WO2013158258A1 - Ocular therapeutics using embryonic system cell microvesicles - Google Patents
Ocular therapeutics using embryonic system cell microvesicles Download PDFInfo
- Publication number
- WO2013158258A1 WO2013158258A1 PCT/US2013/030733 US2013030733W WO2013158258A1 WO 2013158258 A1 WO2013158258 A1 WO 2013158258A1 US 2013030733 W US2013030733 W US 2013030733W WO 2013158258 A1 WO2013158258 A1 WO 2013158258A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- esmv
- retinal
- fraction
- miiller
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/48—Reproductive organs
- A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
- A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/06—Antiglaucoma agents or miotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/12—Ophthalmic agents for cataracts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
- C12N5/0621—Eye cells, e.g. cornea, iris pigmented cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
- C12N5/0622—Glial cells, e.g. astrocytes, oligodendrocytes; Schwann cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/02—Coculture with; Conditioned medium produced by embryonic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/45—Artificially induced pluripotent stem cells
Definitions
- This invention is in the field of ophthalmological medicine, and more particularly, in the field of treatment for retinal degenerative and dystrophic diseases, optic nerve degenerations, anterior segment of the eye disease, such as cataract, corneal and dry eye disease, and systemic and local autoimmune diseases that adversely affect the eye.
- Ocular diseases such as retinal degeneration and dystrophies
- retinal degeneration and dystrophies are among the leading cause of irreversible blindness in the world; millions of people are affected with diabetic retinopathy, and various forms of macular degeneration, such as age-related macular degeneration and other hereditary retinal and macular degenerations.
- Cataract, glaucoma, corneal and dry eye conditions represent the majority of global, non-retinal blinding conditions.
- Therapies to slow down ocular disease and augment repair and or regeneration of tissue for example, by improving the regenerative capacity of ocular tissue, such as the retina, are in dire need.
- the present disclosure relates to a therapeutic fraction of embryonic stem cell (ESC)-derived microvesicles (ESMVs) and its therapeutic use in various compartments of the eye for treatment of ocular diseases and disorders.
- ESC embryonic stem cell
- ESMVs embryonic stem cell-derived microvesicles
- the disclosure provides a method of isolating such a therapeutic fraction and of identifying its selection.
- endogenous progenitor cells such as Muller and microglial cells
- a method of obtaining retinal neural cells comprises treating ocular neural progenitor cells with an amount of an ESMV fraction effective to cause the ocular neural progenitor cells to differentiate into retinal neural cells.
- the differentiation of retinal progenitor cells or of microglial and/or Muller cells is measured by the presence of glutamine synthetase, Gad67, NeuN, Brn3a, and Syntaxin la in the treated cells.
- the disclosure provides a method of obtaining cells with a retinal stem cell phenotype, comprising treating microglial cells and Muller cells for at least 8 hours with an effective amount of an embryonic stem cell-derived microvesicle fraction, and measuring the level of epidermal growth factor receptor (EGFR) in the treated cells, the level of EGFR in cells with a retinal stem cell phenotype being decreased relative to the level of EGFR in untreated microglial cells and Muller cells.
- the ESMV fraction comprises human ESMVs.
- a method of treating an eye pathology in a mammal comprising administering to the eye of the mammal a therapeutically effective amount of an embryonic stem cell-derived microvesicle (ESMV) fraction.
- ESMV embryonic stem cell-derived microvesicle
- the ESMV fraction is administered by intravitreal injection, subretinal injection, interocular injection, or by topical administration.
- the ESMV fraction is administered by continuous or bolus release.
- administration may be provided by a device, such as a contact lens or device including a pump.
- administration is by continuous or bolus release.
- the ESMV fraction comprises human ESMVs.
- the eye pathology treated is age-related macular degeneration, myopic degeneration, diabetic retinopathy, glaucoma, the retinitis pigmentosa complex, inherited retinal degeneration, uveitis, dry eye, optic neuropathy, corneal or anterior segment ocular diseases, such as, but not limited to, ocular cicatricial pemphigoid, benign and malignant Mooren's corneal ulcer, or rheumatoid arthritis.
- the eye pathology is glaucoma and the ESMV fraction is administered topically, intraocularly, or by intravitreal injection.
- the eye pathology is age-related macular degeneration (AMD) or photoreceptor/RPE degeneration, and the ESMC fraction is administered by intravitreal, intraocular, or subretinal injection.
- the eye pathology is retinal degeneration, and the ESMV fraction is administered by subretinal injection.
- the eye pathology is dry eye, corneal disease, or anterior segment ocular disease
- the ESMV fraction is administered by topical application.
- the mammal being treated is human
- the ESMV fraction comprises human ESMVs.
- the disclosure also provides a therapeutic composition comprising human embryonic stem cells in an amount effective to cause ocular neural progenitor cells to regenerate.
- the ocular neural progenitor cells are retinal progenitor cells.
- the ocular neural progenitor cells are microglial cells and/or Miiller cells.
- Figure 1 A is a microscopic representation showing untreated Miiller cells growing as homogeneous, bipolar, spindle-like adherent cell "sheets," where ESMV- treated (T) and control (C) cells were counted after each treatment and the ratio of treated to control cells calculated (T/C 6 S.E.M.);
- Figure IB is a microscopic representation showing Miiller cells post 9 ESMV treatments, growing as morphologically heterogeneous individual cells, some with multiple cellular processes, others with enlarged nuclei or multinucleated, many having visible metaphase plates and numerous stellar-shaped, where ESMV-treated (T) and control (C) cells were counted after each treatment and the ratio of treated to control cells calculated (T/C 6 S.E.M.);
- Figure 1C is a microscopic representation showing a collage of individual cells morphologically unique to the ESMV treatment group, where ESMV-treated (T) and control (C) cells were counted after each treatment and the ratio of treated to control cells calculated (T/C 6 S.E.M.);
- Figure ID is a schematic representation of a timeline of the morphological changes that take place in Miiller cells after ESMV treatments
- Figure 2A is a graphic representation showing the fold change in expression for the embryonic stem cell-specific mouse Oct4 mRNA after ESMV treatment for 8 hours, 24 hours, and 48 hours relative to control (medium only), where Gapdh was used as a loading control for qRT-PCR and error bars represent S.E.M. Student's t-test, performed to assay the difference between experimental and control Miiller cells groups, with p- values ⁇ 0.05, except for Nanog mRNA;
- Figure 2B is a graphic representation showing the fold change in expression for the embryonic stem cell-specific mouse Sox2 mRNA after ESMV treatment for 8 hours, 24 hours, and 48 hours relative to control (medium only), where Gapdh was used as a loading control for qRT-PCR, and error bars represent S.E.M. Student's t-test, performed to assay the difference between experimental and control Miiller cells groups, with p- values ⁇ 0.05, except for Nanog mRNA;
- Figure 2C is a graphic representation showing the fold change in expression for the embryonic stem cell-specific mouse Nanog mRNA after ESMV treatment for 8 hours, 24 hours, and 48 hours relative to control (medium only), where Gapdh was used as a loading control for qRT-PCR, and error bars represent S.E.M. Student's t-test, performed to assay the difference between experimental and control Miiller cells groups, with p- values ⁇ 0.05, except for Nanog mRNA;
- Figure 2D is a graphic representation showing the fold change in expression for the embryonic stem cell-specific human Oct4 mRNA after ESMV treatment for 8 hours, 24 hours, and 48 hours relative to control (medium only), where Gapdh was used as a loading control for qRT-PCR, and error bars represent S.E.M. Student's t-test, performed to assay the difference between experimental and control Miiller cells groups, with p- values ⁇ 0.05, except for Nanog mRNA;
- Figure 2E is a graphic representation showing the fold change in expression for the embryonic stem cell-specific human Pax6 mRNA after ESMV treatment for 8 hours, 24 hours, and 48 hours relative to control (medium only), where Gapdh was used as a loading control for qRT-PCR, and error bars represent S.E.M. Student's t-test, performed to assay the difference between experimental and control Miiller cells groups, with p- values ⁇ 0.05, except for Nanog mRNA;
- Figure 2F is a graphic representation showing the fold change in expression for the embryonic stem cell-specific human Rax mRNA after ESMV treatment for 8 hours, 24 hours, and 48 hours relative to control (medium only), where Gapdh was used as a loading control for qRT-PCR, and error bars represent S.E.M. Student's t-test, performed to assay the difference between experimental and control Miiller cells groups, with p- values ⁇ 0.05, except for Nanog mRNA;
- Figure 3 A is a graphic representation showing the fold change in the levels of ESC-specific miRNA 292 in Miiller cells at 8 hours, 24 hours, and 48 hours after ESMV treatment relative to control, where the y-axis correspond to the fold changes between the treatment and control (light green) groups of Muller cells, and error bars represent S.E.M.; significant differences between experimental and control groups were determined by Student's t-test, where all p-values were ⁇ 0.01;
- Figure 3B is a graphic representation showing the fold change in the levels of ESC-specific miR A 295 in Muller cells at 8 hours, 24 hours, and 48 hours after ESMV treatment relative to control, where the y-axis correspond to the fold changes between the treatment and control (light green) groups of Muller cells, and error bars represent S.E.M.; significant differences between experimental and control groups were determined by Student's t-test, where all p-values were ⁇ 0.01;
- Figure 4A is a diagrammatic representation of a Venn diagram of gene expression changes, as measured by microarray, in ESMV-treated versus control Muller cells at 8 hours, 24 hours, and 48 hours post-ESMV exposure;
- Figure 4B a diagrammatic representation of a heat map of hierarchal clustering of 16 samples based on the 1894 probes found to be differentially regulated in the Muller cells post-ESMV treatment versus control (p-value, 0.001 and a minimum of 3-fold difference in expression), with red representing up-and blue representing down- regulation; rows represent the samples and columns represent the genes;
- Figure 5 A is a graphic representation of an ingenuity pathway analysis of 1894 genes differentially regulated at all tested time points between ESMV-treated and control Muller cells at p ⁇ 0.001 level and fold change > 3 in specific function, where genes were tested for significant associated in specific cell functional signaling pathways versus random change association in a total curated database of gene interactions of over significant canonical pathways;
- Figure 5B is graphic representation of an ingenuity pathway analysis of 1894 genes differentially regulated at all tested time points between ESMV-treated and control Muller cells at p ⁇ 0.001 level and fold change > 3 in cell canonical signaling pathway, where genes were tested for significant associated in specific cell canonical signaling pathways versus random change association in a total curated database of gene interactions of over significant canonical pathways;
- Figure 6 is a graphic representation of an qRT-PCR analysis showing gene expression changes of microarray-identified genes in Muller cells at 24 hours and 48 hours post-ESMV treatment compared to untreated controls, where each bar represents the relative abundance of the genes tested in ESMV-treated versus untreated Muller cells and error bars represent S.E.M.;
- Figure 7A is a graphic representation of a Venn diagram of miRNA expression changes in ESMV-treated versus control Muller cells at 8 hours, 24 hours, and 48 hours post-ESMV treatment;
- Figure 7B is a graphic representations of a heat map of hierarchal clustering of 16 samples based on 25 miRNA probes differentially regulated in ESMV-treated versus control Muller cells at all times tested, (p ⁇ 0.05, minimum 3 -fold difference in expression), where each row represents a single sample, and each column-a single miRNA, and where the red or blue color represents relatively high or low expression, respectively;
- Figure 8 is a graphic representation showing qRT-PCR analysis of select miRNAs involved maintenance of pluripotency, de-differentiation, cell fate determination and differentiation, in ESMV-treated versus control Muller cells, where each bar represents the relative abundance of the miRNAs tested in ESMV-treated Muller cells versus untreated control cells and error bars represent SEM;
- Figures 9A - 9R are representations of confocal photomicrographs showing ESMV-treated and control Muller cells immunostained for markers of various retinal lineages, where Figs. A-L show cells were double stained with Gad67 (amacrine and horizontal cells; green) or NeuN (amacrine and ganglion cells; green) and the marker of Muller cells, glutamine synthetase (red); where Figs. 9A - 9C show Gad67-stained ESMV-treated Muller cells; where Figs. 9D - 9F show Gad67-stained control Muller cells; where Figs. 9G - 91 show NeuN-stained ESMV-treated Muller cells; where Figs.
- 9J - 9L show NeuN-stained control Muller cells; where the third panel of each row shows the merged first two images; where Fig. 9M shows ESMV-treated and Fig. 9N shows control Muller cells, stained for Brn3a (green), a marker of retinal ganglion cells; Fig. 90 shows ESMV-treated and Fig. 9P shows control Muller cells stained for Syntaxin la (green), a marker of amacrine cells; Fig. 9Q shows ESMV-treated and Fig.
- 9R shows control Miiller cells stained for rhodopsin (green), a marker of rod photoreceptors, where cell nuclei were labeled with 496-diamidino-2-phenylindole (DAPI, blue), and scale bar 10 mm for all panels with images showing z-axis projections of 1561 mm in all channels;
- DAPI 496-diamidino-2-phenylindole
- Figures 10A - 10F are representations of confocal micrographs showing Gad67 expression (Figs. 10A and IOC), BrdU expression (Figs. 10B and 10D), and merged expression (Figs. IOC and 10D) seven days (Figs. 10A - IOC) and 30 days (Figs. 10D - 10F) post-injection;
- Figures 11 A - 1 IF are representations of confocal micrographs showing Syntaxin la expression (Figs. 11A and 11C), BrdU expression (Figs. 1 IB and 1 ID), and merged expression (Figs. 11C and 1 ID) seven days (Figs. 11A - 11C) and 30 days (Figs. 1 ID - 1 IF) post-injection;
- Figures 12A - 12F are representations of confocal micrographs showing CRALBP expression (Figs. 12A and 12C), BrdU expression (Figs. 12B and 12D), and merged expression (Figs. 12C and 12D) seven days (Figs. 12A - 12C) and 30 days (Figs. 12D - 12F) post-injection; and
- Figure 13 is a representation of a scotopic dark-adapted ERG tracing of one of the animals improved post-ESMV treatment at arbitrarily chosen stimulus intensity of 0.05345 cd/m2, where the maximum wave amplitude in the untreated right eye (red) remained at approximately 330 ⁇ , while the maximum wave amplitude improved to over 450 ⁇ in the ESMV-treated left eye (blue).
- the present disclosure provides a therapeutic composition
- a therapeutic composition comprising a fraction of human embryonic stem cell (ESC) microvesicles (ESMVs), the isolation and identification of their therapeutic fraction, and the application of this fraction as a therapeutic modality to treat the majority of the diseases that afflict the eye.
- ESC human embryonic stem cell
- ESMVs human embryonic stem cell microvesicles
- Embryonic stem cells are known to release a population of ESCs.
- ESMVs microvesicles
- Miiller cells like microglial cells, are retinal progenitor cells as they have the ability to differentiate along multiple retinal lineages, such as photoreceptors and inner retina neurons.
- ESMVs can transfer their internal contents of stem cell mRNA, miRNA, and protein to cultured human retinal progenitor cells (Miiller cells and microglial cells), thereby inducing the activation of endogenous, adult, quiescent progenitor cells in damaged tissue. Although not meant to be limited by any particular theory, this transfer is believed to occur in part through the merging of the ESMV membrane with other cell membranes. [0046] It has been determined that ESMVs added to the cultures of retinal Miiller cells induced morphological changes towards a more de-differentiated progenitor phenotype (Fig. 1).
- This ESMV fraction selectively transfers ESC mRNA and miR A, resulting in induction of embryonic and early retinal genes in Miiller cells.
- ESMV treatment of Miiller cells induced a transcriptome change, indicative of de-differentiation and activation of a retinal re-generation program.
- Treatment of Miiller cells resulted in the up-regulation of pluripotency and early retinal genes, genes involved in retinal protection and inducers of retinal regeneration, as well as multiple extracellular matrix (ECM)-modifying molecules that create a permissive environment for retinal
- ECM extracellular matrix
- ESMV treatment also resulted in the down-regulation of genes promoting differentiation and inhibitory ECM and scar components. Moreover, ESMVs induced a shift in the miRNA transcriptome of Miiller cells towards a de-differentiated progenitor state. These results demonstrate that ESMVs are therapeutic agents which can activate the retina's endogenous regenerative potential.
- ESMVs are able to induce morphological changes in cultured retinal progenitor cells towards a more de-differentiated phenotype and also to initiate the regeneration of retinal tissue.
- Cultured Miiller cells exposed to ESMVs can up-regulate genes related to pluripotency (Oct4, Lin28, Klf4, and LIF), upregulate early retinal genes (BMP7, Pax6, and Rax), upregulate genes involved in retinal protection (IL6, CSF2), and regeneration (FGF2, IGF2, GDNF), and upregulate extracellular matrix-modifying genes known to create permissive environment for tissue remodeling (e.g., MMP3).
- ESMVs can down-regulate genes promoting differentiation (e.g., DNMT3a and GATA4). Miiller cells are activated in the injured retina with some regenerative success. However, functional retinal recovery has heretofore not been accomplished.
- ESMVs improve the functionality of damaged retinas of mouse models of retinal degeneration. ESMVs stimulate regeneration, at least in part, by inducing endogenous retinal progenitor cells to repopulate and repair damaged retina. After ESMV application, a significant (70%) improvement in the a and b waves of mouse ERG, as well as immunohistochemical evidence of retinal cell repopulation, have been found. [0050] The advantage of using hESMVs versus ESCs for therapeutic applications to humans is that hESMVs are not cells, do not actively produce surface molecules, and are less likely to cause rejection and tumor formation.
- hESMV preparations used are free of endotoxin, non-immunogenic, non-tumorigenic, and contaminant free.
- the use of hESMVs avoids the possible long-term maldifferentiation of engrafted intact ESCs and eliminates the risk of their malignant transformation.
- ESMVs can also specifically stimulate or initiate regeneration of ocular compartments for regeneration and repair of damage.
- damage to be repaired by ESMVs actuating intrinsic regenerative agents range from corneal abrasion, ulcerations and/or scarring to all forms of retinal disease.
- ESMVs initiated the regeneration of damaged retina by inducing its endogenous regenerative capacity.
- the therapeutic ESMV fraction is obtained from native or cultured mammalian ESCs, such as human ESCs, by differential centrifugation, as described in the examples below. Its presence can be confirmed by the presence of known ESC-specific mR As (Oct4, Sox2, Nanog, Lin28, Klf4) and microR As (miR-292, -294, and -295), as well as by certain ESC-specific surface protein antigens (CD9, Delta 1, integrin a6, integrin ⁇ , sonic hedgehog, sonic hedgehog homolog, SSEA1, SSEA3, SSEA4, and TRA-1-60). Thus, the presence of the therapeutic ESMV fraction can be verified using a certain combination of pluripotency factors.
- This ESMV fraction may be additionally fractionated to obtain an RNA fraction containing total RNA or certain mRNAs and miRNAs from the ESMVs which can cause de-differentiation of cells or can initiate the expression of genes involved in the development and functioning of certain differentiated ocular cells.
- the ESMV fraction may be administered to the eye by any mode of delivery determined to be effective by an ophthalmologist for the disease being treated. For example, intravitreal applications may be appropriate for glaucoma, while AMD and photoreceptor/RPE degenerations may be treated by subretinal injections. Delivery may be bolus, intermittent, or continuous, and may be provided by a device, such as, but not limited to, a delivery pump or contact lens. [0054] In other nonlimiting examples, ESMVs may be administered topically to the eye to treat, e.g., corneal epithelial abnormalities and dry eye.
- the therapeutic ESMV fraction may be embedded into an extended release vehicle, such as a hydrogel matrix (see, e.g., Zarembinski, et al. (2011) in Regenerative Medicine and Tissue Engineering-Cells and Biomaterials, Editor: Daniel Eberly, Chapter 16, pp. 341- 364), which can be adhered to the side of a contact lens adjacent to the cornea to treat cornea diseases and to stimulate corneal regeneration.
- a hydrogel matrix see, e.g., Zarembinski, et al. (2011) in Regenerative Medicine and Tissue Engineering-Cells and Biomaterials, Editor: Daniel Eberly, Chapter 16, pp. 341- 364
- the fraction may also be administered continuously or intermittently via a device equipped with a pump.
- Diseases of the eye that can be treated according to the disclosure include cell loss within all eye compartments, tear-producing glands, and cells on or near the ocular surface, corneal cell loss, anterior chamber diseases, and the majority of retinal degenerative diseases including, but not limited to, age-related macular degeneration, diabetic retinopathy, glaucoma, the retinitis pigmentosa complex, as well as inherited retinal degenerations.
- Other diseases of the eye that can be treated according to the disclosure include systemic and local autoimmune disorders that adversely affect the eye, such as, but not limited to, uveitis, dry eye, ocular cicatricial pemphigoid, benign and malignant Mooren's corneal ulcer, and rheumatoid arthritis.
- a particular eye disorder may be treated once or multiple times by repeated administrations of the ESMV fraction to the issue affected, as determined by an ophthalmologist.
- the ESMV fraction may be administered alone or with other therapeutics know to treat the disorder, as long as the secondary treatment does not inactivate the ESMVs being administered.
- Embryonic stem cells derived from the mouse strain SV129 were expanded under serum-free and feeder-free conditions in ESGRO Complete PLUS clonal grade medium supplemented with GSK3B inhibitor to suppress differentiation (Millipore, Billerica, MA). 3.5 x 10 6 cells were plated on gelatin-coated T175 cm 2 culture flasks. ESCs were cultured in a humidified 37°C, 5% C0 2 incubator. The growth of ESCs was monitored microscopically and fresh culture medium was added daily and collected every 48 hr for ESMV isolation. ESCs were passaged using ESGRO Complete Accutase (Millipore) every 48 to 72 hr to maintain ESC colonies at 80% confluence in order to maximize ESMV yield while avoiding differentiation of ESCs.
- ESGRO Complete Accutase Millipore
- ESC colonies were visually inspected by microscopy on a daily basis for signs of differentiation and Oct4, Sox2, and Nanog mRNA expression was assayed by qRT- PCR using mouse specific primer pairs designed by PrimerQuest SM (Integrated DNA Technology-DNAsite, San Diego, CA):
- Oct4 forward-GCCGGGCTGGGTGGATTCTC (SEQ ID NO: l),
- Nanog forward-TCCAGAA-GAGGGCGTCAGAT (SEQ ID NO:3),
- Sox2 forward- AACAATCGCGGCGGCCCGAGGAG (SEQ ID NO:5), reverse-GCCTCGGCGTGCCGGCCCTGCG (SEQ ID NO:6).
- ESMVs To isolate ESMVs, the supernatant was collected in 50 ml centrifuge tubes and spun at 3,500 g for 1 hr at 4°C to pellet debris and fragmented cells. The supernatant was carefully transferred to an ultracentrifuge tube and spun at 200,000 g for 3.5 hr in a Beckman Type 50.2 ⁇ rotor at 4°C to pellet the ESMVs. The ESMVs can then be used or fractionated to obtain a therapeutic composition comprising RNA and/or proteins obtained from the vesicles.
- EXAMPLE 2 EXAMPLE 2
- mirVana miRNA isolation kit which retains small RNA species (Ambion, Austin, TX), treated with TURBO DNAse (Ambion) to remove DNA traces, and examined by RT-PCR for the presence of mouse Oct4, Sox2, Nanog (primer pairs in Example 1), and Klf4, Lin28, and mmu-miR-292-3p, -294, and -295 (Taqman® primers) transcripts.
- RNA in human ESMVs from hESCs is extracted using the miRNeasy MiniTM kit (Qiagen, Germantown, MD, USA), which isolates total RNA as well as miRNAs.
- Total RNA is hybridized to Affimetrix GeneChip U133 Plus 2.0 human gene expression arrays (Affimetrix, Santa Clara, CA).
- the target preparations and array hybridizations are performed following the standard Affymetrix GeneChip Expression Analysis protocol.
- the arrays are scanned using the Affymetrix 7G scanner and the images are acquired using the Affymetrix GeneChip Command Console 1.1 (AGCC).
- hESMV proteins are characterized by hybridization to Invitrogen ProtoArray Human Protein Microarrays (Invitrogen, Carlsbad, CA).
- hESMV surface antigens are analyzed by flow cytometry for the ESC surface markers 1, integrin a6, integrin ⁇ , sonic hedgehog, sonic hedgehog homo log, SSEA1, SSEA3, SSEA4, TRA-1-60 and TRA-1-81.
- Multiple batches of hESMVs are isolated from hESC cultures, washed with PBS, resuspended in PBS supplemented with BSA and sodium azide and stained using the corresponding fluorochrome-conjugated monoclonal antibodies.
- hESMVs are resuspended in the culture medium and taken for flow cytometry analysis. Flow cytometric analysis and the optimization of the experimental conditions are optimized as desired. The acquired data are analyzed using CELLQuest software.
- hESMV preparations are screened to ensure absence of bacterial endotoxin in hESMVs using the GenScript ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit, which utilizes a modified Limulus Amebocyte Lysate and a synthetic color producing substrate to quantitatively detect endotoxin chromogenically in a broad range (0.005 - 1 EU/ml).
- MIO-Ml The human Moorfield/Institute of Ophthalmology-Muller 1 (MIO-Ml) cell line, initially derived from postmortem human neural retina, was established and characterized previously (Limb et al. (2002) Invest. Ophthalmol. Vis. Sci. 43:864-869).
- MIO-Ml cells were maintained as an adherent cell line in 175 cm 2 tissue culture flasks for propagation, and in 6-well cell culture plates for ESMV treatment experiments, in DMEM medium containing 4500 mg/L glucose, sodium pyruvate and stabilized L-glutamine (GlutaMAX; Invitrogen, Grand Island, New York) with 10% vol/vol fetal bovine serum (filtered, heat inactivated; Gemini Bioproducts, Sacramento, CA) and penicillin/streptomycin
- Miiller cells were plated on two 6-well cell culture plates at 1 x 10 6 cells per well and allowed to reach 60% confluence prior to initiating ESMV treatments.
- Control Muller cells cultures in the other 6-well plate were subjected only to medium changes in place of ESMV treatments. To maintain 60% confluence, both treated and control cells were passaged as needed at the end of an ESMV treatment. ESMV-exposed and control Muller cells were examined after each treatment using the Leica DM IL LED microscope.
- ESMV-exposed and control Miiller cells were examined after each treatment using the Leica DM IL LED microscope (Leica Microsystems, Wetzlar, Germany), and for the determination of cell number, images of 3 to 4 fields of view (acquired at 20 X magnification for each well of a 6-well plate of treated and control cells) were obtained using a Leica DCF295 digital camera. Cells within each image were individually marked using Adobe Photoshop (Adobe Systems, San Jose, CA), and then counted. Cell number per field of view was obtained at each time point for treatment and control groups and ratios of treated/control cells was calculated.
- Miiller cells were fixed in 100% ethanol for 15 min and stained with Harris Hematoxylin and Eosin Y (Fisher Scientific, Pittsburgh, PA), dehydrated with serial ethanol washes, air dried and covers lipped with ProLong Gold antifade reagent (Invitrogen).
- the transmitted light differential interference contrast images were acquired using a Zeiss Axiovert 135M microscope with a Photometries CoolSnap camera (Roper Scientific, Arlington, AZ).
- hESMVs are added to human Miiller cell cultures by resuspension in Miiller cell medium and RNA is isolated at 8 hr, 24 hr, and 48 hr post-treatment from ESMV-treated and untreated cells.
- SuperscriptTM III First-Strand Synthesis SuperMix for qRT-PCR Invitrogen.
- mouse-specific primer pairs described above for Oct4, Sox2, and Nanog were used, and amplification was detected using Brilliant Sybr Green qPCR Master Mix (Stratagene, La Jolla, CA) in an Mx3000p qPCR instrument (Stratagene). All results were normalized to the human housekeeping gene
- glyceraldehyde 3-phosphate dehydrogenase ⁇ Gapdh amplified using commercially available primers (IDT, Coralville, IA).
- IDT commercially available primers
- the relative change in gene expression was determined using the 2 ⁇ AACt method of comparative quantification.
- TaqMan® primers for the human Oct4, Pax6, and Rax genes and the TaqMan® Gene Expression Assays protocol and reagents were used; TaqMan® Gapdh primers were used for normalization.
- ESMVs transfer by ESMVs of mRNA transcripts from mouse ESCs was distinguished from the induction by ESMVs of endogenous transcripts of human Muller cells. While mouse Oct4 and Sox2 mRNAs were transferred from ESMVs and remained elevated in Muller cells 48 hr post-ESMV treatment (Figs. 2A and 2B), no Nanog transfer was observed at any time point post- treatment (Fig. 2C), indicating that ESMVs transfer genetic information by a selective mechanism.
- miRNAs small noncoding RNAs, are important regulators of gene expression and maintenance of ESC pluripotency and cell fate determination.
- ESMVs are highly enriched in miRNAs [6], including ESC-specific miRNAs of the 290-cluster, which are involved in maintenance of ESC pluripotency.
- ESMVs are added to human Miiller cell cultures by
- RNA resuspension in Miiller cell medium and RNA is isolated at 8 hr, 24 hr, and 48 hr postexposure from ESMV-treated and untreated cells.
- RNA expression changes in ESMV treated versus untreated Miiller cells are identified by hybridization to Affimetrix GeneChip U133 Plus 2.0 human gene expression arrays (Affimetrix, Santa Clara, CA, USA), as described above.
- mRNAs important for maintenance of stem cell pluripotency, Oct4, Sox2 and Nanog, stem cell specific miRNAs 292 and 295, and early retinal transcripts Pax6 and Rax are examined by qRT-PCR, using TaqmanTM Assays according to the manufacturer's protocol, as described above.
- Glul glucose synthetase
- clusterin Clu
- dickkopf homo log 3 Dkk3
- aquaporin 4 Aqp4
- SI 00 calcium binding protein A16 Apolipoprotein E (ApoE), Vimentin (VIM), and glial fibrillary acidic protein (GFAP)
- 1894 genes were differentially expressed at all 3 time points post-ESMV treatment, with 801 genes up- and 1093 genes down-regulated (Fig. 4A). Tight clustering of genes in ESMV-treated versus control Muller cells was observed, with treated cells sharing a similar gene expression profile over a wide range of genes (Fig. 4B). More than 60% of the gene expression changes occurred by 8 hr post-treatment. 1444 genes were up- and 1878 genes were down-regulated at 8 hr, 1623 genes were up- and 1828 genes were down-regulated at 24 hr, and 1711 genes were up- and 1907 genes were down- regulated at 48 hr post-ESMV treatment. The majority of gene expression changes (95%) occurred by 24 hr, with only 624 genes unique to the 48-hour time point (Fig. 4A).
- ESMV-treated Muller cells differentially expressed multiple genes involved in cellular movement and extracellular matrix composition, inflammation, cellular growth and proliferation, tissue response to injury, molecular transport, energy metabolism, embryonic development, cell survival, DNA replication, and genes involved in ophthalmic diseases (Table SI). Many of the 1894 genes differentially expressed in ESMV-treated Muller cells at all time points have been linked, among others, to the following canonical signaling pathways:
- up-regulated genes were pluripotency genes Oct4, Lin28, Klf4, and LIF, early retinal genes Bmp7, Olig2, FoxN4, Dill, Pax6, and Rax, genes IL6, CSF2 with known retinal protective properties, and inducers of retinal regeneration (FGF2, IGF2, GDNF), as well as multiple extracellular matrix modifying molecules, such as the gene for Matrix metalloproteinase 3 (MMP3), that are known to create permissive environment for tissue remodeling.
- MMP3 Matrix metalloproteinase 3
- down-regulated genes were those promoting differentiation, such as DNMT3a and GATA4, inhibitory extracellular matrix components, such as Aggrecan, heparin sulfate, and Tenascin, and inhibitory scar tissue components, such as GFAP and chondroitin sulfate proteoglycans.
- DNMT3a and GATA4 inhibitory extracellular matrix components
- inhibitory scar tissue components such as GFAP and chondroitin sulfate proteoglycans.
- c-Myc a well-characterized pluripotency-inducing factor
- Hesl, Notch 1, Notch2, and NeuroDl genes which regulate cell cycle re-entry, de-differentiation, and activation of retinal stem cell phenotype in Miiller cells, were highly up-regulated at 8 hr post- ESMV treatment, with levels remaining increased over baseline, but declining at other time points.
- the expression of EGFR, a gene involved in driving retinal progenitors towards Miiller glial fate during retinogenesis was down-regulated at all three time points.
- microarray data analysis revealed the up-regulation of several genes encoding markers of various retinal lineages in Miiller cells exposed to ESMVs, including those for calbindin 1, a marker of horizontal and amacrine retinal neurons, Syntaxin la, a marker of amacrine cells, and rhodopsin, a marker of rod photoreceptors.
- the expression of calbindin 1 was highest 48 hr post-ESMV, while the expression of rhodopsin and Syntaxin la was increased at all tested time points.
- miRNAs play a role in retinogenesis, regulating retinal progenitor cell progression from early to late stages and their differentiation towards various retinal cell lineages. Accordingly, testing was done to determine if miRNAs delivered to Miiller cells by ESMVs alter the miRNA and mRNA expression profiles of Miiller cells and shift these cells towards a de-differentiated state.
- RNA samples prepared as described above was labeled with Hy3TM and the labeled miRNAs were hybridized to miRNA arrays.
- Exiqon miRCURY LNA miRNA arrays (microarrays vl 1), which include 927/648/351 human/mouse/rat miRNAs as well as 438 miRPlus miRNAs, were used according to the manufacturer's instructions.
- the miRNA array slides were scanned with an Axon GenePix 4100A scanner (Molecular Devices, Sunnyvale, CA) and processed with the GenePix Pro 6.0 software (Molecular Devices).
- the raw miRNA data were normalized using a combination of housekeeping miRNAs and invariant miRNAs.
- Statistically different miRNAs were selected using Partek genomic suite 6.4 with thresholds of > 3-fold and FDR corrected p ⁇ 0.05.
- miRNAs which are highly expressed in developing retina were up-regulated in ESMV-treated Miiller cells, including miR-1, miR-96, miR-182 and miR- 183.
- miRNAs belonging to the 290 cluster miR-291b-5p, -292, -294, and -295
- the miRNA cluster involved in the maintenance of ESC pluripotency were up-regulated and remained increased over 48 hr post-ESMV exposure.
- miR-let-7b and miR-let-7c belonging to the miR-let-7 cluster which inhibits cell cycle progression and promote cell differentiation, decreased post-ESMV treatment.
- miR-7 which represses the expression of Yan protein and promotes photoreceptor differentiation [44], as well as miR-125-2b, highly abundant in adult retina, were down-regulated over 48 hr post-ESMV treatment.
- miRNAs strongly up-regulated at all three time points tested were miR-133a (increased 30-fold) and miR-146a (increased 37-fold), the miRNAs which promote cell proliferation and inhibit differentiation of skeletal myoblasts and myogenic stem cells, respectively, the latter acting via the Notch signaling pathway, the same pathway which regulates retinal progenitor differentiation.
- miRNAs strongly down-regulated at all tested times were miR-199b-5p (decreased 70-fold), miR- 214 (decreased 37-fold), and miR-143 (decreased 13-fold), which promotes
- RNA samples involved in maintenance of pluripotency were selected for validation of the microarray results.
- Total RNA samples from Miiller cells at 24 hr and 48 hr post-ESMV treatment were subjected to qRT-PCR using TaqMan miRNA Assays that included stem-loop RT primers specific for each miRNA. qRT-PCR results confirmed the pattern of expression observed by the microarray screening for all the miRNAs tested (Fig. 8).
- Miiller cells that had had 8 treatments with ESMVs were seeded on poly-D- lysine-coated glass coverslips placed in the 6-well culture plates, allowed to attach, and treated with ESMVs derived from 6 T175 flasks, as described above. 24 hr later, ESMV- treated and control cells were rinsed in 0.1 M PBS and fixed for 30 min in 4%
- ESMV -treated and control cells were then incubated for 1 - 2 hr at RT with the appropriate secondary antibodies conjugated to AlexaFluor488, AlexaFluor568, or AlexaFluor594 (Molecular Probes, Eugene, OR) and diluted 1 : 1000.
- GS glutamine synthetase
- Figs. 9A and 9B immunoreactivity to Gad67
- a marker of amacrine and horizontal cells Figs. 9A and 9C
- NeuN a marker of amacrine and retinal ganglion cells
- Figs. 9G and 91 a marker of amacrine and retinal ganglion cells
- Fig. 9M a marker of retinal ganglion cells
- Syntaxin la a marker of amacrine cells (Fig. 90) were observed in small populations of ESMV -treated Miiller cells. None of these markers were present in the untreated control cultures (Figs. 9G - 9L, 9N, 9P, and 9R).
- ESMV treatment induces transdifferentiation of Miiller cells into cells of retinal neural lineage, mainly towards amacrine and retinal ganglion cells, but not horizontal or bipolar cells.
- the very limited expression of rhodopsin post- ESMV exposure also suggests that ESMV treatment induces at least a partial activation of genes of photoreceptor lineage.
- RNA from Miiller cells which are representative of the regenerative cell population
- ESMV treatment for 24 hr and 48 hr the expression profiles of a subset of genes involved in the processes of de-differentiation ⁇ Cyclin D2, BMP7), retinal protection (IL6, IGF2), repair and tissue remodeling (MMP3), as well as genes involved in scar formation (GFAP) and inhibition of ECM components (Aggrecan), all of which were significantly altered in the ESMV-treated group on the microarrays.
- IL6, IGF2 retinal protection
- MMP3 repair and tissue remodeling
- GFAP genes involved in scar formation
- Aggrecan inhibition of ECM components
- metalloproteinase that up-regulates in newt adult organ repair, including retina, and facilitates the integration into the retina of transplanted photoreceptors when present at elevated levels, was found strongly up-regulated in microarrays and qRT-PCR
- the Aggrecan gene which encodes a chondroitin sulfate proteoglycan required for normal glial cell differentiation and development was among the genes down-regulated in microarrays and qRT-PCR studies, as was GFAP, a gene that when deleted from the mouse genome improves retinal transplant integration.
- qRT-PCR analysis of independent samples of ESMV-treated and control Miiller cells was carried out to validate the expression changes from the mRNA and miRNA microarray data. Since microarray analysis indicated that the majority of expression changes in the genes of interest take place 24 hr and 48 hr post-ESMV exposure, these time points were used for array validation.
- Total RNA was isolated using miRNeasy Mini kit (Qiagen) and subjected to on-column DNase digestion per protocol.
- RNA was converted to cDNA as described above, and qPCR was carried out using the following TaqMan® primers, selected to span exon-exon junctions to eliminate potential genomic DNA amplification in the Expression Assay protocol (Applied Biosystems, https://products. appliedbiosystems.com/ab/en/
- hESCs HI and H9 human ESC lines
- hESCs are cultured and expanded under serum- free, feeder-free, conditions. Briefly, hESCs are grown on CELLstartTM CTSTM defined substrate (Invitrogen) in a 1 : 1 ratio of two defined xeno-free media typically used to culture hESC without feeders, TeSR2 and Nutristem, (Invitrogen). Cells are maintained with daily change of medium. In these conditions, the hESCs show typical
- hESMV collection the media from day 4 to 6 cultures of HI and H9 hESCs is collected and spun at 3,500 g for 1 hr to pellet debris and fragmented cells. The supernatants then undergo serial ultracentrifugations at 200,000 g and washing steps to obtain the purified hESMV pellets (Katsman et al. (2012) PLoS ONE 7(1 l):e50417)). Protein and RNA content in the ESMV preparations is measured to corroborate the consistency of the isolation protocol.
- hESMVs are tested for mycoplasma, endotoxin, aerobic and anaerobic bacteria and fungi by the UCLA Clinical Microbiology laboratory.
- RNA in hESMVs from HI and H9 hESCs and in mESMVs from a mESC line that generated according to the protocol described in Yuan et al. ((2009) PLoS One 4(3):e4722) is extracted using the miRNeasy MiniTM kit (Qiagen), which isolates total RNA as well as miRNAs. Each RNA sample is divided into fractions.
- RNA and the other for miRNA analysis are used for mRNA and the other for miRNA analysis.
- the presence of ESC- specific mRNAs (Oct4, Nanog, Sox2, Lin28, and Klf4) and miRNAs of the 290 and 302- 367 clusters is analyzed by qRT-PCR using the relative standard curve method of RNA quantification.
- human and mouse total RNAs are hybridized to the Affimetrix GeneChip U133 Plus 2.0 human gene expression array and GeneChip Mouse Genome 430 2.0 expression array, respectively, by the UCLA Clinical Microarray Core facility, following the standard Affymetrix GeneChip Expression Analysis protocol. The arrays are scanned using the Affymetrix 7G scanner and the images are acquired using the
- Affymetrix GeneChip Command Console 1.1 Expressed genes are identified by
- hESMV proteins are characterized by hybridization to an Invitrogen ProtoArray Human Protein Microarray. The presence and quantity of proteins found to stimulate regeneration of damaged retinas using mESMVs, such as IL6, FGF2, and IGF2, are examined in hESMVs by Western blot analysis.
- mESMVs such as IL6, FGF2, and IGF2
- hESMV and mESMV surface antigens are compared by flow cytometry for the ESC surface markers CD9, CD133, Delta 1, integrins a6 and ⁇ , sonic hedgehog, Thyl, SSEA1, SSEA3, SSEA4, TRA-1-60, and TRA-1-81.
- Multiple batches of hESMVs and mESMVs are isolated from hESC and mESC cultures, respectively, resuspended in PBS supplemented with BSA and sodium azide and stained using the corresponding fluorochrome-conjugated monoclonal antibodies. Optimization of the experimental conditions, as needed, and flow cytometry analysis is carried out at the UCLA's Flow Cytometry Core Laboratory. The acquired data is analyzed using CELLQuest software.
- Muller cells are cultured with hESMVs (similar amount of protein as in mESMV incubations) for 8 hr, 24 hr, and 48 hr. The morphological changes are evaluated by comparison with untreated control Muller cells, as done after exposure to mESMV.
- hiPSMVs human-induced pluripotent stem cell microvesicles
- hiPSCs human microvesicles obtained from cultured human-induced pluripotent stem cells
- Several lines of hiPSCs have been generated according to the protocol described in Karumbayaram et al. ((2012) Stem Cells Transl. Med. l(l):36-43)).
- the NHDF and Fibrogro hiPSC lines are used which were derived and reprogrammed (Sommer et al.
- Microvesicles are isolated from passage 15 hiPSCs following the same protocol used to obtain hESMVs from hESCs described above, and the effects of hiPSMVs on Muller cells are tested as described above for hESMVs.
- the selected hESMVs show in in vitro studies that they produce similar results on progenitor Muller cells to those observed with mESMVs, the corresponding GMP grade hESC line is obtained from WiCELL, Wisconsin. These cells are cultured under GMP compatible conditions at the UCLA iPSC GMP laboratory, along with the in- house GMP compatible hiPSC line chosen, and GMP grade hESMVs as well as hiPSMVs are obtained following the protocol established above for the study of their in vivo effect on mice.
- ERGs are determined at the Jules Stein Eye Institute LIFE (Life Imaging and Functional Evaluation) Core facility.
- An advantage of ERGs is that they allow the evaluation of the function of the retina in living animals; ERGs can be repeated consecutively to determine function over time. Recordings are obtained from each eye of a cohort of C57B1/6J mice to collect information about their retinal function prior to the beginning of the study. Every retina is then acutely damaged by intraocular injections of NMD A, and ERGs are performed the next day on both eyes of each mouse to assess the injury level. Mice are divided into two groups.
- one group is injected intraocularly and the other subretinally with a range of doses (10 ng, 25 ng, 50 ng, 175 ng, and 250 ng RNA/ ⁇ of sterile saline) of the hESMVs selected as described above.
- One eye receives the hESMV injection, while the other serves as control and receive a PBS injection.
- retinal function is examined by ERG in the intraocularly- and subretinally- injected mice at 14 and 30 days post-hESMV injection, and the % of functional recovery is calculated from the peak amplitudes of the ERG b-waves in fiESMV-treated and untreated eyes.
- a subset of animals from each experimental group is sacrificed at the same time points, and their eyes fixed and processed for morphological studies using confocal and electron microscopy. Improvement of retinal morphology is correlated with ERG findings to determine the most effective delivery method and dose of hESMVs, which are used in subsequent studies.
- mice with NMDA-injured retinas To obtain statistically significant, reproducible therapeutic activity of GMP compatible hESMVs in mice with NMDA-injured retinas, the dose and delivery method found to be the most effective is used to treat the left eye with hESMVs and the right eye with PBS of mice from 3 cohorts, each with 15 animals. Scotopic and photopic ERG responses from the eyes of 8 untreated mice and from both eyes of each mouse from Cohort 1 are recorded 14 and 30 days after hESMV injection. Functional recovery and cellular rescue are quantified. In addition, mice from Cohorts 2 and 3 receive a second dose of hESMVs 5 days after the first injection, and Cohort 3 animals are given a third hESMV dose 5 days later. The ERGs from the eyes of the 30 mice from Cohorts 2 and 3 are also recorded at days 14 and 30 after the first hESMV injection. The results obtained enable the determination of whether repeated hESMV treatments are necessary to ensure a better outcome.
- bromodeoxyuridine (BrdU) is co-localized with retinal cell-specific markers. Left eyes from mice with NMDA-damaged retinas are injected with BrdU along with hESMVs as described above. The right eyes of the same mice are used as controls and receive BrdU diluted in PBS. At the appropriate time points, animals are perfused and their eyes enucleated, fixed, and processed for immunohistochemistry.
- Retinal sections are double- and triple-stained with antibodies to BrdU and retinal cell-specific markers (rhodopsin (rods), cone opsin (cones), Brn3a (ganglion cells), Syntaxin la and Gad67 (amacrine cells) and glutamine synthetase (Muller cells)) in order to determine which cell types are responding to hESMVs exposure by proliferating and repopulating the retina.
- rhodopsin rods
- cone opsin cone opsin
- Brn3a ganglion cells
- Syntaxin la and Gad67 amacrine cells
- glutamine synthetase Muller cells
- microenvironment is evaluated using histologic, proteomic and gene expression profiling.
- the two routes of administration, intravitreal and subretinal, are independently tested.
- Initial studies are performed on mouse intact eyes that had not been subjected to NMDA injury.
- the time course of testing from immune reactions is evaluated to investigate both early and late effects.
- Uveitis an influx of inflammatory cells, can occur early, within 24 hr of exposure to foreign proteins, or can take 2 to 3 weeks to develop.
- Both hESMV-injected and control eyes from a total of 5 to 10 animals per time point (1, 7, 14, and 21 days following injection) are histologically evaluated to ascertain the presence or absence of inflammatory cells and retinal integrity (Caspi et al. (2008) Ophthalmic Res. 40: 169-174; Caspi et al. (2010) J. Clin. Invest. 120:3073-3083).
- the fixation protocol maintains the ability to perform immunohistochemistry of the preserved tissue. If a cellular infiltrate is observed, the eyes are graded in a standard and masked manner, and
- CD3, CD20, and CD68 markers are used to confirm whether the cells are of T, B, or macrophage lineage.
- mice (experimental eyes, control fellow eye, and untreated eyes from animals that were not injected) are used for gene expression analysis on an Affymetrix GeneChip 2.0 ST array; gene expression software is used for evaluation of the results.
- Mouse cytokine analysis is performed on the protein extracts using a 26-plex Luminex array.
- the rdl mouse has a retinal degeneration caused by a defect in the Pde6b gene: a C > A mutation in codon 347 of exon 7.
- Loss of rod photoreceptors begins early in life in the rdl retina and progresses rapidly. Swelling of mitochondria in the inner segment of rods is seen at postnatal day 8 (P8), followed by disruption of the ordered stack of outer segment discs, which reach a very short maximal length (as compared with normal rods) by P12; photoreceptor nuclei begin to become pyknotic at P10.
- the wave of rod cell death in the next few days results in a rapid thinning of the retinal outer nuclear layer (ONL) that contains the nuclei of photoreceptors. Most rods have died by P21; only cones (3% of all photoreceptors) remain at this time in the retina and slowly die thereafter.
- ONL retinal outer nuclear layer
- hESMVs The therapeutic activity of hESMs in the rdl mouse is investigated using the delivery method and dose determined in the examples above.
- the effect of hESMV treatment is tested at different developmental times to determine whether the level of retinal damage influences the hESMV activation of Muller cells.
- hESMVs are injected at P5, P8, P12, P15, and P20, and retinal functional improvement is reflected by increases in the a- wave (photoreceptor response) amplitude of ERGs recorded 14 and 30 days post- ESMV injections.
- Results are corroborated by morphological examination of hESMV- treated and rdl untreated retinas, quantifying the width of the outer nuclear layers at the beginning, during and after degeneration (Danciger et al. (2000) Mammalian Genome 11 :422-427) and comparing these numbers with those of ONLs of same age normal mouse retinas to determine the % recovery; and by immunohistochemical identification of the restored cell types.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Developmental Biology & Embryology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Reproductive Health (AREA)
- Ophthalmology & Optometry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Gynecology & Obstetrics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Pain & Pain Management (AREA)
- Rheumatology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2870466A CA2870466A1 (en) | 2012-04-16 | 2013-03-13 | Ocular therapeutics using embryonic stem cell microvesicles |
| AU2013249786A AU2013249786A1 (en) | 2012-04-16 | 2013-03-13 | Ocular therapeutics using embryonic stem cell microvesicles |
| KR1020147031795A KR20150009541A (ko) | 2012-04-16 | 2013-03-13 | 배아 줄기 세포 미소낭포를 이용한 안구 치료법 |
| EP13778372.6A EP2838995A4 (en) | 2012-04-16 | 2013-03-13 | EYE THERAPEUTICS WITH MICROVESICLES FROM EMBRYONAL STEM CELLS |
| JP2015506995A JP2015514760A (ja) | 2012-04-16 | 2013-03-13 | 胚性幹細胞微小胞を用いる眼科治療法 |
| US14/394,688 US20150079047A1 (en) | 2012-04-16 | 2013-03-13 | Ocular therapeutics using embryonic stem cell microvesicles |
| IL235126A IL235126A0 (en) | 2012-04-16 | 2014-10-19 | Medical preparations for eye administration that use embryonic stem cell microvesicles |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261624701P | 2012-04-16 | 2012-04-16 | |
| US61/624,701 | 2012-04-16 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013158258A1 true WO2013158258A1 (en) | 2013-10-24 |
| WO2013158258A8 WO2013158258A8 (en) | 2014-09-04 |
Family
ID=49383920
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/030733 Ceased WO2013158258A1 (en) | 2012-04-16 | 2013-03-13 | Ocular therapeutics using embryonic system cell microvesicles |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20150079047A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2838995A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2015514760A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20150009541A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2013249786A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2870466A1 (cg-RX-API-DMAC7.html) |
| IL (1) | IL235126A0 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2013158258A1 (cg-RX-API-DMAC7.html) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2703480A4 (en) * | 2011-04-28 | 2015-03-25 | Postech Acad Ind Found | METHOD FOR THE PRODUCTION OF INDUCED PLURIPOTENTER STEM CELLS WITH MICROVESICLES FROM EMBRYONAL STEM CELLS |
| US20190216857A1 (en) * | 2016-09-09 | 2019-07-18 | Cornell University | Delivery of nucleic acids, proteins and small molecules in vitreous vesicular bodies |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11653636B2 (en) * | 2019-11-15 | 2023-05-23 | University Of Ulsan Foundation For Industry Cooperation | Method of making a rat model of retinal degeneration and rat model made thereby |
| JP7007770B1 (ja) * | 2021-06-21 | 2022-02-10 | パナジー株式会社 | 眼症状改善剤および眼症状の改善方法 |
| KR20230129828A (ko) | 2022-03-02 | 2023-09-11 | 포항공과대학교 산학협력단 | 안구 후방 질환 또는 손상의 예방 또는 치료용 조성물 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6573271B2 (en) * | 1995-02-01 | 2003-06-03 | John Hopkins University School Of Medicine | Method of preventing proliferation of retinal pigment epithelium by retinoic acid receptor agonists |
| WO2009087361A1 (en) * | 2008-01-04 | 2009-07-16 | Lydac Neuroscience Limited | Microvesicles |
| US20110223140A1 (en) * | 2009-10-06 | 2011-09-15 | Snu R&Db Foundation | Method for differentiation into retinal cells from stem cells |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2493122C (en) * | 2002-07-25 | 2012-11-27 | The Scripps Research Institute | Hematopoietic stem cells and methods of treatment of neovascular eye diseases therewith |
| AU2003280824A1 (en) * | 2002-11-15 | 2004-06-15 | Fumihiko Ishikawa | Method of organ regeneration |
| US20080317721A1 (en) * | 2005-02-24 | 2008-12-25 | The Scripps Research Institute | Method for the Treatment of Retinopathy of Prematurity and Related Retinopathic Diseases |
| KR20080031474A (ko) * | 2005-07-27 | 2008-04-08 | 유니버시티 오브 플로리다 리서치 파운데이션, 아이엔씨. | 안구 질환의 치료를 위한 열충격의 사용 |
| JP5649786B2 (ja) * | 2006-03-07 | 2015-01-07 | ギータ シュロフ | ヒト胚性幹細胞およびそれらの誘導体を含む組成物、使用方法、ならびに調製方法 |
| CN101854941B (zh) * | 2007-10-29 | 2013-03-27 | 弗雷森纽斯医疗护理德国有限责任公司 | 衍生自干细胞的微泡(MVs)用于制备用于受损或损伤组织或器官的内皮/上皮再生的药物的用途、以及相关体外和体内方法 |
| WO2012020308A2 (en) * | 2010-08-13 | 2012-02-16 | The University Court Of The University Of Glasgow | Cellular and molecular therapies |
| JP5872041B2 (ja) * | 2011-08-16 | 2016-03-01 | サムスン ライフ パブリック ウェルフェア ファンデーション | 幹細胞由来微小胞を含む神経生成促進用組成物 |
| EP2866816A4 (en) * | 2012-05-31 | 2016-03-16 | Caladrius Biosciences Inc | VERY SMALL HUMAN EMBRYONIC STEM CELLS FOR THE TREATMENT OF EYE DISEASES |
-
2013
- 2013-03-13 EP EP13778372.6A patent/EP2838995A4/en not_active Withdrawn
- 2013-03-13 CA CA2870466A patent/CA2870466A1/en not_active Abandoned
- 2013-03-13 WO PCT/US2013/030733 patent/WO2013158258A1/en not_active Ceased
- 2013-03-13 JP JP2015506995A patent/JP2015514760A/ja active Pending
- 2013-03-13 AU AU2013249786A patent/AU2013249786A1/en not_active Abandoned
- 2013-03-13 KR KR1020147031795A patent/KR20150009541A/ko not_active Withdrawn
- 2013-03-13 US US14/394,688 patent/US20150079047A1/en not_active Abandoned
-
2014
- 2014-10-19 IL IL235126A patent/IL235126A0/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6573271B2 (en) * | 1995-02-01 | 2003-06-03 | John Hopkins University School Of Medicine | Method of preventing proliferation of retinal pigment epithelium by retinoic acid receptor agonists |
| WO2009087361A1 (en) * | 2008-01-04 | 2009-07-16 | Lydac Neuroscience Limited | Microvesicles |
| US20110223140A1 (en) * | 2009-10-06 | 2011-09-15 | Snu R&Db Foundation | Method for differentiation into retinal cells from stem cells |
Non-Patent Citations (4)
| Title |
|---|
| KATSMAN: "Activation of the retina's regenerative potential by embryonic stem cell-derived microvesicles.", UC LOS ANGELES ELECTRONIC THESES AND DISSERTATIONS., 1 January 2012 (2012-01-01), XP055172912, Retrieved from the Internet <URL:http://escholarship.org/uc/item/4p67r7m7.> * |
| LEMP.: "Management of Dry Eye Disease.", AMERICAN JOUMAL OF MANAGED CARE, vol. 14, 14 April 2008 (2008-04-14), pages S88 - S101., XP008175239, Retrieved from the Internet <URL:http://www.ajmc.com/pdf-access/13355/1> * |
| See also references of EP2838995A4 * |
| YOKOYAMA ET AL.: "Microglia, a potential source of neurons, astrocytes, and oligodendrocytes.", GLIA, vol. 45, 1 January 2004 (2004-01-01), pages 96 - 104, XP055172918, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/14648550.> * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2703480A4 (en) * | 2011-04-28 | 2015-03-25 | Postech Acad Ind Found | METHOD FOR THE PRODUCTION OF INDUCED PLURIPOTENTER STEM CELLS WITH MICROVESICLES FROM EMBRYONAL STEM CELLS |
| US20190216857A1 (en) * | 2016-09-09 | 2019-07-18 | Cornell University | Delivery of nucleic acids, proteins and small molecules in vitreous vesicular bodies |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2838995A1 (en) | 2015-02-25 |
| EP2838995A4 (en) | 2016-01-06 |
| US20150079047A1 (en) | 2015-03-19 |
| KR20150009541A (ko) | 2015-01-26 |
| AU2013249786A1 (en) | 2014-11-06 |
| JP2015514760A (ja) | 2015-05-21 |
| IL235126A0 (en) | 2014-12-31 |
| CA2870466A1 (en) | 2013-10-24 |
| WO2013158258A8 (en) | 2014-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Katsman et al. | Embryonic stem cell-derived microvesicles induce gene expression changes in Müller cells of the retina | |
| Upadhya et al. | Extracellular vesicles from human iPSC-derived neural stem cells: miRNA and protein signatures, and anti-inflammatory and neurogenic properties | |
| CN104321062B (zh) | 干细胞微粒 | |
| Xin et al. | Exosome-mediated transfer of miR-133b from multipotent mesenchymal stromal cells to neural cells contributes to neurite outgrowth | |
| Sun et al. | Mutations in the transcriptional regulator MeCP2 severely impact key cellular and molecular signatures of human astrocytes during maturation | |
| US20150079047A1 (en) | Ocular therapeutics using embryonic stem cell microvesicles | |
| TR201903889T4 (tr) | Korneal endotelyal hücreler üreten yönlendirilmiş diferansiyasyona yönelik yöntem. | |
| CN105142646A (zh) | 产生微粒的方法 | |
| JP2015510401A (ja) | ヒト疾患のインビトロモデル化および細胞に基づく治療のための間葉系幹細胞ならびにそのバンク | |
| Goudriaan et al. | Novel cell separation method for molecular analysis of neuron-astrocyte co-cultures | |
| Lozano-Ureña et al. | IGF2 interacts with the imprinted gene Cdkn1c to promote terminal differentiation of neural stem cells | |
| Kang et al. | RETRACTED ARTICLE: Stem-like cells of various origins showed therapeutic effect to improve the recovery of spinal cord injury | |
| Hsi et al. | Extracellular vesicles as biomarkers for traumatic brain injury using a 3D in vitro human brain tissue model | |
| Ionescu et al. | Muscle-derived miR-126 regulates TDP-43 axonal local synthesis and NMJ integrity in ALS models | |
| JP2025111573A (ja) | 高増殖性細胞の製造方法、高増殖性細胞およびその用途 | |
| US20240254440A1 (en) | Methods to generate glial restricted neural progenitor cells and uses thereof | |
| CN119584975A (zh) | 治疗脑损伤的方法 | |
| KR20180117070A (ko) | 신규 줄기세포 치료제 | |
| Xu et al. | Reversing abnormal neural development by inhibiting OLIG2 in down syndrome human iPSC brain organoids and neuronal mouse chimeras | |
| Alkhazaali et al. | MicroRNAs (miRNAs) as Biomarkers for Diagnosis, Prognosis, or as Therapeutics Molecules in Neurodegenerative Diseases | |
| Rümmele | Exploring the regulation of human neural stem cells quiescence using a CRISPR/Cas9 approach | |
| WO2026078725A1 (en) | A method, a kit and the use of pluripotent stem cells induced using cell-free chromatin particle (cfchps) | |
| Affaneh | BMP Signaling-Induced Neuronal Pathology in Models of Tauopathy | |
| Hou et al. | and Hung-Chih Kuo | |
| Osorio Querejeta | Delivery of microRNAs as a remyelination strategy in multiple sclerosis. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13778372 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2870466 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015506995 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2013249786 Country of ref document: AU Date of ref document: 20130313 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20147031795 Country of ref document: KR Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013778372 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013778372 Country of ref document: EP |