WO2014060383A1 - Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae. - Google Patents
Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae. Download PDFInfo
- Publication number
- WO2014060383A1 WO2014060383A1 PCT/EP2013/071472 EP2013071472W WO2014060383A1 WO 2014060383 A1 WO2014060383 A1 WO 2014060383A1 EP 2013071472 W EP2013071472 W EP 2013071472W WO 2014060383 A1 WO2014060383 A1 WO 2014060383A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- protein
- immunogenic composition
- conjugated
- saccharide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
- A61K39/092—Streptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/05—Actinobacteria, e.g. Actinomyces, Streptomyces, Nocardia, Bifidobacterium, Gardnerella, Corynebacterium; Propionibacterium
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/08—Clostridium, e.g. Clostridium tetani
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/099—Bordetella
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/102—Pasteurellales, e.g. Actinobacillus, Pasteurella; Haemophilus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/16—Otologicals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5252—Virus inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/543—Mucosal route intranasal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55505—Inorganic adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55544—Bacterial toxins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55566—Emulsions, e.g. Freund's adjuvant, MF59
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6037—Bacterial toxins, e.g. diphteria toxoid [DT], tetanus toxoid [TT]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
- C07K14/3156—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32611—Poliovirus
- C12N2770/32634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates to immunogenic compositions comprising one or more Streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising Protein E and/or PilA from Haemophilus influenzae.
- Non- typeable Haemophilus influenzae (NTHi) is an important and common respiratory pathogen that causes otitis media in infants and children. NTHi is, after Streptococcus pneumoniae, the most common cause of acute otitis media in children (J. Immunology 183: 2593-2601 (2009), Pediatrics 113: 1451-1465 (2004)). It is an important cause of sinusitis in children and adults. (Current Infectious Disease Reports 1 1 : 177-182 (2009)). It has been associated with increased risk of exacerbations in chronic obstructive pulmonary disease (COPD) in adults. (Journal of Chronic Obstructive Pulmonary Disease 3:109-1 15 (2006)). In addition, non-typeable H. influenzae causes community-acquired pneumonia in adults and may cause pneumonia in children in developing countries. (Current Infectious Disease Reports 1 1 : 177-182 (2009)).
- Streptococcus pneumoniae also known as the pneumococcus, is a Gram-positive bacterium.
- S. pneumoniae is a major public health problem all over the world and is responsible for considerable morbidity and mortality, especially among infants, the elderly and immunocompromised persons.
- S. pneumoniae causes a wide range of important human pathologies including community-acquired pneumonia, acute sinusitis, otitis media, meningitis, bacteremia, septicemia, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, cellulitis, and brain abscess.
- S. pneumoniae also known as the pneumococcus
- pneumoniae is estimated to be the causal agent in 3,000 cases of meningitis, 50, 000 cases of bacteremia, 500,000 cases of pneumonia, and 7,000,000 cases of otitis media annnually in the United States alone (Reichler, M. R. et al., 1992, J. Infect. Dis. 166: 1346; Stool, S. E. and Field, M. J., 1989 Pediatr. Infect. Dis J. 8: S1 1 ).
- Mortality rates due to pneumococcal disease are especially high in children younger than 5 years of age from both developed and developing countries.
- the elderly, the immunocompromised and patients with other underlying conditions are also particularly susceptible to disease.
- IPD Invasive pneumococcal disease
- pneumoniae is isolated from the blood or another normally sterile site (Musher D M.
- Chronic obstructive pulmonary disease is a chronic inflammatory disease of the lungs and a major cause of morbidity and mortality worldwide. Approximately one in 20 deaths in
- Protein E is an outer membrane lipoprotein with adhesive properties. It plays a role in the adhesion/invasion of non-typeable Haemophilus influenzae fNTHi) to epithelial cells. (J. Immunology 183: 2593-2601 (2009); The Journal of Infectious Diseases 199:522-531 (2009), Microbes and Infection 10:87-96 (2008)). It is highly conserved in both encapsulated
- Haemophilus influenzae and non-typeable H. influenzae and has a conserved epithelial binding domain. (The Journal of Infectious Diseases 201 :414-419 (2010)). Thirteen different point mutations have been described in different Haemophilus species when compared with
- Haemophilus influenzae Rd as a reference strain. Its expression is observed on both logarithmic growing and stationary phase bacteria. (WO2007/084053).
- Protein E is also involved in human complement resistance through binding vitronectin. (Immunology 183: 2593-2601 (2009)). PE, by the binding domain PKRYARSVRQ
- YKILNCANYH LTQVR (SEQ ID NO. 1 , corresponding to amino acids 84-108 of SEQ ID NO. 4), binds vitronectin which is an important inhibitor of the terminal complement pathway.
- Pilin A is likely the major pilin subunit of H. influenzae Type IV Pilus (Tfp) involved in twitching motility (Infection and Immunity, 73: 1635-1643 (2005)).
- NTHi PilA is a conserved adhesin expressed in vivo. It has been shown to be involved in NTHi adherence, colonization and biofilm formation. (Molecular Microbiology 65: 1288-1299 (2007)).
- PilA and PE may be beneficially present in an
- immunogenic composition for prevention of H. influenzae and furthermore that PilA and Protein E can be added to a composition comprising S. pneumoniae capsular saccharides in order to provide an immunogenic composition which can prevent H. influenzae and S.pneumoniae infection.
- the skilled person would be aware of the effect of carrier-induced epitopic
- PilA, PE (or fragments thereof) and saccharides from Streptococcus pneumoniae may be beneficially combined in an immunogenic composition to provide effective protection against H. influenzae and S.pneumoniae.
- an immunogenic composition comprising 1 or more (e.g. 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20) Streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising Protein E or an immunogenic fragment of Protein E and/or PilA (or an immunogenic fragment of PilA) from Haemophilus influenzae.
- a vaccine comprising an immunogenic composition of the invention and a pharmaceutically acceptable excipient.
- a method of immunising a subject against diseases caused by Streptococcus pneumoniae infection comprising administering to the subject a therapeutically effective dose of the immunogenic composition of the invention or the vaccine of the invention.
- a method of immunising a subject against diseases caused by Haemophilus influenzae infection comprising administering to the subject a therapeutically effective dose of the immunogenic composition of the invention or the vaccine of the invention.
- an immunogenic composition of the invention or a vaccine of the invention for use in the treatment or prevention of diseases caused by
- an immunogenic composition of the invention or a vaccine of the invention for use in the treatment or prevention of diseases caused by
- an eighth aspect there is provided a use of the immunogenic composition of the invention or the vaccine of the invention in the manufacture of a medicament for the treatment or prevention of diseases caused by Haemophilus influenzae infection.
- FIG. 1 SDS-PAGE of induced bacterial extracts for fusion protein constructs LVL291 , LVL268 and LVL269. Insoluble fraction (I), Soluble fraction (S) and Culture Media fraction (M) were loaded for LVL291 , LVL268 and LVL269 before and after induction (ind).
- FIG. 3 SDS-PAGE of induced bacterial and purification extracts for fusion protein constructs LVL291 and LVL315.
- Culture Media fraction (M) Soluble fraction (Sol), Insoluble fraction (Ins), Flow through fraction (Ft), Wash fraction #1 (W1 ), Wash fraction #2 (W2) and Elution fraction (E) were loaded for LVL291 and LVL315.
- FIG. 4 SDS-PAGE of induced bacterial and purification extracts for fusion protein construct LVL312. Culture Media fraction (M), Soluble fraction (Sol), Insoluble fraction (Ins), Flow Through fraction (Ft), Wash fraction #1 (W1 ), Wash fraction #2 (W2) and Elution fraction (E) were loaded for l_VL312. Figure 5. SDS-PAGE of induced (1 mM and 10 ⁇ IPTG) bacterial extracts for fusion protein construct LVL317. Extracts from before (Nl) and after induction (In), Soluble fraction (S), Insoluble fraction (I).
- Figure 7 CD spectra of PE, PilA and PE-PilA fusion proteins.
- FIG 1 PE-PilA fusion protein thermal denaturation curve.
- Figure 12. Typical SP SepharoseTM Fast Flow chromatogram.
- Figure 13. Typical Q SepharoseTM Fast Flow chromatogram.
- Figure 15 Western Blot of In-process samples of purification process from PE-PilA fusion protein. Blot using rabbit polyclonal anti-PE.
- Figure 16 Western Blot of In-process samples of purification process from PE-PilA fusion protein. Blot using rabbit polyclonal anti-E.coli (BLR).
- FIG. 1 Thermal transition of PE-PilA fusion protein and PE and PilA proteins. Curves: PilA (1 ), Protein E (Prot E, PE) (2), PE-PilA Purified Bulk not diluted, 737 ⁇ g/ml (3), and PE-PilA Purified Bulk diluted at Final Container concentration 60 ⁇ g/ml (4).
- Figure 18 Antibody responses against LVL291 PE-PilA fusion protein and against monovalent PE and PilA in the Balb/c mouse model.
- Figure 19. Effect of PE-PilA fusion protein vaccination on NTHi strain 86-028NP bacterial clearance in mouse nasopharynx.
- Figure 20 Effect of PE-PilA fusion protein vaccination on NTHi strain 3224A bacterial clearance in mouse nasopharynx.
- Figure 21 Effect of PilA vaccination on bacterial clearance in mouse nasopharynx.
- Figure 22 Effect of PE vaccination on bacterial clearance in mouse nasopharynx.
- Figure 23 (a) LVL317 PE-PilA fusion protein binding to vitronectin and (b) LVL317 and LVL735 PE-PilA fusion protein bound to vitronectin.
- Figure 24 Inhibition of vitronectin binding by polyclonal antibodies against PE-PilA fusion protein.
- FIG. 25 SDS-PAGE of soluble fractions of induced bacterial extracts for fusion protein constructs LVL291 , LVL702, LVL736, LVL737, LVL738, LVL739, LVL740 and pET26b vector (negative control), (a) Experiment 1 (b) Experiment 2 (c) Experiment 3. PE-PilA fusion protein indicated by arrow.
- Figure 28 Effect of LVL735 and LVL317 vaccination on bacterial clearance in a mouse model of non-typeable Haemophilus influenzae nasopharyngeal colonization.
- Figure 29 Graph comparing the immunogenicity of a composition comprising 12 saccharide conjugates, PhtD, dPIy and PE-PilA (12V + prot) with a composition comprising 12 saccharide conjugates (12V) and a composition comprising 10 saccharide conjugates (10V) as measured after injection of mice using an anti-saccharide ELISA assay.
- GMC geometric mean concentration .
- IC confidence intervals.
- Figure 30 Graph comparing the immunogenicity of a composition comprising 12 saccharide conjugates, PhtD, dPIy and PE-PilA (12V + prot) with a composition comprising 12 saccharide conjugates (12V) and a composition comprising 10 saccharide conjugates (10V) as measured after injection of mice using an opsonophagocytosis assay.
- GMT geometric means titer.
- Figure 31 Graph comparing the immunogenicity of a composition comprising 12 saccharide conjugates, PhtD, dPIy and PE-PilA (12V + prot) with a composition comprising PhtD, dPIy and PE-PilA alone (prot) as measured after injection of mice using an anti-protein ELISA assay.
- GMC geometric mean concentration .
- IC confidence intervals.
- Figure 32 Graph comparing the immunogenicity of a composition comprising 12 saccharide conjugates, PhtD, dPIy and PE-PilA (12V + prot) with a composition comprising 12 saccharide conjugates (12V) and a composition comprising 10 saccharide conjugates (10V) as measured after injection of guinea pigs using an opsonophagocytosis assay.
- GMT geometric means titer.
- Figure 33 Graph comparing the immunogenic of a composition comprising 12 saccharide conjugates, PhtD, dPIy and PE-PilA (12V + prot) with a composition comprising 12 saccharide conjugates (12V) and a composition comprising 10 saccharide conjugates (10V) as measured after injection of guinea pigs using an anti-saccharide ELISA.
- GMC geometric mean concentration .
- IC confidence intervals.
- Figure 34 Graph comparing the immunogenic of a composition comprising 12 saccharide conjugates, PhtD, dPIy and PE-PilA (12V + prot) with a composition comprising PhtD, dPIy and PE-PilA alone (prot) as measured after injection of guinea pigs using an anti-protein ELISA.
- the present invention relates to an immunogenic composition
- an immunogenic composition comprising 1 or more (e.g. 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20) Streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising Protein E (or an immunogenic fragment thereof) and/or PilA (or an immunogenic fragment thereof) from Haemophilus influenzae.
- protein component relates to a sequence of amino acids comprising Protein E (or an immunogenic fragment thereof) and/or PilA (or an immunogenic fragment thereof), the protein component may comprise Protein E alone, PilA alone, an immunogenic fragment of Protein E alone, an immunogenic fragment of PilA alone, Protein E and PilA, an immunogenic fragment of Protein E and PilA, an immunogenic fragment of Protein E and an immunogenic fragment of PilA or Protein E and an immunogenic fragment of PilA (for example as a fusion protein).
- the protein component may further comprise additional sequences.
- Protein E As used herein "Protein E”, “protein E”, “Prot E”, and “PE” mean Protein E from H.
- Protein E may consist of or comprise the amino acid sequence of SEQ ID NO. 4 (MKKIILTLSL GLLTACSAQI QKAEQNDVKL APPTDVRSGY IRLVKNVNYY IDSESIWVDN QEPQIVHFDA VVNLDKGLYV YPEPKRYARS VRQYKILNCA NYHLTQVRTD FYDEFWGQGL RAAPKKQKKH TLSLTPDTTL YNAAQIICAN YGEAFSVDKK) as well as sequences with at least or exactly 75%, 77%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity, over the entire length, to SEQ ID NO. 4.
- SEQ ID NO. 4 MKKIILTLSL GLLTACSAQI QKAEQNDVKL APPTDVRSGY IRLVKNVNYY IDSESIWVDN QEPQIVHFDA VVNLDKGLYV YPEPKRYARS VRQYKILNCA NYHLTQVRTD FYDEF
- amino acid #20 may be isoleucine (I) or threonine (T); amino acid #23 may be alanine (A) or valine (V); amino acid #24 may be lysine (K) or glutamic acid (E); amino acid #31 may be alanine (A) or threonine (T); amino acid #32 may be proline (P) or alanine (A); amino acid #34 may be threonine (T) or alanine (A); amino acid #37 may be arginine (R) or glutamine (Q); amino acid #47 may be valine (V) or alanine (A); amino acid #57 may be tryptophane (W) or may be absent (-); amino acid #70 may be alanine (A) or threonine (T); amino acid #23 may be alanine (A) or valine (V); amino acid #24 may be lysine (K) or glutamic acid (E); amino acid #31 may be
- Protein E may consist of or comprise an amino acid sequence that differs from SEQ ID NO. 4 at any one or more amino acid selected from the group consisting of: amino acid #20, amino acid #23, amino acid #24, amino acid #31 , amino acid #32, amino acid #34, amino acid #37, amino acid #47, amino acid #57, amino acid #70, amino acid #93, amino acid #109, amino acid #1 19, amino acid #153, amino acid #156, amino acid #160, amino acid #161 and amino acids #162-#195, wherein amino acid #20 is threonine (T); amino acid #23 is valine (V); amino acid #24 is lysine (K); amino acid #31 is threonine (T); amino acid #32 is alanine (A); amino acid #34 is alanine (A); amino acid #37 is glutamine (Q); amino acid #47 is alanine (A); amino acid #57 is absent (-); amino acid #70 is threonine (T); amino acid #93 is absent (-
- Protein E may be Protein E from H. influenzae strain 3224A, RdKW20, 86-028NP, R2846, R2866, 3655, PittAA, PittEE, PittHH, Pittll, R3021 , 22.4-21 , 3219C, 3185, 3241A, 038144S1 , 810956, 821246, 840645, 902550Z19, A840177, A860514, A950014, 306543X4, A930105, 901905U, A920030, 3221 B, 27W116791 N, N218, N163, N162, N107, N91 , D21 1 PG, D21 1 PD, D201 PG, D201 PD, D198PG, D198PD, D195PD, D189PG, D189PD, D129CG, D124PG, D124PD, D58PG, D330D, BS433, BS432, 1714, 1128 or BS430.
- Protein E may be Protein E as set forth in any of SEQ ID NO. 5 - SEQ ID NO. 57.
- Protein E may be a sequence with at least 95% or 98%, 99% identity, over the entire length, to any of SEQ ID NO. 4 - SEQ ID NO. 57.
- Protein E may be a sequence with at least 95% identity, over the entire length, to any of the sequences set forth in Table 1 , SEQ ID NO. 5 - SEQ ID NO. 57.
- Immunogenic fragments of Protein E comprise immunogenic fragments of at least 7, 10, 15, 20, 25, 30 or 50 contiguous amino acids of SEQ ID NO. 4.
- the fragment is less than 150, 125, 100, 75, or 60 amino acids of Protein E, for example in one embodiment the immunogenic composition of the invention comprises less than 150, 125, 100, 75 or 60 amino acids of Protein E.
- the immunogenic fragments may elicit antibodies which can bind SEQ ID NO. 4.
- the immunogenic fragment may comprise a B and/or T cell epitope of SEQ ID NO:4.
- Immunogenic fragments of Protein E may comprise immunogenic fragments of at least 7, 10, 15, 20, 25, 30 or 50 contiguous amino acids of any of SEQ ID NO. 4 - SEQ ID NO. 57.
- the immunogenic fragments may elicit antibodies which can bind the full length sequence from which the fragment is derived.
- the immunogenic fragment may comprise a B and/or T cell epitope of SEQ ID NO:4 - SEQ ID NO. 57.
- the immunogenic fragment of Protein E is selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 19-160 of SEQ ID NO. 4 (SEQ ID NO.
- the immunogenic fragment of protein E is selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 19-160 of SEQ ID NO. 4 (SEQ ID NO. 124), amino acids 20-160 of SEQ ID NO. 4 (SEQ ID NO. 125), amino acids 22-160 of SEQ ID NO. 4 (SEQ ID NO. 126), amino acids 23-160 of SEQ ID NO. 4 (SEQ ID NO.
- the immunogenic fragment of Protein E from H. influenzae is selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 20-160 of SEQ ID NO. 4 (SEQ ID NO. 125), amino acids 22-160 of SEQ ID NO. 4 (SEQ ID NO. 126), amino acids 23-160 of SEQ ID NO. 4 (SEQ ID NO. 179) and amino acids 24-160 of SEQ ID NO. 4 (SEQ ID NO. 180). More specifically, in one embodiment, the immunogenic fragment is SEQ ID NO.
- the immunogenic fragment is SEQ ID NO.125, amino acids 20-160 of SEQ ID NO. 5.
- the immunogenic fragment is an immunogenic fragment of Protein E from H. influenzae selected from the group consisting of amino acids 23-160 of SEQ ID NO. 4 (SEQ ID NO. 179) and amino acids 24-160 of SEQ ID NO. 4 (SEQ ID NO. 180). [029] Protein E contains an epithelial cell binding region (PKRYARSVRQ YKILNCANYH LTQVR, SEQ ID NO. 128) that has been reported to be conserved among more than 100 clinical NTHi isolates, encapsulated H.
- the fragment of Protein E comprises the binding region of SEQ ID NO. 128 (PKRYARSVRQ YKILNCANYH LTQVR)
- the Protein E or an immunogenic fragment thereof is capable of eliciting an immune response which recognizes SEQ ID NO:4. Whether or not a first protein is capable of eliciting an immune response which recognizes a second protein can be determined using an ELISA assay (for example the ELISA described in example 22).
- PilA means Pilin A from H. influenzae.
- PilA may consist of or comprise the protein sequence of SEQ ID NO. 58 (MKLTTQQTLK KGFTLIELMI VIAIIAILAT lAIPSYQNYT KKAAVSELLQ ASAPYKADVE LCVYSTNETT NCTGGKNGIA ADITTAKGYV KSVTTSNGAI TVKGDGTLAN MEYILQATGN AATGVTWTTT CKGTDASLFP ANFCGSVTQ) as well as sequences with 80% to 100% identity to SEQ ID NO. 58.
- PilA may be at least 80%, 85%, 90%, 95%, 97% or 100% identical to SEQ ID NO. 58.
- amino acid #6 may be glutamine (Q) or leucine (L); amino acid #7 may be glutamine (Q) or threonine (T); amino acid #37 may be glutamine (Q) or lysine (K); amino acid #44 may be alanine (A) or serine (S); amino acid #57 may be alanine (A) or serine (S); amino acid #67 may be asparagine (N) or glycine (G); amino acid #68 may be glutamic acid (E) or lysine (K); amino acid #69 may be theronine (T) or proline (P); amino acid #71 may be lysine (K), asparagine (N), serine (S) or
- Table 2 Pilin A amino acid sequences from 64 strains of Haemophilus influenzae (SEQ ID NO. 58 - SEQ ID NO. 121 )
- PilA may be PilA from H. influenzae strain NTHi3219C, NTHi3224A, NTHi12, NTHi44, NTHi67, 1054MEE, 1729MEE, 1728MEE, 1885MEE, 1060MEE, RdKW20, 214NP, 1236MEE, 1714MEE, 1 128MEE, 86-028NP, R2846, R2866, 3655, PittAA, PittGG, Pittll, R3021 , 22.4-21 , 3185A, 3221 B, 3241A, 038144S1 , 821246, 840645, 902550Z19, A840177, A920030, A950014, 901905U, A920029, A930105, 306543X4, N218, N163, N162, N120, N107, N92, N91 , D219PG, D21 1 PG, D21 1 PD, D204CD, D198PG, D198PD, D195PD, D195CD
- PilA An amino acid sequence for PilA from H. influenzae strain D204CD is set forth in SEQ ID NO. 106, wherein X at position #116 is either glutamine (Q) or leucine (L); ambiguity as to the amino acid at position #116 could be cleared up by technical resolution of the second nucleotide encoding amino acid #116, clarifying the PilA sequence for strain D204CD.
- PilA may be PilA as set forth in any of SEQ ID NO. 58 - SEQ ID NO. 121. [043] PilA may be a sequence with at least 95%, 98%, or 99% identity, over the entire length, to any of SEQ ID NO. 58 - SEQ ID NO. 121 (as set out in Table 2).
- Immunogenic fragments of PilA comprise immunogenic fragments of at least 7, 10, 15, 20, 25, 30 or 50 contiguous amino acids of SEQ ID NO. 58 - SEQ ID NO. 121.
- immunogenic fragments may elicit antibodies which can bind the full length sequence from which the fragment is derived.
- the immunogenic fragments may comprise a B and/or T cell epitope of SEQ ID NO. 58-SEQ ID NO: 121.
- immunogenic fragments of PilA comprise immunogenic fragments of at least 7, 10, 15, 20, 25, 30 or 50 contiguous amino acids of SEQ ID NO. 58.
- the immunogenic fragment of PilA comprises less than 150, 125, 100, 75, or 60 amino acids of PilA, in a further embodiment the immunogenic composition comprises less than 150, 125, 100, 75 or 60 amino acids of PilA.
- the immunogenic fragments may elicit antibodies which can bind SEQ ID NO. 58.
- the immunogenic fragments may comprise a B and/or T cell epitope of SEQ ID NO:58.
- the immunogenic fragment of PilA is a fragment from H. influenzae strain 86-028NP wherein PilA is SEQ ID NO. 58.
- the immunogenic fragment of PilA is approximately at least
- the immunogenic fragment of PilA is SEQ ID NO. 127, a fragment consisting of amino acids 40-149 of SEQ ID NO. 58. [049] Amino acids 40-149 of PilA from H. influenzae strain 86-028NP - SEQ ID NO. 127.
- the immunogenic fragment of PilA consists of amino acids 40- 149 from any of SEQ ID NO. 58 - SEQ ID NO. 121.
- the immunogenic fragment is at least 95% identical to amino acids 40-149 from any of SEQ ID NO. 58 - SEQ ID NO. 121 [051] Identity between polypeptides may be calculated by various algorithms.
- the Needle program from the EMBOSS package (Free software; EMBOSS: The European Molecular Biology Open Software Suite (2000). Trends in Genetics 16(6): 276—277) and the Gap program from the GCG ® package (Accelrys Inc.) may be used.
- This Gap program is an implementation of the Needleman-Wunsch algorithm described in: Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453.
- the BLOSUM62 scoring matrix has been used, and the gap open and extension penalties were respectively 8 and 2.
- a percentage of identity can be computed by (1 ) calculating the number of identities divided by the length of the alignment, multiplied by 100 (for example, for the Needle program analysis), (2) calculating the number of identities divided by the length of the longest sequence, multiplied by 100, (3) calculating the number of identities divided by the length of the shortest sequence, multiplied by 100, or (4) calculating the number of identities divided by the number of aligned residues, multiplied by 100 (a residue is aligned if it is in front of another) (for example, for the Gap program analysis).
- the PilA is capable of eliciting an immune response which recognizes SEQ ID NO. 58.
- Protein E/PilA fusion protein [054] In one embodiment Protein E and PilA are present in a fusion protein. In a further embodiment the fusion protein has formula (I):
- X is a signal peptide or MHHHHHH (SEQ ID NO. 2);
- n 0 or 1 ;
- R-i is an amino acid
- n 0, 1 , 2, 3, 4, 5 or 6;
- A is Protein E from Haemophilus influenzae or an immunogenic fragment thereof, or PilA from Haemophilus influenzae or an immunogenic fragment thereof;
- Y is selected from the group consisting of GG, SG, SS and (G) h wherein h is 4, 5, 6, 7, 8, 9, or 10;
- o 0 or 1 ;
- Z is GGHHHHHH (SEQ ID NO: 3);
- p 0 or 1.
- the fusion proteins of formula (I) are defined wherein X is selected from the group consisting of the signal sequence from CcmH (cytochrome c membrane protein H), DsbA (periplasmic protein disulfide isomerise I), DsbB (disulfide bond membrane protein B), Flgl (flagellar peptidoglycan ring protein), FocC (F1 c Chaperone protein), MalE (maltose transporter subunit E), NadA (quinolinate synthase subunit A), NikA (nickel ABC transporter component A), NspA (Neisserial surface protein A), Omp26 (outer membrane protein 26), OmpA (outer membrane protein A), OspA (outer surface protein A), pelB (pectate lyase B), PhoA (bacterial alkaline phosphatase), PhtD (poly histidine triad protein D), PhtE (poly histidine triad protein E),
- X is a co-translational signal peptide or a post-translational signal peptide.
- X is the signal sequence from Flgl (flgl sp).
- X is the signal sequence from pelB (pelB sp).
- X is a post-translational signal peptide.
- X is selected from the group consisting of the signal sequence from Flgl, NadA and pelB.
- the fusion proteins of formula (I) are defined wherein m is 1. In another embodiment, m is 0.
- n are defined wherein (Ri ) n is 1 to 6 amino acids enriched in small, usually hydrophilic, amino acids.
- Hydrophilic amino acids include glutamic acid (E), aspartic acid (D) and asparagine (N).
- the fusion proteins of formula (I) are defined wherein n is selected from the group consisting of 0, 1 , 2 and 6. In one particular embodiment, and n are defined wherein (R ⁇ is selected from the group consisting of D, E, ATNDDD (SEQ ID NO. 178) and MD, or any subset thereof.
- n is selected from the group consisting of 1 , 2 and 6. In one particular embodiment, n is 0. [060] In one embodiment, the fusion proteins of formula (I) are defined wherein A is Protein E from H. influenzae. In another embodiment, the fusion proteins of formula (I) are defined wherein A is Protein E as encoded by an amino acid sequence selected from the group consisting of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 1 1 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO.
- SEQ ID NO. 17 SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21 , SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31 , SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID N0.39, SEQ ID NO. 40, SEQ ID NO. 41 , SEQ ID NO. 42, SEQ ID NO. 43 SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO.
- the fusion proteins of formula (I) are defined wherein A is Protein E, wherein Protein E is approximately at least 75%, 80%, 85%, 90%, 92%, 95%, 98% or 99% identical to the Protein E amino acid sequence set forth in SEQ ID NO: 4.
- A is Protein E wherein Protein E is approximately 90% to 100% identical to the Protein E amino acid sequence set forth in SEQ ID NO: 4. In another embodiment, A is Protein E wherein Protein E is at least 95% identical to the Protein E amino acid sequence set forth in SEQ ID NO: 4. In additional embodiment, A is Protein E wherein Protein E is at least 95% identical to Protein E as set for in any of SEQ ID NO. 4 - SEQ ID NO. 57. In a particular embodiment, A is Protein E having the amino acid sequence set forth in SEQ ID NO. 4.
- the fusion proteins of formula (I) are defined wherein A is an immunogenic fragment of Protein E from H. influenzae.
- A is an immunogenic fragment of Protein E wherein Protein E has an amino acid sequence selected from the group consisting of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 1 1 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21 , SEQ ID NO. 22, SEQ ID NO.
- SEQ ID NO. 24 SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31 , SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID N0.39, SEQ ID NO. 40, SEQ ID NO. 41 , SEQ ID NO. 42, SEQ ID NO. 43 SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49, SEQ ID NO. 50, SEQ ID NO.
- A is an immunogenic fragment of Protein E, wherein Protein E is approximately 75%, 80%, 85%, 90%, 92%, 95%, 98% or 99%identical to the amino acid sequence set forth in SEQ ID NO: 4.
- A is an immunogenic fragment of Protein E, wherein Protein E is approximately 90% to 100% identical to SEQ ID NO. 4.
- A is an immunogenic fragment of Protein E, wherein Protein E is at least 95% identical to any of SEQ ID NO.
- A is an immunogenic fragment of Protein E, wherein Protein E is at least 93%, 95%, 98%, 99% or 100% identical to SEQ ID NO. 124.
- A is an immunogenic fragment of Protein E wherein Protein E is SEQ ID NO. 4.
- A is an immunogenic fragment of Protein E from H. influenzae selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 19-160 of SEQ ID NO. 4 (SEQ ID NO. 124), amino acids 20-160 of SEQ ID NO.
- A is an immunogenic fragment of Protein E from H. influenzae selected from the group consisting of amino acids 17- 160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 19-160 of SEQ ID NO. 4 (SEQ ID NO. 124), amino acids 20-160 of SEQ ID NO. 4 (SEQ ID NO. 125), amino acids 22-160 of SEQ ID NO. 4 (SEQ ID NO. 126), amino acids 23-160 of SEQ ID NO. 4 (SEQ ID NO. 179) and amino acids 24-160 of SEQ ID NO. 4 (SEQ ID NO. 180).
- A is an immunogenic fragment of Protein E from H.
- influenzae selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 20-160 of SEQ ID NO. 4 (SEQ ID NO. 125), amino acids 22-160 of SEQ ID NO. 4 (SEQ ID NO. 126), amino acids 23-160 of SEQ ID NO. 4 (SEQ ID NO. 179) and amino acids 24-160 of SEQ ID NO. 4 (SEQ ID NO. 180). More specifically, in one embodiment, A is SEQ ID NO. 124, amino acids 19-160 of SEQ ID NO. 4. In an additional embodiment, A is SEQ ID N0.125, amino acids 20- 160 of SEQ ID NO. 5.
- A is immunogenic fragment of Protein E from H. influenzae selected from the group consisting of amino acids 23-160 of SEQ ID NO. 4 (SEQ ID NO. 179) and amino acids 24-160 of SEQ ID NO. 4 (SEQ ID NO. 180).
- the fusion proteins of formula (I) are defined wherein A is PilA from H. influenzae.
- the fusion proteins of formula (I) are defined wherein A is PilA from H. influenzae having an amino acid sequence selected from the group consisting of SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, SEQ ID NO. 61 , SEQ ID NO. 62, SEQ ID NO. 63, SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66, SEQ ID NO. 67, SEQ ID NO. 68, SEQ ID NO. 69, SEQ ID NO. 70, SEQ ID NO. 71 , SEQ ID N0.72, SEQ ID NO.
- SEQ ID NO. 74 SEQ ID NO. 75, SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, SEQ ID NO. 81 , SEQ ID NO. 82, SEQ ID NO. 83, SEQ ID NO. 84, SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, SEQ ID NO. 88, SEQ ID NO. 89, SEQ ID NO. 90, SEQ ID NO. 91 , SEQ ID NO. 92, SEQ ID NO. 93, SEQ ID NO. 94, SEQ ID NO. 95, SEQ ID NO. 96, SEQ ID NO.
- A is PilA wherein PilA is
- A is PilA wherein PilA is at least 95% identical to any of SEQ ID NO. 58 - SEQ ID NO. 121.
- A is PilA of SEQ ID NO. 58.
- the fusion proteins of formula (I) are defined wherein A is an immunogenic fragment of PilA from H. influenzae. In another embodiment, A is an immunogenic fragment of PilA from H. influenzae. In another embodiment, A is an immunogenic fragment of PilA from H. influenzae. In another embodiment, A is an immunogenic fragment of PilA from H. influenzae.
- A is an immunogenic fragment of PilA wherein PilA has an amino acid sequence selected from the group consisting of SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, SEQ ID NO. 61 , SEQ ID NO. 62, SEQ ID NO. 63, SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66, SEQ ID NO. 67, SEQ ID NO. 68, SEQ ID NO. 69, SEQ ID NO. 70, SEQ ID NO.
- SEQ ID NO. 71 SEQ ID N0.72, SEQ ID NO. 73, SEQ ID NO. 74, SEQ ID NO. 75, SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, SEQ ID NO. 81 , SEQ ID NO. 82, SEQ ID NO. 83, SEQ ID NO. 84, SEQ ID NO. 85,
- A is an immunogenic fragment of PilA wherein PilA is at least 95% identical to any of SEQ ID NO. 58 - SEQ ID NO. 121.
- A is an immunogenic fragment of PilA from H. influenzae strain 86- 028NP wherein PilA is SEQ ID NO. 58.
- A is an immunogenic fragment of PilA approximately at least 75%, 80%, 85%, 90%, 92%, 95%, 98% or 99% identical to SEQ ID NO. 127. More specifically, in one embodiment A is SEQ ID NO. 127, a fragment consisting of amino acids 40-149 of SEQ ID NO. 58.
- A is an immunogenic fragment of PilA consisting of amino acids 40-149 from any of SEQ ID NO. 58 - SEQ ID NO. 121. In an additional embodiment, A is an immunogenic fragment at least 95% identical to amino acids 40-149 from any of SEQ ID NO. 58 - SEQ ID NO. 121.
- the fusion proteins of formula (I) are defined wherein Y is selected from the group consisting of GG, SG and SS. In another embodiment, the fusion proteins of formula (I) are defined wherein Y is GG or SG. In one particular embodiment, Y is GG.
- the fusion proteins of formula (I) are defined wherein o is 1. In another embodiment, o is 0.
- the fusion proteins of formula (I) are defined wherein B is PilA from H. influenzae or an immunogenic fragment of PilA from H. influenzae when A is Protein E from H. influenzae or an immunogenic fragment of Protein E from H. influenzae.
- B is PilA from H. influenzae strain 86-028NP.
- B is PilA from H. influenzae having an amino acid sequence selected from the group consisting of SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, SEQ ID NO. 61 , SEQ ID NO. 62, SEQ ID NO. 63, SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66, SEQ ID NO.
- SEQ ID NO. 67 SEQ ID NO. 68, SEQ ID NO. 69, SEQ ID NO. 70, SEQ ID NO. 71 , SEQ ID N0.72, SEQ ID NO. 73, SEQ ID NO. 74, SEQ ID NO. 75, SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, SEQ ID NO. 81 , SEQ ID NO. 82, SEQ ID NO. 83, SEQ ID NO. 84, SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, SEQ ID NO. 88, SEQ ID NO. 89, SEQ ID NO. 90, SEQ ID NO.
- SEQ ID NO. 92 SEQ ID NO. 93, SEQ ID NO. 94, SEQ ID NO. 95, SEQ ID NO. 96, SEQ ID NO. 97, SEQ ID NO. 98, SEQ ID NO. 99, SEQ ID NO. 100, SEQ ID NO. 101 , SEQ ID NO. 102, SEQ ID NO. 103, SEQ ID NO. 104, SEQ ID NO. 105, SEQ ID NO. 106, SEQ ID NO. 107, SEQ ID NO. 108, SEQ ID NO. 109, SEQ ID NO. 110, SEQ ID NO. 1 1 1 , SEQ ID NO. 112, SEQ ID NO. 1 13, SEQ ID NO. 1 14, SEQ ID NO.
- B is PilA wherein PilA is approximately at least 75%, 80%, 85%, 90%, 92%, 95%, 98% or 99% identical to SEQ ID NO. 58.
- B is PilA wherein PilA is at least 95%, 98% or 99% identical to any of SEQ ID NO. 58 - SEQ ID NO. 121.
- B is PilA of SEQ ID NO. 58.
- B is PilA wherein PilA is at least 95%, 98% or 99% identical to any of SEQ ID NO. 58 - SEQ ID NO. 121 and A is PE wherein PE is at least 95%, 98% or 99% identical to any of SEQ ID NO. 4 - SEQ ID NO. 57.
- the fusion proteins of formula (I) are defined wherein B is an immunogenic fragment of PilA from H. influenzae when A is an immunogenic fragment of Protein E from H. influenzae.
- B is an immunogenic fragment of the PilA from H. influenzae strain 86-028NP.
- B is an immunogenic fragment of PilA wherein PilA is approximately at least 80%, 85%, 90%, 95%, 98% or 99% identical to SEQ ID NO: 58.
- B is an immunogenic fragment of PilA wherein PilA has an amino acid selected from the group consisting of SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60, SEQ ID NO. 61 , SEQ ID NO. 62, SEQ ID NO. 63, SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66, SEQ ID NO. 67, SEQ ID NO. 68, SEQ ID NO. 69, SEQ ID NO. 70, SEQ ID NO.
- SEQ ID NO. 71 SEQ ID N0.72, SEQ ID NO. 73, SEQ ID NO. 74, SEQ ID NO. 75, SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, SEQ ID NO. 81 , SEQ ID NO. 82, SEQ ID NO. 83, SEQ ID NO. 84, SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, SEQ ID NO. 88, SEQ ID NO. 89, SEQ ID NO. 90, SEQ ID NO. 91 , SEQ ID NO. 92, SEQ ID NO. 93, SEQ ID NO. 94, SEQ ID NO.
- SEQ ID NO. 95 SEQ ID NO. 96, SEQ ID NO. 97, SEQ ID NO. 98, SEQ ID NO. 99, SEQ ID NO. 100, SEQ ID NO. 101 , SEQ ID NO. 102, SEQ ID NO. 103, SEQ ID NO. 104, SEQ ID NO. 105, SEQ ID NO. 106, SEQ ID NO. 107, SEQ ID NO. 108, SEQ ID NO. 109, SEQ ID NO. 1 10, SEQ ID NO. 1 11 , SEQ ID NO. 112, SEQ ID NO. 113, SEQ ID NO. 1 14, SEQ ID NO. 115, SEQ ID NO. 116, SEQ ID NO. 117, SEQ ID NO. 1 18, SEQ ID NO.
- B is an immunogenic fragment of PilA wherein PilA is at least 95%, 98% or 99% identical to any of SEQ ID NO. 58 - SEQ ID NO. 121.
- B is an immunogenic fragment of PilA from H. influenzae wherein PilA has the amino acid sequence set forth in SEQ ID NO. 58.
- B is an immunogenic fragment of PilA consisting of amino acids 40-149 from any of SEQ ID NO. 58 - SEQ ID NO. 121. More specifically, in one embodiment B is the fragment of PilA as set forth in SEQ ID NO. 127.
- B is an immunogenic fragment at least 95%, 98% or 99% identical to amino acids 40-149 of any of SEQ ID NO. 58 - SEQ ID NO. 121.
- B is the fragment of PilA as set forth in SEQ ID NO. 127 and A is an immunogenic fragment of Protein E selected from the group consisting of SEQ ID NO. 122, SEQ ID NO. 124, SEQ ID NO. 125 and SEQ ID NO. 126. More particularly, B is the fragment of PilA as set forth in SEQ ID NO. 127 and A is the fragment of Protein E as set forth in SEQ ID NO. 124, amino acids 19-160 of Protein E from SEQ ID NO. 4. In another
- B is the fragment of PilA as set forth in SEQ ID NO. 127 and A is the fragment of Protein E as set forth in SEQ ID NO. 125.
- B is an immunogenic fragment of PilA wherein PilA is at least 95% identical to any of SEQ ID NO. 58 - SEQ ID NO. 121 and A is an immunogenic fragment of PE wherein PE is at least 95% identical to any of SEQ ID NO. 4 - SEQ ID NO. 57.
- the fusion proteins of formula (I) are defined wherein B is
- B is Protein E having an amino acid sequence selected from the group consisting of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 1 1 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21 , SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO.
- SEQ ID NO. 28 SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31 , SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID N0.39, SEQ ID NO. 40, SEQ ID NO. 41 , SEQ ID NO. 42, SEQ ID NO. 43 SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49, SEQ ID NO. 50, SEQ ID NO. 51 , SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO.
- the fusion proteins of formula (I) are defined wherein B is Protein E wherein Protein E is approximately at least 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the Protein E amino acid sequence set forth in SEQ ID NO: 4.
- B is Protein E wherein Protein E is approximately 90%, 95%, 98%, or 99% identical to the Protein E amino acid sequence set forth in SEQ ID NO: 4.
- B is Protein E wherein Protein E is at least 95% identical to Protein E as set forth in SEQ ID NO. 4.
- B is Protein E wherein Protein E is at least 95% identical to any of SEQ ID NO. 4 - SEQ ID NO. 57.
- B is Protein E having the amino acid sequence set forth in SEQ ID NO. 4.
- the fusion proteins of formula (I) are defined wherein B is an immunogenic fragment of Protein E from H. influenzae when A is an immunogenic fragment of PilA from H. influenzae.
- B is an immunogenic fragment of Protein E wherein Protein E has an amino acid sequence selected from the group consisting of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 1 1 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO.
- SEQ ID NO. 21 SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31 , SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID N0.39, SEQ ID NO. 40, SEQ ID NO. 41 , SEQ ID NO. 42, SEQ ID NO. 43, SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO.
- the fusion proteins of formula (I) are defined wherein B is an immunogenic fragment of Protein E wherein Protein E is approximately at least 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the Protein E amino acid sequence set forth in SEQ ID NO. 4. In another embodiment, B is an immunogenic fragment of Protein E wherein Protein E is approximately 90% to 100% identical to the Protein E amino acid sequence set forth in SEQ ID NO: 4.
- B is an immunogenic fragment of Protein E having the amino acid sequence set forth in SEQ ID NO. 4.
- B is an immunogenic fragment of Protein E, wherein Protein E is at least 95% identical to any of SEQ ID NO. 4 - SEQ ID NO. 57.
- B is a fragment of Protein E from H. influenzae selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO. 4 (SEQ ID NO. 123), amino acids 19-160 of SEQ ID NO. 4 (SEQ ID NO. 124), amino acids 20-160 of SEQ ID NO. 4 (SEQ ID NO. 125) and amino acids 22-160 of SEQ ID NO. 4 (SEQ ID NO. 126).
- B is an immunogenic fragment of Protein E from H. influenzae selected from the group consisting of amino acids 17-160 of SEQ ID NO. 4 (SEQ ID NO. 122), amino acids 18-160 of SEQ ID NO.
- B is the fragment of Protein E as set forth in SEQ ID NO. 123, amino acids 18-160 of SEQ ID NO. 4.
- B is an immunogenic fragment of Protein E as set forth in SEQ ID NO. 123, amino acids 18-160 of SEQ ID NO. 4, when A is an immunogenic fragment of PilA as set forth in SEQ ID NO. 127.
- the fusion proteins of formula (I) are defined wherein p is 0. In another embodiment, the fusion proteins of formula (I) are defined wherein p is 1.
- the fusion protein of formula (I) is selected from the group consisting of SEQ ID NO. 136, SEQ ID NO. 138, SEQ ID NO. 140, SEQ ID NO. 142, SEQ ID NO. 144, SEQ ID NO. 146, SEQ ID NO. 148, SEQ ID NO. 150, SEQ ID NO. 182, SEQ ID NO. 184, SEQ ID NO. 186, SEQ ID NO. 188, SEQ ID NO. 190, SEQ ID NO. 192, SEQ ID NO. 194, SEQ ID NO. 196, SEQ ID NO. 198, SEQ ID NO. 200, SEQ ID NO. 202 and SEQ ID NO. 204; or any subset thereof.
- the fusion protein of formula (I) is approximately 85%, 88%, 90%, 92%, 95% or 98% identical to any of SEQ ID NO. 136, SEQ ID NO. 138, SEQ ID NO. 140, SEQ ID NO. 142, SEQ ID NO. 144, SEQ ID NO. 146, SEQ ID NO. 148, SEQ ID NO. 150, SEQ ID NO. 182, SEQ ID NO. 184, SEQ ID NO. 186, SEQ ID NO. 188, SEQ ID NO. 190, SEQ ID NO. 192, SEQ ID NO. 194, SEQ ID NO. 196, SEQ ID NO. 198, SEQ ID NO. 200, SEQ ID NO. 202 or SEQ ID NO. 204.
- the fusion protein formula (I) is the fusion protein of SEQ ID NO.148 wherein the signal peptide has been removed SEQ ID NO. 177 (QIQKAEQN DVKLAPPTDV RSGYIRLVKN VNYYIDSESI WVDNQEPQIV HFDAVVNLDK GLYVYPEPKR YARSVRQYKI LNCANYHLTQ VRTDFYDEFW GQGLRAAPKK QKKHTLSLTP DTTLYNAAQI ICANYGEAFS VDKKGGTKKA AVSELLQASA PYKADVELCV YSTNETTNCT GGKNGIAADI TTAKGYVKSV TTSNGAITVK GDGTLANMEY ILQATGNAAT GVTWTTTCKG TDASLFPANF CGSVTQ).
- the fusion protein of formula (I) is the fusion protein of SEQ ID NO.194 wherein the signal peptide has been removed SEQ ID NO. 219 (IQKAEQND VKLAPPTDVR SGYIRLVKNV NYYIDSESIW VDNQEPQIVH FDAVVNLDKG LYVYPEPKRY ARSVRQYKIL NCANYHLTQV RTDFYDEFWG QGLRAAPKKQ KKHTLSLTPD TTLYNAAQII CANYGEAFSV DKKGGTKKAA VSELLQASAP YKADVELCVY STNETTNCTG GKNGIAADIT TAKGYVKSVT TSNGAITVKG DGTLANMEYI LQATGNAATG VTWTTTCKGT DASLFPANFC GSVTQ).
- capsular saccharide includes capsular polysaccharides and oligosaccharides derivable from the capsular polysaccharide.
- An oligosaccharide contains at least 4 sugar residues.
- conjugate and conjugated relate to a capsular saccharide covalently bonded to a carrier protein.
- the total number of saccharide serotypes is optionally less than or equal to 23.
- the immunogenic composition comprises less than 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, or 13 Streptococcus pneumoniae saccharides, optionally the immunogenic composition comprising 10-23 serotypes, 10-16 serotypes, 10-15 serotypes, 10-14 serotypes, 10-13 serotypes or 10-12 serotypes.
- the Streptococcus pneumoniae capsular saccharide conjugates will be derived from the following serotypes 1 , 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 1 1A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F, although it is appreciated that one or two other serotypes could be substituted depending on the age of the recipient receiving the vaccine and the geographical location where the immunogenic composition will be administered.
- a 7 valent immunogenic composition may comprise saccharides from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.
- a 10 valent immunogenic composition may further comprise saccharides derived from serotypes 1 , 5 and 7F.
- a 12 valent immunogenic composition may further comprise saccharides derived from serotypes 6A, 19A.
- a 15 valent immunogenic composition may further comprise saccharides derived from serotypes 22F and 33F.
- Further saccharide antigens for example 23 valent (such as serotypes 1 , 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 1 1A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F), are also contemplated by the invention.
- carrier protein is intended to cover both small peptides and large
- the carrier protein may be any peptide or protein. It may comprise one or more T-helper epitopes.
- the carrier protein may be tetanus toxoid (TT), tetanus toxoid fragment C, non-toxic mutants of tetanus toxin [note all such variants of TT are considered to be the same type of carrier protein for the purposes of this invention], polypeptides comprising tetanus toxin T-cell epitopes such as N19 (WO2006/067632), diphtheria toxoid (DT), CRM 197 (cross reacting material 197), other non-toxic mutants of diphtheria toxin [such as CRM176, CRM 197, CRM228, CRM 45 (Uchida et al J.
- meningitidis serogroup B - EP0372501 synthetic peptides
- synthetic peptides EP0378881 , EP0427347)
- heat shock proteins WO 93/17712, WO 94/03208
- pertussis proteins WO 98/58668, EP0471 177
- cytokines, lymphokines, growth factors or hormones WO 91/01 146
- artificial proteins comprising multiple human CD4+ T cell epitopes from various pathogen derived antigens (Falugi et al (2001 ) Eur J Immunol 31 ; 3816- 3824) such as N19 protein (Baraldoi et al (2004) Infect Immun 72; 4884-7), pneumococcal surface protein PspA (WO 02/091998), iron uptake proteins (WO 01/72337), toxin A or toxin B of Clostridium difficile (WO 00/61761 ), H.
- influenzae Protein D (EP594610 and WO 00/56360), pneumococcal PhtA (WO 98/18930, also referred to Sp36), pneumococcal PhtD (poly histidine triad D disclosed in WO 00/37105, and is also referred to Sp036D), pneumococcal PhtB (poly histidine triad B disclosed in WO 00/37105, and is also referred to Sp036B), or PhtE (poly histidine triad E disclosed in WO00/30299 and is referred to as BVH-3).
- the Streptococcus pneumoniae capsular saccharide conjugates are conjugated to a carrier protein independently selected from the group consisting of tetanus toxoid (TT), fragment C of TT, diphtheria toxoid, CRM 197 (cross reacting material 197), detoxified pneumolysin, protein D (from H. influenzae), PhtD, PhtDE (a protein containing poly histidine triad protein D and poly histidine triad protein E) and N19.
- the Streptococcus pneumoniae capsular saccharide conjugates are all independently conjugated to CRM197.
- the term 'conjugated to' in this context means that the protein is covalently bonded to a saccharide; in this situation the protein is acting as a carrier protein.
- the immunogenic composition comprises at least one Streptococcus pneumoniae capsular saccharide conjugated to protein D. In one embodiment a minority of conjugated Streptococcus pneumoniae saccharides are conjugated to protein D wherein the term 'minority' refers to less than half of the total number of saccharides in the composition being conjugated to protein D.
- the immunogenic composition comprises between 1-20, 1-18, 1-16, 1-14, 1-12, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-4 or 1-2 Streptococcus pneumoniae capsular saccharide conjugated to protein D.
- the immunogenic composition comprises at least one Streptococcus pneumoniae capsular saccharides conjugated to diphtheria toxoid.
- the immunogenic composition comprises 19F is conjugated to diphtheria toxoid.
- the immunogenic composition comprises at least one Streptococcus pneumoniae capsular saccharides conjugated to tetanus toxoid.
- composition comprises 18C is conjugated to tetanus toxoid.
- the immunogenic composition comprises a conjugated serotype 1 saccharide conjugated to protein D or CRM 197. In one embodiment the immunogenic composition comprises a conjugated serotype 4 saccharide conjugated to protein D or CRM 197. In one embodiment the immunogenic composition comprises a conjugated serotype 5 saccharide wherein the serotype 5 saccharide is conjugated to protein D or CRM197. In one embodiment the immunogenic composition comprises a conjugated serotype 6B saccharide wherein the serotype 6B saccharide is conjugated to protein D or CRM197. In one embodiment the immunogenic composition comprises a conjugated serotype 7F saccharide is wherein the serotype 7F saccharide is conjugated to protein D or CRM197.
- the immunogenic composition comprises a conjugated serotype 9V saccharide wherein the 9V saccharide is conjugated to protein D or CRM197. In one embodiment the immunogenic composition comprises a conjugated serotype 14 saccharide wherein the serotype 14 saccharide is conjugated to protein D or CRM197. In one embodiment the immunogenic composition comprises a conjugated serotype 18C saccharide wherein the serotype 18C saccharide is conjugated to tetanus toxoid or CRM 197. In one embodiment the immunogenic composition comprises a conjugated 19F saccharide wherein the serotype 19F saccharide is conjugated to diphtheria toxoid or CRM197.
- the immunogenic composition comprises a conjugated 23F saccharide wherein the serotype 23F saccharide is conjugated to protein D or CRM197. In one embodiment the immunogenic composition comprises a conjugated 6A saccharide conjugated to CRM 197. In one embodiment the immunogenic composition comprises a conjugated 19A saccharide conjugated to CRM197.
- the immunogenic composition comprises a Streptococcus pneumoniae serotype 1 saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 4 saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 5 saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 6B saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 7F saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 9V saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 14 saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 23F saccharide conjugated to protein D, a Streptococcus pneumoniae serotype 18C saccharide conjugated to tetanus toxoid and a Streptococcus pneumoniae 19F saccharide conjugated to diphtheria
- the ratio of carrier protein to S. pneumoniae saccharide is between 1 :5 and 5:1 ; 1 :2 and 2.5: 1 ; 1 :1 and 2:1 (w/w).
- the majority of the conjugates for example 6, 7, 8, 9 or more of the conjugates have a ratio of carrier protein to saccharide that is greater than 1 :1 , for example 1.1 : 1 , 1.2: 1 , 1.3: 1 , 1.4: 1 , 1.5: 1 or 1.6: 1.
- the immunogenic composition of the invention may comprise a dose of each saccharide conjugate between 0.1 and 20 ⁇ g, 1 and 5 ⁇ g, 1 and ⁇ g or 1 and 3 ⁇ g of saccharide.
- the immunogenic composition of the invention contains each S. pneumoniae capsular saccharide conjugate at a dose of between 0.1-20 ⁇ g; 0.5-10 ⁇ g; 0.5- 5 ⁇ g or 1 ⁇ g of saccharide.
- capsular saccharides may be present at different dosages, for example some capsular saccharides may be present at a dose of exactly ⁇ g or some capsular saccharides may be present at a dose of exactly 3 ⁇ g.
- saccharides from serotypes 3, 18C and 19F (or 4, 18C and 19F) are present at a higher dose than other saccharides.
- serotypes 3, 18C and 19F are present at a dose of around or exactly 3 ⁇ g whilst other saccharides in the immunogenic composition are present at a dose of around or exactly 1 ⁇ g.
- serotypes 1 , 5, 6B, 7F, 9V, 14 and 23F are present at a dose of around or exactly ⁇ g.
- saccharides in the immunogenic composition are present at a dose of around or exactly 1 ⁇ g.
- serotypes 1 , 5, 6B, 7F, 9V, 14 and 23F are present at a dose of around or exactly ⁇ g.
- saccharides in the immunogenic composition are present at a dose of around or exactly 1 ⁇ g.
- serotypes 1 , 5, 6B, 7F, 9V, 14 and 23F are present at a dose of around or exactly ⁇ g.
- saccharides in the immunogenic composition are present at a dose of around or exactly 1 ⁇ g.
- Polysaccharides can be sized in order to reduce viscosity in polysaccharide samples and/or to improve filterability for conjugated products.
- Oligosaccharides have a low number of repeat units (typically 5-30 repeat units) and are typically hydrolysed polysaccharides.
- Capsular polysaccharides of Streptococcus pneumoniae comprise repeating
- oligosaccharide units which may contain up to 8 sugar residues.
- a capsular saccharide antigen may be a full length polysaccharide, however in others it may be one oligosaccharide unit, or a shorter than native length saccharide chain of repeating oligosaccharide units. In one embodiment, all of the saccharides present in the vaccine are polysaccharides. Full length polysaccharides may be "sized" i.e. their size may be reduced by various methods such as acid hydrolysis treatment, hydrogen peroxide treatment, sizing by emulsiflex® followed by a hydrogen peroxide treatment to generate oligosaccharide fragments or microfluidization.
- the immunogenic composition further comprises unconjugated S.penumoniae saccharides of serotypes different from those conjugated, such that the number of conjugated and unconjugated saccharide serotypes is less than or equal to 23.
- saccharide conjugates present in the immunogenic compositions of the invention may be conjugated to a carrier protein using any conjugation technique.
- the Streptococcus pneumoniae saccharide is conjugated to the carrier protein via a linker, for instance a bifunctional linker.
- the linker is optionally
- heterobifunctional or homobifunctional having for example a reactive amino group and a reactive carboxylic acid group, two reactive amino groups or two reactive carboxylic acid groups.
- the linker has for example between 4 and 20, 4 and 12, 5 and 10 carbon atoms.
- a possible linker is adipic acid dihydrazide (ADH).
- Other linkers include B-propionamido (WO 00/10599), nitrophenyl-ethylamine (Gever et al (1979) Med. Microbiol. Immunol.
- ADH is used as a linker for conjugating saccharide from serotype 18C.
- the saccharide conjugates present in the immunogenic compositions of the invention may be prepared by any known coupling technique.
- the conjugation method may rely on activation of the saccharide with 1-cyano-4-dimethylamino pyridinium tetrafluoroborate (CDAP) to form a cyanate ester.
- CDAP 1-cyano-4-dimethylamino pyridinium tetrafluoroborate
- the activated saccharide may thus be coupled directly or via a spacer (linker) group to an amino group on the carrier protein.
- the spacer could be cystamine or cysteamine to give a thiolated polysaccharide which could be coupled to the carrier via a thioether linkage obtained after reaction with a maleimide-activated carrier protein (for example using GMBS) or a haloacetylated carrier protein (for example using iodoacetimide [e.g. ethyl iodoacetimide HCI] or N-succinimidyl bromoacetate or SIAB, or SIA, or SBAP).
- a maleimide-activated carrier protein for example using GMBS
- a haloacetylated carrier protein for example using iodoacetimide [e.g. ethyl iodoacetimide HCI] or N-succinimidyl bromoacetate or SIAB, or SIA, or SBAP).
- the cyanate ester (optionally made by CDAP chemistry) is coupled with hexane diamine or ADH and the amino-derivatised saccharide is conjugated to the carrier protein using carbodiimide (e.g. EDAC or EDC) chemistry via a carboxyl group on the protein carrier.
- carbodiimide e.g. EDAC or EDC
- Such conjugates are described in PCT published application WO 93/15760 Uniformed Services University and WO 95/08348 and WO 96/29094.
- This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group' reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate and coupling the CDI carbamate intermediate with an amino group on a protein.
- the conjugates can also be prepared by direct reductive amination methods as described in US 4365170 (Jennings) and US 4673574 (Anderson). Other methods are described in EP-0-161-188, EP-208375 and EP-0-477508.
- a further method involves the coupling of a cyanogen bromide (or CDAP) activated saccharide derivatised with adipic acid dihydrazide (ADH) to the protein carrier by Carbodiimide condensation (Chu C. et al Infect. Immunity, 1983 245 256), for example using EDAC (1-Ethyl- 3-(3-dimethylaminopropyl) carbodiimide hydrochloride).
- a hydroxyl group (optionally an activated hydroxyl group for example a hydroxyl group activated to make a cyanate ester [e.g. using CDAP]) on a saccharide is linked to an amino or carboxylic group on a protein either directly or indirectly (through a linker).
- a linker is present, a hydroxyl group on a saccharide is optionally linked to an amino group on a linker, for example by using CDAP conjugation.
- a further amino group in the linker for example ADH may be conjugated to a carboxylic acid group on a protein, for example by using carbodiimide chemistry, for example by using EDAC.
- the pneumococcal capsular saccharide(s) is conjugated to the linker first before the linker is conjugated to the carrier protein.
- the linker may be conjugated to the carrier before conjugation to the saccharide.
- a combination of techniques may also be used, with some saccharide-protein conjugates being prepared by CDAP, and some by reductive amination.
- Carboxyl for instance via aspartic acid or glutamic acid.
- this group is linked to amino groups on saccharides directly or to an amino group on a linker with
- Amino group (for instance via lysine).
- this group is linked to carboxyl groups on saccharides directly or to a carboxyl group on a linker with carbodiimide chemistry e.g. with EDAC.
- this group is linked to hydroxyl groups activated with CDAP or CNBr on saccharides directly or to such groups on a linker; to saccharides or linkers having an aldehyde group; to saccharides or linkers having a succinimide ester group.
- Sulphydryl for instance via cysteine.
- this group is linked to a bromo or chloro acetylated saccharide or linker with maleimide chemistry.
- this group is activated/modified with bis diazobenzidine.
- protein carrier chemical group that may be generally used for coupling with a saccharide are amino groups (for instance on lysine residues), COOH groups (for instance on aspartic and glutamic acid residues) and SH groups (if accessible) (for instance on cysteine residues.
- At least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, or 23 S. pneumoniae saccharides are conjugated to a carrier protein through reductive amination. In one embodiment less than 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12,
- 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 S. pneumoniae saccharides are conjugated to a carrier protein through reductive amination.
- a carrier protein through reductive amination.
- S. pneumoniae saccharides are conjugated to a carrier protein through reductive amination.
- all of the S. pneumoniae capsular saccharides are conjugated to a carrier protein through reductive amination.
- At least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, or 23 S. pneumoniae saccharides are conjugated to a carrier protein through CDAP chemistry. In one embodiment less than 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 S. pneumoniae saccharides are conjugated to a carrier protein through CDAP chemistry.
- S. pneumoniae saccharides are conjugated to a carrier protein through CDAP chemistry. In a further embodiment all of the S. pneumoniae capsular saccharides are conjugated to a carrier protein through CDAP chemistry.
- the immunogenic composition of the invention comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 saccharides conjugated to a carrier protein through reductive amination and comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22 saccharides conjugated to a carrier protein through a chemistry other than reductive amination for example CDAP chemistry.
- capsular saccharides from at least one of the serotypes selected from the group consisting of serotypes 1 , 3, 19A and 19F are conjugated through a chemistry other than reductive amination and at least one of the serotypes selected from the group consisting of serotypes 4, 5, 6A, 6B, 6C, 7F, 9V, 14, 18C and 23F are conjugated through reductive amination.
- the immunogenic composition of the invention comprises S.
- the immunogenic composition of the invention comprises S.
- 19F is conjugated to a carrier protein by CDAP chemistry.
- pneumoniae capsular saccharide or saccharides is/are conjugated to a carrier protein by reductive amination; serotype 4, 5, 6A, 6B, 7F, 9V, 14, 18C or 23F, 4 and 5, 4 and 6A, 4 and 6B, 4 and 7F, 4 and 9V, 4 and 14, 4 and 18C, 4 and 23F, 5 and 6A, 5 and 6B, 5 and 7F, 5 and 9V, 5 and 14, 5 and 18C, 5 and 23F, 6A and 6B, 6A and 7F, 6A and 9V, 6A and 14, 6A and 18C, 6A and 23F, 6B and 7F, 6B and 9V, 6B and 14, 6B and 18C, 6B and 23F, 7F and 9V, 7F and 14, 7F and 18C, 7F and 23F, 9V and 14, 9V and 18C, 9V and 23F, 14 and 18C, 14 and 23F or 18C and 23F.
- serotype 23F is conjugated to a carrier protein
- the immunogenic compositions of the invention may comprise at least one
- the at least one unconjugated or conjugated S. pneumoniae protein is selected from the group consisting of Poly Histidine Triad family (PhtX), detoxified pneumolysin (dPIy), Choline Binding Protein Family (CbpX), CbpX truncates, LytX (autolytic enzymes) family, LytX truncates, CbpX truncate-LytX truncate chimeric proteins, PcpA (Pneumococcal Choline Binding protein A), PspA
- PsaA Pneumococcal Surface Adhesin Protein A
- Sp128, Sp101 Streptococcus pneumoniae 101
- Sp130 Streptococcus pneumoniae 130
- SP125 Streptococcus pneumoniae 125
- SP133 SPeptococcus pneumoniae 133
- the Pht (Poly Histidine Triad) family comprises proteins PhtA, PhtB, PhtD, and PhtE. Note that the Pht family can be referred to as either the Poly Histidine Triad family or the Pneumococcal Histidine Triad family, thus the terms 'Poly Histidine Triad' and 'Pneumococcal Histidine Triad' can be considered to be interchangeable.
- the family is characterized by a lipidation sequence, two domains separated by a proline-rich region and several histidine triads, possibly involved in metal or nucleoside binding or enzymatic activity, (3-5) coiled-coil regions, a conserved N-terminus and a heterogeneous C terminus. It is present in all strains of pneumococci tested. Homologous proteins have also been found in other Streptococci and Neisseria.
- the Pht protein of the invention is PhtD.
- PhtA, PhtB, PhtD and PhtE refer to proteins having sequences disclosed in the citations below as well as naturally-occurring (and man-made) variants thereof that have a sequence homology that is at least 90% identical to the referenced proteins. Optionally it is at least 95% identical or at least 97% identical.
- PhtA is disclosed in WO 98/18930, and is also referred to Sp36. As noted above, it is a protein from the Pht family and has the type II signal motif of LXXC.
- PhtD is disclosed in WO 00/37105, and is also referred to Sp036D. As noted above, it also is a protein from the Pht family and has the type II LXXC signal motif. In one embodiment the term 'PhtD' refers to SEQ ID NO:220.
- PhtB is disclosed in WO 00/37105, and is also referred to Sp036B. Another member of the PhtB family is the C3-Degrading
- Polypeptide as disclosed in WO 00/17370.
- This protein also is from the Pht family and has the type II LXXC signal motif.
- an immunologically functional equivalent is the protein Sp42 disclosed in WO 98/18930.
- a PhtB truncate (approximately 79kD) is disclosed in
- PhtE is disclosed in WO00/39299 and is referred to as BVH-3. Where any Pht protein is referred to herein, it is meant that immunogenic fragments or fusions thereof of the Pht protein can be used.
- a reference to PhtX includes immunogenic fragments or fusions thereof from any Pht protein.
- a reference to PhtD or PhtB does not exclude PhtDE (a fusion protein comprising PhtD and PhtE) or PhtBE (a fusion protein comprising PhtB and PhtE), respectively, as found, for example, in WO0198334.
- the at least one unconjugated to conjugated Streptococccus pneumoniae protein comprises at least one protein from the Poly histidine Triad family (for example, the protein may be selected from the group consisting of PhtD , PhtBD and PhtDE fusion protein).
- Streptococcus pneumoniae protein is a PhtD protein.
- the PhtD protein comprises an amino acid sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to the sequence at amino acids 21-838 of Sequence ID No.4 of WO00/37105.
- the at least one unconjugated or conjugated Streptococcus pneumoniae protein is detoxified pneumolysin (dPIy).
- the pneumolysin has been chemically detoxified.
- the pneumolysin has been chemically detoxified.
- the pneumolysin has been both chemically and genetically detoxified.
- the immunogenic composition of the invention comprises detoxified pneumolysin (dPIy) and PhtD.
- the immunogenic composition of the invention comprises unconjugated detoxified pneumolysin (dPIy) and unconjugated PhtD.
- choline binding proteins are non-covalently bound to phosphorylcholine moieties of cell wall teichoic acid and membrane-associated lipoteichoic acid. Structurally, they have several regions in common over the entire family, although the exact nature of the proteins (amino acid sequence, length, etc.) can vary.
- choline binding proteins comprise an N terminal region (N), conserved repeat regions (R1 and/or R2), a proline rich region (P) and a conserved choline binding region (C), made up of multiple repeats, that comprises
- CbpX Choline Binding Protein family
- CbpX includes proteins from the group consisting of Choline Binding Proteins as identified in W097/41151 , PbcA, SpsA, PspC, CbpA, CbpD and CbpG.
- CbpA is disclosed in W097/41 151.
- CbpD and CbpG are disclosed in WO00/29434.
- PspC is disclosed in
- PbcA is disclosed in W098/21337.
- SpsA is a choline binding protein disclosed in WO 98/39450.
- the Choline Binding Proteins are selected from the group consisting of CbpA, PbcA, SpsA and PspC.
- An embodiment of the invention comprises CbpX truncates wherein "CbpX” is defined above and “truncates” refers to CbpX proteins lacking 50% or more of the Choline binding region (C). Optionally such proteins lack the entire choline binding region.
- the protein truncates lack (i) the choline binding region and (ii) a portion of the N-terminal half of the protein as well, yet retain at least one repeat region (R1 or R2).
- the truncate retains 2 repeat regions (R1 and R2). Examples of such embodiments are NR1xR2 and R1xR2 as illustrated in W099/51266 or W099/51 188, however, other choline binding proteins lacking a similar choline binding region are also contemplated within the scope of this invention.
- the LytX family is membrane associated proteins associated with cell lysis.
- the N- terminal domain comprises choline binding domain(s).
- the LytX family does not have all the features found in the CbpX family noted above.
- the LytX family is considered distinct from the CbpX family.
- the LytX family C- terminal domain contains the catalytic domain of the LytX protein.
- the family comprises LytA, LytB and LytC.
- LytA is disclosed in Ronda et al., Eur J Biochem, 164:621-624 (1987).
- LytB is disclosed in WO 98/18930, and is also referred to as Sp46.
- LytC is also disclosed in WO 98/18930, and is also referred to as Sp91.
- An embodiment of the invention comprises LytC.
- LytX truncates wherein "LytX” is defined above and “truncates” refers to LytX proteins lacking 50% or more of the Choline binding region. Optionally such proteins lack the entire choline binding region.
- CbpX truncate-LytX truncate chimeric proteins or fusionproteins optionally the fusion protein comprises NR1xR2 (or R1xR2) of CbpX and the C-terminal portion (Cterm, i.e., the protein without the choline binding domains) of LytX (e.g., LytCCterm or Sp91 Cterm).
- CbpX is selected from the group consisting of CbpA, PbcA, SpsA and PspC.
- LytX is LytC (also referred to as Sp91 ).
- LytX is LytC (also referred to as Sp91 ).
- Another embodiment of the present invention is a PspA or PsaA truncate lacking the choline binding domain (C) and expressed as a fusion protein with LytX.
- LytX is LytC.
- PsaA and PspA both are discussed in the art. For example, PsaA and transmembrane deletion variants thereof have been described by Berry & Paton, Infect Immun 1996 Dec;64(12):5255-62.
- PspA and transmembrane deletion variants thereof have been described in, for example, US 5804193, WO 92/14488, and WO 99/53940.
- this protein has been described in the art, for example PcpA has been described in WO201 1/075823.
- the term 'PcpA' refers to a protein comprising at least 80%, 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO:2 or 7 from WO201 1/075823 or fragments of at least 100, 150, 200, 25 or more consecutive amino acids of SEQ ID NO:2 or 7 from WO201 1/075823.
- Sp128 and Sp130 are disclosed in WO00/76540.
- Sp125 is an example of a pneumococcal surface protein with the Cell Wall Anchored motif of LPXTG (where X is any amino acid). Proteins within this class of pneumococcal surface protein with this motif has been found to be useful within the context of this invention, and is therefore considered a further protein of the invention.
- Sp125 itself is disclosed in WO 98/18930, and is also known as ZmpB - a zinc metalloproteinase.
- Sp101 is disclosed in WO 98/06734 (where it has the reference # y85993). It is characterized by a Type I signal sequence.
- Sp133 is disclosed in WO 98/06734 (where it has the reference # y85992). It is also characterized by a Type I signal sequence. [0135] Any of these further S. pneumoniae proteins may be present is an unconjugated or conjugated form. One or more S. pneumoniae proteins is optionally conjugated to an
- S. pneumoniae saccharide (described in the section entitled Streptococcus pneumoniae capsular saccharide conjugates above).
- one or more S. pneumoniae proteins is conjugated to a saccharide from a different bacterium.
- the term 'conjugated to' in this context means that the protein is covalently bonded to a saccharide, in this situation the protein is acting as a carrier protein.
- the at least one further unconjugated or conjugated S. pneumoniae protein comprises a Poly Histidine family (PhtX) protein selected from the group consisting of PhtB, PhtE, PhtA, PhtBD and PhtDE.
- PhtX Poly Histidine family
- the immunogenic composition further comprises an adjuvant.
- Suitable adjuvants include, but are not limited to, aluminium salts (for example, aluminium phosphate or aluminium hydroxide), monophosphoryl lipid A (for example 3D-MPL), saponins (for example QS21 ), oil in water emulsions, blebs or outer membrane vesicle preparations from Gram negative bacterial strains (such as those taught by WO02/09746), lipid A or derivatives thereof, alkyl glucosamide phosphates or combinations of two or more of these adjuvants.
- the adjuvant is aluminium phosphate.
- the adjuvant comprises 100-750, 150-600, 200-500, 250-450, 300-400, or around 350 ⁇ g aluminium as aluminium phosphate per human dose.
- the present invention provides a vaccine comprising the immunogenic compositions of the invention.
- Embodiments herein relating to "immunogenic compositions" of the invention are also applicable to embodiments relating to "vaccines” of the invention, and vice versa.
- the vaccine comprises the immunogenic composition of the invention and a pharmaceutically acceptable excipient.
- the vaccines of the invention may be administered by any suitable delivery route, such as intradermal, mucosal e.g. intranasal, oral, intramuscular or subcutaneous. Other delivery routes are well known in the art. Vaccine preparation is generally described in Vaccine Design ("The subunit and adjuvant approach” (eds Powell M.F. & Newman M.J.) (1995) Plenum Press New York).
- the immunogenic composition of the invention is administered by the intramuscular delivery route.
- Intramuscular administration may be to the thigh or the upper arm. Injection is typically via a needle (e.g. a hypodermic needle), but needle-free injection may alternatively be used.
- a typical intramuscular dose is 0.5 ml.
- a further aspect of the invention is a method of making a vaccine of the invention comprising the steps of mixing the unconjugated S. pneumoniae protein with the adjuvant composition.
- a method of immunizing a subject against diseases caused by Streptococcus pneumoniae infection comprising administering to the subject a therapeutically effective dose of the immunogenic composition or vaccine of the invention.
- a method of immunizing a subject against diseases caused by Haemophilus influenzae infection comprising administering to the subject a therapeutically effective dose of the immunogenic composition or vaccine of the invention.
- a method of immunizing a subject against diseases caused by Streptococcus pneumoniae and Haemophilus influenzae infection comprising administering to the subject a therapeutically effective dose of the immunogenic composition or vaccine of the invention.
- the diseases comprise at least one disease selected from the group consisting of pneumonia, invasive pneumococcal disease (IPD), exacerbations of chronic obstructive pulmonary disease (COPD), otitis media, meningitis, bacteraemia, and conjunctivitis.
- the subject is a mammalian subject.
- the mammalian subject is selected from the group consisting of mouse, guinea pig and human.
- the subject is an adult human, optionally an elderly human.
- the subject is an infant human.
- an immunogenic composition or vaccine of the invention for use in the treatment or prevention of disease caused by Streptococcus pneumoniae infection.
- an immunogenic composition or vaccine of the invention for use in the treatment or prevention of disease caused by Haemophilus influenzae infection.
- the use comprises administration of the immunogenic composition to an adult human host, optionally an elderly human host.
- the use comprises administration of the immunogenic composition to an infant host.
- the diseases comprise at least one disease selected from the group consisting of pneumonia, invasive pneumococcal disease (IPD), exacerbations of chronic obstructive pulmonary disease (COPD), otitis media, meningitis, bacteraemia, and conjunctivitis.
- IPD invasive pneumococcal disease
- COPD chronic obstructive pulmonary disease
- otitis media meningitis, bacteraemia, and conjunctivitis.
- the diseases comprise at least one disease selected from the group consisting of pneumonia, invasive pneumococcal disease (IPD), exacerbations of chronic obstructive pulmonary disease (COPD), otitis media, meningitis, bacteraemia, and conjunctivitis,
- IPD invasive pneumococcal disease
- COPD chronic obstructive pulmonary disease
- otitis media meningitis, bacteraemia, and conjunctivitis
- the use comprises administration of the immunogenic composition or vaccine of the invention to a host selected from the group consisting of an adult human host, an elderly human host and an infant human host.
- Fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates are useful as immunogens in subjects such as mammals, particularly humans.
- the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates are useful in inducing an immune response against H. influenzae in subjects, particularly humans.
- the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates are useful in inducing an immune response against Streptococcus pneumoniae in subjects, particularly humans.
- the fusion proteins of formula (I) are useful in the treatment or prevention of otitis media and/or AECOPD and/or pneumonia.
- the invention further provides a method for the treatment or prevention of otitis media in a subject in need thereof comprising administering to said subject a therapeutically effective amount of an immunogenic composition comprising the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates as described herein.
- the invention provides a method for the treatment or prevention of acute exacerbations of chronic obstructive pulmonary disease (AECOPD) in a subject in need thereof comprising administering to said subject a therapeutically effective amount of an immunogenic composition comprising the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates as described herein.
- AECOPD chronic obstructive pulmonary disease
- the invention provides a method for the treatment or prevention of pneumonia in a subject in need thereof comprising administering to said subject a therapeutically effective amount of an immunogenic composition comprising the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates as described herein.
- the invention provides a method for the treatment or prevention of a H. influenzae infection or disease in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of an immunogenic composition comprising the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates as described herein.
- the invention provides a method for the treatment or prevention of a S. pneumoniae infection or disease in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of an immunogenic composition comprising the fusion proteins of formula (I) and Streptococcus pneumoniae capsular saccharide conjugates as described herein. Further definitions
- a "subject” as used herein is a mammal, including humans, non-human primates, and non-primate mammals such as members of the rodent genus (including but not limited to mice and rats) and members of the order Lagomorpha (including but not limited to rabbits).
- adjuvant means a compound or substance that, when administered to a subject in conjunction with a vaccine, immunotherapeutic, or other antigen- or immunogen- containing composition, increases or enhances the subject's immune response to the administered antigen or immunogen (as compared to the immune response that would be obtained in the absence of adjuvant). This is to be distinguished from "adjuvant therapy", defined by the National Cancer Institute of the United States Institutes of Health in the context of cancer treatment as additional treatment given after the primary treatment, to lower the risk that the cancer will recur.
- Conservative substitutions are well known and are generally set up as the default scoring matrices in sequence alignment computer programs. These programs include PAM250 (Dayhoft M.O. et a/., (1978), "A model of evolutionary changes in proteins", In “Atlas of Protein sequence and structure” 5(3) M.O. Dayhoft (ed.), 345-352), National Biomedical Research Foundation, Washington, and Blosum 62 (Steven Henikoft and Jorja G. Henikoft (1992), "Amino acid substitution matrices from protein blocks"), Proc. Natl. Acad. Sci. USA 89 (Biochemistry): 10915-10919.
- the invention further provides fusion proteins of formula (I) containing conservative amino acid substitutions.
- the fusion proteins of formula (I) may contain a conservative substitution of any amino acid from PE or PilA of H. influenzae as described in any of the sequences set forth herein (for example, any PE sequence set forth in SEQ ID NO. 4 - SEQ ID NO. 57 and/or any PilA sequence set forth in SEQ ID NO. 58 - SEQ ID NO. 121 )
- signal peptide refers to a short (less than 60 amino acids, for example, 3 to 60 amino acids) polypeptide present on precursor proteins (typically at the N terminus), and which is typically absent from the mature protein.
- the signal peptide (sp) is typically rich in hydrophobic amino acids.
- the signal peptide directs the transport and/or secretion of the translated protein through the membrane.
- Signal peptides may also be called targeting signals, transit peptides, localization signals, or signal sequences.
- the signal sequence may be a co-translational or post-translational signal peptide.
- a heterologous signal peptide may be cleaved from a fusion protein construct by signal peptide peptidases during or after protein transportation or secretion.
- the signal peptide peptidase is signal peptide peptidase I.
- a "heterologous" signal peptide is one which is not associated with the protein as it exists in nature.
- treatment means the prevention of occurrence of symptoms of the condition or disease in a subject, the prevention of recurrence of symptoms of the condition or disease in a subject, the delay of recurrence of symptoms of the condition or disease in a subject, the decrease in severity or frequency of symptoms of the condition or disease in a subject, slowing or eliminating the progression of the condition and the partial or total elimination of symptoms of the disease or condition in a subject.
- ATP adenosine triphosphate
- BCA bicinchoninic acid
- BSA bovine serum albumin
- CaCI 2 calcium chloride
- DNA deoxyribonucleic acid
- DSC differential scanning calorimetry
- dNTP deoxynucleoside triphosphate
- EDTA ethylenediaminetetraacetic acid
- HEPES 4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid
- IMAC immobilized metal affinity chromatography
- IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
- KCI potassium chloride
- K 2 HP0 4 dibasic potassium phosphate
- KH 2 PO 4 monobasic potassium phosphate
- LDS lithium dodecyl sulfate
- MES 2-( V-morpholino)ethanesulfonic acid
- MgCI 2 magnesium chloride
- RPM revolutions per minute
- mM millimolar
- ⁇ _ microliter
- NaCI sodium chloride
- Na 2 HP0 4 dibasic sodium phosphate
- NaH 2 P0 4 monobasic sodium phosphate
- nm nanometer
- PBS phosphate buffered saline
- PS polysaccharide and may be used interchangeably with the term 'saccharide'.
- Fusion proteins were produced with different signal peptides and amino acid linker sequences. These fusion proteins allowed for secretion of both Protein E and PilA (or fragments thereof) without being restricted to a single bacterial strain. The fusion protein is released into the periplasm after removal of the heterologous signal peptide by a signal peptide peptidase. Fusion protein purified from the bacteria does not contain the heterologous signal peptide. "Purified" proteins are removed from the bacteria and lack the signal peptide.
- Table 3 Fusion Protein Constructs containing PilA and Protein E.
- MIKFLSALIL LLVTTAAQA Nad A signal peptide (DNA) - SEQ ID NO. 133:
- the single underlined portion of the amino acid sequences is from PilA from Haemophilus influenzae strain 86-028NP.
- the embolded underlined portion of the amino acid sequences was derived from Protein E from Haemophilus influenza strain 772.
- LVL312 protein: (flgl sp)(E)(PilA aa 40-149)(GG)(ProtE aa 18-160)(GGHHHHHH) - SEQ ID NO. 136
- LVL291 (Protein)(pe ⁇ sp)(ProtE aa 19-160)(GG)(PilA aa40-149)(GGHHHHHH) - SEQ ID NO. 138
- LVL268 protein: (pelB sp)(D)(ProtE aa 20-160)(GG)(PilA aa40-149)(GGHHHHHH) - SEQ ID NO. 140:
- LVL269 protein: (nadA sp)(ATNDDD)(ProtE aa 22-160)(GG)(PilA aa 40-149)(GGHHHHHH) - SEQ ID NO.142
- LVL270 protein: (MHHHHHH)(ProtE aa 17-160)(GG)(PilA aa40-149) - SEQ ID NO. 144: MHHHHHHSAQ IQKAEQNDVK LAPPTDVRSG YIRLVKNVNY YIDSESIWVD NQEPQIVHFD AWNLDKGLY VYPEPKRYAR SVRQYKILNC ANYHLTQVRT DFYDEFWGQG LRAAPKKQKK HTLSLTPDTT LYNAAQIICA NYGEAFSVDK KGGTKKAAVS ELLQASAPYK ADVELCVYST NETTNCTGGK NGIAADITTA KGYVKSVTTS NGAITVKGDG TLANMEYILQ ATGNAATGVT WTTTCKGTDA SLFPANFCGS VTQ
- LVL315 protein: (pelB sp)(MD)(ProtE aa 22-160)(GG)(PilA aa40-149)(GGHHHHHH) - SEQ ID NO. 146:
- LVL317 (protein): (pelB sp)(ProtE aa 19-160)(GG)(PilA aa40-149) - SEQ ID NO. 148:
- LVL318 protein: (pelB sp)(MD)(ProtE aa 22-160)(GG)(PilA aa40-149) - SEQ ID NO. 150: MKYLLPTAAA GLLLLAAQPA MAMDKAEQND VKLAPPTDVR SGYIRLVKNV NYYIDSESIW VDNQEPQIVH FDAWNLDKG LYVYPEPKRY ARSVRQYKIL NCANYHLTQV
- LVL702 protein: (pelB sp)(ProtE aa 20-160)(GG)(PilA aa40-149)(GGHHHHHH) - SEQ ID NO. 182:
- LVL736 protein: (pelB sp)(ProtE aa 17-160)(GG)(PilA aa40-149)(GGHHHHHH) - SEQ ID NO. 184:
- LVL737 protein: (pelB sp)(ProtE aa 18-160)(GG)(PHA aa40- 149)(G GHHHHHH) - SEQ ID NO. 186:
- LVL738 protein: (pelB sp)(ProtE aa 22-160) (GG) (Pit A aa40- 149)(G GHHHHHH) - SEQ ID NO. 188: MKYLLPTAAA GLLLLAAQPA MAKAEQNDVK LAPPTDVRSG YIRLVKNVNY YIDSESIWVD NQEPQIVHFD AVVNLDKGLY VYPEPKRYAR SVRQYKILNC ANYHLTQVRT DFYDEFWGQG LRAAPKKQKK HTLSLTPDTT LYNAAQIICA NYGEAFSVDK KGGTKKAAVS ELLQASAPYK ADVELCVYST NETTNCTGGK NGIAADITTA KGYVKSVTTS NGAITVKGDG TLANMEYILQ ATGNAATGVT WTTTCKGTDA SLFPANFCGS VTQGGHHHHH H
- LVL739 protein: (pelB sp)(ProtE aa 23-160)(GG)(PHA aa40- 149)(G GHHHHHH) - SEQ ID NO. 190:
- LVL740 protein: (pelB sp)(ProtE aa 24-160)(GG)(PHA aa40- 149)(G GHHHHHH) - SEQ ID NO. 192:
- LVL735 protein: (pelB sp)(ProtE aa 20-160) (GG) (Pit A aa40-149) - SEQ ID NO. 194: MKYLLPTAAA GLLLLAAQPA MAIQKAEQND VKLAPPTDVR SGYIRLVKNV NYYIDSESIW VDNQEPQIVH FDAWNLDKG LYVYPEPKRY ARSVRQYKIL NCANYHLTQV RTDFYDEFWG QGLRAAPKKQ KKHTLSLTPD TTLYNAAQII CANYGEAFSV DKKGGTKKAA VSELLQASAP YKADVELCVY STNETTNCTG GKNGIAADIT TAKGYVKSVT TSNGAITVKG DGTLANMEYI LQATGNAATG VTWTTTCKGT DASLFPANFC GSVTQ
- LVL778 protein: (pelB sp)(ProtE aa 17-160)(GG)(PHA aa40-149) - SEQ ID NO. 196:
- LVL779 protein: (pelB sp)(ProtE aa 18-160)(GG)(PHA aa40-149) - SEQ ID NO. 198:
- LVL780 protein: (pelB sp)(ProtE aa 22-160)(GG)(PHA aa40-149) - SEQ ID NO. 200:
- LVL781 protein: (pelB sp)(ProtE aa 23-160)(GG)(PHA aa40-149) - SEQ ID NO. 202:
- LVL782 protein: (pelB sp)(ProtE aa 24-160)(GG)(PHA aa40-149) - SEQ ID NO. 204:
- Primers for amplifying PE from H. influenzae strain 772 were designed based on the sequence of H. influenzae strain Hi Rd.
- the 5' primer sequence contains one nucleotide difference compared to the NTHi 772 sequence, introducing an amino acid difference at position 24 when compared with the currently reported NTHi 772 genome sequence.
- Amino acid #24 in the fusion protein constructs is E (glutamic acid) instead of K (lysine) as found in NTHi 772.
- a polymerase chain reaction (PCR) preparation of the following components was prepared (specific components are subsequently exemplified): 36.6 ⁇ of deionized water, 5 ⁇ of buffer #1 10X, 5 ⁇ of dNTPs 2mM, 2 ⁇ MgCI 2 25 mM, 0.4 ⁇ of primer #1 (50 ⁇ ), 0.4 ⁇ of primer #2 (50 ⁇ ), 0.5 ⁇ of template (100 ng/ ⁇ ) and 0.4 ⁇ of KOD HiFi DNA polymerase 2.5 units/ ⁇ (NOVAGEN ® ) was formulated.
- PCR polymerase chain reaction
- Polymerase chain reaction involved 25 cycles of 15 seconds of denaturation at 98°C, 2 seconds for annealing at 55°C and 20 seconds of primer extension at 72°C.
- the PCR products were purified using QIAQUICK ® PCR purification kit (QIAGEN ® ). This product was used under conditions recommended by the supplier which were: the addition of 5 volumes Buffer PB, provided in the QIAQUICK ® PCR purification kit, to 1 volume of the PCR preparation.
- the PCR preparation with Buffer PB was subsequently mixed by vortex.
- a QIAQUICK ® column was placed into a 2 ml collection tube. To bind DNA in the PCR preparation to the column, the mixed sample was applied to the
- Each QIAQUICK ® column was placed in a clean 1.5 ml microcentrifuge tube. To elute the DNA, 33 ⁇ water was added to the center of the QIAQUICK ® membrane and the column was centrifuged for 1 minute at 14 000 RPM. Restriction enzymes and buffer related were obtained from New England BioLabs.
- pET26b vector 100 ng/ ⁇
- 2 ⁇ of NEBuffer 2 New England Biolabs, 1X NEBuffer 2: 50 mM NaCI, 10 mM Tris-HCI, 10 mM MgCI 2 , 1 mM dithiothreitol, pH 7.9 at 25°C
- 1 ⁇ of Hindlll (20 000 units/ml) and 1 1 ⁇ of deionized water were mixed and incubated for two hours at 37°C for DNA digestion.
- a second step of purification was performed using the QIAQUICK ® PCR purification kit (QIAGEN ) with the procedure described above.
- Ligation was performed using Quick T4 DNA ligase and Quick Ligation Reaction Buffer from New England BioLabs. For example, around 10 ng of vector and 30 ng of insert in 10 ⁇ of deionized water were mixed with 10 ⁇ of 2X Quick Ligation Reaction Buffer (New England Biolabs, 132 mM Tris-HCI, 20 mM MgCI 2 , 2mM dithiothreitol, 2 mM ATP, 15% polyethylene glycol, pH 7.6 at 25°C) and 1 ⁇ of Quick T4 DNA ligase (New England Biolabs). The enzymatic reaction was incubated for 5 minutes at room temperature before transformation.
- 2X Quick Ligation Reaction Buffer New England Biolabs, 132 mM Tris-HCI, 20 mM MgCI 2 , 2mM dithiothreitol, 2 mM ATP, 15% polyethylene glycol, pH 7.6 at 25°C
- Quick T4 DNA ligase New England Biolabs
- a PCR preparation of the following components was prepared: 40 ⁇ of deionized water, 5 ⁇ of reaction buffer 10X, 1 ⁇ of dNTPs mix, 1 ⁇ of primer #1 (10 ⁇ ), 1 ⁇ of primer #2 (10 ⁇ ), 1 ⁇ of template (25 ng/ ⁇ ) and 1 ⁇ of PfuUltra High-Fidelity DNA polymerase 2.5 units/ ⁇ (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies, Stratagene Division) was formulated.
- Polymerase chain reaction involved one cycle of denaturation at 95°C for 30 sec, 18 cycles of 30 sec of denaturation at 95°C, 1 min for annealing at 55°C and 5 min 30 sec of primer extension at 68°C.
- the PCR products were digested using 1 ⁇ of Dpnl restriction enzyme at 37°C for one hour before transformation.
- the amplification primers were designed based on the available strain Hi Rd sequence (at that time, the 772 sequence was not known).
- the 5' primer sequence contains one mutation compared to the NTHi 772 sequence (sequence as now available), introducing one amino acid difference in PE coding sequence at position 24, glutamic acid (E) instead of lysine (K).
- E glutamic acid
- K lysine
- a DNA fragment coding for a PilA gene fragment (amino acids 40 to 149 of SEQ ID NO. 58, SEQ ID NO. 127), which excludes its leader peptide as well as a portion of the predicted hydrophobic alpha helix, was amplified from genomic DNA of NTHi strain 86- 028NP and cloned into the pET15 expression vector.
- the vector pRIT16790 (containing amino acids 40 to 149 from NTHi strain 86-028NP) was used as a template to generate the vector pRIT16671.
- the PilA gene fragment was amplified by PCR using the vector pRIT16790 and primers MDES PILA-3 and MDES PILA-4.
- the PilA fragment was cloned into the pET-26 expression vector using Ndel I Xhol restriction sites.
- the DNA sequence encoding six histidine (his) amino acids was incorporated into the 5' primer to add six histidines (6xhis) at the N- terminal end of the PilA sequence (MDES PILA-3).
- MDES PILA-3 The DNA sequence encoding six histidine (his) amino acids was incorporated into the 5' primer to add six histidines (6xhis) at the N- terminal end of the PilA sequence (MDES PILA-3).
- LVL312 Frgl signal peptide-E-PilA fragment-GG-PE fragment-GGHHHHHH
- a polymerase chain reaction was performed to amplify the PilA gene (amino acids 40-149 / strain 86-028NP) using the pRIT16671 vector as a template and primers CAN534 and CAN537.
- DNA sequence corresponding to Flgl signal peptide (sp) and glutamic acid (E) amino acid was incorporated into the 5' primer (CAN534).
- DNA sequence corresponding to the two glycine (GG) amino acids linker and the N-terminal PE amino acids were incorporated into the 3' primer (CAN537).
- Another polymerase chain reaction was performed to amplify the PE gene (amino acids 18-160) using pRIT1671 1 vector as a template and primers CAN536 and CAN538.
- DNA sequence corresponding to the C-terminal PilA amino acids and GG amino acids were incorporated into the 5' primer to link pilA to PE sequence (CAN536).
- DNA sequence corresponding to the GG amino acids linker and 6xhis amino acids were incorporated into the 3' primer (CAN538).
- a third polymerase chain reaction was performed to amplify the PilA and PE genes in fusion with the Flgl signal peptide at the N-terminus, a glutamic acid (E) amino acid between Flgl and pilA, a GG linker between PilA and PE sequences and a GG linker between PE and the 6xhis amino acids at the C-terminus.
- E glutamic acid
- the products of the two polymerase chain reactions described above were used as a template with primers CAN534 and CAN538.
- DNA sequence corresponding to Ndel restriction site was incorporated into the 5' primer and Hindlll restriction site was incorporated into the 3' primer.
- the generated PCR product was then inserted into the pET-26b(+) cloning vector (NOVAGEN ® ).
- LVL291 (pelB signal peptide-PE fragment-GG-PilA fragment-GG-6xhis)
- a polymerase chain reaction was performed to amplify the PE gene (amino acids 19-160) using the pRIT16711 vector as a template and primers CAN544 and CAN546.
- DNA sequence corresponding to pelB signal peptide (sp) amino acids was incorporated into the 5' primer (CAN544).
- CAN546 DNA sequence corresponding to GG amino acids linker and the N-terminal PilA amino acids were incorporated into the 3' primer.
- Another polymerase chain reaction was performed to amplify the PilA gene (amino acids 40-149 of SEQ ID NO.
- LVL291 a third polymerase chain reaction was performed to amplify the PE and PilA genes in fusion with the pelB signal peptide at the N-terminus, a GG linker between the PE and PilA sequences and a GG linker between PilA and 6xhis amino acids at the C-terminus.
- LVL268 (pelB signal peptide-D-PE fragment-GG-PilA fragment-GG-6xhis)
- a polymerase chain reaction was performed to amplify the PE gene (amino acids 20-160) using the pRIT16711 vector as a template with primers CAN547 and CAN546.
- DNA sequence corresponding to the pelB signal peptide (sp) amino acids and aspartic acid (D) amino acid were incorporated into the 5' primer (CAN547).
- CAN546 DNA sequence corresponding to GG amino acids linker and the N-terminal PilA amino acids
- Another polymerase chain reaction was performed to amplify the PilA gene (amino acids 40-149 / NTHi strain 86-028NP) using the pRIT16671 vector as a template with CAN545 and CAN535.
- DNA sequence corresponding to the C-terminal PE amino acids and GG amino acids were incorporated into the 5' primer (CAN545) to link the PilA sequence to the PE sequence.
- DNA sequence corresponding to linker GG amino acids and 6xhis amino acids were incorporated into the 3' primer (CAN535).
- LVL268 a third polymerase chain reaction was performed to amplify the PE and PilA genes in fusion with the pelB signal peptide at the N-terminus, a D amino acid between pelB signal peptide and PE, a GG linker between PE and pilA sequences and a GG linker between PilA and 6xhis amino acids in C-term.
- the products of the two polymerase chain reactions described above were used as a template with primers CAN547 and CAN535. DNA sequence corresponding to Ndel restriction site was incorporated into the 5' primer and Hindlll restriction site was incorporated into the 3' primer.
- LVL269 NadA signal peptide-ATNDDD-PE fragment-GG-PilA fragment-GG-6xhis
- a polymerase chain reaction was performed to amplify the PE gene (amino acids 22-160 of SEQ ID NO. 4) using the pRIT1671 1 vector as a template with primers CAN548 and CAN546.
- DNA sequence corresponding to pelB signal peptide (sp) amino acids and ATNDDD amino acids were incorporated into the 5' primer (CAN548).
- DNA sequence corresponding to the GG amino acids linker and the N-terminal PilA amino acids were incorporated into the 3' primer (CAN546).
- Another polymerase chain reaction was performed to amplify the PilA gene (amino acids 40-149 of SEQ ID NO. 58, SEQ ID NO. 127) using the pRIT16671 vector as a template with primers CAN545 and CAN535.
- DNA sequence corresponding to the C-terminal PE amino acids and GG amino acids were incorporated into the 5' primer to link the PilA sequence to the PE sequence (CAN545).
- DNA sequence corresponding to linker GG amino acids and 6xhis amino acids were incorporated into the 3' primer (CAN535).
- LVL269 a third polymerase chain reaction was performed to amplify the PE and PilA gene in fusion with the NadA signal peptide at the N- terminus, ATNDDD amino acids between the pelB signal peptide and PE, a GG linker between the PE and pilA sequences and a GG linker between PilA and 6xhis amino acids at the C- terminus.
- the products of the two polymerase chain reactions describe above were used as a template with primers CAN548 and CAN535. DNA sequence corresponding to Ndel restriction site was incorporated into the 5' primer and Hindlll restriction site was incorporated into the 3' primer.
- the generated PCR product was then inserted into the pET-26b(+) cloning vector (NOVAGEN ® ).
- LVL270 M-6xHis-PE fragment-GG-PilA fragment
- a polymerase chain reaction was performed to amplify the PE gene (amino acids 17-160) using the pRIT1671 1 vector as a template with primers CAN540 and CAN542.
- DNA sequence corresponding to 6xhis amino acids were incorporated into the 5' primer (CAN540).
- CAN542 DNA sequence corresponding to the GG amino acids linker and the N-terminal PilA amino acids were incorporated into the 3' primer (CAN542).
- Another polymerase chain reaction was performed to amplify the PilA gene (amino acids 40-149 / NTHi strain 86-028NP) using pRIT16671 vector as a template with primers CAN541 and CAN543. DNA sequence corresponding to the C-terminal PE amino acids and GG amino acids were incorporated into the 5' primer (CAN541 ) to link the PilA to the PE sequence. Finally, to generate LVL270, a third polymerase chain reaction was performed to amplify the 6-his-PE-GG-PilA gene in fusion. To achieve this amplification, the products of the two polymerase chain reactions describe above were used as a template with primers CAN540 and CAN543.
- LVL317 (pelB signal peptide-PE fragment-GG-pilA fragment)
- a site-directed mutagenesis was performed to incorporate a stop codon between the PilA gene and the DNA sequence corresponding to GGHHHHHH amino acid residues (SEQ ID NO: 3) using LVL291 as a template with primers CAN678 and CAN679 and the QuikChange II Site-Directed
- LVL318 (pelB signal peptide-MD-PE-GG-PilA)
- a site-directed mutagenesis was performed to incorporate a stop codon between the PilA gene and the DNA sequence corresponding to GGHHHHHH amino acid residues (SEQ ID NO: 3) using LVL315 as a template with primers CAN678 and CAN679 and the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene Division).
- LVL702 (LVL291 AQ)
- a polymerase chain reaction was performed using the LVL291 vector as template and primers CAN1517 and CAN1518. Deletion of three nucleotides corresponding to the amino acid Q at the position 23 on LVL291 sequence was incorporated to the 5' primer. The only difference between LVL702 and LVL291 is the deletion of amino acid Q at the position 23 on LVL291 sequence. Ndel and Hindlll restriction sites were incorporated into the 5' and 3' primers respectively. The generated PCR product was then inserted into the pET- 26b(+) cloning vector (NOVAGEN ® ).
- LVL735 (LVL317 AQ)
- a polymerase chain reaction was performed using the LVL317 vector as template and primers CAN1517 and CAN1519. Deletion of three nucleotides corresponding to the amino acid Q at the position 23 on LVL317 sequence was incorporated to the 5' primer. The only difference between LVL735 and LVL317 is the deletion of amino acid Q at the position 23 on LVL317 sequence. Ndel and Hindlll restriction sites were incorporated into the 5' and 3' primers respectively. The generated PCR product was then inserted into the pET- 26b(+) cloning vector (NOVAGEN ® ).
- LVL736 (LVL291 + SA)
- a site-directed mutagenesis was performed to add amino acids S and A between amino acid 22 and 23 on LVL291 sequence.
- LVL291 was used as template with primers CAN1531 and CAN1532 and the QuikChange II Site-Directed
- LVL737 (LVL291 + A)
- LVL291 was used as template with primers CAN 1529 and CAN 1530 and the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene Division).
- LVL738 (LVL291 AQIQ)
- a site-directed mutagenesis was performed to delete amino acids Q, I and Q at positions 23 to 25 on LVL291 sequence.
- LVL291 was used as template with primers CAN1523 and CAN1524 and the QuikChange II Site-Directed
- LVL739 (LVL291 AQIQK)
- a site-directed mutagenesis was performed to delete amino acids Q, I, Q and K at positions 23 to 26 on LVL291 sequence.
- LVL291 was used as template with primers CAN1525 and CAN1526 and the QuikChange II Site-Directed
- LVL740 (LVL291 AQIQKA)
- a site-directed mutagenesis was performed to delete amino acids Q, I, Q, K and A at positions 23 to 27 on LVL291 sequence.
- LVL291 was used as template with primers CAN1527 and CAN1528 and the QuikChange II Site-Directed
- LVL778 (LVL736 A6xHis tag), LVL779 (LVL737 A6xHis tag), LVL780 (LVL738 A6xHis tag), LVL781 (LVL739 A6xHis tag) and LVL782 (LVL740 A6xHis tag)
- LVL736, LVL737, LVL738, LVL739 and LVL740 vectors as template, respectively, with primers CAN1669 and CAN543.
- Deletion of 6xHis tag corresponds to the amino acid sequence GGHHHHHH (SEQ ID NO.
- CACACACATATGAAACACTTTCCATCCAAAGTACTGACCACAGCCATCCTTGC CAC I I I CTGTAGCGGCG CACTG G C AGC C AC AAAC G AC G AC G ATAAG G CTG A
- Escherichia coli BLR (DE3) or E. coli HMS (DE3) cells were transformed with plasmid DNA according to standard methods with CaCI 2 -treated cells. (Hanahan D. « Plasmid transformation by Simanis. » In Glover, D. M. (Ed), DNA cloning. IRL Press London. (1985): p. 109-135.). Briefly, BLR (DE3) or HMS174(DE3) competent cells were gently thawed on ice. Approximately 4 ⁇ of plasmid (10-100 ng) were mixed using 50-100 ⁇ competent cells. Thereafter, this formulation was incubated on ice for 30 min.
- the formulation was heat pulsed at 42°C for 45 seconds then incubated on ice for 2 minutes.
- SOC medium Super Optimal broth with Catabolite repression
- LB Luria-Bertani
- BLR is a recA ⁇ derivative of BL21 (F- ompT hsdSB(rB- mB-) gal dcm (DE3).
- This E. coli strain used for expression of recombinant proteins improves plasmid monomer yields and may help stabilize target plasmids containing repetitive sequences or whose products may cause the loss of the DE3 prophage.
- the detailed genotype of E.coli BLR (DE3) has been published by NOVAGEN ® .
- HMS174 (DE3): HMS174 strains provide the recA mutation in a K-12 background. Like BLR, these strains may stabilize certain target genes whose products may cause the loss of the DE3 prophage.
- the detailed genotype of E.coli HMS174 (DE3) has been published by NOVAGEN ® . (F- recA 1 /7sdR(rK12- mK12+) (DE3) (Rif R ).
- the BLR (DE3) cultures were cooled down (-20°C, 20 minutes or 4°C, 1 hour, preferably at 4°C for 1 hour) before inducing the expression of the recombinant protein by addition of 1 mM isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG; EMD Chemicals Inc., catalogue number: 5815) and incubation overnight at 16, 22 and 30°C, or 3 hours at 37°C with agitation of 250 RPM, preferably overnight at 22°C. After the induction period the cultures were centrifuged at 14 000 RPM for 5 minutes or 6 000 RPM for 15 minutes and supernatant (media fraction sample) and pellets (containing soluble and insoluble fractions) were frozen at -20°C separately.
- IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
- Example 4 Protein purification using shake flask, cell pastes. His tagged constructs
- HEPES 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid
- 20 to 50 mM bicine buffer may be used instead of HEPES buffer containing NaCI.
- 20 mM bicine buffer may be used.
- Bacteria were lysed using a Constant System 1.1 KW 2 X 30 000 PSI (pounds per square inch). Soluble (supernatant) and insoluble (pellet) components were separated by centrifugation at 20 OOOg for 20 min at 4°C.
- 6-His tagged-proteins were purified under native conditions on immobilized metal affinity chromatography (IMAC) using PROFINIATM protein purification protocol (Bio-Rad Laboratories, Inc.).
- the soluble components were loaded on a 5ml His Trap column (Bio-Rad Laboratories, Inc.) preequilibrated with the same buffer used for bacterial resuspension; the soluble components were added at up to 5 ml/min (producing a "flow through fraction") After loading on the column, the column was washed with 10 column volumes of the same buffer at a rate of 10 ml/min (producing a "wash fraction #1 ).
- a second wash using 20 mM bicine buffer or 20 mM HEPES buffer (pH 8.0) containing 500 mM NaCI and 20 mM imidazole was performed, producing a "wash fraction #2). Elution was performed using 2 column volumes of 20mM HEPES buffer or 50mM bicine buffer (pH 8.0) containing 500 mM NaCI and 250 mM imidazole at a rate of 10 ml/min, producing an "elution fraction".
- 1 ml of culture after induction was centrifuged at 14 000 RPM for 2 min.
- the pellet was resolubilized using 40 ⁇ of BUGBUSTER ® Protein Extraction Reagent (NOVAGEN ® , EMD4 Biosciences, Merck), creating a cell suspension.
- the cell suspension was incubated on a rotating platform for 10 min at room temperature.
- the cell suspension was then centrifuged at 14 000 RPM for 2 min to separate the soluble fraction.
- the resulting pellet (insoluble fraction) was resolubilized using 70 ⁇ of deionized water, 5 ⁇ of dithiothreitol (DTT) 1 M and 25 ⁇ of NUPAGE ® LDS (Lithium Dodecyl Sulphate) Sample Buffer 4X (INVITROGENTM).
- the soluble fraction (supernatant from the cell suspension of the resolubilized pellet) was added to 30 ⁇ of deionized water, 5 ⁇ of DTT 1 M and 25 ⁇ of LDS Sample Buffer 4X.
- the media fraction 100 ⁇ of the supernatant from the induced whole cell culture following centrifugation (see, for example, Example 3 above) was concentrated by adding 500 ⁇ of RC reagent I (Bio-Rad Laboratories, Inc.); the sample was mixed and incubated for 1 min at room temperature. Then, 500 ⁇ of Reagent II (Bio-Rad Laboratories, Inc.) was added to the sample and mixed. This formulation was centrifuged at 14 000 RPM for 10 min. The pellet was resolubilized using 28 ⁇ of deionized water, 2 ⁇ of DTT 1 M and 10 ⁇ of LDS SB 4X.
- purified proteins for example, obtained as described in Example 4
- purified proteins were prepared for SDS-PAGE analysis by adding 70 ⁇ of sample, 5 ⁇ of DTT 1 M and 25 ⁇ of LDS Sample Buffer 4X.
- the gel was loaded with a 20 ul sample from a master mix comprising 70 ⁇ of a purified protein fraction, 5 ⁇ of DTT 1 M and 25 ⁇ of LDS SB 4X. After samples were run on NUPAGE ® Bis-Tris 4-12% gels, the proteins were transferred to nitrocellulose membranes.
- Nitrocellulose membranes were blocked for 30 minutes at 37°C, 60 RPM using 3 % milk / PBS 1X fresh solution. After the blocking incubation, Primary Antibodies were added (6X His Tag ® antibody, Abeam PLC, catalogue number: ab9108) at a dilution of: 1 : 1000 in 3 % milk / PBS 1X fresh solution for 1 hour at 37°C, 60 RPM. After that, membranes were washed three times, for 5 minutes each, at room temperature using 0.02% polsorbate 20 (for example, TWEENTM 20) / PBS 1X.
- Primary Antibodies 6X His Tag ® antibody, Abeam PLC, catalogue number: ab9108
- membranes were washed three times for 5 minutes at room temperature using 0.02% polysorbate 20 (for example, TWEENTM 20) / PBS 1X before the membrane expositions to 5- bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (for example, BCIP ® /NBT from Sigma- Aldrich ® , 1 tablet / 10 ml water).
- polysorbate 20 for example, TWEENTM 20
- PBS 1X 0.02% polysorbate 20
- 5- bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium for example, BCIP ® /NBT from Sigma- Aldrich ® , 1 tablet / 10 ml water.
- Figure 5. SDS-PAGE of induced (1 mM and 10 ⁇ IPTG) bacterial extracts for fusion protein construct LVL317. Extracts from before (Nl) and after induction (In), Soluble fraction (S), Insoluble fraction (I).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Pulmonology (AREA)
- Molecular Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Rheumatology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Pain & Pain Management (AREA)
- Ophthalmology & Optometry (AREA)
- Hematology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicinal Preparation (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13779190.1A EP2908855B1 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae . |
| CN201380066162.9A CN104968366B (zh) | 2012-10-17 | 2013-10-15 | 包含一种或多种肺炎链球菌荚膜糖缀合物和含有来自流感嗜血杆菌的蛋白E和/或PilA的蛋白组分的免疫原性组合物 |
| JP2015537216A JP6236086B2 (ja) | 2012-10-17 | 2013-10-15 | 1種以上の肺炎球菌莢膜糖類コンジュゲートとインフルエンザ菌由来のタンパク質Eおよび/またはPilAを含むタンパク質成分とを含む免疫原性組成物 |
| EA201590490A EA201590490A1 (ru) | 2012-10-17 | 2013-10-15 | ИММУНОГЕННАЯ КОМПОЗИЦИЯ, СОДЕРЖАЩАЯ ОДИН ИЛИ БОЛЕЕ КОНЪЮГАТОВ КАПСУЛЬНЫХ САХАРИДОВ STREPTOCOCCUS PNEUMONIAE И БЕЛКОВЫЙ КОМПОНЕНТ, ВКЛЮЧАЮЩИЙ БЕЛОК Е И/ИЛИ PilA ИЗ HAEMOPHILIUS INFLUENZAE |
| CA2888310A CA2888310C (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae |
| MX2015004949A MX365842B (es) | 2012-10-17 | 2013-10-15 | Composicion inmunogenica que comprende 1 o mas conjugados de sacaridos capsulares de streptococcus pneumoniae y un componente proteico que comprende proteinas e y/o pila de haemophilus influenzae. |
| KR1020157013039A KR20150072444A (ko) | 2012-10-17 | 2013-10-15 | 하나 이상의 스트렙토코커스 뉴모니애 캡슐 사카라이드 컨쥬게이트 및 해모필루스 인플루엔자로부터의 단백질 E 및/또는 PilA를 포함하는 단백질 성분을 포함하는 면역원성 조성물 |
| ES13779190.1T ES2640320T3 (es) | 2012-10-17 | 2013-10-15 | Composición inmunogénica que comprende 1 o más conjugados de sacáridos capsulares de Streptococcus pneumoniae y un componente proteico que comprende proteína E y/o PilA de Haemophilus influenzae |
| SG11201502634TA SG11201502634TA (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae. |
| AU2013331781A AU2013331781A1 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition comprising 1 or more Streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising Protein E and/or PilA from Haemophilus influenzae. |
| BR112015008419-2A BR112015008419B1 (pt) | 2012-10-17 | 2013-10-15 | Composição imunogênica, vacina, e, uso de uma composição imunogênica ou de uma vacina |
| IL238053A IL238053A0 (en) | 2012-10-17 | 2015-03-31 | An immunogenic composition containing one or more conjugates of capsular saccharide of Streptococcus pneumoniae and a protein component containing protein e and/or pila of Haemophilus influenzae |
Applications Claiming Priority (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261714942P | 2012-10-17 | 2012-10-17 | |
| US201261714956P | 2012-10-17 | 2012-10-17 | |
| GB1218660.7 | 2012-10-17 | ||
| GBGB1218660.7A GB201218660D0 (en) | 2012-10-17 | 2012-10-17 | Immunogenic composition |
| US61/714,956 | 2012-10-17 | ||
| US61/714,942 | 2012-10-17 | ||
| US13/826,696 US9561268B2 (en) | 2012-10-17 | 2013-03-14 | Immunogenic composition |
| US13/827,203 US20140105927A1 (en) | 2012-10-17 | 2013-03-14 | Immunogenic composition |
| US13/826,932 US20140193451A1 (en) | 2012-10-17 | 2013-03-14 | Immunogenic composition |
| US13/826,696 | 2013-03-14 | ||
| US13/827,203 | 2013-03-14 | ||
| US13/826,932 | 2013-03-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014060383A1 true WO2014060383A1 (en) | 2014-04-24 |
Family
ID=53008966
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/071472 Ceased WO2014060383A1 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae. |
| PCT/EP2013/071483 Ceased WO2014060389A2 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition |
| PCT/EP2013/071477 Ceased WO2014060385A1 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/071483 Ceased WO2014060389A2 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition |
| PCT/EP2013/071477 Ceased WO2014060385A1 (en) | 2012-10-17 | 2013-10-15 | Immunogenic composition |
Country Status (13)
| Country | Link |
|---|---|
| EP (3) | EP2908856B1 (https=) |
| JP (3) | JP2015534964A (https=) |
| KR (2) | KR20150058571A (https=) |
| CN (2) | CN104968366B (https=) |
| AU (2) | AU2013333975A1 (https=) |
| BR (3) | BR112015008417A8 (https=) |
| CA (3) | CA2888310C (https=) |
| EA (2) | EA201590491A1 (https=) |
| ES (1) | ES2640320T3 (https=) |
| IL (2) | IL238053A0 (https=) |
| MX (2) | MX2015005002A (https=) |
| SG (2) | SG11201502634TA (https=) |
| WO (3) | WO2014060383A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017067962A1 (en) * | 2015-10-21 | 2017-04-27 | Glaxosmithkline Biologicals S.A. | Vaccine |
| US11090375B2 (en) * | 2014-01-21 | 2021-08-17 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| EP3724212A4 (en) * | 2018-01-19 | 2021-11-24 | OBI Pharma, Inc. | CRM197 PROTEIN EXPRESSION |
| JP2023526780A (ja) * | 2020-05-01 | 2023-06-23 | 神州細胞工程有限公司 | タンパク質/ペプチド抗原の免疫原性を向上させる方法 |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201218660D0 (en) | 2012-10-17 | 2012-11-28 | Glaxosmithkline Biolog Sa | Immunogenic composition |
| CN104306965B (zh) * | 2014-10-31 | 2017-05-10 | 康希诺生物股份公司 | 预防肺炎链球菌感染性疾病的免疫原性组合物及制备方法 |
| CN108367063A (zh) * | 2015-07-21 | 2018-08-03 | 辉瑞公司 | 包含缀合的荚膜糖抗原的免疫原性组合物及其试剂盒和用途 |
| GB201603029D0 (en) * | 2016-02-22 | 2016-04-06 | Glaxosmithkline Biolog Sa | Vaccine |
| CN106432512B (zh) * | 2016-09-30 | 2022-03-01 | 康希诺生物股份公司 | 一种增强多糖抗原免疫原性蛋白载体及其制备方法与应用 |
| CN110540597B (zh) * | 2018-12-20 | 2021-04-30 | 湖北工业大学 | 基于流感嗜血杆菌表面蛋白的乳胶微球免疫层析试纸的制备方法 |
| KR20220142219A (ko) * | 2021-04-14 | 2022-10-21 | 한국생명공학연구원 | 장내 미생물에서 단백질 분비를 유도하는 신호서열 |
| EP4169513A1 (en) | 2021-10-19 | 2023-04-26 | GlaxoSmithKline Biologicals S.A. | Adjuvant composition comprising sting agonists |
| CN117512031B (zh) * | 2023-10-16 | 2024-06-25 | 江苏金迪克生物技术股份有限公司 | 一种肺炎球菌荚膜多糖的纯化方法 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007008527A2 (en) * | 2005-07-08 | 2007-01-18 | Children's Hospital Inc. | Chimeric vaccine for haemophilus influenzae-induced disease |
| WO2007084053A1 (en) * | 2006-01-17 | 2007-07-26 | Arne Forsgren | A NOVEL SURFACE EXPOSED HAEMOPHILUS INFLUENZAE PROTEIN (PROTEIN E; pE) |
| WO2009000826A1 (en) * | 2007-06-26 | 2008-12-31 | Glaxosmithkline Biologicals S.A. | Vaccine comprising streptococcus pneumoniae capsular polysaccharide conjugates |
| WO2011075823A1 (en) * | 2009-12-22 | 2011-06-30 | Sanofi Pasteur Limited | Immunogenic compositions |
| WO2012139225A1 (en) * | 2011-04-13 | 2012-10-18 | Glaxosmithkline Biologicals S.A. | Fusion proteins and combination vaccines comprising haemophilus influenzae protein e and pilin a |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2275499T3 (es) * | 1999-03-19 | 2007-06-16 | Glaxosmithkline Biologicals S.A. | Vacuna contra streptococcus pneumoniae. |
| HU227893B1 (en) * | 2000-06-29 | 2012-05-29 | Glaxosmithkline Biolog Sa | Vaccine compositions |
| GB0108364D0 (en) * | 2001-04-03 | 2001-05-23 | Glaxosmithkline Biolog Sa | Vaccine composition |
| GB0022742D0 (en) * | 2000-09-15 | 2000-11-01 | Smithkline Beecham Biolog | Vaccine |
| GB0130215D0 (en) * | 2001-12-18 | 2002-02-06 | Glaxosmithkline Biolog Sa | Vaccine |
| PL1697403T3 (pl) * | 2003-12-23 | 2010-09-30 | Nationwide Childrens Hospital Inc | Pilusy typu IV Haemophilus influenzae |
| CN102712680B (zh) * | 2008-12-24 | 2016-06-22 | 荷兰王国卫生福利和运动部国家公共卫生和环境研究所 | 修饰的肺炎链球菌溶血素(ply)多肽 |
| PE20161551A1 (es) * | 2009-09-03 | 2017-01-18 | Pfizer Vaccines Llc | Vacuna de pcsk9 |
| KR20140009281A (ko) * | 2010-12-03 | 2014-01-22 | 사노피 파스퇴르 리미티드 / 사노피 파스퇴르 리미떼 | 스트렙토코커스 뉴모니애에 대한 면역화를 위한 조성물 |
| BR112013024322B1 (pt) * | 2011-03-22 | 2020-04-22 | Serum Inst India Ltd | processo para preparação de polissacarídeos |
| WO2012156391A1 (en) * | 2011-05-17 | 2012-11-22 | Glaxosmithkline Biologicals S.A. | Vaccine against streptococcus pneumoniae |
-
2013
- 2013-10-15 JP JP2015537220A patent/JP2015534964A/ja active Pending
- 2013-10-15 JP JP2015537216A patent/JP6236086B2/ja active Active
- 2013-10-15 CA CA2888310A patent/CA2888310C/en active Active
- 2013-10-15 AU AU2013333975A patent/AU2013333975A1/en not_active Abandoned
- 2013-10-15 MX MX2015005002A patent/MX2015005002A/es unknown
- 2013-10-15 CA CA2888300A patent/CA2888300A1/en not_active Abandoned
- 2013-10-15 CN CN201380066162.9A patent/CN104968366B/zh active Active
- 2013-10-15 SG SG11201502634TA patent/SG11201502634TA/en unknown
- 2013-10-15 CN CN201380066113.5A patent/CN104853768B/zh not_active Expired - Fee Related
- 2013-10-15 KR KR1020157013037A patent/KR20150058571A/ko not_active Withdrawn
- 2013-10-15 BR BR112015008417A patent/BR112015008417A8/pt not_active Application Discontinuation
- 2013-10-15 WO PCT/EP2013/071472 patent/WO2014060383A1/en not_active Ceased
- 2013-10-15 BR BR112015008418A patent/BR112015008418A2/pt not_active IP Right Cessation
- 2013-10-15 EP EP13779191.9A patent/EP2908856B1/en active Active
- 2013-10-15 ES ES13779190.1T patent/ES2640320T3/es active Active
- 2013-10-15 AU AU2013331781A patent/AU2013331781A1/en not_active Abandoned
- 2013-10-15 WO PCT/EP2013/071483 patent/WO2014060389A2/en not_active Ceased
- 2013-10-15 JP JP2015537218A patent/JP6412500B2/ja not_active Expired - Fee Related
- 2013-10-15 MX MX2015004949A patent/MX365842B/es active IP Right Grant
- 2013-10-15 BR BR112015008419-2A patent/BR112015008419B1/pt active IP Right Grant
- 2013-10-15 EP EP13776808.1A patent/EP2908854A2/en not_active Ceased
- 2013-10-15 EP EP13779190.1A patent/EP2908855B1/en active Active
- 2013-10-15 CA CA2888321A patent/CA2888321A1/en not_active Abandoned
- 2013-10-15 WO PCT/EP2013/071477 patent/WO2014060385A1/en not_active Ceased
- 2013-10-15 SG SG11201502635SA patent/SG11201502635SA/en unknown
- 2013-10-15 EA EA201590491A patent/EA201590491A1/ru unknown
- 2013-10-15 EA EA201590490A patent/EA201590490A1/ru unknown
- 2013-10-15 KR KR1020157013039A patent/KR20150072444A/ko not_active Withdrawn
-
2015
- 2015-03-31 IL IL238053A patent/IL238053A0/en unknown
- 2015-04-01 IL IL238079A patent/IL238079A0/en unknown
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007008527A2 (en) * | 2005-07-08 | 2007-01-18 | Children's Hospital Inc. | Chimeric vaccine for haemophilus influenzae-induced disease |
| WO2007084053A1 (en) * | 2006-01-17 | 2007-07-26 | Arne Forsgren | A NOVEL SURFACE EXPOSED HAEMOPHILUS INFLUENZAE PROTEIN (PROTEIN E; pE) |
| WO2009000826A1 (en) * | 2007-06-26 | 2008-12-31 | Glaxosmithkline Biologicals S.A. | Vaccine comprising streptococcus pneumoniae capsular polysaccharide conjugates |
| WO2011075823A1 (en) * | 2009-12-22 | 2011-06-30 | Sanofi Pasteur Limited | Immunogenic compositions |
| WO2012139225A1 (en) * | 2011-04-13 | 2012-10-18 | Glaxosmithkline Biologicals S.A. | Fusion proteins and combination vaccines comprising haemophilus influenzae protein e and pilin a |
Non-Patent Citations (7)
| Title |
|---|
| BRYANT KRISTINA A ET AL: "Safety and immunogenicity of a 13-valent pneumococcal conjugate vaccine.", PEDIATRICS MAY 2010, vol. 125, no. 5, May 2010 (2010-05-01), pages 866 - 875, XP002719289, ISSN: 1098-4275 * |
| CHOO S ET AL: "Immunogenicity and reactogenicity of a pneumococcal conjugate vaccine administered combined with a haemophilus influenzae type B conjugate vaccine in United Kingdom infants.", THE PEDIATRIC INFECTIOUS DISEASE JOURNAL SEP 2000, vol. 19, no. 9, September 2000 (2000-09-01), pages 854 - 862, XP002970987, ISSN: 0891-3668 * |
| PEETERS C C ET AL: "Effect of carrier priming on immunogenicity of saccharide-protein conjugate vaccines.", INFECTION AND IMMUNITY OCT 1991, vol. 59, no. 10, October 1991 (1991-10-01), pages 3504 - 3510, XP002719290, ISSN: 0019-9567 * |
| PRYMULA R ET AL: "Effect of vaccination with pneumococcal capsular polysaccharides conjugated to Haemophilus influenzae-derived protein D on nasopharyngeal carriage of Streptococcus pneumoniae and H. influenzae in children under 2 years of age", VACCINE, ELSEVIER LTD, GB, vol. 28, no. 1, 10 December 2009 (2009-12-10), pages 71 - 78, XP026789447, ISSN: 0264-410X, [retrieved on 20091008], DOI: 10.1016/J.VACCINE.2009.09.113 * |
| PRYMULA R ET AL: "Pneumococcal capsular polysaccharides conjugated to protein D for prevention of acute otitis media caused by both Streptococcus pneumoniae and non-typable Haemophilus influenzae: a randomised double-blind efficacy study", THE LANCET, LANCET LIMITED. LONDON, GB, vol. 367, no. 9512, 4 March 2006 (2006-03-04), pages 740 - 748, XP027948090, ISSN: 0140-6736, [retrieved on 20060304] * |
| RENNELS M B ET AL: "SAFETY AND IMMUNOGENICITY OF HEPTAVALENT PNEUMOCOCCAL VACCINE CONJUGATED TO CRM197 IN UNITED STATES INFANTS", PEDIATRICS, AMERICAN ACADEMY OF PEDIATRICS, EVANSTON, IL, US, vol. 101, no. 4, PART 01, 1 April 1998 (1998-04-01), pages 604 - 611, XP008024884, ISSN: 0031-4005, DOI: 10.1542/PEDS.101.4.604 * |
| SHARMA SHARAD K ET AL: "CD4+ T-cell responses among adults and young children in response to Streptococcus pneumoniae and Haemophilus influenzae vaccine candidate protein antigens.", VACCINE 26 JUN 2013, vol. 31, no. 30, 26 June 2013 (2013-06-26), pages 3090 - 3097, XP002719291, ISSN: 1873-2518 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11090375B2 (en) * | 2014-01-21 | 2021-08-17 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US11160855B2 (en) | 2014-01-21 | 2021-11-02 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US11872274B2 (en) | 2014-01-21 | 2024-01-16 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2017067962A1 (en) * | 2015-10-21 | 2017-04-27 | Glaxosmithkline Biologicals S.A. | Vaccine |
| BE1024465B1 (fr) * | 2015-10-21 | 2018-03-05 | Glaxosmithkline Biologicals Sa | Vaccin |
| US20180303923A1 (en) * | 2015-10-21 | 2018-10-25 | Glaxosmithkline Biologicals, Sa | Vaccine |
| JP2018531315A (ja) * | 2015-10-21 | 2018-10-25 | グラクソスミスクライン バイオロジカルズ ソシエテ アノニム | ワクチン |
| US11844828B2 (en) | 2015-10-21 | 2023-12-19 | Glaxosmithkline Biologicals Sa | Vaccine |
| EP3724212A4 (en) * | 2018-01-19 | 2021-11-24 | OBI Pharma, Inc. | CRM197 PROTEIN EXPRESSION |
| JP2023526780A (ja) * | 2020-05-01 | 2023-06-23 | 神州細胞工程有限公司 | タンパク質/ペプチド抗原の免疫原性を向上させる方法 |
| EP4144365A4 (en) * | 2020-05-01 | 2024-06-05 | Sinocelltech Ltd. | METHODS FOR IMPROVING THE IMMUNOGENERICITY OF PROTEIN/PEPTIDE ANTIGEN |
| JP7568746B2 (ja) | 2020-05-01 | 2024-10-16 | 神州細胞工程有限公司 | タンパク質/ペプチド抗原の免疫原性を向上させる方法 |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2908855B1 (en) | Immunogenic composition comprising 1 or more streptococcus pneumoniae capsular saccharide conjugates and a protein component comprising protein e and/or pila fromhaemophilus influenzae . | |
| KR101441368B1 (ko) | 폐렴구균 다당류 컨쥬게이트 백신 | |
| US10730917B2 (en) | Fusion proteins and combination vaccines comprising haemophilus influenzae Protein E and Pilin A | |
| US9561268B2 (en) | Immunogenic composition | |
| AU2007235979A1 (en) | Conjugate vaccines | |
| MX2012010384A (es) | Composicion inmunogenica que comprende polisacaridos de s. pneumoniae conjugados con proteinas portadoras. | |
| US20140193451A1 (en) | Immunogenic composition | |
| US20140105927A1 (en) | Immunogenic composition | |
| JP2018522978A (ja) | 免疫原性組成物 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13779190 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201590490 Country of ref document: EA |
|
| ENP | Entry into the national phase |
Ref document number: 2888310 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015537216 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2015/004949 Country of ref document: MX |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015008419 Country of ref document: BR |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013779190 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013779190 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013331781 Country of ref document: AU Date of ref document: 20131015 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: IDP00201502894 Country of ref document: ID |
|
| ENP | Entry into the national phase |
Ref document number: 20157013039 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112015008419 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150415 |