WO2013100713A2 - 효모 염색체 통합 또는 산업 스트레인 형질전환용 효모 발현 벡터, 그리고 이들의 용도 - Google Patents
효모 염색체 통합 또는 산업 스트레인 형질전환용 효모 발현 벡터, 그리고 이들의 용도 Download PDFInfo
- Publication number
- WO2013100713A2 WO2013100713A2 PCT/KR2012/011772 KR2012011772W WO2013100713A2 WO 2013100713 A2 WO2013100713 A2 WO 2013100713A2 KR 2012011772 W KR2012011772 W KR 2012011772W WO 2013100713 A2 WO2013100713 A2 WO 2013100713A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- spp
- yeast
- expression vector
- sequence
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/905—Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Definitions
- yeast expression vectors for yeast chromosome integration or upstrain transformation and uses thereof
- the present invention relates to yeast expression vectors for chromosomal integration or stable episomal yeast expression vectors and their use.
- Gene integration includes rRNA genes (Lopes et al., 1969; Fuj ii et al., 1990) and sigma (Kudla et al., 1992) or delta sequences (Sakai et al., 1990; Lee et al., 1997; Ekino et al., 2002; Oliviera et al., 2007). Since the sequences are present in many places throughout the yeast genome, strains containing multiple copies of the inserted gene can occur. Although you have rarely had cellular or cellular heterogeneity, Strategies can cause similar problems in controlling expression levels from the beginning by controlling the copy number of the inserted gene, for example, requiring additional selection of clones that express the inserted gene at the appropriate level.
- the selection marker is located between the bacterial ⁇ sequence pairs. The selection marker can then be removed via homologous recombination mediated by the Cre protein.
- Another optional means is the Ura- blaster cassette or the URA3-dpl200 cassette. Ura-blasters were originally developed for the destruction of genes that were successfully targeted in adiploid microorganisms, such as Candida albicans (Alani and Kleckner, 1987; Fonzi and Irwin, 1993; Pla et al., 1996).
- the cassette comprises direct repeats of Salmonella hisG gene separated by C. albicans U A3 copy (hisG-U A3-hisG).
- the present inventors have tried to develop a high efficiency expression system capable of continuously delivering the desired genes in yeast or stably expressing and transforming.
- the inventors have developed novel dual module plasmids (expression modules and rescue modules) and used them to produce yeast genes (preferably Saccharomyces three).
- the present invention was completed by confirming that it can be stably expressed by transformation of 5aca3 ⁇ 4ari3 ⁇ 4 »yces cerevisiae or Kluyberomyces maximans Vz / yve / / ziFces maxianus)).
- an object of the present invention is to provide a yeast expression vector.
- Another object of the present invention to provide a yeast expression vector for chromosome integration.
- the present invention provides a kit comprising: (a) an autonomous replicating sequence; (b) (i) KmPCLP3 (Kluyvero yces maxianus purine® cytosine-like-permease 3) promoters (PCLP pro ), (ii) ) An expression module comprising multiple cloning sites (MCS) and (iii) a KmPCLP3 terminator (PCLP ter ); And (c) (i) a select ion marker; and (ii) a rescue module (loxP-select ion marker-loxP) comprising a ⁇ sequence coupled to both ends of the selectable marker. It provides a yeast expression vector.
- the invention provides a composition comprising (a) a centromere sequence; (b) a sequence homologous to an upstream flanking sequence of the gene of interest; (c) (i) KinPCLP3 (Kluyveromyces maxianus pur ine-cytosine-1 ike-permease 3) promoter (PCLP pro ), (ii) multiple cloning site (MCS) and (iii) KmPCLP3 terminator; An expression module comprising ( ⁇ 1 ′); and (d) (i) a selection marker; and (ii) a rescue module comprising a ⁇ sequence bound to both ends of the selection marker. rescue module (loxP-select ion marker-loxP); (e) provides a yeast expression vector for chromosomal integration comprising a sequence homologous to a downstream full tanking sequence of a gene of interest.
- KinPCLP3 Kluyveromyces maxianus pur ine-cytosine-1 ike-permease 3 promoter
- the invention provides a composition comprising (a) a centromere sequence; (b) a sequence homologous to an upstream flanking sequence of the gene of interest (UP fragment); (c) expression modules comprising (i) a promoter of Saccharomyces cerevisiae glyceraldehyde '3' phosphate dehydrogenase 3, (ii) a multicloning site (MCS), and (iii) a terminator of ScGAL7 expression module; and (d) (i) selection marker; and (ii) a rescue module comprising a loxP sequence linked to both ends of the selection marker; loxP-select ion marker-loxP (E) Provides a yeast expression vector for chromosome integration comprising a sequence homologous to the downstream fulling sequence of the gene of interest (DOWN fragment).
- expression modules comprising (i) a promoter of Saccharomyces cerevisiae glyceraldehyde '3' phosphate de
- the present invention provides a method for continuous transformation of one or more target nucleotide sequences in yeast, comprising the steps of: (a) transferring the target nucleotide sequence to the MCSOnultiple cloning site of the vector described above; Cloning; (b) transforming the vector into yeast; (c) inducing rescue by Cre recombinase in the transformed yeast; And (d) repeatedly performing steps (a) to (c) with another target nucleotide sequence.
- the present inventors have tried to develop a high efficiency expression system capable of continuously delivering the desired genes in yeast or stably expressing and transforming.
- yeast genes preferably Saccharomyces three. It was confirmed that it can be stably expressed by transforming Leviciae (5accA r (3 ⁇ 4 ces cerevisiae) or Kluyveromyces maximans " ⁇ rc3 ⁇ 4zyces maxianu ⁇ 0 .
- Saccharomyces cerevisiae (5a? ArOT? Y ?? s cerevisiae) has been used industrially for a long time and has other advantages that other yeasts may be more suitable for the production of desired products.
- the genus Kluyberomyces V / yre ⁇ ces is a yeast species with beneficial properties for biotechnological methods.
- K. s E ⁇ Kluyveromyces 1 act is
- K. maximans / wyye c ces 1 marxianus
- yeasts are classified as GRAS (Generally Recognized As Save) and can be used with the same stability as Saccharomyces. .
- Vectors of the invention include self-replicating sequences (centrosequences), expression modules and rescue sequences.
- the vector of the present invention can stably express a target gene in yeast cells through a self-replicating sequence.
- Autologous Sequences include the origin of replication of the yeast genome.
- the origin of replication of the yeast genome comprises four sites (A, Bl, B2 and B3), Impart stability of the plasmid.
- self-replicating sequences have AT-rich sequences and replication is not initiated if the origin of replication is mutated or lost.
- element A has very high conservativeness (conservation sequence, 5'-T / ATTTAYRTTTT / A-3 '; Y is pyrimidine base and R is purine base). Initiation power disappears completely.
- mutations occur in elements B1, B2 and B3, the replication initiation capacity of the self-replicating sequence decreases.
- the expression vector of the present invention containing the centromere sequence can also solve the problem of the loss of the episomal vector based on the yeast physiology.
- the yeast to which the vector of the present invention can be applied is the species Kluiberomyces sp. Khiyveromyces spp. ), Saccharomyces sp., ⁇ 12 ⁇ ⁇ ⁇ °] Schi zosaccharomyces spp.), Pichia spp.), Papia ⁇ Paffia spp.), Candida ⁇ ⁇ Candida spp.), Talaromyces spp.), Brett anomyces spp., Pa 7 ; Solen ⁇ -(Pachysolen spp.) Or Debaryomyces spp.), More specifically include the Cluyveromyces sp. Or Saccharomyces spp., And more specifically Noose or Saccharomyces cerevisiae.
- the expression vector of the present invention is (i) KmPCLP3 (Kl uyveromyces max i anus pur i ne ⁇ cyt os i ne-1 i ke-permease 3) promoter (PCLP pro ), (ii) An expression module comprising multiple cloning sites (MCS) and (iii) a KmPCLP3 terminator (PCLP ter ); And (c) (i) a selection marker; and (ii) a rescue module (loxP-select ion marker-loxP) comprising a loxP sequence linked to both ends of the selection marker.
- KmPCLP3 Kl uyveromyces max i anus pur i ne ⁇ cyt os i ne-1 i ke-permease 3 promoter
- MCS multiple cloning sites
- PCLP ter KmPCLP3 terminator
- the vector of the present invention comprises: (i) a nucleotide sequence encoding an expression object; (ii) a promoter operably linked to the nucleotide sequence of (i) and acting on animal cells, specifically yeast cells, to form RNA molecules, more specifically (i) Nucleotide sequences encoding the expression material; (ii) a promoter of mPLCP3 that is operably linked to the nucleotide sequence of (i) and acts on animal cells, specifically yeast cells, to form RNA molecules; And (iii) an expression comprising a 3'-non-detoxification site, specifically a terminator of KmPLCP3, which acts on the animal cell, specifically the yeast cell, resulting in 3 1 -terminal polyadenylation of the RNA molecule.
- Vector or (i) a nucleotide sequence encoding an expression subject; (ii) a promoter of KmPCLP3 operably linked to the nucleotide sequence of (i) and acting on animal cells, specifically yeast cells, to form RNA molecules; And (iii) an expression comprising a terminator of a 3'-non-detoxification site, specifically KmPaP3, which acts on the animal cell, specifically the yeast cell, resulting in 3'-end polyadenylation of the RNA molecule.
- a vector or
- the multi-cloning position of the present invention acts as a location for cloning a nucleotide sequence that encodes the expression of the substance, and specifically, includes three restriction enzymes position (5a / I, EccRl and Ban).
- the expression module of the invention comprises an expression module comprising a ScTDH promoter, (ii) a multiple cloning site (MCS) and (iii) a GAL7 terminator ( expression module; and (c) (i) selection marker; and (ii) a rescue module comprising a loxP sequence linked to both ends of the selection marker. It includes.
- the vector of the present invention comprises: (i) a nucleotide sequence encoding an expression object; (ii) a promoter operably linked to the nucleotide sequence of (i) and acting on an animal cell, specifically a yeast cell, to form an RNA molecule, and more specifically (i) encoding an expression target Nucleotide sequence; (ii) a promoter of ScTDH3 operably linked to the nucleotide sequence of (i) and acting on animal cells, specifically yeast cells, to form RNA molecules; And (iii) an expression comprising a terminator of a 3′—non-detoxification site, specifically GAL7, which acts on the animal cell, specifically the yeast cell, resulting in polyadenylation of the 3′-end of the RNA molecule.
- Vector or (i) an expression target Nucleotide sequence encoding; (ii) a promoter of ScTDH3 operably linked to the nucleotide sequence of (i) and acting on animal cells, specifically yeast cells, to form RNA molecules; And (iii) an expression comprising a 3'-non-detoxification site, specifically a terminator of GAL7, which acts on said animal cell, specifically a yeast cell, resulting in 3'-terminal polyadenylation of said RNA molecule.
- a vector or
- the multi-cloning position serves as a position for cloning the nucleotide sequence encoding the expression material, and specifically includes three restriction enzyme positions EccRl and BanR).
- promoter refers to a DNA sequence that regulates the expression of a coding sequence or functional RNA.
- the expression-coding nucleotide sequence is operably linked to the promoter.
- operatively linked refers to a functional binding between a nucleic acid expression control sequence (eg, a promoter sequence, a signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence; Whereby the regulatory sequence modulates the transcription and / or translation of the other nucleic acid sequence.
- a nucleic acid expression control sequence eg, a promoter sequence, a signal sequence, or an array of transcriptional regulator binding sites
- Rescue mothers of the present invention comprise an antibiotic resistance gene (e.g., ⁇ gene) that functions as a yeast selection marker.
- an antibiotic resistance gene e.g., ⁇ gene
- loxP—kanMX— ⁇ as a selection marker in transformation with the vector of the present invention.
- yeast strains transformed with the vectors of the invention can be grown in antibiotic (eg G418) -containing media. That is, as the vector of the present invention is transformed into yeast, the transformed yeast strain is selected from the antibiotic-containing medium.
- the vector of the present invention can continuously integrate the gene of interest on the yeast chromosome using sequences homologous to the upstream and downstream flanking sequences of the gene of interest. More specifically, a flanking sequence of the gene fragment of interest is further included upstream of the expression mothers and downstream of the rescue mothers in the expression vector of the present invention. Sequences complementary to the plumtaning sequence are those of the target gene fragment on the chromosome. Integrate the dual-mode constructs of the present invention (expressing moieties and rescue cues; preferably, genes of interest and ⁇ -kanMX-loxP constructs) onto chromosomes via homologous recombination.
- the yeast strain incorporating the construct is isolated / identified according to the selection marker (preferably, resistance to G418) present in the rescue moieties, and the sites between the ⁇ sequences are removed by recognizing the two ⁇ sequences.
- the selection marker preferably, resistance to G418
- Cre re-combination of xylanase (recom bi nase) activity removes rescue mode to. Therefore, the vector of the present invention containing a target gene other than the target gene can be used to perform transformation to target a target gene at another position on the chromosome of the transformed yeast strain.
- a transformed yeast strain obtained by continuously modifying two different genes of interest can be produced.
- Cre recombinase a transformed yeast strain in which one or more target genes are modified can be prepared.
- the vector of the invention is rescued by Cre recom binase.
- the expression vector of the present invention is a sequence homologous to the flanking sequence of the target gene fragment present upstream and downstream of the rescue parent and the target gene on the chromosome. Through homologous recombinat ions with the fragments, the expression and rescue hairs are integrated onto the chromosome.
- the UP fragment and the DOWN fragment that can be used in the expression vector of the present invention are sequences derived from ribosomal DNA or transposon, and more particularly sequences derived from Ty (transposon-yeast) elements. to be.
- Ty transposon® yeast elements that can be used in the expression vector of the invention include, but are not limited to, elements selected from the group consisting of Tyl, Ty2, Ty3, Ty4 and Ty5. .
- the expression vector of the present invention is homologous recombination of the UP fragment and the DOWN fragment and the fragment on the chromosome (hanologous Through recombination, expression modules and rescue parents are integrated onto the chromosome.
- the yeast selection marker gene of the present invention can use a variety of selection marker genes known in the art, for example, auxotrophic (auxotrophic) such as Neomycin phosphotransferase 11 (NPTII), UAR3, LEU2, HIS3, TRP1, ADE2 and LYS2 ), But not limited to selection marker genes. More specifically, the yeast selection marker gene is NPTII. ⁇ Alternatively, the present invention may utilize genes encoding proteins that impart drug resistance on host cells that can be used as yeast selection markers, including, but not limited to, CAN1 and CYH2, for example. It doesn't happen.
- a promoter that can be used is a promoter that can regulate the transcription of the expression target material of the present invention, a promoter derived from a yeast cell, a mammal Promoters derived from animal viruses and promoters derived from genomes of mammalian cells, including, for example, the yeast (X marxianus) PCLP3 (ur i ne-cy t os i ne-1 i ke permease 3) promoter, yeast (5 cerevisiae) promoter of TDH3 (g 1 ycer a 1 dehyde-3-phospha te dehydrogenase 3), yeast (5.
- GAPDH G 1 ycer a 1 dehyde 3-phosphate dehydrogenase promoter
- yeast 5. cerevisiae
- GAL1 To GAL10 promoter yeast (/? / A pastor is)
- A0X1 or A0X2 promoter CMV cyt omega lo virus promoter
- adenovirus late promoter vaccinia virus 7.5K promoter
- SV40 promoter tk promoter of HSV Motor RSV promoter
- EF1 alpha promoter metallothionine promoter
- beta-actin promoter promoter of human IL-2 gene
- promoter of human IFN gene promoter of human IL-4 gene
- the expression cassette to be comprised comprises a polyaninated sequence (eg, PCLP3 terminator, ADH1 terminator, ectopic hormone terminator and SV40 derived poly adenylation sequence).
- the method of carrying the vector of the present invention into a host cell may use various methods known in the art, for example, when the host cell is a prokaryotic cell, the CaCl 2 method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973)), one method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973); and Hanahan, D , J.
- yeast globular / cell fusion used in transduction, electroporat ion, lipofection, microinjection, part icle bombardment, YAC, Agrobacterium—mediated transformation, etc. used in plant cells.
- the bacterial replication initiation point can then be selected from those well known in the art useful for stable bacterial replication of long DNA inserts, and include ColEl, F—F-factor and P1 replicon ( replicon), but is not limited thereto.
- the bacterial selection marker of the present invention may use bacterial selection marker genes known in the art.
- bacterial selection marker genes include, but are not limited to, genes that confer resistance to antibiotics such as ampicillin, kanamycin, tetracycline, zeosin, neomycin, hygromycin and chloramphenicol. '
- the production of transformed yeast cells using the vector of the invention can be carried out by gene transfer methods commonly known in the art. For example, electroporat ion, lithium acetate / DMS0 method (Hi 11, J., et al., (1991), enhanced whole eel 1 yeast trans format ion with DMS.Nucleic Acids Res. 19, 5791 ), Liposome-mediated transfer method (Wong, et al., 1980), retrovirus-mediated transfer method (Chen, HY, et al., (1990), J. Reprod. Fert.
- the above-described transformation is Cluiberomyces ⁇ Kluyveromyces spp.), Saccharo yces spp., Shichizozosaccharomyces spp., Pichia ⁇ Pichia spp.), Papia species 3 ⁇ 4 / 7/3 spp.), Candida species (Candida spp.), Talaromyces species (Talaromyces spp.), Bretanomyces ⁇ (Bret tanomyces spp.), Pachysolene ⁇ - ⁇ Pachysolen spp.
- the present invention relates to a novel dual module expression vector for yeast and a method for transforming a target nucleotide sequence using the same.
- Expression modules of the present invention include expression modules and rescue modules comprising multiple cloning site MCSs, suitable promoters and terminators.
- the vector of the present invention stably targets the gene of interest in yeast, preferably, Cl. veroyces maximans or Saccharomyces cerevisiae (5ac? aroffl ces cere s / ae). Can be expressed.
- the vector of the present invention can efficiently integrate a target gene into a specific position in a chromosome in yeast, preferably Saccharomyces cerevisiae or Kluyveromyces maximus.
- Transformation method using the vector of the present invention is to produce a transformed yeast strain stably integrating the target gene into the chromosome and then continuous transformation to induce modification of another target gene in the yeast strain Where possible, it can be very usefully applied to the industrial production of desired products (biomass).
- FIG. 1 is a diagram schematically showing a pKMEXll vector map.
- the plasmid pKMEXll was constructed on the backbone of pBluescript SKII (Stratagene), and contains an autonomous repeating sequence (ARS2) and a restriction site in a multickming site.
- ARS2 autonomous repeating sequence
- FIG. 2 is a diagram schematically illustrating a pKMEX12 vector map. Expression parents were inserted at the Xhol and Notl sites of the pKMEXll. Abbreviations: Pro, promoter; CS, target nucleotide cloning site; And Ter, terminator.
- 3 is a diagram schematically showing a pKMEX13 vector map. A rescue module (loxP—kanMX-loxP) was inserted at the Notl and SacII sites of the pKMEXll.
- FIG. 4 is a diagram schematically illustrating a pKMEX14 vector map.
- the plasmid pKMEX14 was prepared by inserting the expression mode fragment obtained from pKMEX12 into pKMEX13.
- FIG. 5 is a diagram schematically showing a pKMEX21 vector map.
- the plasmid pKMEXll was constructed on the backbone of pBluescript SKI I (Stratagene) and comprises a centromere sequence (CE B / ARS2) and a restriction site in a multicloning site.
- FIG. 6 is a diagram schematically illustrating a pKMEX22 vector map. Expression parents were inserted at the Xhol and Notl sites of pKMEX21. Abbreviations: Pro, promoter; MCS, target nucleotide multicloning site; And Tei ⁇ terminator.
- FIG. 7 is a diagram schematically showing a pKMEX23 vector map.
- a rescue module (loxP—kan-loxP) was inserted at the Notl and SacII sites of the pKMEX21.
- FIG. 8 is a diagram schematically illustrating a PKMEX24 vector map.
- the plasmid pKMEX24 was prepared by inserting the expression mode fragment obtained from pKMEX22 into pKMEX23.
- FIG. 9 is a diagram schematically illustrating a pScDAL21 vector map.
- the plasmid pKMEXll was constructed on the backbone of pBluescript SKI I (Stratagene), CEN6 and autonomc s repeating sequence (ARS), 012011772
- E. coli origin of replication origin of replication, expression module and restriction sites in multicloning sites.
- the vector comprises an expression module and a rescue module.
- FIG. 11 is a diagram schematically showing a pScDAL23 vector map.
- the delta "UP” and delta “DOWN” fragments in the vector are located upstream and downstream of the rescue moieties, respectively.
- FIG. 12 is a diagram schematically illustrating a pScDAL24 vector map.
- the sigma "UP” and sigma “DOWN” fragments are located upstream and downstream of the rescue moieties, respectively.
- FIG. 13 is a diagram schematically illustrating a pScDAL25 vector map.
- FIG. 14 is a diagram schematically showing a pScDAL22_ETS3 ′ ADFG5 vector map 14a and a chromosome integration process 14b using the same.
- the DGF5 "UP” and DGF5 “DOWN” fragments are located upstream of the expression parents and downstream of the rescue parents, respectively.
- the homologous recombinat ion into the DFG5 gene position inserts / integrates the expression and rescue modules of the pScDAL22_ETS3_ADFG5 vector.
- FIGS 15A-15C of the present invention incorporated into the S. cerevisiae chromosome
- the S. cerevisiae used in this study were BY4741 (aa; his3A 1; leu2A 0; met 15 ⁇ 0; ⁇ (National Collection of Yeast Cultures, UK) and the novel strains were lithium acetate transformation (Burns et al. , 1994) Molecular Biological Methods
- PCR conditions were as follows: 95 ° C., 1 min; 60 ° C., 1 minute; And 72 ° C, suitable extension time for the length of DNA to be amplified.
- the Kluiberomyces maxianus (/ i / i / j ⁇ ro yces imrxianus ⁇ ) autonomous replicating sequence (KmARS2) was amplified with Pfu DNA polymerase from K. Maximilian genomic DNA as a template.
- Used Primer sequences (including the PvuII position) are as follows: sense primer, 5′-CAGCTGGATCCAAGTCTGAAGGTTGGTTTGGC-3 ′; and antisense primer, 5′-CAGCTGGCTGGTAAGCCATCTTCATAGAGGG-3 ′.
- the PCR-amplified 863 bp fragment was purified, cloned into pGem-T easy vector (Promega), and sequenced.
- KmARS2 DNA was prepared from this plasmid via PvuII cleavage.
- the single-cut 2,958 bp fragment was purified by incomplete cleavage of pBluescript II SK vector (Stratagene) comprising PvuII positions in 530 and 975 nucleotides with PvuII.
- the two fragments were ligated to each other.
- a clone in which KmARS2 was inserted at the 530th nucleotide position was named pKMEXll vector (3.85 kb) (FIG. 1).
- the vector can be used for cloning functionally superior genes.
- the multicloning site consists of pnl, Xhol, Sail, Hindlll, EcoRV, EcoRI, Smal, BamHI, Xbal, Not I, Sac 11 and Sacl I.
- the PKMEX12 vector is a vector in which an expression module consisting of a plasmidlog promoter, cloning position and terminator derived from the pKMEXll vector is inserted into the pKMEXll vector. Promoters and terminators in the expression modes were used as promoters and terminators of K. maximanus (purine-cytosine-ike permease).
- the promoter fragment (PCLP3 pro ) was amplified with Pfu DNA polymerase from K.
- the fragment obtained by cleavage was re-cloned into an Xhol / Sall-cleaved pKMEXll fragment, after which the terminator fragment (PCLP3 ter ) was amplified with Pfu DNA polymerase using K. Maximilian genomic DNA as a template.
- Primer sequences are as follows: sense primers (including BamHI position), 5'- GGATCCTGCGTATCGCATAATGATGG-3 '; and antisense primers (including Xbal position), 5'-TCTAGATCCGGGTAACAGACAGTGGA-3'.
- the PCR-amplified fragment was purified and cloned into the BamHI / Xbal-cleaved vector in which the promoter fragment was cloned to produce a 4.31 kb pKMEX12 vector (FIG. 2).
- the desired DNA fragment to be expressed can be cloned into Sail, EcoRI or BamHI.
- Various plasmids with different selection markers can be constructed by inserting a marker gene between one of the expression parents, preferably between SacII and Sacl.
- kanMX provides resistance to G418 in yeast, including K. maximans (Ribeiro et al., 2007). Since the two ⁇ positions can be used to rescue the selection marker by Cre recombinase (Gueldener et al., 2002), the ' ⁇ -kanMX— ⁇ ' sequence is referred to as the "rescue mod". Called The rescue mothers used pUG6 as template and primer (sense primer with Notl position), 5'-GCGGCCGCGCTTCGTACGCTGCAGCTCGACMC-3 '; and antisense primer with SacII position, 5' one.
- pKMEX13 provides additional strategies for gene disruption: upstream of rescue mice (using two positions of Kpnl, Xhol, Sail, Hindlll, EcoRV, EcoRI, Smal, BamHI, Xbal, and Notl) and rescue Longer DNA fragments can be cloned using the parent's downstream (between SacII and Sacl), and the rescue mothers frequently promote effective integration.
- linear DNA fragments for transformation are prepared by cleavage with Sacl and one of the two restriction enzymes upstream.
- Expression modules were obtained from pKMEX12 vectors via cleavage of Xhol and Xbal and cloned into Xhol / Xbal-cleaved PKMEX13 vectors to produce 5.92 kb of pKMEXW vectors (FIG. 4).
- the PCLP3 promoter can be replaced by another promoter by cloning between Xhol and Sail.
- the rescued pKMEX14 genes can be used for gene disruption in the same manner as the PKMEX13 vector described above, except that only Xbal and Notl positions are useful for 3 ⁇ 4 stream cloning of longer DNA fragments.
- Two additional PCR fragments were prepared for gene integration from a vector cloned with an open reading frame (0RF) of the gene of interest between Sail and EcoRI or BamHI: one PCR fragment containing from the promoter to the end of kanMX; And another PCR fragment comprising from 0RF to the end of kanMX. If correctly integrated, the former PCR fragment is replaced by the PCLP3 promoter with the native promoter of the gene.
- mutant 0RF Due to the blocking system of the expression mothers, various homologous or heterologous promoters can be used. In genome integration of the latter PCR fragment in which 0RF was mutated, wild type 0RF was replaced with a mutant form. If the cells incorporating the fragment are viable after replacement with a haploid strain with a single copy gene, then the effect of mutant 0RF can be easily achieved through the newly acquired phenotype (ie, the phenotype due to the absence of wild type 0RF). Can be detected. However, the huge size of the sequence to be amplified has the following problem. In other words, the sequence from the PCLP3 promoter to the kanMX terminus is 2,193 bp in length when the target 0RF is cloned.
- the use of the pKMEX14 vector can avoid the amplification problem described above as follows: The Kpnl / Xhol position and SacII / SacI position behind the rescue modalities present on the side are used for upstream and downstream cloning of longer DNA fragments (or vice versa, as long as the orientation is maintained).
- the pKMEXM vector has an unprecedented structure that can effectively promote the replacement of promoter 0RF, or both.
- repeat sequences derived from ribosomal DNA or transposons are cloned upstream (Kpnl / Xhol) and downstream (SacII / SacI) cloning sites, functionally useful genes can be incorporated into harmless gene loci.
- the integration can be repeated in all cases as long as the kanMX mater is rescued.
- PKMEX14 vector for episomal expression
- cells based on the physiology of 5acc rOTyces cere / s / ae can The pKMEX14 vector is lost due to the absence of centromere.
- the inventors have produced a series of pKMEX vectors incorporating the Centromere sequence.
- centromere—like sequences in K. maximus which are co-located with an autonomously replicating sequence (ARS): (a) CENA present with ARSl (Genbank No. Z31562); And (b) CENB present with ARS2 (Genbank No. Z31563).
- ARS autonomously replicating sequence
- the CENB / ARS2 sequence was amplified with Pfu DNA polymerase using K. Maximilian genomic DNA as a template, wherein the primer sequences used (including the PvuII position) were as follows: sense primers , 5 ′ CAGCTGGATCCMGTCTGMGGTTGGTTTGGC-3 , and antisense primer, 5′-CAGCTGC TM GTTCACCTTAAACACTCACCGACG-3 ′.
- the PCR-amplified 1,176 bp fragment was purified, cloned into a pGem-T easy vector, and then sequenced.
- the sequence-identified fragment was digested from the vector with PvuII and then cloned into an incompletely PvuII-cleaved pBluescript II SK vector to prepare a pKMEX21 vector (FIG. 5).
- pKMEX21 vector as a parental plasmid
- pKMEX22, 23 and 24 vectors were respectively Prepared in the same manner as in PKMEX12, 13 and 14 vectors (FIGS. 6-8).
- the features of the pKMEX21 vector series are identical to those of the pKMEXll vector series except for the presence of CENB, which are expected to maintain and function as episomal in low-copy state and to be delivered to the next generation. Constructing a pScDAL21 Vector
- Saccharomyces cerevisiae DNA fragments containing CEN6 and autonomous replicating sequence (ARS), E. co J / replication origin (Or iC) and ampicillin resistance selection markers associated with histone 4 gene of cere ' s / ae) were identified as pRS316 TDH3.
- the template was amplified with Pfu DNA polymerase, wherein the primer sequence used was as follows: sense primer (including Kpnl position), 5'-GGGGGTACCCGCGTT (TGGCGTTTTTCC-3 '; and antisense primer (including Sac I position), 5 '-GGGGAGCTCGGACGGATCGOTGCCTGTAA-3'
- sense primer including Kpnl position
- antisense primer including Sac I position
- the PCR-amplified 2,303 bp fragment was purified, cloned into Topo vector (Invitrogen), and sequenced.
- DNA fragments comprising the TDH3 promoter, SPT15m7B and GAL7 terminators of S. cerevisiae were amplified with Pfu DNA polymerase with pRS316 TDH3 as a template with the following primer sequences: sense primers (Sacl and overlapping Notl) And Xbal positions), 5 '-GGGGAGCTCATCGCGGCCGCGCnCTAGAACCAGnCTCACACGGAACAC-3'; and antisense primers (including Kpnl and Xhol positions), 5 '-
- the product I and product II were cleaved with Kpnl and Sacl and ligated to prepare 4,648 bp of pScDAL21 vector (FIG. 9).
- kanMX with ⁇ position as flanking sequence on both sides DNA fragments containing the constructs were used and the kanMX provides resistance to G418 in yeast. Since the two ⁇ positions can be used to rescue the selection marker by Cre recom binase, the 'loxP ⁇ kanMX-loxP' sequence is called “rescue modles”.
- the rescue mothers used pUG6 as a template and primer (sense primer with Not I position), 5'-GCGGCCGCGCTTCGTACGCTGCAGCTCGACAAC-3 '; and antisense primer with SacII position, 5'-
- nCTCGACAGCTCGTTTTC-3 ') Pf u -amplified In designing the primer pairs, the Sacl 'Sail and Xhol positions present in the original vector were removed via a single base change, which is then useful for plasmid construction. After the 1,609 bp PCR fragment was cloned and sequenced into the pGem-T easy vector, a 6,385 bp pScDAL22 vector was prepared by cloning the fragment obtained by Notl and SacII cleavage into a Notl / SacII-cleaved pScDAL21 fragment (FIG. 10). ⁇
- Ty element aransposon-yeast is a DNA sequence that moves from one chromosome location to another through an RNA intermediate. DNA segments are transcribed into RNA and then reverse-transcribed into cDNA and always re-inserted into other locations on the nuclear genome.
- the original retrotranspozone is in situ and the new retrotranspozone contains copies of the original retrotranspozone and adjacent genes or sites that have been amplified during the process. remind The presence of retrotranspozone triggers transposition, the main source of gene expansion during genomic evolution.
- the insertion event may also affect genomic evolution by disrupting coding sites or transcriptional regulatory elements or by promoting chromosomal rearrangement through homologous recombination.
- Tyl-Ty5 There are about 50 retrotranspozones (five forms; Tyl-Ty5) in the yeast genome. All five types of Ty elements share a common structure consisting of TYA and TYB 0RF (similar to the retroviral gag and pol genes) plumped with LTRsGong terminal repeats) .
- TYA genes are virus-like involved in reverse transcription. Encode the structural proteins of the virus-like particles (VLPs).
- the TYB gene encodes a polyprotein comprising four proteins (protease (PR), integrase (IN), reverse transcriptase (RT) and ribonuclease H (RH) active domain), which proteins Important for retrotransitions.
- PR protease
- integrase I
- RT reverse transcriptase
- RH ribonuclease H
- LTRs associated with Ty elements Four types of LTRs associated with Ty elements are known: deltas (Tyl and Ty2), sigma (Ty3), tau (Ty4) and omega (Ty5).
- the LTRs described above not only exist in the retrotransposon as flanking direct terminal repeats, but also spread throughout the genome as single LTRs.
- the LTRs are removed through recombination between two LTRs of the full length Ty element.
- the delta sequence is the most abundant (almost 300), about tens of sigma and tau, and less than 10 omegas.
- the distribution reflects the relative abundance of Ty elements associated with LTRs.
- the P ScDAL23 vector, the pScDAL24 vector and the pScDAL25 vector use the LTRs sequence as delta sequence, sigma sequence and tau sequence, respectively.
- the basic strategy is to amplify an LTR sequence of about 350 bp into two fragments: (a) the first fragment, "UP”; and (b) the second fragment, "DN".
- the "UP” fragment is cloned between Kpnl and Xhol
- the "DN” fragment is cloned between Sacl and SacII.
- the P- SCDAL22-deltaUP vector was prepared by purifying the PCR-amplified fragment, cloning into the Topo vector, sequencing, and cloning the fragment obtained by Kpnl and Xhol cleavage into a Kpnl / Xhol-cut pScDAL22 fragment.
- Delta “DN” fragments were amplified with S. cerevisiae genomic DNA as a template with Pfu DNA polymerase, wherein the primer sequences used were as follows: sense primer (including SacII position), 5′-GGGCCGCGGATAAAATGATGATAATAATATTT-3 ′; And antisense primers (including the Sac I position), 5'-GGGGAGCTCTGAGAAATGGGTGAATGTTGAGA-3 '.
- the PCR-amplified fragment was purified and cloned into a Topo vector, sequenced, and then a fragment obtained by SacII and Sacl cleavage was cloned into a Sacl I / Sacl-cut pScDAL22-deltalP fragment to prepare a P ScDAL23 vector (FIG. 11). ). Construction of the ScDAL24 Vector
- a sigma "UP" fragment was amplified with Pfu DNA polymerase from S. cerevisiae genomic DNA as a template, and the primer sequence used was as follows: sense primer (including Kpnl position), 5 '-GGGGGTACCTG GTATCTCAAAATGAGATATG-3' And antisense primers (including Xhol position), 5'-GGGCTCGAGCTCGGATCTAAACTAAnGnCAG-3 '.
- the P- SCDAL22-sigmaUP vector was prepared by purifying the PCR-amplified fragment, cloning it in a Topo vector, sequencing, and cloning the fragment obtained by Kpnl and Xhol cleavage into a Kpnl / Xhol-cut pScDAL22 fragment.
- GGGCCGCGGAnCCGCGOTCCACCACTTAGTA-3 'and antisense primer (including Sacl position), 5'-GGGGAGCTCTGnGTAmCGGGCTGGAGTAATACC-3'.
- the PCR-amplified fragments were purified, cloned into Topo vectors and sequenced, followed by SacII and Sacl.
- the pScDAL24 vector was prepared by cloning the fragment obtained by cleavage into a SacII / SacI-cleaved pScDAL22 ′ sigmaUP fragment (FIG. 12).
- the P ScDAL22-tauUP vector was prepared by purifying the PCR-amplified fragment, cloning into a Topo vector, and then sequenced, followed by cloning of the fragment obtained by Kpnl and Xhol cleavage into a Kpnl / Xhol—cut pScDAL22 fragment.
- Tau "DN" fragments were amplified with Pfu DNA polymerase from S. cerevisiae genomic DNA as a template, wherein the primer sequences used were as follows: sense primers (including SacII positions), 5 '-
- the PCR-amplified fragment was purified and cloned into the Topo vector, sequenced, and the pScDAL25 vector was prepared by cloning the obtained SacII and Sacl cleavage fragments into the SacII / SacI-cut pScDAL22-t auUP fragment (FIG. 13). .
- a P ScDAL22_ETS3_ ⁇ DFG5 vector was prepared by cloning the ETS3 gene (Republic of Korea Patent Publication No. 12010-0101739) in the MCS of the pScDAL22 vector.
- the "UP” and “DN” fragments in the pScDAL22—ETS3 vector were designed to correspond to the N-terminus and C-terminus of the DFG5 gene, respectively.
- the DFG5 "UP" fragment was amplified with Pfu DNA polymerase from S. cerevisiae genomic DNA as a template, wherein the primer sequence used was as follows: sense primer, 5'-CCGCGTAAAGCGAAACTGAGTATAACCC-3 '; and Antisense primer, 5'-TCATTGTCGGTGTCGTTATCGA— 3 '.
- the PCR-amplified fragment was purified, cloned into a Topo vector, sequenced, and the pScDAL22_ETS3_DFG5UP vector was prepared by cloning the fragment obtained by Kpnl and Xhol cleavage into a Kpnl / Xhol-cut pScDAL22_ETS3 fragment.
- the primer sequence used was as follows: sense primer 5'-CGCCTCGACATCATCTGCCCAG-3 '; and antisense primer, 5'-GGGGGAGCTCCAGCATCCACACAGCCCCACCAG-3'.
- the PCR-amplified fragment was purified, cloned into the Topo vector, sequenced, and the pScDAL22_ETS3— ⁇ vector was prepared by cloning the fragment obtained by SacII and Sacl cleavage into a SacII / SacI-cleaved pScDAL22_ETS3_DFG5UP fragment (FIG. 14A).
- the pScDAL22 ′ ETS3_ADFG5 vector prepared above was transformed into S. cerevisiae and integrated at the DFG5 gene position in S. cerevisiae genomic DNA. As a result, it was confirmed that PCR was stably integrated into the genome of S. cerevisiae (Figs. 15A-15C and Table 1).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Mycology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 효모 형질전환용 신규한 이중 모듈 발현 벡터(dual module expression vector) 및 이를 이용한 목적 뉴클레오타이드 서열의 형질전환 방법에 관한 것이다. 본 발명의 발현 모듈은 멀티 클로닝 위치(multiple cloning site, MCS), 적합한 프로모터 및 터미네이터(terminator)를 포함하는 발현 모듈(expression module) 및 레스큐 모듈(rescue module)을 포함한다. 본 발명의 벡터는 효모, 구체적으로는 클루이베로미세스 막시아누스(Kluyveromyces marxianus) 또는 사카로마이세스 세레비지애(Saccharomyces cerevisiae)에서 목적 유전자를 안정적으로 발현시킬 수 있을 뿐 아니라, 염색체 내 특정 위치로 목적 유전자를 고효율로 통합시킬 수 있다. 본 발명의 벡터를 이용한 형질전환 방법은 안정적으로 목적 유전자를 안정적으로 염색체로 통합시킨 형질전환 효모 스트레인을 제작한 후 상기 효모 스트레인에 또 다른 목적 유전자의 변형을 유발시키는 연속적인 형질전환이 가능함에 따라, 소망하는 산물들(바이오매스)의 산업적 생산에 매우 유용하게 적용될 수 있다.
Description
【명세서】
【발명의 명칭】
효모 염색체 통합 또는 업 스트레인 형질전환용 효모 발현 백터, 그리고 이들의 용도
【기술 분야】
본 발명은 염색체 통합 또는 안정적인 에피좀 효모 발현 백터용 효모 발현 백터 및 이의 용도에 대한 것이다.
【배경 기술】
유전자 기능을 연구하기 위한 추가적인 대사공학 (metabolic engineering)으로서, 사카로마이세스 세레비지애 ( 5accaAro/»yces cere /s/ae)에서 이종 또는 자가 유전자 발현이 대량으로 경제적 가치를 가지는 물질의 생산하거나 또는 숙주세포의 물리화학적 특성을 증진시킬 수 있다 (Nevoigt, 2008). 이것은 다른 영양요구 돌연변이체 (auxotrophic mutants) 및 목적 유전자가 다양한 프로모터의 조절 하에 위치하여 자가적으로 복제하는 적합한 선택마커를 가진 플라스미드가 유용하기 때문에 실험실 스트레인들에서 용이한 일이다. 잘—알려진 프로모터를 포함하는 플라스미드의 이용과 관련된 문제들 중 하나는 산업적 적용에서 효모 배양을 위해 임의대로 선택할 수 없는 선택 압력 (selection pressures)의 지속적인 존재에도 불구하고 카피 수를 조절할 수 없음으로 인해 야기되는 발현 상에 세포 -세포 이질성 (cell -cell heterogeneity)이다. 따라서, 선택 압력의 부재 (즉, 상동 재조합에 의한 염색체로의 통합) 하에서 유전자의 안정적인 발현 및 유지는 매우 중요한 문제이다.
、 유전자 통합은 rRNA 유전자 (Lopes et al. , 1969; Fuj i i et al. , 1990) 및 시그마 (Kudla et al. , 1992) 또는 델타 서열 (Sakai et al. , 1990; Lee et al ., 1997; Ekino et al. , 2002; Oliviera et al. , 2007) 같은 지놈 상의 특정 위치로 타겟팅된다. 상기 서열들이 효모 지놈 전반에 걸쳐서 많은 곳에서 존재하기 때문에, 여러 카피의 삽입된 유전자를 포함하는 스트레인이 발생할 수 있다. 세포ᅳ세포 이질성을 희피했을 지라도, 이
전략은 삽입된 유전자의 카피 수를 조절하여 시작부터 발현 레벨을 조절하는 데 유사한 문제를 일으킬 수 있는데, 예를 들어 적정 레벨로 삽입된 유전자를 발현시키는 클론의 추가적인 선택이 필요하다. 더욱이, 발현된 단백질 레벨이 항상 유전자 카피 수와 상관관계를 가지지 않는다 (Moriya et al., 2006) . 이런 점으로 인해, 삽입된 유전자의 단백질 산물이 양적 또는 기능적으로 상응하는 야생형 유전자의 단백질보다 크게 우세하지 않는다면 변형된 유전자들 (예컨대, 돌연변이)에 대한 기능 분석이 어려운 것이다. 이런 측면에서 유전자 대체 (replacement)는 간결한 방식으로 원하는 위치로의 정밀한 통합 타겟팅 (integrative targeting)하기 위한 선택수단일 수 있다. 최근에, 특정 유전자의 고유의 프로모터가 다른 유전자의 다른 강도를 가지는 유전적으로 변형되거나 또는 천연의 프로모터로 대체되어 졌다 (Verstrepen et al ., 2004; Nevoigt et al., 2006).
예를 들어, Nevoigt 등 (2006)은 S. 세레비지애용 재생산용 프로모터 대체 카세트 (reusable promoter replacement cassette)'를 보고하였다. 상기 컨스트럭트에서 선택마커는 박테리아 ΙοχΡ 서열 쌍 간에 위치한다. 이후, 선택마커가 Cre 단백질에 의해 매개되는 상동재조합을 통해 제거될 수 있다. 또 다른 선택적인 수단은 Ura-블라스터 카세트 (Ura— blaster cassette) 또는 URA3-dpl200 카세트이다. Ura-블라스터는 원래 칸디다 알비칸스 albicans) 같은 무성생식 배수체 (diploid) 미생물에서 성공적으로 타켓팅된 유전자의 파괴를 위해 개발되었다 (Alani and Kleckner, 1987; Fonzi and Irwin, 1993; Pla et al . , 1996) . 상기 카세트는 C. 알비칸스 U A3 카피 (hisG-U A3-hisG)에 의해 분리된 살모넬라 hisG 유전자의 반복서열 (direct repeats)를 포함한다.
상술한 바와 같이, 변형된 유전자의 0RF(open reading frame; 또는 다른 강도의 프로모터와 함께)를 대체함으로써 변형된 형태만의 효과를 조사하는 것이 바람직하다. 대부분의 경우, 통합된 클론들의 선택은 통합 백터에 의해 제공되는 특정 영양성분 (nutrients)의 부재 하에서 성장하는 세포의 능력에 의존한다. 이론적으로, 많은 유전자 통합은 여러 영양요구 돌연변이를 가진 스트레인에서 획득될 수 있다. 하지만 특별한 경우 산업적 미생물에 영양요구 돌연변이를 도입함으로써 얻어질 수 있는데,
이러한 돌연변이가 필요한 영양성분을 보층하는 필요한 증가된 배양 비용 이외에도 세포 생리상태 (physiology)에 영향을 미칠 수 있기 때문이다. 따라서, 재생산할 수 있는 통합 백터는 단일 영양요구 돌연변이를 가진 산업적 미생물에서 상술한 목적을 달성하기 위한 강력한 수단으로 당업계에서 시급히 요구되고 있는 실정이다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 상세한 설명】
본 발명자들은 효모에서 목적 유전자들을 연속적으로 전달할 수 있거나 또는 안정적으로 발현하고 형질전환시킬 수 있는 고효율 발현 시스템을 개발하고자 노력하였다. 그 결과, 본 발명자들은 신규한 이중 모들 플라스미드 (dual module plasmids; 발현 모들 (expression module) 및 레스큐 모들 (rescue module))를 개발하고 이를 이용하여 목적 유전자를 효모 (바람직하게는, 사카로마이세스 세레비지애 (5aca¾ari¾»yces cerevisiae) 또는 클루이베로미세스 막시아누스 Vz/yve/ /ziFces maxianus))^ 형질전환시켜 안정적으로 발현시킬 수 있다는 것을 확인함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 효모 발현백터 (yeast expression vector)를 제공하는 데 있다.
본 발명의 다른 목적은 염색체 통합용 효모 발현백터를 제공하는 데 있다.
본 발명의 또 다른 목적은 상술한 백터를 이용한 효모에서 하나 이상의 목적 뉴클레오타이드 서열들의 연속적 형질전환 방법을 제공하는 데 있다. 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 양태에 따르면, 본 발명은 (a) 자가복제 서열 (autonomous replicating sequence); (b) ( i ) KmPCLP3 ( Kluyvero yces maxianus purineᅳ cytosine-like-permease 3) 프로모터 (PCLPpro) , ( ii ) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) KmPCLP3 터미네이터 (terminator; PCLPter)를 포함하는 발현 모들 (expression module); 및 (c) ( i ) 선택 마커 (select ion marker); 및 ( ii ) 상기 선택 마커의 양쪽 말단에 결합된 ΐοχρ 서열을 포함하는 레스큐 모들 (rescue module; loxP-select ion marker-loxP)을 포함하는 효모 발현백터 (yeast expression vector)를 제공한다.
본 발명의 다른 양태에 따르면, 본 발명은 (a) 센트로미어 서열 (centromere sequence); (b) 목적 유전자의 업스트림 플탱킹 서열 (upstream flanking sequence)과 상동적인 서열; (c) ( i ) KinPCLP3 ( Kluyveromyces maxianus pur ine-cytosine-1 ike-permease 3) 프로모터 (PCLPpro), (ii) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) KmPCLP3 터미네이터 (terminator; ?(∑1 „)를 포함하는 발현 모들 (expression module); 및 (d) ( i ) 선택 마커 (selection marker); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 ΙοχΡ 서열을 포함하는 레스큐 모듈 (rescue module; loxP-select ion marker- loxP); (e) 목적 유전자의 다운스트림 플탱킹 서열과 상동적인 서열을 포함하는 염색체 통합용 효모 발현백터 (yeast expression vector)를 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 센트로미어 서열 (centromere sequence); (b) 목적 유전자의 업스트림 플탱킹 서열 (upstream flanking sequence)과 상동적인 서열 (UP 단편); (c) ( i ) ScTDH3 ( Saccharomyces cerevisiae glyceraldehydeᅳ 3ᅳ phosphate dehydrogenase 3)의 프로모터, ( ii ) 멀티 클로닝 위치 (隱 ltiple cloning site, MCS) 및 (iii) ScGAL7 의 터미네이터 (terminator )를 포함하는 발현 모들 (expression module); 및 (d) ( i ) 선택 마커 (selection marker); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 loxP 서열을 포함하는 레스큐 모들 (rescue module; loxP-select ion marker- loxP); (e) 목적 유전자의 다운스트림 플탱킹 서열과 상동적인 서열 (DOWN 단편)을 포함하는 염색체 통합용 효모 발현백터 (yeast expression vector)를 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 다음의 단계를 포함하는 효모에서 하나 이상의 목적 뉴클레오타이드 서열들의 연속적 형질전환 방법을 제공한다: (a) 상술한 백터의 MCSOnultiple cloning site)에 목적 뉴클레오타이드 서열을 클로닝하는 단계; (b) 상기 백터를 효모에 형질전환시키는 단계; (c) 상기 형질전환된 효모에서 Cre 리콤비나제에 의한 레스큐를 유도하는 단계; 및 (d) 상기 단계 (a) 내지 (c)를 다른 목적 뉴클레오타이드 서열로 반복적으로 실시하는 단계 . 본 발명자들은 효모에서 목적 유전자들을 연속적으로 전달할 수 있거나 또는 안정적으로 발현하고 형질전환시킬 수 있는 고효율 발현 시스템을 개발하고자 노력하였다. 그 결과, 본 발명자들은 신규한 이중 모들 플라스미드 (dual module plasmids; 발현 모들 (expression module) 및 레스큐 모들 (rescue module))를 개발하고 이를 이용하여 목적 유전자를 효모 (바람직하게는, 사카로마이세스 세레비지애 (5accA r(¾ ces cerevisiae) 또는 클루이베로미세스 막시아누스 "^rc¾zyces maxianu쒜0 형질전환시켜 안정적으로 발현시킬 수 있다는 것을 확인하였다.
효모는 경제적으로 관심을 끄는 외래 단백질 및 다른 산물들의 생산에 폭넓게 이용되어 왔다. 사카로마이세스 세레비지애 (5a« arOT?y«?s cerevisiae)는 오랜 기간 동안 산업적으로 이용되어져 왔으며, 이 외에도 다른 효모들이 소망하는 산물들의 생산에 보다 더 적합할 수 있는 장점들을 가진다. 또한, 생명공학적 방법을 위해 유익한 특징들을 가지고 있는 속이 클루이베로미세스 V/yre ^ces) 효모종이다. K. s E ^ ( Kluyveromyces 1 act is) 및 K. 막시아누스 ( /wyye c ces1 marxianus) 효모는 GRAS(Generally Recognized As Save)로서 분류되어 사카로마이세스와 동일한 안정성을 가지고 이용될 수 있다.
본 발명의 백터는 자가복제서열 (센트로미어서열), 발현 모들 (expression module) 및 레스큐 모들을 포함한다.
본 발명의 백터는 자가복제서열을 통해 목적 유전자를 안정적으로 효모 세포에서 발현시킬 수 있다.
자가복제서열 (ARS)은 효모 게놈의 복제 기원을 포함한다. 상기 효모 게놈의 복제 기원은 4 개의 부위 (A, Bl, B2 및 B3)를 포함하며,
플라스미드의 안정성을 부여한다. 일반적으로, 자가복제서열은 A-T 풍부 서열을 가지며, 상기 복제 기원이 돌연변이 되거나 또는 소실된 경우, 복제가 개시되지 않는다. 특히, 엘리먼트 A 는 매우 높은 보존성을 가지며 (보존 서열, 5'- T/A T T T A Y R T T T T/A -3'; Y 는 피리미딘계 염기 및 R 은 퓨린계 염기) 돌연변이가 발생하는 경우에 자가복제서열의 복제 개시능이 완전히 사라진다. 또한, 엘리먼트 Bl, B2 및 B3 에서 돌연변이가 발생하는 경우, 자가복제서열의 복제 개시능이 감소한다.
또한, 효모 게놈에서 자가복제서열은 센트로미어 서열과 병치되어 존재하기 때문에, 센트로미어 서열을 포함하는 본 발명의 발현백터는 효모 생리학에 기초한 에피좀 백터의 소실의 문제점도 해결할 수 있다.
본 발명의 일 구현예에 따르면, 본 발명의 백터가 적용될 수 있는 효모는 클루이베로미세스 종 Khiyveromyces spp . ) , 사카로마이세스 ( Saccharomyces sp . ) , Λ12^^}^}^} °]세스 ( Schi zosaccharomyces spp.), 피키아 종 Pichia spp.), 파피아 ^ Paffia spp.), 칸디다 ^{Candida spp.), 탈라로미세스 종 {Talaromyces spp.), 브레타노미세스 { Brett anomyces spp.), 파 7];솔렌 ^-{Pachysolen spp.) 또는 데바리오미세스 종 Debaryomyces spp.)을 포함하며, 보다 구체적으로는 클루이베로미세스 종 또는 사카로마이세스 종을 포함하고, 보다 더 구체적으로는 클루이베로미세서 막시아누스 또는 사카로마이세스 세레비지애를 포함한다.
본 발명의 일 구현예에 따르면, 본 발명의 발현백터는 (i) KmPCLP3 ( Kl uyveromyces max i anus pur i ne~cyt os i ne- 1 i ke-permease 3 ) 프로모터 (PCLPpro) , (ii) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) KmPCLP3 터미네이터 (terminator; PCLPter)를 포함하는 발현 모듈 (expression module); 및 (c) ( i ) 선택 마커 (selection marker ); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 loxP 서열을 포함하는 레스큐 모들 (rescue module; loxP-select ion marker-loxP)을 포함한다.
보다 상세하게는, 본 발명의 백터는 ( i ) 발현대상물질을 인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 구체적으로는 효모세포에서 작용하여 RNA 분자를 형성시키는 프로모터를 포함하며, 보다 더 구체적으로는 ( i )
발현대상물질을 인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 구체적으로는 효모세포에서 작용하여 RNA 분자를 형성시키는 mPLCP3 의 프로모터; 및 (iii) 상기 동물세포, 구체적으로는 효모세포에서 작용하여 상기 RNA 분자의 31-말단의 폴리아데닐화를 야기시키는 3'-비-해독화 부위, 구체적으로는 KmPLCP3 의 터미네이터를 포함하는 발현백터, 또는 ( i ) 발현대상물질을 인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 구체적으로는 효모세포에서 작용하여 RNA 분자를 형성시키는 KmPCLP3 의 프로모터; 및 (iii) 상기 동물세포, 구체적으로는 효모세포에서 작용하여 상기 RNA 분자의 3'-말단의 폴리아데닐화를 야기시키는 3'-비-해독화 부위, 구체적으로는 KmPaP3 의 터미네이터를 포함하는 발현백터를 포함한다.
본 발명의 '백터에서, 상기 멀티 클로닝 위치는 발현대상물질을 인코딩하는 뉴클레오타이드 서열을 클로닝하는 위치로 기능하며, 구체적으로는 3개의 제한효소 위치 (5a/I, EccRl 및 Ban )를 포함한다. 본 발명의 일 구현예에 따르면, 본 발명의 발현 모들 (expression module)은 ScTDH 프로모터, (ii) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) GAL7 터미네이터 (terminator)를 포함하는 발현 모들 (expression module); 및 (c) ( i ) 선택 마커 (selection marker ); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 loxP 서열을 포함하는 레스큐 모들 (rescue module; loxP-select ion markerᅳ loxP)을 포함한다.
보다 상세하게는, 본 발명의 백터는 ( i ) 발현대상물질을 인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 구체적으로는 효모세포에서 작용하여 RNA 분자를 형성시키는 프로모터를 포함하며, 보다 더 구체적으로는 ( i ) 발현대상물질을 인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 구체적으로는 효모세포에서 작용하여 RNA분자를 형성시키는 ScTDH3의 프로모터; 및 (iii) 상기 동물세포, 구체적으로는 효모세포에서 작용하여 상기 RNA 분자의 3'- 말단의 폴리아데닐화를 야기시키는 3'—비-해독화 부위, 구체적으로는 GAL7 의 터미네이터를 포함하는 발현백터, 또는 ( i ) 발현대상물질을
인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 구체적으로는 효모세포에서 작용하여 RNA 분자를 형성시키는 ScTDH3 의 프로모터; 및 (iii) 상기 동물세포, 구체적으로는 효모세포에서 작용하여 상기 RNA 분자의 3'-말단의 폴리아데닐화를 야기시키는 3'-비-해독화 부위, 구체적으로는 GAL7 의 터미네이터를 포함하는 발현백터를 포함한다.
본 발명의 백터에서, 상기 멀티 클로닝 위치는 발현대상물질올 인코딩하는 뉴클레오타이드 서열을 클로닝하는 위치로 기능하며, 구체적으로는 3개의 제한효소 위치 EccRl 및 BanR )를 포함한다. 본 명세서에서 용어 "프로모터" 는 코딩 서열 또는 기능적 RNA 의 발현을 조절하는 DNA 서열을 의미한다. 본 발명의 제조합 발현백터에서 발현대상물질 -코딩 뉴클레오타이드 서열은 상기 프로모터에 작동적으로 연결된다. 본 명세서에서 용어 "작동적으로 결합된 (operatively linked)" 은 핵산 발현 조절 서열 (예: 프로모터 서열, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열 사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및 /또는 번역을 조절하게 된다.
본 발명의 레스큐 모들은 효모 선택마커로서 기능하는 항생제 저항성 유전자 (예를 들어, ΝΡΤΠ 유전자)를 포함한다ᅳ 본 발명에 따르면, 본 발명의 백터를 이용한 형질전환에 있어서 선택마커로서 loxP— kanMX— ΙοχΡ 컨스트럭트를 이용한다. 따라서, 본 발명의 백터로 형질전환된 효모 스트레인은 항생제 (예를 들어, G418)-포함 배지에서 성장할 수 있다. 즉, 본 발명의 백터가 효모 내로 형질전환됨에 따라 형질전환된 효모 스트레인이 항생게ᅳ포함 배지에서 선택된다.
또한, 본 발명의 백터는 목적 유전자의 업스트림 및 다운스트림 플탱킹 서열 (upstream flanking sequences)과 상동적인 서열을 이용하여 본 발명의 목적 유전자를 효모 염색체 상에 연속적으로 통합 (integration)시킬 수 있다. 보다 상세하게는, 본 발명의 발현백터 내 발현 모들의 업스트림과 레스큐 모들의 다운스트림에 목적 유전자 단편의 플탱킹 서열 (flanking sequence)을 추가적으로 포함시킨다. 상기 플탱킹 서열과 상보적인 서열은 염색체 상의 상기 목적 유전자 단편과의
상동재조합 (homologous recombination)을 통해 염색체 상으로 본 발명의 이중 모들 컨스트릭트 (발현 모들 및 레스큐 모들; 바람직하게는, 목적 유전자 및 ΙοχΡ-kanMX-loxP 컨스트럭트)를 통합시킨다. 상기 컨스트럭트가 통합된 효모 스트레인을 레스큐 모들 내에 존재하는 선택 마커 (바람직하게는, G418 에 대한 저항성 )에 따라 분리 /동정한 후, 상기 2 개의 ΙοχΡ 서열을 인지하여 ΙοχΡ 서열 사이의 부위를 제거하는 Cre 리콤비나제 (recombinase) 활성을 이용하여 레스큐 모들을 제거한다. 따라서 , 상기 목적 유전자가 아닌 다른 목적 유전자를 포함하는 본 발명의 백터를 이용하여 상기 형질전환된 효모 스트레인의 염색체 상에 다른 위치의 목적 유전자를 타겟팅하는 형질전환을 실시할 수 있다. 그 결과, 서로 다른 2 개의 목적 유전자를 연속적으로 변형시킨 형질전환 효모 스트레인을 제조할 수 있다. 상술한 바와 같이, Cre 리콤비나제를 이용한 레스큐 과정을 반복적으로 실시함으로써, 하나 이상의 목적 유전자를 변형시킨 형질전환 효모 스트레인을 제조할 수 있다.
본 발명의 어떤 구현예에 따르면, 본 발명의 백터는 Cre 리콤비나제 (recombinase)에 의해 레스큐된다.
본 발명의 어떤 구현예에 따르면, 본 발명의 발현백터는 상기 발현 모들의 업스트림 및 레스큐 모들의 다운스트림에 존재하는 목적 유전자 단편의 플탱킹 서열 (flanking sequence)과 상동적인 서열과 염색체 상의 상기 목적 유전자 단편과의 상동재조합 (homologous recombinat ion)을 통해 발현 모들 및 레스큐 모들이 염색체 상으로 통합된다.
본 발명의 어떤 구현예에 따르면, 본 발명의 발현백터에서 이용될 수 있는 UP 단편 및 DOWN 단편은 리보좀 DNA 또는 트랜스포존으로부터 유래한 서열이고, 보다 구체적으로는 Ty(transposon-yeast) 엘리먼트로부터 유래한 서열이다.
본 발명의 어떤 구현예에 따르면, 본 발명의 발현백터에서 이용될 수 있는 Ty transposonᅳ yeast) 엘리먼트는 Tyl, Ty2, Ty3, Ty4 및 Ty5 로 구성된 군으로부터 선택된 앨리먼트를 포함하지만, 이에 한정되는 것은 아니다.
본 발명의 어떤 구현예에 따르면, 본 발명의 발현백터는 상기 UP 단편 및 DOWN 단편과 염색체 상의 상기 단편과의 상동재조합 (hanologous
recombination)을 통해 발현 모듈 및 레스큐 모들이 염색체 상으로 통합된다.
본 발명의 효모 선택마커 유전자는 당업계에 공지된 다양한 선택마커 유전자를 이용할 수 있으며, 예를 들어, NPTII(Neomycin phosphotransferase 11), UAR3, LEU2, HIS3, TRP1, ADE2 및 LYS2 같은 영양요구성 (auxotrophic) 선택마커 유전자를 포함하지만, 이에 한정되는 것은 아니다. 보다 구체적으로는, 효모 선택마커 유전자는 NPTII 이다. ^택적으로, 본 발명은 효모 선택마커로서 이용될 수 있는 숙주세포 상에 약물 저항성 (drug resistance)를 부여하는 단백질을 인코딩하는 유전자를 이용할 수 있고, 예를 들어 CAN1 및 CYH2 를 포함하지만, 이에 한정되는 것은 아니다.
또한, 본 발명의 발현백터가 진핵세포, 구체적으로는 효모 세포에 적용되는 경우, 이용될 수 있는 프로모터는, 본 발명의 발현대상물질의 전사를 조절할 수 있는 것으로서, 효모 세포에서 유래된 프로모터, 포유동물 바이러스로부터 유래된 프로모터 및 포유동물 세포의 지놈으로부터 유래된 프로모터를 포함하며, 예컨대, 효모 (X marxianus) PCLP3 ( ur i ne-cy t os i ne- 1 i ke permease 3) 프로모터, 효모 (5. cerevisiae) TDH3 ( g 1 ycer a 1 dehyde-3-phospha t e dehydrogenase 3)의 프로모터, 효모 (5. cerevisiae) GAPDH ( G 1 ycer a 1 dehyde 3-phosphate dehydrogenase) 프로모터, 효모 (5. cerevisiae) GAL1 내지 GAL10 프로모터, 효모 (/ ?/a pastor is) A0X1 또는 A0X2 프로모터, CMV cyt omega lo virus) 프로모터, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, HSV 의 tk 프로모터 RSV 프로모터 , EF1 알파 프로모터, 메탈로티오닌 프로모터, 베타 -액틴 프로모터, 인간 IL-2 유전자의 프로모터 인간 IFN 유전자의 프로모터 , 인간 IL— 4 유전자의 프로모터 , 인간 림포톡신 유전자의 프로모터 및 인간 GM— CSF 유전자의 프로모터를 포함하나 이에 한정되는 것은 아니다. 보다 구체적으로는, 효모 PCLP3 또는 TDH3 의 프로모터이다.
구체적으로는, 본 발명에 이용.되는 발현 카세트는 폴리 아네닐화 서열을 포함한다 (예: PCLP3 터미네이터, ADH1 터미네이터, 소성장 호르몬 터미네이터 및 SV40 유래 폴리 아데닐화 서열).
본 발명의 백터를 숙주 세포 내로 운반하는 방법은 당업계에 공지된 다양한 방법들을 이용할 수 있으며, 예를 들어 숙주 세포가 원핵 세포인 경우, CaCl2 방법 (Cohen, S.N. et al . , Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), 하나한 방법 (Cohen, S.N. et al. , Proc. Natl. Acac. Sci . USA, 9:2110-2114(1973); 및 Hanahan, D. , J. Mo I. Biol. , 166: 557- 580(1983)) 및 전기 천공 방법 (Dower, W.J. et al . , Nucleic. Acids Res. , 16:6127-6145(1988)) 등에 의해 실시될 수 있으며, 진핵세포인 경우, 트랜스덕션 (transduction), 전기천공법 (electroporat ion), 리포펙션 (lipofection), 마이크로인젝션, 유전자총 (part icle bombardment ) , YAC 에서 이용되는 효모 구형질체 /세포 융합, 식물세포에서 이용되는 아그로박테리움—매개된 형질전환 등을 이용하여 실시할 수 있다. 이때, 박테리아 복제 개시점은 긴 DNA 삽입물 (inserts)의 안정적인 박테리아 복제에 유용한 당업계에 잘 알려진 복제 개시점들로부터 선택될 수 있으며, ColEl, F—인자 (F-factor) 및 P1 레플리콘 (replicon)올 포함하지만, 이에 한정되는 것은 아니다. 본 발명의 박테리아 선택마커는 당업계에 알려진 박테리아 선택마커 유전자를 이용할 수 있다. 예를 들어, 박테리아 선택마커 유전자는 암피실린, 카나마이신, 테트라사이클린, 제오신, 네오마이신, 하이그로마이신 및 클로람페니콜 같은 항생제에 대한 저항성을 부여하는 유전자들을 포함하지만, 이에 한정되는 것은 아니다. '
본 발명의 백터를 이용하여 형질전환된 효모 세포의 제조는 당업계에 통상적으로 공지된 유전자 전이방법에 의해 실시될 수 있다. 예를 들어, 전기천공법 (electroporat ion), 리튬 아세테이트 /DMS0 방법 (Hi 11, J., et al ., (1991) , DMS으 enhanced whole eel 1 yeast trans format ion. Nucleic Acids Res. 19, 5791), 리포좀 -매개 전이방법 (Wong, et al . , 1980), 레트로바이러스 -매개 전이방법 (Chen, H.Y., et al. , (1990), J. Reprod. Fert. 41:173-182; Kopchick, J.J. et al. , (1991) Methods for the introduct ion of recombinant DNA into chicken embryos . In Transgenic Animals, ed. N.L. First & F.P. Haseltine, pp.275-293, Boston; But t er wor t h-He i nemann; Lee, M.- . and Shuman , R. (1990) Proc. 4th World Congr . Genet . Appl. Livestock Prod. 16, 107-110) 등을 이용하여 실시할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 어떤 구현예에 따르면, 상술한 형질전환은 클루이베로미세스 ^ Kluyveromyces spp.), 사카로마이세스 종 ( Saccharo yces spp · ), 시조사카로마이세스 종 ( Schi zosaccharomyces spp.), 피키아 ^ Pichia spp.), 파피아 종 ¾/7/3 spp.), 칸디다 종 {Candida spp.), 탈라로미세스 종 {Talaromyces spp.), 브레타노미세스 ^ ( Bret tanomyces spp.), 파키솔렌 ^-{Pachysolen spp. ) 또는 데바리오미세스 ^U)ebaryomyces spp.) 효모 스트레인에서 실시하며, 보다 구체적으로는 클루이베로미세스 종 또는 사카로마이세스 종에서 실시하고, 보다 더 구체적으로는 클루이베로미세스 막시아누스 또는 사카로마이세스 세레비지애에서 실시한다. 본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 효모용 신규한 이중 모들 발현 백터 (dual module expression vector) 및 이를 이용한 목적 뉴클레오타이드 서열의 형질전환 방법에 관한 것이다.
(b) 본 발명의 발현 모들은 멀티 클로닝 위치 (multiple cloning site MCS), 적합한 프로모터 및 터미네이터 (terminator)를 포함하는 발현 모들 (expression module) 및 레스규 모들 (rescue module)을 포함한다.
(c) 본 발명의 백터는 효모, 바람직하게는 클루이베로미세스 막시아누스 Vi/y ero yces marxianus) 또는 사카로마이세스 세레비지애 (5ac ?aroffl ces cere s/ae)에서 목적 유전자를 안정적으로 발현시킬 수 있다.
(d) 또한, 본 발명의 백터는 효모, 바람직하게는 사카로마이세스 세레비지애 또는 클루이베로미세스 막시아누스에서 염색체 내 특정 위치로 목적 유전자를 고효율로 통합시킬 수 있다ᅳ
(e) 본 발명의 백터를 이용한 형질전환 방법은 안정적으로 목적 유전자를 안정적으로 염색체로 통합시킨 형질전환 효모 스트레인을 제작한 후 상기 효모 스트레인에 또 다른 목적 유전자의 변형을 유발시키는 연속적인 형질전환이 가능함에 따라, 소망하는 산물들 (바이오매스)의 산업적 생산에 매우 유용하게 적용될 수 있다.
【도면의 간단한 설명】
도 1 은 pKMEXll 벡터 맵을 도식적으로 나타내는 도면이다. 상기 플라스미드 pKMEXll 은 pBluescript SKII(Stratagene)의 백본에서 구축되었으며, 자가복제서열 (autonomous repeating sequence , ARS2)와 멀티 클로닝 위치 (multickming site) 내 제한효소 위치를 포함한다.
도 2 는 pKMEX12 백터 맵을 도식적으로 나타내는 도면이다. 발현 모들은 상기 pKMEXll 의 Xhol 과 Notl 사이트에 삽입되었다. 약어: Pro, 프로모터; CS, 목적 뉴클레오타이드 클로닝 사이트; 및 Ter, 터미네이터. 도 3 은 pKMEX13 백터 맵을 도식적으로 나타내는 도면이다. 레스큐 모들 (rescue module; loxP— kanMX-loxP)은 상기 pKMEXll 의 Notl 과 SacII 사이트에 삽입되었다.
도 4 는 pKMEX14 백터 맵을 도식적으로 나타내는 도면이다. 상기 플라스미드 pKMEX14는 pKMEX12 로부터 얻어진 발현 모들 단편을 pKMEX13 에 삽입함으로써 제조하였다.
도 5 는 pKMEX21 백터 맵을 도식적으로 나타내는 도면이다. 상기 플라스미드 pKMEXll 은 pBluescript SKI I (Stratagene)의 백본에서 구축되었으며, 센트로미어 서열 (centromere sequence, CE B/ARS2)와 멀티 클로닝 위치 (multicloning site) 내 제한효소 위치를 포함한다.
도 6 은 pKMEX22 백터 맵을 도식적으로 나타내는 도면이다. 발현 모들은 상기 pKMEX21 의 Xhol 과 Notl 사이트에 삽입되었다. 약어: Pro, 프로모터; MCS, 목적 뉴클레오타이드 멀티클로닝 사이트; 및 Tei\ 터미네이터.
도 7 은 pKMEX23 백터 맵을 도식적으로 나타내는 도면이다. 레스큐 모들 (rescue module; loxP— kan -loxP)은 상기 pKMEX21 의 Notl 과 SacII 사이트에 삽입되었다.
도 8 은 PKMEX24 백터 맵을 도식적으로 나타내는 도면이다. 상기 플라스미드 pKMEX24 는 pKMEX22 로부터 얻어진 발현 모들 단편을 pKMEX23 에 삽입함으로써 제조하였다.
도 9 는 pScDAL21 백터 맵을 도식적으로 나타내는 도면이다. 상기 플라스미드 pKMEXll 은 pBluescript SKI I (Stratagene)의 백본에서 구축되었으며, CEN6 및 자가복제서열 (autonomc s repeating sequence , ARS),
012011772
E. coli 복제기원점, 발현 모들 (expression module) 및 멀티 클로닝 위치 (multicloning site) 내 제한효소 위치를 포함한다.
도 10 은 pScDAL22 백터 맵을 도식적으로 나타내는 도면이다. 상기 백터는 발현 모들 (expression module) 및 레스큐 모들 (rescue module)을 포함한다.
도 11 은 pScDAL23 백터 맵을 도식적으로 나타내는 도면이다. 상기 백터에서 델타 "UP" 및 델타 "DOWN" 단편은 각각 발현 모들의 업스트림 및 레스큐 모들의 다운스트림에 위치한다.
도 12 는 pScDAL24 백터 맵을 도식적으로 나타내는 도면이다. 상기 백터에서 시그마 "UP" 및 시그마 "DOWN" 단편은 각각 발현 모들의 업스트림 및 레스큐 모들의 다운스트림에 위치한다.
도 13 은 pScDAL25 백터 맵을 도식적으로 나타내는 도면이다. 상기 백터에서 타우 "UP" 및 타우 "DOWN" 단편은 각각 발현 모듈의 업스트림 및 레스큐 모들의 다운스트림에 위치한다.
도 14 는 pScDAL22_ETS3ᅳ ADFG5 백터 맵 (14a) 및 이를 이용한 염색체 통합 과정 (14b)을 도식적으로 나타내는 도면이다. 상기 백터에서 DGF5 "UP" 및 DGF5 "DOWN" 단편은 각각 발현 모들의 업스트림 및 레스큐 모들의 다운스트림에 위치한다. 형질전환 후, pScDAL22_ETS3_ADFG5 백터 내 상기 DGF5 "UP" 및 DGF5 "DOWN" 단편에 의해 S. 세레비지애 게놈 내
DFG5 유전자 위치로 상동재조합 (homologous recombinat ion)을 통해 pScDAL22_ETS3_ADFG5 백터의 발현 모들과 레스큐 모들이 삽입 /통합된다.
도 15a-15c 는 S. 세레비지애 염색체에 통합된 본 발명의
PScDAL22_ETS3_ADFG5 백터를 확인한 결과이다. DGF5 "UP" (15b) 및
DGF5 "DOWN" 부위 (15c), 그리고 KanMX 부위 (15b)가 검출됨을 확인할 수 있었다. 본 발명의 발현 모들 및 레스큐 모들이 염색체에 통합된 스트레인들은 도 15b 및 도 15c 에서 각각 빨간 박스 및 노란 박스로 표시되어 있다ᅳ
【실시예】
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서,
본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 실시예
실험재료 및 실험방법
스트레인 및 배지
본 연구에서 이용된 S. 세레비지애는 BY4741( a a; his3A 1; leu2A 0; met 15 Δ 0; ^(National Collection of Yeast Cultures, UK) 및 신규한 스트레인들은 리튬 아세테이트 형질전환 (Burns et al . , 1994)을 통해 제조하였다. 분자생물학적 방법
클로.닝, 플라스미드 제조, 시퀀싱 및 웨스턴 블롯 분석은 이전에 기재된 바와 같이 실시하였다 (Sambrook and Russell, 2001). 모든 증폭된 DNA 단편들의 뉴클레오타이드 서열은 pGEM-T easy 백터 (Promega, Madison, WI, USA)에 클로닝한 후 시¾성하여 확인하였다. 지놈 DNA 및 세포 추출물의 제조
이전에 기술된 바와 같이, 지놈 DNA(Hoffman and Winston, 1987) 및 세포 추출물 (Choi, et al., 2003)을 중간 -로그 세포로부터 제조하였다.
PCR
PCR조건은 다음과 같다: 95°C, 1분; 60°C, 1분; 및 72°C , 증폭될 DNA 길이에 따라 적합한 연장 시간ᅳ 실험결과
pKMEXll 백터의 구축
클루이베로미세스 막시아누스 (/i/i/j^ro yces imrxianus^)^ 자가복제서열 (autonomous replicating sequence; KmARS2)는 K. 막시아누스 게놈 DNA를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며 , 이때 이용된
프라이머 서열 (PvuII 위치 포함)은 다음과 같다: 센스 프라이머, 5' - CAGCTGGATCCAAGTCTGAAGGTTGGTTTGGC-3 ' ; 및 안티센스 프라이머, 5' - CAGCTGGCTGGTAAGCCATCTTCATAGAGGG-3 ' . 상기 PCR-증폭된 863 bp 단편을 정제하여 pGem-T easy 백터 (Promega)에 클로닝한 후, 시퀀싱하였다. KmARS2 DNA 는 PvuII 절단을 통해 상기 플라스미드로부터 제조되었다. 한편, 530 및 975 번째 뉴클레오타이드에 PvuII 위치를 포함하는 pBluescript II SK 백터 (Stratagene)를 PvuII 로 불완전하게 절단시켜 단일- 컷된 2,958 bp 단편을 정제하였다. 상기 2 개의 단편들 (KmARS2 DNA 및 단일—컷된 단편)을 서로 라이게이션시켰다. KmARS2 이 530 번째 뉴클레오타이드 위치에 삽입된 클론을 pKMEXll 백터 (3.85 kb)로 명명되었다 (도 1). 상기 백터를 기능적으로 우수한 유전자들의 클로닝에 이용될 수 있다. 상기 백터에서, 멀티클로닝 위치 (multicloning site)는 순서적으로 pnl, Xhol, Sail, Hindlll, EcoRV, EcoRI , Smal, BamHI , Xbal, Not I, Sac 11 및 Sacl I로 이루어져있다.
PKMEX12 백터의 구축
PKMEX12 백터는 pKMEXll 백터로부터 유래된 플라스미드로ᅳ 프로모터, 클로닝 위치 및 터미네이터로 이루어진 발현 모들 (expression module)이 pKMEXll 백터로 삽입된 백터이다. 상기 발현 모들 내 프로모터 및 터미네이터는 K. 막시아누스 (J. marxianus)^ PCLP3(pur ine-cytosine-l ike permease)의 프로모터 및 터미네이터가 이용되었다. 프로모터 단편 (PCLP3pro)는 K. 막시아누스 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (Xhol 위치 포함), 5' -CTCGA( TATnGATTAAGCTTCGATC-3 ' ; 안티센스 프라이머 (Sail 위치 포함), 5' -GTCGACCTCGAGATATTATTCTGTAATC- 3' . 상기 PCR-증폭된 단편을 정제하여 pGem-T easy 백터에 클로닝하고 시뭔성하여 확인한 후, 상기 백터를 Xho I 및 Sal I 으로 절단하여 얻은 단편을 Xhol/Sall-절단된 pKMEXll 단편에 재-클로닝하였다. 이후, 터미네이터 단편 (PCLP3ter)는 K. 막시아누스 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (BamHI 위치 포함), 5' -
GGATCCTGCGTATCGCATAATGATGG-3 ' ; 및 안티센스 프라이머 (Xbal 위치 포함), 5' -TCTAGATCCGGGTAACAGACAGTGGA-3 ' . 상기 PCR—증폭된 단편을 정제하여 상기 프로모터 단편이 클로닝된 BamHI /Xbal-절단된 백터에 클로닝하여 4.31 kb 의 pKMEX12 백터를 제조하였다 (도 2). 발현될 목적 DNA 단편은 Sail, EcoRI 또는 BamHI 에 클로닝될 수 있다. 서로 다른 선택 마커를 가지는 다양한 플라스미드들이 발현 모들의 한쪽, 바람직하게는 SacII 및 Sacl 사이에 마커 유전자를 삽입시킴으로써 구축될 수 있다.
PKMEX13 백터의 구축
야생형 또는 산업적인 스트레인을 조작하는데 중요한 인자들 중 하나는 이용된 백터에 존재하는 양성 선택 마커이다. 여러 양성 선택 마커 중에서, ΙοχΡ 위치를 양쪽에 플탱킹 서열로 가지는 kanMX 컨스트럭트를 포함하는 DNA 단편을 이용하였으며 상기 kanMX 는 K. 막시아누스를 포함하는 효모에서 G418 에 대한 저항성을 제공한다 (Ribeiro et al., 2007). 상기 2 개의 ΙοχΡ 위치는 Cre 리콤비나제 (recombinase)에 의해 선택 마커를 레스큐하는 데 이용될 수 있기 때문에 (Gueldener et al., 2002), 상기 'ΙοχΡ-kanMX— ΙοχΡ' 서열은 "레스큐 모들" 로 불려진다. 상기 레스큐 모들은 pUG6 를 템플레이트 및 프라이머 (센스 프라이머 (Notl 위치 포함), 5' -GCGGCCGCGCTTCGTACGCTGCAGCTCGACMC-3' ; 및 안티센스 프라이머 (SacII 위치 포함), 5' 一
TTCTCGACAGCTCGTTTTC-3' )로 Pfu-증폭되었다. 프라이머 쌍을 디자인하는 데 있어서, 원 (original) 백터 내 존재하는 Sacl, Sail 및 Xhol 위치를 단일 염기 변화를 통해 제거되었는데, 이는 이후 플라스미드 구축에 유용하다. 1,609 bp의 PCR단편이 pGem-T easy 백터에 클로닝되고 시퀀싱된 후, Notl 및 SacII 절단하여 얻어진 단편을 Notl/SacII-절단된 pKMEXll 단편에 클로닝함으로써 5.45 kb의 pKMEX13 백터를 제조하였다 (도 3). 즉, pUG6 백터로 실시한 바와 같이 pKMEX13 은 유전자 파괴를 위해 이용될 수 있다. 선택적으로ᅳ pKMEX13 은 유전자 파괴를 위한 추가적인 전략을 제공한다: 레스큐 모들의 업스트림 (Kpnl, Xhol, Sail, Hindlll, EcoRV, EcoRI , Smal , BamHI , Xbal, 및 Notl 중 2 개의 위치를 이용) 및 레스큐
모들의 다운스트림 (SacII 와 Sacl 사이 )을 이용하여 보다 긴 DNA 단편들이 클로닝될 수 있으며, 상기 레스큐 모들은 효과적인 통합 (integration)을 빈번하게 촉진시킨다. 상기 경우에, 형질전환을 위해 선형 DNA 단편들이 업스트림 위치의 상기 2 개의 제한효소 중 한 효소 위치와 Sacl 를 이용한 절단에 의해 제조된다.
PKMEX14 백터의 구축
하나의 플라스미드 내 발현 모들 및 레스큐 모들의 동시 존재는 선택 마커로서 G418 을 가지는 발현 백터를 제조할 수 있게 한다. 발현 모듈은 Xhol 와 Xbal 의 절단을 통해 pKMEX12 백터로부터 얻어 Xhol/Xbal-절단된 PKMEX13 에 클로닝하여 5.92 kb 의 pKMEXW 백터를 제조하였다 (도 4). PCLP3 프로모터는 Xhol 과 Sail 사이에 클로닝함으로써 다른 프로모터로 대체될 수 있다. 에피좀 (episomal) 유전자 발현 이외에도, pKMEX14 의 레스큐 모들은 Xbal 과 Notl 위치만이 더 긴 DNA 단편의 ¾스트림 클로닝을 위해 유용하다는 점을 제외하고는 상술한 PKMEX13 백터와 동일한 방식으로 유전자 파괴에 이용될 수 있다. Sail 과 EcoRI 또는 BamHI 사이에 목적 유전자의 0RF(open reading frame)가 클로닝된 백터로부터 유전자 통합을 위한 추가적인 2 개의 PCR단편들이 제조되었다: 프로모터로부터 kanMX의 말단까지를 포함하는 하나의 PCR 단편 ; 및 0RF 로부터 kanMX 의 말단까지를 포함하는 또 다른 PCR 단편. 올바르게 통합된 경우, 전자의 PCR 단편은 상기 유전자의 고유 프로모터가 PCLP3 프로모터로 대체된다. 발현 모들의 차단 시스템으로 인해, 다양한 상동 (homologous) 또는 이종 (heterologous) 프로모터들이 이용될 수 있다. 0RF가 돌연변이된 후자의 PCR단편의 게놈 통합에서, 야생형 0RF 가 돌연변이 형태로 대체된다. 상기 단편이 통합된 세포가 단일ᅳ카피 유전자를 가지는 반수성 스트레인 (haploid strain)으로 대체 후에 생존이 가능하다면, 돌연변이 0RF 의 효과는 새로이 획득된 표현형 (즉, 야생형 0RF 의 부재로 인한 표현형 )을 통해 간편하게 검출될 수 있다. 하지만, 증폭될 거대한 크기의 서열은 다음과 같은 문제를 가진다. 즉, PCLP3 프로모터부터 kanMX 말단까지의 서열은 2,193 bp 의 길이로 목적 0RF 이 클로닝되는 경우에는 더 큰 크기의 서열이 된다. pKMEX14 백터의 이용은 상술한 증폭 문제를 다음과 같이 회피할 수 있다: 발현 모들의 앞
쪽에 존재하는 Kpnl/Xhol 위치 및 레스큐 모들 뒤의 SacII/SacI 위치를 각각 더 긴 DNA 단편들의 업스트림 및 다운스트림 클로닝에 이용한다 (또는 방향성이 유지되는 한 역도 가능하다). 따라서, pKMEXM 백터는 프로모터 0RF, 또는 양자의 대체를 효과적으로 촉진할 수 있는 신규한 (unprecedented) 구조를 가진다. 또한, 리보좀 DNA 또는 트랜스포존으로부터 유래된 반복 서열들이 업스트림 (Kpnl/Xhol) 및 다운스트림 (SacII/SacI) 클로닝 위치에 클로닝 된다면 기능적으로 유용한 유전자가 무해한 유전자 위치 (loci)로 통합될 수 있다. 더 나아가, 상기 통합은 kanMX 마터가 레스큐되는 한 모든 경우에서 반복적으로 실시될 수 있다.
PKMEX21-24 백터의 구축
일과성 발현을 위한 문제가 없을 지라도, 에피좀 발현을 위한 PKMEX14 백터의 이용 상에서 발생될 수 있는 하나의 문제는 사카로마이세스 세레비지애 (5acc rOTyces cere /s/ae)의 생리학에 기초하여 세포들이 센트로미어 (centromere)의 부재로 인해 상기 pKMEX14 백터를 잃어버리는 것이다. 이에, 본 발명자들은 센트로미어 서열이 도입된 일련의 pKMEX 백터를 제조하였다. K. 막시아누스에는 2 개의 센트로미어—유사 서열이 존재하며, 상기 서열은 ARS( autonomously replicating sequence)과 병치되어 존재한다: (a) ARSl 와 존재하는 CENA(Genbank No. Z31562); 및 (b) ARS2와 존재하는 CENB(Genbank No. Z31563).
상술한 pKMEXll 시리즈의 구축과 유사하게, CENB/ARS2 서열이 K. 막시아누스 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열 (PvuII 위치 포함)은 다음과 같다: 센스 프라이머, 5' CAGCTGGATCCMGTCTGMGGTTGGTTTGGC-3, ; 및 안티센스 프라이머, 5' -CAGCTGC™GTTCACCTTAAACACTCACCGACG-3 ' . 상기 PCR- 증폭된 1,176 bp 단편을 정제하여 pGem-T easy 백터에 클로닝한 후, 시뭔싱하였다. 상기 서열-확인된 단편이 백터로부터 PvuII 로 절단된 후 불완전하게 PvuII-절단된 pBluescript II SK 백터에 클로닝하여 pKMEX21 백터를 제조하였다 (도 5). 상기 제조된 p MEX21 백터를 모 플라스미드 (parental plasmid)로 하여, pKMEX22, 23 및 24 백터가 각각
PKMEX12, 13 및 14 백터에서처럼 동일한 방식으로 제조되었다 (도 6 내지 도 8). pKMEX21 백터 시리즈의 특징은 CENB 의 존재를 제외하고는 pKMEXll 백터 시리즈의 특징과 동일한데, 상기 pKMEX21-24 백터들은 저 -카피 상태의 에피좀으로 유지 및 기능하고 다음 세대로 전달될 것으로 예상된다. pScDAL21 백터의 구축
사카로마이세스 세레비지애
cere 's/ae)의 히스톤 4 유전자와 관계된 CEN6 및 자가복제서열 (autonomous replicating sequence; ARS), E. co J/ 복제기원 (Or iC) 및 앰피실린 저항성 선택 마커를 포함하는 DNA 단편이 pRS316TDH3를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (Kpnl 위치 포함), 5' -GGGGGTACCCGCGTT( TGGCGTTTTTCC-3 ' ; 및 안티센스 프라이머 (Sac I 위치 포함), 5' -GGGGAGCTCGGACGGATCGOTGCCTGTAA-3 ' . 상기 PCRᅳ증폭된 2,303 bp 단편 (산물 I)을 정제하여 Topo 백터 (Invitrogen)에 클로닝한 후, 시퀀싱하였다.
S. 세레비지애의 TDH3 프로모터, SPT15m7B 및 GAL7 터미네이터를 포함하는 DNA 단편이 pRS316TDH3 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (Sacl 및 중첩된 Notl 과 Xbal 위치 포함), 5' ― GGGGAGCTCATCGCGGCCGCGCnCTAGAACCAGnCTCACACGGAACAC-3 ' ; 및 안티센스 프라이머 (Kpnl 과 Xhol 위치 포함), 5' -
GGGGGTACCGCTCTCGAGTCGATAACGACACCGACAATG-3 ' . 상기 PCR—증폭된 2,369 bp 단편 (산물 II)을 정제하여 Topo 백터 (Invitrogen)에 클로닝한 후, 시퀀싱하였다.
상기 산물 I 및 산물 II 를 Kpnl 과 Sacl 으로 절단시켜 라이게이션시킴으로써, 4,648 bp의 pScDAL21 백터를 제조하였다 (도 9).
PScDAL22 백터의 구축
야생형 또는 산업적인 스트레인을 조작하는데 중요한 인자들 중 하나는 이용된 백터에 존재하는 양성 선택 마커이다. 여러 양성 선택 마커 중에서, ΙοχΡ 위치를 양쪽에 플랭킹 서열로 가지는 kanMX
컨스트럭트를 포함하는 DNA 단편을 이용하였으며, 상기 kanMX 는 효모에서 G418 에 대한 저항성을 제공한다. 상기 2 개의 ΙοχΡ 위치는 Cre 리콤비나제 (recombinase)에 의해 선택 마커를 레스큐하는 데 이용될 수 있기 때문에, 상기 'loxPᅳ kanMX-loxP' 서열은 "레스큐 모들" 로 불려진다. 상기 레스큐 모들은 pUG6 를 템플레이트 및 프라이머 (센스 프라이머 (Not I 위치 포함), 5' -GCGGCCGCGCTTCGTACGCTGCAGCTCGACAAC-3 ' ; 및 안티센스 프라이머 (SacII 위치 포함), 5' -
nCTCGACAGCTCGTTTTC-3 ' )로 Pfu-증폭되었다. 프라이머 쌍을 디자인하는 데 있어서, 원 (original) 백터 내 존재하는 Saclᅳ Sail 및 Xhol 위치를 단일 염기 변화를 통해 제거되었는테, 이는 이후 플라스미드 구축에 유용하다. 1,609 bp 의 PCR 단편이 pGem-T easy 백터에 클로닝되고 시퀀싱된 후, Notl 및 SacII 절단하여 얻어진 단편을 Notl/SacII-절단된 pScDAL21 단편에 클로닝함으로써 6,385 bp 의 pScDAL22 백터를 제조하였다 (도 10). ·
일반적으로, 세포에 신규한 표현형을 제공하는 단백질의 이상 (ectopic) (과다)발현은 영양요구성 (auxotroph) 마커 또는 양성 선택 마커를 포함하는 에피좀 자가 -복제 플라스미드를 이용하여 유도된다. 하지만, 산업성 효모 스트레인들은 대부분 복잡한 배지에서 배양되어 선택 압력 (selection pressure)이 부족하기 때문에, 정상 상태 (no pressure)의 배양 과정 동안 플라스미드들을 잃어버리는 경향이 있다. 따라서, 발현 모들을 게놈의 무해한 유전자 위치에 통합하는 것이 매우 바람직하다. 가장 유명한 2개의 게놈 타겟이 리보좀 DNA와 트랜스포존으로, 상기 2개의 타겟들은 게놈 내에 매우 반복적으로 존재한다. 하기 3 개의 통합용 백터 (pScDAL23, 24 및 25)들이 효모 트랜스포존으로부터 유래된다.
Ty 엘리먼트 aransposon-yeast)는 RNA 중간산물을 통해 하나의 염색체 위치에서 다른 위치로 이동하는 DNA 서열이다. DNA 절편 (segment)은 RNA로 전사된 후 cDNA로 역-전사되어 핵 게놈 상의 다른 위치로 항상 재 -삽입된다. 원형 (original) 레트로트랜스포존은 원 자리에 위치하고 새로운 레트로트랜스포존은 원형 레트로트랜스포존과 상기 과정 동안 증복된 인접 유전자들 또는 부위의 카피들을 포함한다. 상기
레트로트랜스포존의 존재는 게놈 진화 동안 유전자 확장의 주요 소스인 트랜스포지션을 유발한다 . 또한 , 상기 삽입 이벤트는 코딩 부위 또는 전사 조절 엘리먼트들을 파괴시키거나 또는 상동 재조합을 통한 염색체 재배열을 촉진시킴으로써 게놈 진화에 영향을 끼칠 수 있다.
효모 게놈에는 약 50개의 레트로트랜스포존 (5가지 형태; Tyl-Ty5)이 존재한다. 모든 5 가지 형태의 Ty 엘리먼트들은 LTRsGong terminal repeats)로 플탱킹된 (레트로바이러스 gag 및 pol 유전자와 유사한) TYA 및 TYB 0RF 로 구성된 기본 구조를 공통적으로 공유한다ᅳ TYA 유전자는 역전사에 관여하는 바이러스 -유사 입자 (virus-like particle, VLP)의 구조 단백질을 인코딩한다. TYB 유전자는 4 개의 단백질 [프로테아제 (PR), 인테그라제 (IN), 역전사효소 (RT) 및 리보뉴클레아제 H(RH) 활성 도메인]을 포함하는 다단백질 (polyprotein)을 인코딩하고, 상기 단백질들은 레트로트랜스포지션에 중요하다.
Ty 엘리먼트와 연관된 4 가지 형태의 LTRs 이 알려져 있다: 델타 (Tyl 및 Ty2), 시그마 (Ty3), 타우 (Ty4) 및 오메가 (Ty5). 상술한 LTRs 은 플탱킹 직접 말단 반복서열 (flanking direct terminal repeats)로 레트로트랜스포존에 존재할 뿐 아니라, 단일 LTRs 로 게놈 전반에 걸쳐 퍼져있다. 상기 LTRs 은 전장 Ty 앨리먼트의 2 개의 LTRs 간의 재조합을 통해 제거된다. 델타 서열이 가장 많이 존재 (거의 300 개 정도)하며, 시그마 및 타우가 약 수십개 정도 존재하고, 오메가는 10 개 미만으로 존재한다. 상기 분포는 LTRs 과 연관된 Ty 엘리먼트들의 상대적인 풍부함을 반영한다.
PScDAL23 백터, pScDAL24 백터 및 pScDAL25 백터는 LTRs 서열로, 각각 델타 서열, 시그마 서열 및 타우 서열을 이용한다. 기본적인 전략은 약 350 bp 의 LTR서열을 2 개의 단편들로 증폭하는 것이다: (a) 첫 번째 단편, "UP" ; 및 (b) 두 번째 단편, "DN" . 상기 "UP" 단편은 Kpnl 과 Xhol의 사이로, "DN" 단편은 Sacl과 SacII의 사이로 클로닝된다.
PScDAL23 백터의 구축
델타 "UP" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu
DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과
같다: 센스 프라이머 (Kpnl 위치 포함), 5' -
GGGGGTACCTGTTGGAATAGAAATCAACTATC-3 ' ; 및 안티센스 프라이머 (Xhol 위치 포함), 5' -GGGCTCGAGATGTTTATATTCATTGATCCTAT-3 ' . 상기 PCR—증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시퀀싱한 후, Kpnl 및 Xhol 절단하여 얻어진 단편을 Kpnl/Xhol-절단된 pScDAL22 단편에 클로닝함으로써 PScDAL22-deltaUP 백터를 제조하였다.
델타 "DN" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (SacII 위치 포함), 5' - GGGCCGCGGATAAAATGATGATAATAATATTT-3' ; 및 안티센스 프라이머 (Sac I 위치 포함), 5' -GGGGAGCTCTGAGAAATGGGTGAATGTTGAGA-3 ' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시뭔싱한 후, SacII 및 Sacl 절단하여 얻어진 단편을 Sacl I/Sacl-절단된 pScDAL22-deltalP 단편에 클로닝함으로써 PScDAL23 백터를 제조하였다 (도 11). ScDAL24 백터의 구축
시그마 "UP" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (Kpnl 위치 포함), 5' - GGGGGTACCTG GTATCTCAAAATGAGATATG-3 ' ; 및 안티센스 프라이머 (Xhol 위치 포함), 5' -GGGCTCGAGCTCGGATCTAAACTAAnGnCAG-3' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시퀀싱한 후, Kpnl 및 Xhol 절단하여 얻어진 단편을 Kpnl/Xholᅳ절단된 pScDAL22 단편에 클로닝함으로써 PScDAL22-sigmaUP 백터를 제조하였다.
시그마 "DN" 단편이 S, 세레비지애 게놈 DNA 를 템플레이트로 Pfu
DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (SacII 위치 포함), 5' -
GGGCCGCGGAnCCGCGOTCCACCACTTAGTA-3 ' ; 및 안티센스 프라이머 (Sacl 위치 포함), 5' -GGGGAGCTCTGnGTAmCGGGCTGGAGTAATACC-3 ' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시뭔싱한 후, SacII 및 Sacl
절단하여 얻어진 단편을 SacII/SacI-절단된 pScDAL22ᅳ sigmaUP 단편에 클로닝함으로써 pScDAL24 백터를 제조하였다 (도 12).
PScDAL25 백터의 구축
타우 "UP" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu
DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다 : 센스 프라이머 (Kpnl 위치 포함), 5' -
GGGGGTACCTGTTGGAACGAGAGTAA AATAG-3 ' ; 및 안티센스 프라이머 (Xhol 위치 포함), 5' -GGGCTCGAG-CATAACATGnCAACTAATAGGTC-3 ' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시뭔싱한 후, Kpnl 및 Xhol 절단하여 얻어진 단편을 Kpnl/Xhol—절단된 pScDAL22 단편에 클로닝함으로써 PScDAL22-tauUP 백터를 제조하였다.
타우 "DN" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 (SacII 위치 포함), 5' ―
GGGCCGCGGGTAGGTACATATATGAGGAATATG-3 ' ; 및 안티센스 프라이머 (Sacl 위치 포함), 5' -GGGGAGCTCTGnGATAATTAGAGGTTAAAAATTAG-3 ' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시뭔싱한 후, SacII 및 Sacl 절단하여 얻어진 단편을 SacII/SacI-절단된 pScDAL22-t auUP 단편에 클로닝함으로써 pScDAL25 백터를 제조하였다 (도 13).
PScDAL22_ETS3_ADFG5 백터를 이용한 DFG5 유전자의 결실 및 ETS3 의 염색체 통합에 의한 스트레스 저항성 효모 스트레인의 제조
상기 pScDAL22 백터의 MCS 에 ETS3 유전자 (대한민국 공개특허공보 제 1으2010-0101739)를 클로닝하여 PScDAL22_ETS3_ Δ DFG5 백터를 제조하였다.
DFG5 유전자를 결실시키기 위해, pScDAL22— ETS3 백터 내 "UP" 및 "DN" 단편을 각각 DFG5 유전자의 N-말단 및 C—말단에 해당하도록 고안하였다.
DFG5 "UP" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머, 5' -CCGCGTAAAGCGAAACTGAGTATAACCC-3 ' ; 및
안티센스 프라이머, 5' -TCATTGTCGGTGTCGTTATCGA— 3' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시퀀싱한 후, Kpnl 및 Xhol 절단하여 얻어진 단편을 Kpnl/Xhol-절단된 pScDAL22_ETS3 단편에 클로닝함으로써 pScDAL22_ETS3_DFG5UP 백터를 제조하였다.
DFG5 "DN" 단편이 S. 세레비지애 게놈 DNA 를 템플레이트로 Pfu
DNA 폴리머라제로 증폭되었으며, 이때 이용된 프라이머 서열은 다음과 같다: 센스 프라이머 5' -CGCCTCGACATCATCTGCCCAG-3 ' ; 및 안티센스 프라이머, 5' -GGGGGAGCTCCAGCATCCACACAGCCCCACCAG-3' . 상기 PCR-증폭된 단편을 정제하여 Topo 백터에 클로닝하여 시퀀싱한 후, SacII 및 Sacl 절단하여 얻어진 단편을 SacII/SacI-절단된 pScDAL22_ETS3_DFG5UP 단편에 클로닝함으로써 pScDAL22_ETS3— ΔΙ 백터를 제조하였다 (도 14a).
상기 제조된 pScDAL22ᅳ ETS3_ADFG5 백터를 S. 세레비지애에 형질전환시켜 S. 세레비지애 게놈 DNA 내 DFG5 유전자 위치에 통합시켰다. 그 결과, S. 세레비지애의 게놈에 안정적으로 통합되었음을 PCR 결과로 확인할 수 있었다 (도 15a-15c 및 표 1).
【표 1】
염색체 통합에 이용된 프라이머 서열
상술한 과정을 반복적으로 수행함으로써, 다양한 유전자의 결실 및 목적 유전자의 염색체 통합을 실시할 수 있다. 또한, 대한민국 공개특허공보 제 10-2010—0117208 호에 따르면, 상술한 S. 세레비지애 스트레인은 에탄올- 및 삼투—저항성을 가지고, DFG5 유전자의 결실에 따라 열―저항성을 가지는 것이 명백하다 (결과를 보이지 않음). 따라서 , 본 발명에 따라 스트레스-관여된 중요한 유전자의 염색체 통합을 반복하여 실시함으로써, 다양한 스트레스에 대한 저항성을 가지는 통합 효모 스트레인의 제조를 실시할 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술 하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. 참고문헌
Alani, Eᅳ, and N. Klecknerᅳ 1987. A new type of fusion analysis appl icable to many organisms: protein fusions to the URA3 gene of yeast . Genetics 117: 5-12.
Burns, N ., B . Gr i隱 ade, P. B. Ros s一 Macdona Id, E. Y. Cho i, K. Fi nberg, G. S. Roeder, and M . Snyder . 1994. Large-seal e analys is of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae. Genes Dev. 8 :108그 1105.
Choi, W. , Y. J. Yoo, M, Kim, D. Shin, and H. B, Jeon, and W. Choi. 2003. Identification of proteins highly expressed in the hyphae of Candida albicans by two-dimensional electrophoresis. Yeast 20:1053一 60. Ekino, Kᅳ, H. Hayashi , M. Moriyama, M. Matsuda, M. Goto, S. Yoshino, and K , Fur ukawa , 2002. Eng i neer ing of polyploid Saccharomyces cerevisiae for secretion of large amount s of fungal glucoamylase. Appl Environ. Microbiol. 68:5693—5697.
Fonz i , W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene map ing in Candida albicans. Genetics 134: 717-28.
Fuj i i, T., K. Kondo , F. Shimizu, H. Sone, J. Tanaka, and T. Inoue. 1990. Application of a r ibosomal DNA integrat ion vector in the construct ion of a brewer' s yeast having a lpha-aceto lactate decarboxylase activity. Appl . Environ. Microbiol . 56:997-1003
Hoffman, C, S., and F. Winston. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformat ion of Escherichia coli . Gene 57:26그 72.
Kudla, B. , and A. Nicolas. 1992. A multisite integrative cassette for the yeast Saccharomyces cerevisiae. Gene 119:49—56.
Lopes , T. S. , J. Klootwi jk, A. E. Veenstra, P. C. van der Aar , H. van Heer ikhuizen, H. A. Raue, and R. J. PI ant a. 1989. High-copy-number integration into the r ibosomal DNA of Saccharomyces cerevisiae: a new vector for high-level expression. Gene 79:199—206.
Moriya, H. , Shimizuᅳ Yoshida, Y. , and H. Kitano. 2006. In vivo robustness analysis of cell division cycle genes in Saccharomyces cerevisiae. PLoS Genetics 2: 1034-1045.
Nevoigt E. 2008 Progress in metabolic en ineering of Saccharomyces cerevisiae. Microbiol Mol Rev 72: 379—412.
Nevoigt , E. , J. Kohnke , C. R. Fischer , H. Alper , U. Stahl , and G. Stephanopoulos . 2006. Engineering of promoter re lacement cassettes for f inetuning of gene expression in Saccharomyces cerevisiae. Ap l . Environ. Microbiol . 72:5266-5273.
Pla J., C. Gil, L. Monteol iva, F. Navarro Garcia, M. Sanchez , and C Nombe 1 a . 1996. Understanding Candida albicans at the molecular level . Yeast 12: 1677-702.
Sambrook, J., and D. Russell. 2001. Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor Laboratory Press
Verstrepen, K. J. and J. M. Thevelein. 2004. Control led expression of homo 1 ogous genes by genomic promoter re lacement in the yeast Saccharomyces cerevisiae. Methods Mol . Biol . 267:259-266.
Wilson, R. B. , D. , Davis, B. M. Enloe, and A. P. Mitchell . 2000. A recyclable Candida albicans URA3 cassette for PCR product-directed gene disrupt ions Yeast 16: 65-70.
Claims
【청구의 범위】
【청구항 11
(a) 자가복제 서열 ( aut onomous replicating sequence); (b) ( i ) KmPCLP3 ( K 1 uyve r omy c e s max i anus pur i ne-cyt os i ne- 1 i ke-permease 3) 프로모터 (PCLPpro), (ii) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) KmPCLP3 터미네이터 (terminator ; PCLPter)를 포함하는 발현 모들 (expression module); 및 (c) ( i ) 선택 마커 (select ion marker); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 ΙοχΡ 서열을 포함하는 레스큐 모들 (rescue module; loxP— select ion marker—loxP)을 포함하는 효모 발현백터 (yeast expression vector) .
【청구항 2】
게 1 항에 있어서, 상기 자가복제 서열은 ARS2 인 것을 특징으로 하는 효모 발현백터 .
[청구항 3】
제 1 항에 있어서, 상기 선택 마커는 kanMX 인 것을 특징으로 하는 효모 발현백터 .
【청구항 4】
제 1 항에 있어서, 상기 발현백터는 Cre 리콤비나제 (recombinase)에 레스큐되는 것을 특징으로 하는 효모 발현백터.
【청구항 5】
제 1 항에 있어서, 상기 발현백터는 상기 발현 모들의 업스트림 및 레스큐 모들의 다운스트림에 목적 유전자 단편의 플탱킹 서열 (flanking sequence)과 상동적인 서열을 추가적으로 포함하여 염색체 상의 상기 목적 유전자 단편과의 상동재조합 (homologous recombinat ion)을 통해 염색체 상으로 통합될 수 있는 것을 특징으로 하는 효모 발현백터.
【청구항 6】
제 1 항에 있어서, 상기 효모는 클루이베로미세스 종 (Kluyveromyces spp.), 사카로마이세스 종 (Saccharomyces spp.), 시조사카로마이세스 종 (Schizosaccharomyces spp.), 피키아 종 (Pichia spp,), 파피아 종 (Paffia spp.), 칸디다 종 (Candida spp.), 탈라로미세스 종 (Talaromyces spp.), 브레타노미세스 종 (Brettananyces spp.), 파키솔렌 종 (Pachysolen spp.) 또는 데바리오미세스 종 (Debaryomyces spp.) 인 것을 특징으로 하는 효모 발현백터.
【청구항 7】
거 1 6 항에 있어서 상기 효모는 클루이베로미세스 종인 것을 특징으로 하는 효모 발현백터 .
【청구항 8】
(a) 센트로미어 서열 (centromere sequence); (b) 목적 유전자의 업스트림 플랭킹 서열 (upstream flanking sequence)과 상동적인 서열; (c) ( i ) KmPCLPS ( K 1 uyve r omy c e s ma i anus pur ine-cytosine-1 ike-permease 3) 프로모터 (PCLPpro), ( ii) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) KmPCLP3 터미네이터 (terminator ; PCLPter)를 포함하는 발현 모들 (expression module); 및 (d) ( i ) 선택 마커 (select ion marker); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 ΙοχΡ 서열을 포함하는 레스큐 모들 (rescue module; loxP-select ion marker- loxP); (e) 목적 유전자의 다운스트림 플행킹 서열과 상동적인 서열을 포함하는 염색체 통합용 효모 발현백터 (yeast expression vector).
【청구항 9】
제 8 항에 있어서, 상기 센트로미어 서열은 CENB인 것을 특징으로 하는 효모 발현백터.
【청구항 10】
제 8 항에 있어서, 상기 선택 마커는 kanMX인 것을 특징으로 하는 효모 발현백터.
【청구항 11】
제 8 항에 있어서, 상기 발현백터는 Cre 리콤비나제 (recombinase)에 의해 레스큐되는 것을 특징으로 하는 효모 발현백터.
【청구항 12]
제 8 항에 있어서, 상기 발현백터는 상기 발현 모들의 업스트림 및 레스큐 모들의 다운스트림에 존재하는 목적 유전자 단편의 플랭킹 서열 (flanking sequence)과 상동적인 서열과 염색체 상의 상기 목적 유전자 단편과의 상동재조합 (homologous recombination)을 통해 상기 발현 모들 및 레스큐 모들이 염색체 상으로 통합될 수 있는 것을 특징으로 하는 효모 발현백터.
【청구항 13】
제 8 항에 있어서, 상기 효모는 클루이베로미세스 종 (Kluyveromyces spp.), 사카로마이세스 종 (Saccharomyces spp.), 시조사카로마이세스 종 (Schizosaccharomyces spp.)', 피키아 종 (Pi.chia spp.), 파피아 종 (Paffia spp.), 칸디다 종 (Candida spp. ) , 탈라로미세스 종 (Talaromyces spp.), 브레타노미세스 종 (Brettanomyces spp.), 파키솔렌 종 (Pachysolen spp.) 또는 데바리오미세스 종 (Debaryomyces spp.)인 것을 특징으로 하는 효모 발현백터ᅳ
【청구항 14】
제 13 항에 있어서, 상기 효모는 클루이베로미세스 종인 것을 특징으로 하는 효모 발현백터.
【청구항 15】
(a) 센트로미어 서열 (centromere sequence); (b) 목적 유전자의
업스트림 플랭킹 서열 (upstream flanking sequence)과 상동적인 서열 (UP 단편); (c) ( i ) ScTDH3(Saccharomyces cerevisiae g 1 ycer a 1 dehyde-3- phosphate dehydrogenase 3)의 프로모터, (ii) 멀티 클로닝 위치 (multiple cloning site, MCS) 및 (iii) ScGAL7의 터미네이터 (terminator )를 포함하는 발현 모들 (expression module); 및 (d) ( i ) 선택 마커 (select ion marker); 및 (ii) 상기 선택 마커의 양쪽 말단에 결합된 ΙοχΡ 서열을 포함하는 레스규 모듈 (rescue module; loxP-select ion marker- loxP); (e) 목적 유전자의 다운스트림 플탱킹 서열과 상동적인 서열 (DOWN 단편)을 포함하는 염색체 통합용 효모 발현백터 (yeast expression vector).
【청구항 16]
제 15 항에 있어서, 상기 센트로미어 서열은 CEN6 또는 자가복제서열 (autonomous replicating sequence , ARS)인 것을 특징으로 하는 효모 발현백터.
【청구항 17】
제 15 항에 있어서ᅳ 상기 선택 마커는 kanMX인 것을 특징으로 하는 효모 발현백터.
【청구항 18】
제 15 항에 있어서, 상기 발현백터는 Cre 리콤비나제 (recombinase)에 의해 레스큐되는 것을 특징으로 하는 효모 발현백터.
【청구항 19]
제 15 항에 있어서, 상기 UP 단편 및 D0而 단편은 목적 유전자의 서열, 리보좀 DNA 또는 트랜스포존으로부터 유래한 서열인 것을 특징으로 하는 효모 발현백터 .
【청구항 20]
제 19 항에 있어서, 상기 UP 단편 및 DOWN 단편은 Ty(transposon- yeast) 엘리먼트로부터 유래한서열인 것을 특징으로 하는 효모 발현 백터.
【청구항 21]
제 20 항에 있어서, 상기 Ty 엘리먼트는 Tyl, Ty2, Ty3, Ty4 및
Ty5로 구성된 군으로부터 선택된 엘리먼트인 것을 특징으로 하는 효모 발현 백터.
【청구항 22]
제 15 항에 있어서, 상기 백터는 상기 UP 단편 및 D N 단편과 염색체 상의 대웅되는 부위와의 상동재조합 (homologous recombinat ion)을 통해 발현 모들 및 레스큐 모들이 염색체 상으로 통합되는 것을 특징으로 하는 효모 발현백터.
【청구항 23】
제 15 항에 있어서, 상기 효모는 사카로마이세스 종 (Saccharomyces spp.), 클루이베로미세스 종 (Kluyveromyces spp.), 시조사카로마이세스 종 (Schizosaccharomyces spp.), 7] 종 (Pichia spp. ) , 파피^ >} 종 (Paffia spp. ) , 칸디다 종 (Candida spp.), 탈라로미'세.스 종 (Talaromyces spp.), 브레타노미세스 종 (Brettanomyces spp.), 파키솔렌 종 (Pachysolen spp.) 또는 데바리오미세스 종 (Debaryomyces spp.) 인 것을 특징으로 하는 효모 발현백터.
【청구항 24]
제 23 항에 있어서, 상기 효모는 사카로마이세스 종인 것을 특징으로 하는 효모 발현백터.
【청구항 25】
다음의 단계를 포함하는 효모에서 하나 이상의 목적 뉴클레오타이드 서열들의 연속적 형질전환 방법 :
(a) 제 8 항 또는 제 15 항의 백터 내 MCSOnultiple cloning site)에 목적 뉴클레오타이드 서열을 클로닝하는 단계 ;
(b) 상기 백터를 효모에 형질전환시키는 단계;
(c) 상기 형질전환된 효모에서 Cre 리콤비나제에 의한 레스큐를
유도하는 단계; 및
(d) 상기 단계 (a) 내지 (c)를 다른 목적 뉴클레오타이드 서열로 반복적으로 실시하는 단계 .
【청구항 26】
제 25 항에 있어서, 상기 형질전환은 사카로마이세스 종 (Saccharomyces spp.), 클루이베로미세스 종 (Kluyveromyces spp,), 시조사카로마이세스 종 (Schizosaccharomyces spp . ) , 피키아 종 (Pichia spp.), 파피아 종 (Paffia spp.), 칸디다 종 (Candida spp.), 탈라로미세스 종 (Talaromyces spp . ) , 브레타노미세스 종 (Brettanomyces spp.), 파키솔렌 종 (Pachysolen spp.) 및 데바리오미세스 종 (Debaryomyces spp.)으로 구성된 군으로부터 선택된 효모 스트레인에서 실시하는 것을 특징으로 하는 방법.
【청구항 27]
제 26 항에 있어서, 상기 형질전환은 사카로마이세스 종 또는 클루이베로미세스 종에서 실시하는 것을 특징으로 하는 방법 .
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020110146752A KR101328481B1 (ko) | 2011-12-30 | 2011-12-30 | 염색체 통합용 효모 발현 벡터 및 이의 용도 |
| KR10-2011-0146746 | 2011-12-30 | ||
| KR1020110146746A KR20130078034A (ko) | 2011-12-30 | 2011-12-30 | 안정적인 에피좀 효모 발현 벡터 및 이의 용도 |
| KR10-2011-0146752 | 2011-12-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013100713A2 true WO2013100713A2 (ko) | 2013-07-04 |
| WO2013100713A3 WO2013100713A3 (ko) | 2013-09-19 |
Family
ID=48698752
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2012/011772 Ceased WO2013100713A2 (ko) | 2011-12-30 | 2012-12-28 | 효모 염색체 통합 또는 산업 스트레인 형질전환용 효모 발현 벡터, 그리고 이들의 용도 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2013100713A2 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113493800A (zh) * | 2020-04-03 | 2021-10-12 | 中国科学院深圳先进技术研究院 | 一种提高酿酒酵母中异源蛋白分泌或表面展示表达的方法 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2133428A1 (en) * | 2004-03-09 | 2009-12-16 | Eidgenössische Technische Hochschule Zürich | New baculovirus vectors for improved protein production |
-
2012
- 2012-12-28 WO PCT/KR2012/011772 patent/WO2013100713A2/ko not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113493800A (zh) * | 2020-04-03 | 2021-10-12 | 中国科学院深圳先进技术研究院 | 一种提高酿酒酵母中异源蛋白分泌或表面展示表达的方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2013100713A3 (ko) | 2013-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11168117B2 (en) | Constitutive promoter | |
| Kingsman et al. | Heterologous gene expression in Saccharomyces cerevisiae | |
| EP3332005B1 (en) | Promoter variants | |
| WO2015138855A1 (en) | Vectors and methods for fungal genome engineering by crispr-cas9 | |
| US10428123B2 (en) | Constitiutive promoter | |
| KR101213179B1 (ko) | 염색체 통합용 효모 발현 벡터 및 이의 용도 | |
| Heo et al. | Simultaneous integration of multiple genes into the Kluyveromyces marxianus chromosome | |
| WO2013100713A2 (ko) | 효모 염색체 통합 또는 산업 스트레인 형질전환용 효모 발현 벡터, 그리고 이들의 용도 | |
| JP2018537109A (ja) | 酵母細胞の破壊のための遺伝子カセット | |
| WO2010087344A1 (ja) | シゾサッカロミセス・ポンベの形質転換方法および形質転換体、ならびに異種蛋白質の製造方法 | |
| KR101328481B1 (ko) | 염색체 통합용 효모 발현 벡터 및 이의 용도 | |
| JP5973563B2 (ja) | 相同組み換えによる酵母形質転換体の形質転換用および選択用のカセットならびに方法 | |
| EP3356534B1 (en) | Novel episomal plasmid vectors | |
| WO2020106599A1 (en) | A recombinant yeast cell | |
| KR20130078034A (ko) | 안정적인 에피좀 효모 발현 벡터 및 이의 용도 | |
| CN102051374A (zh) | 一种食品级酿酒酵母重组质粒的制备方法 | |
| WO2018009809A1 (en) | Extrachromosomal switching auxotrophies progressively by integration (eswap-in) for assembly of dna sequences in yeast | |
| Siewers et al. | Genetic engineering tools for Saccharomyces cerevisiae | |
| JP2007075013A (ja) | rDNAコピー数の増加した酵母及びその酵母の利用 | |
| JP2008507266A (ja) | ピチアにおける異種遺伝子発現のためのリンゴ酸シンターゼ調節配列 | |
| KR20120045276A (ko) | 열?저항성 효모 균주 및 이의 유전자 | |
| JP2014143957A (ja) | 自己倍数化抑制に基づく酵母の育種方法 | |
| Leifso | Analysis of heterologous gene expression from the KlMAL21-KlMAL22 bi-directional promoter using cyan and yellow fluorescent proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12862581 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12862581 Country of ref document: EP Kind code of ref document: A2 |
