WO2014019025A1 - Epcam aptamer for detection of cancer stem cells - Google Patents

Epcam aptamer for detection of cancer stem cells Download PDF

Info

Publication number
WO2014019025A1
WO2014019025A1 PCT/AU2013/000851 AU2013000851W WO2014019025A1 WO 2014019025 A1 WO2014019025 A1 WO 2014019025A1 AU 2013000851 W AU2013000851 W AU 2013000851W WO 2014019025 A1 WO2014019025 A1 WO 2014019025A1
Authority
WO
WIPO (PCT)
Prior art keywords
aptamer
epcam
cancer
cell
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2013/000851
Other languages
English (en)
French (fr)
Inventor
Wei Duan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Deakin University
Original Assignee
Deakin University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2012903333A external-priority patent/AU2012903333A0/en
Priority to CA2880590A priority Critical patent/CA2880590C/en
Priority to IN636DEN2015 priority patent/IN2015DN00636A/en
Priority to HK16101899.2A priority patent/HK1213941A1/zh
Priority to US14/418,660 priority patent/US9567586B2/en
Priority to AU2013299332A priority patent/AU2013299332B2/en
Priority to MX2015001441A priority patent/MX2015001441A/es
Priority to NZ704718A priority patent/NZ704718A/en
Application filed by Deakin University filed Critical Deakin University
Priority to SG11201500663RA priority patent/SG11201500663RA/en
Priority to CN201380050791.2A priority patent/CN104854243B/zh
Priority to JP2015524573A priority patent/JP6297034B2/ja
Priority to BR112015002286A priority patent/BR112015002286A2/pt
Priority to EP13825695.3A priority patent/EP2880163B1/en
Publication of WO2014019025A1 publication Critical patent/WO2014019025A1/en
Priority to IL237038A priority patent/IL237038A0/en
Anticipated expiration legal-status Critical
Priority to ZA2015/01317A priority patent/ZA201501317B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/0002General or multifunctional contrast agents, e.g. chelated agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/0491Sugars, nucleosides, nucleotides, oligonucleotides, nucleic acids, e.g. DNA, RNA, nucleic acid aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57557Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/5759Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds localised on the membrane of tumour or cancer cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3

Definitions

  • the present disclosure relates to an RNA aptamer and uses thereof, in particular, an aptamer which specifically bind to EpCAM and which demonstrates superior tumor penetrating ability.
  • EpCAM The epithelial cell adhesion molecule EpCAM (also known as CD326 or ESA) is a pleiotropic molecule, capable of both promoting and preventing epithelial cell-cell adhesion. It is a 30-40 kDa type I glycosylated membrane protein expressed at a low level in a variety of human epithelial tissues. EpCAM is overexpressed in most solid cancers. For example, intense expression of EpCAM is found in more than 98% of patients with colorectal cancer. Two decades of studies have shed light on the roles the EpCAM plays in tumorigenesis.
  • EpCAM acts by inducing proliferation with a direct impact on cell cycle control upregulating the proto-oncogene c-myc and cyclins A and E, and signal transduction into the cell nucleus by way of the Wnt pathway.
  • cancer stem cells are resistant to chemotherapy and radiotherapy. It is thought that cytotoxic drugs and radiation kill mainly the bulk tumor cells but spare the cancer stem cells. Thus, in order to effectively eradicate cancer, one must target and eliminate cancer stem cells as well as their progeny cells.
  • Epithelial cell adhesion molecule has been identified to be a cancer stem cell marker in a number of solid cancers, including breast cancer, colorectal cancer, pancreatic cancer, and liver cancer.
  • Expression of EpCAM in various cancers appears to be inversely related to the prognosis of the patients (Baeuerle PA et al (2007). Br J Cancer 96:417-23).
  • Initial clinical trials with anti-EpCAM antibodies failed to provide objective clinical response. It is thought that the large size of the antibody is a limitation to the distribution and delivery of monoclonal antibodies.
  • the antibody dependent cytotoxicity relies on the carbohydrate composition in the CH2 of the antibody, which can vary significantly during antibody production. Thus, a smaller and more effective EpCAM targeting molecule is needed for targeted cancer therapy. Summary of the Invention
  • RNA aptamers are 10-20 times small than an antibody, they have superb tissue penetration properties and are, therefore, advantageous over antibodies in cancer targeting. While aptamers show great promise, there have been limited reports of their use as probes for immunohistochemistry. While not wishing to be bound by theory, it has been suggested that one of the difficulties associated with substituting aptamer for antibodies in histological protocols could be from their non-specific staining due to electrostatic attraction of these polyanion nucleic acid aptamers to positively charged sites, such as histones, present in nuclei.
  • the present disclosure describes an RNA aptamer against EpCAM which has diagnostic and therapeutic potential.
  • the present disclosure provides an isolated RNA aptamer which specifically binds to EpCAM, wherein the aptamer is not DT3 having the sequence 5' - GCGACUGGUUACCCGGUCG- 3'(SEQ ID NO:1 ).
  • the present disclosure provides an isolated RNA aptamer which specifically binds to
  • EpCAM the aptamer comprising the sequence 5' -ACGUAUCCCUUUUCGCGUA- 3' (SEQ ID NO:2).
  • the EpCAM is human EpCAM.
  • the aptamer of the present disclosure has a dissociation constant for EpCAM expressed on breast tumor cell lines of about 90 nM or less.
  • the dissociation constant is about 65 nM or less.
  • the dissociation constant is about 45 nM or less.
  • the dissociation constant is about 87 nM for MDA- MB-231 cells.
  • the dissociation constant is about 64 nM for MCF7 cells.
  • the dissociation constant is about 41 nM for T47D cells.
  • the aptamer of the present disclosure has a dissociation constant for EpCAM expressed on a colon cancer cell line (HT29 cells) of about 37 nM.
  • the isolated RNA aptamer consists essentially of the sequence of SEQ ID NO:2.
  • the isolated RNA aptamer consists of the sequence of SEQ ID NO: 1
  • the isolated RNA aptamer comprises the sequence of SEQ ID NO: 1
  • sequence length is between 1 9 and 100 bases. In another example, the sequence length is between 19 and 40 bases. In another example, the sequence length is between 19 and 30 bases. In another example, the sequence length is between 19 and 25 bases.
  • base as used herein is understood to mean a nucleotide base or residue which is guanine (G), adenine (A), uracil (U) or cytosine (C). The bases may form hydrogen bonds between cytosine and guanine, adenine and uracil and between guanine and uracil.
  • the sequence comprises one or more substitutions within the sequence of SEQ ID NO:2. In another example, the sequence comprises at least one, two, three, four, five or six substitutions within the sequence of SEQ ID NO:2. In another example, the sequence comprises at least one, two, three, four, five or six substitutions within the stem region of the aptamer according to SEQ ID NO:2. In one example, the stem region is that of the predicted two dimensional structure of the aptamer.
  • the aptamer comprises one or more modifications (modified aptamer) that improve aptamer stability (in vitro or in vivo). Suitable modifications are discussed elsewhere herein.
  • the pyrimidine bases are 2'-fluoro (2'-F) modified.
  • the 3' end of the RNA aptamer is modified to protect it from nuclease digestion.
  • aptamer is modified by coupling the 5' end to a fluorophore or inverted dT or to a PEG molecule.
  • the present disclosure also provides an isolated RNA aptamer having substantially the same ability to bind to EpCAM as that of an aptamer comprising a sequence of SEQ ID NO:2, wherein the aptamer is not DT3 having the sequence 5' -GCGACUGGUUACCCGGUCG- 3' (SEQ ID NO:1 ).
  • the aptamer specifically binds to EpCAIVT cell(s).
  • the EpCAM+ cell(s) is a stem cell(s).
  • the stem cell is an isolated cancer stem cell(s).
  • the cancer stem cell(s) is characterised as (i) expressing EpCAM, (ii) is tumorigenic, (iii) is capable of self renewal (iv) is capable of differentiating and (v) resistant to apoptosis by conventional therapy.
  • the cancer stem cells may be alternatively described as isolated, enriched or purified from a source, such as a biological sample.
  • the cancer stem cell(s) represent a population of cells enriched on the basis of EpCAM + expression.
  • the population of cells comprises at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% cancer stem cells.
  • the EpCAM expressing cells and/or cancer stem cells are present in vivo. In another example, the EpCAM expressing cells and/or cancer stem cells are present in vitro. In a further example, the EpCAM expressing cells and/or cancer stem cells are present in a biological sample obtained from a subject. In another example, the EpCAM expressing cells and/or cancer stem cells of the present disclosure may express one or more additional antigens including CD44, ABCG2, ⁇ - catenin, CD1 17, CD133, ALDH, VLA-2, CD166, CD201 , IGFR, and EGF1 R.
  • additional antigens including CD44, ABCG2, ⁇ - catenin, CD1 17, CD133, ALDH, VLA-2, CD166, CD201 , IGFR, and EGF1 R.
  • the cancer stem cell according to the present disclosure is a breast cancer stem cell, a prostate cancer stem cell, a pancreatic cancer stem cell, a colon cancer stem cell, a liver cancer stem cell, a lung cancer stem cell, an ovarian cancer stem cell, or a head and neck cancer stem cell.
  • the present disclosure also provides a diagnostic agent comprising an RNA aptamer as described herein.
  • the diagnostic agent comprises an RNA aptamer of the present disclosure coupled to a detectable label.
  • aptamers of the present invention avoid complications that may be associated with non-specific antibody binding and hence provide superior signal to noise ratio.
  • the diagnostic agent as described herein is used to detect for EpCAM expressing cancer stem cells in vivo or in vitro.
  • the RNA aptamer of the present disclosure can be used diagnostically to detect the presence of EpCAM expressing cells and/or cancer stem cells in a subject or in a biological sample obtained from a subject having a tumor or suspected of having a tumor. Detection can be facilitated by coupling the aptamer to a detectable label.
  • detectable labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, electron dense labels, labels for MRI and radioactive materials.
  • the present disclosure also provides an RNA aptamer as described herein or the diagnostic agent as described herein for use in histological examination of biological samples. Methods for preparing histological preparations will be familiar to persons skilled in the art.
  • the present disclosure also provides an anticancer agent comprising an RNA aptamer as described herein.
  • the anticancer agent comprises an RNA aptamer of the present disclosure coupled to a moiety.
  • the moiety may be selected from the group consisting of a radionuclide, a chemotherapeutic agent, an si-RNA or toxin or combination thereof.
  • the anticancer agent comprises an RNA aptamer-survivin siRNA conjugate comprising the sequence 5'-
  • the anticancer agent as described herein is used to treat a cancer in a subject.
  • the subject is one which would benefit from treatment with the RNA aptamer of the present disclosure.
  • the subject is one which has been diagnosed as having cancer.
  • the subject is one having a solid tumor.
  • the subject is one which has a cancer selected from breast cancer, prostate cancer, pancreatic cancer, colon cancer, liver cancer, lung cancer, ovarian cancer, head and neck cancer or any other cancer in which EpCAIVT cells are present.
  • the aptamer of the present disclosure can be coupled to a moiety and the aptamer used to direct the moiety to the site of a tumor which comprises, or is suspected of comprising an EpCAM expressing cancer stem cell(s).
  • moieties include toxins, radionuclides or chemotherapeutic agents which can be used to kill cancer stem cells, or imaging agents which can be used to locate and size tumors comprising EpCAM expressing cells.
  • the anticancer agent comprising the RNA aptamer of the present disclosure can additionally include one or more effective ingredients.
  • the present disclosure also provides a method for isolating, purifying or enriching an EpCAM expressing cell(s) and/or cancer stem cell(s) from a biological sample obtained from a subject, the method comprising contacting the cell with an RNA aptamer of the present disclosure or the diagnostic agent of the present disclosure.
  • the method is carried out in vitro.
  • EpCAM expressing cells Methods isolating, purifying or enriching EpCAM expressing cells are known to persons skilled in the art and are also described elsewhere herein.
  • the present disclosure also provides a method for identifying an EpCAM expressing cell(s) and/or cancer stem cell(s) in a subject or in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the cell with an isolated RNA aptamer of the present disclosure or the diagnostic agent of the present disclosure.
  • the present disclosure also provides a method for treating or preventing cancer in a subject comprising providing a subject with an RNA aptamer as described herein or the anticancer agent as described herein.
  • the cancer is any cancer in which EpCAM expressing cells and/or cancer stem cells are present or suspected of being present.
  • the subject is one which has been diagnosed as having cancer.
  • the subject is one having a solid tumor.
  • the subject is one which has a cancer selected from brain cancer, breast cancer, prostate cancer, pancreatic cancer, colon cancer, liver cancer, lung cancer, ovarian cancer, skin cancer or any other cancer in which EpCAM + cells are present.
  • the present disclosure also relates to the use of an RNA aptamer or anticancer agent as described herein in medicine.
  • the present disclosure also relates to the use of an RNA aptamer or anticancer agent as described herein for treating or preventing cancer in a subject.
  • the present disclosure also relates to the use of an RNA aptamer or anticancer agent as described herein in the manufacture of a medicament for treating or preventing cancer in a subject.
  • the present invention also relates to a delivery agent comprising an RNA aptamer as described herein coupled to an siRNA or ribozyme.
  • the delivery agent comprises an RNA aptamer-survivin siRNA conjugate comprising the sequence 5'- ACGUAUCCCUUUUCGCGUAAAAUGUAGAGAUGCGGUGGUCCUU-3'
  • the present disclosure also provides a composition comprising a therapeutically effective amount of an RNA aptamer, anticancer agent or delivery agent as described herein, together with a pharmaceutically acceptable carrier and/or excipient.
  • the present disclosure also provides an RNA aptamer as described herein or the diagnostic agent as described herein for use in molecular imaging of tumors.
  • RNA aptamer of the present invention provides a distinct advantage over antibodies for molecular imaging of tumors.
  • the RNA aptamer can be coupled to an agent which facilitates the detecting and imaging of tumors bearing EpCAM expressing cells.
  • suitable agents include the detection labels are described herein.
  • RNA aptamer, diagnostic agent, anticancer agent, delivery agent or pharmaceutical composition as described herein may be used alone or in combination with other treatment modalities.
  • the RNA aptamer, diagnostic agent, anticancer agent, delivery agent or pharmaceutical composition may be used in combination with chemotherapy and/or radiotherapy.
  • chemotherapy or radiotherapeutic agents can be use to shrink tumors by primarily targeting rapidly dividing cells which are typically the progeny cells of the cancer stem cells.
  • the diagnostic agent can be used to determine the effectiveness of any prior treatment modality to eliminate cancer stem cells by detecting the presence or absence of cancer stem cells in the tumor.
  • the anticancer agent, delivery agent or pharmaceutical composition containing the RNA aptamer of the present disclosure can then be administered to the site of the tumor to specifically deplete cancer stem cells. Accordingly, the anticancer agent, delivery agent or pharmaceutical composition containing the RNA aptamer can be used together with chemotherapy or radiotherapy or subsequent to chemotherapy or radiotherapy treatment. It is also contemplated that the RNA aptamer of the present disclosure can be combined with one or more additional aptamers which target an antigen present on a cancer stem cell.
  • Each example of the disclosure shall be taken to apply mutatis mutandis to a method for treating, preventing or ameliorating cancer in a subject.
  • FIG. 1 Detection of EpCAM in paraffin embedded tissue using aptamers and antibodies.
  • A Immunofluorescence staining of breast cancer (T47D, MCF7 and MDA-MB-231 ), colon cancer (HT-29) and glioblastoma (U 1 18MG) xenograft tumours by EpCAM aptamers, DT3 and 23, control aptamer and the anti-EpCAM antibody, 323/A3 (Blue: nuclei; Red: EpCAM positive staining).
  • B Immunohistochemistry was performed with the anti-EpCAM antibody BerEP4, and all tumours were evaluated by haematoxylin and eosin staining for morphological confirmation.
  • the chimera for in vivo delivery of siRNA directed by EpCMA aptamer is consisted of three elements, the guided strand of siRNA linked to the EpCMA aptamer (A), the passenger strand of siRNA (B) and a liker.
  • Fig. 2C shows the assembled siRNA-aptamer chimera.
  • a Dy647 fluorescence dye is attached to the 5'-end of the passenger strand of siRNA (C).
  • D The predicted final produce after processing by Dicer enzyme in the cytoplasm is shown in (D).
  • Figure 3 Analysis of chimera with native agarose gel.
  • EpCAM aptamer-siRNA chimera is internalised specifically by EpCAM positive HT-29 colonic adenocarcinoma cells. DY-647-labelled EpCA aptamer-siRNA chimera was incubated with indicated human cancer cells for 30 min at 37 ° C, followed by visualisation using laser scanning confocal microscopy. For each pair of panels, fluorescent images are across the top and optical (phase contrast) images are below.
  • A Binding and subcellular distribution of chimeras to HEK-293T (EpCAM negative) and HT-29 (EpCAM positive) cancer cell lines.
  • Figure s In vivo targeting efficacy of aptamer-siRNA chimera in a xenograft model of breast tumor.
  • T47D ductal carcinoma cells (EpCAM positive) were orthotopically xenotransplanted into the 4 th mammary gland of 8-week old NOD/SCID mice.
  • the Dy647-labelled siRNA-EpCAM aptamer chimera was administered with chimera (1 nmol/mouse) through tail vein injection. After injection, fluorescence density was measured using a Xenogen IVIS Lumina II imaging system at different time points as shown.
  • transfection agent such as Lipofectamine 2000
  • the HT-29 cells were incubated with different concentrations of chimera (10nM and 40nM) in the full cell culture medium (containing 10% feral calf serum) for 24 hr. After washing with PBS three times, the cells were incubated with the growth medium for a further 48 h followed by cell lysis, separation on a 12% SDS-PAGE gel and Western analysis
  • A Western blot analysis of survivin protein in HT-29 cells, ⁇ -actin was served as an internal loading control.
  • B The knock down of survivin protein by siRNA-aptamer chemira. The surviving expression levels were normalised as the ratio of survivin protein expression levels to that of ⁇ -actin protein.
  • Chimeras were incubated with recombinant human Dicer enzyme (1 unit/reaction) for 12 hours.
  • the products of Dicer cleavage or uncleavaged products were visualized on 4% Metapher agrose gel.
  • the negative control chimera is the chimera without the passenger strand.
  • a double-stranded surviving siRNA was used as a control to mark the position of a 21 -mer double-stranded RNA on the gel.
  • HT-29 or HEK293T cells were cultured in stem cell culture medium (DMEM/F12 with 20 ng/ml EGF and FGF and B27).
  • stem cell culture medium DMEM/F12 with 20 ng/ml EGF and FGF and B27.
  • tumour sphere reached a size of ⁇ 300-400 ⁇
  • the sphere were incubated with 100 nM PE-labelled anti-EpCAM antibody, DY647-labelled EpCAM aptamer-23 or a DY647-labelled control aptamer that does not bind to EpCAM.
  • the spheres were washed twice with PBS and imaged via fluorescence confocal microscopy. A phase contrast image of the sphere was also taken for each sample.
  • Panel C fluorescence image for aptamer EpCAM 23, Panel D: phase contrast image for tumor sphere.
  • Panel E fluorescence image aptamer control, Panel F: phase contrast image for tumor sphere.
  • Tumour spheres were incubated with EpCAM antibody, atpamer-23 or control aptamer for 4 h. After washing with PBS twice, the tumor spheres were incubated with the culture medium for a further 24 h followed by confocal microscopy.
  • Panel A fluorescence image for antibody or aptamer.
  • Panel B phase contrast image for tumour sphere.
  • Figure 10 The specificity and selectivity of aptamer-23 in the penetration of tumor sphere. After four hour incubation with EpCAM antibody or aptamer 23 separately, the tumor spheres were washed twice with PBS and were cultured for a further 24 h followed by confocal microscopy. Panel A: fluorescence image for aptamer 23. Panel B: phase contrast for tumor sphere. Panel C: fluorescence image for anti-EpCAM antibody. Panel D:phase contrast image for tumour sphere.
  • HT29 xenograft tumour size (in volume) was measured against time in mice administered Dox- treated cells or EpCAM aptamer-Dox treated cells.
  • Figure 13 Live animal imaging
  • Tumours excised from mice bearing HT29 xenograft tumours treated with Doxorubicin only or EpCAM aptamer-Dox (A).
  • PEG-aptamer-Dox (5 mg Dox/kg) was injected i.v. into NOD/SCID mice bearing HT-29 colon cancer xenograft (s.c).
  • the percentage (%) injected dose (ID) of PEG-aptamer normalised by the weight of a given tissue/organ (in g) as determined via aptamer ELISA is plotted in the bar chart.
  • MCF-7/ADR tumour bearing mice were treated on days 1 , 3 and 5 with an i.v. bolus injection of EpCAM aptamer-siRNA PEG chimera and day 2, 4, 6 with an i.v. bolus of doxorubicin. Two days after the last (third) treatment, tumours were removed and weighed.
  • SEQ ID NO: 1 is a nucleotide sequence of an aptamer which specifically binds to EpCAM
  • SEQ ID NO: 2 is a nucleotide sequence of an aptamer which specifically binds to EpCAM
  • SEQ ID NO: 3 is an nucleotide sequence of an aptamer-siRNA chimera which specifically binds to EpCAM.
  • composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
  • aptamer refer in general to either an oligonucleotide of a single defined sequence or a mixture of said oligonucleotides, wherein the mixture retains the properties of binding specifically to EpCAM.
  • aptamer refers to single stranded nucleic acid. Structurally, the aptamers of the present disclosure are specifically binding oligonucleotides.
  • oligonucleotide as used herein is generic to polydeoxyribonucleotides (containing 2'-deoxy-D-ribose or modified forms thereof), i.e. DNA, to polyribonucleotides (containing D ribose or modified forms thereof), i.e. RNA, and to any other type of polynucleotide which is an N-glycoside or C-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base or abasic nucleotides.
  • oligonucleotide includes not only those with conventional bases, sugar residues and internucleotide linkages, but also those that contain modifications of any or all of these three moieties.
  • RNA aptamer as used herein is an aptamer comprising ribonucleoside units. RNA aptamer is also meant to encompass RNA analogs as defined herein.
  • binding affinity and binding activity are intended to refer to the tendency of a ligand molecule/aptamer to bind or not bind a target and describes the measure of the strength of the binding or affinity of the ligand molecule/aptamer to bind the target.
  • the energetics of said interactions are significant in "binding activity” and "binding affinity” because they define the necessary concentrations of interacting partners, the rates at which these partners are capable of associating, and the relative concentrations of bound and free molecules in a solution.
  • the energetics are characterized herein through, among other ways, the determination of a dissociation constant, K d .
  • a low dissociation constant indicates stronger binding and affinity of the molecules to each other.
  • the dissociation constant is at least 10 "6 M.
  • the dissociation constant is at least 10 "8 and 10 "9 M.
  • biological sample refers to a cell or population of cells or a quantity of tissue or fluid from a subject. Most often, the sample has been removed from a subject, but the term “biological sample” can also refer to cells or tissue analyzed in vivo, i.e. without removal from the subject. Often, a “biological sample” will contain cells from the subject, but the term can also refer to non-cellular biological material, such as non-cellular fractions of blood, saliva, or urine, that can be used to measure gene expression levels. Biological samples include, but are not limited to, tissue biopsies, needle biopsies, scrapes (e.g.
  • a biological sample or tissue sample can refer to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, blood, plasma, serum, tumor biopsy, urine, stool, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, cells (including but not limited to blood cells), tumors, organs, and also samples of in vitro cell culture constituent.
  • the sample is from a resection, bronchoscopic biopsy, or core needle biopsy of a primary or metastatic tumor, or a cellblock from pleural fluid.
  • fine needle aspirate samples can be used. Samples may be paraffin-embedded or frozen tissue.
  • the sample can be obtained by removing a sample of cells from a subject, but can also be accomplished by using previously isolated cells (e.g. isolated by another person), or by performing the methods of the invention in vivo.
  • the term "coupled to” as used herein is intended to encompass any construction whereby the RNA aptamer is linked, attached or joined to a detection agent, moiety, siRNA or ribozyme as described herein.
  • Methods for effecting coupling will be known to persons skilled in the art and include, but are not limited to conjugation, linking via peptide linker or by direct chemical synthesis of the RNA and agent (e.g. siRNA or ribozyme) as a whole chain.
  • RNA and agent e.g. siRNA or ribozyme
  • isolated as used herein is intended to refer to the RNA aptamer or the stem cell (e.g. cancer stem cell), isolatable or purified from other components.
  • An isolated cell refers to a cell from the environment in which it may naturally occur. The isolated cell may be purified to any degree relative to its naturally-obtainable state.
  • ligand refers to a molecule or other chemical entity having a capacity for binding to a target.
  • a ligand can comprise a peptide, an oligomer, a nucleic acid (e.g. an aptamer), a small molecule (e.g. a chemical compound), an antibody or fragment thereof, nucleic acid-protein fusion and/or any other affinity agent.
  • a ligand can come from any source, including libraries, particularly combinatorial libraries, such as the aptamer libraries disclosed herein below, phage display libraries, or any other library as would be apparent to one of ordinary skill in the art after review of the disclosure herein.
  • modified RNA aptamer as used herein is meant to refer to a polymeric molecule, which in addition to containing ribonucleosides as its units, also contains at least one of the following: 2'-deoxy, 2'-halo (including 2'-fluoro), 2'-amino (preferably not substituted or mono- or disubstituted), 2'-mono-, di- or tri-halomethyl, 2'-0-alkyl, 2'-0-halo-substituted alkyl, 2'-alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2-hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with halo or C 15 alkyl groups, abas
  • RNA aptamer As used herein, the term "therapeutically effective amount” shall be taken to mean a sufficient quantity of RNA aptamer, anticancer agent, delivery agent or pharmaceutical composition according to the present disclosure to reduce or inhibit the number of EpCAM expressing cancer stem cells and/or one or more symptoms of cancer.
  • the skilled artisan will be aware that such an amount will vary depending upon, for example, the particular subject and/or the type or severity or level of disease. The term is not be construed to limit the present disclosure to a specific quantity of RNA aptamer.
  • RNA aptamer As used herein, the term “treat” or “treatment” or “treating” shall be understood to mean administering a therapeutically effective amount of RNA aptamer, anticancer agent, delivery agent or pharmaceutical composition as disclosed herein and reducing or inhibiting at least one symptom of a clinical condition associated with or caused by cancer.
  • RNA aptamer As used herein, the term “prevent” or “preventing” or “prevention” shall be taken to mean administering a therapeutically effective amount of RNA aptamer, anticancer agent, delivery agent or pharmaceutical composition according to the present disclosure and stopping or hindering or delaying the development or progression of at least one symptom of cancer.
  • RNA aptamer reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances.
  • an RNA aptamer that specifically binds to a target protein binds that protein or an epitope or immunogenic fragment thereof with greater affinity, avidity, more readily, and/or with greater duration than it binds to unrelated protein and/or epitopes or immunogenic fragments thereof. It is also understood by reading this definition that, for example, a RNA aptamer that specifically binds to a first target may or may not specifically bind to a second target.
  • binding does not necessarily require exclusive binding or non-detectable binding of another molecule, this is encompassed by the term “selective binding”.
  • reference to binding means specific binding.
  • the specificity of binding is defined in terms of the comparative dissociation constants (Kd) of the aptamer for target as compared to the dissociation constant with respect to the aptamer and other materials in the environment or unrelated molecules in general.
  • Kd comparative dissociation constants
  • the Kd for the aptamer with respect to the target will be 2-fold, 5-fold, or 10-fold less than the Kd with respect to the target and the unrelated material or accompanying material in the environment. Even more preferably, the Kd will be 50-fold, 100-fold or 200-fold less.
  • EpCAM + or "EpCAM expressing cell” as used herein may be used interchangeably.
  • the term encompasses cell surface expression of the CD133 antigen which can be detected by any suitable means.
  • Reference to a cell being positive for a given marker means it may be either a low (lo or dim) or a high (bright, bri) expresser of that marker depending on the degree to which the marker is present on the cell surface, where the terms relate to intensity of fluorescence.
  • the term "subject” shall be taken to mean any subject, including a human or non-human subject.
  • the non-human subject may include non-human primates, ungulate (bovines, porcines, ovines, caprines, equines, buffalo and bison), canine, feline, lagomorph (rabbits, hares and pikas), rodent (mouse, rat, guinea pig, hamster and gerbil), avian, and fish.
  • the subject is a human. Aptamers
  • aptamers bind to targets with high affinity, demonstrating typical dissociation constants in the pico- to nanomolar range. Binding sites for aptamers include clefts and grooves of target molecules resulting in antagonistic activity very similar to many currently available pharmaceutical agents.
  • aptamers are structurally stable across a wide range of temperature and storage conditions, maintaining the ability to form their unique tertiary structures.
  • aptamers can be chemically synthesised, in contrast to the expensive and work-intensive biological systems needed to produce monoclonal antibodies.
  • RNA aptamers are generally preferred by many groups due to the theoretically higher affinity of RNA aptamers for their target proteins as well as the greater plasma stability of modified RNA than unmodified RNA.
  • RNA aptamer molecules that specifically bind to the EpCAM antigen which can be used for effective intracellular delivery of siRNA or ribozyme, chemotherapy drugs, radioisotopes, toxins and/or other agents bearing the antigen.
  • Aptamers are single stranded oligonucleotides or oligonucleotide analogs that bind to a particular target molecule, such as a protein or a small molecule.
  • aptamers are the oligonucleotide analogy to antibodies.
  • aptamers comprise about 15 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, and more preferably about 20 to about 40 nucleotides, in that oligonucleotides of a length that falls within these ranges can be prepared by conventional techniques.
  • aptamers can further comprise a minimum of approximately 6 nucleotides, preferably 10, and more preferably 14 or 15 nucleotides, that are necessary to effect specific binding.
  • Aptamers of binding regions containing sequences shorter than 10, e.g., 6-mers, are feasible if the appropriate interaction can be obtained in the context of the environment in which the target is placed. Thus, if there is little interference by other materials, less specificity and less strength of binding can be required.
  • RNA and single stranded DNA (or analog) aptamers are known. See, for example, Burke et al (1996). J. Mol. Biol. 264:650-666; Ellington and Szostak (1990). Nature 346:818-22; Hirao et al (1998). Mol Divers. 4:75-89; Jaeger et al (1998). EMBO Journal 17:4535; Kensch et al (2000). J. Biol. Chem 275:18271 -8; Schneider et al (1995). Biochemistry 34:9599-9610; and US 5773598; US6028186; US 61 10900; US61271 19; and US 6171795. Selection of aptamers for a given target
  • Aptamers that bind to virtually any particular target can be selected by using an iterative process called SELEXTM (Systemic Evolution of Ligands by Exponential Enrichment).
  • SELEXTM Systemic Evolution of Ligands by Exponential Enrichment
  • the process is described in, for example US 5270163 and US 5475096.
  • the SELEXTM process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets.
  • the SELEXTM process relies, as a starting point, upon a large library or pool of single stranded oligonucleotides comprising randomised sequences.
  • the oligonucleotides can be modified or unmodified DNA, RNA, or DNA/RNA hybrids.
  • the pool comprises 100% random or partially random oligonucleotides.
  • the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and/or conserved sequence incorporated within randomized sequence.
  • the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and/or conserved sequence at its 5' and/or 3' end which may comprise a sequence shared by all the molecules of the oligonucleotide pool.
  • Fixed sequences are sequences common to oligonucleotides in the pool which are incorporated for a preselected purpose such as, CpG motifs, hybridization sites for PCR primers, promoter sequences for RNA polymerases (e.g., T3, T4, T7, and SP6), restriction sites, or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, and other sequences to facilitate cloning and/or sequencing of an oligonucleotide of interest.
  • conserveed sequences are sequences, other than the previously described fixed sequences, shared by a number of aptamers that bind to the same target.
  • the oligonucleotides of the pool preferably include a randomised sequence portion as well as fixed sequences necessary for efficient amplification.
  • the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences which flank an internal region of 30- 50 random nucleotides.
  • the randomised nucleotides can be produced in a number of ways including chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in the test nucleic acids can also be introduced or increased by mutagenesis before or during the selection/amplification iterations.
  • the random sequence portion of the oligonucleotide can be of any length and can comprise ribonucleotides and/or deoxyribonucleotides and can include modified or non-natural nucleotides or nucleotide analogs (see for example US 5958691 , US 5660985 and WO 92/07065).
  • Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques well known in the art. See, for example, Froehler et aL (1986). Nucl. Acid Res. 14:5399-5467 and Froehler et al (1986) Tet. Lett.
  • Random oligonucleotides can also be synthesized using solution phase methods such as triester synthesis methods. See, e.g., Sood et al (1977). Nucl. Acid Res. 4:2557 and Hirose et al (1978). Tet. Lett., 28:2449. Typical syntheses carried out on automated DNA synthesis equipment yield 10 14 -10 16 individual molecules, a number sufficient for most SELEXTM experiments.
  • the starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesiser. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step.
  • the starting library of oligonucleotides may be either RNA or DNA.
  • an RNA library is to be used as the starting library it is typically generated by transcribing a DNA library in vitro using T7 RNA polymerase or modified T7 RNA polymerases and purified.
  • the RNA or DNA library is then mixed with the target under conditions favourable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity.
  • the SELEXTM method includes steps of: (a) contacting the mixture with the target under conditions favorable for binding; (b) partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.
  • the SELEXTM method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process.
  • Cycles of selection and amplification are repeated until a desired goal is achieved. Generally this is until no significant improvement in binding strength is achieved on repetition of the cycle.
  • nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure.
  • nucleic acid primary, secondary and tertiary structures are known to exist.
  • the structures or motifs that have been shown most commonly to be involved in non-Watson- Crick type interactions are referred to as hairpin loops, symmetric and asymmetric bulges, pseudoknots and myriad combinations of the same.
  • Almost all known cases of such motifs suggest that they can be formed in a nucleic acid sequence of no more than 30 nucleotides. For this reason, it is often preferred that SELEXTM procedures with contiguous randomized segments be initiated with nucleic acid sequences containing a randomized segment of between about 20 to about 50 nucleotides.
  • the core SELEXTM method has been modified to achieve a number of specific objectives.
  • US 5707796 describes the use of SELEXTM in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA.
  • US 5763177 describes SELEXTM based methods for selecting nucleic acid ligands containing photo reactive groups capable of binding and/or photo-crosslinking to and/or photo- inactivating a target molecule.
  • US 5567588 and US 5861254 describe SELEXTM based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule.
  • US 5496938 describes methods for obtaining improved nucleic acid ligands after the SELEXTM process has been performed.
  • US 5705337 describes methods for covalently linking a ligand to its target.
  • Counter-SELEXTM is a method for improving the specificity of nucleic acid ligands to a target molecule by eliminating nucleic acid ligand sequences with cross- reactivity to one or more non-target molecules.
  • Counter-SELEXTM is comprised of the steps of: (a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (d) dissociating the increased affinity nucleic acids from the target; (e) contacting the increased affinity nucleic acids with one or more non-target molecules such that nucleic acid ligands with specific affinity for the non-target molecule(s) are removed; and (f) amplifying the nucleic acids with specific affinity only to the target molecule to yield a mixture of nucleic acids enriched for nucleic acid sequences with
  • an RNA aptamer is synthesized on a solid support column, using conventional techniques such as those described by Beaucage et al. (1981 ) Tetrahedr. Letters 22:1859-1862 and Sinha et al., (1984) Nucleosides and Nucleotides 3:157- 171. The final D T-group is removed from the resulting RNA aptamer.
  • the RNA aptamer can be made by scale-up of the solid support method or the RNA aptamer can be made by using solution phase techniques, particularly if the desired end-product is a relatively short oligonucleotide.
  • a starting material for the synthesis process can be a 5'-non-tritylated RNA oligoribo-nucleotide or analog of the desired primary structure, which preferably can have protected bases, and which is preferably bound to a solid-support.
  • Any conventionally used protecting groups can be used. Typically N 6 -benzoyl is used for adenine, N 4 -benzoyl for cytosine, N 2 -isobutyryl for guanine and N 2 -benzoyl for 2- amino purine.
  • Other useful protecting groups include phenoxyacetyl (PAC) and t-butoxyacetyl (TAC).
  • the more base labile protection groups should be used for the synthesis of the RNA aptamer; those of ordinary skill in the art know these groups. Such groups can help to prevent hydrolysis of the generated tri- or diphosphates, which are generally quite stable under basic conditions, but could be subject to some hydrolysis.
  • Other envisioned modifications are disclosed in U.S. Pat. No. 6,01 1 ,020, and include but are not limited to the incorporation of bioavailability enhancing molecules such as PEG or cholesterol via a covalent linkage.
  • nucleoside analogs such as 2'-deoxy, 2'-halo, 2'-amino (not substituted or mono- or disubstituted), 2'-mono, di- or trihalomethyl, 2'-0-alkyl, 2'-0-halo-substituted alkyl, 2'- alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2-hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with halo or Ci_ 5 alkyl groups, abasic linkers, 3'-deoxy-adenosine as well as other available "chain terminator” or "non-extendible" analogs (at the 3'-end of the RNA), and the like can be
  • the binding affinity describes the measure of the strength of the binding or affinity of molecules to each other. Binding affinity of the aptamer herein with respect to targets and other molecules is defined in terms of K d .
  • the dissociation constant can be determined by methods known in the art and can be computed even for complex mixtures by methods such as those, for example, set forth in Caceci, M., et al., Byte (1984) 9:340-362. Examples of measuring dissociation constants are described for example in US 7602495 which describes surface Plasmon resonance analysis, US 6562627, US 6562627, and US 2012/00445849.
  • the K d is established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, (1993). Proc. Natl. Acad. Sci. USA 90, 5428- 5432.
  • K concentration at which 50% inhibition occurs
  • K concentration at which 50% inhibition occurs
  • K the concentration at which 50% inhibition occurs
  • determination of K sets a maximal value for the value of K d .
  • measurement of K can conveniently be substituted to provide an upper limit for K d .
  • a K, value can also be used to confirm that an aptamer of the present binds a target.
  • Oligonucleotide modifications contemplated in the present disclosure include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole.
  • Modifications to generate oligonucleotides which are resistant to nucleases can also include one or more substitute internucleotide linkages, altered sugars, altered bases, or combinations thereof.
  • Such modifications include 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanosine; 3' and 5' modifications such as capping; conjugation to a high molecular weight, non-immunogenic compound; conjugation to a lipophilic compound; and phosphate backbone modification.
  • the non-immunogenic, high molecular weight compound conjugated to the aptamer of the present disclosure is polyalkylene glycol, preferably polyethylene glycol.
  • the backbone modification comprises incorporation of one or more phosphorothioates into the phosphate backbone.
  • the aptamer of the present disclosure comprises the incorporation of fewer than 10, fewer than 6, or fewer than 3 phosphorothioates in the phosphate backbone.
  • RNA aptamer molecules of the present disclosure can be used as affinity ligands to separate and purify target molecules (e.g. EpCAM bearing cancer stem cells), as probes to trace, monitor, detect and quantitate target molecules (e.g. EpCAM bearing cancer stem cells), or to block, allow, activate or catalyse reactions that are physiologically relevant to achieve therapeutic effect. They can act as pharmaceutical agent, bind to a specific target and direct specific molecules to a desired site.
  • target molecules e.g. EpCAM bearing cancer stem cells
  • target molecules e.g. EpCAM bearing cancer stem cells
  • RNA aptamer molecules of the present disclosure can be used in in vitro processes, for example affinity purification mixtures to purify target molecules (e.g. EpCAM bearing cancer stem cells).
  • target molecules e.g. EpCAM bearing cancer stem cells
  • the aptamers are ideal for chromatographic separations of target molecules (e.g. EpCAM bearing cancer stem cells) from contaminants and for purifying target molecules from cell cultures or cell extracts.
  • RNA aptamer molecules of the present disclosure can be used as a capture agent to bind or immobilise a target (e.g. EpCAM bearing cancer stem cells) to a solid support.
  • a target e.g. EpCAM bearing cancer stem cells
  • the solid support can be comprised of substrates having the structure and composition commonly associated with filters, wafers, wafer chips, membranes and thin films.
  • the solid support may be comprises of substrates including, but not limited to resins, affinity resins, magnetic or polymer beads, or any diagnostic detection reagent, to capture or immobilise reagents for diagnostic, detection or quantitative studies
  • the solid supports may comprise any material depending of the desired use, including but not limited to glass, metal surfaces and materials such as steel, ceramic or polymeric materials such as polyethylene, polypropylene, polyamide, and polyvinylidenefluonde etc or combinations thereof.
  • hematopoietic stem cells The best known example of adult cell renewal by the differentiation of stem cells is the hematopoietic system.
  • Developmental ⁇ immature precursors such as hematopoietic stem cells and progenitor cells respond to molecular signals to gradually form the varied blood and lymphoid cell types.
  • Stem cells are also found in other tissues, including epithelial tissues and mesenchymal tissues. Cancer stem cells may arise from any of these cell types, for example, as a result of genetic damage in normal stem cells or by the dysregulated proliferation of stem cells and/or differentiated cells.
  • Cancer stem cells may be derived from any cancer comprising tumorigenic stem cells, i.e. cells having an ability to proliferate extensively or indefinitely, and which give rise to the majority of cancer cells. Within an established tumor, most cells have lost the ability to proliferate extensively and form new tumors, and a small subset of cancer stem cells proliferate to thereby regenerate the cancer stem cells as well as give rise to tumor cells lacking tumorigenic potential. Cancer stem cells may divide asymmetrically and symmetrically and may show variable rates of proliferation. Cancer stem cell may include transit amplifying cells or progenitor cells that have reacquired stem cell properties.
  • cancers from which stem cells may be isolated include cancers characterised by solid tumors, including for example fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, synovioma, lymphagioendotheliosarcoma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, chorio
  • Additional representative cancers from which stem cells can be isolated or enriched according to the present disclosure include hematopoietic malignancies, such as B cell lymphomas and leukemias, including low grade/follicular non-Hodgkin's lymphoma (NHL), small lymphocytic (SL) NHL, intermediate grade/follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade small non-cleaved cell NHL, bulky disease NHL and Waldenstrom's acroglobulinemia, chronic leukocytic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, lymphoblastic leukemia, lymphocytic leukemia, monocytic leukemia, myelogenous leukemia and promyelocyte leukemia.
  • NHL low grade/follicular non-Hodgkin's lymphoma
  • SL small lymphocytic
  • NHL intermediate grade/follicular NHL
  • intermediate grade diffuse NHL high grade immunoblastic
  • Cancer stem cells bearing EpCAM may be selected using the aptamer molecules as described herein.
  • aptamers which are coupled to fluorescent dyes can be used for the positive selection of cancer stem cells.
  • EpCAM is also known to be expressed in some normal cells. However, EpCAM expression is thought to be upregulated in cancer stem cells.
  • Cancer stem cell markers are typically expressed at a level that is at least about 5-fold greater than differentiated cells of the same origin or non-tumorigenic cells, for example, at least about 10-fold greater, or at least about 15-fold greater, or at least about 20-fold greater, or at least about 50-fold greater, or at least about 100-fold greater.
  • the selection process may also include negative selection markers which can be used for the elimination of those cancer cells in the population that are not cancer stem cells.
  • RNA aptamer of the present disclosure may be attached to a solid support to allow for a crude separation.
  • Various techniques of different efficacy may be employed depending upon efficiency of separation, associated cytotoxicity, ease and speed of performance and necessity for sophisticated equipment and/or technical skill.
  • Procedures for isolation or purification may include, but are not limited to, magnetic separation using aptamer-coated magnetic beads, affinity chromatography and "panning" with aptamer attached to a solid matrix.
  • Techniques providing accurate isolation or purification include but are not limited to FACS. Methods for preparing FACS will be apparent to the skilled artisan.
  • the RNA aptamer molecules of the present disclosure are enriched from a biological sample obtained from a subject.
  • the subject will be one which has a tumor or is suspected of having a tumor containing cancer stem cells.
  • enrichment or variations thereof are used herein to describe a population of cells in which the proportion of one particular cell type (i.e. cancer stem cells) is increased when compared with an untreated population of the cells (e.g. cells in the sample).
  • one particular cell type i.e. cancer stem cells
  • an untreated population of the cells e.g. cells in the sample.
  • a population enriched for cancer stem cells comprises at least about 0.1 %, or 0.5% or 1 % or 2% or 5% or 10% or 15% or 20% or 25% or 30% or 50% or 75%
  • EpCAM bearing cancer stem cells EpCAM bearing cancer stem cells.
  • enriched cell population comprising cancer stem cells will be taken to provide explicit support for the term “population of cells comprising X% cancer stem cells, wherein X% is a percentage as recited herein.
  • the population of cells is enriched from a cell preparation comprising EpCAM + cells in a selectable form.
  • selectable form will be understood to mean that the cells express a marker (e.g. a cell surface marker) permitting selection of
  • EpCAM bearing cells EpCAM bearing cells.
  • RNA aptamer molecules of the present disclosure can be used in vitro for diagnostic purposes to determine the presence of cancer stem cells in malignant tissue.
  • the method involves examining a biological sample for the presence of EpCAM + cancer stem cells.
  • the biological sample can be contacted with a labelled RNA aptamer of the present disclosure and the ability of the RNA aptamer to specifically bind to the cells in the sample is determined. Binding by the aptamer indicates the presence of an EpCAM bearing cell.
  • the EpCAM bearing cell is a cancer stem cell.
  • RNA aptamer of the present disclosure can also be used to localise a EpCAM + tumor in vivo by administering to a subject an isolated RNA aptamer of the present disclosure which is labelled with a reporter group which gives a detectable signal. Bound aptamers can then be detected using flow cytometry, microscopy, external scintigraphy, emission tomography, optical imaging or radionuclear scanning. The method can be used to stage a cancer in a subject with respect to the extent of the disease and to monitor changes in response to therapy.
  • RNA aptamer can be facilitated by coupling the RNA aptamer to a detectable label.
  • detectable labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, electron dense labels, labels for MRI, and radioactive materials.
  • suitable enzymes include horseradish peroxidise, alkaline phosphatise, ⁇ -galactosidase, or acetylcholinesterase.
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin.
  • suitable fluorescent materials include umbellifone, fluorescein isothiocyanate, rhodamine, dischlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin.
  • An example of a luminescent material includes luminol.
  • bioluminescent materials include luciferase, luciferin, and aequorin
  • suitable radioactive material include 125 l, 131 1, 35 S, 18 F, 64 Cu, 94m Tc, 124 l, 11 C, 13 N, 15 0, 68 Ga, 86 Y, 82 Rb or 3 H.
  • Labelling at the 3' end of the aptamer can be achieved, for example by templated extension using Klenow polymerase, by T4 RNA ligase-mediated ligation and by terminal deoxynucleotidyl transferase. Labelling at the 5' end can be achieved by the supplementation of the in vitro transcription mix with an excess of ⁇ - ⁇ -S, the thiol of which can then be used to attach biotin. In addition, direct chemical conjugation of a suitable group(s) to either 5'- or 3'- end can be used to label the aptamers.
  • Anticancer agent of the present disclosure is provided.
  • RNA aptamer molecules of the present disclosure can be conjugated to a moiety and used to direct the moiety to EpCAM+ cells, preferably cancer stem cells.
  • moieties include toxins, radionuclides, or chemotherapeutic agents which can be used to kill cancer stem cells.
  • RNA aptamer can be fused to the moiety, e.g. the toxin, either by virtue of the moiety and aptamer being chemically synthesised, or by means of conjugation, e.g. a non- peptide covalent bond, e.g. a non-amide bond, which is used to join separately produced RNA aptamer and the moiety.
  • the RNA aptamer and moiety may be joined by virtue of a suitable linker peptide.
  • Useful toxin molecules include peptide toxins, which are significantly cytotoxic when present intracellular ⁇ .
  • toxins include cytotoxins, metabolic disrupters (inhibitors and activators) that disrupt enzymatic activity and thereby kill cancer stem cells, and radioactive molecules that kill all cells within a defined radius of the effector portion.
  • a metabolic disrupter is a molecule, e.g. an enzyme or a cytokine that changes the metabolism of a cell such that is normal function is altered.
  • the term toxin includes any effector that causes death to a tumor cell.
  • peptide toxins have a generalised eukaryotic receptor binding domain; in these instances the toxin must be modified to prevent killing cells not bearing EpCA (e.g. to prevent killing cells not bearing EpCAM but having a receptor for the unmodified toxin). Such modifications must be made in a manner that preserves the cytotoxic function of the molecule.
  • Potentially useful toxins include, but are not limited to diphtheria toxin, cholera toxin, ricin, 0- Shiga-like toxin (SLT-I, SLT-II, SLT-II V ), LT toxin, C3 toxin, Shiga toxin pertussis toxin, tetanus toxin, Pseudomonas exotoxin, alorin, saponin, modeccin and gelanin.
  • Other toxins include tumor necrosis actor alpha (TNF-alpha) and lymphotoxin (LT).
  • calicheamicin gamma 1 Another toxin which has antitumor activity is calicheamicin gamma 1 , a diyne-ene containing antitumor antibiotic with considerable potency against tumors (Zein N et al (1988). Science 240:1 198-201 ).
  • diphtheria toxin (which sequence is known) can be conjugated to the RNA aptamer molecules of the present disclosure.
  • the natural diphtheria toxin molecule secreted by Corynebacterium diptheriae consist of several functional domains that can be characterised, starting at the amino terminal end of the molecule, as enzymatically-active fragment A (AA 1 -193) and fragment B (AA 194-535) which includes a translocation domain and a generalised cell binding domain (AA 475-535).
  • RNA aptamer and the toxin moiety can be linked in any of several ways which will be known to persons skilled in the art. For example, a method of conjugating an RNA aptamer to a toxin (gelonin) is described in Chu TC et al. (2006) Cancer Res 6(12)5989-5992.
  • the moiety can also be a modulator of the immune system that either activates or inhibits the body's immune system at the local level.
  • cytokines e.g. lymphokines such as IL-2
  • delivered to a tumor can cause the proliferation of cytotoxic T-lymphocytes or natural killer cells in the vicinity of the tumor.
  • the moiety or reporter group can also be a radioactive molecule, e.g. a radionucleotide, or a so-called sensitizer, e.g. a precursor molecule that becomes radioactive under specific conditions, e.g. boron when exposed to a bean of low-energy neutrons, in the so-called "boron neutron capture therapy" (BNCT) as described in Barth et al. (1990). Scientific American Oct 1990:100-107.
  • BNCT boron neutron capture therapy
  • Radionucleotides are single atom radioactive molecules that can emit either ⁇ , ⁇ , or ⁇ particles.
  • Alpha particle emitters are preferred to ⁇ , or ⁇ particle emitters, because they release far higher energy emissions over a shorter distance, and are therefore efficient without significantly penetrating, and harming, normal tissues.
  • Suitable a particle emitting radionuclides include 211 At, 212 Pb, and 212 Bi.
  • the radioactive molecule must be tightly linked to the aptamer either directly or by a bifunctional chelate. This chelate must not allow elution and thus premature release of the radioactive molecule in vivo. Waldmann, Science, 252:1657-62 (1991 ).
  • a stable isotope of boron e.g., boron 10
  • the boron will be delivered to and concentrates in or on the tumor cells by the specific binding of the aptamer to the cancer stem cell.
  • the tumor can be imaged and irradiated with a beam of low-energy neutrons, having an energy of about 0.025 eV. While this neutron irradiation, by itself, causes little damage to either the healthy tissue surrounding the tumor, or the tumor itself, boron 10 (e.g., on the surface of a tumor cell) will capture the neutrons, thereby forming an unstable isotope, boron 1 1. Boron 1 1 instantly fissions yielding lithium 7 nuclei and energetic a particles, about 2.79 million Ev. These heavy particles are a highly lethal, but very localized, form of radiation, because particles have a path length of only about one cell diameter (10 microns).
  • RNA aptamer molecules of the present disclosure can be used for siRNA or ribozyme delivery into cells.
  • suitable siRNA or ribozyme will depend upon the circumstances.
  • siRNAs or ribozymes that are suitable for use according to the present disclosure include those which target ATP binding cassette membrane transporters, sternness genes (Bmi-1 , Notch 1 , Sox 2, Oct-4, Nanog, ⁇ -catenin, Smo. nestin, ABCG2, Wnt2 and SCF, etc), GAPDH (glyceraldehyde 3-phosphate dehydrogenase), and survivin.
  • RNA aptamer molecules of the present disclosure can also be used to deliver cargo into EpCAIVT cancer stem cells in a variety of solid tumours.
  • Gelonin is a ribosomal toxin that can inhibit the process of protein synthesis and is cytotoxic. However, it is membrane impermeable and needs an usher for its cellular entry.
  • the RNA aptamer molecules of the present disclosure can be utilised to deliver membrane impermeable toxic payload to cancer stem cells.
  • NP Biodegradable nanoparticle
  • Pt(IV) pro-drug
  • Polyethylene glycol (PEG) was used as a copolymer during the nanoprecipitation step to synthesise the PLGA-PEG nanoparticle.
  • the PLGA-PEG-NP surface was decorated with a PSMA (prostate specific membrane antigen) aptamer.
  • PSMA prote specific membrane antigen
  • the present disclosure also extends to the use of the RNA aptamer molecules as simultaneous drug delivery and imaging agents.
  • This can be achieved by conjugating the aptamer to the surface of a fluorescent quantum dot (QD).
  • QD fluorescent quantum dot
  • the QD-aptamer conjugate is incubated with Dox to form the QD-aptamer-Dox nanoparticle.
  • Dox and QD are fluorescent molecules.
  • FRET bi-fluorescence resonance energy transfer
  • RNA aptamer, anticancer agent or drug delivery agent according to the present disclosure is administered in the form of a composition comprising a pharmaceutically acceptable carrier and/or excipient.
  • a composition comprising a pharmaceutically acceptable carrier and/or excipient.
  • excipient or other elements of the composition can be adapted in accordance with the route and device used for administration.
  • carrier and “excipient” refer to compositions of matter that are conventionally used in the art to facilitate the storage, administration, and/or the biological activity of an active compound (see, e.g., Remington's Pharmaceutical Sciences, 16th Ed., Mac Publishing Company (1980).
  • a carrier may also reduce any undesirable side effects of the active compound.
  • a suitable carrier is, for example, stable, e.g., incapable of reacting with other ingredients in the carrier. In one example, the carrier does not produce significant local or systemic adverse effect in recipients at the dosages and concentrations employed for treatment.
  • Suitable carriers for the present disclosure include those conventionally used, e.g. water, saline, aqueous dextrose, lactose, Ringer's solution a buffered solution, hyaluronan and glycols are exemplary liquid carriers, particularly (when isotonic) for solutions.
  • Suitable pharmaceutical carriers and excipients include starch, cellulose, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, glycerol, propylene glycol, water, ethanol, and the like.
  • the anticancer agent or drug delivery agent containing the RNA aptamer of the present invention can be administered parentally (for example, intravenous, hypodermic, local or peritoneal injection).
  • the effective dosage of the anticancer agent can be determined according to weight, age, gender, health condition, diet, administration frequency, administration method, excretion and severity of a disease.
  • the anticancer agent or drug delivery agent contains the RNA aptamer by 10-95 weight %.
  • the anticancer agent or drug delivery agent contains the RNA aptamer by 25-75 weight %.
  • the administration frequency may be one to several times a day.
  • the effective intracellular content of the RNA aptamer is approximately
  • the effective intracellular content of the RNA aptamer is preferably 100 nM to 500 nM.
  • the dosage of the aptamer could be under or more than the above range.
  • the isolated RNA aptamer molecule(s) of the present disclosure can be used alone or in combination with one or more additional RNA aptamers according to any method disclosed herein.
  • the RNA aptamer molecule(s) of the present disclosure can be combined with an RNA aptamer that facilitates the detection, purification or enrichment of cancer stem cells.
  • the additional RNA aptamer is one which specifically binds to CD133 + cells.
  • the additional RNA aptamer comprises the sequence 5'- CCCUCCUACAUAGGG-3'.
  • the additional RNA aptamer comprises the sequence 5'-CAGAACGUAUACUAUUCUG-3'.
  • the present disclosure also provides diagnostic kits for carrying out the methods disclosed herein.
  • the diagnostic kit includes the RNA aptamer or the diagnostic agent as described herein for detecting EpCAM expressing cells (e.g. cancer stem cells).
  • the kit may also include ancilliary agents such as buffering agents and stabilising agents.
  • the diagnostic kit may further include agents for reducing background interference, control reagents and an apparatus for conducting a test. Instructions on how to use the diagnostic kit are generally also included.
  • Aptamers against human EpCAM were generated and characterised as previously described (Shigdar S et al (201 1 ). Cancer Sci 102:991 -998).
  • Aptamer DT3 and control aptamer were described previously (Shigdar S et al, supra), while aptamer 23 is a 19 base nucleotide with a near-infrared fluorescent dye, TYE 665, conjugated to its 5' end. This aptamer was characterised using the same methods as for the inventors previous aptamers (Shigdar S et al, supra).
  • the cell lines of human origin used in this study were purchased from American type Culture Collection. They were glioblastoma U1 18-MG; breast carcinoma MCF-7, MDA-MB-231 and T47D; and colorectal adenocarcinoma HT-29. Cells were grown and maintained in culture with Dulbecco's Modified Eagle medium (DMEM) (Invitrogen, Victoria, Australia) supplemented with 10% fetal calf serum (MCF-7, T47D, HT-29, and U 118-MG), or Roswell Park Memorial Institute 1640 (RPMI 1640) (Invitrogen) with 10% fetal calf serum (MDA-MB-231 ).
  • DMEM Dulbecco's Modified Eagle medium
  • MCF-7 fetal calf serum
  • RPMI 1640 Roswell Park Memorial Institute 1640
  • Sections from each of the xenograft tumours were cut at 4 ⁇ onto polylysine coated slides prior to deparaffinisation with Histoclear and rehydration through graded ethanol.
  • Heat induced antigen retrieval was performed in a microwave oven using Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, 0.05 % Tween 20, pH 9.0) for 20 min and the slides were allowed to cool prior to blocking with 0.1 mg/mL tRNA, 0.1 mg/mL salmon sperm DNA and 1 mg/mL bovine serum albumin (BSA) in phosphate buffered saline (PBS) for 20 min.
  • Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, 0.05 % Tween 20, pH 9.0
  • BSA bovine serum albumin
  • PBS phosphate buffered saline
  • aptamers were prepared as previously described (Shigdar S et al, supra). Briefly, aptamers were heated to 85 °C for 5 min, allowed to cool to room temperature for 10 min and then heated at 37 °C for 15 min. Slides were incubated with aptamers at 100 nM concentration in a solution of PBS containing 5 mM MgCI 2 , 0.1 mg/mL tRNA, 1 mg/mL BSA, 10 % dextran sulphate and 500 Mg/mL heparin for 15 min at 37 °C.
  • Cells were harvested at 80% confluence with trypsin digestion and resuspended in washing buffer (DPBS with 5 mM MgCI 2 ) and enumerated. Following centrifugation (1000 x g for 5 min), the cell pellet was resuspended in assay buffer (DPBS supplemented with 5 mM MgCI 2 , 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 0.2% [w/v] sodium azide, and 5% FCS) and diluted to 1 x 10 6 /mL. The blocking step was carried out at 4 ' C. The binding of the aptamers was carried out at 37 ° C for 30 min or 4 ° C for 1 h, with the final concentration of magnesium chloride being 2.5 mM in all binding assays.
  • assay buffer DPBS supplemented with 5 mM MgCI 2 , 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 0.2% [
  • RNA from iterative rounds were labelled at the 3'-ends with fluorescein isothiocyanate (FITC) according to a previously described method (Willkomm & Hartmann (2005). Weinheim, Wiley- VCH GmbH & Co. KGaA 1 :86-94). Amber tubes were used throughout to minimise photo-bleaching. Briefly, samples were oxidized with sodium periodate. The oxidation was terminated with the addition of 10 mM ethylene glycol, followed by ethanol precipitation. FITC was added at a 30-molar excess, and the reaction was completed overnight at 4°C.
  • FITC fluorescein isothiocyanate
  • FITC-labelled RNA was incubated with trypsinised 5 x 10 5 Kato III or U1 18-MG cells in 100 ⁇ binding buffer (DPBS supplemented with 5 mM MgCI 2 , 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA) for 1 h on ice, followed by washing three times and resuspension in 300 ⁇ of assay buffer. Fluorescent intensity was determined with a FACS Canto II flow cytometer (Becton Dickinson) by counting 50,000 events each sample. The FITC-labelled RNA from the unselected library was used to determine non-specific binding.
  • 100 ⁇ binding buffer DPBS supplemented with 5 mM MgCI 2 , 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA
  • the binding for each round was calculated after subtracting the mean fluorescence intensity of the binding of round zero RNA to target cells as well as that for binding to negative control cells according to a method described by Ellington and colleagues (Li et al. (2009). J. Proteome Res 8:2438-48).
  • the dead cells were gated and excluded from the analyses by staining with 2.5 Mg/ml propidium iodide and 0.5 mg/ml RNase A in PBS.
  • Transferrin (5 Mg/mL) was added to the cells following pre-treatment followed by a 30 min incubation at 37 ° C. The cells were washed three times in their respective buffers and visualised using the FluoView FV10i confocal microscope. Colocalisation of aptamers with transferrin.
  • T47D, MCF7, MDA-MB-231 , HT29 and U 1 18MG cells were prepared as previously described for confocal microscopy. Following removal of media, cells were incubated in blocking buffer containing 5 % (v/v) serum at 37 °C for 15 min, washed twice in binding buffer prior to incubation with 200 nM aptamer for 30 min at 37 °C. The aptamer solution was removed and the cells washed 3 times for 5 min each in binding buffer. Transferrin were then added to the cells and incubated for 2 hours prior to Bisbenzimide Hoechst 33342 (3 Mg/mL) (Sigma) being added to the cells during the final 15 mins of incubation. The cells washed 3 times for 5 min each in binding buffer prior to visualisation using a FluoView FV10i laser scanning confocal microscope. EpCAM aptamer
  • Human EpCAM cDNA was purchased from Invitrogen and cloned into a mammalian expression vector, pcDNA 3.1/V5-His-TOPO.
  • the recombinant 6 x Histine-tagged EpCAM was transiently expressed in HEK293T and the total cell lysate was prepared as described previously (Yeong SS et al. (2006) J Biol Chem 281 (41 ):30768-81 ).
  • Each well in the DELFIA anti-mouse-lgG coated plate PerkinElmer, Cat. No.
  • EpDT1 (1 st Truncation) derived from a sense oligonucleotide, 5'-
  • TAATACGACTCACTATAGGTCCGTAGTTCTGGCTGACTGGTTACCCGGTCGTACA GCTCG- 3' antisense oligonucleotide, 5'-CGAGCTGTACGACCGGGTA
  • EpDT3 (the third truncation) was derived from a sense oligonucleotide: 5'-TAATACGA CTCACTATAGCGACTGGTTACCCGGTCG-3' and an antisense oligonucleotide, 5'- CGACCGGGTAACCAGTCGCTATAGTGAGTCGTATTA-3';
  • Aptamer 23 was derived from a sense oligonucleotide 5'-TAATACGACTCACTATAACGTATCCCTTTTCGC GTA-3' and an antisense oligonucleotide, 5'- TACGCGAAAAGGGATACGT-3' (T7 RNA promoter sequence is underlined).
  • Each pair of oligonucleotides was mixed in equal molar ratios in 1 PEI buffer (0.1 M Tris-HCI pH 8, 0.1 M MgCI 2 0.5 M NaCI and 0.1 M dithiothreitol), heated for 5 min at 90 °C and cooled slowly to room temperature prior to ethanol precipitation.
  • In vitro transcription and FITC-labelling was performed as described above.
  • the final truncation of this clone (EpDT3), a fluoropyrimidine version of 5'-GCGACUGGUUCCCGGUCGdT-3' was also chemically synthesized with a 5'-DY647 fluorescent tag and a 3'-inverted deoxythymidine (Dharmacon).
  • the binding affinity of DY647-EpDT3 was determined as described herein, using EpCAM-positive and -negative cell lines and a negative control (2-O-methyl-pyrimidine) aptamer (5'-DY647-mGCmGACUmGmGUUmACCCmGmG UCmGdT-3').
  • the equilibrium dissociation constant (K'd) of successful 2'-fluoropyrimidine RNA aptamer species to native EpCAM expressed on the cell surface was determined using flow cytometry with EpCAM-positive and -negative cell lines and a negative control (2-O-methyl-pyrimidine) aptamer (5'-DY647-mGCmGACUmGmGUUmACCCmGmG UCmGdT-3').
  • Kato III or U1 18MG cells (5 x 10 5 ) were first incubated with assay buffer followed by two washes with binding buffer prior to incubation with serial concentrations (approximately 10-fold above and below the apparent K'd) of FITC-labelled aptamer in a 100 ⁇ assay buffer for 1 h on ice.
  • the cells were washed three times, resuspended in 150 ⁇ assay buffer containing 2.5 mM MgCI 2 and subjected to flow cytometric analyses.
  • the FITC-labelled unselected library was used as another negative control.
  • the mean fluorescence intensity (MFI) of the unselected library was subtracted from that of the aptamer-target cell to generate the MFI of specific binding.
  • the K'd for each aptamer was determined by Scatchard analysis according to the equation:
  • RNA strands were syntheses and the long strand was chemically modified with 2'- fluoropyrimidines.
  • the 19nt EpCAM aptamer was covalently combined with the guide strand of survivin siRNA (Carvalho A et al. (2003) J Cell Science 1 16:2987-2998) through a two amino acid bridge, while the passenger strand of Survivin siRNA was synthesised as the short strand.
  • Both the long strand (A) and short strand (B) have unstable secondary structures with free energy -7.5kcal/mol and -0.5kcal/mol for 43nt and 21 nt, respectively.
  • the expected chimera has a much more stable structure with a free energy of -42.6kcal/mol for 64nt. This means that after annealing, these two separated strands are more likely to create the expected aptamer-siRNA chimera (C). Furthermore, a 2 nt (UU) 3' overhang will be created after annealing, which will facilitate Dicer enzyme digestion of the chimera from 3' end of the guide strand of siRNA and finally result in the expected 21 mer siRNA.
  • a fluorescent molecule (DY647) was added at the 5' end of the short strand, which not only facilitates image analysis, but also contributes to the structure symmetry of the chimera and results in expected siRNA after Dicer processing.
  • DY647 A fluorescent molecule (DY647) was added at the 5' end of the short strand, which not only facilitates image analysis, but also contributes to the structure symmetry of the chimera and results in expected siRNA after Dicer processing.
  • the anti-EpCAM aptamers DT3 and 23 When incubated in the presence of dextran sulphate and heparin, the anti-EpCAM aptamers DT3 and 23 showed highly sensitive staining of T47D, MCF7 and DA-MB-231 human breast cancer xenografts at a concentration of 100 n for 15 min at 37°C ( Figure 1 ). Indeed, the staining pattern correlates well with the level of EpCAM expression seen on the surface of breast cancer cells, as demonstrated by weaker staining of the MDA-MB-231 xenograft sections that express much lower amounts of EpCAM than T47D and MCF7.
  • the intensity of antibody staining for the three different breast cancer xenografts using an anti-EpCA antibody 323/A3 is much weaker than that of the aptamers, in particular aptamer 23.
  • antibody 323/A3 did show moderate to strong staining of the HT-29 colorectal cancer xenograft.
  • the standard EpCAM stain in use at that laboratory is the anti-EpCAM antibody BerEP4.
  • MDA-MB-231 cells express the lowest amounts of EpCAM (1.7 ⁇ 10 3 binding sites/cell in MBD-MB-231 vs 222.1 ⁇ 10 3 binding sites/cell in MCF7 (Prang N et al (2005). Br J Cancer 92:342-349).
  • both of the two aptamers were able to successfully detect EpCAM in a xenograft tumour of MDA-MB-231 , while the two antibodies showed negligible staining of this breast cancer xenograft ( Figure 1 ).
  • RNA aptamers at a comparable concentration, can reliably detect low levels of EpCAM in tumours the antibodies fail to do so.
  • Figure 4 shows that the conjugation of siRNA to aptamer did not have an effect on the internalising capability of the aptamer.
  • Example 7 EpCAM aptamer-siRNA chimera targets tumors expressing EpCAM in vivo
  • the EpCAM aptamer-siRNA chimera could concentrate specifically in the tumour and that this result could be detected consecutively within four hours, with the peak present at about the time point of one hour.
  • fluorescence from aptamer-siRNA chimera still could be detected from the tumour and with a higher intensity than heart, liver, spleen and lung.
  • the high fluorescence signal in the kidney probably resulted from the relatively larger blood flow volume and the small volume of chimera (about 4 nm and could be partly diffused through blood vessels).
  • further modification such as PEGylation and full chemical modification, better plasma stability and lower kidney and liver accumulation could be achieved.
  • Example 8 Chimera can be recognised by Dicer enzyme after internalisation
  • EpCAM aptamer-survivin siRNA chimera 64 nt RNA oligonucleotide
  • control survivin siRNA the longer strand of the chimera without the passenger strand that was marked in green in Fig. 2C.
  • Figure 6 indicates that the chimera was successfully processed by the Dicer enzyme once delivered to the cytoplasm to produce the 21 -mer siRNA in cells.
  • the aptamer-siRNA chimera was successfully cleaved by the recombinant Dicer enzyme to produce the properly processed 21 - mer siRNA.
  • Example 9 Chimera demonstrates gene silencing capability in vitro
  • FIG. 8 shows the EpCAM antibody could only penetrate a few layers of cells on the surface of the tumor sphere even after 4 h.
  • the EpCAM aptamer-23 could penetrate into the core or center of the tumor sphere at after 30 min incubation; while a control aptamer that does not bind to EpCAM showed only limited non-specific binding to the tumor sphere.
  • EpCAM aptamer-guided delivery of a chemotherapy drug transforms an agent known to kill only non-cancer stem cell into an agent that kills cancer stem cells both in vitro and in vivo.
  • Example 11 Aptamer23-Dox conjugates, but not free Pox, target cancer stem cells in vitro.
  • CSCs cancer stem cells
  • progenitor cells survive and undergo self-renewal as well as proliferate to form tumour spheres.
  • the inventor studied the ability of aptamer-Dox to target cancer stem cells by plating various cell doses of single-cell suspension of HT29 colon cancer cells in ultra-low attachment 96-wells in the presence of 3 ⁇ of free Dox, 3 ⁇ equivalent Dox conjugated with aptamer, 3 ⁇ Dox- negative control aptamer or vehicle control for 5 days. Tumour spheres (with a size >50 ⁇ ) were enumerated. Consistent with previous findings from both clinical and preclinical studies that Dox kills only non-CSCs, 3 ⁇ free Dox had no effect on HT29 tumour sphere formation (Table 3).
  • Example 12 EpCAM aptamer-Dox targets cancer stem cells ex vivo
  • free Dox-treated cells formed tumours in every mouse studied but no tumour was detected in mice cells (Table 4) at Day 50 after receiving aptamer-Dox- treated tumour implantation.
  • EpCAM aptamer-Dox targets colon CSC in vivo.
  • the inventor first studied whether the aptamer-Dox conjugate could efficiently target tumour in vivo via live animal imaging with an on-site IVIS Lumina II imaging station. As shown in Fig. 13, the Dy647-labelled aptamer-Dox accumulated in the HT-29 xenograft tumour (s.c. approx. 5 mm in size) 5 min after i.v. injection and the signal in the tumour lasted for ⁇ 2 h. The ability of aptamer-Dox to target CSC was further tested in vivo using the gold standard extreme limiting dilution/xenotransplantation assay (ELDA). To this end, the inventor injected 1 x10 6 HT29 cells s.c. into NOD/SCID mice.
  • ELDA extreme limiting dilution/xenotransplantation assay
  • mice When tumours reached a size of 3 mm, the mice were randomized and treated serially for 3 days at a daily dose of 5 mg/Kg of either free Dox, EpCAM aptamer-Dox or control aptamer-Dox via tail vein injection. Mice were sacrificed one week after the last treatment. As shown in Fig. 14, after only 3 injections, the tumours from aptamer-Dox treated groups were statistically significantly smaller/lighter than mice receiving free Dox or Dox conjugated with the control aptamer. The experiment as repeated and single cell suspensions prepared from the treated tumours (as in Fig. 14) and ELDA (Extreme limiting dilution analysis) performed to assess the effect on CSC frequency. As shown in Table 5, EpCAM aptamer-Dox conjugates were able to significantly reduce the tumourigenicity in vivo as determined at 9 weeks after inoculation.
  • Example 14 Conjugation of a 20kDa-PEG to the 5 -end of EpCAM aptamers improves its biodsitribution and tumour targeting
  • PEG-aptamer-Dox (5 mg Dox/kg) was injected i.v. to tumour bearing-mice.
  • the percentage (%) ID of PEG-aptamer normalised by the weight of a given tissue/organ (in g) as determined via aptamer ELISA is plotted in the bar chart shown in Figure 15.
  • EpCAM aptamer-guided delivery of siRNA overcomes chemoresistance via effective targeting of cancer stem cell in vivo.
  • EpCAM aptamer-mediated siRNA delivery targets cancer stem cells in vitro
  • Doxorubicin on its own, does not kill cancer stem cells.
  • the inventor further confirmed the effect of the chimera plus Dox on cancer stem cells' tumourigenicity by xenotransplanting treated cells into the 4th inguinal mammary fat pads of NOD/SCID mice coupled with an extreme limiting dilution analysis to assess CSC frequency (at Day 40 after implantation) (Table 6).
  • treatment of tumourspheres in vitro with chimera plus 300 nM Dox resulted in a significant decrease of breast cancer CSCs (EpCAM7CD44 + /CD24 " ) than that of free Dox alone (Fig. 16), while the EpCAM7CD44 + /CD24 " population remained at -22.5% and 21.7% for cells treated with vehicle control or negative control chimera plus Dox, respectively.
  • EpCAM aptamer delivers siRNA to xenograft tumour in vivo and targets cancer stem cells
  • the in vivo efficacy of the chimera was demonstrated by its ability to knockdown both the survivin mRNA and protein by -60%.
  • the EpCAM-targeted delivery of survivin siRNA combined with treatment of Dox had eliminated a substantial portion of the cancer stem cells in the MCF7/ADR tumour in vivo as evident from the xenotransplantation-extreme limiting dilution analyses that assess the distinguishing features of cancer stem cells, self-renew and tumourigenicity of the tumours (at Day 50 after implantation) (Table 7).
  • a 20-kDa PEG was attached to the 5'-end of siRNA-aptamer-chimera in order to extend its systemic circulation time.
  • the inventor then used the same orthotopic breast cancer model by implanting 3x10 6 CF7/ADR cells (mixed with Matrigel) per site. When tumours reached a volume of -200 mm 3 , we started treatment.
  • tumours were removed, its weight determined and the percentage of breast cancer stem cell marker (EpCAM + /CD447CD24 ) positive cells in the treatment groups and various control groups was studied via flow cytometray.
  • the tumours from the mice treated with EpCAM-23 aptamer-survivin siRNA chimera plus doxorubicin had significantly reduced tumour total tumour mass (weight) than that of any of the other treatment groups, including the group treated with free doxorubicin.
  • the treatment by EpCAM-23 aptamer-survivin siRNA chimera plus doxorubicin has drastically reduced the breast cancer stem cell pool (Table 8).
  • EpCAM-23 aptamer-guided delivery of siRNA to cancer stem cell in vivo enhances treatment efficacy by preventing the development of chemoresistance.
  • EpCAM is a cancer biomarker with its overexpression documented in both primary and metastatic breast cancers.
  • the adverse clinical outcomes of such patients are associated with increasing EpCAM expression especially in the metastases.
  • a poorer prognosis in gallbladder, ovarian and pancreatic cancer has also been associated with an overexpression of EpCAM.
  • EpCAM expression in triple-negative breast cancers may be a suitable target for immunotherapy, given its resistance to current targeted therapies, such as endocrine treatment and trastuzumab.
  • adecatumumab MT201
  • patients with metastatic breast cancer showed dose- dependent and target dependent clinical responses with a reduced rate of new metastases.
  • prior aptamer DT3 did not show any staining of HT-29 xenograft sections, while the other aptamer tested, aptamer 23, showed strong positive staining.
  • One possibility is that the particular epitope that DT3 binds to on the EpCAM molecule may be lost or remains inaccessible due to other antigens on the cell surface masking that epitope on this particular tumour.
  • this particular epitope remains masked on this xenograft tumour following antigen retrieval.
  • the lower affinity that aptamer DT3 has for this cell line might also play a role and it could be a combination of these two factors that lead to a lack of immunostaining.
  • aptamers are 10-20 times smaller (6 kDa vs 150 kDa) than antibodies and it is therefore possible that more numbers of aptamers bind to a given target molecule than antibodies.
  • the smaller size of aptamer may facilitate it to penetrate the layers of cells in a histopathology slides more effectively.
  • EpCAM expression on the surface of MDA- B- 231 cells via aptamer staining of paraffin embedded tissues, when this cell line is generally regarded as EpCAM negative due to the inability of antibodies to detect its expression. Conceivably, low levels of EpCAM expression might be missed during diagnosis using conventional antibody staining.
  • aptamers can provide a robust and cost-effective tool to translate discoveries from biomarker and cancer stem cell research into pathology diagnostic practice to enable better stratification of patients for personalized medicine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Optics & Photonics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/AU2013/000851 2012-08-02 2013-08-02 Epcam aptamer for detection of cancer stem cells Ceased WO2014019025A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
EP13825695.3A EP2880163B1 (en) 2012-08-02 2013-08-02 Epcam aptamer for detection of cancer stem cells
SG11201500663RA SG11201500663RA (en) 2012-08-02 2013-08-02 Epcam aptamer for detection of cancer stem cells
HK16101899.2A HK1213941A1 (zh) 2012-08-02 2013-08-02 用於检测癌症干细胞的epcam适配子
US14/418,660 US9567586B2 (en) 2012-08-02 2013-08-02 EpCAM aptamer for detection of cancer stem cells
AU2013299332A AU2013299332B2 (en) 2012-08-02 2013-08-02 EpCAM aptamer for detection of cancer stem cells
MX2015001441A MX2015001441A (es) 2012-08-02 2013-08-02 Aptamero epcam para la deteccion de celulas madre cancerosas.
NZ704718A NZ704718A (en) 2012-08-02 2013-08-02 Epcam aptamer for detection of cancer stem cells
CA2880590A CA2880590C (en) 2012-08-02 2013-08-02 Epcam aptamer for detection of cancer stem cells
CN201380050791.2A CN104854243B (zh) 2012-08-02 2013-08-02 用于检测癌症干细胞的EpCAM适配子
JP2015524573A JP6297034B2 (ja) 2012-08-02 2013-08-02 癌幹細胞を検出するためのEpCAMアプタマー
IN636DEN2015 IN2015DN00636A (https=) 2012-08-02 2013-08-02
BR112015002286A BR112015002286A2 (pt) 2012-08-02 2013-08-02 aptâmeros epcam para a detecção de células tronco cancerosas
IL237038A IL237038A0 (en) 2012-08-02 2015-02-01 Epcam aptamer for detection of cancer stem cells
ZA2015/01317A ZA201501317B (en) 2012-08-02 2015-02-26 Epcam aptamer for detection of cancer stem cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2012903333A AU2012903333A0 (en) 2012-08-02 EpCAM Aptamer for Detection of Cancer Stem Cells
AU2012903333 2012-08-02

Publications (1)

Publication Number Publication Date
WO2014019025A1 true WO2014019025A1 (en) 2014-02-06

Family

ID=50026988

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2013/000851 Ceased WO2014019025A1 (en) 2012-08-02 2013-08-02 Epcam aptamer for detection of cancer stem cells

Country Status (16)

Country Link
US (1) US9567586B2 (https=)
EP (1) EP2880163B1 (https=)
JP (1) JP6297034B2 (https=)
KR (1) KR20150083075A (https=)
CN (1) CN104854243B (https=)
AU (1) AU2013299332B2 (https=)
BR (1) BR112015002286A2 (https=)
CA (1) CA2880590C (https=)
HK (1) HK1213941A1 (https=)
IL (1) IL237038A0 (https=)
IN (1) IN2015DN00636A (https=)
MX (1) MX2015001441A (https=)
NZ (1) NZ704718A (https=)
SG (1) SG11201500663RA (https=)
WO (1) WO2014019025A1 (https=)
ZA (1) ZA201501317B (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016033472A1 (en) * 2014-08-29 2016-03-03 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
KR20160029335A (ko) * 2014-09-05 2016-03-15 한국생명공학연구원 EpCAM에 특이적으로 결합하는 핵산 앱타머 및 이의 용도
JP2018506284A (ja) * 2015-02-11 2018-03-08 ディーキン・ユニバーシティー EpCAMアプタマー及びそのコンジュゲート
EP3868884A1 (en) * 2020-02-19 2021-08-25 Aarhus Universitet Method for subtyping bladder cancer using aptamers
CN114072504A (zh) * 2019-03-28 2022-02-18 株式会社海赛尔科技 与癌干细胞特异性结合的适体及其用途
US12590311B2 (en) 2019-06-21 2026-03-31 The Children's Medical Center Corporation Methods and compositions for the treatment of cancer

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022165286A1 (en) * 2021-01-29 2022-08-04 Base Pair Biotechnologies, Inc. Functional ligands to pertussis toxin
CN105779458B (zh) * 2016-03-23 2020-03-17 苏州方舟生物医药有限公司 对非小细胞肺癌具有抑制作用的核糖核酸适配体及包含其的药物组合物
CN107875140A (zh) * 2016-09-30 2018-04-06 复旦大学 一种双靶向药物递送系统及其在制备肿瘤治疗制剂中的应用
US11634676B2 (en) 2017-07-18 2023-04-25 President And Fellows Of Harvard College Intracellular delivery using microfluidics-assisted cell screening (MACS)
CN110184272B (zh) * 2019-04-01 2021-03-30 福州大学 一种新型环状三元适配体及其合成方法和应用
CN110261359B (zh) * 2019-06-27 2022-01-28 复旦大学 一种基于激光共聚焦显微镜的癌症标志物成像方法
CN110592093B (zh) * 2019-09-10 2023-08-25 上海交通大学医学院附属仁济医院 一种能够识别EpCAM蛋白的核酸适体及其制备方法与应用
KR102685696B1 (ko) * 2020-06-03 2024-07-16 한국생명공학연구원 암 전이 및 재발 진단용 조성물
WO2022235971A2 (en) * 2021-05-06 2022-11-10 Systems Oncology, Llc Compositions for inhibiting growth of targeted cells
CN114990124B (zh) * 2022-06-22 2023-09-05 中国科学院苏州纳米技术与纳米仿生研究所 膜蛋白靶标cd44的核酸适配体、其筛选方法与应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010023327A2 (en) * 2008-09-01 2010-03-04 Consiglio Nazionale Delle Ricerche Method for obtaining oligonucleotide aptamers and uses thereof
WO2013003898A1 (en) * 2011-07-07 2013-01-10 Clinical Genomics Pty. Ltd Method for detection of cancer in a patient

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2130913A4 (en) * 2007-03-05 2010-09-01 On Chip Cellomics Consortium CHIP FOR CELL COMPONENT SAMPLING, CELL COMPONENT ANALYSIS SYSTEM AND CELL COMPONENT ANALYSIS METHOD USING THEREOF

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010023327A2 (en) * 2008-09-01 2010-03-04 Consiglio Nazionale Delle Ricerche Method for obtaining oligonucleotide aptamers and uses thereof
WO2013003898A1 (en) * 2011-07-07 2013-01-10 Clinical Genomics Pty. Ltd Method for detection of cancer in a patient

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BAEUERLE PA ET AL., BR J CANCER, vol. 96, 2007, pages 417 - 23
CERCHIA, L. ET AL.: "Nucleic acid aptamers in cancer medicine", FEBS LETTERS, vol. 528, 2002, pages 12 - 16, XP026978460 *
See also references of EP2880163A4
SHIGDAR S ET AL., CANCER SCI., vol. 102, no. 5, 2011, pages 991 - 8
SHIGDAR, S. ET AL.: "RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule", CANCER SCIENCE, vol. 102, no. 5, 2011, pages 991 - 998, XP055119088 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2015308721B2 (en) * 2014-08-29 2021-04-01 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
CN107106704A (zh) * 2014-08-29 2017-08-29 儿童医疗中心有限公司 用于治疗癌症的方法和组合物
JP2017526367A (ja) * 2014-08-29 2017-09-14 チルドレンズ メディカル センター コーポレーション 癌の処置のための方法および組成物
EP4043567A1 (en) * 2014-08-29 2022-08-17 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
US11180762B2 (en) 2014-08-29 2021-11-23 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
US10385343B2 (en) 2014-08-29 2019-08-20 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
WO2016033472A1 (en) * 2014-08-29 2016-03-03 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
KR20160029335A (ko) * 2014-09-05 2016-03-15 한국생명공학연구원 EpCAM에 특이적으로 결합하는 핵산 앱타머 및 이의 용도
KR101641920B1 (ko) 2014-09-05 2016-07-22 한국생명공학연구원 EpCAM에 특이적으로 결합하는 핵산 앱타머 및 이의 용도
US10577610B2 (en) 2015-02-11 2020-03-03 Deakin University EpCAM aptamers and conjugates thereof
EP3256593A4 (en) * 2015-02-11 2018-12-05 Deakin University Epcam aptamers and conjugates thereof
JP2018506284A (ja) * 2015-02-11 2018-03-08 ディーキン・ユニバーシティー EpCAMアプタマー及びそのコンジュゲート
CN114072504A (zh) * 2019-03-28 2022-02-18 株式会社海赛尔科技 与癌干细胞特异性结合的适体及其用途
EP3950946A4 (en) * 2019-03-28 2023-10-25 Hicell Tech APTAMER SPECIFICALLY BINDING TO CANCER STEM CELLS AND USE THEREOF
US12590311B2 (en) 2019-06-21 2026-03-31 The Children's Medical Center Corporation Methods and compositions for the treatment of cancer
EP3868884A1 (en) * 2020-02-19 2021-08-25 Aarhus Universitet Method for subtyping bladder cancer using aptamers

Also Published As

Publication number Publication date
EP2880163B1 (en) 2018-11-21
KR20150083075A (ko) 2015-07-16
AU2013299332A1 (en) 2015-02-26
MX2015001441A (es) 2015-09-23
US9567586B2 (en) 2017-02-14
CN104854243A (zh) 2015-08-19
AU2013299332B2 (en) 2018-08-09
NZ704718A (en) 2017-09-29
US20150197755A1 (en) 2015-07-16
EP2880163A4 (en) 2016-03-09
JP2015530081A (ja) 2015-10-15
SG11201500663RA (en) 2015-02-27
BR112015002286A2 (pt) 2017-07-04
IL237038A0 (en) 2015-03-31
CA2880590A1 (en) 2014-02-06
HK1213941A1 (zh) 2016-07-15
CN104854243B (zh) 2018-01-19
ZA201501317B (en) 2016-07-27
IN2015DN00636A (https=) 2015-06-26
CA2880590C (en) 2020-10-06
JP6297034B2 (ja) 2018-03-20
EP2880163A1 (en) 2015-06-10

Similar Documents

Publication Publication Date Title
US9567586B2 (en) EpCAM aptamer for detection of cancer stem cells
EP2880185B1 (en) Cd133 aptamers for detection of cancer stem cells
US10577610B2 (en) EpCAM aptamers and conjugates thereof
AU2015213483B2 (en) Aptamer construct
Zhang Targeting MED1 LxxLL Motifs for Tissue-Selective Treatment of Human Breast Cancer
HK1231933B (en) Aptamer construct

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13825695

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2880590

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14418660

Country of ref document: US

Ref document number: MX/A/2015/001441

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 237038

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2015524573

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2013299332

Country of ref document: AU

Date of ref document: 20130802

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2013825695

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20157005475

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015002286

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015002286

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150130