yeast include Saccharomyces seravisiae, or Pichia stipitis.
  • any conventional method used for culturing the host may be used.
  • any method used for culturing ordinary microorganisms such as a batch type, a flow batch type, a continuous culture, or a reactor type can be used.
  • the amplified fragment was cleaved with KpnI and HindIII present at both ends thereof, and cloned into pQE30 (Qiagen), which is an expression vector, to obtain pQE- frsA .
  • E. coli JM109 Promega containing this expression vector was cultured in a medium containing 0.2 mM isopropylthio-D-galactoside, followed by Ni + -nitrilotriacetic acid affinity column and size exclusion chromatography. (Qiagen, USA) was used to purify the recombinant FrsA protein using the manufacturer's instructions.
  • E. col i For cloning of the E. coli FrsA, E. col i was amplified using primers specific for the to frsA sequence of K-12: ECFrsAexp-FB ( 5'- CG GGATCC ATGACACAGGCAAACCTGAG-3 '; underlined BamHI site) and ECFrsAexp-RH: 5′-CCC AAGCTT GCTATCTCCTGTTGTGATGC-3 ′; underlined HindIII site). E. coli FrsA was also purified using the Ni + -nitrilotriacetic acid affinity column and size exclusion chromatography following the procedure described above.
  • FrsA protein can be identified on the gel.
  • the FrsA protein prepared and purified above was subjected to gel filtration chromatography (Sigma) according to the manufacturer's instructions to apply the protein to a 10 mM sodium phosphate buffer containing 1 mM DTT and 300 mM NaCl. eluted at pH 8.0.
  • the expected molecular weight is 47 kDa, indicating that FrsA is present as a monomer in solution.
  • the two primers Crrexp-F (5'- CG GGATCC GACACAATGGGTCTGTTTGAC -3 '; underlined BamHI) and Crrexp-R (5'-AA CTGCAG TAGTAATTACTTAGTTACGCG -'3; underlined PstI ) was used to amplify the complete translation frame of the 522-bp crr gene encoding IIA Glc .
  • the amplified crr DNA was cut into BamHI and PstI sites located at both ends thereof and cloned into a pQE30 expression vector (Qiagen) to construct pQE- crr .
  • Phosphorylated recombinant IIA Glc protein and non-phosphorylated recombinant IIA Glc were overexpressed in a medium comprising 1.0 mM phosphoenolpyruvate or 1.0% glucose in E. coli JM109, respectively, and were subjected to Ni + -nitrilotriacetic acid affinity column. And size exclusion chromatography.
  • a mutation was introduced into the region of FrsA by the overlap extension (4) method using a primer comprising a sequence in which the amino acid sequence of 131th cysteine was substituted with alanine.
  • a primer comprising a sequence in which the amino acid sequence of 131th cysteine was substituted with alanine.
  • two sets of primers FrsAexp-FK / FrsA FrsA C131AR (5'-GTAACCTGCGATGCTGTAAGCCAAGGATGc-3 ') / FrsA C131AF (5'-GCATCCTTGGCTTACAGCATCGCAGGTTAC-3') were used.
  • secondary PCR was performed using FrsAexp-FK and FrsAexp-RH as primers, using two PCR products obtained as the primers as templates.
  • frsA DNA containing the mutation was digested with KpnI and HindIII and then ligated to pQE30, which was also cut with KpnI / HindIII to construct pQE- frsA C131A.
  • the sequence of the constructed plasmid was confirmed by sequencing.
  • frsA -up F (5'-AC ATGCAT GCAATAATCGTTTGCGCAGCTCGATACCC-3 '; underlined-SphI cleavage site) and frsA -up R (5'-GC TCTAGA TCGGCATGTATTGAGTCAATGCCGAGG -3 '; with the underlined XbaI cleavage site) was amplified 838bp DNA containing frsA upstream region by PCR. The fragment was then cloned into pBluescript SK II (+) (Promega) to give pSK frsA up.
  • a 1,118-bp DNA fragment containing the downstream region of the frsA gene was constructed using the same genome as the frsA -downF (5'-GC TCTAGA AGGGGATCCGGTCTCGCCATATTCGGA-3 '; underlined site XbaI cleavage site) and frsA -downR (5'- GGACTAGTATCCGCTCGAGTGAGCAACATTTGGCC-3 '; the underlined region SpeI cleavage site) was amplified by PCR with primers and cloned into the pSK frsA up to give the pSK frsA up / down.
  • SM10 pir strain (6) containing E. coli pDM4- frsA was conjugated with Vibrio bulnipicus MO624 / O30, and the conjugate completed was selected in thiosulphate citrate bile sucrose medium (7). Subsequently, selected colonies were identified by PCR using frsA -upF and frsA -downR as primers, and the frsA mutant was named SM201.
  • FrsA enzyme analysis was performed using a 50 mM sodium phosphate solution (pH 7.0) containing 1 mM disothritol and varying concentrations of pyruvate.
  • 2 mM NADH and 3.7 U of East Alcohol Dehydrogenase (ADH) (Sigma) were included in the FrsA reaction mixture (8).
  • Cell lysates of wild type E. coli and frsA mutant (9) were used in amounts of 0.005 to 1 mg.
  • the acetaldehyde reaction produced by the method described above was initiated by the addition of FrsA (1 nM), the reaction proceeded at 37 ° C.
  • the concentrations of pyruvate and acetaldehyde in the cell lysate or reaction mixture were measured using the pyruvate assay kit (BioVision) and acetaldehyde UV-method kit (Roche), respectively, as directed by the user.
  • the reaction mixture is further treated with a pigment (40 mg iodonitrotetrazolium chloride and 10 mg phenazene mesosulfate in 50 ml of 1.0% Tween 20 solution), followed by spectroscopy at 490 nm. It was measured photometrically (11).
  • a pigment 40 mg iodonitrotetrazolium chloride and 10 mg phenazene mesosulfate in 50 ml of 1.0% Tween 20 solution
  • PDC kinetics derived from yeast and Zymomonas was basically measured in the same manner as FrsA. That is, the ADH / NADH coupled analysis method as described above was used, and the reaction solution MES, pH 6.0, 5 mM MgCl 2 and 1 mM thiamine pyrophosphate was carried out at 25 °C conditions.
  • the enzyme is pretreated in a buffer of the following composition (0.1 M sodium citrate buffer, pH 6.0, 20 mM Mg 2+ , 1.5 mM thiamine pyrophosphate) before starting the reaction.
  • the reaction was started by addition of citrate buffer, pH 6.0, 21 ⁇ M MgSO 4 , 18 ⁇ M sodium pyruvate, 0.19 ⁇ M NADH, 3.7 U east alcohol dehydronase, and analysis was performed as above.
  • FrsA has a catabolic function for pyruvate.
  • the concentration of acetaldehyde of frsA- deficient mutants cultured under anaerobic conditions was about three times lower than that of wild type (FIG. 1E).
  • the frsA gene was added to a frsA deficient variant in a vector having a wide range of host adaptability, and the concentrations of pyruvate and acetaldehyde were restored to wild type levels (see FIGS. 1D and 1E). There was no difference between wild type and mutant in aerobic conditions, which is thought to be due to decreased expression of FrsA in oxygen-rich conditions.
  • FrsA catalyzes non-oxygen pyruvate decarboxylation and breaks it down into acetaldehyde and carbon dioxide.
  • FrsA is an efficient enzyme, and as shown in Table 1, the values of k cat and k cat / km are 1,372 11s -1 and 3,518 183s -1 mM -1, and the catalytic activity is high. 8 times higher compared to pyruvate dehydrogenase complex) and 17 times higher with IIA Glc addition (see Table 1).
  • the enzymatic activity of FrsA meets the physiological function of promoting fermentation.
  • Zaimomonas Mobilelis A genome extracted from ZM4 (ATCC) was used as a template, and two primers [ZmPDC FPstI
  • the amplified fragment was cleaved at the PstI and XbaI sites present at both ends thereof, and then cloned into the expression vector pXMJ19 to obtain pXMJ- frsA . Then, to clone pXMJ- frsA / crr , a genome extracted from Vibrio bulnipicus was used as a template, and two primers were used.
  • VvcrrFBamHI (5'-CTAG GGATCC AAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC-3 '; Underlined-BamHI cleavage) and VvcrrRKpnI (5'-GG) GGTACC GTAGTAATTACTTAGTTACGCGTAG-3 '; Underlined-KpnI cleavage site)
  • VvcrrFBamHI 5'-CTAG GGATCC AAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC-3 '; Underlined-BamHI cleavage
  • VvcrrRKpnI 5'-GG GGTACC GTAGTAATTACTTAGTTACGCGTAG-3 '; Underlined-KpnI cleavage site
  • Zaimomonas Mobilelis The genome extracted from ZM4 was used as a template, and two primers [ZmadhB FK (5'-GG) GGTACC AAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTCC-3 '; Underlined-KpnI cleavage site) and ZmadhB RE (5'-CG) GAATTC TTAGAAAGCGCTCAGGAAGAGTTC-3 '; Underlined-EcoRI cleavage site)] by PCR adhB 1,171-bp DNA fragments containing all coding sequences of the gene were amplified and cleaved at the KpnI and EcoRI sites at both ends of the gene, followed by pXMJ- frsA Of crr Cloning to plasmid and finally pXMJ- frsA Of crr Of adhB Plasmids were obtained.
  • the amplified fragments were then cleaved at the PstI and XbaI sites present at both ends and cloned into pXMJ19, an expression vector, to obtain pXMJ- frsA [mt]. Then, in order to clone pXMJ- frsA [mt] / crr , the genome extracted from Vibrio bulnipicus was used as a template, and two primers.
  • VvcrrFBamHI (5'-CTAG GGATCC AAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC -3 '; the underlined part - BamHI cleavage site) and VvcrrRKpnI (5'-GG GGTACC GTAGTAATTACTTAGTTACGCGTAG- 3'; the underlined part -KpnI cleavage site)] crr gene by PCR using the A 524-bp DNA fragment containing all coding sequences of was amplified.
  • This amplified fragment was cleaved at the BamHI and KpnI sites present at both ends and cloned into the pXMJ frsA [mt] plasmid to obtain pXMJ frsA [mt] / crr .
  • Zaimomonas Mobilelis The genome extracted from ZM4 was used as a template, and two primers [ZmadhB FK (5'-GG) GGTACC AAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTCC-3 '; Underlined-KpnI cleavage site) and ZmadhB RE (5'-CG) GAATTC TTAGAAAGCGCTCAGGAAGAGTTC-3 '; Underlined-EcoRI cleavage site)] by PCR adhB 1,171-bp DNA fragments containing all coding sequences of the gene were amplified and cleaved at the KpnI and EcoRI sites at both ends of the gene, followed by pXMJ- frsA [mt] / crr Cloning to the plasmid to the final pXMJ- frsA [mt] / crr Of adhB Plasmids were obtained.
  • E. coli K12 Esherichia coli K-12 F-prime factors, old and new.Bacteriological Reviews. 36 : 587-607 incorporating each of the plasmids constructed in Example 3-1 was prepared as a medium for ethanol production (LB, 10 % glucose) was incubated at 37, stationary. E. coli K12 was treated with a final 100 mM MES (2- (N-morpholino) ethanesulfonic acid) buffer at 0 and 12 hours to prevent a sharp drop in pH (100 mM MES, LB medium with 5% glucose). E. coli was incubated for 12 hours, and then 100 mM MES was added to increase the pH). 4 ⁇ g / ml chloramphenicol was added to all culture media.
  • FrsA of the present application is a new PDC enzyme that can replace the function of the PDC required in ethanol production, it can be seen that the ethanol production can be increased by adjusting the pH in the medium.
  • FIG. 8B shows the mutant FrsA [mt] from the 2nd to 19th amino acids from the amino terminus of the wild type FrsA protein and the 131th amino acid is substituted with alanine in cysteine.
  • FIG. 8C shows the results of SDS-PAGE comparing the stability of the FrsA [mt] mutant protein. As a result of comparing the amount of FrsA overexpressed in C. glutamicum , the stability of FrsA [mt] was increased.
  • Corynebacterium was constructed by constructing plasmids (pXMJ- pdc / adh , pXMJ- frsA [mt] / adh , pXMJ- frsA [mt] / crr / adh ) with various gene constructs expressing FrsA [mt] mutant proteins. It was introduced into glutamicum, and the ethanol production over time for each strain in which each plasmid was introduced in the same manner as in Example 3-2 was examined.
  • FrsA [mt] mutant protein has superior intracellular stability than wild type FrsA, and thus may be useful for ethanol production in strains.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본원은 FrsA 단백질을 발현하는 균주 및 이를 이용한 에탄올 생산방법에 관한 것이다. 본원의 FrsA는 기질인 파이루베이트에 대해 높은 PDC 효소 활성을 가지므로 에탄올 생산과정에 이용할 수 있다. 또한, 숙주 세포내 안정성을 증진시킨 FrsA 돌연변이를 IIAGlc와 함께 과발현할 경우, 기존의 자이모모나스 모빌리스 유래의 PDC를 이용한 경우보다 안정성 증가로 인해 에탄올 생산에 보다 효율적으로 사용할 수 있다.

Description

ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법
본 발명은 FrsA를 발현하는 에탄올 생산 균주 및 이를 이용한 에탄올 생산방법에 관한 것이다.
대부분의 나라에서 전적으로 수입에 의존해야만 하는 오일은 환경 문제와도 맞물려 대체 에너지원을 찾으려는 노력으로 이어져왔으며, 그 중 하나가 바로 미생물을 이용하여 바이오메스를 에탄올로 전환하는 것이다.
그러나, 미생물을 이용한 에탄올의 생산은 생산비용에 비해 생산효율은 낮아 보다 경제적인 공정으로의 개선이 필요하다. 상기 공정에 대한 측면은 크게 글루코스 공급원으로서의 바이오메스를 미생물에서 사용될 수 있는 형태로 전환하는 것과 더불어 세포내에서의 효율적인 에탄올 생산을 위해 당 대사에 관여하는 효소를 발굴하고 이를 개선하기 위한 방향으로 진행되고 있다.
미생물을 이용한 에탄올 생산 공정에서는 사카로마이세스 서레비시에 (Saccharomyces cerevisiae), 자이모모나스 모빌리스 (Zymomonas mobilis) 또는 대장균 (Escherichia coli) 등을 이용하여 육탄당 또는 오탄당과 같은 당을 발효하여 에탄올로 전환한다.
이러한 미생물은 효율적인 에탄올 생산을 위해 유전적으로 변형되는 경우가 많은데 이를 통해 외부에서 유래된, 에탄올 생산에 관여하는 효소를 발현하게 된다. 그 대표적인 효소로서 파이루베이트 데카르복실라제(PDC)와 알콜데하이드로지나제(ADH)가 있으며, 대장균을 숙주 세포로 이용할 경우 파이루베이트를 에탄올로 전환하기 위해 자이모모나스 모빌리스 유래의 파이루베이트 데카르복실라제 및 알콜 데하이드로지나제와 같은 효소가 이용되었다.
이들 효소는 세포내에서의 에탄올 생산효율을 높여서 전처리에 많은 비용이 드는 바이오메스의 사용량을 감소시킬 수 있다. 따라서, 이들 효소의 활성 개선은 어 전체 공정의 비용 감소에 있어 중요한 역할을 할 것이다.
이와 관련하여, US 공개특허공보 제2009/0155871호는 광 반응성 프로모터, 자이모모나스 모빌리스 유래의 PDC 코딩 서열 및 ADH 코딩서열을 포함하는 핵산 컨스트럭트 및 이를 시아노박테리움에 도입하여 에탄올을 생산하는 방법을 개시하고 있고,
대한민국 공개특허공보 제2011-0007981호는 신규한 알콜 탈수소효소 및 이를 미생물에 도입하여 에탄올을 생산하는 방법을 개시하고 있고,
대한민국 공개특허공보 제2011-0082141호는 글리세롤 생산능을 저감시킨 균주에 사카로마이세스 세레비지에 유래의 PDC 및 ADH 유전자를 도입하여 에탄올을 생산하는 방법을 개시하고 있다.
그러나, 본원발명과 같이 비브리오 불니피쿠스 유래의 FrsA를 PDC로 이용하여 숙주의 에탄올 생산능력을 증진시킨 예는 보고된 바 없으며, 새로운 생산 균주에 대한 개발 필요성이 있다.
본원의 목적은 당대사에 관여하는 FrsA의 생화학적 특성을 규명하고 이를 에탄올 생산에 사용하는 용도를 제공하는 것이다.
한 양태에서 본원은 비브리오 불니피쿠스 유래의 frsA 유전자 또는 그 변이체로 형질전환된 균주를 제공한다.
본원은 또한 frsA 유전자가, 서열번호 2의 야생형 FrsA 아미노산 서열 또는 상기 서열의 131번째의 시스테인이 알라닌으로 치환된 아미노산 서열 (서열번호 6), 또는 상기 서열의 131번째의 시스테인이 알라닌으로 치환되고, 서열번호 2의 서열을 기준으로 아미노산잔기 2 내지 19번째가 결실된 서열 (서열번호 8)의 아미노산 서열을 코딩하는 것인 균주를 제공한다.
본원은 또한 상기 균주가 박테리아 또는 효모인 균주를 제공한다.
본원은 또한, 상기 균주가 E.coli, Corynebacterium glutamicum, Erwinia chrysanthemi, Zymomonas mobilis, Klebsiella spp, Bacillus stearothrermophilus, Kluveromyces spp., Pachysolen tanophilus, Lactic acid bacteria, Clostridium spp., Thermococcus spp., Thermococcus onnurineus, Candida shehatae, Saccharomyces eravisiae 및 Pichia stipitis 로 구성되는 군으로부터 선택되는 균주를 제공한다.
본원은 또한 상기 균주가 E.coli 또는 Corynebacterium glutamicum인 균주를 제공한다.
본원은 알콜 데하이드로지나제 유전자로 추가로 형질전환된 균주를 제공한다.
본원은 또한 IIAGlc 유전자로 추가로 형질전환된 균주를 제공한다.
다른 양태에서 본원은 또한 상기 균주를 이용한 바이오에탄올 생산방법을 제공한다.
본원에서 상기 방법은 본원의 FrsA를 발현하는 미생물을 제공하는 단계; 상기 미생물을 탄소원과 접촉하는 단계; 및 상기 미생물을 발효 조건에서 배양하는 단계를 포함하는 바이오에탄올 생산방법을 제공한다.
본원은 또한 상기 탄소원이 녹말, 셀룰로스, 헤미 셀룰로스, 오탄당, 및 육탄당으로 구성되는 군으로부터 선택되는 하나 이상인 바이오에탄올 생산방법을 제공한다.
본원은 또한 상기 탄소원이 락토스, 글루코스, 자일로스, 아라비노스, 갈락토스 및 만노스로 구성되는 군으로부터 선택되는 하나 이상인 바이오에탄올 생산방법을 제공한다.
본원은 또한, 상기 발효 조건이 산소 또는 pH 조건의 조절을 통하여 수행되는, 생산방법을 제공한다.
본원은 또한, 상기 산소 조건이 혐기 또는 조건무산소 조건인 생산방법을 제공한다.
본원의 비브리오 불니피쿠스 유래의 FrsA는 기질인 파이루베이트에 대해 높은 PDC 효소 활성을 가지므로 에탄올 생산과정에 이용할 수 있다. 또한, 숙주 세포내 안정성을 증진시킨 FrsA 돌연변이를 IIAGlc와 함께 과발현할 경우, 기존의 자이모모나스 모빌리스 유래의 PDC를 이용한 경우보다, 숙주가 더 높은 에탄올 생산능력을 갖게 하므로, 바이오에탄올 생산에 더 유용하다.
도 1a은 재조합 FrsA를 이용한 파이루베이트의 분해 활성을 나타내는 그래프이다. 0 내지 50nM 범위의 다양한 농도의 FrsA의 존재 하에서 파이루베이트(1mM)를 반응 혼합물에 첨가하여 반응시켰다. 5분 반응 후 남아있는 파이루베이트의 농도를 측정하여 3회 반복 실험 결과의 평균값을 나타냈다.
도 1b는 FrsA에 의한 파이루베이트의 아세트알데하이드로의 전환 실험결과를 나타내는 것으로, 파이루베이트(5mM)를 50mM 포스페이트 완충 D2O에 첨가하여 2μM FrsA의 존재 또는 부재하에서 반응시키고 이 반응 혼합물을 1H-NMR로 분석하였다. [약어: A, 아세트알데하이드; AH, 수화된 아세트알데하이드; PYR, 파이루베이트; TMS, 테트라메틸실란. 아세트알데하이드에 대한 스탠다드 1H-NMR 스펙트럼은 도 4c에 있다]
도 1c는 FrsA의 파이루베이트 분해 과정에서 생성된 아세트알데하이드 및 CO2의 농도를 나타낸다. 상기 아세트알데하이드 및 CO2의 농도는 1nM FrsA 및 0 내지 1.0 mM 범위의 다양한 농도의 파이루베이트를 포함하는 반응혼합물에서 측정하였다. 각 반응 혼합물에서 생산된 아세트알데하이드 및 CO2는 각각 X축 및 Y 축에 표시하였으며, 이어서 선형회귀 분석을 하였다.
도 1d 및 도 1e는 야생형 및 돌연변이 frsA를 포함하는 박테리아(LBS-글루코스 배지에서 호기성 또는 혐기성 조건에서 배양)에서 각각 파이루베이트 및 아세트알데하이드의 농도를 나타내며, 상기 박테리아는 광범위한 숙주 범위를 갖는 벡터 pRK415를 포함한다. 실험에 사용한 각 화합물의 양은 3회 실험값의 평균값 및 표준편차로 나타냈다. 별표는 p-value < 0.0001 (Student t-test)이다.
도 2는 정제된 재조합 FrsA 단백질의 SDS-PAGE 분석 결과이다.
도 3은 야생형(검은색 원) 및 FrsA 결손 돌연변이(흰색 원) 대장균의 아세트알데하이드 생산 결과를 나타낸 그래프이다.
도 4a는 α-케토부티레이트와 FrsA 반응 혼합물의 500MHz 1H-NMR 스펙트럼이다 [약어: KB, α-케토부티레이트; TMS, 테트라메틸실란].
도 4b는 α-케토글루타레이트와 FrsA 반응 혼합물의 500MHz 1H-NMR 스펙트럼과 순수한 아세트알데하이드의 500MHz 1H-NMR 스펙트럼을 나타낸다 [약어: KG, -케토글루타레이트; TMS, 테트라메틸실란].
도 4c는 순수한 아세트알데하이드의 500MHz 1H-NMR 스펙트럼을 나타낸다[약어: A(아세트알데하이드: 2.24 및 9.68 ppm) 및 HA(수화아세트알데하이드: 1.33 및 5.25ppm), HDO (중수)].
도 5는 비브리오 불니피쿠스의 FrsA와 그 오솔로그(ortholog)의 아미노산 서열을 정렬한 결과이다. 비브리오 불니피쿠스의 FrsA 서열을 ClustalW 프로그램을 사용하여 GenBank의 FrsA 오솔로그와 비교하였다. 동일 및 유사한 아미노산 잔기는 각각 청색 별표 및 초록색 점으로 표시하였다. 촉매에 관여하는 잔기(R53, D203 및 R272)는 적색으로 표시하였다. 아미노산 잔기는 NCBI 데이터베이스에서 수득하였다[약어: V.v (Vibrio vulnificus; NP_759330.1); V.p (Vibrio parahaemolyticus; EED26191); V.c (Vibrio cholerae; NP_231907); E.c (Escherichia coli; AP_000892); S.f (Shigella flexneri; NP_706239); S.e (Salmonella enterica; YP_001571692); 및 Y.p (Yersinia pestis; AAM84545)].
도 6은 FrsA가 촉매하는 반응의 pH 의존성을 나타내는 실험결과이다. 재조합 FrsA를 pH 4 내지 9의 다양한 범위로 적정화된 반응 혼합물에 추가하여 효소 반응속도계수 알콜 데하이드로지나제(ADH) 분석 키트를 사용하여 측정하였다. 파이루베이트의 아세트알데하이드로의 전환과 관련된 k cat 및 k cat /K m 상응하는 pH 조건하에서 수행한 ADH 반응의 표준커브로 결정하였다.
도 7a는 본 발명의 일 실시예에 따라 구축된 다양한 유전자 컨스트럭트를 가지는 FrsA 발현 플라스미드(pXMJ-pdc/adh, pXMJ-frsA/adh, pXMJ-frsA/crr/adh)를 대장균 K12에 도입하고, 각 플라스미드가 도입된 균주 별 시간의 경과에 따른 에탄올 생산량을 나타내는 그래프이다.
도 7b는 본 발명의 일 실시예에 따라 구축된 다양한 유전자 컨스트럭트를 가지는 FrsA 발현 플라스미드(pXMJ-pdc/adh, pXMJ-frsA/adh, pXMJ-frsA/crr/adh)를 대장균 K12에 도입하고, 각 플라스미드가 도입된 균주의 배양 중 MES 버퍼를 첨가하여 pH를 조절한 경우, 에탄올 생산량이 증가되었음을 보여주는 그래프이다.
도 8a는 본 발명의 일 실시예에 따라 구축된 다양한 유전자 컨스트럭트를 가지는 FrsA 발현 플라스미드(pXMJ-pdc/adh, pXMJ-frsA/adh, pXMJ-frsA/crr/adh)를 코리네박테리움 글루타미쿰에 도입하고, 각 플라스미드가 도입된 균주 별 시간의 경과에 따른 에탄올 생산량을 나타낸 그래프이다.
도 8b는 야생형 FrsA와 FrsA[mt] 돌연변이 단백질의 아미노산 서열을 정렬한 결과로서, 돌연변이 FrsA[mt] 단백질은 야생형 FrsA 단백질의 아미노 말단으로부터 2번째 아미노산부터 19번째 아미노산까지가 결실되고, 131번째 아미노산이 시스테인에서 알라닌으로 치환된 것이다.
도 8c는 FrsA[mt] 돌연변이 단백질의 안정성이 비교 실험된 SDS-PAGE 결과로서, 돌연변이 FrsA[mt](frsA[mt]/adh, frsA[mt]/crr/adh,)를 제작하여 코리네박테리움 글루타미쿰 내에서 발현시킨 결과를 나타내는 전기영동 사진이다.
도 8d는 본 발명의 일 실시예에 따라 구축된 다양한 유전자 컨스트럭트를 가지는 FrsA[mt] 돌연변이 단백질을 발현하는 플라스미드(pXMJ-pdc/adh, pXMJ-frsA[mt]/adh, pXMJ-frsA[mt]/crr/adh)를 코리네박테리움 글루타미쿰에 도입하고, 각 플라스미드가 도입된 균주 별 시간의 경과에 따른 에탄올 생산량을 나타내는 그래프이다.
본원에서는 FrsA의 생화학적 기능을 규명하였다. 글루코스는 대사과정에서 파이루베이트로 이화되며, 파이루베이트를 기점으로 하여 호흡과 발효 과정으로 갈라진다. FrsA (Fermentation Respiration Switch) 단백질은 발효/호흡의 갈림길에서 그 방향을 결정하는 스위치 역할을 하며, 당대사를 발효 쪽으로 전환한다.
본원에서는 생화학적 실험을 통하여 FrsA가 코팩터의 도움없이 파이루베이트의 탈카르복실화 반응을 촉매하여 이를 아세트알데하이드와 이산화탄소로 이화한다는 것을 밝혔다. 또한 이 과정에서 IIAGlc 단백질이 FrsA의 효소활성을 증가시키는 것을 발견하였다.
또한, 본원에서는 FrsA와 IIAGlc를 미생물에서 과발현하여 숙주의 에탄올 생산능을 촉진시킬 수 있음을 규명하였다.
또한, 본원에서는 돌연변이 FrsA와 IIAGlc를 미생물에서 과발현하여 숙주의 에탄올 생산능을 더욱 촉진시킬 수 있음을 규명하였다.
이에, 한 양태에서 본원은 FrsA 유전자 및 단백질을 제공한다. FrsA 유전자 및 단백질은 야생형 및 이와 생물학적 동등성을 갖는 변이체를 포함한다. 핵산 수준에서의 변이는 아미노산의 변이를 수반하거나 수반하지 않을 수 있으며, 아미노산 수준에서 변이를 수반하는 경우, 생물학적 동등성을 갖는 한 다양한 아미노산 변이체가 본원에 포함된다. 한 구현예에서 상기 유전자 및 단백질은 비브리오 불니피쿠스 유래의 것이다. 다른 구현예에서 상기 유전자 및 단백질은 각각 서열번호 1 및 2의 서열을 가질 수 있다. 또한, 상기 서열번호의 서열에 치환이 있으나 생물학적 동등성을 갖는 핵산 수준 및 단백질 수준에서의 서열변이체도 포함하는 것이다. 한 구현예에서, 상기 FrsA는 서열번호 2의 서열 중 131번째 아미노산이 시스테인에서 알라닌으로 치환된 돌연변이 단백질을 코딩하는 돌연변이 frsA 유전자 서열을 가질 수 있으며, 상기 131번째 아미노산이 시스테인에서 알라닌으로 치환된 frsA 유전자 및 단백질 서열은 각각 서열번호 5 및 6으로 나타낸다.
한 구현예에서 상기 서열번호 2의 단백질을 코딩하는 핵산 서열은 서열번호 1의 서열로 표시하였으나, 이로 한정하는 것은 아니며, 하나의 아미노산을 코딩하는 여러 개의 코돈의 존재로 인한 핵산 서열의 변이도 본원에 포함된다.
본원은 나아가 비브리오 불니피쿠스 유래의 frsA 유전자로 형질전환된 균주를 제공한다. 한 구현예에서 상기 frsA 유전자는 서열번호 1의 서열일 수 있으며, 서열번호 2의 서열 중 131번째 아미노산이 시스테인에서 알라닌으로 치환된 돌연변이 단백질을 코딩하는 돌연변이 frsA 유전자 서열일 수 있다.
상기 frsA 유전자 또는 돌연변이 frsA 유전자를 포함하는 이의 등가물로 형질전환된 균주는 FrsA 단백질을 발현하며, 목적하는 바에 따라 발현을 조절하여 과량으로 또는 원하는 시기에 맞추어 발현하게 할 수 있다.
상기 균주는 에탄올 생산을 위해 알콜 데하이드로지나제 (Alcohol dehydrogenas, ADH) 유전자 및/또는 IIAGlc 유전자로 추가로 형질 전환될 수 있다.
ADH 유전자로는 다양한 기원의 것이 사용될 수 있다. 예를 들면 사카로마이세스 세레비지에 유래의 GenBank 접근번호, NM_001183340, NM_001182812, NM_001181122가 사용될 수 있으며 이들로 제한하는 것은 아니다.
IIAGlc 단백질은 crr 유전자에 의해 코딩되는 글루코스-특이적 수송자(glucose-specific transporter)로 알려져 있다. 이것은 타겟 단백질에 결합하여 그 타겟 단백질의 활성을 조절하는 능력이 있는데, 그 타겟 단백질의 하나가 본원에서 특성을 규명한 FrsA이다. 본 발명자는 IIAGlc를 FrsA외 추가로 발현하는 경우 FrsA의 효소활성을 약 2배로 증가시킬 수 있음을 알아내었다. 한 구현예에서 상기 IIAGlc는 비브리오 불니피쿠스 유래의 것으로 예를 들면 그 유전자 및 단백질 서열은 각각 서열번호 3 및 4로 표시된다.
ADH 및/또는 IIAGlc는 상술한 바와 같은 방식으로 FrsA의 활성을 촉진하기 위하여 미생물에 도입되어 사용될 수 있다.
본원의 frsA 유전자는 숙주 미생물로서, 육탄당, 오탄당 및 락토스를 포함하는 다양한 기질을 탄소원으로 이용하는 박테리아 또는 효모에 도입되어 에탄올의 생산에 사용될 수 있다.
상기 미생물로서는 혐기성(anaerobic) 및 조건무산소성(facultative anaerobic) 환경에서 자랄 수 있는 박테리아 또는 효모가 사용될 수 있다. 혐기성은 산소가 없는 환경에서 발육할 수 있으며, 산소가 증식하면 오히려 생육이 곤란해지는 성질을 가리키며,조건무산소성은 통성혐기성이라고도 하며, 산소 호흡을 주로 하지만 무산소 환경에서도 증식할 수 있는 균학적 성질을 가리킨다.
이와 같은 통성혐기성 균으로, 예를 들면, 에스쉐리키아 콜라이 (Escherichia coli), 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum), 에르위니아 크리산트헤미(Erwinia chrysanthemi), 자이모모나스 모빌리스 (Zymomonas mobilis), 클렙시엘라 (Klebsiella spp), 박실러스 스테아로써모필루스 (Bacillus stearothrermophilus), 클루베로마이세스 (Kluveromyces spp.), 파키솔렌 타노필루스 (Pachysolen tanophilus), 유산균, 클로스트리디움 (Clostridium spp.), 칸디다 세하테 (Candida shehatae), 효모균으로는 사카로마이세스 서레비시에 (Saccharomyces seravisiae), 또는 피키아 스티피티스 (Pichia stipitis)가 사용될 수 있으나 이들로 제한하는 것은 아니다.
또한 고세균 (Archaea)이 사용될 수 있으며, 유리알케오타 (Euryarchaeota), 하이퍼써모필(Hyperthermophiles), 써모코커스 (Thermococcus spp). 또는 파이로코커스 (Pyrococcus spp.), 써모코커스 온누리네우스 (Thermococcus onnurineus NA1)가 사용될 수 있다. 유산균은 예를 들면 스트렙토코커스 (Streptococcus spp.), 락토박실러스 (Lactobacillus spp.) 및 락토코커스 (Lactococcus spp.), 또는 류코노스탁(Leuconostoc spp.)를 포함한다.
본원의 FrsA가 도입되어 에탄올 생산에 사용할 수 있는 미생물은 온도, pH 범위, 알콜내성, 삼투내성, 생장속도, 생산량, 특이성, 생산효율, 유전적 안정성 및 억제제 내성과 같은 항목에서 특정 조건을 만족하여야 하며, 당업자라면 목적하는 바에 따라 적절한 균주를 선택할 수 있을 것이다. 한 구현예에서는 S. cerevisiae, E.coli, Zymomonas mobilis가 사용된다. 다른 구현예에서는 Thermococcus onnurineus NA1이 사용된다. 또 다른 구현예에서는 Corynebacterium glutamicum이 사용된다.
본원의 frsA 유전자를 미생물에 도입하기 위한 클로닝 벡터 및 이러한 벡터의 전달 방법은 당업계에 공지되어 있다. 예를 들어 FrsA를 코딩하는 뉴클레오티드 서열을 PCR과 같은 당업계의 통상적인 방법을 이용하여 획득하고 이를 통상적으로 이용되는 벡터, 예컨대 pQE30, pGEM-T, pSC101, ColE1,pBR322, pUC8/9, pHC79, pUC19 또는 pET와 같은 발현벡터에 삽입한 다음, 상술한 미생물을 포함하는 적합한 숙주 세포에 형질전환시킨다. 에탄올 생산을 위해서는 이들 형질전환 미생물에서 FrsA 단백질을 과량으로 발현시킬 수 있다.
본원의 frsA 유전자는 박테리아의 유전체에 혼입되어 존재하거나 또는 플라즈미드에 포함되어 유전체와 독립적으로 존재할 수 있다. 한 구현예에서는 안정적 발현을 위해 유전체에 혼입되어 존재한다.
본원의 frsA 유전자는 또한 오페론의 형태로 박테리아에 도입될 수 있다. 오페론은 frsA의 유전자 및 세포내에서의 발현 및 조절을 위해 조절서열을 포함하는 것으로, 조절서열은 프로모터, 인듀서, 오퍼레이터 및 라이보소말 결합부위를 포함한다. 이러한 오페론에 포함된 조절서열의 예로는 미국특허 제 5,000,000호에 기술된 것을 들 수 있으나 이로 제한하는 것은 아니다.
발현된 FrsA 단백질을 정제하여 인비트로에서 사용하는 경우, 단백질은 당업계에 공지된 다양한 정제 방법에 따라 정제할 수 있다. 예를 들어, 배양된 형질전환 세포를 파쇄하여 얻은 조추출물을 다양한 크로마토그래피에 적용하여 FrsA 단백질을 정제할 수 있다.
본원의 표 1에 기재된 바와 같이 본원의 FrsA는 기존의 알려진 PDC인 자이모모나스(Zymomonas) 유래의 것과 비교하여 유사한 Km값을 가지나, 약 8배의 Kcat 및 Kcat/km 값을 가져 매우 우수한 촉매효율을 갖는 것으로 평가할 수 있다. 사카로마이세스 세레비지에의 그것과 비교해서는 Kcat 및 Kcat/km 값이 각각 약 19배 및 약 110배 높다.
다른 양태에서 본원은 또한 본원에 따른 FrsA 유전자 또는 돌연변이 유전자를 포함하는 균주를 이용하는 것을 특징으로 하는 바이오에탄올 생산방법을 제공한다.
바이오에탄올은 바이오에너지의 한 종류로 바이오매스를 활용하여, 당 발효과정을 통하여 생산되는 에탄올이다. 본원에 따른 FrsA 또는 그 변이체는 균주에 도입시 당의 발효를 통해 에탄올을 고효율로 생산할 수 있다.
본원의 바이오에탄올 생산에 사용되는 균주는 앞서 언급한 바와 같이, ADH 이외에 IIAGlc를 추가로 포함할 수 있다. 상기 방법은 본원에 따른 FrsA를 발현하는 미생물을 제공하는 단계; 상기 미생물을 탄소원과 접촉하는 단계; 및 상기 미생물을 발효 조건에서 배양하는 단계를 포함하는 바이오에탄올 생산방법을 제공한다.
바이오에탄올의 생산을 위한 미생물의 배양에 사용되는 배지, 온도 조건 및 사용가능한 탄소원 등은 사용하는 미생물의 종류에 따라 달라지며, 당업자라면 당업계의 기술로부터 용이하게 선택할 수 있을 것이다. 예를 들면 대장균의 경우 Peterson & Ingram et. al. Ann. N.Y. Acad. Sci. 1125: 36372 (2008)를 참조할 수 있다.
본원의 FrsA를 발현하는 미생물, 즉 형질전환 균주에 대하여는 이미 언급한 바와 같다.
본원의 방법에 사용되는 탄소원으로서는 바이오에탄올을 생산할 수 있는 한, 크게 제한되는 것은 없다. 예를 들면 바이오매스 유래의 것이 사용될 수 있다. 바이오매 스는 연료 및 연료의 제조에 사용할 수 있는 살아있거나 최근에 죽은 식물을 의미한다.
바이오매스는 탄수화물과 비-탄수화물의 2가지로 구성되어 있다. 탄수화물은 다시 셀룰로스, 즉, β-1,4 결합된 글루코스 단위체로 구성된 선형 폴리머와 헤미셀룰로스, 즉, β-1,4 결합된 자일로스 주쇄와 아라비노스, 갈락토스, 만노스 및 글루쿠론산의 분지로 구성되는 복합 분지형 폴리머로 분류될 수 있다. 비탄수화물 물질은 가교된 페닐프로파노이드 구조의 리그닌이다. 이러한 리그노셀룰로스와 같은 바이오매스가 본원의 방법에 사용될 수 있으며, 본원의 균주와 접촉하기 전에 공지된 처리방법, 예를 들면 WO2009/071996에 기재된 방법을 사용하여 처리될 수 있다.
또한, 본원의 방법에는 탄소원으로서 락토스 및 바이오매스에 존재하는 주당인 글루코스, 자일로스, 아라비노스, 갈락토스 및 만노스가 사용될 수 있으나, 이로 제한하는 것은 아니다.
상기 발효는 산소 또는 pH 조건의 조절을 통하여 수행될 수 있다. 산소조건 의 조절 즉 혐기(anaerobic) 또는 조건무산소(facultaive anaerobic) 조건 및 pH 조건은 배양을 목적으로 하는 미생물의 종류에 따라 달라질 수 있으며, 예를 들면 Lin et al, 의 Appl Microbiol Biotechnol (2006) 69: 627642에 기재된 것을 참조할 수 있다.
상기 혐기 또는 조건무산소 조건에서 배양가능한 미생물은, 예를 들면, 에스쉐리키아 콜라이 (Escherichia coli), 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum), 에르위니아 크리산트헤미(Erwinia chrysanthemi), 자이모모나스 모빌리스 (Zymomonas mobilis), 클렙시엘라 (Klebsiella spp), 박실러스 스테아로써모필루스 (Bacillus stearothrermophilus), 클루베로마이세스 (Kluveromyces spp.), 파키솔렌 타노필루스 (Pachysolen tanophilus), 유산균, 클로스트리디움 (Clostridium spp.), 칸디다 세하테 (Candida shehatae), 효모균으로는 사카로마이세스 서레비시에 (Saccharomyces seravisiae), 또는 피키아 스티피티스 (Pichia stipitis)를 들 수 있다.
본 발명의 형질전환 균주를 배양하는 방법은 숙주의 배양에 사용되는 통상의 방법을 사용하면 된다. 또 배양방법은, 배치(batch)식, 유동배치식, 연속배양, 리액터형식 등 통상의 미생물의 배양에 사용하는 어떠한 방법도 사용할 수 있다.
이하, 본 발명의 이해를 돕기 위해서 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 본 발명의 범주가 하기의 실시예에 한정되는 것은 아니다.
실시예 1 단백질의 발현 및 정제
1-1 frsA 클로닝 및 정제
비브리오 불니피쿠스(3)로부터 추출한 유전체를 주형으로, 두 개의 프라이머 [FrsAexp-FK (5'- GGGGTACCCCGAATATGTCAGAAGAAGTCAGC-3'; 밑줄친 부분- KpnI 절단부위) 및 FrsAexp-RH (5'-CCCAAGCTTGTCACCTTAAGAGTTCATCTTCCAGC-3'; 밑줄 친 부분-HindIII 절단부위)]를 사용하여 frsA 유전자의 모든 코딩서열을 포함하는 PCR로 1,255-bp DNA 단편을 증폭하였다.
이어 증폭된 단편을 이의 양 말단에 존재하는 KpnI 및 HindIII로 절단한 후 발현벡터인 pQE30 (Qiagen)에 클로닝하여 pQE-frsA를 수득하였다. 이 발현벡터를 포함하는 E. coli JM109 (Promega)를 0.2 mM의 아이소프로필씨오--D-갈락토사이드를 포함하는 배지에서 배양한 후 Ni+-니트릴로트리아세트산 친화성 컬럼 및 크기배제 크로마토그래피(Qiagen, USA)를 제조자의 지시대로 사용하여 재조합 FrsA 단백질을 정제하였다.
대장균 FrsA의 클로닝의 경우, E. coli K-12의 frsA 서열에 특이적인 하기의 프라이머를 사용하여 증폭하였다: ECFrsAexp-FB (5'- CGGGATCCATGACACAGGCAAACCTGAG-3' ; 밑줄친 부분 BamHI 부위) 및 ECFrsAexp-RH: 5'-CCCAAGCTTGCTATCTCCTGTTGTGATGC-3' ;밑줄친 부분 HindIII 부위). E. coli FrsA도 상술한 바와 같은 과정을 거쳐 Ni+-니트릴로트리아세트산 친화성 컬럼 및 크기배제 크로마토그래피를 사용하여 정제하였다. 정제한 단백질은 소디움도세실설페이트-폴리아크릴아마이드 젤에서 전기영동하고 코마시브릴런트로 염색하였다. 도 2의 사진을 참고하면, 47 kDa의 FrsA 단백질을 젤 상에서 확인할 수 있다. FrsA 단백질이 다량체를 형성하는지 여부를 확인하기 위하여 상기에서 제조, 정제된 FrsA 단백질을 제조자의 지시대로 젤 여과 크로마토그래피(Sigma)에 적용하여 단백질을 1mM DTT 및 300mM NaCl을 포함하는 10mM 소디움포스페이트 완충액(pH 8.0)으로 용출하였다. 예상 분자량은 47 kDa이며, 이는 FrsA가 용액 중에서 단량체로 존재하는 것을 나타낸다.
1-2 IIAGlc 클로닝 및 정제
비브리오 불니피쿠스 유전체를 주형으로, 두 개의 프라이머 Crrexp-F (5'- CGGGATCCGACACAATGGGTCTGTTTGAC -3'; 밑줄친부분 BamHI) 및 Crrexp-R (5'-AACTGCAGTAGTAATTACTTAGTTACGCG -'3; 밑줄 친 부분 PstI)를 사용하여 IIAGlc를 코딩하는 522-bp의 crr 유전자의 완전한 해독틀을 증폭하였다. 증폭된 crr DNA를 그 양 말단에 위치한 BamHI 및 PstI 부위로 잘라 pQE30 발현벡터 (Qiagen)에 클로닝하여 pQE-crr를 구축하였다. 인산화된 재조합 IIAGlc 단백질 및 비인산화된 재조합 IIAGlc은 E. coli JM109 내에서 각각 1.0 mM 포스포에놀파이루베이트 또는 1.0% 글루코스를 포함하는 배지에서 과발현시키고 Ni+-니트릴로트리아세트산 친화성 컬럼 및 크기 배제 크로마토그래피를 사용하여 정제하였다.
1-3 FrsA의 부위특이적 돌연변이
서열번호 1의 아미노산 서열 131번째 시스테인이 알라닌으로 치환된 서열을 포함하는 프라이머를 사용하여 오버랩익스텐션(4) 방법으로 FrsA의 상기 부위에 돌연변이를 도입하였다. FrsA C131A 를 코딩하는 DNA를 증폭하기 위해, 두 세트의 프라이머 FrsAexp-FK/FrsA FrsA C131AR (5'-GTAACCTGCGATGCTGTAAGCCAAGGATGc-3')/ FrsA C131AF (5'-GCATCCTTGGCTTACAGCATCGCAGGTTAC-3')를 사용하였다. 이어서 상기 프라이머로 수득한 두 가지의 PCR 산물을 주형으로 사용하여 FrsAexp-FK 및 FrsAexp-RH를 프라이머로 하여 2차 PCR을 수행하였다. 돌연변이를 포함하는 수득한 frsA DNA를 KpnI와 HindIII로 절단한 후 역시 KpnI/HindIII로 자른 pQE30에 라이게이션하여 pQE-frsAC131A를 구축하였다. 구축된 플라스미드의 서열은 염기서열 분석으로 확인하였다.
1-4 frsA가 결손된 비브리오 불니피쿠스 돌연변이체 제조
비브리오 불니피쿠스 MO624/O30의 유전체를 주형으로, 두 개의 프라이머 [frsA-up F (5'-ACATGCATGCAATAATCGTTTGCGCAGCTCGATACCC-3'; 밑줄 친 부분- SphI 절단 부위) 및 frsA-up R (5'- GCTCTAGATCGGCATGTATTGAGTCAATGCCGAGG -3'; 밑줄 친 부분 XbaI 절단 부위)]를 사용하여 PCR로 frsA 업스트림 부위를 포함하는 838bp DNA를 증폭하였다. 이어 상기 단편을 pBluescript SK II(+)(Promega)에 클로닝하여 pSKfrsAup를 수득하였다.
frsA 유전자의 다운스트림 부위를 포함하는 1,118-bp DNA 단편을 위와 같은 유전체를 주형으로 frsA-downF (5'-GCTCTAGAAGGGGATCCGGTCTCGCCATATTCGGA-3'; 밑줄 친 부위 XbaI 절단 부위) 및 frsA-downR (5'- GGACTAGTATCCGCTCGAGTGAGCAACATTTGGCC-3'; 밑줄 친 부위 SpeI 절단 부위) 프라이머로 하여 PCR로 증폭한 후 pSKfrsAup에 클로닝하여 pSKfrsAup/down을 수득하였다. 이어 이를 SphI과 SpeI으로 절단하여 1,956-bp DNA 단편을 수이사이드(suicide) 벡터인 pDM4(5)에 클로닝하여 pDM4-frsA를 구축하였다. E. coli pDM4-frsA를 포함하는 SM10pir strain(6)를 비브리오 불니피쿠스 MO624/O30와 컨쥬케이트시키고, 컨쥬케이트 완료체는 씨오설페이트 사이트레이트 바일 수크로스 배지(7)에서 선별하였다. 이어 선별된 콜로니는 frsA-upF와 frsA-downR를 프라이머로 사용하여 PCR로 결실을 확인하였으며, frsA 돌연변이체는 SM201로 명명하였다.
실시예 2 FrsA의 생화학적 분석을 통한 특성 규명
2-1 반응속도 상수 측정
FrsA 효소 분석은 1 mM 디씨오쓰레이톨 및 다양한 농도의 파이루베이트를 포함하는 50mM 소디움 포스페이트 용액(pH 7.0)을 사용하여 수행하였다. 파이루베이트로부터 생산된 아세트알데하이드를 측정하기 위해, 2 mM NADH 및 3.7 U의 이스트 알콜 데하이드로지나제(ADH)(Sigma)를 FrsA 반응혼합물에 포함하였다 (8). 야생형 E.coli와 frsA 돌연변이체 (9)의 세포 융해물은 0.005 내지 1mg의 양으로 사용하였다. 상술한 방법으로 생산된 아세트알데하이드 반응은 FrsA (1nM)을 첨가하여 개시하였으며, 37℃에서 5분간 반응을 진행하고, 50mM 포타슘 하이드로젠 프탈레이트 완충액(pH3.0)을 첨가하여 반응을 종료하였다. 반응혼합물에 남아있는 잔여 NADH는 340nm에서 분광광도법으로 측정하였다. CO2 측정을 위해서, FrsA 효소 반응은 50 mM Tris-HCl 완충액 (pH 7.0)에서 수행하였다. 반응물 용액 중에 용해된 이산화탄소는 반응물 용액을 10mM 칼슘하이드록사이드로 처리한 후 분광광도법으로 정량하였다 (10). 세포 융해물 또는 반응 혼합물 중의 파이루베이트 및 아세트알데하이드의 농도는 각각 파이루베이트 분석 키트 (BioVision) 및 아세트알데하이드 UV-방법 키트 (Roche)를 사용자의 지시대로 사용하여 측정하였다. 아세트알데하이드 UV-방법 키트의 감도를 높이기 위해, 반응 혼합물을, 추가로 색소 (1.0% Tween 20 용액 50ml 중에 40 mg 아이오도니트로테트라졸리움 클로라이드 및 10mg 페나젠 메쏘설페이트)로 처리하고, 이어서 490nm에서 분광광도법으로 측정하였다 (11). 결과는 도 3 및 표 1에 기재되어 있다.
Km 및 Kcat 값은 다음과 같이 계산하였다. 각 기질 농도(S) 별로 1분간 얻은 흡광도 결과 값으로 부터 반응 산물 농도를 mM 단위로 계산한 후 기질 농도별 초기 반응속도(V0)를 각각 구하였다(이때 단위는 mM(product)/sec/mg(enzyme)). S와 V0에 역수를 취하여 얻은 값을 각각 X축과 Y축으로 하여 Linenweaver-Burk plot을 그린 후 linear regression으로 Y=aX+b의 수식을 얻었다 (이때 X절편의 역수가 Km이고, Y절편의 역수가 Vmax임). 계산된 Vmax (mM(product)/sec/mg(enzyme))에서 효소의 단위 무게를 mM 농도 값으로 바꾸어 계산하여 sec-1 단위의 Kcat을 계산하였다.
이스트 및 자이모모나스 유래의 PDC 반응속도는 기본적으로 FrsA와 동일하게 측정하였다. 즉, 상술한 바와 같은 ADH/NADH 커플드 분석 방법을 사용하였으며 반응액 MES, pH 6.0, 5 mM MgCl2 및 1 mM 티아민 파이로포스페이트에서 25℃ 조건으로 수행하였다. 자이모모나스의 경우 반응시작 전 효소를 다음과 같은 조성의 완충액(0.1 M 소듐 시트레이트 완충액, pH 6.0, 20 mM Mg2+, 1.5 mM 티아민 파이로포스페이트)에서 전처리한 후 반응액에 105 μmol 소듐 시트레이트 완충액, pH 6.0, 21 μM MgSO4, 18 μM 소듐 파이루베이트, 0.19 μM NADH, 3.7 U 이스트 알콜 데하이드로나제를 첨가하여 반응을 시작하였으며, 분석은 위와 동일하게 수행하였다.
2-3 NMR 분광법
5mM 파이루베이트, α-케토글루타레이트, 또는 α-케토부티레이트를 용액 (95% D2O 중에 50mM 소디움 포스페이트 및 1mM 디씨오쓰레이톨)에 첨가하였다. 이어 반응 혼합물을 2 μM FrsA의 존재 또는 부재하에서 20℃에서 90분간 반응하였다. 이어 반응 혼합물을 얼음에서 2시간 동안 둔 후, NMR 실험을 수행하였다. 분광은 Bruker DRX500 spectrometer를 사용하여 500MHz의 1H 공명진동수에서 측정하였다. 결과는 도 4에 나타나 있다.
2-4 FrsA 효소의 특성
A. FrsA의 파이루베이트 탈카르복실화반응 활성
파이루베이트를 포함하는 반응물에 실시예 1에서 제조한 FrsA를 첨가한 경우, 파이루베이트의 농도가 감소하였다 (도 1a 참조). 1H NMR 스펙트럼을 통해 이러한 파이루베이트 농도의 감소는 아세트알데하이드의 증가로 이어졌음을 규명하였다 (도 1b 참조). FrsA의 존재하에 다양한 농도의 파이루베이트를 포함하는 반응 혼합물 분석결과도 이와 일치하는 것으로 아세트알데하이드와 이산화탄소가 1:1 비로의 생성됨을 보여준다 (도 1c). FrsA에 포함된 오염물에 의한 결과를 배제하기 위해 실시예 1에서 제조한 frsA 결손 돌연변이체와 야생형 대장균의 파쇄물을 파이루베이트를 포함하는 용액에 추가한 결과 농도 의존적으로 아세트알데하이드가 증가한 야생형과 달리 돌연변이체에서는 아세트알데하이드가 검출되지 않았다 (도 3 참조). 이는 FrsA가 파이루베이트에 대한 이화 기능을 갖는다는 것을 입증하는 것이다.
B. 기질특이성
나아가 기질 특이성을 입증하기 위해 파이루베이트 이외에 다른 다양한 기질인 아세테이트, 락테이트, 옥살로아세테이트, α-케토글루타레이트, 및 α-케토부티레이트를 포함하는 반응물에서 위와 동일한 실험을 수행하였다. 그러나, NMR 결과 이러한 기질을 사용한 경우에는 이산화탄소가 생성되지 않았다 (도 4a, 도 4b 및 도 4c 참조).
C. 세포내에서의 활성
이어서 세포내에서의 FrsA의 활성을 확인하기 위하여, 글루코스의 존재하에서 배양한 비브리오 불니피쿠스의 세포내 파이루베이트의 농도와 실시예 1에서 제작한 frsA 결손 돌연변이체의 것을 비교한 결과, 혐기성 배양조건에서 후자의 파이루베이트 농도가 약 3배 더 높았다. 반면 호기성 조건에서의 농도는 두 경우가 유사하였다 (도 1d 참조). 이는 frsA의 결손이 발효대사 과정에서 파이루베이트 사용에 문제를 가져왔음을 의미한다. 아세트알데하이드의 농도 모니터링 결과도 위와 일치하였다. 즉, 혐기성 조건에서 배양한 frsA 결손 돌연변이체의 아세트알데하이드의 농도가 야생형과 비교하여 약 3배 낮았다 (도 1e). 그러나, 광범위한 숙주 적응성을 갖는 벡터에 frsA 유전자를 넣어 frsA 결손변이체에 전달한 결과, 파이루베이트와 아세트알데하이드의 농도가 야생형 수준으로 회복되었다 (도 1d 및 도 1e 참조). 호기성 조건에서는 야생형과 돌연변이체의 차이가 없었는데, 이는 산소가 풍부한 조건에서는 FrsA의 발현이 감소되었기 때문으로 생각된다.
이러한 결과는 FrsA가 비산소성 파이루베이트 탈카르복실화 반응(decarboxylation)을 촉매하여 이를 아세트알데하이드와 이산화탄소로 분해한다는 것을 나타낸다. 반응속도 분석에 의하면 FrsA는 효율이 좋은 효소로 표 1에 기재된 것과 같이 k cat 및 k cat/km의 값이 1,372 11s-1 및 3,518 183s-1mM-1로 높은 촉매 활성을 가지며 기존의 PDC (pyruvate dehydrogenase complex)와 비교시 약 8배가 높고, IIAGlc 첨가시 약 17배가 더 높다 (표 1 참조). 따라서 FrsA의 효소 활성은 발효를 촉진할 수 있는 생리적 기능을 충족한다.
[표 1]
Figure PCTKR2013009311-appb-I000001
실시예 3 FrsA 발현 플라스미드의 제조 및 이를 이용한 에탄올 생산
3-1 발현 플라스미드 구축
pXMJ- pdc / adhB 클로닝
자이모모나스 모빌리스 ZM4 (ATCC) 로부터 추출한 유전체를 주형으로,두 개의 프라이머 [ZmPDC FPstI
(5'-GATCCTGCAGAAAGGAGGACAACCATGAGTTATACTGTCGGTAC-3'; 밑줄 친 부분- PstI 절단 부위) 및 ZmPDC RXbaI (5'-GATCTCTAGACTAGAGGAGCTTGTTAACAG-3'; 밑줄 친 부분-XbaI 절단 부위)]를 사용하여 PCR 반응을 수행하여 pdc 유전자의 모든 코딩서열을 포함하는, 1,721-bp DNA 단편을 증폭하였다. 이어 증폭된 단편을 이의 양 말단에 존재하는 PstI 및 XbaI로 절단 한 후 발현벡터인 pXMJ19(M. Jakoby et al. 1999. Construction and application of new Corynebacterium glutamicum vectors. Biotechnology Techniques. 13:437441))에 클로닝하여 pXMJ-pdc를 수득하였다. 이후 pXMJ-pdc/adhB를 클로닝 하기 위하여 자이모모나스 모빌리스 ZM4로부터 추출한 유전체를 주형으로, 두 개의 프라이머 [ZmadhB FK (5'-GGGGTACCAAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTCC-3'; 밑줄친 부분- KpnI 절단 부위) 및 ZmadhB RE
(5'-CGGAATTCTTAGAAAGCGCTCAGGAAGAGTTC-3'; 밑줄 친 부분-EcoRI 절단 부위)]를 이용하여 PCR을 수행하여 adhB 유전자의 모든 코딩서열을 포함하는 1,171-bp DNA 단편을 증폭하였다. 증폭된 단편을 이의 양 말단에 존재하는 KpnI 및 EcoRI 부위에서 절단 후 pXMJ-pdc 플라스미드에 클로닝하여 pXMJ-pdc/adhB 를 수득하였다.
pXMJ- frsA / crr / adhB 클로닝
비브리오 불니피쿠스 (Wright, A. C., Simpson, L. M., Oliver, J. D. & Morris, J. G., Jr. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect Immun 58, 1769-73 (1990))로부터 추출한 유전체를 주형으로, 두 개의 프라이머 [VvfrsAFP(5'-AACTGCAGAAAGGAGGACAACCCCGAATATGTCAGAAGAAGTCAGC-3'; 밑줄 친 부분- pstI 절단 부위) 및 VvfrsA RX (5'-GCTCTAGAGATTTGTCACCTTAAGAGTTCATC-3'; 밑줄 친 부분-XbaI 절단부위)]를 사용하여 PCR로 frsA 유전자의 모든 코딩서열을 포함하는 1,264-bp DNA 단편을 증폭하였다. 이어 증폭된 단편을 이의 양 말단에 존재하는 PstI 및 XbaI 부위에서 절단한 후 발현벡터인 pXMJ19에 클로닝하여 pXMJ-frsA 를 수득하였다. 이후 pXMJ-frsA/crr을 클로닝하기 위하여 비브리오 불니피쿠스로부터 추출한 유전체를 주형으로, 두 개의 프라이머
[VvcrrFBamHI(5'-CTAGGGATCCAAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC-3'; 밑줄친 부분- BamHI 절단부위) 및 VvcrrRKpnI(5'-GGGGTACCGTAGTAATTACTTAGTTACGCGTAG-3'; 밑줄 친 부분-KpnI 절단 부위)]를 사용하여 PCR로 crr 유전자의 모든 코딩서열을 포함하는 524-bp DNA 단편을 증폭하였다. 이 증폭된 단편을 이의 양 말단에 존재하는 BamHI 및 KpnI 부위에서 절단한 후 pXMJ-frsA 플라스미드에 클로닝하여 pXMJ-frsA/crr을 수득하였다. 자이모모나스 모빌리스 ZM4로부터 추출한 유전체를 주형으로, 두 개의 프라이머 [ZmadhB FK (5'-GGGGTACCAAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTCC-3'; 밑줄친 부분- KpnI 절단 부위) 및 ZmadhB RE (5'-CGGAATTCTTAGAAAGCGCTCAGGAAGAGTTC-3'; 밑줄 친 부분-EcoRI 절단 부위)]를 사용하여 PCR로 adhB 유전자의 모든 코딩서열을 포함하는 1,171-bp DNA 단편을 증폭하고 이의 양 말단에 존재하는 KpnI 및 EcoRI 부위에서 절단한 후 pXMJ-frsA/crr 플라스미드에 클로닝하여 최종적으로 pXMJ-frsA/crr/adhB 플라스미드를 얻었다.
pXMJ- frsA [mt]/ crr / adhB 클로닝
실시예 1-3에서 제작된 131번째 시스테인이 알라닌으로 치환된 frsA가 클로닝된 pQE-frsAC131A 플라스미드를 주형으로, 두 개의 프라이머 [VvfrsA[mt] FP(5'-AACTGCAGAAAGGAGGACAACCTAGCTATGGCCATAGAAACCTCGGCATTG-3'; 밑줄 친 부분- pstI 절단 부위) 및 VvfrsA RX (5'-GCTCTAGAGATTTGTCACCTTAAGAGTTCATC-3'; 밑줄 친 부분-XbaI 절단 부위)]를 사용하여 PCR로 1,210-bp의 frsA DNA 단편을 증폭하였다. 이어 증폭된 단편을 이의 양 말단에 존재하는 PstI 및 XbaI 부위에서 절단한 후 발현벡터인 pXMJ19에 클로닝하여 pXMJ-frsA[mt]를 수득하였다. 이후 pXMJ-frsA[mt]/crr을 클로닝하기 위하여, 비브리오 불니피쿠스로부터 추출한 유전체를 주형으로, 두 개의 프라이머
[VvcrrFBamHI (5'-CTAGGGATCCAAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC-3'; 밑줄 친 부분- BamHI 절단 부위) 및 VvcrrRKpnI (5'-GGGGTACCGTAGTAATTACTTAGTTACGCGTAG-3'; 밑줄 친 부분-KpnI 절단 부위)]를 사용하여 PCR로 crr 유전자의 모든 코딩서열을 포함하는 524-bp DNA 단편을 증폭하였다. 이 증폭된 단편을 이의 양 말단에 존재하는 BamHI 및 KpnI 부위에서 절단한 후 pXMJ-frsA[mt] 플라스미드에 클로닝하여 pXMJ-frsA[mt]/crr을 수득하였다.
자이모모나스 모빌리스 ZM4로부터 추출한 유전체를 주형으로, 두 개의 프라이머 [ZmadhB FK (5'-GGGGTACCAAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTCC-3'; 밑줄 친 부분- KpnI 절단 부위) 및 ZmadhB RE (5'-CGGAATTCTTAGAAAGCGCTCAGGAAGAGTTC-3'; 밑줄 친 부분-EcoRI 절단 부위)]를 사용하여 PCR로 adhB 유전자의 모든 코딩서열을 포함하는 1,171-bp DNA 단편을 증폭하고 이의 양 말단에 존재하는 KpnI 및 EcoRI 부위에서 절단한 후 pXMJ-frsA[mt]/crr 플라스미드에 클로닝하여 최종 pXMJ-frsA[mt]/crr/adhB 플라스미드를 얻었다.
3-2 대장균을 이용한 에탄올 생산
대장균 내 FrsA/IIA Glc 과발현
실시예 3-1에서 구축한 각 플라스미드를 도입한 E. coli K12(Escherichia coli K-12 F-prime factors, old and new. Bacteriological Reviews. 36:587-607)를 에탄올 생산용 배지 (LB, 10% glucose)에서 37, 정치상태로 배양하였다. E. coli K12는 pH의 급격한 저하를 막기 위해 0시간과 12시간일 때 최종 100mM의 MES (2-(N-morpholino)ethanesulfonic acid) 완충액으로 처리하였다(100mM MES, 5% 글루코스가 첨가된 LB배지에 대장균을 12시간 배양 후 100mM의 MES를 추가로 첨가하여 pH를 높여주었다). 모든 배양배지에는 4μg/ml의 클로람페니콜이 첨가되었다.
한편, 배지 내 에탄올 생산량을 분석하기 위하여, 시간별로 채취한 배양 샘플에서 균을 제거한 상등액을 얻어 다음과 같이 ADH 분석을 수행하였다. 구체적으로, 990μl의 ADH 반응 완충액 (glycine 500mM, hydrazine sulfate 75mM, sodium pyrophosphate tetrabasic 75mM, 3.7 unit ADH, 5mM NAD+, pH 9.0)에 10μl의 시료를 섞어준 후 37℃에서 30분간 반응시킨 뒤 반응으로 생성된 NADH를 340nm에서 분광광도법으로 측정하여 얻어진 값을 에탄올 검량선에 대입하여 각 시료의 에탄올 농도를 계산하였다. 상기 결과를 도 7a에 나타내었다.
그 결과, 대장균 내에서 FrsA를 과발현시(pXMJ-frsA/adh) 에탄올 생산량에 변화가 없었으며, FrsA와 IIAGlc를 과발현시킬 경우(pXMJ-frsA/crr/adh) 에탄올 생산량은 대조군 대비 310% 증가하였다. FrsA/IIAGlc의 과발현(pXMJ-frsA/crr/adh)에 의한 에탄올 생산량은 파이루베이트 디카르복실라아제(PDC)가 과발현된 경우(pXMJ-pdc/adh)의 에탄올 생산량 대비 42%로 나타났다.
배지 내 pH 조절을 통한 에탄올 생산의 증진
FrsA/IIAGlc의 과발현(pXMJ-frsA/crr/adh)에 의한 에탄올 생산량은 MES 완충액 첨가를 통하여 배지 내 pH를 조절할 경우, pH를 조절하지 않는 조건에 비해 254% 증가하였다. 또한, 이때의 생산량은 pH 조절시 대조군 대비 138% 증가한 것이며, PDC 과발현(pXMJ-pdc/adh)의 에탄올 생산량 대비 40%이다(도 7b).
이 같은 결과로부터 본원의 FrsA는 에탄올 생산에서 필요한 PDC의 기능을 대체할 수 있는 새로운 PDC 효소이며, 배지 내 pH 조절을 통해 에탄올 생산량을 증가시킬 수 있음을 알 수 있다.
3-3 코리네박테리움 글루타미쿰을 이용한 에탄올 생산
코리네박테리움 글루타미쿰 내 FrsA/IIA Glc 과발현을 이용한 에탄올 생산
3-1에서 구축한 각 플라스미드를 도입한 Corynebacterium glutamicum ATCC 13032를 에탄올 생산용 배지 (LB, 10% glucose)에서 30℃ 100rpm 진탕 조건으로 배양하였다. 모든 배양배지에는 10μg/ml의 클로람페니콜이 첨가되었다. 한편, 배지 내 에탄올 생산량을 분석하기 위하여, 시간별로 채취한 배양 샘플에서 균을 제거한 상등액을 얻어 3-2에서와 동일한 방법으로 ADH 분석을 수행하였다. 그 결과를 도 8a에 나타내었다.
그 결과, 박테리아 내 FrsA 과발현시(pXMJ-frsA/adh)에는 대조군과 비교하여 에탄올 생산량에 변화가 없으며, FrsA/IIAGlc의 과발현시(pXMJ-frsA/crr/adh)에는 대조군 대비 312% (108h 기준 496%) 증가하였다.
FrsA[mt] 돌연변이를 이용한 에탄올 생산
실시예 3-1에서와 같이 숙주세포 내 안정성을 증진시키기 위한 돌연변이 FrsA[mt]를 제작하였다. 도 8b에 나타난 바와 같이, 돌연변이 FrsA[mt]는 야생형 FrsA 단백질의 아미노말단으로부터 2번째에서 19번째 아미노산이 결실되었고 131번째 아미노산이 시스테인에서 알라닌으로 치환된 것이다. 도 8c는 FrsA[mt] 돌연변이 단백질의 안정성이 비교실험된 SDS-PAGE 결과로서, C. glutamicum 내 과발현시킨 FrsA 양을 비교한 결과 FrsA[mt]의 안정성이 증가함이 관찰되었다.
FrsA[mt] 돌연변이 단백질 발현하는 다양한 유전자 컨스트럭트를 가지는 플라스미드(pXMJ-pdc/adh, pXMJ-frsA[mt]/adh, pXMJ-frsA[mt]/crr/adh)를 구축하여 코리네박테리움 글루타미쿰에 도입하고, 실시예 3-2에서와 같은 방법으로 각 플라스미드가 도입된 균주 별 시간의 경과에 따른 에탄올 생산량을 살펴보았다.
도 8d를 참고하면, FrsA[mt]/IIAGlc의 과발현(pXMJ-frsA[mt]/crr/adh)에 의한 에탄올 생산량은 대조군 대비 985% (108h 기준 949%) 증가한 양이며, 또한 야생형 FrsA/IIAGlc의 과발현시(미도시)의 211% (108h 기준 191%) 증가한 양이다. PDC 과발현시(pXMJ-pdc/adh)와 비교해서는 169% (108h 기준 89.79%) 증가하였다.
따라서, FrsA를 이용하여 에탄올을 생산할 경우 코리네박테리움 글루타미쿰을 숙주세포로 유용하게 이용할 수 있다. 또한, FrsA[mt] 돌연변이 단백질은 야생형 FrsA보다 세포내 안정성이 우수하여 균주에서 에탄올 생산에 유용하게 사용될 수 있다.
<참조문헌>
1. LIN, Y. & S. TANAKA. Ethanol fermentation from biomass resources: current state and prospects. Appl. Microbiol.Biotechnol. 69: 62742 (2006).
2. DIEN, B.S., M.A.COTTA & T.W. JEFFRIES. Bacteria engineered for fuel ethanol production: current status. Appl.Microbiol. Biotechnol. 63: 25866 (2003).
3. Wright, A. C., Simpson, L. M., Oliver, J. D. & Morris, J. G., Jr. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect Immun 58, 1769-73 (1990).
4. Sambrook, J. & Russell, D.W. Molecular cloning: a laboratory manual, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001).
5. Anand, Rishi D. et al. Restriction digestion monitors facilitate plasmid construction and PCR cloning. BioTechniques 36:982-985 (2004).
6. Simon, R., Priefer, U. & Puhler, A. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat Biotechnol 1, 784-791 (1983).
7. Park, K.J. et al. Isolation and characterization of rpoS from a pathogenic bacterium, Vibrio vulnificus: role of S in survival of exponential-phase cells under oxidative stress. J Bacteriol 186, 3304-12 (2004).
8. Ullrich, J. Yeast pyruvate decarboxylase (2-oxoacid acrboxylase, EC 4.1.1.1) assay of thiamine pyrophosphate. Methods Enzymol. 18, 109-115 (1970).
9. Koo, B.M. et al. A novel fermentation/respiration switch protein regulated by enzyme IIAGlc in Escherichia coli. J Biol Chem 279, 31613-21 (2004).
10. Gu, W., Bousfield, D.W. & Tripp, C.P. Formation of calcium carbonate particles by direct contact of Ca(OH)2 powders with supercritical CO2. J Mater Chem 16, 3312-3317 (2006).
11. Hinman, L.M. & Blass, J.P. An NADH-linked spectrophotometric assay for pyruvate dehydrogenase complex in crude tissue homogenates. J Biol Chem 256, 6583-6 (1981).
12. Stephenson, M.P. & Dawes, E.A. Pyruvic acid and formic acid metabolism in Sarcina ventriculi and the role of ferredoxin. J Gen Microbiol 69, 331-43 (1971).
13. Erecinska, M. & Silver, I.A. Tissue oxygen tension and brain sensitivity to hypoxia. Respir Physiol 128, 263-76 (2001).

Claims (17)

  1. frsA 유전자로 형질전환된 균주.
  2. 제 1 항에 있어서, 상기 frsA 유전자가 서열번호 1, 서열번호 5 또는 서열번호 7 의 서열인 균주.
  3. 제 2 항에 있어서, 상기 균주는 에스쉐리키아 콜라이 (Escherichia coli), 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum), 에르위니아 크리산트헤미(Erwinia chrysanthemi), 자이모모나스 모빌리스 (Zymomonas mobilis), 클렙시엘라 (Klebsiella spp), 박실러스 스테아로써모필루스 (Bacillus stearothrermophilus), 클루베로마이세스 (Kluveromyces spp.), 파키솔렌 타노필루스 (Pachysolen tanophilus), 유산균, 클로스트리디움 (Clostridium spp.), 칸디다 세하테 (Candida shehatae), 효모균으로는 사카로마이세스 서레비시에 (Saccharomyces seravisiae), 또는 피키아 스티피티스 (Pichia stipitis)로 구성되는 군으로부터 선택되는 것인 균주.
  4. 제 3 항에 있어서, 상기 균주는 에스쉐리키아 콜라이 또는 코코리네박테리움 글루타미쿰인, 균주.
  5. 제 1 항에 있어서, 상기 균주는 알콜 데하이드로지나제 유전자로 추가로 형질전환된 균주.
  6. 제 1 항 내지 제 5 항 중 어느 한 항에 있어서, 상기 균주는 IIAGlc 유전자로 추가로 형질전환된 균주.
  7. 제 6 항에 있어서, 상기 IIAGlc 유전자는 서열번호 3의 서열을 가지는 것인, 균주.
  8. 서열번호 2의 서열을 기준으로 131번째 아미노산이 시스테인에서 알라닌으로 치환되거나, 또는 서열번호 2의 서열을 기준으로 2번째부터 19번째 아미노산이 결실되고 131번째 아미노산이 시스테인에서 알라닌으로 치환된, FrsA 단백질.
  9. 제 8 항에 따른 상기 각 단백질을 코딩하는 폴리뉴클레오타이드.
  10. 제 9 항에 있어서, 상기 각 단백질을 코딩하는 폴리뉴클레오타이드는 각각 서열번호 5 및 서열번호 7의 서열을 갖는 폴리뉴클레오타이드.
  11. 제 9 항에 따른 폴리뉴클레오타이드를 포함하는 벡터.
  12. 제 11 항에 따른 벡터를 포함하는 균주.
  13. 제 1 항 내지 제 6 항 중 어느 한 항 또는 제 12 항에 따른 균주를 이용하는 것을 특징으로하는, 바이오에탄올 생산방법.
  14. 제 13 항에 있어서, 상기 방법은 상기 미생물을 탄소원과 접촉하는 단계 및
    상기 미생물을 발효 조건에서 배양하는 단계를 포함하는, 바이오에탄올 생산방법.
  15. 제 13 항에 있어서 상기 탄소원은 녹말, 셀룰로스, 헤미 셀룰로스, 오탄당 및 육탄당으로 구성되는 군으로부터 선택되는 하나 이상인, 생산방법.
  16. 제 13 항에 있어서, 상기 탄소원은 락토스, 글루코스, 자일로스, 아라비노스, 갈락토스 및 만노스로 구성되는 군으로부터 선택되는 하나 이상인, 생산방법.
  17. 제 13 항에 있어서, 상기 균주는 대장균 또는 코리네박테리움 글루타미쿰인, 생산방법.
PCT/KR2013/009311 2012-10-29 2013-10-18 ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법 WO2014069823A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/439,317 US9567576B2 (en) 2012-10-29 2013-10-18 Strain expressing FRSA and method for producing ethanol using same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2012-0120128 2012-10-29
KR20120120128 2012-10-29
KR10-2012-0129937 2012-11-16
KR1020120129937A KR101432072B1 (ko) 2012-10-29 2012-11-16 FrsA를 발현하는 균주 및 이를 이용한 에탄올 생산방법

Publications (1)

Publication Number Publication Date
WO2014069823A1 true WO2014069823A1 (ko) 2014-05-08

Family

ID=50627670

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/009311 WO2014069823A1 (ko) 2012-10-29 2013-10-18 ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법

Country Status (1)

Country Link
WO (1) WO2014069823A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110007980A (ko) * 2009-07-17 2011-01-25 한국생명공학연구원 신규 알콜 탈수소효소 ＨｐＡＤＨ３ 및 이를 이용한 바이오에탄올의 제조 방법
KR20120126827A (ko) * 2011-05-13 2012-11-21 한국외국어대학교 연구산학협력단 ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110007980A (ko) * 2009-07-17 2011-01-25 한국생명공학연구원 신규 알콜 탈수소효소 ＨｐＡＤＨ３ 및 이를 이용한 바이오에탄올의 제조 방법
KR20120126827A (ko) * 2011-05-13 2012-11-21 한국외국어대학교 연구산학협력단 ＦｒｓＡ를 발현하는 균주 및 이를 이용한 에탄올 생산방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 11 July 2010 (2010-07-11), accession no. M172799 *
KOO, B.-M. ET AL.: "A Novel Fermentation/Respiration Switch Protein Regulated by Enzyme IIAGIc in Escherichia coli.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 30, 2004, pages 31613 - 31621 *
LEE, K.-J. ET AL.: "FrsA functions as a cofactor-independent decarboxylase to control metabolic flux.", NATURE CHEMICAL BIOLOGY., vol. 7, July 2011 (2011-07-01), pages 434 - 436 *

Similar Documents

Publication Publication Date Title
Ren et al. Identification and inactivation of pleiotropic regulator CcpA to eliminate glucose repression of xylose utilization in Clostridium acetobutylicum
Nichols et al. Use of catabolite repression mutants for fermentation of sugar mixtures to ethanol
Kuit et al. Disruption of the acetate kinase (ack) gene of Clostridium acetobutylicum results in delayed acetate production
US5602030A (en) Recombinant glucose uptake system
WO2012099396A2 (en) A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2009125924A2 (ko) 퓨트레신 고생성능을 가지는 변이 미생물 및 이를 이용한 퓨트레신의 제조방법
WO2013105800A2 (ko) L-트립토판 생산능이 강화된 에스케리키아속 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
WO2012018226A2 (ko) 카다베린 고생성능을 가지는 변이 미생물 및 이를 이용한 카다베린의 제조방법
Bertram et al. Tn 916-induced mutants of Clostridium acetobutylicum defective in regulation of solvent formation
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
JP2013505739A (ja) 乳酸菌におけるアセト乳酸誘導生成物への改善されたフラックス
WO2014003439A1 (ko) 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
WO2015186990A1 (ko) O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법
WO2020075986A2 (ko) 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2012046924A1 (ko) 아라비노스 대사경로가 도입된 자일리톨 생산균주 및 이를 이용한 자일리톨 생산방법
US20150376654A1 (en) Recombinant microorganisms with increased tolerance to ethanol
WO2014148754A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2015163682A1 (ko) 2，3－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2，3－부탄디올의 생산 방법
WO2015178586A1 (ko) 세포내 에너지 수준이 향상된 미생물 및 이를 이용하여 l-아미노산을 생산하는 방법
EP3824089A1 (en) Nucleic acid molecules comprising a variant rpoc coding sequence
FI111552B (fi) Menetelmä rekombinanttisen isäntäsolukannan tuottamiseksi ja näin saatu rekombinanttinen isäntäsolu
CN106164252B (zh) 用于琥珀酸产生的改进微生物
US20100047861A1 (en) Process for producing useful substance

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13850982

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14439317

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 13850982

Country of ref document: EP

Kind code of ref document: A1