WO2013157833A1 - 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 조성물 - Google Patents
베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 조성물 Download PDFInfo
- Publication number
- WO2013157833A1 WO2013157833A1 PCT/KR2013/003223 KR2013003223W WO2013157833A1 WO 2013157833 A1 WO2013157833 A1 WO 2013157833A1 KR 2013003223 W KR2013003223 W KR 2013003223W WO 2013157833 A1 WO2013157833 A1 WO 2013157833A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- obesity
- beta
- blocker
- composition
- osteopenia
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
- A61K31/138—Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/18—Sulfonamides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
- A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
- A61K31/404—Indoles, e.g. pindolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
Definitions
- the present invention is to prevent, improve or improve metabolic diseases and osteopenia caused by obesity, obesity
- the present invention relates to a therapeutic composition, and more particularly, to obesity and a disease-related prevention, improvement or treatment of the beta-adrenergic receptor antagonist (beta blocker) as an active ingredient.
- beta-adrenergic receptor antagonist beta blocker
- Adipose tissue is accepted as an important endocrine organ that regulates energy homeostasis by secreting various types of adipokine such as adiponectin and leptin.
- Obesity is an abnormal increase in the size and number of adipocytes due to abnormal control of metabolism, glucose metabolism and insulin signaling mechanisms. Therefore, in order to effectively treat metabolic diseases such as obesity and diabetes secondary to this, it should be based on a proper understanding of fat metabolism.
- metabolic diseases such as diabetes are known to be associated with a decrease in bone mineral density, which requires a holistic treatment strategy.
- 2002-0086749 relates to 'a novel combination of beta blockers and cholesterol lowering agents', wherein the mixed beta-blockers and cholesterol lowering agents of pharmaceutically acceptable adjuvants, diluents or carriers Disclosed are methods and uses of kits of pharmaceutical formulations or components, including formulations for the prevention and treatment of atherosclerosis, hypercholesterolemia and hyperlipoproteinemia.
- the Republic of Korea Patent Publication No. 2010-0087012 discloses the use of beta blockers that can be used for the manufacture of medicines for the treatment of hemangiomas, for example, infant hemangiomas, as relates to the use of beta blockers for the manufacture of medicines for the treatment of hemangiomas.
- the prevention and treatment of obesity using the beta-blocker and the possibility of treatment for metabolic diseases such as diabetes mellitus and osteopenia / osteoporosis secondary to obesity.
- the present application is a novel use of the beta-blocker, the beta-blocker
- the present invention provides a pharmaceutical composition for the prevention, treatment or improvement of metabolic diseases and osteopenia / osteoporosis including obesity (beta-blocker) as an active ingredient and accompanying diabetes.
- the present invention provides a pharmaceutical composition for the prevention, improvement or treatment of obesity, metabolic diseases due to obesity, osteopenia due to obesity, including a beta-blocking agent as an active ingredient.
- the beta-blocker comprises a non-selective beta-blocker.
- the beta-blocker comprises acebu (Acebutolol), alprenolol (alprenolol), athenol (Atenolol), betasolol (Betaxolol), bisoprolol, Bucindol (Bucindolol), and cateol.
- the beta-blocker is propranolol.
- the beta-blocker may be included in 0.001 to 50% by weight relative to the total weight of the composition.
- the beta-blocker is fat-specific 27 kDa, FSP27, diacylglycerol acyl transferase 1, DGATl, and DGAT. It regulates the expression of adipocyte specific proteins or genes encoding the same or leptin or its genes.
- the present invention provides a method of administering an effective amount of a beta-blocker to a subject in need of prevention, amelioration or treatment of obesity, metabolic disease caused by obesity or osteopenia caused by obesity. Provided are methods for preventing, ameliorating or treating osteopenia caused.
- the present disclosure relates to novel uses of beta-blockers and provides beta-blockers for use in the prevention, amelioration or treatment of obesity, metabolic diseases due to obesity or osteopenia due to obesity. ⁇ Effects of the Invention ⁇
- FIG. 1 shows the results of investigating changes in body weight according to the composition and dietary changes of the present invention
- Figure 2 is a result of examining the changes in body fat (A) and muscle mass (B) according to the composition and diet of the present invention
- Figure 3 is a result of examining the changes in body fat cells according to the composition and dietary changes of the present invention.
- 4 shows the results of the glucose tolerance test (KA) and the insulin tolerance test (B) according to the composition and dietary changes of the present invention.
- FIG. 5 is a result of examining the propensity of Esp gene expression (A, C) and blood osteocalcin concentration (B) in the mouse tibia and osteoblast cell line according to the composition and dietary changes of the present invention.
- Figure 6 is a result of examining the changes in bone marrow fat cells according to the composition and dietary changes of the present invention.
- Figure 7 is a result of examining the changes in bone mass and bone structure according to the composition and dietary changes of the present invention.
- 8 is a result of examining the bone density change and the ratio of bone surface area (Cancellous bone volume, BV / TV) according to the composition and diet of the present invention.
- 9 is a result of examining the differentiation ability of bone marrow stem cells into osteoblasts according to the composition and dietary changes of the present invention.
- 10 is a result of investigating the differentiation ability of bone marrow stem cells into adipocytes according to the composition and dietary changes of the present invention.
- 11 is a result of confirming the mRNA expression tendency of FSP27 (A), DGAT1 (B), and DGAT2 (C) gene according to the composition and dietary changes of the body fat cells.
- 12 is a result of confirming the tendency of leptin expression in the bone marrow (C, D) and the tendency of changes in the blood (A, B) laptin hormone concentration according to the composition and dietary changes of the present invention.
- the present inventors have linked sympathetic activity to the differentiation or metabolic response of body fat / myeloid fat cells by high calorie diet, and when inhibiting sympathetic activity, the differentiation of fat cells changed by high calorie diet, mechanism at the molecular level or It was confirmed that the metabolic reaction was substantially improved to the normal level, and completed the present invention.
- sympathetic activity is also associated with bone mineral density reduction and bone structure deterioration due to high calorie diet, and when sympathetic nerve activity is inhibited, bone density decrease due to high calorie diet and bone structure deterioration are alleviated. It was. In obese patients, there is a possibility that bone mass may decrease, despite an increase in mechanical loading into the skeleton due to increased weight.
- the present invention relates to a composition for preventing, ameliorating or treating obesity, metabolic diseases due to obesity, or osteopenia due to obesity, comprising a beta-blocking agent as an active ingredient.
- a "beta-blocker” is a compound that is bled with a beta-receptor blocker, a beta adrenergic receptor blocker, or the like, which interferes with the binding of a natural or artificial agent to a beta adrenergic receptor, such as beta-1, beta-2, Beta-3 blockers dung. It also includes non-selective beta-blockers or beta-1 selective beta blockers or beta 2-selective beta blockers. Furthermore, a combination of one or more beta blockers may be used. In one embodiment non-selective beta-blockers are used.
- the beta-blocker according to the present invention is represented by the following formula (1).
- R is C1-C20 alkyl, C3-C20 (C3-
- C20) cycloalkyl, a hetero-allyl having 6 to 20 (C6-C20) aryl, or C3 to 20CC3-C20) of, 3 ⁇ 4 to R 3 are each independently H, (C1- C20) alkyl or (C6 to each other -C20) aryl.
- Alkyl as described herein includes both straight chain or ground forms, and [cycloalkyl] includes not only single ring systems but also several ring hydrocarbons.
- [Aryl] described herein is an organic radical derived from an aromatic hydrocarbon by one hydrogen removal, and is a single or fused ring system containing 4 to 7, preferably 5 or 6 ring atoms, suitably for each ring.
- the compound of Formula 1 is characterized in that R is phenyl, naphthyl, or anthracene, and 3 ⁇ 4 to 3 ⁇ 4 are each independently H, or (C1-C20) alkyl.
- R is phenyl, naphthyl, or anthracene
- 3 ⁇ 4 to 3 ⁇ 4 are each independently H, or (C1-C20) alkyl.
- various known beta-blockers can be used as long as they produce the effect according to the present application.
- beta-blockers examples include acebu (Acebutolol), alprenolol (alprenolol), atenolol (Atenolol), betasolol (Betaxolol), bisovol (Bisoprolol), adrenaldol (Bucindolol), cartheol (Carteolol), Carvedilol, Celifol, Cel iprolol, Esmolol, Labetalol, Levobunolol, Medroxalol, Mepindolol, Methifranol (Metipranolol), Metopro (Metoprolol), Nadol (Nadolol), Navivo (Nebivolol), Oxprenolol, Penbutolol, Pindolol, Propranolol (Sotalol) ), Or timolol (Timolol) or a pharmaceutical
- the beta-blocker may internally have sympathomimetic activity, for example, acebutul is betasolol, carteol caroteol and labetatal.
- propranols or pharmaceutically acceptable salts thereof such as propranols of L- or D-type or mixtures thereof.
- L- or D-forms may be included in the range of about 0: 1 to 1: 0, for example 1: 1.
- pharmaceutical salts include propranol chlorhydrate.
- the beta-blockers herein include those salts, derivatives, analogs or isomers thereof, so long as the effect according to the present application is achieved.
- the composition comprising a beta-blocker according to the present invention is effective in preventing, ameliorating or treating metabolic diseases or metabolic syndrome or osteopenia / osteoporosis due to obesity, obesity.
- the composition according to the present invention can be used for obesity or obesity-derived osteopenia / osteoporosis may inhibit the beta receptor action during sympathetic activity due to diet to alleviate the differentiation of adipocytes, increased adipose tissue or decreased bone mass / bone density.
- the adipocytes are body fat cells and bone marrow fat cells.
- composition according to the present invention is a fat cell-specific protein comprising fat-specific protein of 27 kDa, FSP27, diacylglycerol acyl transferase (Diacylglycerol Acyl transferase 1, DGAT1) and DGAT 2 Or modulates the expression of a gene encoding the protein, or a laptin or a gene thereof.
- composition according to the present invention may in one embodiment, for example, a gene associated with adipocyte differentiation and adipocyte-specific genes that are increased by a high calorie diet, ie, genes associated with triglyceride synthesis or adipocyte size increase in adipocytes (eg, Fat-specific protein of 27 kDa (FSP27) diacylglycerol acyl transferase (Diacylglycerol Acyl transferase 1, DGAT1) and DGAT 2).
- adipocytes eg, Fat-specific protein of 27 kDa (FSP27) diacylglycerol acyl transferase (Diacylglycerol Acyl transferase 1, DGAT1) and DGAT 2.
- FSP27 Fat-specific protein of 27 kDa
- diacylglycerol acyl transferase Diacylglycerol Acyl transferase 1, DGAT1
- DGAT2
- the Asia-Pacific region used to diagnose obesity is the weight of one's own weight divided by the square of its height (meters). Less than 25 is defined as overweight (risk weight).
- Obesity is classified according to classification into endocrine obesity (due to endocrine abnormalities or from brain diseases), simple obesity (due to excessive nutrition); Proliferative obesity (obesity due to an increase in the number of fat cells), hypertrophic obesity (obesity due to an increase in the size of fat cells); Upper body obesity, lower body obesity; And visceral obesity, subcutaneous fat obesity, and the like, all of which are included in the scope of the present invention.
- Obesity can cause a variety of secondary diseases, for example metabolic diseases such as diabetes mellitus, hyperlipidemia or metabolic syndrome.
- Metabolic syndrome means that diseases such as type 2 diabetes, hyperlipidemia, obesity, nephropathy and hepatic disease occur simultaneously (Pershadsingh HA, Dual Peroxisome Prol iferator-Act ivated Receptor ⁇ alpha / gamma Agonists: In the Treatment of Type 2 Diabetes Mel li tus and the Metabol ic Syndrome. Treat Endocr inol. 2006; 5 (2): 89-99).
- osteoporosis or “osteoporosis” refers to a condition where bone density decreases and bone strength weakens due to qualitative and structural changes, which is likely to cause fractures. Aging, congenital, menopausal, thyroid function It is caused by a variety of causes, including hyperactivity, hyperparathyroidism, chronic renal failure, and corticosteroid administration, all of which are included herein.
- One embodiment includes osteoporosis or osteopenia due to obesity.
- osteopenia or osteoporosis derived from obesity has a characteristic of changing fat cell metabolism and differentiation and bone density / bone structure due to high calorie diet and sympathetic nerve activity, and fat cells are body fat cells and bone marrow fat cells. .
- prevention refers to administering the composition to a subject, particularly a human, to prevent the development of obesity, metabolic diseases due to obesity and / or osteopenia due to obesity, or to slow the onset as compared to when not administered. it means.
- improvement refers to the administration of the composition to a subject, particularly a human, to inhibit physiological changes or symptoms caused by the disease as compared to when obesity, metabolic diseases due to obesity and / or osteopenia due to obesity have not been administered. Firstly, it means to alleviate or alleviate.
- the term “treatment” refers to a physiological change or symptom caused by a disease as compared to when the present composition is administered to a subject, particularly a human, in which no metabolic disease due to obesity, obesity, and / or osteopenia due to obesity is administered. Means to remove it.
- subject or “subject” as used herein includes humans, non-human primates, and other mammals, metabolic diseases caused by obesity, obesity And / or subjects in need of prevention, improvement or treatment of osteopenia due to obesity.
- the beta-blocking agent is characterized in that it comprises 0.001 to 50% by weight relative to the total weight of the composition.
- the composition of the present invention having a prophylactic or improving effect on metabolic diseases and / or osteopenia / osteoporosis, including obesity and accompanying diabetes is a pharmaceutically or physiologically acceptable carrier, excipient in addition to the beta-blockers described above.
- the therapeutic agent herein may further contain at least one active ingredient exhibiting the same or similar function in addition to the aforementioned beta-blockers, or a compound which maintains / increases the solubility and / or absorption of the active ingredient.
- the therapeutic agents of the present application can be used alone or in combination with methods using surgery, drug treatment, and bioreactivity modulators.
- the therapeutic agent herein may be prepared by including one or more pharmaceutically acceptable carriers in addition to the above-mentioned active ingredients.
- Pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, textose solution, maltofulin solution, glycerol, ethanol, liposomes and one or more of these components.
- Antioxidants, complete fluids, bacteriostatic agents and other conventional additives can be added.
- composition of the present invention is oral form such as powder, granule, tablet, capsule, suspension, emulsion dog, syrup, aerosol, etc.
- Formulations can be used in the form of sterile injectable solutions, and the carriers, excipients and diluents that may be included in such compositions include lactose, textrose, sucrose, sorbbi, mannilet, xili, erythritol, malty. Mold, Starch, Acacia Rubber, Alginate, Gelatin, Calcium Phosphate, Calcium Silicate, Cellose, Methyl Salose, Microcrystalline Salose, Polyvinyl Pyridone, Water, Methylhydroxybenzoate, Propylhydroxybenzoate, Talc , Magnesium stearate and mineral drips.
- Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and such solid preparations comprising at least one excipient such as starch, calcium carbonate, sucrose, lactose, gelatin dung in the composition. Formulate. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
- Liquid preparations for oral use include suspensions, solvents, emulsions, and syrups. Water, liquid paraffin, which is a commonly used diluent, and various excipients such as wetting agents, sweeteners, and fragrance preservatives.
- Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
- Non-aqueous solvents and suspending agents may be used with propylene glycol, polyethylene glycol, vegetable oils such as eurib oil, and injectable esters such as ethyl oleate.
- Bases for injectables may include conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers and preservatives.
- the effective amount of the composition of the present invention may vary depending on the age, sex, and weight of the patient, but is generally in the amount of 5 to 100 mg, preferably 10 to 50 mg, more preferably 15 to 30 mg per kg body weight.
- the amount of can be administered daily or every other day, or divided into once to three times a day.
- the dosage of the composition may be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, and age. Therefore, the above dosage does not limit the scope of the present invention in any aspect.
- the present invention provides a method of administering an effective amount of a beta-blocker to a subject in need of prevention, amelioration or treatment of obesity, metabolic disease due to obesity or osteopenia due to obesity, metabolic disease due to obesity, obesity
- a beta-blocker used in the methods herein are as mentioned above.
- an effective amount may be determined in consideration of side effects compared to effects applied to conventional drug treatment in an amount sufficient to prevent, ameliorate, or treat obesity, metabolic diseases due to obesity, or osteopenia due to obesity.
- the total daily dose in accordance with the present disclosure may be determined within the scope of normal practice of a physician.
- Specific effective amounts include the type of disease, severity, type of specific active ingredient used, age, weight, general health, sex, diet of the patient, time of administration, route of administration, excretion of the specific active ingredient used, Other drugs and other factors well known in the art will vary.
- the initial dose is lower than the amount necessary to achieve the desired effect and can be increased gradually until the desired effect is achieved.
- the present disclosure also relates to beta-blockers, which are used for the prevention, amelioration or treatment of obesity, metabolic diseases due to obesity or osteopenia due to obesity, as mentioned above with respect to beta-blockers which may be used for this purpose. Reference may be made. The present invention will be described in more detail with reference to the following examples.
- mice According to Table 1 and Table 2, a total of 40 6-week-old C57BL / 6 mice (Orient, Seoul, Korea) were assigned to four groups of 10 animals each, and the mouse dietary intake and water belonging to each group as follows. Intake was measured daily for 12 weeks. Ten mice were used in each group, and each group was treated as follows: the control group (CON VEH) who consumed a normal diet, the DL-propranolol (( ⁇ ) -propranolol hydrochloride, Sigma who consumed a normal diet).
- CON VEH CON VEH
- DL-propranolol (( ⁇ ) -propranolol hydrochloride, Sigma who consumed a normal diet).
- the in vivo vivo body fat mass and body muscle mass of the mice in each experimental group tested for 12 weeks were measured using Dual-energy X-ray absorpt iometry (DEXA).
- DEXA Dual-energy X-ray absorpt iometry
- the body fat mass of the high-calorie diet group (HIGH VEH) mice fed the high calorie diet was consistently higher than that of the control group (CON VEH) mice fed the normal diet. I could confirm that.
- high-calorie diets but the mice with oral administration of DL-propranolol (HIGH BB) showed a significant decrease in body fat gain.
- insulin resistance test also showed that insulin-resistant mice (CON VEH, CON BB) and high-calorie diets were fed with high-calorie diet, but mice treated with DL-propranol (HIGH BB) Although not significantly different, high calorie diets (HIGH VEH) were found to increase significantly.
- HIGH VEH high calorie diets
- beta-blockers may not only alleviate weight and body fat gain due to a high calorie diet, but also alleviate glucose metabolism disorder (or diabetes) caused by a high calorie diet.
- the following experiments were performed to investigate the role of the neuronal mediation for insulin secretion control through bone.
- the activity of the sympathetic nervous system in osteoblasts also affects the ⁇ -cells in the pancreas, which regulates insulin secretion and blood glucose, resulting in overall bone metabolism and energy metabolism. It can be an axis of interlocking regulation and secrete factors that promote insulin secretion of ⁇ cells from osteoblasts.
- osteoblasts are not only responsible for bone formation and mineralization, but also as endocrine cells that secrete molecules that act on the pancreas and ⁇ cells.
- the following experiments were performed on the basis that osteocalcin) significantly lowered the incidence of obesity and diabetes in a group of mice fed high fat diet and decreased blood osteocalcin levels in adult males with metabolic syndrome.
- Esp encodes receptor-like protein tyrosine phosphatase, a gene that is thought to regulate osteoblast-specific expression in the body's energy metabolism.
- RA was extracted from the tibia bone of each group to investigate the role of skeletal-mediated sympathetic nervous system activity / suppression in mitigating body fat / weight gain observed in high calorie-digested beta-blockers. After synthesizing cDNA, quantitative expression of Esp gene in real time
- Esp expression was inhibited by beta-blockers, especially in mice fed a high calorie diet.
- the serum levels of the undercarboxylated Osteocalcin concentration in each group of mice showed a decrease in the levels of osteocalcin in the blood of the high calorie diet mice compared to the normal diet group, as shown in FIG. 5B.
- blood osteocalcin concentration was increased compared to the group not receiving beta-blocker.
- MC3T3E1 cell line a major model cell line for osteoblast differentiation and sympathetic signal transduction, was treated with osteoblast differentiation medium (10% bovine serum (BioWhittaker; USA), 10 mM ⁇ -glycerophosphate (Sigma-Aldr ich), 50 g / mL ascorbic) for 7 days.
- femurs were removed from each group of mice to make tissue sections, and the number and size of bone marrow fat cells were observed by H & E staining.
- femurs were extracted from each mouse, and micro CT (Skyscan 1172, Micro Photonic; Antwerpen, Belgium) was performed to measure bone density, bone mass, and bone structure according to the manufacturer's method.
- the femurs were photographed under conditions of 70 kV, 141 ⁇ , image pick-alk size 7 ⁇ and hydroxyapatite were photographed under the same conditions.
- the femur was reconstructed to 644 x 644 pixels and the spine to 900 x 900 pixels.
- the CTan program was used for two-dimensional analysis of cortical bones.
- mice in the high-calorie diet who received oral DL-propranolol alleviated the decrease in cancellous vBMD and were statistically compared with the control group (CON VEH) who consumed normal diet. It was confirmed that the bone density was not different. From the above results, it was confirmed that the high calorie diet caused the decrease of bone mass and bone density and the deterioration of bone structure, and the decrease of bone mass and bone density and the deterioration of bone structure were alleviated by beta blockers when the bone mass and bone density decreased due to the diet.
- beta blockers when the bone mass and bone density decreased due to the diet.
- bone marrow cells harvested from each group of mice were incubated in the same osteoblast differentiation medium as described above at 37 ° C and 5% C0 2 , followed by Alizarin Red staining and Alkaline phosphatase staining (Sigma-Aldr ich). ) was performed according to the manufacturer's method to investigate whether there is a change in the differentiation ability of bone marrow stem cells due to diet and sympathetic activity (suppression).
- the bone marrow cells extracted from each group of mice were treated with adipocyte differentiation medium (10% bovine serum, 1 mM dexamethasone (Sigma-Aldr ich), 200 mM indomethacin (Sigma ⁇ Aldrich), 10 mg / ml insulin ( Sigma ⁇ Aldr ich), Dulbecco's Modified Eagle Mediura_Hyclone) containing 0.5mM methyl isobutylxanthine (Sigma-Aldr ich)) were incubated under 3 ⁇ C, 5% C0 2 conditions, and then stained with Oil Red 0 (Sigma-Aldr ich). Was performed according to the manufacturer's method to investigate whether there is a change in the differentiation ability of bone marrow cells by diet and sympathetic activity (suppression).
- adipocyte differentiation medium (10% bovine serum, 1 mM dexamethasone (Sigma-Aldr ich), 200 mM indomethacin (Sigma
- bone marrow cells collected from mice treated with DL-propranolol alleviated the increased differentiation into fat cells due to high calorie diet.
- the high calorie diet increased the differentiation ability of bone marrow cells into adipocytes, and it was confirmed that the adipocyte differentiation ability increased by the high calorie diet was alleviated by beta blockers.
- mice were regenerated, body fat was collected from their epididymal adipose tissue, total RNA was extracted, and real-time quantitative PCR was performed. Primers used in PCR and corresponding annealing temperatures are listed in Table 3. PCR conditions are as described above. As a result, as shown in Figure 11, all the body fat cells of the experimental group (HIGH VEH) mice fed a high-calorie diet expressed higher levels of FSP27, DGATl, DGAT2 mRNA than the control group (CON VEH) fed a normal diet.
- HIGH VEH mice fed a high-calorie diet expressed higher levels of FSP27, DGATl, DGAT2 mRNA than the control group (CON VEH) fed a normal diet.
- the increase of FSP27, DGATl, and DGAT2 expression was alleviated by the administration of DL-propranolol. From the above results, it was confirmed that the expression of the representative lipid gene synthesis related genes were all increased in the high calorie diet, and this increase was alleviated by the beta blocker. In conclusion, the above results indicate that there is a mechanism by which beta-blockers act to alleviate the increase in the expression of genes related to lipid biosynthesis in the phenomenon that the increase in weight and body fat by the high calorie diet is alleviated by the beta blocker.
- mice were regenerated and RNA was extracted from the femur bone marrow of each group of mice to perform real-time quantitative PCR for leptin.
- the primers used for PCR in PCR and the corresponding annealing temperatures are shown in Table 3. PCR conditions are as described above.
- mice were regenerated, and femoral bones of each group of mice were removed and demineralized, and then a rabbit rabbit polyclonal anti-leptin antibody (Ob (A20): sc-842, Santa Cruz Biotech, USA) was used.
Abstract
본원은 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료용 조성물을 개시한다. 본원에 따른 조성물은 비만의 예방, 치료를 통해 비만으로 인해 이차적으로 야기되는 당뇨를 포함한 대사질환과 골감소증/골다공증을 동시에 예방, 개선 또는 치료할 수 있다.
Description
【명세서】
【발명의 명칭】 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 조성물 【기술분야】 본 발명은 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 조성물에 관한 것으로 , 보다 상세하게는 베타 -아드레날린 수용체 길항제 (beta blocker)를 유효성분으로 하는 비만 및 이로 인한 질환관련 예방, 개선 또는 치료와 관련된 것이다 . 【배 경 기술】 서구화된 식 이와 운동부족으로 인한 과체중, 비만 및 이로 인한 각종 대사질환은 현대인의 건강을 위협하는 가장 큰 요인 중 하나이다. 비만은 고혈압, 고지혈증, 심장 질환, 2 형 당뇨 등 여 러 가지 성 인병의 유병율 증가와 직접 적 인 관련이 있다고 알려져 있다. 지방조직은 아디포넥틴 (adiponect in) , 렙틴 ( lept in) 등 여러 종류의 아디포카인 (adipokine)들을 분비하여 에너지의 항상성을 조절하는 중요한 내분비 기관으로 받아들여지고 있는데, 이러한 아디포카인의 조절 이상, 지질대사, 당대사 및 인슐린 신호 기 전의 조절 이상으로 인해 지방세포의 크기와 수가 비정상적으로 증가하는 것이 비만의 특징 이다. 따라서 비만과 이에 의해 이차적으로 수반되는 당뇨 등의 대사질환을 효율적으로 치료하기 위해서는 지방대사에 대한 올바른 이해를 근거로 한 것이어야 한다. 또한 당뇨 등의 대사질환은 골밀도 감소와도 관련이 있는 것으로 알려져 있으므로 이에 대한 총체적 인 치료전략이 필요하다 . 대한민국 공개특허 제 2002-0086749 호는 '베타 차단제 및 콜레스테를 저하제의 신규한 조합물' 에 관한 것으로 약학적 허용 가능한 아주번트, 희석 제 또는 담체의 흔합된 베타-차단제 및 콜레스테를 저하제를
포함하는 약학적 제제 또는 부품의 키트, 아테롬성동맥 경화증, 과콜레스테를혈증 및 과지단백질혈증의 예방 및 치료용의 제제의 치료 방법 및 용도를 개시한다 . 또한, 대한민국 공개특허 제 2010-0087012 호는 '혈관종 치료용 의약품 제조용 베타 차단제의 용도' 에 관한 것으로 혈관종, 예를 들어 영유아 혈관종 치료용 의약품 제조용으로 사용될 수 있는 베타 차단제의 용도를 개시한다 . 그러나 상기 베타-차단제를 이용한 비만의 예방 및 치료, 또 비만에 의해 이차적으로 수반되는 당뇨 등의 대사질환과 골감소증 /골다공증에 대한 치료 가능성에 대해서는 개시된 바 없다.
【발명의 상세한설명】
【기술적 과제】
본원은 베타-차단제 (beta-blocker)의 신규한 용도로서, 베타-차단제
(beta-blocker)를 유효성분으로 포함하는 비만 및 이에 수반되는 당뇨를 포함한 대사질환과 골감소증 /골다공증의 예방, 치료 또는 개선용 약학 조성물을 제공하는 것이다. 【과제의 해결 수단】 한 양태에서 본원은 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료용 약학 조성물을 제공한다. 일 구현예에서 상기 베타-차단제는 비선택적 베타-차단제를 포함한다. 다른 구현예에세 상기 베타-차단제는 아세부를를 (Acebutolol), 알프레놀를 (alprenolol ), 아테놀를 (Atenolol ) , 베타솔올 (Betaxolol), 비소프를롤 (Bisoprolol ), 부신돌를 (Bucindolol ), 카르테올를 (Carteolol,), 카르베딜를 (Carvedi lol ), 샐리프를를 (Celiprolol), 에스몰롤 (Esmolol ), 라베탈를 (Labetalol) , 레보분놀를 (Levobunolol), 메드록살롤 (MedroxaloO, 메핀돌를 (Mepindolol ), 메티프란놀를 (Metipranolol), 메토프를를 (Metoprolol ), 나돌를 (Nadolol ),
네비볼를 (Nebivolol ) , 옥스프렌놀를 (Oxprenolol ), 펜부틀를 (Penbutolol ), 핀돌를 (Pindolol ) , 프로프라놀를 (Propranolol ) 소탈를 (Sotalol ) , 또는 티몰를 (Timolol )로 구성되는 군으로부터 선택되나, 이로 제한하는 것은 아니다. 또다른 구현예에서, 상기 베타-차단제는 프로프라놀를이다. 본원에 따른 일 구현예에서, 상기 베타-차단제는 조성물 총 중량에 대해 0.001 내지 50 중량 %로 포함될 수 있다. 본원에 따른 다른 구현예에서, 상기 베타-차단제는 지방-특이 적 27 kDa 단백질 (Fat-speci f ic protein of 27 kDa, FSP27) , 디아실글리세롤 아실트랜스퍼라제 (Diacylglycerol Acyl transferase 1 , DGATl) 및 DGAT 2 를 포함하는 지방세포 특이적 단백질 또는 이를 코딩하는 유전자의 발현 또는 렙틴 또는 그 유전자의 발현을 조절한다 . 다른 양태에서 본원은 베타-차단제의 유효량을 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료가 필요한 대상체에게 투여하는 단계를 포함하는, 비만, 비만으로 인한 대사성 잘환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료 방법을 제공한다. 또다른 양태에서 본원은 베타-차단제의 신규한 용도에 관한 것으로, 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료에 사용되는 베타-차단제를 제공한다 . 【발명의 효과】
본 발명에 따른 조성물은 비만의 예방, 치료를 통해 비만으로 인해 이차적으로 야기되는 당뇨를 포함한 대사질환과 골감소증 /골다공증을 동시에 예방, 개선 또는 치료할 수 있다 . 【도면의 간단한 설명】 도 1 은 본 발명의 조성물과 식 이 변화에 따른 체중 변화를 조사한 결과이고 ;
도 2 는 본 발명의 조성물과 식이 변화에 따른 체지방 (A) 및 근육량 (B) 변화를 조사한 결과이다. 도 3 은 본 발명의 조성물과 식이 변화에 따른 체지방 세포 변화를 조사한 결과이다. 도 4 는 발명의 조성물과 식이 변화에 따른 당 부하 검사 (Glucose tolerance testKA)와 인슐린 내성 검사 (insulin tolerance test) (B)결과이다. 도 5 는 본 발명의 조성물과 식이 변화에 따른 마우스 정강이뼈와 조골세포주에서의 Esp 유전자 발현 (A, C)과 혈중 오스테오칼신 농도 (B) 경향을조사한 결과이다. 도 6 은 본 발명의 조성물과 식이 변화에 따른 골수지방 세포 변화를 조사한 결과이다. 도 7 은 본 발명의 조성물과 식이 변화에 따른 골량 및 골구조 변화를조사한 결과이다. 도 8 은 본 발명의 조성물과 식이 변화에 따른 골 밀도 변화와 골부피에 대한 골표면적의 비율 (Cancellous bone volume, BV/TV)올 조사한 결과이다. 도 9 는 본 발명의 조성물과 식이 변화에 따른 골수 줄기세포의 조골세포로의 분화능을 조사한 결과이다. 도 10 은 본 발명의 조성물과 식이 변화에 따른 골수 줄기세포의 지방세포로의 분화능을 조사한 결과이다. 도 11 은 체지방 세포에서 본 발명의 조성물과 식이 변화에 따른 FSP27 (A), DGAT1 (B), 및 DGAT2 (C) 유전자의 mRNA 발현 경향을 확인한 결과이다.
도 12 는 본 발명의 조성물과 식이 변화에 따른 혈중 (A, B) 랩틴 호르몬 농도 변화 경향과 골수 (C, D) 에서 렙틴 발현 경향올 확인한 결과이다.
【발명의 실시를 위한 형태】
본 발명자들은 고열량 식이에 의한 체지방 /골수지방 세포의 분화 또는 대사 반응에 교감 신경 활성이 연관되어 있으며, 이 때 교감 신경 활성을 억제하면 고열량 식이에 의해 변화된 지방세포의 분화, 분자수준에서의 기전 또는 대사 반웅이 상당부분 정상 수준으로 호전됨을 확인하고, 본 발명을 완성하였다. 또한 고열량 식이에 의한 골밀도 감소, 골 구조 악화 현상에도 교감 신경 활성이 연관되어 있으며, 이 때 교감 신경 활성을 억제하면 고열량 식이에 의한 골밀도 감소, 골구조 악화 현상 둥이 완화됨을 확인하고, 본 발명을 완성하였다. 비만환자에서, 체증 증가로 인한 골격으로의 기계적 자극 (mechanical loading)이 증가함에도 불구하고 오히려 골량이 감소할 수 있다는 가능성이 있다. 하지만 교감 신경계 활성 /억제가 1) 지방 세포 대사에 미치는 영향과 2) 줄기세포의 분화방향에 미치는 영향, 특히 지방세포로의 분화를 촉진 /억제시키는지에 대한 여부는 밝혀진 바 없다. 또한 3) 고열량 식이 /비만으로 유발된 골상실에도 교감 신경 활성 억제제가 효능을 발휘할수 있을지에 대해서도 연구된 바 없다. 따라서 한 양태에서 본원은 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료용조성물에 관한 것이다. 본원에서 "베타-차단제" 는 베타-수용체 차단제, 베타 아드레날린성 수용체 차단제 등으로 블리는 화합물로서, 천연 또는 인위적 작용제가 베타 아드레날린성 수용체에 결합하는 것을 방해하는 것으로, 베타 -1, 베타 -2,
베타 -3 차단제 둥을 포함한다. 본원에는 또한 비선택성 베타-차단제 또는 베타 -1 선택성 베타 차단제 또는 베타 2-선택성 베타 차단제를 포함한다. 나아가 하나 이상의 베타 차단제의 조합이 사용될 수 있다. 일 구현예에서는 비선택적 베타-차단제가사용된다. 본원에 따른 베타-차단제는 하기 화학식 1로 표시된다.
[화학식 1]
C20)의 시클로알킬, 탄소수 6 내지 20 (C6-C20)아릴, 또는 탄소수 3 내지 20CC3-C20)의 헤테로알릴이며, ¾ 내지 R3은 서로 독립적으로 각각 H, (C1- C20)알킬 또는 (C6-C20)아릴이다. 본원에 기재된 [알킬]은 직쇄 또는 분쇄 형태를 모두 포함하고, [시클로알킬]은 단일 고리계 뿐 아니라 여러 고리계 탄화수소도 포함한다. 본원에 기재된 [아릴]은 하나의 수소 제거에 의해서 방향족 탄화수소로부터 유도된 유기 라디칼로, 각 고리에 적절하게는 4 내지 7 개, 바람직하게는 5 또는 6 개의 고리원자를 포함하는 단일 또는 융합고리계를 포함하며, 다수개의 아릴이 단일결합으로 연결되어 있는 형태까지 포함한다. 일 구현예에서 상기 화학식 1 의 화합물은 R 이 페닐, 나프틸, 또는 안트라센이며, ¾ 내지 ¾ 은 서로 독립적으로 각 각 H, 또는 (C1-C20) 알킬인 것을 특징으로 한다.
나아가 본원에 따른 효과를 나타내는 한 공지된 다양한 베타- 차단제가 사용될 수 있다. 베타-차단제의 예로는 아세부를를 (Acebutolol), 알프레놀를 (alprenolol), 아테놀롤 (Atenolol ), 베타솔올 (Betaxolol), 비소프를를 (Bisoprolol), 부신돌를 (Bucindolol ), 카르테올를 (Carteolol,), 카르베딜를 (Carvedilol), 셀리프를를 (Cel iprolol) , 에스몰롤 (Esmolol ), 라베탈를 (Labetalol), 레보분놀를 (Levobunolol ), 메드록살를 (Medroxalol), 메핀돌롤 (Mepindolol), 메티프란놀를 (Metipranolol), 메토프를를 (Metoprolol), 나돌를 (Nadolol ), 네비볼를 (Nebivolol), 옥스프렌놀를 (Oxprenolol), 펜부를를 (Penbutolol ) , 핀돌롤 (Pindolol ) , 프로프란놀를 (Propranolol) 소탈를 (Sotalol ) , 또는 티몰를 (Timolol) 또는 그 약학적으로 허용가능한 염을 들 수 있으나 이로 제한하는 것은 아니다. 또한 베타-차단제는 내제적으로 교감신경홍분활성 (sympathomimetic activity)을 가질 수 있으며, 예를 들면 아세부틀를 베타솔올, 카르테올를 카르테올를 라베탈를을 들 수 있다. 일 구현예에서는 프로프라놀를 또는 그 약학적으로 허용가능한 염, 예를 들면 L-또는 D- 형의 프로프라놀를 또는 그 혼합물을 포함한다. L- 또는 D- 형태는 약 0:1 내지 1:0, 예를 들면 1:1 의 범위로 포함될 수 있다. 약학적 염의 예로는 프로프란놀를 클로르하이드레이트를포함한다. 본원에서 베타 -차단제는, 본원에 따른 효과를 달성하는 한, 그 염, 그 유도체, 그유사체 또는 이성질체를 포함하는 것이다. 본원에 따른 베타—차단제를 포함하는 조성물은 비만, 비만으로 인한 대사성 질환 또는 대사증후군 또는 골감소증 /골다공증의 예방, 개선 또는 치료에 효과가 있다. 본원에 따른 조성물은 비만 또는 비만 유래의 골감소증 /골다공증은 식이에 기인한 교감 신경 활성 중 베타 수용체 작용을 억제하여 지방세포의 분화, 지방조직 증가 또는 골량 /골밀도 감소를 완화할 수 있다. 본원에 따른 일 구현예에서 지방세포는 체지방 세포 및 골수지방 세포이다.
본원에 따른 조성물은 지방—특이적 27 kDa 단백질 (Fat— specific protein of 27 kDa, FSP27) , 디아실글리세를 아실트랜스퍼라제 (Diacylglycerol Acyl transferase 1, DGAT1) 및 DGAT 2 를 포함하는 지방세포 특이적 단백질 또는 상기 단백질을 코딩하는 유전자, 또는 랩틴 또는 그 유전자의 발현을 조절한다. 특히 본원에 따른 조성물은 일 구현예에서, 예를 들면 고열량 식이에 의해 증가하는 지방세포 분화와 지방 세포 특이 유전자, 즉 지방 세포 내 트리글리세이드 합성 이나 지방 세포 크기 증가와 관련된 유전자들 (예를 들어, 지방-특이적 27 kDa 단백질 (Fat-specific protein of 27 kDa, FSP27) 디아실글리세롤 아실트랜스퍼라제 (Diacylglycerol Acyl transferase 1, DGAT1) 및 DGAT 2)의 발현을 억제한다. 본원에서 사용된 용어 "비만"은 에너지 불균형에 의하여 체내에 축적된 지방이 정상수치보다 높은 과다한 체지방을 가진 상태 (condition) 또는 질환 (disease)을 의미한다. 세계보건기구 WHO 에 의하면 아시아태평양 지역의 경우, 비만의 진단에 이용되는 것은 키 (meter 단위)의 제곱으로 자신의 체중을 나눈 값이 되며, 이 값이 25.0 이상인 경우는 비만이라고 정의하고, 23 이상 25 미만은 과체중 (위험체중)으로 정의하고 있다. 비만은 분류에 따라 내분비성 비만 (내분비 이상 또는 뇌질환으로부터 기인), 단순성 비만 (과다한 영양 섭취로부터 기인); 증식성 비만 (지방세포수의 증가로 인한 비만), 비대형비만 (지방세포의 크기 증대로 인한 비만); 상반신 비만, 하반신비만; 및 내장형 비만, 피하지방형 비만 등으로 나눌 수 있으며, 이들 모두 본 발명의 범위에 포함된다. 비만으로 인해 다양한 2 차성 질환이 유발될 수 있으며, 예를 들면 제 2 당뇨병, 고지혈증과 같은 대사성 질환 또는 대사증후군이 유발될 수 있다. 대사증후군이란, 제 2 형 당뇨병, 고지혈증, 비만, 신병증, 간병증과 같은 질환이 동시에 발생하는 것을 의미한다 (Pershadsingh HA, Dual Peroxisome Prol iferator-Act ivated Receptorᅳ alpha/gamma Agonists : In
the Treatment of Type 2 Diabetes Mel l i tus and the Metabol ic Syndrome. Treat Endocr inol . 2006 ; 5(2) :89-99) . 본원에서 사용된 용어 "골다공증" 또는 "골감소증" 이 란 뼈의 밀도가 감소하고 질적, 구조적 인 변화로 인해 뼈의 강도가 약해져서 골절이 일어날 가능성 이 높은 상태를 말한다, 노화, 선천성, 폐경기, 갑상선 기능항진, 부갑상선 기능항진, 만성신부전, 부신피질 호르몬투여 둥올 포함하는 다양한 원인에 의해 발생하며 , 이 모든 원인에 의한 증상이 본원에 포함된다. 한 구현예에 비만으로 인한 골다공증 또는 골감소증이 포함된다. 본원에서 비만 유래의 골감소증 또는 골다공증은 고열량 식이와 이로 인한 교감신경의 활성으로 지방세포 대사와 분화 그리고 골밀도 /골구조가 변화되는 특성을 가지며, 지방세포는 체지방 세포 및 골수지방 세포인 것을 특징으로 한다. 본원에 사용된 용어 "예방" 은 본원 조성물을 대상체 , 특히 인간에 투여하여 비만, 비만으로 인한 대사질환 및 /또는 비만으로 인한 골감소증이 발병되지 않도록 하거나, 투여되지 않은 경우와 비교하여 발병을 늦추는 것을 의미한다. 본원에 사용된 용어 "개선" 은 본원 조성물을 대상체, 특히 인간에 투여하여 비만, 비만으로 인한 대사질환 및 /또는 비만으로 인한 골감소증이 투여되지 않은 경우와 비교하여 질병으로 인한 생리적 변화 또는 증상을 억 제, 경감 또는 완화하는 것을 의미한다. 본원에 사용된 용어 "치료 " 는 본원 조성물을 대상체, 특히 인간에 투여하여 비 만, 비만으로 인한 대사질환 및 /또는 비만으로 인한 골감소증이 투여되지 않은 경우와 비교하여 질병으로 인한 생리 적 변화 또는 증상을 제거하는 것을 의미한다. 본원에서 사용된 용어 "대상체 " 또는 "대상자" 는 인간, 비인간 영장류 , 기타 포유류를 포함하는 것으로, 비만 , 비만으로 인한 대사질환
및 /또는 비만으로 인한 골감소증의 예방, 개선 또는 치료가 필요한 대상자를 의미한다 . 본 발명에 있어서, 베타-차단제는 조성물 총 중량에 대해 0.001 내지 50 중량 %로 포함되는 것을 특징으로 한다 . 상기한 바와 같이 비만 및 이에 수반되는 당뇨를 포함한 대사성 질환 및 /또는 골감소증 /골다공증에 예방 또는 개선 효과를 갖는 본 발명의 조성물은 상기한 베타-차단제 이외에 약학 또는 생리학적으로 허용되는 적 절한 담체, 부형제, 회석제 등을 추가로 포함할 수 있다. 본원의 치료제는 상기 언급한 베타-차단제 이외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1 종 이상 또는 유효성분의 용해성 및 /또는 흡수성을 유지 /증가시키는 화합물을 추가로 함유할 수 있다. 또한 본원의 치료제는 단독으로 , 또는 수술, 약물치료 및 생물학적반옹조절제를 사용하는 방법들과 병용하여 사용할 수 있다. 본원의 치료제는 상기 언급한 유효성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1 종 이상 포함하여 제조할 수 있다 . 약제학적으로 허용 가능한 담체는 식 염수 , 멸균수, 링거 액, 완충 식염수, 텍스트로즈 용액, 말토텍스트린 용액 , 글리세를, 에탄올, 리포좀 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제 , 완층액, 정균제 둥 다른 통상의 첨가제를 첨가할 수 있다 . 또한 회석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액 , 유탁액 등과 같은 주사용 제형, 환약 , 캡슐, 과립 또는 정제로 제제화할 수 있으며, 표적 기관에 특이적으로 작용할 수 있도록 표적 기관 특이적 항체 또는 기타 리간드를 상기 담체와 결합시켜 사용할 수 있다. 더 나아가 당해 기술분야의 적정한 방법으로 또는 레밍턴의 문헌 (Remington ' s Pharmaceut ical Science (최근판) : Mack Publ ishing Company, East on PA)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제형화할 수 있다. 본 발명의 조성물은 각각의 사용 목적에 맞게 , 통상의 방법에 따라 산제, 과립제, 정제 , 캡슐제, 현탁액, 에멀견, 시 럽, 에어로졸 등의 경구형
제형, 멸균 주사용액의 형태로 제형화하여 사용될 수 있으며, 이러한 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 텍스트로즈, 수크로스, 솔비를, 만니틀, 자일리를, 에리스리틀, 말티틀, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀를로즈, 메틸 샐를로즈, 미정질 샐를로스, 폴리비닐 피를리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 둥을 들수 있다. 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 둥이 포함되며, 이러한 고형 제제는 상기 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 둥을 섞어 제형화 한다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크와 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 둥이 해당되는데 흔히 사용되는 단순 희석제인 물, 액체 파라핀 이외에 여러 가지 부형제 , 예를 들면 습윤제 , 감미제 , 방향제 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 을리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 둥이 사용될 수 있다 . 주사제의 기제로는 용해제, 등장화제, 현탁화제, 유화제 , 안정화제 및 방부제와 같은 종래의 첨가제를 포함할수 있다. 본 발명의 조성물의 유효량은 환자의 나이, 성별, 체증에 따라 달라질 수 있으나, 일반적으로 체증 kg 당 5 내지 100 mg 의 양, 바람직하게는 10 내지 50 mg 의 양, 보다 바람직하게는 15 내지 30 mg 의 양을 매일 또는 격일 투여하거나 1 일 1 회 내지 3 회로 나누어 투여할 수 있다. 또한 조성물의 투여량은 투여 경로, 질병의 정도, 성별, 체중, 연령 둥에 따라서 증감 될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
다른 양태에서 본원은 베타-차단제의 유효량을 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료가 필요한 대상체에게 투여하는 단계를 포함하는, 비만 , 비 만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료 방법을 제공한다. 본원의 방법에 사용되는 베타-차단제의 종류는 앞서 언급한 바와 같다. 본원에서 유효량이 란 비만 , 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료에 층분한 양으로 통상 약물치료에 적용되는 효과 대비 부작용을 고려하여 결정할 수 있을 것이다 . 본원에 따른 하루 총 투여량은 의사의 통상적 인 진료의 범위내에서 결정될 수 있을 것이다. 구체적 유효량은 질환의 종류, 중증도, 사용되는 구체적 유효성분의 종류, 나이, 체중 , 일반적 건강상태, 성별, 환자의 식 이, 투여시 간, 투여 경로, 사용되는 구체적 유효성분의 배설를, 함께 사용되는 기타 약물 및 기타 당업 계에서 잘 알려진 다양한 인자에 의해 달라질 것아다. 예를 들면 최초 투여량은 목적하는 효과를 달성하는데 필요한 양보다 낮으며, 원하는 효과가 나타날 때까지 점진적으로 증가시킬 수 있다. 다른 양태에서 본원은 또한 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료에 사용되는 베타-차단제에 관한 것으로 , 이 러한 용도로 사용될 수 있는 베타-차단제와 관련되서는 앞서 언급한 것을 참조할 수 있다. 본 발명을 하기 실시 예에 의하여 더욱 구체적으로 설명한다. 그러나, 하기 실시 예는 본 발명의 이해를 돕기 위한 것일 뿐, 어떤 의미로든 본 발명의 범위가 이 러한 실시 예에 의하여 한정되는 것은 아니다 . 이때, 사용되는 기술 용어 및 과학 용어에 있어서 다른 정의가 없다면, 이 발명 이 속하는 기술 분야에서 통상의 지식을 가진 자가 통상적으로 이해하고 있는 의미를 가지며, 하기의 설명 및 첨부 도면에서 본 발명의 요지를 불필요하게 흐릴 수 있는 공지 기능 및 구성에 대한 설명은 생략한다.
[실시예]
[실시예 1] 교감 신경 활성 차단 (베타-차단제)이 비만 진행을 억제하는지의 여부와지방또는골격계와의 상호 작용규명
고열량 식이로 인한 비만 유도 시 교감 신경계 활성 /억제가 지방 대사와 더불어 골대사에 미치는 영향을 규명하기 위해 다음과 같은 실험을 수행하였다.
[표 1] 정상식이와고열량 식이 구성
상기 표 1 및 표 2 에 따라 총 40 마리의 6 주령 C57BL/6 마우스 (오리엔트사, 서울, 한국) 를 각각 10 마리씩 4 그룹의 실험군에 할당한 뒤 하기와 같이 각 군에 속하는 마우스 식이 섭취량 및 물 섭취량을 12 주간 매일 측정하였다. 각 군당 10 마리의 마우스를 사용하였으며, 각 군은 다음과 같이 처리되었다: 정상 식이를 섭취한 대조군 (CON VEH), 정상 식이를 섭취하였으나 DL-프로프라놀롤 (propranolol) ((土 )-propranolol hydrochloride, Sigma, USA) 을 경구 투여한 군 (CON BB), 고열량 식이를 섭취한 군 (HIGH VEH), 고열량 식이를 섭취하였으나 DL- 프로프라놀를 (propranolol)을 경구 투여한 군 (HIGH BB)으로 나누었다. 실험 시작 전 7 일간 계량 튜브를 이용, 매일 40 마리 마우스의 물 섭취량올 측정하여 일일 평균 물 섭취량을 계산하였고 이를 바탕으로 베타- 차단제 투여군의 경우 DL-프로프라놀를 0.5g 을 1 리터의 물에 녹인 것을 식음수로사용하여 12주 간의 실험기간 동안마우스에 공급하였다.
각 군별 10 마리의 마우스에서 수득 한 각 결과의 평균값을 계산하여 사용하였으며 각 값은 평균土 SD 로 나타냈다.
( 1) 체증, 전신 체지방량 및 근육량 조사 매 주 체중을 측정하여, 식 이가 체중에 미치는 영향을 조사하였다. 그 결과 도 1 에서도 확인할 수 있듯이 12 주간의 실험 기간 후, 고열량 식 이를 섭취한 실험군 (HIGH VEH)의 마우스의 체중은 정상 식 이를 섭취 한 대조군 (CON VEH)의 마우스 체중에 비해 유의성 있게 높은 것을 확인할 수 있었다. 그러나 고열량 식 이를 섭취하였으나 DL-프로프라놀를을 경구 투여한 군 (HIGH BB)의 마우스에서는 체중의 증가세가 현저히 완화되는 현상을 확인할 수 있었으며 HIGH VEH 군과 HIGH BB 군 체중 간의 유의한 차이는 5~6 주차에서부터 이미 나타남을 확인할 수 있었다. ' 또한, 상기 12 주간 실험한 각 실험군의 마우스의 생체내 vivo) 전신 체지방량 (Body fat mass) 및 전신 근육량 (Body Lean mass)을 Dual- energy X-ray absorpt iometry(DEXA)를 이용하여 측정하였다. 그 결과 도 2 의 A 에서도 확인할 수 있듯이, 체중 측정 결과와 일관되게 고열량 식이를 섭취한 실험군 (HIGH VEH) 마우스의 체지방량은 정상 식이를 섭취한 대조군 (CON VEH)의 마우스의 체지방량에 비해 유의성 있게 높은 것을 확인할 수 있었다 . 그러나 고열량 식 이를 섭취하였으나 DL-프로프라놀롤 (propranolol )을 경구 투여한 군 (HIGH BB)의 마우스에서는 체지방량의 증가세가 현저히 완화되는 현상을 확인할 수 있었다. 전신 근육량을 측정 비교한 결과 도 2 의 B 에서도 확인할 수 있듯이, 상기 체지방량 결과 (도 2 의 A)와는 반대의 경향으로 고열량 식 이를 섭취 한
실험군 (HIGH VEH)의 마우스의 근육량은 정상 식이를 섭취한 군에 비해 마우스의 근육량이 낮은 경향을 확인할수 있었다. 상기의 결과로부터 성장기 마우스에서 고열량 식이로 인한 체중 및 체지방 증가는 베타-차단제에 의해 그 증가 현상을 완화시킬 수 있음을 확인할 수 있었고, 성장기 마우스에서의 근육 생성은 정상 식이에 비해 오히려 고열량 식이에 의해 감소한다는사실을 확인할수 있었다. (2) 체지방 세포 각 군의 마우스의 (부고환 지방 조직 (epididymal fat) 체지방 조직을 채취하여 파라핀 조직 절편을 만든 후, H&E (Hematoxylin & Eosin, Sigma)을 이용하여 제조자의 방법대로 염색하여 체지방 세포의 크기를 비교하였다. 그 결과, 도 3 에서도 확인할 수 있듯이 고열량 식이를 섭취한 실험군 (HIGH VEH)의 마우스의 체지방 세포 크기가 정상 식이를 섭취한 대조군 (CON VEH)에 비해 증가하는 것을 확인할 수 있었다. 고열량 식이 군내 DL-프로프라놀를 (propranolol)을 투여한 마우스의 체지방 세포 크기는 HIGH-VEH 군의 체지방 세포에 비해 크기가 불균일하고, 작은 세포들이 군데군데 몰려있는 양상을 관찰할수 있었다. 상기의 결과로부터 고열량 식이로 인한 체지방 과립 (droplet) 형성과 그 크기 조절에 교감 신경 활성기전이 밀접하게 연관되어 있음을 확인할 수 있었다.
(3) 당부하 검사 실험 종료 2 주 전, 당 부하 검사를 실시하였다. 검사는 대상 마우스를 6시간 절식 후 공복 혈당을 먼저 측정하고 복강 내로 포도당 용액 Ig/kgBW을 투여한 뒤 15분 30분 60분 90분 120분 150분 간격으로 혈당을 측정하였다.
도 4 의 A 에서 확인할 수 있듯이 각 군의 마우스 혈액을 통해 당 부하 검사를 해 본 결과 고열량 식이 마우스 (HIGH VEH)의 공복 시 혈당이 정상 식이 마우스 (CON VEH)의 공복 혈당보다 높았으나 고열량 식이 군내 DL-프로프라놀를 (propranolol)을 투여한 마우스 (HIGHBB)의 공복 시 혈당은 정상 식이 군 마우스에 비해 통계적으로 다르지 않음을 확인할수 있었다. 포도당 부하 이후 증가했던 혈당치는 고열량 식이 군 마우스 (HIGH VEH)에 비해 정상 식이 군 마우스 (CON VEH, CON BB)와 고열량 식이를 섭취했으나 DL—프로프라놀를 (propranolol)을 투여한 마우스 (HIGH BB)에서 빠른 시간 내에 정상수치로 회복되는 것을 확인 할수 있었다. 실험 종료 1 주 전, 인슐린 내성 검사를 실시하였다. 검사는 대상 마우스를 6 시간 절식 후 기저 혈당을 측정하고 복강 내로 인슐린 0.75U/kgBW을 투여한 뒤 15분 30분 60분 90 분 120분 150분 간격으로 혈당을 측정하였다. 도 4 의 B 에서 볼 수 있듯이 인술린 내성 검사에서도 역시 인슐린에 대한 내성이 정상 식이 군 마우스 (CON VEH, CON BB)와 고열량 식이를 섭취했으나 DL-프로프라놀를을 투여한 마우스 (HIGH BB)끼리는 크게 다르지 않으나 고열량 식이 군 마우스 (HIGH VEH)에서는 크게 증가해 있음을 확인할수 있었다. 상기의 결과는 베타-차단제가 고열량 식이에 의한 체중 및 체지방 증가를 완화시킬 뿐 아니라 고열량 식이로 인해 발생하는 체내 당 대사 장애 (혹은 당뇨)도 완화시킬 수 있음을 제시하는 결과이다. 교감 신경계 활성 차단이 비만을 억제 하는 기전에 있어 골격계의 역할 (Neuronal mediation for insulin secretion control through bone)을 규명하기 위하여 다음과 같은 실험을 수행하였다.
(4) 교감 신경 활성 차단에 의한 마우스 정강이 뼈 (Tibia) 에서의 Esp발현과 혈중 오스테오칼신 조절 현상
조골세포에서 교감신경계의 활성은 췌장의 β세포에도 영향을 미쳐 인슐린 분비능과 혈당을 조절함으로써 전체적으로 골대사와 에너지 대사를
맞물려 조절하는 한 축이 될 수 있으며, 조골세포로부터 β 세포의 인슐린 분비를 촉진하는 인자가 분비된다 .
따라서 조골세포가 골 형성과 미 네탈화를 담당하는 역할 뿐 아니라 췌장과 β 세포에 작용하는 분자를 분비하는 내분비성 세포로서의 역할도 담당하며 에너지 대사에 관여할 수 있다는 근거하에, 또한 오스테오 칼신 (osteocalcin)이 고지방 식 이를 섭취 한 마우스 그룹에서 비만과 당뇨 발병률을 현저히 낮추고, 대사 증후군을 가진 성 인 남성에서 혈중 오스테오칼신 농도가 감소한 것을 근거로 다음과 같은 실험을 수행하였다.
Esp는 조골세포 특이적으로 발현되는 체내 에 너지 대사를 조절하는 것으로 간주되는 유전자로 수용체유사 단백질 타이로신 포스파타제 (receptor l ike protein tyros ine phosphatase를 encode)를 코딩 한다 .
따라서 고열량 식 이군 내 베타-차단제가 투여된 마우스에서 관찰된 체지방 /체중 증가 완화에 있어 골격계를 매개로 한 교감 신경계 활성 /억제의 역할을 알아보기 위해 각 군 마우스의 정강이뼈에서 R A를 추출하여, cDNA 를 합성한 후, Esp 유전자의 발현 경향을 실시간 정량
PCR을 이용하여 관찰하였다.
PCR에 사용된 프라이머 및 해당 어 닐링 은도는 표 3에 기 재되어 있다.
PC 조건은 95°C에서 30초간 초기 변성을 한 후, 95°C에서 30초간 변성, 어닐링 /신장은 표 3의 각 유전자에 해당하는 온도에서 34초 수행하였으며, 총 40주기를 수행하였다. 수득된 Ct (cycle at threshold)값을 이용하여 대조군으로 널리 사용되는 GAPDH 유전자의 값에 대한 각 유전자의 상대적인 발현 수준을 비교하였다.
[표 3]
S전지 S청 서열 5"→3" Tin
Foroani CATGTTCCAGTATGACICCACTC
mouse g^pdh arc
Reverse GGCCTCACCCCATWGATGT
Foiward ACCGCGAGTTCTACA
mouse <Igat1l 58TC
Reveise AGGGGAACGCTCACTAGGTA
Foiviard GCGCTACTICCGAGACTAC T
mouse dgat2
Revise GCACAGGCAICCGGAAGnACC
Foivianfl! GCCTGTCCCICCTGATCACCTAAGAG
iiKusees|}
Reveise GACCACITTGGTCAGGTTGGTACC
CAGAAGCCAACTAAfiAAGATCG
i7imjsef^}27 柳 :
evise IGTA5CAGTGCAGGTCATAG
Foiwaril CATCTGCTGGCCTTCTCCAA
mouse teptin 58TC eveise fCCASGCTCTCTGGCWCTG
도 5A에서와 같이 베타-차단제에 의해 Esp 발현이 억제되고 특히 고열량 식이를 먹인 마우스에서 그 억제 현상이 더 강화됨. 이와 맥락을 같이 하껴 각 군 마우스의 혈중 오스테오칼신 (undercarboxylated Osteocalcin) 농도를 관찰한 결과 도 5B에서와 같이 고열량 식이 군 마우스의 혈액에서 오스테오칼신 농도가 정상식이군에 비해 감소하였으며, 베타-차단제를 섭취한 마우스 그룹에서는 혈중 오스테오칼신 농도가 베타- 차단제를 섭취하지 않은 그룹에 비해 증가하는 현상이 관찰되었다.
(5) 교감 신경 활성 차단에 의한 MC3T3E1 조골 세포주에서의 ESP 발현 조절 현상
조골세포 분화 및 교감 신경 신호 전달에 주요한 모델 세포주인 MC3T3E1 세포주를 7일간 조골세포 분화 배지 (10% 소혈청 (BioWhittaker; USA) , 10 mM β -glycerophosphate (Sigma-Aldr ich) , 50 g/mL ascorbic acid (Sigmaᅳ Aldr ich)가 포함된 alpha- modified Eagle' s medium (Hyclone, USA))중에서 37° C, 5% C02 조건으로 배양하며 교감 신경 작용제인 isopreterenol (ΙμΜ) 처리한 후 Esp 발현을 실시간 정량 PCR로 분석하였다.
PCR에 사용된 프라이머 및 해당 어닐링 온도는 표 3에 기재되어 있다. PCR조건은 상술한 바와 같다. 흥미로운 사실은 두 경우 모두 β 수용체 억제제인 ace (βΐ 특이적 길항제), ici (β2 특이적 길항제), Propranolol (비 특이적 β 수용체
길항제) 처리에 의해 Esp 의 발현이 억제 되는 것으로 나타났다 (도 5 C 참조).
상기 (4) 및 (5)의 결과로부터 교감 신경 활성 (본 연구의 동물 실험에서는 고열량 식이로 유도된 비만)에 의해 골격에서 Esp 발현이 증가하고 활성 오스테오칼신의 분비는 감소하는데 이 변화세는 교감 신경 억제제를 이용, 효과적으로 완화시킬 수 있음을 알 수 있다. 교감 신경 억제제에 의해 회복된 혈증 활성 오스테오칼신 농도와 맥락을 같이 하여 당 대사, 인슐린 대사가 개선되고 있음을 상기 (3)의 결과로 확인할수 있다. 이러한 실험 결과는 교감 신경계 활성 차단이 고지방 식이에 의한 비만을 억제하는 데 있어 췌장, 골격 기관과의 상호작용에 대한 단서를 제공할수 있다.
(6) 골수 지방 세포
12주 간의 실험 후 각 군의 마우스로부터 대퇴골 (femur)을 적출하여 조직 절편을 만든 후 H&E 염색을 통해 골수 지방 세포의 수와 크기를 관찰하였다.
그 결과 도 6의 결과에서도 확인할 수 있듯이, 정상 식이를 섭취한 대조군 (CON VEH)의 마우스에 비해 고열량 식이를 섭취한 실험군 (HIGH VEH)골수에서 지방 세포의 수가현저히 증가되는 것을 확인할수 있었다. 또한, 정상 식이를 섭취한 마우스에서는 매체대조군 (vehicle)과 DL- 프로프라놀를 (propranolol) 투여에 의한 골수 지방의 수나 크기의 차이가 관찰되지 않았으나 고열량 식이를 섭취한 마우스에서는 DL- 프로프라놀를 (propranolol) 투여에 의해 골수 지방 수의 증가가 완화되는 현상올 확인할수 있었다.
상기의 결과로부터 골수 지방의 형성에 교감 신경 활성이 밀접하게 연관되어 있음을 확인할수 있었다.
(7) 골밀도, 골량 및 골 구조
12주 간의 실험 후 각 마우스로부터 대퇴골 (femur)을 적출하여, micro CT (Skyscan 1172, Micro Photonic 사; Antwerpen, Belgium) 를 수행하여 제조자의 방법대로 골밀도, 골량, 골 구조를 측정하였다.
대퇴골은 70 kV, 141 μΑ, 이미지 픽샐크기 7 μηι의 조건으로 촬영하였고 동일 조건에서 수산화인회석 (hydroxyapatite)올 촬영하여 기준으로 이용하였다. Skyscan 1172에 제공된 NRecon, NReconserver 프로그램을 이용하여 대퇴골은 644 X 644 픽셀, 척추는 900 X 900 픽셀 크기로 이미지를 재건하였으며, CTan 프로그램을 이용하여 피질골 (cortical bone)의 2차원적 분석, 해면골의 골밀도 및 골 질적 · 구조적 지표의 분석을 시행하였고 CTvol 프로그램을 이용하여 해면골의 3차원 형태를 시각화하였다. 또한, 골소주 (trabecule)를 포함한 전체 골수 면적에서 해면골이 차지하는 퍼센트 (Cancellous bone volume, BV/TV)와 골 구조를 조사하였다. 그 결과 상기 표 4, 도 7 및 도 8에서도 확인할 수 있듯이, 고열량 식이를 섭취한 실험군 (HIGH VEH) 마우스의 대퇴골에서 정상 식이를 섭취한 대조군 (CON VEH)의 마우스에 비해 낮은 해면 용적골밀도 (cancellous vBMD)가관찰되었다. 그러나 고열량 식이를 섭취하였으나 DL-프로프라놀를 (propranolol)을 경구 투여한 군 (HIGH BB)의 마우스에서는 해면 용적골밀도 (cancellous vBMD)의 감소가 완화되어 정상 식이를 섭취한 대조군 (CON VEH)과 통계적으로 다르지 않은 골밀도를 나타내는 것을 확인할수 있었다. 상기의 결과로부터 고열량 식이가 골량 및 골밀도 감소와 골구조 악화의 원인이 됨을 확인할 수 있었고, 식이로 인한 골량 및 골밀도의 감소시 베타 블로커에 의해 골량 및 골밀도의 감소 현상과 골 구조 악화 현상이 완화될 수 있음을 확인할수 있었다.
[표 4]
αΐ9±αο7 ai6± o3 αιβ οβ
% λ99±ι一 sa .59± 77 ,90±L77 w
Th os±aiKM a06±0.C aos±ao os± ocs a93±0Ll7
± 02 27±0.04 ±a03
1.62± 2L
poTosrty (0 % 95.41± ?7
% 94-01
177.SS± a52 17ai9±72.99
[실시예 2] 식이 (열량)가 신체 부위별 줄기 세포의 분화능에 미치는 영향과교감신경 활성과의 연관성
(1) 골수 줄기세포의 조골세포로의 분화능
12 주간의 실험 후, 각 군 마우스에서 적출한 골수 세포를 앞서 기술한 것과 동일한 조골세포 분화 배지에 37° C, 5% C02 조건으로 배양 한 후 Alizarin Red 염색 과 Alkaline phosphatase 염색 (Sigma-Aldr ich)을 제조사의 방법대로 수행하여 식이와 교감 신경 활성 (억제) 의한 골수 줄기세포의 분화능에 변화가 있는지 조사하였다.
그 결과 도 9 에서 확인할 수 있듯이, 정상 식이군 내에서는 매체대조군과 DL—프로프라놀를 (propranolol)의 경구 투여에 따른 조골세포로의—분화차이는 관찰되지 않았다.
고열량 식이를 섭취한 실험군 (HIGH VEH)의 골수 세포에서는, 정상 식이를 섭취한 대조군 (CON VEH) 마우스의 골수 세포에 비해 조골세포로의 분화가 감소한 경향을 보이는 것을 확인할 수 있었다. 그러나 고열량
식이를 섭취하였으나 DL-프로프라놀를 (propranolol)올 경구 투여한 군 (HIGH BB)의 골수세포에서는 고열량 식이로 인한 조골세포 분화 감소세가 완화되는 것을 확인할수 있었다.
(2) 골수 줄기세포의 지방세포로의 분화능
12주간의 실험 후, 각 군 마우스에서 적출한 골수 세포를 지방세포 분화배지 (10% 소혈청, 1 mM dexamethasone (Sigma-Aldr ich) , 200 mM indomethacin (Sigmaᅳ Aldrich), 10 mg/ml insulin (Sigmaᅳ Aldr ich), 0.5mM methyl isobutylxanthine (Sigma-Aldr ich) 이 포함된 Dulbecco' s Modified Eagle Mediura_Hyclone))에 3Γ C, 5% C02 조건으로 배양한 후 Oil Red 0 (Sigma-Aldr ich) 염색을 제조자의 방법대로 수행하여 식이와 교감 신경 활성 (억제 )에 의한 골수 세포의 분화능에 변화가 있는지 조사하였다.
그 결과 도 10 에서도 확인할 수 있듯이, 정상 식이군 내에서는 매체대조군과 DL-프로프라놀를 (propranolol)의 경구 투여에 따른 지방 세포로의 분화 차이는 관찰되지 않았고, 세포의 형태 (지방 vacuole 형태)로 보아 고열량 식이를 섭취한 실험군 (HIGH VEH)의 골수 세포는 정상 식이군 (C0N-VEH)의 골수 세포에 비해 지방 세포로의 분화가 증가하는 것을 확인할수 있었다.
그러나 DL-프로프라놀를 (propranolol)을 투여한 군의 마우스에서 채취한 골수세포에서는 고열량 식이로 인한 지방 세포로의 분화 증가세가 완화되는 것을 확인할수 있었다.
상기의 결과로부터 고열량 식이에 의해 골수세포의 조골세포로의 분화능이 감소하며, 이러한 고열량 식이에 의한 조골세포 분화능 감소는 베타 블로커에 의해 완화되는 것을 확인할수 있었다.
또한, 고열량 식이에 의해 골수 세포의 지방세포로의 분화능은 증가하고, 이러한 고열량 식이에 의한 지방세포 분화능 증가는 베타 블로커에 의해 완화되는 것을 확인할수 있었다.
상기의 결과는 식이 (열량) 변화에 의한 골수 줄기세포의 지방세포 또는 조골세포로의 분화 방향 조절에 교감 신경 활성이 연관되어 있음을 확인한 결과로서, 이는 지금까지 보고된 바 없는 베타 차단제 (beta- blocker)의 새로운 용도인 비만 및 이에 이차적으로 수반되는
골감소증 /골다공증 같은 골 대사 장애 치료 또는 개선효과를 확인한 결과이다.
[실시예 3] 고열량 식이에 의한 체중 및 체지방 증가가 베타 - 차단제에 의해 완화되는분자수준 기전 연구
(1) 지방질 생합성 (Lipogenesis) 측면
상기 실시예 1 의 고열량 식이를 섭취하였으나 DL- 프로프라놀를 (propranolol)을 경구 투여한 군 (HIGH BB)의 마우스에서 관찰된 체지방 및 체중 증가 완화의 원인을 알아보기 위해 지방질 생합성 (Lipogenesis)과 관련된 유전자인, 지방세포 분화와 관련된 지방- 특이적 27 kDa 단백질 (Fat-specific protein of 27 kDa, FSP27), 지질 합성과 관련된 디아실글리세를 아실트랜스퍼라제 (Diacylglycerol Acyl transferase 1, DGATl) 및 DGAT 2, 지질 대사와 관련된 FSP27 유전자의발현 수준을 mRNA수준에서 조사하였다 (도 11).
12주간의 실험 종료 후 마우스를 회생하며 이의 부고환 지방 조직에서 체지방을 채취하여, 총 RNA를 추출한 후 실시간 정량 PCR을 수행하였다. PCR에 사용된 프라이머 및 해당 어닐링 온도는 표 3에 기재되어 있다. PCR조건은 상술한 바와 같다. 그 결과 도 11 에서 확인할 수 있듯이, 고열량 식이를 섭취한 실험군 (HIGH VEH) 마우스의 체지방 세포세서 모두 정상 식이를 섭취한 대조군 (CON VEH)에 비해 높은 수준의 FSP27, DGATl, DGAT2 mRNA이 발현됨을 확인할수 있었다.
고열량 식이군 내에서는 DL-프로프라놀를 (propranolol) 투여에 의해 FSP27, DGATl, DGAT2 발현 증가세가완화되는 현상을 확인할수 있었다. 상기의 결과로부터 대표적 지방질 생합성 (Lipogenesis)관련 유전자들의 발현이 고열량 식이에서 모두 증가하고, 이 증가세가 모두 베타 블로커에 의해 완화되는 것을 확인할수 있었다.
결론적으로, 상기의 결과는 고열량 식이에 의한 체중 및 체지방 증가가 베타 블로커에 의해 완화되는 현상에는 지방질 생합성관련 유전자 발현 증가 완화에 베타-차단제가 작용하는 기전이 존재함을 확인한 결과이다.
(2) 고 열량 식이로 인한 비만 유도 시 교감 신경 활성 억제가 성장기 마우스의 랩틴 발현에 미치는 측면
12주간의 실험 종료 후 마우스를 회생하며 각 군 마우스의 대퇴골 골수에서 RNA를 추출하여 렙틴에 대한 실시간 정량 PCR올 수행하였다 PCR에 PCR에 사용된 프라이머 및 해당 어닐링 온도는 표 3에 기재되어 있다. PCR 조건은 상술한 바와 같다. 또한 12 주간의 실험 종료 후 마우스를 회생하며 각 군 마우스의 대퇴골을 적출하여 탈회 한 후, 랩틴 항체 (primary rabbit polyclonal anti-leptin antibody (Ob (A20): sc-842 , Santa Cruz Biotech, USA) 를 이용하여 면역 염색을 수행하여 골수에서의 렙틴 단백질 발현을 관찰하였다. 렙틴은 음식물 섭취 시 지방 세포에서 주로 분비되며 시상 하부의 식욕 중추를 자극하여 포만감을 느끼게 하는 호르몬이다. 혈중 렙틴 농도는 고열량 식이에 의해서 증가 (+100.8% vs CON VEH)하였다. 도 12 에 나타난 바와 같이 혈중 랩틴 농도를 gram body fat 또는 gram body weight 으로 노말라이즈시킨 결과 고열량 식이군에서 교감 신경 억제제를 투여한 군 (HIGHBB)의 단위 지방 (g) 당 렙틴 분비 수준이 대조군 (HIGHVEH)보다높게 나타났다 (도 12A, B). 또한 골수에서의 렙틴 발현은 고열량 식이에서 감소하는 것으로 관찰되었으며, 베타-차단제를 투여한 고열량 식이군에서는 랩틴의 감소세가 현저히 완화된 것으로 나타났다 (도 12 C, D). 고 열량 식이로 인한 비만 유도 시 교감 신경 활성 억제에 의해 체지방, 골수 지방에서의 렙틴 발현이 모두 촉진되며 특히 골수 지방에서의 랩틴 발현이 현저히 촉진된 결과는, 교감 신경 억제제에 의한 비만 진행
억제와 골량 /골밀도 감소세 완화 현상에 있어 렙틴 호르몬이 밀접히 연관되어 있음을 시사하는 것이다. 전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.
Claims
【청구범위】 【청구항 1】 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환또는 비만으로 인한 골감소증의 예방, 개선 또는 치료용 조성물.
【청구항 2】 제 1 항에 있어서, 상기 베타-차단제는 하기 화학식 1 로 표시되는 것인, 조성물:
[화학식 1]
[상기 화학식 1에서, R 은 C1-C20 알킬, C3-C20 시클로알킬, C6-C20 아릴, 또는 C3-
C20헤테로알릴이며,
Ri내지 ¾은 서로 독립적으로 H, C1-C20 알킬 또는 C6-C20 아릴임].
【청구항 3] 제 2항에 있어서
상기 화학식 1 의 화합물은 R 이 페닐, 나프틸, 또는 안트라센이며 Ri 내지 ¾은서로 독립적으로 H, 또는 C1-C20 알킬인, 조성물.
【청구항 4] 제 1 항에 있어서, 상기 베타-차단제는 비선택적 베타-차단제인 조성물.
【청구항 5】 제 1 항에 있어서, 베타 차단제는 아세부를를 (Acebutolol) 알프레놀를 (alprenolol), 아테놀를 (Atenolol ), 베타솔올 (Betaxolol ) 비소프를를 (BisoproloO, 부신돌롤 (BucindoloO, 카르테올를 (Carteolol,) 카르베딜를 (Carvedilol), 셀리프를를 (Cel iprolol ), 에스몰를 (Esmolol) 라베탈를 (Labetalol), 레보분놀를 (Levobunolol ) , 메드특살를 (Medroxalol ) 메핀돌를 (Mepindolol), 메티프란놀를 (Met ipranolol ) 메토프를롤 (Metoprolol), 나돌를 (Nadolol), 네비불를 (Nebivolol) 옥스프렌놀를 (Oxprenolol), 펜부를롤 (Penbutolol ), 핀돌를 (Pindolol) 프로프라놀롤 (Propranolol) 소탈를 (Sotalol ) , 또는 티몰를 (Timolol)로 구성되는 군으로부터 선택되는 것인, 조성물.
【청구항 6】 제 5항에 았어서, 상기 베타-차단제는 프로프라놀를인, 조성물
【청구항 7】
제 1 항에 있어서, 상기 베타-차단제는 조성물 총 중량에 대해 0.001 내지 50 중량 %로 포함되는, 조성물.
【청구항 8】 제 1항에 있어서, 상기 베타-차단제는 지방-특이적 27 kDa 단백질 (Fat-specific protein of 27 kDa, FSP27) , 디아실글리세를 아실트랜스퍼라제 (Diacylglycerol Acyl transferase 1, DGATl) 및 DGAT 2 를 포함하는 지방세포 특이적 단백질 또는 상기 단백질을 코딩하는 유전자, 또는 렙틴 또는 그 유전자의 발현을 조절하는 것인, 조성물.
【청구항 9】 유효한 양의 베타-차단제를 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료가 필요한 대상체에게 투여하는 단계를 포함하는, 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료 방법 .
【청구항 10】 비만, 비만으로 인한 대사성 질환 또는 비만으로 인한 골감소증의 예방, 개선 또는 치료에 사용되는 베타-차단제.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2012-0040315 | 2012-04-18 | ||
KR20120040315 | 2012-04-18 | ||
KR1020130041414A KR20130117681A (ko) | 2012-04-18 | 2013-04-16 | 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 약학 조성물 |
KR10-2013-0041414 | 2013-04-16 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2013157833A1 true WO2013157833A1 (ko) | 2013-10-24 |
Family
ID=49383720
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2013/003223 WO2013157833A1 (ko) | 2012-04-18 | 2013-04-17 | 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 조성물 |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2013157833A1 (ko) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20020086749A (ko) * | 2000-04-03 | 2002-11-18 | 아스트라제네카 아베 | 베타 블록커 및 콜레스테롤 저하제의 신규한 조합물 |
KR20030036861A (ko) * | 2000-09-29 | 2003-05-09 | 솔베이 파마슈티칼스 비. 브이 | 이온 농도에 비의존적인 지속 방출성 약제학적 제형 |
KR20100039292A (ko) * | 2007-05-29 | 2010-04-15 | 베로사이언스, 엘엘씨 | 대사 증후군, 제2형 당뇨병, 비만 또는 전당뇨병을 위한 치료학적 치료 |
WO2011019882A1 (en) * | 2009-08-12 | 2011-02-17 | William Marsh Rice University | Nanostructure-beta-blocker conjugates |
-
2013
- 2013-04-17 WO PCT/KR2013/003223 patent/WO2013157833A1/ko active Application Filing
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20020086749A (ko) * | 2000-04-03 | 2002-11-18 | 아스트라제네카 아베 | 베타 블록커 및 콜레스테롤 저하제의 신규한 조합물 |
KR20030036861A (ko) * | 2000-09-29 | 2003-05-09 | 솔베이 파마슈티칼스 비. 브이 | 이온 농도에 비의존적인 지속 방출성 약제학적 제형 |
KR20100039292A (ko) * | 2007-05-29 | 2010-04-15 | 베로사이언스, 엘엘씨 | 대사 증후군, 제2형 당뇨병, 비만 또는 전당뇨병을 위한 치료학적 치료 |
WO2011019882A1 (en) * | 2009-08-12 | 2011-02-17 | William Marsh Rice University | Nanostructure-beta-blocker conjugates |
Non-Patent Citations (2)
Title |
---|
BAY ET AL.: "Current and investigational antiobesity agents and obesity therapeutic treatment targets", OBESITY RESEARCH, vol. 12, no. 8, August 2004 (2004-08-01), pages 1197 - 1211 * |
SATO, T. ET AL.: "Effects ofpropranolol on bone metabolism in spontaneously hypertensive rats", JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 334, no. 1, July 2010 (2010-07-01), pages 99 - 105 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9573919B2 (en) | Peroxisome proliferator-activated receptor (PPAR) activator, and drugs, supplements, functional foods and food additives using the same | |
EA019402B1 (ru) | Композиции и способ лечения болезни шарко-мари-тусса | |
KR20190142364A (ko) | 펜플루라민을 사용하여 두즈 증후군을 치료하는 방법 | |
CN107405332A (zh) | 治疗与s1p1受体有关的病症的方法 | |
KR20200098536A (ko) | Dux4 발현과 관련된 질병의 치료를 위한 화합물 | |
RU2531353C2 (ru) | Альфа-производные цис-мононенасыщенных жирных кислот, предназначенные для применения в качестве лекарственного средства | |
JP2017519775A (ja) | 腸の腸内分泌系を関連疾患又は病状の処置のために刺激する方法及び組成物 | |
NO337660B1 (no) | Anvendelse av en selektiv østrogenreseptor-modulator for fremstilling av en farmasøytisk blanding egnet til behandling eller forebyggelse av symptomer i nedre urinveier. | |
KR20180051560A (ko) | 비만 및 비만 관련 장애의 치료를 위한 카나글리플로진 및 펜테르민을 포함하는 공동 요법 | |
Wehring et al. | Diabetes mellitus associated with clozapine therapy | |
CA2957804C (en) | Pharmaceutical composition for prevention and/or treatment of urinary incontinence | |
WO2008104976A1 (en) | Amphipathic carboxylates for the treatment of immune-related disorders | |
JP6272646B2 (ja) | axial−equatorial aryl配向のfurofuran型リグナンを含有する骨形成促進用医薬組成物、その組成物を含有する医薬製剤、その組成物を含む機能性食品及び健康食品 | |
US20080262071A1 (en) | Pindolol for the Treating Premenstrual Syndrome and Premenstrual Dysphoric Disorder | |
JP2022524505A (ja) | 閉経周辺期及び閉経期の治療のための方法 | |
WO2013157833A1 (ko) | 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 조성물 | |
US20120022036A1 (en) | Method of treating osteoporosis | |
KR102221723B1 (ko) | Ampk 활성화 화합물 및 이의 용도 | |
KR101232872B1 (ko) | 스핑고신-1-포스페이트(sphingosine-1-phosphate) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 비만 예방 및 치료용 약학적 조성물 | |
KR20130117681A (ko) | 베타-차단제를 유효성분으로 포함하는 비만, 비만으로 인한 대사성 질환 및 골감소증 예방, 개선 또는 치료용 약학 조성물 | |
CN110636847B (zh) | 用于预防及治疗肌肉疾病的组合物 | |
JP7217259B2 (ja) | てんかん及び関連疾患を患う患者の予防及び治療のためのメセンブレノール及び/又はメセンブラノール | |
AU2005283829A1 (en) | Pindolol for the treating premenstrual syndrome and premenstrual dysphoric disorder | |
WO2013141202A1 (ja) | 筋増加剤、及び筋増加物質のスクリーニング方法 | |
KR101572311B1 (ko) | 2-아미노-2-노보네인카르복실산을 함유하는 비만 예방 또는 치료용 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13778714 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 13778714 Country of ref document: EP Kind code of ref document: A1 |