WO2013105775A1 - 절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법 - Google Patents

절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법 Download PDF

Info

Publication number
WO2013105775A1
WO2013105775A1 PCT/KR2013/000140 KR2013000140W WO2013105775A1 WO 2013105775 A1 WO2013105775 A1 WO 2013105775A1 KR 2013000140 W KR2013000140 W KR 2013000140W WO 2013105775 A1 WO2013105775 A1 WO 2013105775A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
primer
nucleic acid
primer consisting
primer set
Prior art date
Application number
PCT/KR2013/000140
Other languages
English (en)
French (fr)
Inventor
김광우
김종원
남도현
기창석
Original Assignee
사회복지법인 삼성생명공익재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 사회복지법인 삼성생명공익재단 filed Critical 사회복지법인 삼성생명공익재단
Priority to US14/371,255 priority Critical patent/US9512488B2/en
Priority to CN201380013038.6A priority patent/CN104160025B/zh
Publication of WO2013105775A1 publication Critical patent/WO2013105775A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a chronic myeloid leukemia diagnostic kit and a diagnostic method using the same, and a kit capable of detecting a gene in real time using a primer pair and a cleavable probe and a diagnostic method using the same.
  • Leukemia is a general term for a disease in which leukocytes proliferate oncologically. Types of leukemia can be divided into “myeloid leukemia” and “lymphoid leukemia” according to the leukocyte origin of leukemia, and divided into acute leukemia and chronic leukemia according to the progress rate. The clinical manifestations of leukemia vary depending on the type of disease and the nature of the cells involved. Lymphoid leukemia is caused by lymphoid blood cells, myeloid leukemia is myeloid blood cells, and chronic myelogenous leukemia is caused by mutations in malignant cells, ie malignant clones of pluripotent hematopoietic stem cells. Leukemia results from disorders of myeloid blasts that begin to differentiate in relatively early stages of hematopoiesis.
  • chronic myelogenous leukemia is a malignant blood disease in which myeloid cells proliferate in the bone marrow and invade peripheral blood or other organs.
  • the most important for the diagnosis of chronic myelogenous leukemia is the detection of the Philadelphia chromosome by chromosome test, which is positive in more than 95% of patients.
  • Chronic myelogenous leukemia has been found to cause a variety of causes, but the most common cause is known to be caused by translocation of the chromosome, in particular, translocation of chromosome 9 and chromosome 22 It is known to cause the onset. In fact, about 95% of chronic myelogenous leukemia patients have translocations between chromosome 9 and chromosome 22, and the translocation is part of the abl (abelson oncogene) gene located at q34 of chromosome 9. It is formed by translocation to the break point cluster region (bcr) gene present at position 2, and this rearrangement is called BCR-ABL rearrangement. Chronic myelogenous leukemia caused by the previous BCR-ABL rearrangement is very effective for the treatment of imatinibmesylate under the trademark GlivecTM as an active agent. Very important for direction determination and prognosis.
  • FISH fluorescent in situ hybridization
  • FISH is a method of directly detecting individual cells in which BCR-ABL rearrangement has occurred, and it is difficult to detect in the early stage of chronic myelogenous leukemia.
  • the method by RT-PCR is highly sensitive, but in general, cytogenetic methods are necessary because it is not easy to prepare primers for diagnosing patients with very rare chronic myelogenous leukemia. Therefore, in the case of patients suspected of chronic myelogenous leukemia, various cytogenetic analysis methods have been performed since the initial diagnosis.
  • the cytogenetic analysis method has many limitations because bone marrow cell division must reach 'medium', various requirements such as extraction and culture of proliferating cells must be met, and the amount must be sufficient.
  • the conventional RT-PCR is complicated because the analysis of the BCR-ABL gene should be performed by performing separate reactions for each type.
  • the detection method that can be used more useful in the diagnosis of chronic myelogenous leukemia by improving this method has been developed a detection kit and diagnostic method using the cleavable probe of the present invention.
  • One embodiment provides a kit for detecting breakpoints of a BCR-ABL fusion gene comprising a primer pair capable of specifically amplifying breakpoints of the BCR-ABL fusion gene and a cleavable probe.
  • Another embodiment provides a method of diagnosing chronic myelogenous leukemia comprising a primer pair and cleavable probe that can specifically amplify a breakpoint of the BCR-ABL fusion gene.
  • One aspect provides a kit for detecting an e19a2 breakpoint of a BCR-ABL fusion gene comprising a primer pair and a cleavable probe that can specifically amplify the e19a2 breakpoint of a BCR-ABL fusion gene.
  • kits for detecting an e19a2 breakpoint of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 1 and a primer set consisting of a primer consisting of SEQ ID NO: 2 and a cleavable probe of SEQ ID NO: 33 do.
  • kits for detecting an e19a2 breakpoint of a BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 3 and a second primer set consisting of a primer consisting of SEQ ID NO: 4 and a cleavable probe of SEQ ID NO: 33 to provide.
  • kits for detecting an e19a2 breakpoint of a BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 5 and a third primer set consisting of a primer consisting of SEQ ID NO: 6 and a cleavable probe of SEQ ID NO: 33 to provide.
  • kits for detecting an e19a2 breakpoint of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 7 and a fourth primer set consisting of a primer consisting of SEQ ID NO: 8 and a cleavable probe of SEQ ID NO: 33 to provide.
  • kits for detecting an e19a2 breakpoint of a BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 9 and a fifth primer set consisting of a primer consisting of SEQ ID NO: 10 and a cleavable probe of SEQ ID NO: 33 to provide.
  • primer may be used interchangeably with “oligonucleotide” or “polynucleotide”.
  • the primers refer to oligonucleotides that serve as a starting point for starting DNA synthesis in a PCR reaction. Primers are generally 15 to 35 nucleotides and hybridize with regions complementary to the target sequence.
  • probe refers to an oligonucleotide that specifically binds to a target sequence and is intended to hybridize in a sequence-specific manner with complementary regions of specific nucleic acid sequences, such as, for example, target nucleic acid sequences. Polynucleotides comprising specific moieties designed. In one embodiment, the oligonucleotide probe ranges from 15 to 60 nucleotides. More preferably, the oligonucleotide probe ranges from 18 to 30 nucleotides.
  • cleavable probe means a probe consisting of two kinds of nucleic acid, for example, that some nucleotides in a DNA probe are RNA.
  • Sequences of the cleavable probes are amplification products amplified by SEQ ID NOs: 1 and 2, amplification products amplified by SEQ ID NOs: 3 and 4, amplification products amplified by SEQ ID NOs: 5 and 6, amplification products amplified by SEQ ID NOs: 7 and 8 And any sequence capable of complementarily binding to a sequence commonly present in the amplification products amplified by SEQ ID NOs: 9 and 10.
  • the cleavable probe may include a DNA of 1 to 10 substituted with RNA, a DNA of 2 to 8 may be substituted with RNA, and a DNA of 3 to 7 may be substituted with RNA, It is not limited to this.
  • RNA may be located in the probe continuously, but may be located in the probe non-continuously.
  • the cleavable probe may be a probe consisting of a polynucleotide of SEQ ID NO: 33.
  • both ends or the inside of the cleavable probe may be labeled with a detectable substance. It includes an RNase enzyme that can specifically cleave the RNA sequence portion of the RNA-DNA double strand in a PCR reaction. After cleavage by RNase, all of the fragments of the probe dissociate in the target amplicon at the reaction temperature and are dispersed in the reaction solution. As the labeled donor and receptor are separated inside the probe, the fluorescence emission by the donor can be monitored.
  • label or “detectable lebel” refers to a fluorescent dye compound bound to a probe by covalent or non-covalent bonds, and refers to FRET (Forter Resonance Energy Transfer) of fluorescent donors and fluorescent receptors. May be a pair.
  • FRET Forward Resonance Energy Transfer
  • fluorescent means a fluorescent compound that is excited by light of a shorter wavelength than emitted light and emits light.
  • fluorescent donor means a fluorescent dye that emits light as measured in the assays disclosed herein.
  • the fluorescent donor can provide light absorbed by the fluorescent acceptor.
  • fluorescent receptor also refers to a second fluorescent dye or quencher that absorbs energy emitted from a fluorescent donor. The second fluorescent dye absorbs energy emitted from the fluorescent donor and emits light of a longer wavelength than the light emitted by the fluorescent donor. The quenching molecule absorbs the energy released by the fluorescent donor.
  • any luminescent molecule preferably a fluorescent dye and / or fluorescent quencher, can be used in the practice of the present invention.
  • the light emitting molecule may be, for example, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-diethylaminocowmarin-3-carboxylic acid, fluorescein, Oregon Green 488, Oregon Green 514, tetramethyltamine, rhodamine X, Texas red dye, QSY 7, QSY33, Dabcyl, BODIPY FL , BODIPY 630/650, BODIPY6501665, BODIPY TMR-X, BODIPY TR-X, dialkylaminocoumarin, Cy3 (cyanine 3), Cy5.5, Cy5, Cy3.5,
  • the kit for detecting the overexpression of the chronic myelogenous leukemia gene may additionally include a thermostable polymerase, RNase, enzymes included in the kit may be a thermostable polymerase and a thermostable RNase.
  • thermostable refers to an enzyme that retains its biological activity at elevated temperatures (eg, 55 ° C. or higher), or maintains biological activity upon repeated cycles of heating and cooling. it means.
  • Thermostable polynucleotide polymerases can be used in particular in PCR amplification reactions.
  • the thermostable polymerase may be Taq polymerase. It may be any one Taq polymerase selected from the group consisting of AmpliTaq, AmpliTaq Stoffel fragment, SuperTaq, SuperTaq plus, LA Taq, LApro Taq, and EX Taq.
  • RNase refers to an enzyme that specifically cleaves RNA.
  • the RNA may be RNA forming a double strand, and the double strand may be a hybrid double strand in which RNA and DNA are combined.
  • the kit may be provided in the form of a kit including a packaging unit having one or more reaction reagents.
  • the kit may also include one or more of the following items: buffers, instructions, and positive or negative controls.
  • the kit may comprise containers of reaction reagents mixed in appropriate proportions to carry out the methods described herein.
  • the reaction reagent vessels preferably contain a unit quantity of reaction reagent so that the measuring step can be omitted when performing the method.
  • the kit reagent further comprises a reagent for extracting genomic DNA or RNA from a biological sample.
  • Kit reagents may also include reagents for application to reverse transcriptase-PCR analysis.
  • the e19a2 breakpoint detection kit of the BCR-ABL fusion gene may use any one primer set selected from the group consisting of a first primer set or a fifth primer set to identify an e19a2 breakpoint. To increase, all five primer sets can be used.
  • Another aspect is an e13a2, e14a2, e13a3 or e14a3 break of the BCR-ABL fusion gene comprising a primer pair and cleavable probe that can specifically amplify the e13a2, e14a2, e13a3 or e14a3 breakpoint of the BCR-ABL fusion gene
  • a point detection kit Provided is a point detection kit.
  • One embodiment provides an e13a2, e14a2, e13a3 or e14a3 break of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 11 and a primer set consisting of a primer consisting of SEQ ID NO: 12 and a cleavable probe of SEQ ID NO: 33
  • a point detection kit Provided is a point detection kit.
  • Another embodiment provides the e13a2, e14a2, e13a3 or e14a3 of the BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 13 and a seventh primer set consisting of a primer consisting of SEQ ID NO: 14 and a cleavable probe of SEQ ID NO: 33
  • a breakpoint detection kit Provided is a breakpoint detection kit.
  • Another embodiment provides the e13a2, e14a2, e13a3 or e14a3 of the BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 15 and an eighth primer set consisting of a primer consisting of SEQ ID NO: 16 and a cleavable probe of SEQ ID NO: 33
  • a breakpoint detection kit Provided is a breakpoint detection kit.
  • Another embodiment provides the e13a2, e14a2, e13a3 or e14a3 of the BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 17 and a ninth primer set consisting of a primer consisting of SEQ ID NO: 18 and a cleavable probe of SEQ ID NO: 33
  • a breakpoint detection kit Provided is a breakpoint detection kit.
  • Yet another embodiment provides an e13a2, e14a2, e13a3 or e14a3 of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 19 and a tenth primer set consisting of a primer consisting of SEQ ID NO: 20 and a cleavable probe of SEQ ID NO: 33
  • a breakpoint detection kit Provided is a breakpoint detection kit.
  • Yet another embodiment provides an e13a2, e14a2, e13a3 or e14a3 of a BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 21 and a set of primers consisting of a primer consisting of SEQ ID NO: 22 and a cleavable probe of SEQ ID NO: 33
  • a breakpoint detection kit Provided is a breakpoint detection kit.
  • the e13a2, e14a2, e13a3 or e14a3 breakpoint detection kit of the BCR-ABL fusion gene may use any one primer set selected from the group consisting of sixth to eleventh primer sets to identify the breakpoint. However, all six primer sets may be used to increase accuracy.
  • the cleavable probe is an amplification product amplified by SEQ ID NOs: 11 and 12, an amplification product amplified by SEQ ID NOs: 13 and 14, an amplification product amplified by SEQ ID NOs: 15 and 16, an amplification product amplified by SEQ ID NOs: 17 and 18, and sequence Any sequence can be used as long as it is capable of complementarily binding to sequences amplifying products amplified by numbers 19 and 20 and amplification products amplified by SEQ ID NOs: 21 and 22.
  • the cleavable probe may be a probe consisting of a polynucleotide of SEQ ID NO: 33.
  • kits for detecting an e1a2 breakpoint of a BCR-ABL fusion gene comprising a primer pair and a cleavable probe that can specifically amplify the e1a2 breakpoint of a BCR-ABL fusion gene.
  • kits for detecting an e1a2 breakpoint of a BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 23 and a twelfth primer set consisting of a primer consisting of SEQ ID NO: 24 and a cleavable probe of SEQ ID NO: 33 do.
  • kits for detecting an e1a2 breakpoint of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 25 and a primer set consisting of a primer consisting of SEQ ID NO: 26, and a cleavable probe of SEQ ID NO: 33 to provide.
  • kits for detecting an e1a2 breakpoint of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 27 and a primer set consisting of a primer consisting of SEQ ID NO: 28, and a cleavable probe of SEQ ID NO: 33 to provide.
  • kits for detecting an e1a2 breakpoint of a BCR-ABL fusion gene comprising a primer consisting of a nucleic acid of SEQ ID NO: 29 and a primer set of SEQ ID NO: 30, and a cleavable probe of SEQ ID NO: 33 to provide.
  • kits for detecting an e1a2 breakpoint of a BCR-ABL fusion gene comprising a primer set consisting of a nucleic acid of SEQ ID NO: 31 and a primer set consisting of a primer consisting of SEQ ID NO: 32, and a cleavable probe of SEQ ID NO: 33 to provide.
  • the kit for detecting the e1a2 breakpoint of the BCR-ABL fusion gene may use any one primer set selected from the group consisting of the 12th to 16th primer sets to identify the e1a2 breakpoint. To increase, all five primer sets can be used.
  • the cleavable probe includes an amplification product amplified by SEQ ID NOs: 23 and 24, an amplification product amplified by SEQ ID NOs: 25 and 26, an amplification product amplified by SEQ ID NOs: 27 and 28, amplification products and sequences amplified by SEQ ID NOs: 29, and 30 Any sequence can be used so long as it is capable of complementarily binding to a sequence commonly present in the amplification products amplified by numbers 31 and 32.
  • the cleavable probe may be a probe consisting of a polynucleotide of SEQ ID NO: 33.
  • kits for chronic myelogenous leukemia gene multiplexing comprising the first to sixteenth primer sets and a cleavable probe.
  • any one primer set selected from the group consisting of the first primer set to the sixteenth primer set may be used, but chronic myelogenous leukemia has various breakpoints due to translocation at various positions. Therefore, for more accurate detection, a primer set capable of detecting e19a2 breakpoint, a primer set capable of detecting e13a2, e14a2, e13a3, or e14a3 breakpoint, and a primer set capable of detecting e1a2 breakpoint are included. shall.
  • the cleavable probe capable of amplifying the chronic myelogenous leukemia gene is not limited as long as it is a sequence capable of specifically binding to the amplification product by the primer set, and may be a probe consisting of a polynucleotide of SEQ ID NO: 33.
  • the primer set may further include a thermostable polymerase, RNase.
  • Another aspect provides a chronic myelogenous leukemia gene multiplexing method using a kit for detecting a chronic myelogenous leukemia gene comprising the first to sixteenth primer sets and a cleavable probe.
  • the method for detecting the chronic myelogenous leukemia gene is described in detail as follows.
  • the method may include obtaining DNA from a sample.
  • the sample may be taken from a patient with chronic myelogenous leukemia or from a person for diagnosing the progression of chronic myelogenous leukemia, or may be taken directly from a specific body part.
  • a first primer set consisting of a primer consisting of a nucleic acid of SEQ ID NO: 1 and a primer consisting of SEQ ID NO: 2
  • a second primer set consisting of a primer consisting of a nucleic acid of SEQ ID NO: 3
  • a primer consisting of SEQ ID NO: 4 A third primer set consisting of a primer consisting of a nucleic acid and a primer consisting of a SEQ ID NO: 6, a primer consisting of a nucleic acid of SEQ ID NO: 7 and a fourth primer set consisting of a primer consisting of SEQ ID NO: 8, a primer consisting of a nucleic acid of SEQ ID NO: 9, and a sequence
  • a fifth primer set consisting of a primer consisting of SEQ ID NO: 10
  • a sixth primer set consisting of a primer consisting of a nucleic acid of SEQ ID NO: 11
  • a primer consisting of a nucleic acid of SEQ ID NO: 13 a primer
  • two or more primer sets may be used in the first to sixteenth primer sets.
  • 16 primer sets can be used simultaneously.
  • the cleavable probe may be labeled with a detectable substance at both ends of different DNA portions, and may be labeled with a FRET (Forter Resonance Energy Transfer) pair of a fluorescent donor and a fluorescent receptor.
  • FRET Forward Resonance Energy Transfer
  • the amplified by mixing the polymerase, RNase and amplification buffer to the mixed sample.
  • the polymerase and RNase have thermal stability, any kind of enzyme can be used.
  • buffers are compounds that are added to an amplification reaction to modify the stability, activity, and / or lifetime of one or more elements of the amplification reaction.
  • the buffer may be compatible with PCR amplification and RNase H cleavage activity.
  • buffers include HEPES (4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid), MOPS (3- (N-morpholino) -propanesulonic acid), and buffers including acetate or phosphate Including but not limited to
  • PCR buffers may generally comprise up to about 70 mM KCl and about 1.5 mM or more MgCl 2, about 50-200 uM of each dATP, dCTP, dGTP and dTTP.
  • the buffer may also include additives to optimize efficient reverse transcriptase-PCR or PCR reactions.
  • Additives are compounds added to modify the stability, activity and / or life of one or more elements of the composition.
  • additives that may be included in the amplification reaction are betaine, formamide, KCl, CaCl 2 , MgOAc, MgCl 2 , NaCl, NH 4 OAc, NaI, Na (CO 3 ) 2 , LiCl, MnOAc, NMP, trehalose, demi Ethyl sulfoxide (“DMSO”), glycerol, ethylene glycol, dithiothreitol (“DTT”), pyrophosphatase, inorganic pyrophosphatase (TAP), cations, and other compounds that can alter the efficiency of amplification , Proteins, or cofactors, but is not limited thereto.
  • Additives may optionally be added to enhance the selectivity of primer annealing.
  • the method may include detecting an increase in the signal emitted from the label on the probe.
  • the signal emitted can be fluorescence and the results of fluorescence emission can be detected using a suitable device such as the Applied Biosystems 7500 Fast Real-Time PCR System or the Biorad CFX96 real-time PCR thermocycler, but any device available in the art Can be used.
  • the method may include a reverse transcription PCR step of obtaining RNA from a sample and providing cDNA obtained by amplification with a reverse transcriptase enzyme as a DNA of the sample.
  • RNA can be obtained from a chronic myelogenous leukemia patient or a person who wants to be treated for chronic myelogenous leukemia, and then amplified with reverse transcriptase to obtain cDNA.
  • reverse transcription to cDNA using a reverse transcriptase can be used in all methods that can be used in the art.
  • the reverse transcription PCR uses one of the template specific DNA primers to generate complementary DNA strands.
  • the product is then denatured in a PCR reaction and the second template specific primer is expanded to bind to the cDNA to form duplex DNA.
  • This product is amplified in the next step of temperature cycling. In order to maintain the highest sensitivity, it is important that the RNA is not degraded prior to the synthesis of cDNA.
  • FIG. 1 to 5 show experimental results of amplifying the e19a2 target nucleotide sequence using primer sets 1 to 5.
  • FIG. 6 to 11 show experimental results of amplifying the e14a2 target nucleotide sequence using primer sets 6 to 11.
  • FIG. 6 to 11 show experimental results of amplifying the e14a2 target nucleotide sequence using primer sets 6 to 11.
  • FIG. 12 to 17 show experimental results of amplifying the e13a2 target nucleotide sequence using primer sets 6 to 11.
  • FIG. 12 to 17 show experimental results of amplifying the e13a2 target nucleotide sequence using primer sets 6 to 11.
  • 18 to 23 show experimental results of amplifying the e14a3 target nucleotide sequence using primer sets 6 to 11, respectively.
  • 24 to 29 are experimental results of amplifying the e13a3 target nucleotide sequence using primer sets 6 to 11, respectively.
  • CataCleave probe is common: 5'-ggggaatggt guga agcccaaacc-3 '(SEQ ID NO: 33) (underlined base is RNA )
  • Primer set for detecting R-ABL e19a2 (F: forward; R: reverse)
  • Table 1 set ID order SEQ ID NO: Combined position bp
  • Primer set for detecting BCR-ABL e1a2 (F: forward; R: reverse)
  • 6-FAM was used as a fluorescent dye at the 5 'end of the DNA of the catacleave probe, which is a cleavable probe
  • Iowa Black RQ was used as the quencher at the 3' end.
  • Plasmids (six: one per genotype) synthesized by gene cloning were prepared for preparation of BCR-ABL positive samples (see SEQ ID NOs: 34-39). The polynucleotide encoding the following gene sequence was inserted into the EcoR1 / BamH1 site of pGEM-3Z (Promega) and used as a positive sample.
  • the primers, probes and amplification buffer 32 mM HEPES-KOH, pH 7.8, 100 mM potassium acetate, 4 mM magnesium acetate, 0.11% bovine serum albumin, 1% dimethylsulfoxide), dUTP / NTP mix (80 ⁇ M of dGTP, dCTP, dATP and 160 ⁇ M dUTP), 2.5 units of Thermus aquaticus DNA polymerase, 1 unit of Pyrococcus furiosis RNase HII, and 0.1 units of uracil-N-glycosila Agent was performed in RABI7500 (applied biosystem) according to the following cycling protocol: Initial denaturation was performed at 95 ° C.
  • the primers and probes of one embodiment When the primers and probes of one embodiment are used, very low concentrations of chronic myelogenous leukemia genes can be easily detected as compared to conventional PCR. Therefore, when using the primer-probe set of one embodiment, it can be usefully used to easily determine whether the expression of chronic myelogenous leukemia gene after performing reverse transcription PCR.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

일 구체예는 일 양상은 만성골수성백혈병 유전자에 특이적으로 결합하는 프라이머 쌍 및 상기 프라이머쌍에 의해 증폭되는 만성골수성백혈병 증폭 산물의 내부에 특이적으로 결합하는 절단 가능한 프로브를 포함하는 만성골수성백혈병 유전자의 발현량을 검출하는 검출용 키트를 제공하는 것이고, 다른 구체예는 일 구체예 따른 검출용 키트를 이용하여 시료에 있는 만성골수성백혈병 유전자의 발현량을 측정하는 것이다. 구체예의 방법을 이용할 경우, 낮은 농도의 만성골수성백혈병 유전자의 발현량도 효율적으로 실시간으로 검출하여 만성골수성백혈병 진단 및 예후 진단에 유용하게 이용할 수 있다.

Description

절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법
본 발명은 만성골수성백혈병 진단 키트 및 이를 이용한 진단 방법에 관한 것으로, 프라이머쌍 및 절단 가능한 프로브를 이용하여 실시간으로 유전자를 검출할 수 있는 키트 및 이를 이용한 진단 방법에 관한 것이다.
백혈병(leukemia)은 백혈구가 종양성으로 증식하는 질환을 총칭한다. 백혈병의 종류는 백혈병이 기원하는 백혈구에 따라‘골수성 백혈병’과‘림프성 백혈병’으로 나눌 수 있고, 진행속도에 따라 급성백혈병과 만성백혈병으로 나뉜다. 백혈병의 임상학적 양상은 질환의 유형과 침범한 세포의 성질에 따라 다양하다. 림프성 백혈병은 림프계 혈액세포가, 골수성 백혈병은 골수계 혈액세포가, 그리고 만성골수성백혈병은 성숙기에 있는 세포가 변이, 즉 혈구모세포 (pluripotent hematopoietic stem cell)의 악성 클론들에 의해서 발생하며, 급성 골수성백혈병은 비교적 초기단계의 조혈과정에서 분화를 시작하는 골수계 모세포의 장애에서 초래된다.
이 중 만성골수성백혈병은 골수계 세포가 골수 내에서 증식하여 말초 혈액이나 기타 장기를 침습하는 악성 혈액 질환으로 성인에게 발병 빈도가 높은 질환이다. 만성골수성백혈병의 진단을 위하여 가장 중요한 것은 염색체 검사를 통해서 필라델피아 염색체를 발견하는 것으로, 이는 환자의 95% 이상에서 양성 소견을 보인다.
만성골수성백혈병(chronic myelogenous leukemia, CML)은 다양한 발병 원인이 밝혀지고 있으나, 가장 일반적인 원인은 염색체의 전좌(translocation)에 의하여 발생하는 것으로 알려져 있는데, 특히, 9번 염색체와 22번 염색체의 전좌가 주된 발병 원인으로 알려져 있다. 실제, 만성골수성백혈병환자의 95 % 정도에서 9번 염색체와 22번 염색체 사이의 전좌가 발견되며, 전기 전좌는 9번 염색체의 q34 위치에 존재하는 abl(abelson oncogene) 유전자 일부가 22번 염색체 q11.2 위치에 존재하는 bcr(break point cluster region) 유전자로 전위되어 형성되는데, 이러한 재배열을 BCR-ABL 재배열(BCR-ABL rearrangement)이라고 한다. 전기 BCR-ABL 재배열에 의한 만성골수성백혈병에는 글리벡(GlivecTM)이라는 상표로 판매되는 이마티니브메실레이트(imatinibmesylate)가 특효약으로서 치료 효과가 매우 뛰어나므로, 전기 BCR-ABL 재배열의 조기 진단은 환자의 치료 방향 결정과 예후 판단에 매우 중요하다.
상기 BCR-ABL 재배열을 확인하기 위하여는, 주로 BCR-ABL 융합 유전자의 재조합 정도를 정량하는 방법이 사용되고 있으며, 보다 용이하게 BCR-ABL 융합 유전자의 재조합 정도를 정량할 수 있는 방법을 개발하기 위한 다양한 연구가 진행되고 있다. 예를 들어, FISH(fluorescent in situ hybridization)를 이용한 진단방법(Tkachuk et al., Science, 250(4980): 559-562, 1990), 체세포 DNA에 대한 PCR을 이용한 방법(Dobrovic et al., Blood, 72(6): 2063-2065, 1998), RT-PCR을 이용한 방법(Lee et al.,Blood, 73(8): 2165-2170, 1989) 및 네스티드(nested) PCR을 이용한 방법(Hessner et al., Genet. Anal. Tech. Appl., 11(4): 90-94, 1994) 등이 개발되었다.
그러나 상기 방법 중 FISH는 BCR-ABL 재배열이 일어난 개별 세포를 직접 검출하는 방법으로, 만성골수성백혈병의 초기에는 검출이 어렵다. RT-PCR에 의한 방법은 민감도는 뛰어나나, 일반적으로 매우 희귀한 만성골수성백혈병 환자의 경우를 진단할 수 있는 프라이머를 제작하기가 용이하지 않기 때문에 반드시 세포 유전학적인 방법이 필요하다. 그런 까닭에, 만성골수성백혈병으로 의심되는 환자의 경우 진단 초기부터 다양한 세포 유전학적 분석방법이 시행되고 있는 실정이다. 그런데, 세포 유전학적 분석 방법은 골수 세포의 분열 상태가 반드시‘중기’에 이르러야 하고, 증식 세포의 추출과 배양 등의 여러 가지 요건이 충족되어야 하며, 그 양 또한 충분해야 하기 때문에 많은 제약이 따른다. 또한 기존의 RT-PCR은 BCR-ABL 유전자의 분석을 위해 각 타입별로 분리된 반응을 시행하여 분석을 진행하여야 하므로 그 방식이 복잡하다.
따라서, 이러한 방법을 개선하여 만성골수성백혈병 진단에 보다 유용하게 이용될 수 있는 검출 방법을 연구한 결과 본 발명의 절단 가능한 프로브를 이용한 검출 키트 및 진단 방법을 개발하였다.
일 구체예는 BCR-ABL 융합 유전자의 브레이크 포인트를 특이적으로 증폭할 수 있는 프라어머 쌍 및 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 브레이크 포인트 검출용 키트를 제공한다.
또 다른 구체예는 BCR-ABL 융합 유전자의 브레이크 포인트를 특이적으로 증폭할 수 있는 프라어머 쌍 및 절단 가능한 프로브를 포함하는 만성골수성백혈병을 진단하는 방법을 제공한다.
일 양상은 BCR-ABL 융합 유전자의 e19a2 브레이크포인트를 특이적으로 증폭할 수 있는 프라이머 쌍 및 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트를 제공한다.
일 구체예는 서열번호 1의 핵산으로 구성된 프라이머 및 서열번호 2로 구성된 프라이머로 구성된 제1 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 3의 핵산으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성된 제2 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 5의 핵산으로 구성된 프라이머 및 서열번호 6로 구성된 프라이머로 구성된 제3 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 7의 핵산으로 구성된 프라이머 및 서열번호 8로 구성된 프라이머로 구성된 제4 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 9의 핵산으로 구성된 프라이머 및 서열번호 10로 구성된 프라이머로 구성된 제5 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트를 제공한다.
용어, "프라이머(primer)"는 "올리고뉴클레오티드(oligonucleotide)" 또는 "폴리뉴클레오티드(polynucleotide)"와 혼용될 수 있다. 상기 프라이머는 PCR 반응에서 DNA 합성을 시작하기 위한 시작점으로서 작용하는 올리고뉴클레오티드를 의미한다. 프라이머는 일반적으로 15 내지 35개의 뉴클레오티드이며, 상기 표적 서열에 상보적인 영역과 혼성화된다.
용어, "프로브(probe)"는 표적 서열에 특이적으로 결합하는 올리고뉴클레오티드를 의미하며, 예를 들어, 표적 핵산 서열과 같은 특이적인 핵산 서열의 상보적인 영역을 갖는 서열-특이적인 방법으로 혼성화되도록 고안된 특이적인 부분을 포함하는 폴리뉴클레오티드를 포함한다. 일 구체예에서, 상기 올리고뉴클레오티드 프로브는 15 내지 60개의 뉴클레오티드 범위이다. 더욱 바람직하게는, 상기 올리고뉴클레오티드 프로브는 18 내지 30개의 뉴클레오티드 범위이다.
용어, "절단 가능한 프로브"는 두 종류의 핵산으로 구성된 프로브를 의미하며, 예를 들어 DNA 프로브내의 일부 뉴클레오티드가 RNA인 것을 의미한다.
상기 절단 가능한 프로브의 서열은 서열번호 1 및 2로 증폭되는 증폭 산물, 서열번호 3 및 4로 증폭되는 증폭 산물, 서열번호 5 및 6로 증폭되는 증폭 산물, 서열번호 7 및 8로 증폭되는 증폭 산물 및 서열번호 9 및 10으로 증폭되는 증폭 산물에 공통적으로 존재하는 서열에 상보적으로 결합할 수 있는 서열이면 어떠한 서열도 이용될 수 있다.
상기 절단 가능한 프로브는 프로브 내부에 1 내지 10의 DNA를 RNA로 치환된 것을 포함할 수 있으며, 2 내지 8의 DNA가 RNA로 치환될 수 있으며, 3 내지 7의 DNA가 RNA로 치환될 수 있으나, 이에 한정되는 것은 아니다. 또한, RNA는 연속하여 프로브내에 위치할 수 있으나, 비 연속적으로 프로브내에 위치할 수 있다. 상기 절단 가능한 프로브로는 서열번호 33의 폴리뉴클레오티드로 구성된 프로브일 수 있다.
또한, 상기 절단 가능한 프로브의 양 말단 또는 내부에 검출가능한 물질로 표지될 수 있다. PCR 반응시에 RNA-DNA 이중가닥의 RNA 서열 부분을 특이적으로 절단할 수 있는 RNase 효소를 포함한다. RNase에 의해 절단된 후에, 프로브의 단편들은 모두는 반응 온도에서 표적 앰플리콘에서 해리되며, 반응용액으로 분산된다. 프로브 내부에 표지된 공여체 및 수용체가 분리될수록, 공여체에 의한 형광 방출은 모니터 될 수 있다.
용어, "표지(label)" 또는 "검출가능한 표지(detectable lebel)"는 공유 결합 또는 비공유 결합에 의해 프로브에 결합된 형광 색소 화합물을 의미하며, 형광 공여체 및 형광 수용체의 FRET(Forter Resonance Energy Transfer) 쌍일 수 있다.
용어, "형광 색소(fluorochrome)"는 방출되는 빛보다 더 짧은 파장의 빛에 의해 여기되어, 빛을 방출하는 형광 화합물을 의미한다. 또한, 용어, "형광 공여체"는 본 발명에 개시된 어세이에서 측정되는 빛을 방출하는 형광 색소를 의미한다. 또한, 형광 공여체는 형광 수용체(acceptor)에 의해 흡수되는 빛을 제공할 수 있다. 또한, 용어, "형광 수용체"는 형광 공여체로부터 방출되는 에너지를 흡수하는 제2형광 색소 또는 퀀칭 분자(quencher)를 의미한다. 제2 형광 색소는 형광 공여체로부터 방출되는 에너지를 흡수하며, 형광 공여체에 의해 방출되는 빛보다 더 긴 파장의 빛을 방출한다. 퀀칭 분자는 형광 공여체에 의해 방출된 에너지를 흡수한다.
어떠한 발광 분자, 바람직하게는 형광 색소 및/또는 형광 퀀쳐(quencher)라도 본 발명의 실시에 사용될 수 있다. 상기 발광 분자는 예를 들어, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532,Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660,Alexa Fluor 680, 7-디에틸아미노카우마린-3-카르복실산, 플루오레세인, Oregon Green 488, Oregon Green 514,테트라메틸로다민, 로다민 X, 텍사스 레드 염료, QSY 7, QSY33, Dabcyl, BODIPY FL, BODIPY 630/650, BODIPY6501665, BODIPY TMR-X, BODIPY TR-X, 디알킬아미노코우마린, Cy3(cyanine 3), Cy5.5, Cy5, Cy3.5, DTPA(Eu3+)-AMCA 및 TTHA(Eu3+)AMCA를 포함하나, 이에 한정하지는 않는다. 바람직하게는 6-FAM 및 Iowa Black BQ의 FRET 쌍이 이용될 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 만성골수성백혈병 유전자의 과발현 검출용 키트는 추가적으로 열안정 폴리머라제, RNase를 포함할 수 있으며, 키트에 포함하는 효소는 열안정성 폴리머라제 및 열안정성 RNase 일 수 있다.
용어, 효소에 적용되는 "열안정성(thermostable)"은 상승된 온도(예를 들어, 55 ℃ 이상)에서 생물학적 활성을 유지하거나, 또는 가열 및 냉각의 반복된 싸이클에 따라 생물학적 활성을 유지하는 효소를 의미한다. 열안정성 폴리뉴클레오티드 폴리머라제는 특별히 PCR 증폭 반응에서 사용될 수 있다. 일 구체예에서, 상기 열안정성 폴리머라제는 Taq 폴리머라제일 수있다. AmpliTaq, AmpliTaq Stoffel fragment, SuperTaq, SuperTaq plus, LA Taq, LApro Taq, 및 EX Taq으로 구성된 군으로부터 선택된 어느 하나의 Taq 폴리머라제일 수 있다. 또한, 용어, "RNase"는 RNA를 특이적으로 절단하는 효소를 의미한다. 이때 RNA는 이중가닥을 형성하는 RNA일 수 있으며, 이러한 이중가닥은 RNA와 DNA가 결합한 혼성 이중가닥일 수 있다.
또한, 상기 키트는 하나 이상의 반응 시약을 갖는 포장단위를 포함하는 키트 형태로 제공될 수 있다. 또한 상기 키트는 하나 이상의 하기의 품목을 포함할 수 있다: 완충액, 사용설명서, 및 양성 또는 음성 대조군. 키트는 본 명세서에 기술된 방법을 수행하기 위해 적절한 비율로 혼합된 반응 시약들의 용기들을 포함할 수 있다. 반응 시약 용기들은 바람직하게는 상기 방법을 수행할 때 측정하는 단계를 생략할 수 있도록 단위 수량의 반응 시약을 포함한다. 다른 구체예에서, 상기 키트 시약은 생물학적 시료로부터 게놈 DNA 또는 RNA을 추출하기 위한 시약을 더 포함한다. 또한, 키트 시약은 역전사 효소-PCR 분석에 적용하기 위한 시약을 포함할 수 있다.
상기 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트는 e19a2 브레이크포인트를 확인하기 위하여, 제1 프라이머 세트 내지 제5 프라이머 세트로 이루어진 군으로부터 선택되는 어느 하나의 프라이머 세트를 이용할 수 있으나, 보다 정확도를 높이기 위하여는 5개의 프라이머 세트를 모두 이용할 수 있다.
또 다른 양상은 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3브레이크포인트를 특이적으로 증폭할 수 있는 프라이머 쌍 및 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
일 구체예는 서열번호 11의 핵산으로 구성된 프라이머 및 서열번호 12로 구성된 프라이머로 구성된 제6 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 13의 핵산으로 구성된 프라이머 및 서열번호 14로 구성된 프라이머로 구성된 제7 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 15의 핵산으로 구성된 프라이머 및 서열번호 16로 구성된 프라이머로 구성된 제8 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 17의 핵산으로 구성된 프라이머 및 서열번호 18로 구성된 프라이머로 구성된 제9 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 19의 핵산으로 구성된 프라이머 및 서열번호 20로 구성된 프라이머로 구성된 제10 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 21의 핵산으로 구성된 프라이머 및 서열번호 22로 구성된 프라이머로 구성된 제11 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트를 제공한다.
상기 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트는 상기 브레이크포인트를 확인하기 위하여, 제6 프라이머 세트 내지 제11 프라이머 세트로 이루어진 군으로부터 선택되는 어느 하나의 프라이머 세트를 이용할 수 있으나, 보다 정확도를 높이기 위하여는 6개의 프라이머 세트를 모두 이용할 수 있다.
상기 절단 가능한 프로브는 서열번호 11 및 12로 증폭되는 증폭 산물, 서열번호 13 및 14로 증폭되는 증폭 산물, 서열번호 15 및 16으로 증폭되는 증폭 산물, 서열번호 17 및 18로 증폭되는 증폭 산물, 서열번호 19 및 20으로 증폭되는 증폭 산물 및 서열번호 21 및 22로 증폭되는 증폭 산물에 공통적으로 존재하는 서열에 상보적으로 결합할 수 있는 서열이면 어떠한 서열도 이용될 수 있다. 상기 절단 가능한 프로브로는 서열번호 33의 폴리뉴클레오티드로 구성된 프로브일 수 있다.
또 다른 양상은 BCR-ABL 융합 유전자의 e1a2 브레이크포인트를 특이적으로 증폭할 수 있는 프라이머 쌍 및 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트를 제공한다.
일 구체예는 서열번호 23의 핵산으로 구성된 프라이머 및 서열번호 24로 구성된 프라이머로 구성된 제12 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 25의 핵산으로 구성된 프라이머 및 서열번호 26로 구성된 프라이머로 구성된 제13 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 27의 핵산으로 구성된 프라이머 및 서열번호 28로 구성된 프라이머로 구성된 제14 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 29의 핵산으로 구성된 프라이머 및 서열번호 30으로 구성된 프라이머로 구성된 제15 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트를 제공한다.
또 다른 구체예는 서열번호 31의 핵산으로 구성된 프라이머 및 서열번호 32로 구성된 프라이머로 구성된 제16 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트를 제공한다.
상기 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트는 e1a2 브레이크포인트를 확인하기 위하여, 제12 프라이머 세트 내지 제16 프라이머 세트로 이루어진 군으로부터 선택되는 어느 하나의 프라이머 세트를 이용할 수 있으나, 보다 정확도를 높이기 위하여는 5개의 프라이머 세트를 모두 이용할 수 있다.
상기 절단 가능한 프로브는 서열번호 23 및 24로 증폭되는 증폭 산물, 서열번호 25 및 26으로 증폭되는 증폭 산물, 서열번호 27 및 28로 증폭되는 증폭 산물, 서열번호 29 및 30으로 증폭되는 증폭 산물 및 서열번호 31 및 32으로 증폭되는 증폭 산물에 공통적으로 존재하는 서열에 상보적으로 결합할 수 있는 서열이면 어떠한 서열도 이용될 수 있다. 상기 절단 가능한 프로브로는 서열번호 33의 폴리뉴클레오티드로 구성된 프로브일 수 있다
또 다른 양상은 상기 제1 프라이머 세트 내지 제16 프라이머 세트 및 절단 가능한 프로브를 포함하는 만성골수성백혈병 유전자 다중검사용 키트를 제공한다.
만성골수성백혈병을 검출하기 위하여는 제1 프라이머 세트 내지 제16프라이머 세트로 이루어진 군으로부터 선택되는 어느 하나의 프라이머세트를 이용할 수 있으나, 만성골수성백혈병은 다양한 위치에서 전좌가 일어나서 다양한 브레이크포인트를 갖는다. 따라서, 보다 정확한 검출을 위하여는 e19a2 브레이크포인트를 검출할 수 있는 프라이머 세트, e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트를 검출할 수 있는 프라이머 세트 및 e1a2 브레이크포인트를 검출할 수 있는 프라이머세 세트를 모두 포함하여야 한다. 즉, 제1 프라이머 세트 내지 제5 프라이머 세트로 이루어진 군에서 선택되는 어느 하나의 프라이머 세트, 제6 프라이머 세트 내지 제11 프라이머 세트로 이루어진 군에서 선택되는 어느 하나의 프라이머 세트, 및 제12 프라이머 세트 내지 제16 프라이머 세트로 이루어진 군에서 선택되는 어느 하나의 프라이머 세트를 포함하는 것이 바람직하다.
또한, 상기 만성골수성백혈병 유전자를 증폭할 수 있는 절단 가능한 프로브는 상기 프라이머 세트에 의한 증폭산물에 특이적으로 결합할 수 있는 서열이라면 한정되지 않으며, 서열번호 33의 폴리뉴클레오티드로 구성된 프로브일 수 있다.
또한, 상기의 프라이머 세트는 열안정 폴리머라제, RNase를 추가로 포함할 수 있다.
또 다른 양상은 상기 제1 프라이머 세트 내지 제16 프라이머 세트 및 절단 가능한 프로브를 포함하는 만성골수성백혈병 유전자 검출용 키트를 이용하여 만성골수성백혈병 유전자 다중검사(multiplex) 방법을 제공한다.
일 구체예로는 시료에서 DNA를 수득하는 단계; 서열번호 1의 핵산으로 구성된 프라이머 및 서열번호 2로 구성된 프라이머로 구성된 제1 프라이머 세트, 서열번호 3의 핵산으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성된 제2 프라이머 세트, 서열번호 5의 핵산으로 구성된 프라이머 및 서열번호 6로 구성된 프라이머로 구성된 제3 프라이머 세트, 서열번호 7의 핵산으로 구성된 프라이머 및 서열번호 8로 구성된 프라이머로 구성된 제4 프라이머 세트, 서열번호 9의 핵산으로 구성된 프라이머 및 서열번호 10로 구성된 프라이머로 구성된 제5 프라이머 세트, 서열번호 11의 핵산으로 구성된 프라이머 및 서열번호 12로 구성된 프라이머로 구성된 제6 프라이머 세트, 서열번호 13의 핵산으로 구성된 프라이머 및 서열번호 14로 구성된 프라이머로 구성된 제7 프라이머 세트, 서열번호 15의 핵산으로 구성된 프라이머 및 서열번호 16로 구성된 프라이머로 구성된 제8 프라이머 세트, 서열번호 17의 핵산으로 구성된 프라이머 및 서열번호 18로 구성된 프라이머로 구성된 제9 프라이머 세트, 서열번호 19의 핵산으로 구성된 프라이머 및 서열번호 20로 구성된 프라이머로 구성된 제10 프라이머 세트, 서열번호 21의 핵산으로 구성된 프라이머 및 서열번호 22로 구성된 프라이머로 구성된 제11 프라이머 세트, 서열번호 23의 핵산으로 구성된 프라이머 및 서열번호 24로 구성된 프라이머로 구성된 제12 프라이머 세트, 서열번호 25의 핵산으로 구성된 프라이머, 서열번호 26로 구성된 프라이머로 구성된 제13 프라이머 세트, 서열번호 27의 핵산으로 구성된 프라이머 및 서열번호 28로 구성된 프라이머로 구성된 제14 프라이머 세트, 서열번호 29의 핵산으로 구성된 프라이머 및 서열번호 30로 구성된 프라이머로 구성된 제15 프라이머 세트, 서열번호 31의 핵산으로 구성된 프라이머 및 서열번호 32로 구성된 프라이머로 구성된 제16 프라이머 세트로 이루어진 군에서 선택되는 적어도 어느 하나의 프라이머 세트, 및 서열번호 33의 절단 가능한 프로브와 상기 수득된 시료를 혼합하는 단계; 상기 혼합된 시료에 폴리머라제, RNase 및 증폭 완충액을 혼합하여 증폭시키는 단계; 및 상기 프로브 상의 표지로부터 방출되는 신호 증가를 검출하는 단계를 포함하는 만성골수성백혈병 유전자의 발현을 검출하는 방법을 제공한다.
상기 만성골수성백혈병 유전자를 검출하는 방법을 상세하게 설명하면 다음과 같다.
먼저, 시료에서 DNA를 수득하는 단계를 포함할 수 있다. 시료는 만성골수성백혈병 환자 또는 만성골수성백혈병의 진행여부를 진단하기 위한 사람으로부터 채취될 수 있으며, 또한 특정 신체 부위에서 직접 채취될 수 있다.
이후, 서열번호 1의 핵산으로 구성된 프라이머 및 서열번호 2로 구성된 프라이머로 구성된 제1 프라이머 세트, 서열번호 3의 핵산으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성된 제2 프라이머 세트, 서열번호 5의 핵산으로 구성된 프라이머 및 서열번호 6로 구성된 프라이머로 구성된 제3 프라이머 세트, 서열번호 7의 핵산으로 구성된 프라이머 및 서열번호 8로 구성된 프라이머로 구성된 제4 프라이머 세트, 서열번호 9의 핵산으로 구성된 프라이머 및 서열번호 10로 구성된 프라이머로 구성된 제5 프라이머 세트, 서열번호 11의 핵산으로 구성된 프라이머 및 서열번호 12로 구성된 프라이머로 구성된 제6 프라이머 세트, 서열번호 13의 핵산으로 구성된 프라이머 및 서열번호 14로 구성된 프라이머로 구성된 제7 프라이머 세트, 서열번호 15의 핵산으로 구성된 프라이머 및 서열번호 16로 구성된 프라이머로 구성된 제8 프라이머 세트, 서열번호 17의 핵산으로 구성된 프라이머 및 서열번호 18로 구성된 프라이머로 구성된 제9 프라이머 세트, 서열번호 19의 핵산으로 구성된 프라이머 및 서열번호 20로 구성된 프라이머로 구성된 제10 프라이머 세트, 서열번호 21의 핵산으로 구성된 프라이머 및 서열번호 22로 구성된 프라이머로 구성된 제11 프라이머 세트, 서열번호 23의 핵산으로 구성된 프라이머 및 서열번호 24로 구성된 프라이머로 구성된 제12 프라이머 세트, 서열번호 25의 핵산으로 구성된 프라이머 및 서열번호 26로 구성된 프라이머로 구성된 제13 프라이머 세트, 서열번호 27의 핵산으로 구성된 프라이머 세트 및 서열번호 28로 구성된 프라이머로 구성된 제14 프라이머 세트, 서열번호 29의 핵산으로 구성된 프라이머 세트 및 서열번호 30으로 구성된 프라이머로 구성된 제15 프라이머 세트, 및 서열번호 31의 핵산으로 구성된 프라이머 및 서열번호 32로 구성된 프라이머 세트로 구성된 제16 프라이머 세트로 이루어진 군에서 선택되는 적어도 어느 하나의 프라이머 세트, 및 서열번호 33의 절단 가능한 프로브와 상기 수득된 시료를 혼합하는 단계를 포함할 수 있다.
이때 상기 제1 프라이머 세트 내지 제16 프라이머 세트에서 두개 이상의 프라이머 세트가 이용될 수 있다. 또한, 16개의 프라이머 세트가 동시에 이용될 수 있다.
상기 절단 가능한 프로브는 서로 다른 DNA 부분의 양 말단에 검출가능한 물질로 표지될 수 있으며, 형광 공여체 및 형광 수용체의 FRET(Forter Resonance Energy Transfer) 쌍으로 표지될 수 있다.
이후, 상기 혼합된 시료에 폴리머라제, RNase 및 증폭 완충액을 혼합하여 증폭시키는 단계를 포함할 수 있다. 상기 폴리머라제 및 RNase는 열안정성을 갖는 것이면, 어떠한 종류의 효소라도 이용될 수 있다.
증폭 "완충액(buffer)"은 증폭 반응에 첨가되어 상기 증폭 반응을 조절함으로서 상기 증폭 반응의 하나 이상의 요소의 안정성, 활성, 및/또는 수명을 변형시키는 화합물이다. 상기 완충액은 PCR 증폭 및 RNase H절단 활성과 양립할 수 있다. 완충액의 예는, HEPES (4-(2-히드록시에틸)-1-피페라진에탄술폰산), MOPS(3-(N-모르폴리노)-프로판술론산), 및 아세테이트 또는 포스페이트를 포함하는 완충액 등을 포함하나 이에 한정되지 않는다,
PCR 완충액은 일반적으로 약 70 mM 이하의 KCl 및 약 1.5 mM 또는 그 이상의 MgCl2, 약 50-200uM의 각각의 dATP, dCTP, dGTP 및 dTTP를 포함할 수 있다. 또한 상기 완충액은 효율적인 역전사 효소-PCR 또는 PCR 반응을 최적화시키기 위해 첨가물이 포함될 수 있다.
첨가물은 상기 조성물의 하나 이상의 요소의 안정성, 활성 및/또는 수명을 변형시키기 위하여 첨가되는 화합물이다. 증폭 반응에 포함될 수 있는 첨가물의 예는 베타인, 포름아미드, KCl, CaCl2, MgOAc, MgCl2, NaCl, NH4OAc, NaI, Na(CO3)2, LiCl, MnOAc, NMP, 트레할로스,데미에틸술폭시드("DMSO"), 글리세롤, 에틸렌 글리콜, 디티오트레이톨("DTT"), 피로포스파타제, 무기 피로포스파타제(inorganic pyrophosphatase, TAP), 양이온, 및 증폭의 효율을 변화시킬 수 있는 기타 화합물, 단백질, 또는 보조 인자를 포함하나, 이에 한정하지 않는다. 첨가물은 프라이머 어닐링의 선택성을 향상시키기 위해 선택적으로 첨가될 수 있다.
이후, 상기 프로브 상의 표지로부터 방출되는 신호의 증가를 검출하는 단계를 포함할 수 있다. 방출되는 신호는 형광일 수 있으며, 형광 방출의 결과는 Applied Biosystems 7500 Fast Real-TimePCR System 또는 Biorad CFX96 real-time PCR thermocycler와 같은 적절한 장치를 사용하여 검출할 수 있으나, 당업계에서 사용 가능한 모든 장치가 이용될 수 있다.
추가적으로, 시료에서 RNA를 수득하여, 역전사 효소로 증폭하여 얻은 cDNA를 시료의 DNA로 제공하는 단계인 역전사 PCR 단계를 포함할 수 있다. 만성골수성백혈병 환자 또는 만성골수성백혈병에 대한 진료를 받고자 하는 사람으로부터 RNA를 수득한 뒤, 역전사 효소로 증폭하여 cDNA를 얻을 수 있다. 이때, 역전사 효소를 이용한 cDNA로의 역전사는 당업계에서 이용될 수 있는 모든 방법으로 이용될 수 있다.
상기 역전사 PCR은 주형 특이적인 DNA 프라이머의 하나를 사용하여 상보적인 DNA 가닥을 생성한다. 그후, PCR 반응에서 이 생성물은 변성되고, 제2 주형 특이적인 프라이머가 상기 cDNA에 결합하여, 듀플렉스 DNA를 형성하도록 확장된다. 이 생성물은 온도 싸이클링의 다음 단계에서 증폭된다. 가장 높은 민감성을 유지하기 위해, cDNA의 합성 전에 상기 RNA는 분해되지 않는 것이 중요하다.
일 구체예에 따른 만성골수성백혈병에 특이적으로 결합하는 프라이머 세트 및 절단 가능한 프로브를 이용할 경우, 만성골수성백혈병의 원인이 되는 브레이크 포인트를 함유하는 유전자의 미량의 발현을 검출할 수 있으므로, 만성골수성백혈병의 발현과 관련된 만성골수성백혈병의 진단 및 예후를 쉽게 판단할 수 있다.
도 1 내지 5는 프라이머 세트 1 내지 5를 이용하여 e19a2 타겟 염기 서열을 증폭한 실험 결과이다.
도 6 내지 11은 프라이머 세트 6 내지 11을 이용하여 e14a2 타겟 염기 서열을 증폭한 실험 결과이다.
도 12 내지 17은 프라이머 세트 6 내지 11을 이용하여 e13a2 타겟 염기 서열을 증폭한 실험 결과이다.
도 18 내지 23은 프라이머 세트 6 내지 11을 각각 이용하여 e14a3 타겟 염기 서열을 증폭한 실험 결과이다.
도 24 내지 29은 프라이머 세트 6 내지 11을 각각 이용하여 e13a3 타겟 염기 서열을 증폭한 실험 결과이다.
도 30 내지 34는 프라이머 세트 12 내지 16을 각각 이용하여 e1a2 타겟 염기 서열을 증폭한 실험 결과이다.
이하 하나 이상의 구체예를 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 만성골수성백혈병 탐지용 프라이머 세트 및 프로브의 제작
만성골수성백혈병 탐지용 프라이머(F: forward 및 R: reverse)와 프로브: 총 16세트 (소문자로 표기된 서열은 RNA임)를 제작하였다(Integrated DNA Technologies, Inc에서 합성).
CataCleave probe는 공통: 5'-ggggaatggt guga agcccaaacc-3' (서열번호 33)(밑줄친 염기는 RNA임)
R-ABL e19a2 검출용 프라이머 세트 (F: forward; R: reverse)
표 1
세트 ID 서열 서열번호 결합 위치 bp
1 F gaggtgggcatctaccgcgt 서열번호1 BCR-e19 20
R gctgccattgatcccgctgc 서열번호2 ABL-a3 20
2 F tctaccgcgtgtccggtgtg 서열번호3 BCR-e19 20
R gctgccattgatcccgctgc 서열번호4 ABL-a3 20
3 F tgcgtggaggagatcgagcg 서열번호5 BCR-e19 20
R gctgccattgatcccgctgc 서열번호6 ABL-a3 20
4 F aggtgggcatctaccgcgtg 서열번호7 BCR-e19 20
R gctgccattgatcccgctgc 서열번호8 ABL-a3 20
5 F tgcgtggaggagatcgagcg 서열번호9 BCR-e19 20
R attgcgggacacaggcccat 서열번호10 ABL-a3 20
BCR-ABL e13a2(=b2a2), e14a2(=b3a2), e13a3(=b2a3), e14a3(=b3a3) 검출용 프라이머 세트 (F: forward, R: reverse)
표 2
세트 ID 서열 서열번호 결합 위치 bp
6 F agcttctccctgacatccgtggag 서열번호11 BCR-e13 24
R attgcgggacacaggcccat 서열번호12 ABL-a3 20
7 F ctgcagatgctgaccaactcgtgt 서열번호13 BCR-e13 24
R attgcgggacacaggcccat 서열번호14 ABL-a3 20
8 F gatgctgaccaactcgtgtgtgaaac 서열번호15 BCR-e13 26
R cattgcgggacacaggcccat 서열번호16 ABL-a3 20
9 F agcttctccctgacatccgtggag 서열번호17 BCR-e13 24
R gctgccattgatcccgctgc 서열번호18 ABL-a3 20
10 F ctgcagatgctgaccaactcgtgt 서열번호19 BCR-e13 24
R gctgccattgatcccgctgc 서열번호20 ABL-a3 20
11 F gatgctgaccaactcgtgtgtgaaac 서열번호21 BCR-e13 26
R gctgccattgatcccgctgc 서열번호22 ABL-a3 20
BCR-ABL e1a2 검출용 프라이머 세트 (F: forward; R: reverse)
표 3
세트 ID 서열 서열번호 결합 위치 bp
12 F cataagcggcaccggcactg 서열번호23 BCR-e1 20
R attgcgggacacaggcccat 서열번호24 ABL-a3 20
13 F actgcccggttgtcgtgtcc 서열번호25 BCR-e1 20
R attgcgggacacaggcccat 서열번호26 ABL-a3 20
14 F cactgcccggttgtcgtgtc 서열번호27 BCR-e1 20
R gctgccattgatcccgctgc 서열번호28 ABL-a3 20
15 F ccataagcggcaccggcact 서열번호29 BCR-e1 20
R attgcgggacacaggcccat 서열번호30 ABL-a3 20
16 F cccggttgtcgtgtccgagg 서열번호31 BCR-e1 20
R gctgccattgatcccgctgc 서열번호32 ABL-a3 20
또한, 절단 가능한 프로브인 catacleave 프로브의 DNA의 양말단인 5' 말단에는 형광 염료로서, 6-FAM을 이용하였고, 3' 말단에는 퀀쳐로서 Iowa Black RQ를 이용하여 표지하였다.
실시예 2. 시료의 채취
BCR-ABL 양성 샘플준비를 위해 유전자 클로닝법으로 합성제작한 플라스미드 (6종: 유전형 당 1개)를 준비하였다(서열번호 34 내지 39 참조). 하기 유전자 서열를 암호화하는 폴리뉴클레오티드를 pGEM-3Z(프로메가)의 EcoR1/BamH1 사이트에 삽입하여 양성 샘플로 이용하였다.
표 4
서열번호 유전형
서열번호 34 e14a2
서열번호 35 e13a2
서열번호 36 e14a3
서열번호 37 e13a3
서열번호 38 e1a2
서열번호 39 e19a2
실시예 3. 성골수성백혈병 유전자의 검출
상기 프라이머, 프로브 및 증폭 완충액(32 mM HEPES-KOH, pH 7.8, 100 mM 포타슘 아세테이트, 4 mM 마그네슘 아세테이트, 0.11 % 우혈청 알부민, 1% 디메틸술폭시드), dUTP/NTP 믹스 (80 μM의 dGTP, dCTP, dATP 및 160 μM dUTP), 2.5 유니트의 테르무스 아쿠아티쿠스(Thermus aquaticus) DNA 폴리머라제, 1 유니트의 피로코쿠스 푸리오시스(Pyrococcus furiosis) RNase HII, 및 0.1 유니트의 우라실-N-글리코실라제를 이용하여 하기 싸이클링 프로토콜에 따라 RABI7500(applied biosystem)에서 수행하였다: 초기 변성은 95 ℃에서 5분간 실시; 95℃에서 10초간 변성, 이후, 65℃에서 10초간 어닐링, 72℃에서 40초로 50회의 증폭; 72 ℃에서 5분간 최종 연장. FAM 방출은 65℃ 단계에서 모니터 되었다(도 1 내지 34 참조).
일 구체예의 프라이머 및 프로브를 이용할 경우 통상의 PCR로 수행하는 경우에 비하여 매우 낮은 농도의 만성골수성백혈병 유전자도 용이하게 검출할 수 있다. 따라서, 일 구체예의 프라이머-프로브 세트를 이용할 경우, 역전사 PCR을 수행한 후 만성골수성백혈병 유전자의 발현 여부를 용이하게 판단하는데 유용하게 사용될 수 있다.

Claims (12)

  1. 서열번호 1의 핵산으로 구성된 프라이머 및 서열번호 2로 구성된 프라이머로 구성된 제1 프라이머 세트, 서열번호 3의 핵산으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성된 제2 프라이머 세트, 서열번호 5의 핵산으로 구성된 프라이머 및 서열번호 6로 구성된 프라이머로 구성된 제3 프라이머 세트, 서열번호 7의 핵산으로 구성된 프라이머 및 서열번호 8로 구성된 프라이머로 구성된 제4 프라이머 세트, 및 서열번호 9의 핵산으로 구성된 프라이머 및 서열번호 10로 구성된 프라이머로 구성된 제5 프라이머 세트로 구성된 군으로부터 선택되는 어느 하나의 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트.
  2. 서열번호 11의 핵산으로 구성된 프라이머 및 서열번호 12로 구성된 프라이머로 구성된 제6 프라이머 세트, 서열번호 13의 핵산으로 구성된 프라이머 및 서열번호 14로 구성된 프라이머로 구성된 제7 프라이머 세트, 서열번호 15의 핵산으로 구성된 프라이머 및 서열번호 16로 구성된 프라이머로 구성된 제8 프라이머 세트, 서열번호 17의 핵산으로 구성된 프라이머 및 서열번호 18로 구성된 프라이머로 구성된 제9 프라이머 세트, 서열번호 19의 핵산으로 구성된 프라이머 및 서열번호 20로 구성된 프라이머로 구성된 제10 프라이머 세트, 및 서열번호 21의 핵산으로 구성된 프라이머 및 서열번호 22로 구성된 프라이머로 구성된 제11 프라이머 세트로 구성된 군으로부터 선택되는 어느 하나의 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트.
  3. 서열번호 23의 핵산으로 구성된 프라이머 및 서열번호 24로 구성된 프라이머로 구성된 제12 프라이머 세트, 서열번호 25의 핵산으로 구성된 프라이머 및 서열번호 26로 구성된 프라이머로 구성된 제13 프라이머 세트, 서열번호 27의 핵산으로 구성된 프라이머 및 서열번호 28로 구성된 프라이머로 구성된 제14 프라이머 세트, 서열번호 29의 핵산으로 구성된 프라이머 및 서열번호 30으로 구성된 프라이머로 구성된 제15 프라이머 세트, 및 서열번호 31의 핵산으로 구성된 프라이머 및 서열번호 32로 구성된 프라이머로 구성된 제16 프라이머 세트로 구성된 군으로부터 선택되는 어느 하나의 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트.
  4. 제1항에 있어서, 상기 절단 가능한 프로브는 프로브 내부에 1 내지 10의 DNA를 RNA로 치환된 것인 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트.
  5. 제2항에 있어서, 상기 절단 가능한 프로브는 프로브 내부에 1 내지 10의 DNA를 RNA로 치환된 것인 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트.
  6. 제3항에 있어서, 상기 절단 가능한 프로브는 프로브 내부에 1 내지 10의 DNA를 RNA로 치환된 것인 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트.
  7. 제4항에 있어서, 상기 절단 가능한 프로브는 프로부의 양 말단에 검출가능한 물질로 표지된 것인 BCR-ABL 융합 유전자의 e19a2 브레이크포인트 검출용 키트.
  8. 제5항에 있어서, 상기 절단 가능한 프로브는 프로부의 양 말단에 검출가능한 물질로 표지된 것인 BCR-ABL 융합 유전자의 e13a2, e14a2, e13a3 또는 e14a3 브레이크포인트 검출용 키트.
  9. 제6항에 있어서, 상기 절단 가능한 프로브는 프로부의 양 말단에 검출가능한 물질로 표지된 것인 BCR-ABL 융합 유전자의 e1a2 브레이크포인트 검출용 키트.
  10. 서열번호 1의 핵산으로 구성된 프라이머 및 서열번호 2로 구성된 프라이머로 구성된 제1 프라이머 세트, 서열번호 3의 핵산으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성된 제2 프라이머 세트, 서열번호 5의 핵산으로 구성된 프라이머 및 서열번호 6로 구성된 프라이머로 구성된 제3 프라이머 세트, 서열번호 7의 핵산으로 구성된 프라이머 및 서열번호 8로 구성된 프라이머로 구성된 제4 프라이머 세트, 서열번호 9의 핵산으로 구성된 프라이머 및 서열번호 10로 구성된 프라이머로 구성된 제5 프라이머 세트,
    서열번호 11의 핵산으로 구성된 프라이머 및 서열번호 12로 구성된 프라이머로 구성된 제6 프라이머 세트, 서열번호 13의 핵산으로 구성된 프라이머 및 서열번호 14로 구성된 프라이머로 구성된 제7 프라이머 세트, 서열번호 15의 핵산으로 구성된 프라이머 및 서열번호 16로 구성된 프라이머로 구성된 제8 프라이머 세트, 서열번호 17의 핵산으로 구성된 프라이머 및 서열번호 18로 구성된 프라이머로 구성된 제9 프라이머 세트, 서열번호 19의 핵산으로 구성된 프라이머 및 서열번호 20로 구성된 프라이머로 구성된 제10 프라이머 세트, 서열번호 21의 핵산으로 구성된 프라이머 및 서열번호 22로 구성된 프라이머로 구성된 제11 프라이머 세트,
    서열번호 23의 핵산으로 구성된 프라이머 및 서열번호 24로 구성된 프라이머로 구성된 제12 프라이머 세트, 서열번호 25의 핵산으로 구성된 프라이머 및 서열번호 26로 구성된 프라이머로 구성된 제13 프라이머 세트, 서열번호 27의 핵산으로 구성된 프라이머 및 서열번호 28로 구성된 프라이머로 구성된 제14 프라이머 세트, 서열번호 29의 핵산으로 구성된 프라이머 및 서열번호 30으로 구성된 프라이머로 구성된 제15 프라이머 세트, 서열번호 31의 핵산으로 구성된 프라이머 및 서열번호 32로 구성된 프라이머로 구성된 제16 프라이머 세트로 이루어진 군에서 선택되는 적어도 어느 하나의 프라이머 세트 및 서열번호 33의 절단 가능한 프로브를 포함하는 만성골수성백혈병 유전자 다중검사용 키트.
  11. 제10항에 있어서, 열안정 폴리머라제, RNase를 추가로 포함하는 만성골수성백혈병 유전자 다중검사용 키트.
  12. 시료에서 DNA를 수득하는 단계;
    서열번호 1의 핵산으로 구성된 프라이머 및 서열번호 2로 구성된 프라이머로 구성된 제1 프라이머 세트, 서열번호 3의 핵산으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성된 제2 프라이머 세트, 서열번호 5의 핵산으로 구성된 프라이머 및 서열번호 6으로 구성된 프라이머로 구성된 제3 프라이머 세트, 서열번호 7의 핵산으로 구성된 프라이머 및 서열번호 8로 구성된 프라이머로 구성된 제4 프라이머 세트, 서열번호 9의 핵산으로 구성된 프라이머 및 서열번호 10로 구성된 프라이머로 구성된 제5 프라이머 세트, 서열번호 11의 핵산으로 구성된 프라이머 및 서열번호 12로 구성된 프라이머로 구성된 제6 프라이머 세트, 서열번호 13의 핵산으로 구성된 프라이머 및 서열번호 14로 구성된 프라이머로 구성된 제7 프라이머 세트, 서열번호 15의 핵산으로 구성된 프라이머 및 서열번호 16으로 구성된 프라이머로 구성된 제8 프라이머 세트, 서열번호 17의 핵산으로 구성된 프라이머 및 서열번호 18로 구성된 프라이머로 구성된 제9 프라이머 세트, 서열번호 19의 핵산으로 구성된 프라이머 및 서열번호 20로 구성된 프라이머로 구성된 제10 프라이머 세트, 서열번호 21의 핵산으로 구성된 프라이머 및 서열번호 22로 구성된 프라이머로 구성된 제11 프라이머 세트, 서열번호 23의 핵산으로 구성된 프라이머 및 서열번호 24로 구성된 프라이머로 구성된 제12 프라이머 세트, 서열번호 25의 핵산으로 구성된 프라이머 및 서열번호 26으로 구성된 프라이머로 구성된 제13 프라이머 세트, 서열번호 27의 핵산으로 구성된 프라이머 및 서열번호 28로 구성된 프라이머로 구성된 제14 프라이머 세트, 서열번호 29의 핵산으로 구성된 프라이머 및 서열번호 30으로 구성된 프라이머로 구성된 제15 프라이머 세트, 서열번호 31의 핵산으로 구성된 프라이머 및 서열번호 32로 구성된 프라이머로 구성된 제16 프라이머 세트로 이루어진 군에서 선택되는 적어도 어느 하나의 프라이머 세트 및 서열번호 33의 절단 가능한 프로브와 상기 수득된 시료를 혼합하는 단계;
    상기 혼합된 시료에 폴리머라제, RNase 및 증폭 완충액을 혼합하여 증폭시키는 단계; 및
    상기 프로브 상의 표지로부터 방출되는 신호의 증가를 검출하는 단계를 포함하는 만성골수성백혈병 유전자의 발현 다중검사 방법.
PCT/KR2013/000140 2012-01-09 2013-01-09 절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법 WO2013105775A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/371,255 US9512488B2 (en) 2012-01-09 2013-01-09 Method for multiplex-detecting chronic myelogenous leukemia gene using cleavable probe
CN201380013038.6A CN104160025B (zh) 2012-01-09 2013-01-09 使用可裂解探针复合检测慢性粒细胞性白血病基因的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2012-0002466 2012-01-09
KR1020120002466A KR101753833B1 (ko) 2012-01-09 2012-01-09 절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법

Publications (1)

Publication Number Publication Date
WO2013105775A1 true WO2013105775A1 (ko) 2013-07-18

Family

ID=48781677

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/000140 WO2013105775A1 (ko) 2012-01-09 2013-01-09 절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법

Country Status (4)

Country Link
US (1) US9512488B2 (ko)
KR (1) KR101753833B1 (ko)
CN (1) CN104160025B (ko)
WO (1) WO2013105775A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104946634A (zh) * 2015-06-04 2015-09-30 陕西师范大学 一种双标记荧光激活型探针及其检测dna的方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080004514A (ko) * 2005-03-25 2008-01-09 제넨테크, 인크. 폐암에서의 ｃ-ｍｅｔ 돌연변이
US7700279B2 (en) * 1999-12-24 2010-04-20 Quest Diagnostics Investments Incorporated Assay for bcr/abl gene rearrangement

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8618253B2 (en) * 2010-05-25 2013-12-31 Samsung Techwin Co., Ltd. Modified RNAse H and detection of nucleic acid amplification

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7700279B2 (en) * 1999-12-24 2010-04-20 Quest Diagnostics Investments Incorporated Assay for bcr/abl gene rearrangement
KR20080004514A (ko) * 2005-03-25 2008-01-09 제넨테크, 인크. 폐암에서의 ｃ-ｍｅｔ 돌연변이

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BURMEISTER, THOMAS ET AL.: "A multiplex PCT for improved detection of typical and atypical BCR-ABL fusion transcripts", LEUKEMIA RESEARCH, vol. 32, 2008, pages 579 - 585 *
DATABASE GENBANK 18 December 2011 (2011-12-18), "Homo sapiens breakpoint cluster region (BCR), transcript variant 2, mRNA", accession no. M 021574.2 *
DATABASE GENBANK 24 December 2011 (2011-12-24), "Homo sapiens c-abl oncogene 1, non- receptor tyrosine kinase (ABL1), transcript variant a, mRNA", accession no. M 005157.4 *
HARVEY,J. J. ET AL.: "Characterization and applications of CataCleave probe in real-time detection assays", ANAL. BIOCHEM., vol. 333, no. 2, 15 October 2004 (2004-10-15), pages 246 - 255 *
RENAULT, ILANA ZALCBERG ET AL.: "The significance of major and stable molecular responses in chronic myeloid leukemia in the tyrosine kinase inhibitor era", REV. BRAS. HEMATOL. HEMOTER., vol. 33, no. 6, 2011, pages 455 - 460 *

Also Published As

Publication number Publication date
US9512488B2 (en) 2016-12-06
CN104160025A (zh) 2014-11-19
KR20130081469A (ko) 2013-07-17
US20150038360A1 (en) 2015-02-05
CN104160025B (zh) 2017-02-22
KR101753833B1 (ko) 2017-07-05

Similar Documents

Publication Publication Date Title
ES2961374T3 (es) Amplificación con cebadores de composición de nucleótidos limitada
US8999644B2 (en) Method for detecting the presence of a DNA minor contributor in a DNA mixture
CA2993517A1 (en) Single nucleotide polymorphism in hla-b*15:02 and use thereof
JP2017521056A (ja) 鎖侵入に基づくｄｎａ増幅法
CN106591442B (zh) 用于y染色体微缺失检测的引物组合及试剂盒
WO2013105774A1 (ko) 절단 가능한 프로브를 이용한 ｃ－Ｍｅｔ 유전자 검출 방법
WO2021177773A2 (ko) Sars-cov-2 진단용 조성물, 키트 및 이를 이용한 sars-cov-2의 진단방법
US9260757B2 (en) Human single nucleotide polymorphisms
WO2021182850A1 (ko) Mirna 동시 다중 검출 방법 및 이를 이용한 mirna 검출용 키트
CN111996244B (zh) 一种单核苷酸多态性检测用组合物及其应用
JPWO2007105673A1 (ja) 変異遺伝子の検出方法
EP2414541B1 (en) Methylation ligation-dependent macroarray (mlm)
EP2789693B1 (en) Amelogenin SNP on chromosome X
WO2013105775A1 (ko) 절단 가능한 프로브를 이용한 만성골수성백혈병 유전자의 멀티플렉스 검출 방법
Wiesbauer et al. Multiplex primer extension analysis for rapid detection of major European mitochondrial haplogroups
JP2023552693A (ja) 標的遺伝子変異及びウイルスゲノムの検出システム並びにその製造及び使用の方法
WO2019231287A1 (ko) 회전환 증폭을 이용한 표적핵산 검출 방법 및 표적핵산 검출용 조성물
CN107400722B (zh) 一种检测人基因组的竞争性实时荧光pcr snp探针
JP3942079B2 (ja) 核酸増幅時の外因性コントロール、内部コントロールのための方法
CN117448447B (zh) Itpkc基因检测引物探针组合、试剂盒及其应用
CN117487921B (zh) Casp3基因检测引物探针组合、试剂盒及其应用
KR20190100675A (ko) Sfts 바이러스 검출용 올리고뉴클레오티드 세트 및 이의 용도
WO2022203297A1 (ko) 가이드 프로브 및 클램핑 프로브를 이용한 표적핵산 증폭방법 및 이를 포함하는 표적핵산 증폭용 조성물
RU2652895C2 (ru) Набор синтетических олигонуклеотидных проб для определения генотипа митохондриальной днк человека
KR20240038203A (ko) 호흡기 바이러스 감염 진단을 위한 RT-qLAMP용 프라이머 세트 및 이를 포함하는 키트

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13736316

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14371255

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 13736316

Country of ref document: EP

Kind code of ref document: A1