WO2013177245A2 - Nano46 genes and methods to predict breast cancer outcome - Google Patents

Nano46 genes and methods to predict breast cancer outcome Download PDF

Info

Publication number
WO2013177245A2
WO2013177245A2 PCT/US2013/042157 US2013042157W WO2013177245A2 WO 2013177245 A2 WO2013177245 A2 WO 2013177245A2 US 2013042157 W US2013042157 W US 2013042157W WO 2013177245 A2 WO2013177245 A2 WO 2013177245A2
Authority
WO
WIPO (PCT)
Prior art keywords
expression
intrinsic
genes
tumor
nan046
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/042157
Other languages
English (en)
French (fr)
Other versions
WO2013177245A3 (en
Inventor
Sean M. Ferree
Joel S. Parker
James Justin STORHOFF
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
NS Wind Down Co Inc
Original Assignee
Nanostring Technologies Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES13794236T priority Critical patent/ES2763931T3/es
Priority to EP13794236.3A priority patent/EP2852689B1/en
Priority to MX2014014275A priority patent/MX369628B/es
Priority to BR112014029300A priority patent/BR112014029300A2/pt
Priority to CN201380038875.4A priority patent/CN104704128A/zh
Priority to CA2874492A priority patent/CA2874492C/en
Priority to AU2013266419A priority patent/AU2013266419B2/en
Priority to JP2015514143A priority patent/JP6325530B2/ja
Application filed by Nanostring Technologies Inc filed Critical Nanostring Technologies Inc
Priority to IN2418MUN2014 priority patent/IN2014MN02418A/en
Publication of WO2013177245A2 publication Critical patent/WO2013177245A2/en
Priority to IL235795A priority patent/IL235795B/en
Anticipated expiration legal-status Critical
Publication of WO2013177245A3 publication Critical patent/WO2013177245A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • This disclosure relates generally to the field of cancer biology, and specifically, to the fields of detection and identification of specific cancer cell phenotypes and correlation with appropriate therapies.
  • the present invention provides a method of predicting outcome in a subject having breast cancer comprising: providing a tumor sample from the subject; determining the expression of the genes in the NAN046 intrinsic gene list of Table 1 in the tumor sample; measuring the similarity of the tumor sample to an intrinsic subtype based on the expression of the genes in the NAN046 intrinsic gene list, wherein the intrinsic subtype consists of at least Basal-like, Luminal A, Luminal B or HER2-enriched; determining a proliferation score based on the expression of a subset of proliferation genes in the NAN046 intrinsic gene list; determining the size of the tumor, calculating a risk of recurrence score using a weighted sum of said intrinsic subtype, proliferation score and tumor size; and determining whether the subject has a low or high risk of recurrence based on the recurrence score.
  • a low score indicates a more favorable outcome and high score indicates a less favorable outcome.
  • the methods of the present invention can include determining the expression of at least one of, a combination of, or each of, the NAN046 intrinsic genes recited in Table 1. In some embodiments, the methods of the present invention can include determining the expression of at least one of, a combination of, or each of, the NAN046 intrinsic genes selected from ANLN, CCNE1, CDC20, CDC6, CDCA1, CENPF, CEP55, EXOl, KIF2C, KNTC2, MELK, MKI67, ORC6L, PTTG1, RRM2, TYMS, UBE2C and/or UBE2T.
  • the expression of the members of the NAN046 intrinsic gene list can be determined using the nanoreporter code system (nCounter® Analysis system).
  • the methods of the present invention can include determining at least one of, a combination of, or each of, the following: tumor size, tumor grade, nodal status, intrinsic subtype, estrogen receptor expression, progesterone receptor expression, and HER2/ERBB2 expression
  • the sample can be a sampling of cells or tissues.
  • the sample can be a tumor.
  • the tissue can be obtained from a biopsy.
  • the sample can be a sampling of bodily fluids.
  • the bodily fluid can be blood, lymph, urine, saliva or nipple aspirate.
  • Figure 1 is a heatmap of the breast cancer intrinsic subtypes and the intrinsic genes of Table 1.
  • Figure 2 shows a Kaplan Meier survival curves from a cohort of untreated breast cancer patients.
  • Figure 3 shows a Kaplan Meier survival curves from a cohort of node-negative, ER+ Breast Cancer Patients treated with tamoxifen.
  • Figure 4 shows a 10 Year event probability as a function of ROR Score in ER+, Node-negative breast cancer patients treated with tamoxifen.
  • the graph shows the sub- population subtyped as Luminal A or B within this population.
  • RFS Recurrence-free survival
  • DSS disease-specific survival
  • Figure 5 is a schematic of the breast cancer intrinsic subtyping assay.
  • Figure 6 is a schematic of the algorithm process.
  • Figure 7 is an illustration showing the hybridization of the CodeSet to mRNA.
  • Figure 8 is an illustration showing the removal of excess reporters.
  • Figure 9 is an illustration showing the binding of the reporters to the surface of a cartridge.
  • Figure 10 is an illustration showing the immobilization and alignment of a reporter.
  • Figure 11 is an illustration of data collection.
  • Figure 12 is an illustration of the nCounter analysis system breast cancer test assay process.
  • Figure 13 is an illustration of the nCounter Prep Station.
  • Figure 14 is an illustration of nCounter Digital Analyzer.
  • the disclosure presents a method of predicting outcome in a subject having breast cancer comprising: providing a tumor sample from the subject; determining the expression of the genes in the NAN046 intrinsic gene list of Table 1 in the tumor sample; determining the intrinsic subtype of the tumor sample based on the expression of the genes in the NAN046 intrinsic gene list, wherein the intrinsic subtype consists of at least Basal-like, Luminal A, Luminal B or HER2-enriched; determining a proliferation score based on the expression of a subset of proliferation genes in the NAN046 intrinsic gene list; determining the size of the tumor, calculating a risk of recurrence score using a weighted sum of said intrinsic subtype, proliferation score and tumor size; and determining whether the subject has a low or high risk of recurrence based on the recurrence score.
  • a low score indicates a more favorable outcome and high score indicates a less favorable outcome.
  • Intrinsic genes are statistically selected to have low variation in expression between biological sample replicates from the same individual and high variation in expression across samples from different individuals. Thus, intrinsic genes are used as classifier genes for breast cancer classification. Although clinical information was not used to derive the breast cancer intrinsic subtypes, this classification has proved to have prognostic significance. Intrinsic gene screening can be used to classify breast cancers into five molecular distinct intrinsic subtypes, Luminal A (LumA), Luminal B (LumB), HER2-enriched (Her-2-E), Basal-like, and Normal-like (Perou et al. Nature, 406(6797):747-52 (2000); Sorlie et al. PNAS, 98(19): 10869-74 (2001)).
  • a NAN046 gene expression assay can identify intrinsic subtype from a biological sample, e.g., a standard formalin fixed paraffin embedded tumor tissue.
  • the methods utilize a supervised algorithm to classify subject samples according to breast cancer intrinsic subtype.
  • This algorithm referred to herein as the NAN046 classification model, is based on the gene expression profile of a defined subset of intrinsic genes that has been identified herein as superior for classifying breast cancer intrinsic subtypes.
  • the subset of genes, along with primers target-specific sequences utilized for their detection, is provided in Table 1.
  • Table 1A provides the sequences of target specific probe sequences for detecting each gene utilized in Table 1.
  • the sequences provided in Table 1A are merely representative and are not meant to limit the invention. The skilled artisan can utilize any target sequence- specific probe for detecting any of (or each of) the genes in Table 1.
  • GPR160 NM_014373.1 GGATTTCAGTCCTTGCTTATGTTTTGGGAGAC 160
  • NAT1 NM_000662.4 AGCACTTCCTCATAGACCTTGGATGTGGGAGG 175
  • RRM2 NM_001034.1 TTCCTTTTGGACCGCCGAGGAGGTTGACCTCT 180
  • TYMS NM_001071.1 TGCTAAAGAGCTGTCTTCCAAGGGAGTGAAA 184
  • Table 2 provides select sequences for the NAN046 genes of Table 1.
  • NM_006845 ACGCTTGCGCGCGGGATTTAAACTGCGGCGGTTTACGCGGCGTTAAGACTTCGTAGGGTTAGCGAAATTG 116
  • NM_00112306 GGACGGCCGAGCGGCAGGGCGCTCGCGCGCGCCCACTAGTGGCCGGAGGAGAAGGCTCCCGCGGAGGCCG 121 6 CGCTGCCCGCCCCCTCCCCTGGGGAGGCTCGCGTTCCCGCTGCTCGCGCCTGCGCCGCCCGCCGGCCTCA
  • At least 40, at least 41, at least 42, at least 43, at least 44, at least 46 or all 46 of the genes in Table 1 can be utilized in the methods of the present invention.
  • the expression of each of the 46 genes is determined in a biological sample.
  • the prototypical gene expression profiles (i.e. centroid) of the four intrinsic subtypes were pre-defined from a training set of FFPE breast tumor samples using hierarchical clustering analysis of gene expression data.
  • a heatmap of the prototypical gene expression profiles (i. e. centroids) of these four subtypes is shown in Figure 1, where the level of expression is illustrated by the heatmap. Table 3 shows the actual values.
  • CDCA1 0.9367 0.1623 -0.4509 0.2692
  • CDH3 0.7639 0.0144 -0.0502 -1.0229
  • a computational algorithm based on a Pearson's correlation compares the normalized and scaled gene expression profile of the NAN046 intrinsic gene set of the test sample to the prototypical expression signatures of the four breast cancer intrinsic subtypes.
  • the intrinsic subtype analysis is determined by determining the expression of a NANO50 set of genes (which is determining the expression of the NAN046 set of genes and further includes determining the expression of MYBL2, BIRC5, GRB7 and CCNB1) and the risk of recurrence (“ROR”) is determined using the NAN046 set of genes).
  • the intrinsic subtype is identified by comparing the expression of the NANO50 set of genes in the biological sample with the expected expression profiles for the four intrinsic subtypes.
  • the subtype with the most similar expression profile is assigned to the biological sample.
  • the ROR score is an integer value on a 0-100 scale that is related to an individual patient's probability of distant recurrence within 10 years for the defined intended use population.
  • the ROR score is calculated by comparing the expression profiles of the NAN046 genes in the biological sample with the expected profiles for the four intrinsic subtypes, as described above, to calculate four different correlation values. These correlation values are then combined with a proliferation score (and optionally one or more clinicopathological variables, such as tumor size) to calculate the ROR score.
  • the ROR score is calculated by comparing only the expression profiles of the NAN046 genes.
  • FIG. 6 provides a schematic of the specific algorithm transformations.
  • the tumor sample is assigned the subtype with the largest positive correlation to the sample.
  • Kaplan Meier survival curves generated from a training set of untreated breast cancer patients demonstrate that the intrinsic subtypes are a prognostic indicator of recurrence free survival (RFS) in this test population, which includes both estrogen receptor positive/negative and HER2 positive/negative patients, Figure 2.
  • RFS recurrence free survival
  • the gene set contains many genes that are known markers for proliferation.
  • the methods of the present invention provide for the determination of subsets of genes that provide a proliferation signature.
  • the methods of the present invention can include determining the expression of at least one of, a combination of, or each of, a 18-gene subset of the NAN046 intrinsic genes selected from ANLN, CCNE1, CDC20, CDC6, CDCA1, CENPF, CEP55, EXOl, KIF2C, KNTC2, MELK, MKI67, ORC6L, PTTGl, RRM2, TYMS, UBE2C and/or UBE2T.
  • the expression of each of the 18-gene subset of the NAN046 gene set is determined to provide a proliferation score.
  • the expression of one or more of these genes may be determined and a proliferation signature index can be generated by averaging the normalized expression estimates of one or more of these genes in a sample.
  • the sample can be assigned a high proliferation signature, a moderate/intermediate proliferation signature, a low proliferation signature or an ultra-low proliferation signature.
  • Luminal subtypes The most common subtypes of breast cancer are the luminal subtypes, Luminal A and Luminal B. Prior studies suggest that luminal A comprises approximately 30% to 40% and luminal B approximately 20% of all breast cancers, but they represent over 90 % of hormone receptor positive breast cancers (Nielsen et al. Clin. Cancer Res., 16(21):5222-5232 (2009)). The gene expression pattern of these subtypes resembles the luminal epithelial component of the breast.
  • ER estrogen receptor
  • PR progesterone receptor
  • LIV1, GATA3, and cyclin Dl genes associated with ER activation, such as LIV1, GATA3, and cyclin Dl, as well as expression of luminal cytokeratins 8 and 18 (Lisa Carey & Charles Perou (2009). Gene Arrays, Prognosis, and Therapeutic Interventions. Jay R. Harris et al. (4th ed.), Diseases of the breast (pp. 458-472). Philadelphia, PA: Lippincott Williams & Wilkins).
  • Luminal A breast cancers exhibit low expression of genes associated with cell cycle activation and the ERBB2 cluster resulting in a better prognosis than Luminal B.
  • the Luminal A subgroup has the most favorable prognosis of all subtypes and is enriched for endocrine therapy-responsive tumors.
  • Luminal B Luminal B (LumB) breast cancers also express ER and ER-associated genes. Genes associated with cell cycle activation are highly expressed and this tumor type can be HER2(+) (-20%) or HER2(-). The prognosis is unfavorable (despite ER expression) and endocrine therapy responsiveness is generally diminished relative to LumA.
  • HER2-enriched The HER2-enriched subtype is generally ER-negative and is HER2- positive in the majority of cases with high expression of the ERBB2 cluster, including ERBB2 and GRB7. Genes associated with cell cycle activation are highly expressed and these tumors have a poor outcome.
  • Basal-like The Basal-like subtype is generally ER-negative, is almost always clinically HER2-negative and expresses a suite of "basal” biomarkers including the basal epithelial cytokeratins (CK) and epidermal growth factor receptor (EGFR). Genes associated with cell cycle activation are highly expressed.
  • CK basal epithelial cytokeratins
  • EGFR epidermal growth factor receptor
  • the NAN046 classification model described herein may be further combined with information on clinical variables to generate a continuous risk of recurrence (ROR) predictor.
  • ROR risk of recurrence
  • a number of clinical and prognostic breast cancer factors are known in the art and are used to predict treatment outcome and the likelihood of disease recurrence. Such factors include, for example, lymph node involvement, tumor size, histologic grade, estrogen and progesterone hormone receptor status, HER-2 levels, and tumor ploidy.
  • risk of recurrence (ROR) score is provided for a subject diagnosed with or suspected of having breast cancer. This score uses the NAN046 classification model in combination with clinical factors of lymph node status (N) and tumor size (T).
  • Lymph node status is classified as N0-N3 (NO: regional lymph nodes are free of metastasis; Nl : metastasis to movable, same-side axillary lymph node(s); N2: metastasis to same-side lymph node(s) fixed to one another or to other structures; N3: metastasis to same-side lymph nodes beneath the breastbone).
  • Methods of identifying breast cancer patients and staging the disease are well known and may include manual examination, biopsy, review of patient's and/or family history, and imaging techniques, such as mammography, magnetic resonance imaging (MRI), and positron emission tomography (PET).
  • MRI magnetic resonance imaging
  • PET positron emission tomography
  • breast cancer subtype is assessed through the evaluation of expression patterns, or profiles, of the intrinsic genes listed in Table 1 in one or more subject samples.
  • subject, or subject sample refers to an individual regardless of health and/or disease status.
  • a subject can be a subject, a study participant, a control subject, a screening subject, or any other class of individual from whom a sample is obtained and assessed in the context of the disclosure.
  • a subject can be diagnosed with breast cancer, can present with one or more symptoms of breast cancer, or a predisposing factor, such as a family (genetic) or medical history (medical) factor, for breast cancer, can be undergoing treatment or therapy for breast cancer, or the like.
  • a subject can be healthy with respect to any of the aforementioned factors or criteria.
  • the term “healthy” as used herein is relative to breast cancer status, as the term “healthy” cannot be defined to correspond to any absolute evaluation or status.
  • an individual defined as healthy with reference to any specified disease or disease criterion can in fact be diagnosed with any other one or more diseases, or exhibit any other one or more disease criterion, including one or more cancers other than breast cancer.
  • the healthy controls are preferably free of any cancer.
  • the methods for predicting breast cancer intrinsic subtypes include collecting a biological sample comprising a cancer cell or tissue, such as a breast tissue sample or a primary breast tumor tissue sample.
  • biological sample any sampling of cells, tissues, or bodily fluids in which expression of an intrinsic gene can be detected.
  • biological samples include, but are not limited to, biopsies and smears.
  • Bodily fluids useful in the present disclosure include blood, lymph, urine, saliva, nipple aspirates, gynecological fluids, or any other bodily secretion or derivative thereof.
  • Blood can include whole blood, plasma, serum, or any derivative of blood.
  • the biological sample includes breast cells, particularly breast tissue from a biopsy, such as a breast tumor tissue sample.
  • Biological samples may be obtained from a subject by a variety of techniques including, for example, by scraping or swabbing an area, by using a needle to aspirate cells or bodily fluids, or by removing a tissue sample (i.e. , biopsy). Methods for collecting various biological samples are well known in the art.
  • a breast tissue sample is obtained by, for example, fine needle aspiration biopsy, core needle biopsy, or excisional biopsy. Fixative and staining solutions may be applied to the cells or tissues for preserving the specimen and for facilitating examination.
  • Biological samples, particularly breast tissue samples may be transferred to a glass slide for viewing under magnification.
  • the biological sample is a formalin-fixed, paraffin-embedded breast tissue sample, particularly a primary breast tumor sample.
  • the tissue sample is obtained from a pathologist-guided tissue core sample.
  • the present disclosure provides methods for classifying, prognosticating, or monitoring breast cancer in subjects.
  • data obtained from analysis of intrinsic gene expression is evaluated using one or more pattern recognition algorithms.
  • Such analysis methods may be used to form a predictive model, which can be used to classify test data.
  • one convenient and particularly effective method of classification employs multivariate statistical analysis modeling, first to form a model (a "predictive mathematical model") using data (“modeling data”) from samples of known subtype (e.g. , from subjects known to have a particular breast cancer intrinsic subtype:
  • Pattern recognition methods have been used widely to characterize many different types of problems ranging, for example, over linguistics, fingerprinting, chemistry and psychology. In the context of the methods described herein, pattern recognition is the use of multivariate statistics, both parametric and non-parametric, to analyze data, and hence to classify samples and to predict the value of some dependent variable based on a range of observed measurements. There are two main approaches. One set of methods is termed “unsupervised” and these simply reduce data complexity in a rational way and also produce display plots which can be interpreted by the human eye. However, this type of approach may not be suitable for developing a clinical assay that can be used to classify samples derived from subjects independent of the initial sample population used to train the prediction algorithm.
  • the other approach is termed "supervised” whereby a training set of samples with known class or outcome is used to produce a mathematical model which is then evaluated with independent validation data sets.
  • a "training set” of intrinsic gene expression data is used to construct a statistical model that predicts correctly the "subtype” of each sample.
  • This training set is then tested with independent data (referred to as a test or validation set) to determine the robustness of the computer-based model.
  • These models are sometimes termed “expert systems,” but may be based on a range of different mathematical procedures.
  • Supervised methods can use a data set with reduced dimensionality (for example, the first few principal components), but typically use unreduced data, with all dimensionality. In all cases the methods allow the quantitative description of the multivariate boundaries that characterize and separate each subtype in terms of its intrinsic gene expression profile. It is also possible to obtain confidence limits on any predictions, for example, a level of probability to be placed on the goodness of fit. The robustness of the predictive models can also be checked using cross-validation, by leaving out selected samples from the analysis.
  • the NAN046 classification model described herein is based on the gene expression profile for a plurality of subject samples using the intrinsic genes listed in Table 1.
  • the plurality of samples includes a sufficient number of samples derived from subjects belonging to each subtype class.
  • “sufficient samples” or “representative number” in this context is intended a quantity of samples derived from each subtype that is sufficient for building a classification model that can reliably distinguish each subtype from all others in the group.
  • a supervised prediction algorithm is developed based on the profiles of objectively-selected prototype samples for "training" the algorithm. The samples are selected and subtyped using an expanded intrinsic gene set according to the methods disclosed in International Patent Publication WO 2007/061876 and US Patent Publication No.
  • the samples can be subtyped according to any known assay for classifying breast cancer subtypes. After stratifying the training samples according to subtype, a centroid-based prediction algorithm is used to construct centroids based on the expression profile of the intrinsic gene set described in Table 1.
  • the prediction algorithm is the nearest centroid methodology related to that described in Narashiman and Chu (2002) PNAS 99:6567-6572, which is herein incorporated by reference in its entirety.
  • the method computes a standardized centroid for each subtype. This centroid is the average gene expression for each gene in each subtype (or "class") divided by the within-class standard deviation for that gene.
  • Nearest centroid classification takes the gene expression profile of a new sample, and compares it to each of these class centroids.
  • Subtype prediction is done by calculating the Spearman's rank correlation of each test case to the five centroids, and assigning a sample to a subtype based on the nearest centroid.
  • detecting expression is intended determining the quantity or presence of an RNA transcript or its expression product of an intrinsic gene.
  • Methods for detecting expression of the intrinsic genes of the disclosure include methods based on hybridization analysis of polynucleotides, methods based on sequencing of polynucleotides, immunohistochemistry methods, and proteomics-based methods. The methods generally detect expression products ⁇ e.g. , mRNA) of the intrinsic genes listed in Table 1.
  • PCR-based methods such as reverse transcription PCR (RT-PCR) (Weis et al , TIG 8:263- 64, 1992), and array-based methods such as microarray (Schena et al , Science 270:467- 70, 1995) are used.
  • microarray is intended an ordered arrangement of hybridizable array elements, such as, for example, polynucleotide probes, on a substrate.
  • probe refers to any molecule that is capable of selectively binding to a specifically intended target biomolecule, for example, a nucleotide transcript or a protein encoded by or corresponding to an intrinsic gene.
  • Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
  • RNA e.g. , mRNA
  • RNA can be extracted, for example, from frozen or archived paraffin- embedded and fixed (e.g. , formalin- fixed) tissue samples (e.g. , pathologist-guided tissue core samples).
  • RNA isolation can be performed using a purification kit, a buffer set and protease from commercial manufacturers, such as Qiagen (Valencia, CA), according to the manufacturer's instructions.
  • RNA from cells in culture can be isolated using Qiagen RNeasy mini- columns.
  • Other commercially available RNA isolation kits include MASTERPURETM Complete DNA and RNA Purification Kit (Epicentre, Madison, Wis.) and Paraffin Block RNA Isolation Kit (Ambion, Austin, TX).
  • Total RNA from tissue samples can be isolated, for example, using RNA Stat-60 (Tel-Test, Friendswood, TX).
  • Total RNA from FFPE can be isolated, for example, using High Pure FFPE RNA Microkit, Cat No. 04823125001 (Roche Applied Science, Indianapolis, IN).
  • RNA prepared from a tumor can be isolated, for example, by cesium chloride density gradient centrifugation.
  • large numbers of tissue samples can readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski (U.S. Pat. No. 4,843, 155).
  • Isolated RNA can be used in hybridization or amplification assays that include, but are not limited to, PCR analyses and probe arrays.
  • One method for the detection of RNA levels involves contacting the isolated RNA with a nucleic acid molecule (probe) that can hybridize to the mRNA encoded by the gene being detected.
  • the nucleic acid probe can be, for example, a full-length cDNA, or a portion thereof, such as an oligonucleotide of at least 7, 15, 30, 60, 100, 250, or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to an intrinsic gene of the present disclosure, or any derivative DNA or RNA.
  • Hybridization of an mRNA with the probe indicates that the intrinsic gene in question is being expressed.
  • the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
  • the probes are immobilized on a solid surface and the mRNA is contacted with the probes, for example, in an Agilent gene chip array.
  • Agilent gene chip array A skilled artisan can readily adapt known mRNA detection methods for use in detecting the level of expression of the intrinsic genes of the present disclosure.
  • An alternative method for determining the level of intrinsic gene expression product in a sample involves the process of nucleic acid amplification, for example, by RT-PCR (U.S. Pat. No. 4,683,202), ligase chain reaction (Barany, PNAS USA 88: 189-93, (1991)), self sustained sequence replication (Guatelli et al. , Proc. Natl. Acad. Sci USA 87: 1874-78, (1990)), transcriptional amplification system (Kwoh et al. , Proc. Natl. Acad.
  • intrinsic gene expression is assessed by quantitative RT-PCR.
  • Numerous different PCR or QPCR protocols are known in the art and exemplified herein below and can be directly applied or adapted for use using the presently- described compositions for the detection and/or quantification of the intrinsic genes listed in Table 1.
  • a target polynucleotide sequence is amplified by reaction with at least one oligonucleotide primer or pair of oligonucleotide primers.
  • the primer(s) hybridize to a complementary region of the target nucleic acid and a DNA polymerase extends the primer(s) to amplify the target sequence.
  • a nucleic acid fragment of one size dominates the reaction products (the target polynucleotide sequence which is the amplification product).
  • the amplification cycle is repeated to increase the concentration of the single target polynucleotide sequence.
  • the reaction can be performed in any thermocycler commonly used for PCR.
  • cyclers with real time fluorescence measurement capabilities for example, SMARTCYCLER® (Cepheid, Sunnyvale, CA), ABI PRISM 7700® (Applied Biosystems, Foster City, Calif.), ROTOR- GENETM (Corbett Research, Sydney, Australia), LIGHTCYCLER® (Roche Diagnostics Corp, Indianapolis, Ind.), ICYCLER® (Biorad Laboratories, Hercules, Calif.) and MX4000® (Stratagene, La Jolla, Calif.).
  • SMARTCYCLER® Cepheid, Sunnyvale, CA
  • ABI PRISM 7700® Applied Biosystems, Foster City, Calif.
  • ROTOR- GENETM Corbett Research, Sydney, Australia
  • LIGHTCYCLER® Roche Diagnostics Corp, Indianapolis, Ind.
  • ICYCLER® Biorad Laboratories, Hercules, Calif.
  • MX4000® Stratagene, La Jolla, Calif.
  • microarrays are used for expression profiling. Microarrays are particularly well suited for this purpose because of the
  • DNA microarrays provide one method for the simultaneous measurement of the expression levels of large numbers of genes. Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA or DNA is hybridized to complementary probes on the array and then detected by laser scanning. Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, for example, U.S. Pat. Nos. 6,040, 138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316. High-density oligonucleotide arrays are particularly useful for determining the gene expression profile for a large number of RNAs in a sample.
  • the nCounter® Analysis system is used to detect intrinsic gene expression.
  • the basis of the nCounter® Analysis system is the unique code assigned to each nucleic acid target to be assayed (International Patent Application Publication No. WO 08/124847, US Patent No. 8,415,102 and Geiss et al. Nature Biotechnology. 2008. 26(3): 317-325; the contents of which are each incorporated herein by reference in their entireties).
  • the code is composed of an ordered series of colored fluorescent spots which create a unique barcode for each target to be assayed.
  • a pair of probes is designed for each DNA or RNA target, a biotinylated capture probe and a reporter probe carrying the fluorescent barcode. This system is also referred to, herein, as the nanoreporter code system.
  • each sequence specific reporter probe comprises a target specifc sequence capable of hybriding to no more than one NAN046 gene of Table 1 and optionally comprises at least two, at least three, or at least four label attachment regions, said attachment regions comprising one or more label monomers that emit light.
  • Capture probes are made by ligating a second sequence-specific DNA oligonucleotide for each target to a universal oligonucleotide containing biotin. Reporter and capture probes are all pooled into a single hybridization mixture, the "probe library".
  • the probe library comprises a probe pair (a capture probe and reporter) for each of the NAN046 genes in Table 1.
  • the method comprises contacting a biological sample with a probe library, the library comprising a probe pair for the NAN046 genes in Table 1 , such that the presence of the target in the sample creates a probe pair - target complex.
  • the complex is then purified. More specifically, the sample is combined with the probe library, and hybridization occurs in solution.
  • the tripartite hybridized complexes (probe pairs and target) are purified in a two-step procedure using magnetic beads linked to oligonucleotides complementary to universal sequences present on the capture and reporter probes. This dual purification process allows the hybridization reaction to be driven to completion with a large excess of target-specific probes, as they are ultimately removed, and, thus, do not interfere with binding and imaging of the sample. All post hybridization steps are handled robotically on a custom liquid-handling robot (Prep Station, NanoString
  • the sample cartridge is transferred to a fully automated imaging and data collection device (Digital Analyzer, NanoString Technologies).
  • the expression level of a target is measured by imaging each sample and counting the number of times the code for that target is detected. Data is output in simple spreadsheet format listing the number of counts per target, per sample.
  • nucleic acid probes and nanoreporters can include the rationally designed (e.g. synthetic sequences) described in International Publication No. WO 2010/019826 and US Patent Publication No.
  • Multivariate projection methods such as principal component analysis (PCA) and partial least squares analysis (PLS), are so-called scaling sensitive methods.
  • PCA principal component analysis
  • PLS partial least squares analysis
  • Scaling and weighting may be used to place the data in the correct metric, based on knowledge and experience of the studied system, and therefore reveal patterns already inherently present in the data.
  • missing data for example gaps in column values
  • such missing data may replaced or "filled” with, for example, the mean value of a column ("mean fill”); a random value (“random fill”); or a value based on a principal component analysis (“principal component fill”).
  • Translation of the descriptor coordinate axes can be useful. Examples of such translation include normalization and mean centering. “Normalization” may be used to remove sample-to-sample variation. For microarray data, the process of normalization aims to remove systematic errors by balancing the fluorescence intensities of the two labeling dyes. The dye bias can come from various sources including differences in dye labeling efficiencies, heat and light sensitivities, as well as scanner settings for scanning two channels. Some commonly used methods for calculating normalization factor include: (i) global normalization that uses all genes on the array; (ii) housekeeping genes normalization that uses constantly expressed housekeeping/invariant genes; and (iii) internal controls normalization that uses known amount of exogenous control genes added during
  • the intrinsic genes disclosed herein can be normalized to control housekeeping genes.
  • the housekeeping genes described in U.S. Patent Publication 2008/0032293, which is herein incorporated by reference in its entirety, can be used for normalization.
  • Exemplary housekeeping genes include MRPL19, PSMC4, SF3A1, PUM1, ACTB, GAPD, GUSB, RPLPO, and TFRC. It will be understood by one of skill in the art that the methods disclosed herein are not bound by normalization to any particular housekeeping genes, and that any suitable housekeeping gene(s) known in the art can be used.
  • microarray data is normalized using the LOWESS method, which is a global locally weighted scatter plot smoothing normalization function.
  • qPCR data is normalized to the geometric mean of set of multiple housekeeping genes.
  • Mean centering may also be used to simplify interpretation. Usually, for each descriptor, the average value of that descriptor for all samples is subtracted. In this way, the mean of a descriptor coincides with the origin, and all descriptors are "centered” at zero. In “unit variance scaling,” data can be scaled to equal variance. Usually, the value of each descriptor is scaled by 1/StDev, where StDev is the standard deviation for that descriptor for all samples. "Pareto scaling” is, in some sense, intermediate between mean centering and unit variance scaling.
  • each descriptor In pareto scaling, the value of each descriptor is scaled by l/sqrt(StDev), where StDev is the standard deviation for that descriptor for all samples. In this way, each descriptor has a variance numerically equal to its initial standard deviation.
  • the pareto scaling may be performed, for example, on raw data or mean centered data.
  • logarithmic scaling may be used to assist interpretation when data have a positive skew and/or when data spans a large range, e.g. , several orders of magnitude. Usually, for each descriptor, the value is replaced by the logarithm of that value. In “equal range scaling,” each descriptor is divided by the range of that descriptor for all samples. In this way, all descriptors have the same range, that is, 1. However, this method is sensitive to presence of outlier points. In “autoscaling,” each data vector is mean centered and unit variance scaled. This technique is a very useful because each descriptor is then weighted equally, and large and small values are treated with equal emphasis. This can be important for genes expressed at very low, but still detectable, levels.
  • data is collected for one or more test samples and classified using the NAN046 classification model described herein.
  • DWD Distance Weighted Discrimination
  • DWD is a multivariate analysis tool that is able to identify systematic biases present in separate data sets and then make a global adjustment to compensate for these biases; in essence, each separate data set is a multi-dimensional cloud of data points, and DWD takes two points clouds and shifts one such that it more optimally overlaps the other.
  • the methods described herein may be implemented and/or the results recorded using any device capable of implementing the methods and/or recording the results.
  • devices that may be used include but are not limited to electronic computational devices, including computers of all types.
  • the computer program that may be used to configure the computer to carry out the steps of the methods may be contained in any computer readable medium capable of containing the computer program. Examples of computer readable medium that may be used include but are not limited to diskettes, CD- ROMs, DVDs, ROM, RAM, and other memory and computer storage devices.
  • the computer program that may be used to configure the computer to carry out the steps of the methods and/or record the results may also be provided over an electronic network, for example, over the internet, an intranet, or other network.
  • Outcome may refer to overall or disease-specific survival, event-free survival, or outcome in response to a particular treatment or therapy.
  • the methods may be used to predict the likelihood of long-term, disease-free survival.
  • Predicting the likelihood of survival of a breast cancer patient is intended to assess the risk that a patient will die as a result of the underlying breast cancer.
  • Long-term, disease-free survival is intended to mean that the patient does not die from or suffer a recurrence of the underlying breast cancer within a period of at least five years, or at least ten or more years, following initial diagnosis or treatment.
  • outcome is predicted based on classification of a subject according to subtype.
  • the NAN046 bioinformatics model provides a measurement of the similarity of a test sample to all four subtypes which is translated into a Risk of Recurrence (ROR) score that can be used in any patient population regardless of disease status and treatment options.
  • ROR Risk of Recurrence
  • the intrinsic subtypes and ROR also have value in the prediction of pathological complete response in women treated with, for example, neoadjuvant taxane and anthracycline chemotherapy (Rouzier et al , J Clin Oncol 23:8331-9 (2005), incorporated herein by reference in its entirety).
  • a risk of recurrence (ROR) model is used to predict outcome.
  • ROR risk of recurrence
  • subjects can be stratified into low, medium, and high risk of recurrence groups.
  • Calculation of ROR can provide prognostic information to guide treatment decisions and/or monitor response to therapy.
  • the prognostic performance of the NAN046- defined intrinsic subtypes and/or other clinical parameters is assessed utilizing a Cox Proportional Hazards Model Analysis, which is a regression method for survival data that provides an estimate of the hazard ratio and its confidence interval.
  • the Cox model is a well- recognized statistical technique for exploring the relationship between the survival of a patient and particular variables. This statistical method permits estimation of the hazard ⁇ i.e. , risk) of individuals given their prognostic variables ⁇ e.g. , intrinsic gene expression profile with or without additional clinical factors, as described herein).
  • the "hazard ratio" is the risk of death at any given time point for patients displaying particular prognostic variables. See generally Spruance et al , Antimicrob. Agents & Chemo. 48:2787-92 (2004).
  • the NAN046 classification model described herein can be trained for risk of recurrence using subtype distances (or correlations) alone, or using subtype distances with clinical variables as discussed supra.
  • the risk score for a test sample is calculated using intrinsic subtype distances alone using the following equation:
  • ROR 0.05*Basal + 0.1 l*Her2 + -0.25*LumA + 0.07*LumB + -0.1 l*Normal, where the variables "Basal,” “Her2,” “LumA,” “LumB,” and “Normal” are the distances to the centroid for each respective classifier when the expression profile from a test sample is compared to centroids constructed using the gene expression data deposited with the Gene Expression Omnibus (GEO).
  • GEO Gene Expression Omnibus
  • risk score for a test sample is calculated using intrinsic subtype distances alone using the following equation:
  • ROR-S 0.05*Basal + 0.12*Her2 + -0.34*LumA + 0.0.23*LumB, where the variables "Basal,” “Her2,” “LumA,” and “LumB” are as described supra and the test expression profiles are compared to centroids constructed using the gene expression data deposited with GEO as accession number GSE2845.
  • risk score for a test sample is calculated using intrinsic subtype distances in combination with the proliferation signature ("Prolif ') using the following equation:
  • ROR-P -0.001 *Basal + 0.7*Her2 + -0.95*LumA + 0.49*LumB + 0.34*Prolif, where the variables "Basal,” “Her2,” “LumA,” “LumB” and “Prolif are as described supra and the test expression profiles are compared to centroids constructed using the gene expression data deposited with GEO as accession number GSE2845.
  • risk score can also be calculated using a combination of breast cancer subtype, proliferation signature and the clinical variable tumor size (T) using the ROR-PT described in conjunction with Table 3 supra.
  • a Ki67 antibody (clone SP6; ThermoScientific, Fremont, CA) can be applied at a 1:200 dilution for 32 minutes, by following the Ventana Benchmark automated immunostainer (Ventana, Arlington AZ) standard Cell Conditioner 1 (CC1, a proprietary buffer) protocol at 98°C for 30 minutes.
  • An ER antibody (clone SP1; ThermoFisher
  • HER2 staining can be done with a SP3 antibody (ThermoFisher Scientific) at a 1: 100 dilution after antigen retrieval in 0.05 M Tris buffer (pH 10.0) with heating to 95°C in a steamer for 30 minutes.
  • FISH fluorescent in situ hybridization
  • slides can be hybridized with probes to LSI (locus-specific identifier) HER2/neu and to centromere 17 by use of the PathVysion HER- 2 DNA Probe kit (Abbott Molecular, Abbott Park, IL) according to manufacturer's instructions, with modifications to pretreatment and hybridization as previously described (Brown LA, Irving J, Parker R, et al. Amplification of EMSY, a novel oncogene on l lql3, in high grade ovarian surface epithelial carcinomas. Gynecol Oncol. 2006;100(2):264-270).
  • Biomarker expression from immunohistochemistry assays can then be scored by two pathologists, who were blinded to the clinicopathological characteristics and outcome and who used previously established and published criteria for biomarker expression levels that had been developed on other breast cancer cohorts.
  • Tumors were considered positive for ER or PR if immunostaining was observed in more than 1 % of tumor nuclei, as described previously. Tumors were considered positive for HER2 if immunostaining was scored as 3+ according to HercepTest criteria, with an amplification ratio for fluorescent in situ hybridization of 2.0 or more being the cut point that was used to segregate immunohistochemistry equivocal tumors (scored as 2+) (Yaziji, et al , JAMA, 291(16): 1972-1977 (2004)). Ki67 was visually scored for percentage of tumor cell nuclei with positive immunostaining above the background level by two pathologists.
  • kits useful for classifying breast cancer intrinsic subtypes and/or providing prognostic information to identify risk of recurrence comprise a set of capture probes and/or primers specific for the intrinsic genes listed in Table 1.
  • the kit may further comprise a computer readable medium.
  • the capture probes are immobilized on an array.
  • array is intended a solid support or a substrate with peptide or nucleic acid probes attached to the support or substrate.
  • Arrays typically comprise a plurality of different capture probes that are coupled to a surface of a substrate in different, known locations.
  • the arrays of the disclosure comprise a substrate having a plurality of capture probes that can specifically bind an intrinsic gene expression product.
  • the number of capture probes on the substrate varies with the purpose for which the array is intended.
  • the arrays may be low- density arrays or high-density arrays and may contain 4 or more, 8 or more, 12 or more, 16 or more, 32 or more addresses, but will minimally comprise capture probes for the 46 intrinsic genes listed in Table 1.
  • arrays may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces.
  • Arrays may be probes (e.g. , nucleic-acid binding probes) on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, each of which is hereby incorporated in its entirety for all purposes.
  • Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation on the device. See, for example, U.S. Pat. Nos. 5,856,174 and 5,922,591 herein incorporated by reference.
  • the kit comprises a set of oligonucleotide primers sufficient for the detection and/or quantitation of each of the intrinsic genes listed in Table 1.
  • the oligonucleotide primers may be provided in a lyophilized or reconstituted form, or may be provided as a set of nucleotide sequences.
  • the primers are provided in a microplate format, where each primer set occupies a well (or multiple wells, as in the case of replicates) in the microplate.
  • the microplate may further comprise primers sufficient for the detection of one or more housekeeping genes as discussed infra.
  • the kit may further comprise reagents and instructions sufficient for the amplification of expression products from the genes listed in Table 1.
  • the molecular signatures/expression profiles are typically recorded in a database.
  • the database is a relational database accessible by a computational device, although other formats, e.g. , manually accessible indexed files of expression profiles as photographs, analogue or digital imaging readouts, spreadsheets, etc. can be used.
  • the expression patterns initially recorded are analog or digital in nature
  • the expression patterns, expression profiles (collective expression patterns), and molecular signatures (correlated expression patterns) are stored digitally and accessed via a database.
  • the database is compiled and maintained at a central facility, with access being available locally and/or remotely.
  • the NanoString nCounter Analysis System delivers direct, multiplexed measurements of gene expression through digital readouts of the relative abundance of hundreds of mRNA transcripts.
  • the nCounter Analysis System uses gene-specific probe pairs ( Figure 7) that are mixed together to form a single reagent called a CodeSet. The probe pairs hybridize directly to the mRNA sample in solution eliminating any enzymatic reactions that might introduce bias in the results.
  • probe/target complexes are aligned and immobilized (Figure 10) in the nCounter Cartridge.
  • the Reporter Probe carries the fluorescent signal; the Capture Probe allows the complex to be immobilized for data collection.
  • Up to 800 pairs of probes, each specific to a particular gene, can be combined with a series of internal controls to form a CodeSet.
  • Reagents and Test Components The Breast Cancer test will simultaneously measure the expression levels of NAN046 plus eight housekeeping genes in a single hybridization reaction using an nCounter CodeSet designed specifically to those genes.
  • Each assay also includes positive assay controls comprised of a linear titration of in vitro transcribed RNA transcripts and corresponding probes, and a set of probes with no sequence homology to human RNA sequences which are used as negative controls.
  • Each assay run includes a reference sample consisting of in vitro transcribed RNA's of the targets and housekeeping genes for normalization purposes.
  • the normalized gene expression profile of a breast tumor sample is correlated to prototypical gene expression profiles of the four breast cancer intrinsic subtypes (Luminal A, Luminal B, HER2-enriched, or Basal-like) that were identified from a training set of breast tumors.
  • the gene expression profile in combination with selected clinical variables, is used as part of a trained algorithm as a prognostic indicator of risk of distant recurrence of breast cancer.
  • Figure 12 outlines the assay processes associated with the nCounter Analysis System Breast Cancer Test.
  • FFPE Tissue Extraction - The Breast Cancer Test will use RNA extracted from Formalin- fixed, Paraffin-embedded (FFPE) tissue that has been diagnosed as invasive carcinoma of the breast.
  • a pathologist first performs an H & E stain of a tumor section mounted onto a slide to identify the region of viable invasive breast carcinoma containing tumor content above a minimum threshold. The pathologist circles the region on the H & E slide. The pathologist then mounts unstained tissue sections onto slides and marks the area of the slides containing invasive tumor. For larger tumors (> 100mm 2 of viable invasive carcinoma on the H&E slide), the test requires only a single ⁇ section. For smaller tumors ( ⁇ 100mm 2 ), the test requires 3 sections. The identified region of viable invasive breast carcinoma containing sufficient tumor content on the slides is macro-dissected prior to RNA extraction. Procedures for shipping FFPE tissue slides from the collection site to a testing site will be defined as part of the procedure.
  • RNA quality will be measured using an OD 260/280 reading, with a target ratio of no less than 1.7 with an upper limit of 2.5. Procedures for storing RNA will be provided to the user so that downstream processing can be performed at a later point in time if desired.
  • NanoString's protocol includes a step for quantitating total RNA using a low volume spectrophotometer such as the NanoDropTM spectrophotometer. NanoString will define performance specifications for the spectrophotometer so that the range of RNA input recommended for the test is above the limit of detection of the low volume spectrophotometer and is reproducibly measurable.
  • Hybridization For each set of up to 10 RNA samples, the user will pipette the specified amount of RNA into separate tubes within a 12 reaction strip tube and add the CodeSet and hybridization buffer. A reference sample is pipetted into the remaining two tubes with CodeSet and hybridization buffer.
  • the CodeSet consists of probes for each gene that is targeted, additional probes for endogenous "housekeeping" normalization genes and positive and negative controls. The probes within the CodeSet pertaining to each of these genes within the four groups (target genes, housekeeping genes, and positive and negative controls) are each assigned a unique code and are therefore individually identifiable within each run.
  • the reference sample consists of in vitro transcribed RNA for the targeted genes and housekeeping genes.
  • nCounter assay includes an overnight hybridization under isothermal conditions. Because the overnight hybridization is performed in a small volume at elevated temperature, care must be taken to avoid evaporation. Many commercial PCR thermocyclers are equipped with heated lids that will prevent the evaporation of small volumes of liquid. Because the assay does not require any fine control of temperature ramping, any heat block with a programmable heated lid and a block with dimensions that fit the NanoString tubes will work with the NanoString assay. NanoString plans to provide specifications for heat blocks that meet the assay requirements.
  • the user Upon completing hybridization, the user will then transfer the strip tube containing the set of 10 assays and 2 reference samples into the nCounter Prep Station along with the required prepackaged reagents and disposables described in Table 1.
  • the Prep Plates contain the necessary reagents for purification of excess probes and binding to the cartridge (see section IIIC below for detailed description of purification process).
  • the prep plates are centrifuged in a swinging bucket centrifuge prior to placement on the deck of the Prep Station.
  • An automated purification process then removes excess capture and reporter probe through two successive hybridization-driven magnetic bead capture steps.
  • the nCounter Prep Station then transfers the purified target/probe complexes into an nCounter cartridge for capture to a glass slide. Following completion of the run, the user removes the cartridge from the Prep Station and seals it with an adhesive film.
  • the signals of each sample are next normalized using the housekeeping genes to control for input sample quality.
  • the signals are then normalized to the reference sample within each run to control for run-to-run variations.
  • the resulting normalized data is entered in the Breast Cancer Intrinsic Subtyping algorithm to determine tumor intrinsic subtype, risk of relapse score, and risk classification.
  • Instrumentation- The nCounter Analysis System is comprised of two instruments, the nCounter Prep Station used for post-hybridization processing, and the Digital Analyzer used for data collection and analysis.
  • nCounter Prep Station - The nCounter Prep Station ( Figure 13) is an automated fluid handling robot that processes samples post-hybridization to prepare them for data collection on the nCounter Digital Analyzer. Prior to processing on the Prep Station, total RNA extracted from FFPE (Formalin-Fixed, Paraffin-Embedded) tissue samples is hybridized with the NanoString Reporter Probes and Capture Probes according to the nCounter protocol described above.
  • FFPE Form-Fixed, Paraffin-Embedded
  • Hybridization to the target RNA is driven by excess NanoString probes. To accurately analyze these hybridized molecules they are first purified from the remaining excess probes in the hybridization reaction. The Prep Station isolates the hybridized mRNA molecules from the excess Reporter and Capture probes using two sequential magnetic bead purification steps. These affinity purifications utilize custom oligonucleotide-modified magnetic beads that retain only the tripartite complexes of mRNA molecules that are bound to both a Capture probe and a Reporter probe. [121] Next, this solution of tripartite complexes is washed through a flow cell in the NanoString sample cartridge.
  • PEG polyethylene glycol
  • an electric field is applied along the length of each sample cartridge flow cell to facilitate the optical identification and order of the fluorescent spots that make up each reporter probe. Because the reporter probes are charged nucleic acids, the applied voltage imparts a force on them that uniformly stretches and orients them along the electric field. While the voltage is applied, the Prep Station adds an immobilization reagent that locks the reporters in the elongated configuration after the field is removed. Once the reporters are immobilized the cartridge can be transferred to the nCounter Digital Analyzer for data collection. All consumable components and reagents required for sample processing on the Prep Station are provided in the nCounter Master Kit. These reagents are ready to load on the deck of the nCounter Prep Station which can process up to 10 samples and 2 reference samples per run in approximately 2.5 hours.
  • nCounter Digital Analyzer ( Figure 14) collects data by taking images of the immobilized fluorescent reporters in the sample cartridge with a CCD camera through a microscope objective lens. Because the fluorescent Reporter Probes are small, single molecule barcodes with features of smaller than the wavelength of visible light, the Digital Analyzer uses high magnification, diffraction limited imaging to resolve the sequence of the spots in the fluorescent barcodes.
  • the Digital Analyzer captures hundreds of consecutive fields -of- view (FOV) that can each contain hundreds or thousands of discrete Reporter Probes. Each FOV is a combination of four monochrome images captured at different wavelengths. The resulting overlay can be thought of as a four-color image in blue, green, yellow, and red. Each 4-color FOV is processed in real time to provide a "count" for each fluorescent barcode in the sample.
  • the resultant data from the Digital Analyzer is a precise measure of the relative abundance of each mRNA of interest in a biological sample.
  • Software - The Prep Station and the Digital Analyzer are stand-alone units that do not require connection to an external PC, but must be networked to one another using a Local Area Network (LAN).
  • LAN Local Area Network
  • the nCounter System software securely manages operations through user accounts and permissions. Both instruments use setup and process wizards on an embedded touch screen user interface to guide the user through the sample processing and data collection steps of the assay. The user is led through the procedure by step-by-step instructions on the Prep Station and Digital Analyzer.
  • the instrument touch screen uses a pressure sensitive method for controlling operations and enables the user to interact with the system by touching a selection on the screen. Because the touchscreen provides a limited human interface for data entry, the system also hosts a web-based application for user accounts management, sample batch definition, and sample status tracking.
  • the system software tracks the user account and reagent lots for each sample in a centralized data repository. After expression data for a sample is acquired by the Digital Analyzer, it is first analyzed to ensure that all pre-specified quality control metrics are met. The qualified data are then processed through a locked PAM50 algorithm to generate a report containing intrinsic subtype and risk of recurrence (ROR) score. The sample report is transferred to the central repository where it can be securely accessed for download by a user with the correct permissions.
  • ROR intrinsic subtype and risk of recurrence
  • the Breast Cancer Intrinsic Subtyping Algorithm The Breast Cancer Intrinsic Subtyping Algorithm - The nCounter system will be used to identify the intrinsic subtype of an excised invasive carcinoma of the breast using a 50 gene classifier algorithm originally named the PAM50 (Parker J.S., et al. Supervised Risk Predictor of Breast Cancer Based on Intrinsic Subtypes. Journal of Clinical Oncology, 27: 1160-1167 (2009)).
  • the gene expression profile will assign a breast cancer to one of four molecular classes or intrinsic subtypes: Basal-like, Luminal A, Luminal B, and HER2 enriched. A brief description of each subtype is provided below.
  • Luminal subtypes The most common subtypes of breast cancer are the luminal subtypes in the hormone-receptor positive population, Luminal A and Luminal B. Prior studies suggest that luminal A comprises approximately 30% to 40% and luminal B approximately 20% of breast cancers 2 and over 90 % of hormone receptor-positive breast cancers. The gene expression pattern of these subtypes resembles the luminal epithelial component of the breast (Nielsen, TO et al. A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer. Clinical Cancer Research, 16:5222-5232 (2010)). These tumors are characterized by high expression of estrogen receptor (ER), progesterone receptor (PR), and genes associated with ER activation 2 such as LIV1, GATA3, and cyclin Dl, as well as expression of luminal cytokeratins 8 and 18.
  • ER estrogen receptor
  • PR progesterone receptor
  • genes associated with ER activation 2 such as LIV
  • Luminal A Luminal A (LumA) breast cancers exhibit low expression of genes associated with cell cycle activation and the ERBB2 cluster resulting in a better prognosis than luminal B.
  • the Luminal A subgroup has the most favorable prognosis of all subtypes and is enriched for endocrine therapy-responsive tumors.
  • Luminal B Luminal B (LumB) breast cancers express ER and ER-associated genes, but to a lower extent than LumA. Genes associated with cell cycle activation are highly expressed and this tumor type can be HER2(+) or HER2(-). The prognosis is unfavorable (despite ER expression) and endocrine therapy responsiveness is generally diminished relative to LumA.
  • Basal-like The Basal-like subtype is generally ER-negative, is almost always clinically HER2-negative and expresses a suite of "basal” biomarkers including the basal epithelial cytokeratins (CK) and epidermal growth factor receptor (EGFR). Genes associated with cell cycle activation are highly expressed.
  • CK basal epithelial cytokeratins
  • EGFR epidermal growth factor receptor
  • HER2-enriched The HER2-enriched subtype is generally ER-negative and is HER2- positive in the majority of cases with high expression of the ERBB2 cluster, including ERBB2 and GRB7. Genes associated with cell cycle activation are highly expressed and these tumors have a poor outcome.
  • Cutoffs for the intrinsic subtyping algorithm are pre-defined from training sets that defined the following: 1) intrinsic subtype centroids (i.e. the prototypical gene expression profile of each subtype), 2) coefficients for Risk of Recurrence (ROR) score, and 3) risk classification (Low/Intermediate/High).
  • the intrinsic subtype centroids Luminal A, Luminal B, Her2-enriched, Basal-like
  • the intrinsic subtype centroids were trained using a clinically representative set of archived FFPE breast tumor specimens collected from multiple sites.
  • Hierarchical clustering analysis of gene expression data from the FFPE breast tumor samples was combined with breast tumor biology (i.e. gene expression of previously defined intrinsic subtypes) to define the prototypical expression profile (i.e. centroid) of each subtype.
  • a computational algorithm correlates the normalized 50 gene expression profile of an unknown breast cancer tumor sample to each of the prototypical expression signatures of the four breast cancer intrinsic subtypes.
  • the tumor sample is assigned the subtype with the largest positive correlation to the sample.
  • ROR score is calculated using coefficients from a Cox model that includes the Pearson correlation (R) to each intrinsic subtype, a proliferation score (P), and tumor size (T), as shown in the equation below.
  • ROR aR LumA + bR LumB + cR He r2e + dR basal + eP + fT
  • the MammaPrint test is FDA cleared for use only with frozen or fresh-preserved tissue samples, yet most of the tumor samples collected in the United States are FFPE rather than fresh-frozen. This test is also not distributed and is only available through the Agendia reference labs.
  • the Oncotype Dx test can be used to predict the risk of relapse for stage I II, node negative, estrogen receptor-positive patients receiving adjuvant Tamoxifen therapy as well as response to cyclophosphamide/methotrexate/5- fluorouracil (CMF) chemotherapy.
  • CMF cyclophosphamide/methotrexate/5- fluorouracil
  • this test is only offered as a lab-developed test (LDT) through Genomic Health' s CLIA laboratory and is not FDA cleared for prognostic use, or FDA approved for predicting chemotherapy response.
  • NanoString envisions a model that would have the Breast Cancer test used in conjunction with other sources of clinical data currently available to oncologists for breast cancer prognosis in selected patient segments.
  • the Breast Cancer Test would be an additional source of prognostic information adding significant value to established clinical parameters (i.e tumor size, nodal status) used by oncologists in managing a patient with breast cancer.
  • the methods, assays and kits of the present invention include a series of quality control metrics that are automatically applied to each sample during analysis. These metrics evaluate the performance of the assay to determine whether the results fall within expected values. Upon successful analysis of these quality control metrics, the Assay gives the following results:
  • the Intrinsic Subtype is identified by comparing the gene expression profile of 50 genes in an unknown sample with the expected expression profiles for the four intrinsic subtypes. The subtype with the most similar profile is assigned to the unknown sample.
  • Luminal A comprises approximately 30% to 40% and Luminal B approximately 20% of breast cancers.
  • Luminal B approximately 20% of breast cancers.
  • ER estrogen receptor
  • PR progesterone receptor
  • ER activation such as LIVl, GATA3, and cyclin Dl, as well as expression of luminal cytokeratins 8 and 18.
  • Luminal A breast cancers exhibit lower expression of genes associated with cell cycle activation when compared to Luminal B breast cancers resulting in a better prognosis.
  • HER2-Enriched subtype (Her2E) comprises approximately 20% of breast cancers.
  • HER2-Enriched tumors are generally ER-negative, so only 5% of the tested ER-positive patient population was found to have HER2-Enriched breast cancer.
  • ER-status HER2-Enriched tumors are HER2 -positive in the majority of cases with high expression of the ERBB2 cluster, including ERBB2 and GRB7. Genes associated with cell cycle activation are also highly expressed.
  • Basal-like subtype comprises approximately 20% of breast cancers.
  • Basal-like tumors are generally ER-negative, so only 1% of hormone receptor-positive patients have Basal-like breast cancer.
  • the Basal-like subtype is almost always clinically HER2-negative and expresses a suite of "basal" biomarkers including the basal epithelial cytokeratins (CK) and epidermal growth factor receptor (EGFR). Genes associated with cell cycle activation are highly expressed.
  • CK basal epithelial cytokeratins
  • EGFR epidermal growth factor receptor
  • the ROR score is an integer value on a 0-100 scale that is related to an individual patient's probability of distant recurrence within 10 years for the defined intended use population.
  • the ROR score is calculated by comparing the expression profiles of 46 genes in an unknown sample with the expected profiles for the four intrinsic subtypes, as described above, to calculate four different correlation values. These correlation values are then combined with a proliferation score and the tumor size to calculate the ROR score.
  • receptor-positive early stage breast cancer were compared to distant recurrence-free survival following surgery and treatment with 5 years of adjuvant endocrine therapy followed by 5 years of observation. This study resulted in a model relating the ROR score to the probability of distant recurrence in this tested patient population including a 95% confidence interval.
  • Risk classification is also provided to allow interpretation of the ROR score by using cutoffs related to clinical outcome in tested patient populations.
  • the assay kit includes a series of internal controls that are used to assess the quality of each run set as a whole and each sample individually. These controls are listed below.
  • a synthetic RNA Reference Sample is included as a control within the Assay kit.
  • the reference sample is comprised of in-vitro transcribed RNA targets from the 50 algorithm and 8 housekeeping genes.
  • the Reference Sample is processed in duplicate in each assay run along with a set of up to 10 unknown breast tumor RNA samples in a 12 reaction strip tube.
  • the signal from the Reference Sample is analyzed against pre-defined thresholds to qualify the run.
  • RNA targets are used as positive controls (PCs) for the assay.
  • the PC target sequences are derived from the External RNA Control Consortium (ERCC) DNA sequence library.
  • the RNA targets are in-vitro transcribed from DNA plasmids.
  • Six RNA targets are included within the assay kit in a 4-fold titration series (128 - 0.125 fM final concentration in hybridization reaction) along with the corresponding Capture and Reporter Probes.
  • the PCs are added to each breast tumor RNA sample and Reference RNA Sample tested with the Prosigna Assay. A sample will be disqualified from further analysis if the signal intensities from the PCs do not meet pre-defined thresholds.
  • Negative control set exogenous probes without targets
  • Negative control (NC) target sequences are derived from the ERCC DNA sequence library.
  • the probes designed to detect these target sequences are included as part of the assay kit without the corresponding target sequence.
  • the negative controls (NCs) are added to each breast tumor RNA sample and Reference Sample tested with the Prosigna Assay as a quality control measure. The sample will be disqualified from further analysis if the signal intensities from the NCs do not meet pre-defined thresholds.
  • RNA Integrity Control Set Housekeeping genes
  • Capture and Reporter Probes designed to detect 8 housekeeping genes and 50 algorithm genes are included as part of the kit. The expression levels of the 8 housekeeping genes are analyzed to determine the quality of RNA extracted from the FFPE tissue sample and input into the assay. The sample will be disqualified from further analysis if the expression level of the housekeeping genes falls below pre-defined thresholds.
  • the housekeeping genes are also used to normalize for any differences in the intact RNA amount in a sample prior to Reference Sample normalization.
  • breast cancer includes, for example, those conditions classified by biopsy or histology as malignant pathology.
  • the clinical delineation of breast cancer diagnoses is well known in the medical arts.
  • breast cancer refers to any malignancy of the breast tissue, including, for example, carcinomas and sarcomas.
  • Particular embodiments of breast cancer include ductal carcinoma in situ (DCIS), lobular carcinoma in situ (LCIS), or mucinous carcinoma.
  • Breast cancer also refers to infiltrating ductal (IDC) or infiltrating lobular carcinoma (ILC).
  • the subject of interest is a human patient suspected of or actually diagnosed with breast cancer.
  • FIG. 5 outlines the assay processes associated with the Breast Cancer Intrinsic Subtyping test. Following RNA isolation, the test will simultaneously measure the expression levels of 46 target genes plus eight housekeeping genes in a single hybridization reaction using an nCounter CodeSet designed specifically to those genes.
  • the housekeeping genes described in U.S. Patent Publication 2008/0032293, which is herein incorporated by reference in its entirety, can be used for normalization.
  • Exemplary housekeeping genes include MRPL19, PSMC4, SF3A1, PUM1, ACTB, GAPD, GUSB, RPLP0, and TFRC.
  • the housekeeping genes are used to normalize the expression of the tumor sample.
  • Each assay run also includes a reference sample consisting of in vitro transcribed RNA's of the 58 targets for normalization purposes.
  • FFPE Tissue Review/Procurement and RNA Extraction The Breast Cancer Intrinsic Subtyping Test will use RNA extracted from Formalin-fixed, Paraffin-embedded (FFPE) tissue that has been diagnosed as invasive carcinoma of the breast. A Pathologist reviews an H & E stained slide to identify the tissue area containing sufficient tumor tissue content for the test. Unstained slide mounted tissue sections are processed by macro-dissecting the identified tumor area on each slide to remove any adjacent normal tissue. RNA is then isolated from the tumor tissue, and DNA is removed from the sample.
  • FFPE Formalin-fixed, Paraffin-embedded
  • the reference sample consists of in vitro transcribed RNA for the targeted genes and housekeeping genes.
  • Imaging and Analysis on the Digital Analyzer The cartridge is then sealed and inserted into the nCounter Digital Analyzer which counts the number of probes captured on the slide for each gene, which corresponds to the amount of target in solution. Automated software will then check thresholds for the housekeeping genes, reference sample, and positive and negative controls to qualify each assay and ensure that the procedure was performed correctly.
  • the signals of each sample are next normalized using the housekeeping genes to control for input sample quality.
  • the signals are then normalized to the reference sample within each run to control for run-to-run variations.
  • the resulting normalized data is entered in the Breast Cancer Intrinsic Subtyping algorithm to determine tumor intrinsic subtype and risk of recurrence score.
  • Example 2 Clinical Validation of the NANQ46 risk of recurrence (ROR) score for predicting residual risk of distant-recurrence (PR) after endocrine therapy in postmenopausal women with HR+ early breast cancer (EBC): An ABSCSG Study.
  • the aim of the study is to assess the performance of the ROR score in predicting distal recurrence for postmenopausal patients with hormone receptor positive early breast cancer (HR+ EBC) treated with tamoxifen or tamoxifen followed by anastrozole when the NAN046 test is performed in a routine hospital pathology lab.
  • HR+ EBC hormone receptor positive early breast cancer
  • results: The ROR Score adds statistically significant prognostic information (Distant RFS) beyond CTS in all patients (Likelihood ratio test ALR% 2 53.5, p ⁇ 0.0001).
  • Differentiation between Luminal A and Luminal B adds statistically significant prognostic information (Distant RFS) beyond CTS in all patients (Luminal B vs. A: HR 2.38, 95% CI; 1.69-3.35, p ⁇ 0.0001).
  • Results in the node-negative and node-positive subgroups are similar to the results for all patients that are reported in the study.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2013/042157 2012-05-22 2013-05-22 Nano46 genes and methods to predict breast cancer outcome Ceased WO2013177245A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
AU2013266419A AU2013266419B2 (en) 2012-05-22 2013-05-22 NANO46 genes and methods to predict breast cancer outcome
MX2014014275A MX369628B (es) 2012-05-22 2013-05-22 Genes nano46 y metodos para predecir el resultado del cancer de mama.
BR112014029300A BR112014029300A2 (pt) 2012-05-22 2013-05-22 genes nano46 e métodos para prever resultado de câncer de mama
CN201380038875.4A CN104704128A (zh) 2012-05-22 2013-05-22 预测乳腺癌结果的nano46基因和方法
CA2874492A CA2874492C (en) 2012-05-22 2013-05-22 Nano46 genes and methods to predict breast cancer outcome
ES13794236T ES2763931T3 (es) 2012-05-22 2013-05-22 Genes Nano46 y métodos para predecir el resultado del cáncer de mama
EP13794236.3A EP2852689B1 (en) 2012-05-22 2013-05-22 Nano46 genes and methods to predict breast cancer outcome
JP2015514143A JP6325530B2 (ja) 2012-05-22 2013-05-22 Nano46遺伝子、及び乳癌転帰を予測する方法
IN2418MUN2014 IN2014MN02418A (enExample) 2012-05-22 2013-05-22
IL235795A IL235795B (en) 2012-05-22 2014-11-20 nano46 genes and methods for predicting breast cancer outcome

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261650209P 2012-05-22 2012-05-22
US61/650,209 2012-05-22
US201361753673P 2013-01-17 2013-01-17
US61/753,673 2013-01-17

Publications (2)

Publication Number Publication Date
WO2013177245A2 true WO2013177245A2 (en) 2013-11-28
WO2013177245A3 WO2013177245A3 (en) 2015-01-29

Family

ID=49624503

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/042157 Ceased WO2013177245A2 (en) 2012-05-22 2013-05-22 Nano46 genes and methods to predict breast cancer outcome

Country Status (12)

Country Link
US (3) US20130337444A1 (enExample)
EP (1) EP2852689B1 (enExample)
JP (1) JP6325530B2 (enExample)
CN (2) CN111500718A (enExample)
AU (1) AU2013266419B2 (enExample)
BR (1) BR112014029300A2 (enExample)
CA (1) CA2874492C (enExample)
ES (1) ES2763931T3 (enExample)
IL (1) IL235795B (enExample)
IN (1) IN2014MN02418A (enExample)
MX (1) MX369628B (enExample)
WO (1) WO2013177245A2 (enExample)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014186349A1 (en) * 2013-05-13 2014-11-20 Nanostring Technologies, Inc. Methods to predict risk of recurrence in node-positive early breast cancer
WO2015035377A1 (en) * 2013-09-09 2015-03-12 British Columbia Cancer Agency Branch Methods and kits for predicting outcome and methods and kits for treating breast cancer with radiation therapy
WO2016091880A1 (en) * 2014-12-09 2016-06-16 King's College London Breast cancer treatment with taxane therapy
US9631239B2 (en) 2008-05-30 2017-04-25 University Of Utah Research Foundation Method of classifying a breast cancer instrinsic subtype
US11098301B2 (en) 2014-11-24 2021-08-24 Nanostring Technologies, Inc. Methods and apparatuses for gene purification and imaging
EP3945136A1 (en) * 2020-07-28 2022-02-02 Hospital Clínic de Barcelona In vitro method for the prognosis of patients suffering from her2-positive breast cancer
CN114127314A (zh) * 2019-07-19 2022-03-01 公立大学法人福岛县立医科大学 用于对乳腺癌的亚型(Subtype)进行鉴别或者分类的鉴别标志物遗传基因组、方法和套件

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2012229123B2 (en) 2011-03-15 2017-02-02 British Columbia Cancer Agency Branch Methods of treating breast cancer with anthracycline therapy
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
EP2785873A4 (en) 2011-11-30 2015-11-11 Univ North Carolina METHOD FOR THE TREATMENT OF BREAST CANCER WITH TAXAN THERAPY
DK3511423T4 (da) 2012-10-17 2024-07-29 Spatial Transcriptomics Ab Fremgangsmåder og produkt til optimering af lokaliseret eller rumlig detektion af genekspression i en vævsprøve
EP4234716A3 (en) 2013-06-25 2023-12-06 Prognosys Biosciences, Inc. Methods for determining spatial patterns of biological targets in a sample
CN113403373B (zh) 2014-11-21 2025-04-11 布鲁克空间生物学公司 无酶且无扩增的测序
EP4119677B1 (en) 2015-04-10 2023-06-28 Spatial Transcriptomics AB Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US20180209981A1 (en) * 2015-07-23 2018-07-26 National University Of Singapore Wbp2 as a co-prognostic factor with her2 for stratification of patients for treatment
CN109715825B (zh) 2016-05-16 2023-01-06 纳米线科技公司 用于检测样品中目标核酸的方法
WO2017222453A1 (en) 2016-06-21 2017-12-28 Hauling Thomas Nucleic acid sequencing
WO2018074865A2 (ko) * 2016-10-21 2018-04-26 서울대학교병원 유방암 예후 예측용 조성물 및 방법
JP6730525B2 (ja) 2016-11-21 2020-07-29 ナノストリング テクノロジーズ,インコーポレイティド 化学組成物とそれを利用する方法
KR101950717B1 (ko) * 2016-11-23 2019-02-21 주식회사 젠큐릭스 유방암 환자의 화학치료 유용성 예측 방법
WO2018144782A1 (en) * 2017-02-01 2018-08-09 The Translational Genomics Research Institute Methods of detecting somatic and germline variants in impure tumors
CN120210336A (zh) 2017-10-06 2025-06-27 10X基因组学有限公司 Rna模板化连接
KR102071491B1 (ko) * 2017-11-10 2020-01-30 주식회사 디시젠 차세대 염기서열분석을 이용한 기계학습 기반 유방암 예후 예측 방법 및 예측 시스템
EP3794146B1 (en) 2018-05-14 2025-12-10 Bruker Spatial Biology, Inc. Method for identifying a predetermined nucleotide sequence
WO2020094399A1 (en) * 2018-11-05 2020-05-14 Biontech Diagnostics Gmbh Predictive methods in breast cancer
CN113906147B (zh) 2019-05-31 2024-09-13 10X基因组学有限公司 检测目标核酸分子的方法
GB201919032D0 (en) 2019-12-20 2020-02-05 Cartana Ab Method of detecting an analyte
JP2023514749A (ja) 2020-02-21 2023-04-07 10エックス ジェノミクス インコーポレイテッド 統合型インサイチュ空間的アッセイのための方法および組成物
US12209273B2 (en) 2020-06-12 2025-01-28 10X Genomics, Inc. Nucleic acid assays using click chemistry bioconjugation
US12297499B2 (en) 2020-08-17 2025-05-13 10X Genomics, Inc. Multicomponent nucleic acid probes for sample analysis
US12060603B2 (en) 2021-01-19 2024-08-13 10X Genomics, Inc. Methods for internally controlled in situ assays using padlock probes
CA3248919A1 (en) * 2021-12-20 2023-06-29 Fundacio De Recerca Clinic Barcelona Inst D’Investigacions Biomediques August Pi I Sunyer DEVELOPMENT AND VALIDATION OF AN IN VITRO PROGNOSIS FOR PATIENTS WITH HER2-POSITIVE BREAST CANCER
CN117965734B (zh) * 2024-02-02 2024-09-24 奥明星程(杭州)生物科技有限公司 一种用于检测硬纤维瘤的基因标志物、试剂盒、检测方法及应用

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
US5708153A (en) 1991-09-18 1998-01-13 Affymax Technologies N.V. Method of synthesizing diverse collections of tagged compounds
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6020135A (en) 1998-03-27 2000-02-01 Affymetrix, Inc. P53-regulated genes
US6033860A (en) 1997-10-31 2000-03-07 Affymetrix, Inc. Expression profiles in adult and fetal organs
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6040193A (en) 1991-11-22 2000-03-21 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US6344316B1 (en) 1996-01-23 2002-02-05 Affymetrix, Inc. Nucleic acid analysis techniques
EP1641810A2 (en) 2003-06-24 2006-04-05 Genomic Health Prediction of likelihood of cancer recurrence
WO2007061876A2 (en) 2005-11-23 2007-05-31 University Of Utah Research Foundation Methods and compositions involving intrinsic genes
WO2007076129A2 (en) 2005-12-23 2007-07-05 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
WO2007076132A2 (en) 2005-12-23 2007-07-05 Nanostring Technologies, Inc. Compositions comprising oriented, immobilized macromolecules and methods for their preparation
US20080032293A1 (en) 2004-07-15 2008-02-07 The University Of North Carolina At Chapel Hill Housekeeping Genes And Methods For Identifying Same
WO2008124847A2 (en) 2007-04-10 2008-10-16 Nanostring Technologies, Inc. Methods and computer systems for identifying target-specific sequences for use in nanoreporters
WO2009158143A1 (en) 2008-05-30 2009-12-30 The University Of North Carolina At Chapel Hill Gene expression profiles to predict breast cancer outcomes
WO2010019826A1 (en) 2008-08-14 2010-02-18 Nanostring Technologies, Inc Stable nanoreporters

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6750015B2 (en) * 2000-06-28 2004-06-15 Kathryn B. Horwitz Progesterone receptor-regulated gene expression and methods related thereto
US20020168639A1 (en) * 2000-09-22 2002-11-14 Muraca Patrick J. Profile array substrates
CA2540167A1 (en) * 2003-09-29 2005-05-12 Pathwork Informatics, Inc. Systems and methods for detecting biological features
CN101061480A (zh) * 2004-09-22 2007-10-24 三路影像公司 用来分析和优化用于癌症诊断的标记候选物的方法和计算机程序产品
WO2008150512A2 (en) * 2007-06-04 2008-12-11 University Of Louisville Research Foundation, Inc. Methods for identifying an increased likelihood of recurrence of breast cancer
EP2195467B1 (en) * 2007-09-06 2016-12-14 bioTheranostics, Inc. Tumor grading and cancer prognosis in breast cancer
MX2012011167A (es) * 2010-03-31 2013-02-07 Sividon Diagnostics Gmbh Metodo para prediccion de recurrencia de cancer de mama bajo tratamiento endocrino.

Patent Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5708153A (en) 1991-09-18 1998-01-13 Affymax Technologies N.V. Method of synthesizing diverse collections of tagged compounds
US5770358A (en) 1991-09-18 1998-06-23 Affymax Technologies N.V. Tagged synthetic oligomer libraries
US5789162A (en) 1991-09-18 1998-08-04 Affymax Technologies N.V. Methods of synthesizing diverse collections of oligomers
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
US6040193A (en) 1991-11-22 2000-03-21 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US5922591A (en) 1995-06-29 1999-07-13 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6344316B1 (en) 1996-01-23 2002-02-05 Affymetrix, Inc. Nucleic acid analysis techniques
US6033860A (en) 1997-10-31 2000-03-07 Affymetrix, Inc. Expression profiles in adult and fetal organs
US6020135A (en) 1998-03-27 2000-02-01 Affymetrix, Inc. P53-regulated genes
EP1641810A2 (en) 2003-06-24 2006-04-05 Genomic Health Prediction of likelihood of cancer recurrence
US20080032293A1 (en) 2004-07-15 2008-02-07 The University Of North Carolina At Chapel Hill Housekeeping Genes And Methods For Identifying Same
WO2007061876A2 (en) 2005-11-23 2007-05-31 University Of Utah Research Foundation Methods and compositions involving intrinsic genes
US20090299640A1 (en) 2005-11-23 2009-12-03 University Of Utah Research Foundation Methods and Compositions Involving Intrinsic Genes
WO2007076129A2 (en) 2005-12-23 2007-07-05 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
WO2007076132A2 (en) 2005-12-23 2007-07-05 Nanostring Technologies, Inc. Compositions comprising oriented, immobilized macromolecules and methods for their preparation
US20100015607A1 (en) 2005-12-23 2010-01-21 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
US20100261026A1 (en) 2005-12-23 2010-10-14 Nanostring Technologies, Inc. Compositions comprising oriented, immobilized macromolecules and methods for their preparation
WO2008124847A2 (en) 2007-04-10 2008-10-16 Nanostring Technologies, Inc. Methods and computer systems for identifying target-specific sequences for use in nanoreporters
US8415102B2 (en) 2007-04-10 2013-04-09 Nanostring Technologies, Inc. Methods and computer systems for identifying target-specific sequences for use in nanoreporters
WO2009158143A1 (en) 2008-05-30 2009-12-30 The University Of North Carolina At Chapel Hill Gene expression profiles to predict breast cancer outcomes
WO2010019826A1 (en) 2008-08-14 2010-02-18 Nanostring Technologies, Inc Stable nanoreporters
US20100047924A1 (en) 2008-08-14 2010-02-25 Nanostring Technologies, Inc. Stable nanoreporters

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BENITO ET AL., BIOINFORMATICS, vol. 20, no. 1, 2004, pages 105 - 114
GEISS ET AL., NATURE BIOTECHNOLOGY, vol. 26, no. 3, 2008, pages 317 - 325
JAY R. HARRIS ET AL.: "Diseases of the breast", LIPPINCOTT WILLIAMS & WILKINS, pages: 458 - 472
NARASHIMAN; CHU, PNAS, vol. 99, 2002, pages 6567 - 6572
NIELSEN ET AL., CLIN. CANCER RES., vol. 16, no. 21, 2009, pages 5222 - 5232
PARKER JOEL S ET AL.: "Supervised risk predictor of breast cancer based on intrinsic subtypes", J. OF CLININCAL ONCOLOGY, AMERICAL SOC. OF CLINICAL ONCOLOGY, vol. 27, no. 8, 10 March 2019 (2019-03-10), pages 1160 - 1167, XP009124878, DOI: doi:10.1200/JCO.2008.18.1370
PEROU ET AL., NATURE, vol. 406, no. 6797, 2000, pages 747 - 52
QUACKENBUSH, NAT. GENET., vol. 32, 2002, pages 496 - 501
ROUZIER ET AL., J CLIN ONCOL, vol. 23, 2005, pages 8331 - 9
SCHENA ET AL., SCIENCE, vol. 270, 1995, pages 467 - 70
SORLIE ET AL., PNAS, vol. 98, no. 19, 2001, pages 10869 - 74
SPRUANCE ET AL., ANTIMICROB. AGENTS & CHEMO, vol. 48, 2004, pages 2787 - 92
WEIS ET AL., TIG, vol. 8, 1992, pages 263 - 64

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9631239B2 (en) 2008-05-30 2017-04-25 University Of Utah Research Foundation Method of classifying a breast cancer instrinsic subtype
WO2014186349A1 (en) * 2013-05-13 2014-11-20 Nanostring Technologies, Inc. Methods to predict risk of recurrence in node-positive early breast cancer
EP2997163A4 (en) * 2013-05-13 2017-02-22 Nanostring Technologies, Inc Methods to predict risk of recurrence in node-positive early breast cancer
WO2015035377A1 (en) * 2013-09-09 2015-03-12 British Columbia Cancer Agency Branch Methods and kits for predicting outcome and methods and kits for treating breast cancer with radiation therapy
US11098301B2 (en) 2014-11-24 2021-08-24 Nanostring Technologies, Inc. Methods and apparatuses for gene purification and imaging
WO2016091880A1 (en) * 2014-12-09 2016-06-16 King's College London Breast cancer treatment with taxane therapy
CN114127314A (zh) * 2019-07-19 2022-03-01 公立大学法人福岛县立医科大学 用于对乳腺癌的亚型(Subtype)进行鉴别或者分类的鉴别标志物遗传基因组、方法和套件
EP4001431A4 (en) * 2019-07-19 2023-09-27 Public University Corporation Fukushima Medical University Distinguishing marker gene set, method and kit each for distinguishing or classifying subtype of breast cancer
EP3945136A1 (en) * 2020-07-28 2022-02-02 Hospital Clínic de Barcelona In vitro method for the prognosis of patients suffering from her2-positive breast cancer
WO2022023235A1 (en) * 2020-07-28 2022-02-03 Hospital Clinic De Barcelona In vitro method for the prognosis of patients suffering from her2-positive breast cancer

Also Published As

Publication number Publication date
IL235795B (en) 2020-02-27
US20230272476A1 (en) 2023-08-31
JP2015518724A (ja) 2015-07-06
EP2852689A4 (en) 2016-05-11
MX2014014275A (es) 2015-07-06
EP2852689B1 (en) 2019-12-11
BR112014029300A2 (pt) 2017-07-25
EP2852689A2 (en) 2015-04-01
US20200332368A1 (en) 2020-10-22
MX369628B (es) 2019-11-14
US20130337444A1 (en) 2013-12-19
JP6325530B2 (ja) 2018-05-16
CA2874492A1 (en) 2013-11-28
AU2013266419A1 (en) 2014-12-11
IL235795A0 (en) 2015-01-29
ES2763931T3 (es) 2020-06-01
CN104704128A (zh) 2015-06-10
CN111500718A (zh) 2020-08-07
IN2014MN02418A (enExample) 2015-08-14
CA2874492C (en) 2021-10-19
WO2013177245A3 (en) 2015-01-29
AU2013266419B2 (en) 2018-09-27

Similar Documents

Publication Publication Date Title
US20230272476A1 (en) Nano46 genes and methods to predict breast cancer outcome
US20230250484A1 (en) Gene expression profiles to predict breast cancer outcomes
US9181588B2 (en) Methods of treating breast cancer with taxane therapy
US20140154681A1 (en) Methods to Predict Breast Cancer Outcome
US20150072021A1 (en) Methods and Kits for Predicting Outcome and Methods and Kits for Treating Breast Cancer with Radiation Therapy
US20160115551A1 (en) Methods to predict risk of recurrence in node-positive early breast cancer
AU2013282391A1 (en) Methods of treating breast cancer with gemcitabine therapy
AU2012229123A1 (en) Methods of treating breast cancer with anthracycline therapy
US20160160293A1 (en) Breast cancer treatment with taxane therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13794236

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 235795

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2874492

Country of ref document: CA

Ref document number: 2015514143

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/014275

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013794236

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013266419

Country of ref document: AU

Date of ref document: 20130522

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014029300

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014029300

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20141124