WO2013090053A1 - Enzyme cocktails prepared from mixed cultures - Google Patents
Enzyme cocktails prepared from mixed cultures Download PDFInfo
- Publication number
- WO2013090053A1 WO2013090053A1 PCT/US2012/067717 US2012067717W WO2013090053A1 WO 2013090053 A1 WO2013090053 A1 WO 2013090053A1 US 2012067717 W US2012067717 W US 2012067717W WO 2013090053 A1 WO2013090053 A1 WO 2013090053A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- enzymes
- cell lines
- cell line
- cell
- different
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P39/00—Processes involving microorganisms of different genera in the same process, simultaneously
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/40—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving amylase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- Enzyme cocktails are used in many industrial processes. Enzyme cocktails can be prepared by individual production of enzymes in separate cell lines followed by blending.
- Enzyme cocktails can also be prepared by engineering all desired enzymes for a particular cocktail into a single production cell line. This method lacks flexibility because in this case the enzymes expressed by a particular cell line are always produced in the same or nearly the same proportion. This lacking in flexibility is a drawback, especially when the enzyme cocktails produced by this method are for applications in processes such as biomass hydrolysis and grain processing. In these applications, the selection and performance of enzyme cocktails often depend on the type of substrates and/or pretreatment methods. A different blend may be needed for different substrates or pretreatments. A new production host may need to be built each time a new or even minutely modified blend is desired.
- Aspergillus terreus CH-TE-013 for producing an enzyme mixture (Garcia- Kirchner, et al., Applied Biochem & Biotechnol. 98: 1105-1114, 2002).
- mixed cultures of microorganisms have been fermented under different conditions to obtain cultivated
- microorganisms enriched for certain characteristics which are then blended to obtain a formulated complex culture ⁇ see, e.g., EP 2292731).
- FIGURES Figure 1 A pENTR/D-TOPO vector with the Fv3C open reading frame.
- Figure 2 A map of the expression plasmid pTTT-pyrl3-Fv3C/Bgl3 fusion.
- Figure 3 A map of pENTR-TOPO-Bgll (943/942).
- Figure 4 A map of TOPO Blunt/Pegll-Fv43D.
- Figure 5 SDS gel electrophoresis analysis of Fv43D and (Fv3C/Te3A/Bgl3 chimera) expression.
- Figure 6 HPLC chromatogram of Fv43D and (Fv3C/Te3A/Bgl3 chimera) produced by co-fermenting two T. reesei strains.
- FIG 7 SDS gel electrophoresis analysis of cellulase expression by T. reesei RL-P37 and beta-glusosidase 1 (Bgll, or Tr3A) expression by T. reesei RL-P37-d/Tr3A.
- Figure 8 HPLC chromatogram of Bgll (Tr3A) and cellulase produced by co- fermenting T. reesei RL-P37 and T. reesei RL-P37-d/Tr3A.
- Figure 9 HPLC chromatogram of amylase variants 1 and 2 produced by co- fermenting two B. licheniformis strains.
- Figure 10 HPLC chromatogram of amylase variants 1 and 2 produced by co- fermenting two B. licheniformis strains.
- Figure 11 HPLC chromatogram of (Fv3C/Te3A/Bgl3 chimera), Bgll (Tr3A), and glucoamylase produced by co-fermenting three T. reesei strains.
- the invention provides methods of producing a mixture of enzymes catalyzing a conversion process. Such methods comprise combining first and second cell lines in a liquid medium and culturing the combined cell lines.
- the cell lines secrete the enzymes into the medium, or are lysed releasing the enzymes, thereby providing a mixture of enzymes in proportions effective to enhance the conversion process.
- the first cell line encodes and is disposed to express a first set of one or more enzymes.
- the second cell line encodes and is disposed to express a second set of one or more enzymes.
- the first and second sets of enzymes have catalytic activities enhancing the conversion process.
- One or more of the first set of enzymes are exogenous to the first cell line.
- One or more of the second set of enzymes are exogenous to the second cell line, or are not encoded by the first cell line or expressed at a lower level by the first cell line. In some methods, one or more of the second set of enzymes are exogenous to the second cell line or not encoded by the first cell line. In some methods, one or more of the second set of enzymes are expressed at a lower level by the first cell line. Certain methods may also include a third, a fourth, or even a fifth or sixth cell lines, each of which may secrete the enzymes into the medium or are lysed releasing the enzymes, encodes and is disposed to express a third, fourth, fifth, or sixth, respectively, set of one or more enzymes.
- additional sets of enzymes also have catalytic activities enhancing the conversion process, wherein one or more of these enzymes are exogenous to the respective cell lines.
- One or more enzymes of these additional sets of enzymes can be exogenous to one or more of the cell lines other than the one expressing the enzymes.
- Some methods further comprise identifying a plurality of enzymes catalyzing the conversion process, and identifying or constructing (1) a cell line encoding and disposed to express a first set of one or more of the identified enzymes, and (2) a second cell line encoding and disposed to express a second set of the one or more enzymes to provide the first and second cell lines.
- the cell lines have been grown under selective pressure or under conditions that allow auxotroph growth to retain their disposure to expressing the enzymes to form a bank of cell lines.
- Some methods further comprise identifying or constructing cell lines encoding and disposed to express different sets of enzymes catalyzing a conversion process, and selecting the first and second cell lines from the bank.
- Some methods of the invention can further comprise a third, a fourth, a fifth or even a sixth cell lines.
- the plurality of cell lines comprise the first cell line encoding and disposed to express a first set of one or more enzymes, and the second cell line encoding and disposed to express a second set of one or more enzymes.
- the third, fourth, fifth or sixth cell lines encoding and disposed to express a third, fourth, fifth and sixth set of one or more enzymes.
- the phenotypes of each of the plurality of cell lines can be maintained by being grown under selective pressure or under conditions that allow auxotroph growth. In some methods, the cell lines are grown under different selective pressures in the identifying step and without selective pressure in the culturing step.
- the invention further provides methods of preparing a cell bank.
- Such methods comprise (1) identifying a plurality of enzymes catalyzing a conversion process, (2) identifying or constructing a plurality of cell lines encoding and disposed to express different sets of the plurality of enzymes, (3) propagating the cell lines under different selective pressures or under conditions that allow auxotroph growth to retain disposure to express the set of enzymes encoded by a cell lines, to provide a cell bank; and (4) combining different combinations of the cells lines, culturing the combined cell lines in a liquid medium, and comparing the capacity of the enzymes to enhance the conversion process.
- the enzymes are secreted or the cells are lysed and the enzymes released to the medium to provide different mixture of enzymes.
- the first and second cell lines, or one or more other cell lines are the same cell line engineered to encode the first and second sets, or one or more other sets, of one or more enzymes respectively.
- the second set of one or more enzymes are endogenously expressed by the second cell line.
- the third, fourth, fifth, or sixth set of one or more enzymes are endogenously expressed by the respective cell lines.
- at least one of the first set of one or more enzyme is not encoded by the second cell line and at least one of the second set of one or more enzyme is not encoded by the first cell line.
- at least one of any set of one or more enzymes is not encoded by at least one of the cell lines other than the one encoding that enzyme.
- the combining step comprises combining the first, second and third cell lines, the third cell line encoding and disposed to express a third set of one or more enzymes. In some methods, the combining step comprises combining the first, second, third, fourth, fifth or sixth cell lines, wherein the latter (i.e., after the first and second) cell lines encoding and disposed to express the third, fourth, fifth and sixth set of one or more enzymes. In some methods, the first set of enzymes comprises two or more different enzymes, each having an activity enhancing the conversion process.
- each set of enzymes comprises two or more different enzymes, each having an activity enhancing the conversion process. Some methods further comprise separating the mixture of enzymes from cells in the culture. Some methods further comprise combining the mixture of enzymes with a substrate, wherein the mixture of enzymes enhances conversion of the substrate to a product.
- the substrate is cellulose and/or hemicellulose and the product is glucose. In some methods, the substrate is starch and the product is sugar.
- Some methods further comprise determining the proportions of the enzymes in the mixture.
- the molar ratio of an enzyme of the first set of enzymes and an enzyme of the second set of enzymes in the mixture is at least two-fold different than a molar ratio of the enzymes expressed by either the first or second cell line alone.
- the enzyme of the second set of enzymes is exogenous to the second cell line.
- the molar ratio of the first set of enzymes that are secreted and the second set of enzymes that are secreted is at least two-fold different than a molar ratio of the enzymes expressed by either the first or second cell line alone.
- the molar ratio of the first set of enzymes that are exogenous to the first cell line and the second set of enzymes that are exogenous to the second cell line is at least two-fold different than a molar ratio of the enzymes expressed by either the first or second cell line alone.
- the molar ratio of the most highly expressed enzyme of the first set and the most highly expressed enzyme of the second set in the mixture is at least two-fold different than a molar ratio of the enzymes expressed by either the first or second cell line alone.
- the molar ratio is at least five-fold different. In some methods, the molar ratio ranges from 1:20 to 20: 1. In some methods, the molar ratio ranges from 1:5 to 5: 1.
- the molar ratio ranges from 1:2 to 2: 1. In some embodiments, the molar ratio of an enzyme of each set of enzymes can be determined by culturing each cell line, and combining the sets of enzymes to form a mixture having the desired proportion of each enzyme.
- the first and second cell lines are the same strain. In some methods, two or more of the plurality of cell lines can be the same strain. In some methods, the first and second cell lines are the same strain modified to express different sets of one or more exogenous enzymes. In some methods, two or more of the plurality of the cell lines, which are the same strain, can be modified to express different sets of one or more exogenous enzymes. In some methods, the first and second cell lines are microbial cell lines.
- one or more cell lines of the plurality of cell lines are microbial cell lines.
- the first and second cell lines are the cell lines of fungal cell lines.
- one or more cell lines of the plurality of cell lines are fungal cell lines.
- the first and second cell lines are filamentous fungal cell lines or bacterial cell lines.
- one or more, or two or more cell lines of the plurality of cell lines are filamentous fungal cell lines or bacterial cell lines.
- the first and second cell lines are from fungal cell lines of the same genera.
- two or more cell lines of the plurality of cell lines are fungal cell lines of the same genera.
- the first and second cell lines are fungal cell lines of different genera.
- two or more of the plurality of cell lines are fungal cell lines of different genera.
- the first and second cell lines are fungal cell lines of different species of the same genera.
- two or more cell lines of the plurality of cell lines are fungal cell lines of different species of the same genera.
- the first and second cell lines are fungal cell lines of different strains of the same species.
- two or more cell lines of the plurality of cell lines are fungal cell lines of different strains of the same species.
- the first and second cell lines are fungal cell lines of different species of the same genera.
- two or more cell lines of the plurality of cell lines are fungal cell lines of different species of the same genera.
- the first line is a fungal cell line and the second cell line is a bacterial cell line. In some methods, at least one of the plurality of cell lines is a fungal cell line and at least one of the plurality of cell lines is a bacterial cell line. In some methods, the first and/or second cell lines are fungal cell lines. In some methods, one or more cell lines of the plurality of cell lines are fungal cell lines. In some methods, the first and/or second cell lines are Trichoderma reesei cell lines. In some methods, one or more cell lines of the plurality of cell lines are Trichoderma reesei cell lines. In some methods, the first and/or second cell lines are bacterial cell lines.
- one or more cell lines of the plurality of cell lines are bacterial cell lines.
- the first and/or second cell lines are Bacillus cell lines.
- one or more cell lines of the plurality of cell lines are Bacillus cell lines.
- Some methods further comprise determining growth profiles of the cell lines before the combining step, e.g., determining a ratio with which to mix the cell lines based on the growth profiles.
- the growth profiles of the cell lines are determined in different liquid media.
- Some methods further comprise selecting the liquid medium for culturing the combined cell lines based on the growth profiles of the cell lines in the different liquid media.
- the growth profiles of the cell lines are determined in the same liquid media.
- Some methods further comprise selecting the liquid medium for culturing the combined cell lines based on the growth profiles of the cell lines in the same liquid media. In some methods, the growth rates of the cell lines are within a factor of two of one another in the selected liquid medium.
- the cells used in the present methods can be from any type of organism, e.g., eukaryotic organisms, prokaryotic organisms and archaebacteria.
- the cells are from a microorganism (i.e., microbial cell lines), meaning the cells are prokaryotic, archaebacteria, or from a eukaryote capable of unicellular growth, such as fungi (e.g., filamentous fungi or yeasts), and algae.
- fungi e.g., filamentous fungi or yeasts
- Different organisms can be classified by domain (e.g., eukaryotes and prokaryotes). Domains are subdivided into kingdoms, e.g., Bacteria (e. g., Eubacteria); Archaebacteria;
- Protista; Fungi; Plantae; and Animalia. Kingdoms are further divided into phylums, classes, subclasses, orders, families, and genera.
- genera from fungi include Trichoderma, Aspergillus, Dermatophytes, Fusarium, Penicillum, and Saccharomyces.
- Genera are further divided into species.
- species from Trichoderma include Trichoderma reesei, Trichoderma viride, Trichoderma harzianum, and Trichoderma koningii.
- Species are divided into strains. Different strains are independent isolates of the same species. Different strains have different genotypes and/or phenotypes.
- a cell line is used in the conventional sense to indicate a population of substantially isogenic cells capable of continuous (preferably indefinite) growth and division in vitro without change other than occasional random mutations inherent from DNA replication.
- a cell line is typically propagated from a single colony.
- Submerged fermentation is a process in which the cells grow at least predominantly under the surface of the liquid medium.
- Solid state fermentation is a process in which cells grow on and inside a solid medium.
- An exogenous enzyme means an enzyme that is not normally expressed by a cell (e.g., a heterologous enzyme from another strain, species, genera or kingdom) or an enzyme that is normally expressed by a cell but is expressed at an increased level by virtue of being under the control of genetic material not normally present in a cell.
- Such expression can result from introduction of a gene encoding such an enzyme at a location where it is not normally present or by genetic manipulation of the cell to enhance the expression of an enzyme.
- Such genetic manipulation can change a regulatory element controlling expression of the enzyme or can introduce genetic material encoding a protein that acts in trans to enhance expression of the enzyme.
- exogenous nucleic acid means a nucleic acid not normally present in a cell (i.e., introduced by genetic engineering).
- An exogenous nucleic acid can be from a different strain, species, genera or kingdom (i.e., heterologous) or can be normally present in a cell but introduced in a different location than normally present.
- An enzyme is endogenous to a cell if the enzyme is normally expressed by the cell, and neither nucleic acid encoding the enzyme or any other nucleic acid regulating expression of the enzyme has been introduced into cell.
- An endogenous gene means a gene normally present in a cell at its normal genomic location.
- An enzyme or nucleic acid encoding the enzyme are heterologous to a cell if not normally encoded by the cell and introduced into the cell by genetic engineering.
- filamentous fungi refers to all filamentous forms of the subdivision Eumycotina (see, Alexopoulos, C. J. (1962), Introductory Mycology, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi are morphologically,
- a cell is disposed to express an enzyme if the cell includes DNA encoding the enzyme operably linked to one or more regulatory elements that allow expression of the DNA.
- the enzyme can be endogenous or exogenous. Expression can be constitutive or inducible.
- the DNA encoding the enzyme can be in a genomic or episomal location within the cell.
- SEM standard error of the mean
- Expression levels are compared between respective cultures of the same density and stage of culture growth of the respective cell lines. Expression levels are preferably determined from the concentration of secreted protein in culture media. Expression levels can be determined in units of moles, activity units, OD or other units.
- the invention provides methods of preparing enzyme cocktails by co-culturing different cell lines expressing different sets of enzymes catalyzing the same conversion process.
- Co-culturing provides greater flexibility and lower costs than conventional methods. It allows various mixtures to be made as needed without having to build a new production strain for each individual type of substrates and pretreatment methods. It also allows the desired enzyme mixtures to be created in one batch, obviating the need for blending the output from several separate fermentations. Preparation of a mixture of enzymes according to the present methods does not require a full recovery process for each fermentation, and/or separate storage of each enzyme component. Further, it allows maintenance of each production strain separately thereby preventing loss of the entire cocktail (engineered into a single production cell line) all at once.
- a conversion process is a process in which a substrate is converted into a product catalyzable by at least two enzymes.
- the substrate can be a complex substance such as plant material containing multiple types of molecules.
- the product can be a single product or multiple products.
- the conversion process can be a single step process or involves multiple steps. The process can involve multiple sequential and/or parallel steps. Different enzymes can act in sequential steps, parallel steps or in combination on the same step.
- Exemplary conversion processes include the conversion of cellulosic biomass, glycogen, starch and various forms thereof into sugars (e.g., glucose, xylose, maltose) and/or alcohols (e.g., methanol, ethanol, propanol, butanol).
- Some conversion processes convert starch, e.g., corn starch, wheat starch, or barley starch, corn solids, wheat solids, and starches from grains and tubers (e.g., sweet potato, potato, rice and cassava starch) into ethanol, or a syrup rich in saccharides useful for fermentation, particularly maltotriose, glucose, and/or maltose, or simply into one or more forms of sugars, which are in themselves useful products.
- grains and tubers e.g., sweet potato, potato, rice and cassava starch
- cellulosic or lignocellulosic material such as materials comprising cellulose and/or hemicellulose, and sometimes lignin, starch,
- Cellulosic or lignocellulosic material can optionally further comprise additional components, such as proteins and/or lipids.
- Cellulosic or lignocellulosic material can optionally further comprise additional components, such as proteins and/or lipids.
- lignocellulosic material includes bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste, such as corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley straw, hay, rice straw, switchgrass, wasted paper, sugar cane bagasse, sorghum, giant reed, elephant grass, miscanthus, Japanese cedar, components obtained from milling of grains, tress, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure.
- Cellulosic or lignocellulosic material can be derived from a single source, or can comprise a mixture derived from more than one source.
- cellulosic or lignocellulosic material can comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves.
- lignocellulosic material substrate are glucose and ethanol.
- the substrate is glucose, fructose, dextrose, and sucrose, and/or C5 sugars such as xylose and arabinose, and mixtures thereof.
- Sucrose can be derived from sources such as sugar cane, sugar beets, cassava, sweet sorghum, and mixtures thereof.
- Glucose and dextrose can be derived from renewable grain sources through saccharification of starch based feedstocks including grains such as corn, wheat, rye, barley, oats, and mixtures thereof.
- Fermentable sugars can also be derived from cellulosic or lignocellulosic biomass through processes of pretreatment and saccharification.
- the product of such conversion processes can be alcohols such as ethanol or butanol.
- the substrates are pretreated.
- Pretreatments can be mechanical, chemical, or biochemical processes or combinations thereof.
- the pretreatment can comprise one or more techniques including autohydrolysis, steam explosion, grinding, chopping, ball milling, compression mulling, radiation, flow-through liquid hot water treatment, dilute acid treatment, concentrated acid treatment, peracetic acid treatment, supercritical carbon dioxide treatment, alkali treatment, organic solvent treatment, , and treatment with a microorganism, such as, for example a fungus or a bacterium.
- the alkali treatment can include sodium hydroxide treatment, lime treatment, wet oxidation, ammonia treatment, and oxidative alkali treatment.
- the pretreating can involve removing or altering lignin, removing hemicellulose, decrystallizing cellulose, removing acetyl groups from hemicellulose, reducing the degree of polymerization of cellulose, increasing the pore volume of lignocellulose biomass, increasing the surface area of lignocellulose, or any combination thereof.
- Cocktails of any combination of enzymes selected from enzymes including, but not limited to, the six major enzyme classifications of hydrolase, oxidoreductase, transferase, lyase, isomerase or ligase can be made (Nomenclature Committee of the International Union of
- NC-IUBMB Biochemistry and Molecular Biology
- suitable enzymes include a cellulase, a
- hemicellulase a xylanase, an amylase, a glucoamylase, a protease, a phytase, a cutinase, a phytase, a laccase, a lipase, an isomerase, a glucose isomerase, an esterase, a peroxidase, a phospholipase, a pectinase, a keratinase, a reductase, an oxidase, a peroxidase, a phenol oxidase, a lipoxygenase, a ligninase, a pullulanase, a tannase, a pentosanase, a maltase, mannanase, glucuronidase, galactanase,, a ⁇ -glucanase, an arabinos
- the enzymes can be from any origin, e.g., bacteria or fungi.
- the enzymes can be a hybrid enzyme, i.e., a fusion protein which is a functional enzyme, wherein at least one part or portion is from a first species and another part or portion is from a second species.
- the enzymes can be a mutant, truncated or hybrid form of native enzymes.
- the enzymes suitable for the present methods can be a secreted, cytoplasmic, nuclear, or membrane protein.
- Extracellular enzymes e.g., a cellulase, hemicellulase, protease, or starch degrading enzyme such as amylase, usually have a signal sequence linked to the N-terminal portion of their coding sequence.
- enzyme substrates include lignocellulosic materials, cellulose, hemicellulose, starch, or a combination thereof.
- An exemplary group of enzymes for catalyzing lignocellulosic materials conversion includes endoglucanases, exoglucanases or
- An exemplary group of enzymes for catalyzing hemicellulose conversion includes at least xylanase, mannanase, xylosidase, mannosidase, glucosidase, arabinosidase, glucuronidase, and galactosidase.
- An exemplary group of enzymes for catalyzing starch hydrolysis include at least a-amylase, saccharifying a-amylase, ⁇ -amylase, glucoamylase, and pullulanases.
- additional enzymes e.g., proteases and phytases, can be selected.
- Cellulases are enzymes that hydrolyze the ⁇ -D-glucosidic linkages in celluloses.
- Cellulolytic enzymes have been traditionally divided into three major classes: endoglucanases, exoglucanases or cellobiohydrolases and ⁇ -glucosidases (Knowles, J. et al., TIBTECH 5:255- 261 (1987)).
- Cellulase enzymes also include accessory enzymes, including GH61 members, such as EG4, swollenin, expansin, and CIPl.
- GH61 members such as EG4, swollenin, expansin, and CIPl.
- Numerous cellulases have been described in the scientific literature, examples of which include: from Trichoderma reesei: Shoemaker, S. et al., Bio/Technology, 1:691-696, 1983, which discloses CBHI; Teeri, T. et al., Gene, 51:43-52, 1987, which discloses CBHII; Penttila, M. et al., Gene, 45:253-2
- endoglucanases from species other than Trichoderma have also been described e.g., Ooi et al., 1990, which discloses the cDNA sequence coding for endoglucanase Fl-CMC produced by Aspergillus aculeatus; Kawaguchi T et al., 1996, which discloses the cloning and sequencing of the cDNA encoding ⁇ -glucosidase 1 from Aspergillus aculeatus; Sakamoto et al., 1995, which discloses the cDNA sequence encoding the endoglucanase CMCase-1 from Aspergillus kawachii IFO 4308; and Saarilahti et al., 1990 which discloses an endoglucanase from Erwinia carotovara.
- Hemicellulases are enzymes that catalyze the degradation and/or modification of hemicelluloses, including xylanase, mannanase, xylosidase, mannosidase, glucosidase, arabinosidase, glucuronidase, and galactosidase.
- the hemicellulase can be a xylanase, i.e., any xylan degrading enzyme which is either naturally or recombinantly produced.
- xylan degrading enzymes are endo- and exo-xylanases hydrolyzing xylan in an endo- or an exo-fashion.
- Exemplary xylan degrading enzymes include endo-l,3-P-xylosidase, endo- pi,4-xylanases (1,4-P-xylan xylanohydrolase; EC 3.2.1.8), 1,3-P-D-xylan xylohydrolase and ⁇ - 1-4- xylosidases (1,4-P-xylan xylohydrolase; EC 3.2.1.37) (EC Nos. 3.2.1.32, 3.2.1.72, 3.2.1.8, 3.2.1.37).
- Preferred xylanases are those which are derived from a filamentous fungus (e.g., the fungi of the genera Aspergillus, Disportrichum, Penicillium, Humicola, Neurospora, Fusarium, Trichoderma and Gliocladium) or a bacterial source (e.g., Bacillus, thermotoga, Streptomyces, Microtetraspora, Actinmadura, Thermomonospora, Actinomyctes and Cepholosporum).
- Amylases are starch-degrading enzymes, classified as hydrolases, which cleave a-D-
- a-amylases (E.C. 3.2.1.1, a-D-(l - 4)-glucan glucanohydrolase) are defined as endo-acting enzymes cleaving a-D-(l- 4) O-glycosidic linkages within the starch molecule in a random fashion.
- the exo-acting amylolytic enzymes such as ⁇ -amylases (E.C. 3.2.1.2, a-D-(l- 4)-glucan maltohydrolase), and some product- specific amylases like maltogenic alpha-amylase (E.C.
- 3.2.1.133 cleave the starch molecule from the non-reducing end of the substrate, ⁇ - Amylases, a-glucosidases (E.C. 3.2.1.20, a-D-glucoside glucohydrolase), glucoamylase (E.C. 3.2.1.3, a-D-(l- 4)-glucan glucohydrolase), and product- specific amylases can produce malto-oligosaccharides of a specific length from starch.
- a-amylases are those derived from Bacillus sp., particularly those from Bacillus licheniformis, Bacillus amyloliquefaciens or Bacillus stearothermophilus, as well as Geobacillus stearothermophilus, and fungal ⁇ -amylases such as those derived from Aspergillus (i.e., A. oryzae and A niger).
- ⁇ -amylases can be derived from a precursor a- amylase.
- the precursor a-amylase is produced by any source capable of producing a- amylase.
- Suitable sources of ⁇ -amylases are prokaryotic or eukaryotic organisms, including fungi, bacteria, plants or animals.
- the precursor a-amylase is produced by Geobacillus stearothermophilus or a Bacillus; more preferably, by Bacillus licheniformis, Bacillus amyloliquefaciens or Bacillus stearothermophilus; most preferably, the precursor ⁇ -amylase is derived from Bacillus licheniformis.
- ⁇ -amylases can also be from Bacillus subtilis.
- Glucoamylases are enzymes of amyloglucosidase class (E.C. 3.2.1.3, glucoamylase, 1,4-alpha-D-glucan glucohydrolase). These enzymes release glucosyl residues from the non- reducing ends of amylose and amylopectin molecules.
- Pullulanases are starch debranching enzymes. Pullulanases are enzymes classified in EC 3.2.1.41 and such enzymes are characterized by their ability to hydrolyze the a-1, 6- glycosidic bonds in, for example, amylopectin and pullulan.
- proteases such as a serine, metallo, thiol or acid protease.
- Serine proteases e.g., subtilisin
- Proteolytic activity can be measured as disclosed in K. M. Kalisz, "Microbial Proteinases” Advances in Biochemical Engineering and Biotechnology, A. Fiecht Ed. 1988.
- Phytases are enzymes that catalyze the hydrolysis of phytate to (1) myo-inositol and/or (2) mono-, di-, tri-, tetra- and/or penta-phosphates thereof and (3) inorganic phosphate.
- phytases include enzymes defined by EC number 3.1.3.8, or EC number 3.1.3.26. IV. Cell lines
- cell lines are identified or constructed to express different sets of the enzymes.
- the enzymes endogenously expressed by some cell lines are well known.
- T. reesei is a source of several cellulose processing enzymes and Bacillus is a source of a number of amylases.
- Such cell lines are sometimes used without modification.
- one or more enzymes desired to enhance the enzymatic conversion process are not endogenously expressed at sufficient levels by a known existing cell line.
- an existing cell line can be genetically engineered to express an enzyme exogenously.
- existing cell line(s) can be genetically engineered to express each of the enzymes exogenously.
- each such enzyme can be exogenously expressed in its own cell line.
- the cell lines into which different enzymes are genetically engineered represent modifications of the same base cell line.
- exogenous expression As a result of endogenous expression, exogenous expression, or both, cell lines to be co-cultured can express different sets or panels of enzymes, all of which contribute to the enhancement of enzymatic conversion.
- the set or panel of enzymes produced by the cell line are said to include exogenous enzyme(s).
- the set or panel of enzymes produced by the cell line are said to include endogenous enzymes and exogenous enzymes.
- the set or panel of enzymes produced by the cell line are said to include only endogenous enzymes.
- exogenous enzymes of a set are readily known and recognized, such is not necessarily the case for endogenous enzymes expressed at trace levels.
- the set or panel of enzymes is defined as including only enzymes expressed at detectable levels as determinable by HPLC according to the conditions and/or protocols used in the examples.
- each enzyme in a set is expressed and/or secreted at a level of at least 1/100 or 1/10 the level of the most highly expressed enzyme in the set. It is not necessary for practice of the present methods to know the identity of all enzymes falling within a set. Rather, it is sufficient to know the identity of at least one enzyme within a set produced by a given cell line.
- the set of enzymes encoded by one cell line can contain no, partial or complete overlap with the set of enzymes encoded by a second cell line. Enzymes present in the first set of the first cell line and enzymes present in the second set of the second cell line may be expressed at different levels. If the identities of the enzymes in the sets completely overlap at least one enzyme is expressed at a different level (i.e., the standard errors of means (SEMs) do not overlap) between the sets.
- each set of enzymes includes at least one enzyme not expressed or expressed at a lower level in other set(s) of enzymes from other cell line(s) included in the co-culture.
- At least one enzyme in one set of enzymes (e.g., a first set) catalyzing a conversion process is exogenous to that cell line expressing the same set of enzymes (e.g., a first cell line).
- any cell line included in a co-culture not expressing an exogenous enzyme expresses an endogenous enzyme, which is otherwise not expressed or expressed at significantly lower levels by each other cell line included in the co-culture.
- the cell lines expressing the other sets can be a strain, a species, or a genus different than that of the first cell line.
- one cell line can be a base strain or cell line modified to express an exogenous enzyme and another cell line can the base cell line or strain without the modification.
- the modification may substantially suppress expression of an endogenous enzyme that would otherwise enhance the conversion process.
- co-cultivation of the modified cell line with the base strain or cell line can provide a blend of the exogenous and endogenous enzymes in more effective proportions than culture of either cell line alone.
- the ratios are preferably by moles but activity units, mass or other units can also be used.
- the ratio of any enzymes can be compared by assessing the difference between 1) a first set of enzymes and a second set of enzymes in a mixture of enzymes resulting from co- culture and 2) one or both individual cell lines. Such a comparison is most readily illustrated on a pair-wise basis between the most highly expressed enzyme in the first set and the most highly expressed enzyme in the second set (expression being measured at the protein level, preferably of a secreted protein).
- the ratio of such enzymes in either individual cell line is preferably at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50-fold different than in the mixture of enzymes.
- the highest expressed enzyme in a first set and the highest expressed enzyme in a second set are expressed at a 1: 1 molar ratio in a mixture resulting from co-culture and a 10: 1 ratio in a first cell line and a 1: 10 ratio in a second cell line, then the molar ratio is 10-fold different in the mixture than either cell line.
- Pair- wise or group comparisons can be made between any other enzymes in the first or second set.
- a group used for a comparison can be defined as, e.g., secreted enzymes in each set, intracellular enzymes in each set, exogenous enzymes in each set, or enzymes having a recombinant tag in each set.
- the ratio of enzymes between the first and second sets can also be compared by summing the molar amounts of known enzymes in the first set and molar amounts of enzymes in the second set (or at least those that are known) and calculating a ratio.
- Such ratios preferably range from 1:50 to 50: 1, 1:45 to 45: 1, 1:40 to 40: 1, 1:35 to 35: 1, 1:30 to 30: 1, 1:25 to 25: 1, 1:20 to 20: 1, 1: 10 to 10: 1, 1:5 to 5: 1, or 1:2 to 2: 1
- Cell lines are engineered to express one or more exogenous enzymes by conventional methods.
- a nucleic acid encoding an enzyme in operable linkage to regulatory sequences to ensure its expression is transformed into the cell line.
- the enzyme can be fused to a recombinant tag (e.g., His-tag, FLAG-tag, GST, HA-tag, MBP, Myc- tag) to facilitate detection or quantification in co-culture or in a mixture of enzymes resulting from co-culture.
- the nucleic acid encoding the enzyme is preferably also fused to a signal peptide to allow secretion. Any suitable signal peptide can be used depending on the enzyme to be expressed and secreted in a host organism.
- signal sequences include a signal sequence from a Streptomyces cellulase gene.
- a preferred signal sequence is a S. lividans cellulase, celA (Bently et al., Nature 417: 141-147, 2002).
- the nucleic acid is then preferably stably maintained either as a result of transformation on an episome or through integration into the chromosome.
- expression of an enzyme can be induced by activating in cis or in trans DNA encoding the enzyme in the chromosome.
- inhibition or knockout strategy can also be used to remove unnecessary genes or replacing an endogenous gene and replacing it with an improved version, a variant of, and/or a heterologous version of that gene.
- inhibition or knockout can be performed by siRNA, zinc finger proteins, other known molecular biology techniques used to knockout or reduce expression of particular endogenous genes, or the like.
- the cell lines combined for co-culture can be from different, or same, domains, kingdoms, phylums, classes, subclasses, orders, families, genera, or species. They can also be from different strains of different species, different strains of the same species, or from the same strain.
- Exemplary combinations include cell lines from different strains of the same species (e.g., T. reesei RL-P37 (Sheir-Neiss and Montenecourt, Appl. Microbiol. Biotechnol. 20:46-53, 1984) and T. reesei QM-9414 (ATCC No. 26921 ; isolated by the U.S. Army Natick Laboratory).
- Cell lines from different strains of different species in the same kingdom e.g., fungus
- T. reesei RL-P37 and Aspergillus niger can be used.
- Cell lines from different strains of different species in different kingdoms/domains can also be used (e.g., bacteria, yeast, fungi, algae, and higher eukaryotic cells (plant or animal cells)).
- Exemplary combinations further include a bacterium (e.g., B. subtilis or E. coli) and a fungus (e.g., T. reesei or Aspergillus niger); a bacterium and a yeast (e.g., Saccharomyces or Pichia); a yeast and a fungus; a bacterium and an algae, a yeast and an algae, a fungus and an algae and so forth.
- bacterium e.g., B. subtilis or E. coli
- a fungus e.g., T. reesei or Aspergillus niger
- a bacterium and a yeast e.g., Saccharomyces or Pichia
- each cell line can encode one or more different exogenous enzymes.
- some cell lines can also be engineered so that a gene in the base strain is suppressed or inhibited, e.g., by at least 50%, 75%, or 90%, of the normal expression level.
- the cell lines suitable for the present methods include bacteria, yeast, fungi and higher eukaryotic cell lines such as plant or animal cell lines. Microbial cell lines are preferred.
- the cell lines can be yeast cell lines.
- yeast cells include Saccharomyces sp., Schizosaccharomyces sp., Pichia sp., Hansenula sp., Kluyveromyces sp., Prtaffia sp., or Candida sp., such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans, Hansenula polymorpha, Pichia pastoris, P. canadensis, Kluyveromyces marxianus, and Phaffia rhodozyma.
- the cell lines can be fungal cell lines.
- fungi include species of
- filamentous fungal cells may be a cell of a species of, but not limited to, Trichoderma, (e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified as T.
- Fusarium sp. e.g., F. roseum, F. graminum, F. cerealis, F. oxysporuim, or F. venenatum
- Neurospora sp. e.g., N. crassa
- Hypocrea sp.
- Mucor sp. (e.g., M. miehei), Rhizopus sp. and Emericella sp. (see also, Innis et al, ScL 228: 21- 26, 1985).
- the term "Trichoderma” or “Trichoderma sp.” or “Trichoderma spp.” refers to any fungal genus previously or currently classified as Trichoderma.
- the fungus can be A. nidulans, A. awamori, A. oryzae, A. aculeatus, A. niger, A. japonicus, T. reesei, T. viride, F. oxysporum, or F. solani.
- the fungus is a strain of Trichoderma, such as a strain of T. reesei.
- Strains of T. reesei are known and non-limiting examples include ATCC No. 13631, ATCC No. 26921, ATCC No. 56764, ATCC No. 56765, ATCC No. 56767, and NRRL 15709, which are each hereby incorporated by reference in their entireties, particularly with respect to strains of T. reesei.
- the host strain can be a derivative of RL-P37 (Sheir-Neiss et al., Appl. Microbiol. Biotechnology 20:46-53, 1984).
- the cell lines can be bacterial cell lines.
- bacterial cells suitable for the present methods include a gram-positive bacterium (e.g., Streptomyces and Bacillus) and a gram-negative bacterium (e.g., Escherichia coli and Pseudomonas sp.).
- Preferred examples include strains of Bacillus such as B. lichenformis or B. subtilis, strains of Lactobacillus , strains of Streptococcus, strains of Pantoea such as P. citrea, strains of Pseudomonas such as P.
- the genus "Bacillus” includes all species within the genus "Bacillus,” as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B.
- the genus Bacillus continues to undergo taxonomical reorganization.
- the genus include species that have been reclassified, including but not limited to such organisms as B.
- Aneurinibacillus Anoxybacillus, Brevibacillus, Filobacillus, Gracilibacillus, Halobacillus, Paenibacillus, Salibacillus, Thermobacillus, Ureibacillus, and Virgibacillus.
- the cell lines can be plant cell lines.
- plant cells include a plant cell from the family Fabaceae, such as the Faboideae subfamily.
- plant cells suitable for the present methods include a plant cell from kudzu, poplar (such as Populus alba x tremula CAC35696 or Populus alba) (Sasaki et al., FEBS Letters 579(11): 2514-2518, 2005), aspen (such as Populus tremuloides), or Quercus robur.
- the cell lines can be an algae cell, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
- an algae cell such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
- the cell lines can be a cyanobacteria cell, such as cyanobacteria classified into any of the following groups based on morphology: Chroococcales, Pleurocapsales, Oscillatoriales, Nostocales, or Stigonematales.
- the cell lines can be a mammalian cell such as Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, COS cells, or any number of other immortalized cell lines available, e. g., from the American Type Culture Collection.
- the first cell line is a T. reesei strain encoding an exogenous ⁇ - xylosidase and the second cell line is a T. reesei strain encoding an exogenous ⁇ -glucosidase.
- the first cell line is a B. licheniformis strain encoding Bacilllus licheniformis amylase and the second cell line is a B. licheniformis strain encoding Geobacillus stearothermophilus amylase.
- the first cell line is a T. reesei strain encoding an exogenous GH61 enzyme and the second cell line is a T. reesei strain encoding exogenous or endogenous cellulases.
- the cell lines to be co-cultured can in some embodiments be separately cultured initially to form starter cultures (which preferably have an optical density of at least about 0.1, 0.2, 0.4, 0.8, 1.0, or 1.5 at a wavelength of 600 nm and a path length of 1 cm).
- the starter cultures are then mixed in equal volumes or other desired ratio (as discussed further below) in fresh culture media to form a starting co-culture.
- isolates can be directly inoculated in culture media for protein production (e.g., without the use of starter cultures).
- Potential issues of one cell line outgrowing another can be reduced by selecting cell lines, e.g., closely related cell lines, with inherently similar growth characteristics, selection of a culture media that is not optimal for at least one of the cell lines but reduces differences in growth when each cell line is grown on separate culture media and/or by adjusting the ratio by volume, or more accurately by OD or cell count, with which cultures are combined in order to compensate for different growth characteristics.
- One source of closely related cell lines is cell lines from the same species (e.g., T. reesei) or same strain, or more preferably the same base strain or cell line modified in different ways to express different exogenous enzymes.
- a first cell line is a base cell line genetically engineered to express enzyme A and a second cell line is the base cell line genetically engineered to express enzyme B.
- the growth profile of each cell line can be determined. Based on the determined growth profiles, a ratio or a range of ratios, with which to mix the cell lines for optimal co-expression of the first set of enzymes and the second set of enzymes (or more sets of enzymes), can then be determined to compensate at least in part for differences in growth profiles.
- any cell culture system there is a characteristic growth pattern following inoculation that includes a lag phase, an accelerated growth phase, an exponential or "log" phase, a negative growth acceleration phase and a plateau or stationary phase.
- the log and plateau phases give information about the cell line, the population doubling time during log growth, the growth rate, and the maximum cell density achieved in plateau. For example, in the log phase, as growth continues, the cells reach their maximum rate of cell division, and numbers of cells increase in log relationship to time. By making one count at a specified time and a second count after an interval during the log phase and knowing the number of elapsed time units, one can calculate the total number of cell divisions or doublings, the growth rate and generation time.
- Measurement of the population doubling time can be used to monitor the culture during serial passage and calculate cell yields and the dilution factor required at subculture.
- the population doubling time is an average figure and describes the net result of a wide range of cell division rates within the culture.
- the doubling time differs with varying cell types, culture vessels and conditions.
- Pre-determined growth profiles can be used to determine the population doubling time for each cell line used in the co-culture.
- the population doubling times in exponential growth of cell lines to be co-cultured are within a factor of 2 or 5 of each other.
- the population doubling time in exponential growth of cell lines selected to be co-cultured are within a factor of 2, 3, 4, or 5 of each other.
- the culture media is preferably varied to identify a culture media on which the population doubling times are more similar, preferably within a factor of 2 or 5 of each other.
- the components and conditions provided by the culture media can be adjusted and used to reduce the differences in population doubling time in exponential growth of cell lines such that the population doubling times for each cell lines become within a factor of 2 or 5 of each other.
- cell lines can first be selected based on their small differences in growth profiles using conventional culture media, followed by adjustment of culture
- the optimal ratio of sets of enzymes encoded by a first cell line to a second cell line is not necessarily known a priori. Combination of the cell lines in different ratios by volume, OD or number of cells allows different ratios to be compared empirically on a small scale, with an optimal ratio identified by such analysis being used for subsequent larger scale culture.
- the cell lines can be at ratios that result in each cell line reaching a defined point in the growth curve at about the same time. For example, the ratio can be adjusted so each cell line reaches mid-log phase at about the same time. Alternatively, each cell line reaches plateau phase (mid-plateau phase) at about the same time. Preferably, each cell line reaches both the mid-log phase and the plateau phase at about the same time. Optionally, each cell line reaches stationary phase at about the same time.
- the growth profiles can also be used to determine the harvest time and/or seeding densities required for achieving certain ratios of harvesting cell densities between/among the cell lines. For example, an equal molar ratio of different sets of enzymes may be desired for one type of substrates/pretreatment methods. Different ratios of enzymes desired for other types of substrates/pretreatment methods can be achieved by varying the seeding densities of one or more cell lines as well as the harvest time. Each cell line can have different requirement for optimal growth in culture media, particularly for cell lines from different organisms (e.g., different domains, kingdoms, genera, or species), or different strains.
- a culture media although not optimal for any single cell line, can be optimal for co-fermentation of all cell lines if all cell lines have similar growth profiles in such a media. Accordingly, the growth profile of each cell line in multiple culture media can be determined. These growth profiles are then compared to identify a culture media in which the growth profiles of the cell lines are the most similar. For example, in such a media each cell line reaches plateau phase (mid-plateau phase), mid-log phase, and/or stationary phase at about the same time. The chosen culture media is then used for co-culture. As an alternative to, or in combination with, the cell density-based growth profiling, the amounts of the enzymes and/or the activities of the expressed enzymes can be measured along the growth curve.
- variations along the growth curve provide guidance for determining the ratio with which to mix the cell lines for optimal co-expression of the enzymes.
- the expression levels of some enzymes may be lower than other enzymes.
- a higher seeding density of the cell lines expressing the enzymes is preferred to achieve a desired amount of these lowly expressed enzymes.
- Cell lines from the same strain usually have similar growth profiles and require similar culture media.
- cell lines from different strains or different organisms often have different growth profiles and require different culture media.
- growth profiles of different cell lines can be measured to determine the seeding density for each cell line.
- growth profiles in various culture media for each cell line are measured to determine a media suitable for co-culture.
- the enzymes can be released directly to the culture media.
- cells can be lysed releasing intracellular enzymes.
- some enzymes expressed by a given cell line can be released directly whereas other enzymes may be released by cell lysis.
- the released enzymes can be harvested from the culture media, or the culture medium can be used as is with minimal if any further processing as a whole broth.
- Cell debris e.g., host cells, lysed fragments
- the enzyme mixture can be concentrated, e.g., with a commercially available protein concentration filter.
- the enzyme mixture can be separated further from other impurities by one or more purification steps, e.g., immunoaffinity
- chromatography ion-exchange column fractionation (e.g., on diethylaminoethyl (DEAE) or matrices containing carboxymethyl or sulfopropyl groups), chromatography on Blue-Sepharose, CM Blue-Sepharose, MONO-Q, MONO-S, lentil lectin-Sepharose, WGA-Sepharose, Con A- Sepharose, Ether Toyopearl, Butyl Toyopearl, Phenyl Toyopearl, or protein A Sepharose, SDS- PAGE chromatography, silica chromatography, chromatofocusing, reverse phase HPLC (RP- HPLC), gel filtration using, e.g., Sephadex molecular sieve or size-exclusion chromatography, chromatography on columns that selectively bind the peptide, and ethanol, pH or ammonium sulfate precipitation, membrane filtration and various techniques.
- the enzyme mixture is used in
- the amounts of the enzymes secreted or lysed from cells or in finished product can be measured using conventional techniques, e.g., by reverse phase high performance liquid chromatography (RP-HPLC), or sodium dodecyl sulfate -polyacrylamide gel electrophoresis
- RP-HPLC reverse phase high performance liquid chromatography
- Cell lines expressing different sets of enzymes can be stored in a cell bank and co- cultured in different combinations.
- a cell bank can be constructed with a particular conversion process or a particular set of conversions in mind. Enzymes enhancing the conversion process are identified either from known or published sources, from experiments, or from both. Cell lines are then identified or constructed encoding and disposed to express different sets of the enzymes.
- Cell lines expressing one or more of the enzymes endogenously or exogenously may already be known.
- Cell lines expressing one or more of the enzymes exogenously can also be constructed particularly if no cell line expressing a particular enzyme or a particular combination or panel of enzymes at sufficient levels is already available.
- the cell lines in a bank can be stored on solid or liquid media in the cold or frozen. Before use, a vial of cells is typically separately propagated to form a starter culture, which can also take place in a liquid or on solid medium.
- the cell lines can be propagated and stored under different selective pressures to retain expression of the respective sets of enzyme and avoid the possibility of cross contamination. Alternatively, the cell lines can be propagated and stored under conditions that allow growth of the auxotrophs, thereby maintaining the genotypes.
- the cell lines can be co-cultured and used to prepare a mixture of enzymes using the methods described above. After combination, the cell lines are propagated on media in which the combined cell lines are used, so selective conditions or conditions that allow auxotroph growth that may have been used for separate propagation and storage of the cells lines are not necessarily used in the co-culture step.
- the cell bank may allow selection of different permutations of cell lines that provide enzymes enhancing the conversion process in different combinations or relative expression levels.
- the different combinations can be compared to determine which given enzyme mixture has the best activity for enhancing the conversion process.
- Such a comparison can indicate the best combination of cell lines within a bank without necessarily knowing a priori exactly which enzymes or what ratio of enzymes is optimal. In that sense, this allows the tailoring of the panel of expressed enzymes from a co-culture to the particular requirements of a particular conversion process.
- the amount of hemicellulose may vary in a cellulose preparation. Enzyme cocktails for treating high amounts of hemicellulose can contain a higher level of xylanase activity. Some starch preparations may contain a substance (e.g., raw material or metabolite) known to be inhibitory of amylase activity, in which case a higher amylase amount is desirable.
- a substance e.g., raw material or metabolite
- different enzyme cocktails can be prepared by mixing starter cultures of enzyme production strains in different ratios, thereby producing enzyme cocktails having different relative amounts of the enzymes.
- Cell banking can also be useful irrespective of the conversion process.
- the cell lines By banking different cell lines encoding a variety of commonly used industrial enzymes, the cell lines can be combined in different combinations from the bank for co-culture depending on the conversion process at hand.
- the co-fermentation method provided herein therefore not only provides flexibility of a resulting composition, but also affords various other advantages such as, for example, reduced costs as compared to conducting fermentation of each desired enzyme component separately followed by blending; reduced cost for storage of enzymes because co- fermentation results in a composition with desired ratios of enzymes, whereas the blending strategy will require storage for each individual enzyme separately fermented or prepared. VII. Applications
- the enzyme mixtures produced by the present methods have various agricultural, industrial, medical and nutritional applications where such a conversion process is utilized.
- the substrates of such a conversion process can be, e.g., lignocellulosic materials, cellulose, hemicellulose, starch.
- a mixture of cellulase enzymes and/or cellulase accessory enzymes can be used for hydrolysis of cellulolytic materials, e.g., in the fermentation of biomass into biofuels.
- the mixture is also useful for generating glucose from grain, or as a supplement in animal feed to decrease the production of fecal waste by increasing the digestibility of the feed.
- Cellulase enzymes can also be used to increase the efficiency of alcoholic fermentations (e.g., in beer brewing) by converting lignocellulosic biomass into fermentable sugars.
- the cellulase mixture can be used for commercial food processing in coffee, i.e., hydrolysis of cellulose during drying of beans. They have also been used in the pulp and paper industry for various purposes.
- cellulases are useful as a treatment for phytobezoars, a form of cellulose bezoar found in the human stomach.
- a mixture of cellulase enzymes, cellulase accessory enzymes, and/or hemicellulase enzymes are widely used in textile industry and in laundry detergents.
- Cellulases can also be used in hydrolyzing cellulosic or lignocellulosic materials into fermentable sugars.
- a mixture of amylases or a mixture of a-amylase, ⁇ -amylase, glucoamylase, and/or pullulanases has various applications in food industry.
- a mixture of amylase enzymes is useful in syrup manufacture, dextrose manufacture, baking, saccharification of fermented mashes, food dextrin and sugar product manufacture, dry breakfast food manufacture, chocolate syrups manufacture, and starch removal from fruit juices.
- Amylases can also be used in producing glucose from grain products for ethanol production.
- a mixture of enzymes containing phytases can be used in grain wet milling and cleaning products. They also find many other uses in personal care products, medical products and food and nutritional products, as well as in various industrial applications, particularly in the cleaning, textile, lithographic and chemical arts.
- Example 1 Co-fermentation of two T. reesei strains for producing a mixture of ⁇ -xylosidase and ⁇ -glucosidase.
- NuPAGE® Novex 4-12% Bis-Tris gels and MOPS (Invitrogen) buffer were used with the SeeBlue®Plus2 molecular weight marker for SDS-PAGE analysis. Samples were added on an equal volume of culture supernatant basis.
- LC Liquid chromatography
- MS mass spectroscopy
- Fv3C sequence (SEQ ID NOs: 1 and 2) was obtained from the Fusarium verticillioides genome in the Broad Institute database (http://www.broadinstitute.org/).
- the Fv3C open reading frame was amplified by PCR using purified genomic DNA from Fusarium verticillioides as the template.
- the PCR thermocycler used was DNA Engine Tetrad 2 Peltier Thermal Cycler (Bio- Rad Laboratories).
- the DNA polymerase used was PfuUltra II Fusion HS DNA Polymerase (Stratagene).
- the primers used to amplify the open reading frame were as follows:
- Reverse primer MH235 (5 ' -TTACTCCAACTTGGCGCTG-3 ' ) (SEQ ID NO: 16)
- the forward primers included four additional nucleotides (sequences - CACC) at the 5 '-end to facilitate directional cloning into pENTR/D-TOPO (Invitrogen, Carlsbad, CA).
- the PCR conditions for amplifying the open reading frames were as follows: Step 1: 94°C for 2 minutes. Step 2: 94°C for 30 seconds. Step 3: 57°C for 30 seconds. Step 4: 72°C for 60 seconds. Steps 2, 3 and 4 were repeated for an additional 29 cycles. Step 5: 72°C for 2 min.
- the PCR product of the Fv3C open reading frame was purified using a Qiaquick PCR Purification Kit (Qiagen).
- the purified PCR product was initially cloned into the pENTR/D-TOPO vector, transformed into TOP10 Chemically Competent E. coli cells (Invitrogen) and plated on LA plates containing 50 ppm kanamycin. Plasmid DNA was obtained from the E. coli transformants using a QIAspin plasmid preparation kit (Qiagen). Sequence confirmation for the DNA inserted in the pENTR/D-TOPO vector was obtained using Ml 3 forward and reverse primers and the following additional sequencing primers:
- CHIMERIC ⁇ -GLUCOSIDASE Portions of the wild type Fusarium verticillioides Fv3C (SEQ ID NOs: 1 and 2) C-terminal gene sequence were replaced with C-terminal sequence from T. reesei ⁇ -glucosidase, Bgl3 (or Tr3B) (SEQ ID NOs: 7 and 8). Specifically, a contiguous stretch representing residues 1-691 of Fv3C was fused with a contiguous stretch representing residues 668-874 of Bgl3 (SEQ ID NOs: 9 and 10). The chimeric/fusion molecule was constructed using fusion PCR.
- pENTR clones of the genomic Fv3C ( Figure 1) and Bgl3 coding sequences were used as PCR templates. Both entry clones were constructed in the pDONRTM221 vector (Invitrogen). The fusion product was assembled in two steps. First, the Fv3C chimeric part was amplified in a PCR reaction using a pENTR_Fv3C DNA as a template and the following oligonucleotide primers: pDonor Forward: 5'-
- the Bgl3 chimeric part was amplified from a pENTR_Bgl3 vector using the following oligonucleotide primers: pDonor Reverse: 5'-
- Fv3C/Bgl3 forward 5'- CTACGAGTTCGGTC ACGGTCTATCTTGGTCGACGTTCAAGTTC TCCAACCTCC-3 ' (SEQ ID NO:24)
- equimolar of the PCR products (about 1 and 0.2 ⁇ L ⁇ of the initial PCR reactions, respectively) were added as templates for a subsequent fusion PCR reaction using a set of nested primers as follows:
- the PCR reactions were performed using a high fidelity Phusion DNA polymerase (Finnzymes OY).
- the resulting fused PCR product contained the intact Gateway- specific attLl, attL2 recombination sites on the ends, allowing for direct cloning into a final destination vector via a Gateway LR recombination reaction (Invitrogen).
- the fragments were purified using a Nucleospin® Extract PCR clean-up kit (Macherey-Nagel GmbH & Co. KG) and 100 ng of each fragment was recombined using a pTTT-pyrG13 destination vector and the LR clonaseTM II enzyme mix (Invitrogen).
- Fv3C/Bgl3 region was sequenced using an ABI3100 sequence analyzer (Applied Biosystems) for confirmation.
- a further chimeric ⁇ -glucosidase was constructed, which comprised the N-terminal sequence derived from Fv3C (SEQ ID NOs: 1 and 2), a loop region derived from the sequence of a ⁇ -glucosidase from Talaromyces emersonii Te3A (SEQ ID NOs: 5 and 6), and a C-terminal part sequence derived from T. reesei Bgl3 (Tr3B) (SEQ ID NOs: 7 and 8).
- Pr Cbhl forward 5' CGGAATGAGCTAGTAGGCAAAGTCAGC 3' (SEQ ID NO:29) and
- the PCR fragments were fused using the Pr Cbhl forward and Ter Cbhl primers.
- the resulting fusion product included the two desired glycosylation sites, but also contained intact attBl and attB2 sites, which allowed for recombination with the pDONR221 vector using the Gateway BP recombination reaction (Invitrogen). This resulted in a pENTR- Fv3C/Bgl3/S725N S751N clone, which was then used as a backbone for constructing the triple hybrid molecule Fv3C/Te3A/Bgl3.
- Te3A2 forward 5'- GTCTTCATCGACTACCGTCACTTCGACAAGTACAACATCAC GCCTATCT ACG AGTTCGGTC ACGGTCTATC- 3 ' (SEQ ID NO:34); and pDonor Reverse: 5'
- the resulting PCR product contained the intact Gateway- specific attLl, attL2 recombination sites on the ends, allowing for direct cloning into a final destination vector using a Gateway LR recombination reaction (Invitrogen).
- the DNA sequence of the Fv3C/Te3A/Bgl3 encoding gene is listed in SEQ ID NO: 11.
- the amino acid sequence of the Fv3C/Te3A/Bgl3 hybrid is listed in SEQ ID NO: 12.
- the gene sequence encoding the Fv3C/Te3A/Bgl3 chimera was cloned in the pTTT-pyrG13 vector and expressed in a T. reesei recipient strain as described below. Specifically, 0.5-1 ⁇ g of this fragment was transformed into the T.
- spores were grown for 16-24 h at 24°C in Trichoderma Minimal Medium MM, which contained 20 g/L glucose, 15 g/L KH 2 P0 4 , pH 4.5, 5 g/L (NH 4 ) 2 S0 4 , 0.6 g/L
- the N-terminal portion of the native T. reesei ⁇ -glucosidase gene bgll was codon optimized (DNA 2.0, Menlo Park, CA). This synthesized portion comprised the first 447 bases of the coding region of this enzyme. This fragment was then amplified by PCR using primers SK943 and SK941. The remaining region of the native bgll gene was PCR amplified from a genomic
- Reverse Primer SK941 (5'- CGACCGCCCTGCGGAGTCTTGCCC AGTGGTCCCGCGAC AG-3 ' ) (SEQ ID NO:36)
- CTGTCGCGGGACCACTGGGC AAGACTCCGCAGGGCGGTCG-3 ' (SEQ ID NO:37)
- the resulting fusion PCR fragments were cloned into the Gateway ® Entry vector pENTRTM/D-TOPO® , and transformed into E. coli One Shot® TOP 10 Chemically Competent cells (Invitrogen) resulting in the intermediate vector, pENTR TOPO-Bgl 1(943/942) ( Figure 3).
- the nucleotide sequence of the inserted DNA was determined.
- the pENTR-943/942 vector with the correct bgll sequence was recombined with pTrex3g using a LR clonase® reaction (see, protocols outlined by Invitrogen).
- the LR clonase reaction mixture was transformed into E.
- the expression vector pTrex3g 943/942.
- the vector also contained the Aspergillus nidulans amdS gene, encoding acetamidase, as a selectable marker for transformation of T. reesei.
- the expression cassette was amplified by PCR with primers SK745 and SK771 (below) to generate the product for transformation of the hexa-delete T. reesei strain mad6.
- Reverse Primer SK745 (5' - GAGTTGTGAAGTCGGTAATCC -3') (SEQ ID NO:
- gene product (SEQ ID NO: 14) was amplified from a F.verticillioides genomic DNA sample using the primers SK1322 and SK1297 (below).
- a region of the promoter of the endoglucanase gene egll was PCR amplified from a T. reesei genomic DNA sample extracted from strain RL- P37, using the primers SK1236 and SK1321 (below). These PCR amplified DNA fragments were subsequently fused in a fusion PCR reaction using the primers SK1236 and SK1297 (below).
- the resulting fusion PCR fragment was cloned into pCR-Blunt II-TOPO vector (Invitrogen) to produce the plasmid TOPO Blunt/Pegll-Fv43D (see, Figure 4).
- This plasmid was then used to transform E. coli One Shot® TOP 10 Chemically Competent cells (Invitrogen).
- the plasmid DNA was extracted from several E.coli clones and their sequences were confirmed by restriction digests.
- the expression cassette was amplified by PCR from the TOPO
- Reverse Primer SK1297 (5 ' -GGTT ACT AGTC A ACTGCCCGTTCTGTAGCG AG- 3') (SEQ ID NO:42)
- the production media was 36 mL of defined broth containing glucose/sophorose and 2 g/L uridine, such as Glycine Minimal media (6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5) with post sterile addition of -2% glucose/sophorose mixture as the carbon source, 10 ml/L of lOOg/L of CaCl 2 , 2.5 ml/L of T.
- Glycine Minimal media 6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5
- glucose/sophorose mixture
- a Trichoderma reesei mutant strain (RL-P37-d), derived from RL-P37 (Sheir-Neiss, G. et al. Appl. Microbiol. Biotechnol. 1984, 20:46-53) and selected for high cellulase production was inoculated into one 250 mL glass 4-baffle flask containing 30 mL of YEG broth (5 g/L yeast extract, 20 g/L glucose). A hexa-delete T. reesei strain expressing T.
- reesei bgll (tr3A) (strain construction was described above, under Construction of the ⁇ -glucosidase expression vector) was inoculated into a separate 250 mL glass 4-baffle flask containing 30 mL of YEG broth. Following 2 days of growth at 28°C, with shaking, the cultures were transferred to protein production media.
- the production media was 36 mL of defined broth containing glucose/sophorose and uridine, such as Glycine Minimal media (6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5) with post sterile addition of -2%
- Glycine Minimal media 6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5
- Example 2 Co-fermentation of two Bacillus strains for producing a mixture of amylase variants.
- Materials and Methods Both strains used in this example are production strains.
- Amylase variant one (Amylase-1), a Bacilllus licheniformis amylase with four substitutions, is expressed in accordance with US 5,958,739.
- Amylase variant two (Amylase-2), a Geobacillus stearothermophilus with a substitution is expressed in accordance with US 20090314286A1.
- the experiment was conducted in 250 mL Thomson Ultra shake flasks. The seed culture was grown in a seed medium containing yeast extract, phosphate salts, sulfate salts, and other nutritional components, and a suitable defoamer.
- the control and test flasks used a medium containing lactose, yeast extract, sulfonate, and phosphate salts, other salts, and Maltrin® M- 1000 and a suitable antifoam agent.
- a recipe of such a medium is below: Creating an Amylase Blend by Mixed Strain Fermentation: Two seed cultures were started. A frozen vial of Amylase-1 and Amylase-2 were used to start seed cultures in 35 mis of seed medium in 250 ml baffled glass flasks. The seed flasks were incubated at 38°C, 160 rpm for three hours. After three hours, the seed cultures were used to start a control flask of each enzyme and duplicate test flasks. Each of these flasks had 27 mis of medium.
- control flasks were inoculated with 3.0 mis from their respective seed culture.
- the test flasks were inoculated with 1.5 mis from each seed culture. All flasks were then incubated at 40°C and 160 rpm for 48 hours. At the end of 48 hours incubation, the pH was checked to determine whether the fermentations had reached an end point. All flasks were between pH 7-8 indicating that the endpoint had been reached. An SDS-PAGE gel of supernatants of control and test cultures showed that enzyme had been expressed in all flasks.
- the duplicate test cultures were analyzed by HPLC to confirm that they contained a blend of both Amylase-1 and Amylase-2. The HPLC did find that the enzymes had co-expressed.
- Example 3 Co-fermentation of two Bacillus strains for producing a mixture of amylase variants with an activity ratio of 1 :3 14L Amylase-1/ Amylase-2
- al4L fermentation was run to test whether a certain ratio of the two enzymes could be prepared in a well-controlled manner by co-fermentation. It was decided to create a product with an activity ratio of 1:3 Amylase-1: Amylase-2.
- a seed flask 250 mL baffled glass with 30 mL of a seed medium (containing yeast extract, phosphate salts, sulfate salts, and other nutritional components, and a suitable defoamer) was inoculated with 0.2 mL Amylase-1 and 0.8 mL Amylase-2.
- the seed flask was incubated for 3 hours at 37°C, at 160 rpm. At the end of three hours the entire contents of the flask was transferred to a 14L seed fermenter running with production medium.
- Time course samples taken during the production fermentation were assayed for amylase activity.
- the growth and enzyme production curves were those of a typical 14L scale amylase fermentation.
- the final 100-hour time point sample was analyzed by HPLC to determine the ratio of the two enzymes. Based on peak area, the protein ratio was 1:2.9
- Amylase- 1 Amylase-2. Enzymes from the protein backbone, which was used to build the
- Amylase-2 production strain show double peaks by this HPLC method. The areas of both peaks are combined to determine the total Amylase-2 area.
- Example 4 Mixed strain fermentation to produce a glucoamylase and two beta-glucosidase protein product A first hexa-delete T. reesei strain expressing fo3C/te3A/bgl3 , a second hexa-delete T. reesei strain expressing T. reesei beta-glucosidase 1 (bgll ); and a quad-deleted T.
- reesei strain (WO 2005/001036) expressing glucoamylase were each inoculated into a 250 mL glass 4-baffle flask containing 30 mL of YEG broth (5 g/L yeast extract, 20 g/L glucose) and 2 g/L uridine. Inocula were taken from sporulated cultures growing on PDA (potato dextrose agar) with uridine. Following 2 days of growth at 28°C, with shaking, the cultures were transferred, in duplicate, to protein production media.
- PDA potato dextrose agar
- Each of the production media was 36 mL of defined broth containing glucose/sophorose and 2 g/L uridine, such as Glycine Minimal media (6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5) with post sterile addition of -2% glucose/sophorose mixture as the carbon source, 10 ml/L of 100 g/L of CaCl 2 , 2.5 mL/L of T.
- Glycine Minimal media 6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5
- Test Flask 1 mL each of (Fv3C/Te3A/Bgl3), Tr3A, glucoamylase. All flasks were incubated at 28 °C, 200 rpm (Innova 4900) for four days. After four days incubation, the cells were removed by centrifugation and the supernatants stored at 4°C pending analysis.
- Example 5 Mixed strain fermentation to produce a T. reesei protein product with enhanced ⁇ - glucosidase content by direct inoculation
- a T. reesei mutant strain (RL-P37-d), derived from RL-P37 (Sheir-Neiss, G. et al. Appl. Microbiol. Biotechnol. 1984, 20:46-53) and selected for high cellulase production was incubated with a hexa-delete strain expressing fv3C/te3Afbgl3.
- Each strain was inoculated into a single 250 ml glass 4-baffle flask containing 30 mis production media, with glucose/sophorose and uridine, such as Glycine Minimal media (6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS; pH 5.5) with post sterile addition of -2% glucose/sophorose mixture as the carbon source, 10 ml/L of lOOg/L of CaCl 2 , 2.5 ml/L of T.
- Glycine Minimal media 6.0 g/L glycine; 4.7 g/L (NH 4 ) 2 S0 4 ; 5.0 g/L KH 2 P0 4 ; 1.0 g/L MgS0 4 « 7H 2 0; 33.0 g/L PIPPS
- reesei trace elements 400X: 175g/L Citric acid anhydrous; 200g/L FeS0 4 *7H 2 0; 16g/L ZnS0 4 « 7H 2 0; 3.2 g/L CuS0 4 « 5H 2 0; 1.4 g/L MnS0 4 « H 2 0; 0.8 g/L H 3 B0 3 , from mature, sporulated PDA plates with uridine. Following 4 days of growth at 28°C, with shaking, the cultures were harvested. Cells were removed by centrifugation and the supernatants stored at 4°C pending analysis by HPLC.
- Example 6 Mixed strain fermentation to produce a T. reesei protein product with two ⁇ - glucosidases, glucoamylase, and beta-xylosidase content by direct inoculation A first hexa-delete T. reesei strain expressing fv3C/te3A bgl3, a second hexa-delete T.
- T. reesei strain expressing bgll (tr3A), a third hexa-delete strain expressing/v43D, and a quad- deleted T. reesei strain (WO 2005/001036) expressing T. reesei glucoamylase were each inoculated into a single 250 mL glass 4-baffle flask containing 30 mL of production media with glucose/sophorose and uridine, such as Glycine Minimal media (6.0 g/L glycine; 4.7 g/L
- the single cultures were all cultured with an additional step of a starter culture, whereas the mixed culture (last row) was inoculated directly from agar plugs, without a starter culture step.
- SEQ ID NO: 1 Nucleotide sequence of Fv3C, a GH3 family ⁇ -glucosidase from Fusarium verticillioides
- SEQ ID NO:3 Nucleotide sequence of Bgll (or Tr3A), a GH3 family ⁇ -glucosidase from Trichoderma reesei
- SEQ ID NO:4 Protein sequence of T. reesei beta glucosidase 1 (Bgll) , a GH3 family ⁇ - glucosidase from Trichoderma reesei
- SEQ ID NO: 8 Protein sequence of Bgl3 (or Tr3B), a GH3 family ⁇ -glucosidase from
- SEQ ID NO:9 The nucleotide sequence encoding Fv3C/Bgl3
- SEQ ID NO: 11 Nucleic acid sequence encoding the Fv3C/Te3A/Bgl3 chimera
- SEQ ID NO: 12 Amino acid sequence of the Fv3C/Te3A/Bgl3 chimera
- SEQ ID NO: 13 Nucleotide sequence for Fv43D, a GH43D family enzyme from Fusarium verticilloides
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK12799484.6T DK2791350T3 (da) | 2011-12-13 | 2012-12-04 | Enzymcocktails fremstillet af blandede kulturer |
| JP2014547276A JP2015500041A (ja) | 2011-12-13 | 2012-12-04 | 混合培養物から調製された酵素カクテル |
| EP12799484.6A EP2791350B1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
| RU2014128577A RU2014128577A (ru) | 2011-12-13 | 2012-12-04 | Ферментные смеси, полученные из смешанных культур |
| CA2858373A CA2858373A1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
| HK15103550.9A HK1203083A1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
| MX2014006570A MX367078B (es) | 2011-12-13 | 2012-12-04 | Cocteles de enzimas preparados a partir de cultivos mezclados. |
| AU2012352763A AU2012352763A1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
| US14/355,835 US20140295475A1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
| BR112014012910-0A BR112014012910B1 (pt) | 2011-12-13 | 2012-12-04 | Método para produção de uma mistura de enzimas que catalisam um processo de conversão e método para preparação de um banco de células |
| PH1/2014/500771A PH12014500771A1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
| KR1020147016268A KR20140122704A (ko) | 2011-12-13 | 2012-12-04 | 혼합 배양으로부터 제조된 효소 칵테일 |
| CN201280061537.8A CN104011222A (zh) | 2011-12-13 | 2012-12-04 | 从混合培养物制备的酶合剂 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161570243P | 2011-12-13 | 2011-12-13 | |
| US61/570,243 | 2011-12-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013090053A1 true WO2013090053A1 (en) | 2013-06-20 |
Family
ID=47352051
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/067717 Ceased WO2013090053A1 (en) | 2011-12-13 | 2012-12-04 | Enzyme cocktails prepared from mixed cultures |
Country Status (14)
| Country | Link |
|---|---|
| US (1) | US20140295475A1 (https=) |
| EP (1) | EP2791350B1 (https=) |
| JP (1) | JP2015500041A (https=) |
| KR (1) | KR20140122704A (https=) |
| CN (1) | CN104011222A (https=) |
| AU (1) | AU2012352763A1 (https=) |
| BR (1) | BR112014012910B1 (https=) |
| CA (1) | CA2858373A1 (https=) |
| DK (1) | DK2791350T3 (https=) |
| HK (1) | HK1203083A1 (https=) |
| MX (1) | MX367078B (https=) |
| PH (1) | PH12014500771A1 (https=) |
| RU (1) | RU2014128577A (https=) |
| WO (1) | WO2013090053A1 (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106232828A (zh) * | 2014-04-21 | 2016-12-14 | 丹尼斯科美国公司 | 表达葡糖淀粉酶的真菌菌株和产乙醇物的同时糖化和共发酵以由玉米产生醇 |
| WO2017068012A1 (en) * | 2015-10-21 | 2017-04-27 | Novozymes A/S | Direct inoculation |
| EP3224356A4 (en) * | 2014-11-27 | 2018-05-09 | Wilmar (shanghai) Biotechnology Research & Development Center Co., Ltd. | Methods for recombinant expression of beta-glucosidase gene |
| US10138499B2 (en) | 2009-12-23 | 2018-11-27 | Danisco Us Inc. | Methods for improving the efficiency of simultaneous saccharification and fermentation reactions |
| US10190108B2 (en) | 2011-03-17 | 2019-01-29 | Danisco Us Inc. | Method for reducing viscosity in saccharification process |
| US10273465B2 (en) | 2009-09-23 | 2019-04-30 | Danisco Us Inc. | Glycosyl hydrolase enzymes and uses thereof |
| WO2021041141A1 (en) * | 2019-08-29 | 2021-03-04 | Danisco Us Inc | Expression of beta-glucosidase in yeast for improved ethanol production |
| US11597950B1 (en) | 2020-03-11 | 2023-03-07 | Poet Research, Inc. | Systems, compositions, and methods of fermentation with Z. mobilis |
| US11732278B1 (en) | 2020-03-11 | 2023-08-22 | Poet Research, Inc. | Systems and methods for co-culture of oxygen sensitive bacteria and yeast |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018106656A1 (en) | 2016-12-06 | 2018-06-14 | Danisco Us Inc | Truncated lpmo enzymes and use thereof |
| JP7316758B2 (ja) * | 2018-03-02 | 2023-07-28 | 合同酒精株式会社 | オフフレーバーのリスクを低減できるラクターゼ調製物 |
| CN109852557B (zh) * | 2018-11-30 | 2021-03-26 | 北京国环清华环境工程设计研究院有限公司 | 一种用于城镇存量垃圾稳定化处理的复合菌剂及其制备方法与应用 |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4760025A (en) | 1984-05-29 | 1988-07-26 | Genencor, Inc. | Modified enzymes and methods for making same |
| EP0323299A1 (fr) | 1987-12-24 | 1989-07-05 | Gaz De France (Service National) | Appareil destiné à assurer la combustion étagée d'un mélange combustible-comburant diminuant la production d'oxydes d'azote |
| US5182204A (en) | 1984-05-29 | 1993-01-26 | Genencor International, Inc. | Non-human carbonyl hydrolase mutants, vectors encoding same and hosts transformed with said vectors |
| US5958739A (en) | 1996-06-06 | 1999-09-28 | Genencor International Inc. | Mutant α-amylase |
| US6312936B1 (en) | 1997-10-23 | 2001-11-06 | Genencor International, Inc. | Multiply-substituted protease variants |
| WO2004113490A2 (en) * | 2003-06-24 | 2004-12-29 | HöFer Bioreact GmbH | Directed selective solid-phase culturing of stable microbial mixed populations for the continuous preparation of defined enzyme and metabolite mixture and bioreactor |
| WO2005001036A2 (en) | 2003-05-29 | 2005-01-06 | Genencor International, Inc. | Novel trichoderma genes |
| US20090314286A1 (en) | 2008-06-06 | 2009-12-24 | Danisco Us Inc., Genencor Division | Geobacillus Stearothermophilus Alpha-Amylase (AmyS) Variants with Improved Properties |
| WO2010060056A2 (en) * | 2008-11-21 | 2010-05-27 | Mascoma Corporation | Yeast expressing cellulases for simultaneous saccharification and fermentation using cellulose |
| WO2010141779A1 (en) | 2009-06-03 | 2010-12-09 | Danisco Us Inc. | Cellulase variants with improved expression, activity and/or stability, and use thereof |
| EP2292731A1 (en) | 2009-08-13 | 2011-03-09 | Danisco A/S | Method for preparing complex cultures |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003066826A2 (en) * | 2002-02-08 | 2003-08-14 | Genencor International, Inc. | Methods for producing ethanol from carbon substrates |
| CN101918572A (zh) * | 2007-10-26 | 2010-12-15 | 阿伯燃料公司 | 正丁醇的生产方法 |
| US20090246844A1 (en) * | 2007-10-26 | 2009-10-01 | Arbor Fuel Inc. | Methods for the production of ethanol |
| WO2009143481A1 (en) * | 2008-05-23 | 2009-11-26 | University Of Georgia Research Foundation, Inc. | Paenibacillus ssp. and methods for fermentation of lignocellulosic materials |
-
2012
- 2012-12-04 CA CA2858373A patent/CA2858373A1/en not_active Abandoned
- 2012-12-04 WO PCT/US2012/067717 patent/WO2013090053A1/en not_active Ceased
- 2012-12-04 RU RU2014128577A patent/RU2014128577A/ru not_active Application Discontinuation
- 2012-12-04 MX MX2014006570A patent/MX367078B/es active IP Right Grant
- 2012-12-04 BR BR112014012910-0A patent/BR112014012910B1/pt not_active IP Right Cessation
- 2012-12-04 AU AU2012352763A patent/AU2012352763A1/en not_active Abandoned
- 2012-12-04 US US14/355,835 patent/US20140295475A1/en not_active Abandoned
- 2012-12-04 CN CN201280061537.8A patent/CN104011222A/zh active Pending
- 2012-12-04 EP EP12799484.6A patent/EP2791350B1/en not_active Not-in-force
- 2012-12-04 KR KR1020147016268A patent/KR20140122704A/ko not_active Withdrawn
- 2012-12-04 PH PH1/2014/500771A patent/PH12014500771A1/en unknown
- 2012-12-04 JP JP2014547276A patent/JP2015500041A/ja not_active Withdrawn
- 2012-12-04 DK DK12799484.6T patent/DK2791350T3/da active
- 2012-12-04 HK HK15103550.9A patent/HK1203083A1/xx unknown
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4760025A (en) | 1984-05-29 | 1988-07-26 | Genencor, Inc. | Modified enzymes and methods for making same |
| US5182204A (en) | 1984-05-29 | 1993-01-26 | Genencor International, Inc. | Non-human carbonyl hydrolase mutants, vectors encoding same and hosts transformed with said vectors |
| USRE34606E (en) | 1984-05-29 | 1994-05-10 | Genencor, Inc. | Modified enzymes and methods for making same |
| EP0323299A1 (fr) | 1987-12-24 | 1989-07-05 | Gaz De France (Service National) | Appareil destiné à assurer la combustion étagée d'un mélange combustible-comburant diminuant la production d'oxydes d'azote |
| US5958739A (en) | 1996-06-06 | 1999-09-28 | Genencor International Inc. | Mutant α-amylase |
| US6312936B1 (en) | 1997-10-23 | 2001-11-06 | Genencor International, Inc. | Multiply-substituted protease variants |
| WO2005001036A2 (en) | 2003-05-29 | 2005-01-06 | Genencor International, Inc. | Novel trichoderma genes |
| WO2004113490A2 (en) * | 2003-06-24 | 2004-12-29 | HöFer Bioreact GmbH | Directed selective solid-phase culturing of stable microbial mixed populations for the continuous preparation of defined enzyme and metabolite mixture and bioreactor |
| US20090314286A1 (en) | 2008-06-06 | 2009-12-24 | Danisco Us Inc., Genencor Division | Geobacillus Stearothermophilus Alpha-Amylase (AmyS) Variants with Improved Properties |
| WO2010060056A2 (en) * | 2008-11-21 | 2010-05-27 | Mascoma Corporation | Yeast expressing cellulases for simultaneous saccharification and fermentation using cellulose |
| WO2010141779A1 (en) | 2009-06-03 | 2010-12-09 | Danisco Us Inc. | Cellulase variants with improved expression, activity and/or stability, and use thereof |
| EP2292731A1 (en) | 2009-08-13 | 2011-03-09 | Danisco A/S | Method for preparing complex cultures |
Non-Patent Citations (38)
| Title |
|---|
| "Enzyme Nomenclature", 1992, ACADEMIC PRESS, article "Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB" |
| ALEXOPOULOS, C. J.: "Introductory Mycology", 1962, WILEY |
| ARAI TAKAMITSU ET AL: "Synthesis of Clostridium cellulovorans minicellulosomes by intercellular complementation", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 104, no. 5, January 2007 (2007-01-01), pages 1456 - 1460, XP002696852, ISSN: 0027-8424 * |
| BENTLY ET AL., NATURE, vol. 417, 2002, pages 141 - 147 |
| DASHTBAN ET AL., INT. J. OF BIOL. SCI., vol. 5, 2009, pages 578 - 595 |
| DRENTH, J. ET AL., EUR. J. BIOCHEM., vol. 26, 1972, pages 177 - 181 |
| GARCIA-KIRCHNER ET AL., APPLIED BIOCHEM & BIOTECHNOL., vol. 98, 2002, pages 1105 - 1114 |
| GOEDEGEBUUR ET AL., CURR GENE, vol. 41, 2002, pages 89 - 98 |
| GOEDEGEBUUR ET AL., GENET, vol. 41, 2002, pages 89 - 98 |
| HONNE-SEYLER'S, Z PHYSIOL. CHEM, vol. 364, 1983, pages 1537 - 1540 |
| HOURIA OULED HADDAR ET AL: "Biodegradation of native feather keratin by Bacillus subtilis recombinant strains", BIODEGRADATION, vol. 20, no. 5, 26 March 2009 (2009-03-26), KLUWER ACADEMIC PUBLISHERS, DO, pages 687 - 694, XP019727763, ISSN: 1572-9729, DOI: 10.1007/S10532-009-9256-0 * |
| HU ET AL., INTERNATIONAL BIODETERIORATION & BIODEGRADATION, vol. 65, 2011, pages 248 - 252 |
| INNIS ET AL., SCL, vol. 228, 1985, pages 21 - 26 |
| K. M. KALISZ: "Advances in Biochemical Engineering and Biotechnology", 1988, article "Microbial Proteinases" |
| KNOWLES, J. ET AL., TIBTECH, vol. 5, 1987, pages 255 - 261 |
| MAKI ET AL., INT. J. OF BIOL. SCIENCES, vol. 5, 2009, pages 500 - 516 |
| OKADA, M. ET AL., APPL. ENVIRON. MICROBIOL., vol. 64, 1988, pages 555 - 563 |
| PANDEY ET AL., CURR. SCI., vol. 77, 1999, pages 149 - 162 |
| PENTTILA ET AL., GENE, vol. 61, 1987, pages 155 - 164 |
| PENTTILA, M. ET AL., GENE, vol. 45, 1986, pages 253 - 263 |
| RAJ KUMAR ET AL: "Bioconversion of lignocellulosic biomass: biochemical and molecular perspectives", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY ; OFFICIAL JOURNAL OF THE SOCIETY FOR INDUSTRIAL MICROBIOLOGY, vol. 35, no. 5, 13 March 2008 (2008-03-13), SPRINGER, BERLIN, DE, pages 377 - 391, XP019596328, ISSN: 1476-5535 * |
| SALOHEIMO, A. ET AL., MOLECULAR MICROBIOLOGY, vol. 13, 1994, pages 219 - 228 |
| SALOHEIMO, M. ET AL., EUR. J. BIOCHEM., vol. 249, 1997, pages 584 - 591 |
| SALOHEIMO, M. ET AL., GENE, vol. 63, 1988, pages 11 - 22 |
| SASAKI ET AL., FEBS LETTERS, vol. 579, no. 11, 2005, pages 2514 - 2518 |
| SHEIR-NEISS ET AL., APPL. MICROBIOL. BIOTECHNOL, vol. 20, 1984, pages 46 - 53 |
| SHEIR-NEISS ET AL., APPL. MICROBIOL. BIOTECHNOLOGY, vol. 20, 1984, pages 46 - 53 |
| SHEIR-NEISS, G ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 20, 1984, pages 46 - 53 |
| SHEIR-NEISS, G. ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 20, 1984, pages 46 - 53 |
| SHEIR-NEISS; MONTENECOURT, APPL. MICROBIOL. BIOTECHNOL., vol. 20, 1984, pages 46 - 53 |
| SHOEMAKER, S. ET AL., BIOLTECHNOLOGY, vol. 1, 1983, pages 691 - 696 |
| SUN ET AL., ELECTRONIC J. OF BIOTECHNOLOGY, vol. 12, 2008, pages 1 - 13 |
| TEERI, T. ET AL., GENE, vol. 51, 1987, pages 43 - 52 |
| WALTON J, BANERJEE G, CAR S: "GENPLAT: an automated platform for biomass enzyme discovery and cocktail optimization.", vol. 56, E3314, 24 October 2011 (2011-10-24), XP002696853, Retrieved from the Internet <URL:http://www.jove.com/video/3314/genplat-an-automated-platform-for-biomass-enzyme-discovery-cocktail?id=3314> [retrieved on 20130508], DOI: 10.3791/3314 * |
| WANG ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 73, 2006, pages 533 - 540 |
| WARD ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 39, 1993, pages 738 - 743 |
| WARD ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 39, 1993, pages 7380743 |
| WEN ZHIYOU ET AL: "Production of cellulase/beta-glucosidase by the mixed fungi culture of Trichoderma reesei and Aspergillus phoenicis on dairy manure", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 121, April 2005 (2005-04-01), pages 93 - 104, XP002696851, ISSN: 0273-2289 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10273465B2 (en) | 2009-09-23 | 2019-04-30 | Danisco Us Inc. | Glycosyl hydrolase enzymes and uses thereof |
| US10138499B2 (en) | 2009-12-23 | 2018-11-27 | Danisco Us Inc. | Methods for improving the efficiency of simultaneous saccharification and fermentation reactions |
| US10190108B2 (en) | 2011-03-17 | 2019-01-29 | Danisco Us Inc. | Method for reducing viscosity in saccharification process |
| CN106232828A (zh) * | 2014-04-21 | 2016-12-14 | 丹尼斯科美国公司 | 表达葡糖淀粉酶的真菌菌株和产乙醇物的同时糖化和共发酵以由玉米产生醇 |
| EP3224356A4 (en) * | 2014-11-27 | 2018-05-09 | Wilmar (shanghai) Biotechnology Research & Development Center Co., Ltd. | Methods for recombinant expression of beta-glucosidase gene |
| WO2017068012A1 (en) * | 2015-10-21 | 2017-04-27 | Novozymes A/S | Direct inoculation |
| WO2021041141A1 (en) * | 2019-08-29 | 2021-03-04 | Danisco Us Inc | Expression of beta-glucosidase in yeast for improved ethanol production |
| US12416026B2 (en) | 2019-08-29 | 2025-09-16 | Danisco Us Inc. | Expression of beta-glucosidase in yeast for improved ethanol production |
| US11597950B1 (en) | 2020-03-11 | 2023-03-07 | Poet Research, Inc. | Systems, compositions, and methods of fermentation with Z. mobilis |
| US11732278B1 (en) | 2020-03-11 | 2023-08-22 | Poet Research, Inc. | Systems and methods for co-culture of oxygen sensitive bacteria and yeast |
| US12163175B2 (en) | 2020-03-11 | 2024-12-10 | Poet Research, Inc. | Systems and methods for co-culture of oxygen sensitive bacteria and yeast |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2858373A1 (en) | 2013-06-20 |
| EP2791350B1 (en) | 2019-01-23 |
| DK2791350T3 (da) | 2019-05-06 |
| CN104011222A (zh) | 2014-08-27 |
| JP2015500041A (ja) | 2015-01-05 |
| BR112014012910A2 (pt) | 2020-10-20 |
| AU2012352763A1 (en) | 2014-04-24 |
| KR20140122704A (ko) | 2014-10-20 |
| BR112014012910B1 (pt) | 2021-06-29 |
| MX367078B (es) | 2019-08-05 |
| RU2014128577A (ru) | 2016-02-10 |
| MX2014006570A (es) | 2014-08-21 |
| PH12014500771A1 (en) | 2021-08-09 |
| EP2791350A1 (en) | 2014-10-22 |
| US20140295475A1 (en) | 2014-10-02 |
| HK1203083A1 (en) | 2015-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2791350B1 (en) | Enzyme cocktails prepared from mixed cultures | |
| US12247241B2 (en) | Processes for reducing lactic acid in a biofuel fermentation system and processes for producing a fermentation product | |
| Kovács et al. | Comparative enzymatic hydrolysis of pretreated spruce by supernatants, whole fermentation broths and washed mycelia of Trichoderma reesei and Trichoderma atroviride | |
| Manavalan et al. | Secretome analysis of Ganoderma lucidum cultivated in sugarcane bagasse | |
| AU2016235802B2 (en) | Processes for producing ethanol and ethanol producing yeast | |
| EP2598629B1 (en) | Aspergillus containing beta-glucosidase, beta-glucosidases and nucleic acids encoding the same | |
| KR20140017612A (ko) | 당화 공정에서 점도를 감소시키는 방법 | |
| WO2010148148A2 (en) | β-GLUCOSIDASE VARIANTS | |
| Adav et al. | Proteomic analysis of temperature dependent extracellular proteins from Aspergillus fumigatus grown under solid-state culture condition | |
| Schuerg et al. | Thermoascus aurantiacus is an intriguing host for the industrial production of cellulases | |
| CN111094562A (zh) | 具有海藻糖酶活性的多肽及其在产生发酵产物的方法中的用途 | |
| CN110997701A (zh) | 具有海藻糖酶活性的多肽以及编码其的多核苷酸 | |
| CN103562402A (zh) | 热稳定性木霉属纤维素酶 | |
| Raheja et al. | Combination of system biology and classical approaches for developing biorefinery relevant lignocellulolytic Rasamsonia emersonii strain | |
| US10266814B2 (en) | Systems and methods for production and use of fungal glycosyl hydrolases | |
| Geetha et al. | Optimization of nutrient medium containing agricultural waste for xylanase production by Bacillus pumilus B20 | |
| US20170183691A1 (en) | Simultaneous saccharification and co-fermentation of glucoamylase-expressing fungal strains with an ethanologen to produce alcohol from corn | |
| Yang et al. | Recombinant multi-functional cellulase activity in submerged fermentation of lignocellulosic wastes | |
| CN112771069B (zh) | 表达外源葡糖淀粉酶和木聚糖酶的酿酒酵母菌株及其在生产生物乙醇中的用途 | |
| Lotfi et al. | Screening of some Zygomycetes for cellulase activity | |
| EP4638768A2 (en) | Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast | |
| WO2026008449A2 (en) | A process for producing a fermentation product and a concentrated protein co-product | |
| US9988658B2 (en) | Process for the hydrolysis of biomass | |
| WO2020089847A1 (en) | Process for preventing or limiting microbial contamination during continuous culture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12799484 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2012352763 Country of ref document: AU Date of ref document: 20121204 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14355835 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/006570 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2014547276 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2858373 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14122917 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 20147016268 Country of ref document: KR Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2014128577 Country of ref document: RU Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014012910 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014012910 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140528 |