WO2013082486A1 - Processes for producing fermentation products - Google Patents
Processes for producing fermentation products Download PDFInfo
- Publication number
- WO2013082486A1 WO2013082486A1 PCT/US2012/067380 US2012067380W WO2013082486A1 WO 2013082486 A1 WO2013082486 A1 WO 2013082486A1 US 2012067380 W US2012067380 W US 2012067380W WO 2013082486 A1 WO2013082486 A1 WO 2013082486A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alpha
- amylase
- protease
- seq
- glucoamylase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
- C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/18—Baker's yeast; Brewer's yeast
- C12N1/185—Saccharomyces isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2428—Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P1/00—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
- C12P1/02—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P1/00—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
- C12P1/04—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/14—Multiple stages of fermentation; Multiple types of microorganisms or re-use of microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01001—Alpha-amylase (3.2.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/85—Saccharomyces
- C12R2001/865—Saccharomyces cerevisiae
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention relates to processes for producing fermentation products from starch-containing material.
- the invention also relates to a composition suitable for use in a process of the invention.
- residual starch material is not converted into the desired fermentation product, such as ethanol. At least some of the unconverted residual starch material, e.g., sugars and dextrins, is in the form of non-fermentable Maillard products.
- the present invention relates to processes of producing fermentation products, such as ethanol, from starch-containing material using a fermenting organism.
- the invention relates to processes for producing fermentation products, such as ethanol, from starch-containing material comprising the steps of: i) liquefying the starch-containing material at a pH in the range between from above 5.0- 7.0 at a temperature above the initial gelatinization temperature using:
- thermostability value of more than 20% determined as Relative Activity at 80°C/70°C
- liquefaction is carried out at a temperature between 80-90°C, such as around 85°C. In a preferred embodiment liquefaction is carried out at a pH in the range pH above 5.0 to 6.0.
- an enzyme composition comprising:
- thermostability value of more than 20% determined as Relative Activity at 80°C/70°C
- the optional carbohydrate-source generating enzyme may be a thermostable glucoamylase, and/or a pullulanase.
- the carbohydrate-source generating enzyme in particular a glucoamylase, is Penicillium oxalicum glucoamylase.
- Fig. 1 shows a comparison of the 54 hour ethanol fermentation yield (%) for Alpha-Amylase 1407 with and without Protease Pfu and/or Glucoamylase PE001 added during liquefaction at pH 5.4 and 5.8, respectively, at 85°C for 2 hours.
- the present invention relates to processes of producing fermentation products, such as ethanol from starch-containing material using a fermenting organism.
- the inventors have found that an increased ethanol yield is obtained when liquefying starch-containing material with a mature Bacillus stearothermophilus alpha-amylase disclosed in SEQ ID NO: 1 herein having a double deletion (1181 * + G182 * ) and substitution N193F together with Pyrococcus furiosus protease (pfu S) or thermostable variants of wild-type Thermoascus aurantiacus protease at 85°C, at pH 5.4 or 5.8 for 2 hours.
- the invention relates to processes for producing fermentation products, preferably ethanol, comprising the steps of:
- thermostability value of more than 20% determined as Relative Activity at 80°C/70°C;
- Steps ii) and iii) are carried out either sequentially or simultaneously. In a preferred embodiment steps ii) and iii) are carried out simultaneously.
- the alpha-amylase, thermostable protease and optionally the carbohydrate-source generating enzyme, preferably glucoamylase, and/or optionally a pullulanase may be added before and/or during liquefaction step i).
- a composition of the invention may suitably be used in a process of the invention. However, the enzymes may also be added separately. Examples of alpha-amylases can be found in the "Alpha-Amylase Present and/or Added During Liquefaction' -section below.
- thermostable proteases can be found in the "Protease Present and/or Added During Liquefaction"-section below.
- suitable optional carbohydrate-source generating enzymes preferably thermostable carbohydrate-source generating enzymes, in particular a thermostable glucoamylase, can be found in the "Carbohydrate-Source Generating Enzymes Present and/or Added During Liquefaction' -section below.
- a suitable optional pullulanase can be found in the "Pullulanase Present and/or Added During Liquefaction"-section below.
- the pH during liquefaction is above 5.0, such as between above 5.0-6.5, such as between 5.2-6.2, such as between pH 5.0-6.0, such as around 5.2, such as around 5.4, such as around 5.6, such as around 5.8.
- the pH is between 5.0 and 5.5.
- the temperature is above the initial gelatinization temperature.
- initial gelatinization temperature refers to the lowest temperature at which solubilization of starch, typically by heating, begins. The temperature can vary for different starches.
- the temperature during liquefaction step i) is in the range from 70- 100°C, such as between 75-95°C, such as between 75-90°C, preferably between 80-90°C, such as around 85°C.
- the process of the invention further comprises, prior to the step i), the steps of:
- the starch-containing starting material such as whole grains
- wet and dry milling In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein). Wet milling is often applied at locations where the starch hydrolysate is used in production of, e.g., syrups. Both dry and wet millings are well known in the art of starch processing. According to the present invention dry milling is preferred.
- the particle size is reduced to between 0.05 to 3.0 mm, preferably 0.1 -0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1 -0.5 mm screen. In another embodiment at least 50%, preferably at least 70%, more preferably at least 80%, especially at least 90% of the starch-containing material fit through a sieve with # 6 screen.
- the aqueous slurry may contain from 10-55 w/w-% dry solids (DS), preferably 25-45 w/w-% dry solids (DS), more preferably 30-40 w/w-% dry solids (DS) of starch-containing material.
- the slurry may be heated to above the initial gelatinization temperature, preferably to between 80-90°C, between pH 5.0-7.0, preferably between 5.0 and 6.0, for 30 minutes to 5 hours, such as around 2 hours.
- thermostable protease and optional carbohydrate-source generating enzyme in particular thermostable glucoamylase, and/or optional pullulanase may initially be added to the aqueous slurry to initiate liquefaction (thinning). In an embodiment only a portion of the enzymes is added to the aqueous slurry, while the rest of the enzymes are added during liquefaction step i).
- Liquefaction step i) is according to the invention carried out for 0.5-5 hours, such as 1-3 hours, such as typically around 2 hours.
- the aqueous slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to liquefaction in step i).
- the jet-cooking may be carried out at a temperature between 1 10-145°C, preferably 120-140°C, such as 125-135°C, preferably around 130°C for about 1 -15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes.
- One or more carbohydrate-source generating enzymes may be present and/or added during saccharification step ii) and/or fermentation step iii).
- the carbohydrate-source generating enzyme may preferably be a glucoamylase, but may also be an enzyme selected from the group consisting of: beta-amylase, maltogenic amylase and alpha- glucosidase.
- the carbohydrate-source generating enzyme added during saccharification step ii) and/or fermentation step iii) is typically different from the optional carbohydrate-source generating enzyme, in particular thermostable glucoamylase, optionally added during liquefaction step i).
- the carbohydrate-source generating enzymes, in particular glucoamylase is added together with a fungal alpha-amylase.
- carbohydrate-source generating enzymes including glucoamylases
- Examples of carbohydrate-source generating enzymes can be found in the "Carbohydrate-Source Generating Enzyme Present and/or Added During Saccharification and/or Fermentation' -section below.
- saccharification step ii) may be carried out at conditions well-known in the art. For instance, the saccharification step ii) may last up to from about 24 to about 72 hours.
- pre-saccharification is done. Pre- saccharification is typically done for 40-90 minutes at a temperature between 30-65°C, typically about 60°C. Pre-saccharification is followed by saccharification during fermentation in simultaneous saccharification and fermentation ("SSF). Saccharification is typically carried out at temperatures from 20-75°C, preferably from 40-70°C, typically around 60°C, and at a pH between 4 and 5, normally at about pH 4.5.
- SSF Simultaneous saccharification and fermentation
- a fermenting organism such as yeast, and enzyme(s)
- SSF is according to the invention typically carried out at a temperature from 25°C to 40°C, such as from 28°C to 35°C, such as from 30°C to 34°C, preferably around about 32°C.
- fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
- the pH is between 3.5-5, in particular between 3.8 and 4.3. Fermentation Medium
- “Fermentation media” or “fermentation medium” refers to the environment in which fermentation is carried out.
- the fermentation medium includes the fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism.
- the fermentation medium may comprise nutrients and growth stimulator(s) for the fermenting organism(s).
- Nutrient and growth stimulators are widely used in the art of fermentation and include nitrogen sources, such as ammonia; urea, vitamins and minerals, or combinations thereof.
- Fermenting organism refers to any organism, including bacterial and fungal organisms, especially yeast, suitable for use in a fermentation process and capable of producing the desired fermentation product.
- suitable fermenting organisms are able to ferment, i.e., convert, sugars, such as glucose or maltose, directly or indirectly into the desired fermentation product, such as ethanol.
- Examples of fermenting organisms include fungal organisms, such as yeast.
- Preferred yeast includes strains of Saccharomyces spp., in particular, Saccharomyces cerevisiae.
- Suitable concentrations of the viable fermenting organism during fermentation are well known in the art or can easily be determined by the skilled person in the art.
- the fermenting organism such as ethanol fermenting yeast, (e.g., Saccharomyces cerevisiae) is added to the fermentation medium so that the viable fermenting organism, such as yeast, count per ml. of fermentation medium is in the range from 10 5 to 10 12 , preferably from 10 7 to 10 10 , especially about 5x10 7 .
- yeast examples include, e.g., RED STARTM and ETHANOL
- REDTM yeast available from Fermentis/Lesaffre, USA
- FALI available from Fleischmann's Yeast, USA
- SUPERSTART and THERMOSACCTM fresh yeast available from Ethanol Technology, Wl, USA
- BIOFERM AFT and XR available from NABC - North American Bioproducts Corporation, GA, USA
- GERT STRAND available from Gert Strand AB, Sweden
- FERMIOL available from DSM Specialties.
- starch-containing material may be used according to the present invention.
- the starting material is generally selected based on the desired fermentation product.
- starch-containing materials suitable for use in a process of the invention, include whole grains, corn, wheat, barley, rye, milo, sago, cassava, tapioca, sorghum, rice, peas, beans, or sweet potatoes, or mixtures thereof or starches derived therefrom, or cereals. Contemplated are also waxy and non-waxy types of corn and barley.
- the starch- containing material, used for ethanol production according to the invention is corn or wheat.
- Fermentation product means a product produced by a process including a fermentation step using a fermenting organism.
- Fermentation products contemplated according to the invention include alcohols (e.g., ethanol, methanol, butanol; polyols such as glycerol, sorbitol and inositol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, succinic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H 2 and C0 2 ); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B 12 , beta-carotene); and hormones.
- alcohols e.g., ethanol, methanol, butanol
- polyols such as glycerol, sorbitol and ino
- the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry.
- Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohol beer, low-alcohol beer, low-calorie beer or light beer.
- processes of the invention are used for producing an alcohol, such as ethanol.
- the fermentation product, such as ethanol, obtained according to the invention may be used as fuel, which is typically blended with gasoline. However, in the case of ethanol it may also be used as potable ethanol.
- the fermentation product may be separated from the fermentation medium.
- the slurry may be distilled to extract the desired fermentation product (e.g., ethanol).
- the desired fermentation product may be extracted from the fermentation medium by micro or membrane filtration techniques.
- the fermentation product may also be recovered by stripping or other method well known in the art.
- an alpha-amylase is present and/or added during liquefaction together with a thermostable protease, and optionally a carbohydrate-source generating enzyme, in particular a thermostable glucoamylase, and/or optionally a pullulanase.
- the alpha-amylase added during liquefaction step i) may be any alpha-amylase.
- Preferred are bacterial alpha-amylases, which typically are stable at temperature used during liquefaction.
- bacterial alpha-amylase means any bacterial alpha-amylase classified under EC 3.2.1.1 .
- a bacterial alpha-amylase used according to the invention may, e.g., be derived from a strain of the genus Bacillus, which is sometimes also referred to as the genus Geobacillus.
- Bacillus alpha-amylase is derived from a strain of Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis, but may also be derived from other Bacillus sp.
- bacterial alpha-amylases include the Bacillus stearothermophilus alpha-amylase of SEQ ID NO: 3 in WO 99/19467, the Bacillus amyloliquefaciens alpha-amylase of SEQ ID NO: 5 in WO 99/19467, and the Bacillus licheniformis alpha-amylase of SEQ ID NO: 4 in WO 99/19467 (all sequences are hereby incorporated by reference).
- the alpha-amylase may be an enzyme having a degree of identity of at least 60%, e.g.
- the alpha-amylase may be an enzyme having a degree of identity of at least 60%, e.g., at least 70%, at least 80%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to any of the sequences shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein.
- the alpha-amylase is derived from Bacillus stearothermophilus.
- the Bacillus stearothermophilus alpha-amylase may be a mature wild-type or a mature variant thereof.
- the mature Bacillus stearothermophilus alpha-amylases, or variant thereof, may be naturally truncated during recombinant production.
- the Bacillus stearothermophilus alpha-amylase may be a truncated so it has around 491 amino acids (compared to SEQ ID NO: 3 in WO 99/19467), such as from 480-495 amino acids.
- the Bacillus alpha-amylase may also be a variant and/or hybrid. Examples of such a variant can be found in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059, and WO 02/10355 (all documents are hereby incorporated by reference). Specific alpha-amylase variants are disclosed in U.S. Patent Nos.
- BSG alpha-amylase Bacillus stearothermophilus alpha-amylase (often referred to as BSG alpha-amylase) variants having a deletion of one or two amino acids at positions R179, G180, 1181 and/or G182, preferably a double deletion disclosed in WO 96/23873 - see, e.g., page 20, lines 1-10 (hereby incorporated by reference), preferably corresponding to deletion of positions 1181 and G182 compared to the amino acid sequence of Bacillus stearothermophilus alpha-amylase set forth in SEQ ID NO: 3 disclosed in WO 99/19467 or SEQ ID NO: 1 herein or the deletion of amino acids R179 and G180 using SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein for numbering (which reference is hereby incorporated by reference).
- BSG alpha-amylase Bacillus stearothermophilus alpha-amylase
- Bacillus alpha- amylases especially Bacillus stearothermophilus alpha-amylases, which have a double deletion corresponding to a deletion of positions 181 and 182 and further comprise a N193F substitution (also denoted 1181 * + G182 * + N193F) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO: 3 disclosed in WO 99/19467 or SEQ ID NO: 1 herein.
- the bacterial alpha-amylase may also have a substitution in a position corresponding to S239 in the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4 in WO 99/19467, or a S242 variant of the Bacillus stearothermophilus alpha-amylase of SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein.
- the variant is a S242A, E or Q variant, preferably a S242Q variant, of the Bacillus stearothermophilus alpha-amylase (using SEQ ID NO: 1 herein for numbering).
- the variant is a position E188 variant, preferably E188P variant of the Bacillus stearothermophilus alpha-amylase (using SEQ ID NO: 1 herein for numbering).
- the bacterial alpha-amylase may in an embodiment be a truncated Bacillus licheniformis alpha-amylase. Especially the truncation is so that the Bacillus stearothermophilus alpha- amylase shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein, is around 491 amino acids long, such as from 480-495 amino acids long.
- the bacterial alpha-amylase may also be a hybrid bacterial alpha-amylase, e.g., an alpha-amylase comprising 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown in SEQ ID NO: 4 of WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown in SEQ ID NO: 5 of WO 99/19467).
- this hybrid has one or more, especially all, of the following substitutions:
- variants having one or more of the following mutations (or corresponding mutations in other Bacillus alpha- amylases): H154Y, A181 T, N190F, A209V and Q264S and/or the deletion of two residues between positions 176 and 179, preferably the deletion of E178 and G179 (using SEQ ID NO: 5 of WO 99/19467 for position numbering).
- the bacterial alpha-amylase is the mature part of the chimeric alpha- amylase disclosed in Richardson et al., 2002, The Journal of Biological Chemistry 277(29):. 267501 -26507, referred to as BD5088 or a variant thereof.
- This alpha-amylase is the same as the one shown in SEQ ID NO: 2 in WO 2007134207.
- the mature enzyme sequence starts after the initial "Met" amino acid in position 1.
- the alpha-amylase may be a thermostable alpha-amylase, such as a thermostable bacterial alpha-amylase, preferably from Bacillus stearothermophilus.
- the alpha-amylase used according to the invention has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 of at least 10.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 15.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 20.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 25.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 30.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 40.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 50.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , of at least 60.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 10-70.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 15-70. In an embodiment the thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 20-70.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 25-70.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 30-70.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 40-70.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 50-70.
- thermostable alpha-amylase has a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 , between 60-70.
- the alpha-amylase is an bacterial alpha-amylase, preferably derived from the genus Bacillus, especially a strain of Bacillus stearothermophilus, in particular the Bacillus stearothermophilus as disclosed in WO 99/19467 as SEQ ID NO: 3 (SEQ ID NO: 1 herein) with one or two amino acids deleted at positions R179, G180, 1181 and/or G182, in particular with R179 and G180 deleted, or with 1181 and G182 deleted, with mutations in below list of mutations.
- Bacillus stearothermophilus alpha-amylases have double deletion 1181 + G182, and optional substitution N193F, further comprising mutations selected from below list:
- Bacillus stearothermophilus alpha- amylase and variants thereof are normally produced in truncated form.
- the truncation may be so that the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein, or variants thereof, are truncated in the C- terminal and are typically around 491 amino acids long, such as from 480-495 amino acids long.
- the alpha-amylase variant may be an enzyme having a degree of identity of at least 60%, e.g., at least 70%, at least 80%, at least 90%, at least 95%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, but less than 100% to the sequence shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein.
- thermostable protease is present and/or added during liquefaction together with an alpha-amylase, such as a thermostable alpha-amylase, and optionally a carbohydrate-source generating enzyme, in particular a thermostable glucoamylase, and/or optionally a pullulanase.
- an alpha-amylase such as a thermostable alpha-amylase
- a carbohydrate-source generating enzyme in particular a thermostable glucoamylase, and/or optionally a pullulanase.
- Proteases are classified on the basis of their catalytic mechanism into the following groups: Serine proteases (S), Cysteine proteases (C), Aspartic proteases (A), Metallo proteases (M), and Unknown, or as yet unclassified, proteases (U), see Handbook of Proteolytic Enzymes, A.J.Barrett, N.D.Rawlings, J.F.Woessner (eds), Academic Press (1998), in particular the general introduction part.
- thermostable protease used according to the invention is a "metallo protease” defined as a protease belonging to EC 3.4.24 (metalloendopeptidases); preferably EC 3.4.24.39 (acid metallo proteinases).
- protease is a metallo protease or not
- determination can be carried out for all types of proteases, be it naturally occurring or wild-type proteases; or genetically engineered or synthetic proteases.
- Protease activity can be measured using any suitable assay, in which a substrate is employed, that includes peptide bonds relevant for the specificity of the protease in question.
- Assay-pH and assay-temperature are likewise to be adapted to the protease in question. Examples of assay-pH-values are pH 6, 7, 8, 9, 10, or 1 1 . Examples of assay-temperatures are 30, 35, 37, 40, 45, 50, 55, 60, 65, 70 or 80°C.
- protease substrates examples include casein, such as Azurine-Crosslinked Casein (AZCL-casein).
- AZCL-casein Azurine-Crosslinked Casein
- Two protease assays are described below in the "Materials & Methods"-section, of which the so-called “AZCL-Casein Assay” is the preferred assay.
- thermostable protease has at least 20%, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 100% of the protease activity of the Protease 196 variant or Protease Pfu determined by the AZCL-casein assay described in the "Materials & Methods" section.
- protease used in a process of the invention as long as it fulfills the thermostability properties defined below.
- the protease is of fungal origin.
- the protease may be a variant of, e.g., a wild-type protease as long as the protease has the thermostability properties defined herein.
- the thermostable protease is a variant of a metallo protease as defined above.
- the thermostable protease used in a process of the invention is of fungal origin, such as a fungal metallo protease, such as a fungal metallo protease derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670 (classified as EC 3.4.24.39).
- thermostable protease is a variant of the mature part of the metallo protease shown in SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 and shown as SEQ ID NO: 3 herein further with mutations selected from below list:
- thermostable protease is a variant of the metallo protease disclosed as the mature part of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein with the following mutations:
- the protease variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the mature part of the polypeptide of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein.
- thermostable protease may also be derived from any bacterium as long as the protease has the thermostability properties defined according to the invention.
- thermostable protease is derived from a strain of the bacterium Pyrococcus, such as a strain of Pyrococcus furiosus (pfu protease).
- protease is one shown as SEQ ID NO: 1 in US patent No. 6,358,726-B1 (Takara Shuzo Company) and SEQ ID NO: 13 herein.
- thermostable protease is one disclosed in SEQ ID NO: 13 herein or a protease having at least 80% identity, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO: 1 in US patent no. 6,358,726-B1 or SEQ ID NO: 13 herein.
- the Pyroccus furiosus protease can be purchased from Takara Bio, Japan.
- the Pyrococcus furiosus protease is a thermostable protease according to the invention.
- the commercial product Pyrococcus furiosus protease (Pfu S) was found to have a thermostability of 1 10% (80°C/70°C) and 103% (90°C/70°C) at pH 4.5 determined as described in Example 2 herein.
- thermostable protease used in a process of the invention has a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C determined as described in Example 2.
- the protease has a thermostability of more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, such as more than 105%, such as more than 1 10%, such as more than 1 15%, such as more than 120% determined as Relative Activity at 80°C/70°C.
- protease has a thermostability of between 20 and 50%, such as between 20 and 40%, such as 20 and 30% determined as Relative Activity at 80°C/70°C.
- the protease has a thermostability between 50 and 1 15%, such as between 50 and 70%, such as between 50 and 60%, such as between 100 and 120%, such as between 105 and 1 15% determined as Relative Activity at 80°C/70°C.
- the protease has a thermostability value of more than 10% determined as Relative Activity at 85°C/70°C determined as described in Example 2.
- the protease has a thermostability of more than 10%, such as more than 12%, more than 14%, more than 16%, more than 18%, more than 20%, more than 30%, more than 40%, more that 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 1 10% determined as Relative Activity at 85°C/70°C.
- the protease has a thermostability of between 10 and 50%, such as between 10 and 30%, such as between 10 and 25% determined as Relative Activity at 85°C/70°C. In an embodiment the protease has more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90% determined as Remaining Activity at 80°C; and/or
- the protease has more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90% determined as Remaining Activity at 84°C.
- the protease may have a themostability for above 90, such as above 100 at 85°C as determined using the Zein-BCA assay as disclosed in Example 3.
- the protease has a themostability above 60%, such as above 90%, such as above 100%, such as above 1 10% at 85°C as determined using the Zein-BCA assay.
- protease has a themostability between 60-120, such as between 70- 120%, such as between 80-120%, such as between 90-120%, such as between 100-120%, such as 1 10-120% at 85°C as determined using the Zein-BCA assay.
- thermostable protease has at least 20%, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 100% of the activity of the JTP196 protease variant or Protease Pfu determined by the AZCL-casein assay.
- a carbohydrate-source generating enzyme in particular a glucoamylase, preferably a thermostable glucoamylase, may be present and/or added during liquefaction together with an alpha-amylase and a thermostable protease.
- a pullulanase may also be present and/or added during liquefaction step i).
- carbohydrate-source generating enzyme includes any enzymes generating fermentable sugars.
- a carbohydrate-source generating enzyme is capable of producing a carbohydrate that can be used as an energy-source by the fermenting organism(s) in question, for instance, when used in a process of the invention for producing a fermentation product, such as ethanol.
- the generated carbohydrates may be converted directly or indirectly to the desired fermentation product, preferably ethanol.
- a mixture of carbohydrate- source generating enzymes may be used.
- Specific examples include glucoamylase (being glucose generators), beta-amylase and maltogenic amylase (being maltose generators).
- the carbohydrate-source generating enzyme is thermostable.
- the carbohydrate-source generating enzyme, in particular thermostable glucoamylase may be added together with or separately from the alpha-amylase and the thermostable protease.
- the carbohydrate-source generating enzyme preferably a thermostable glucoamylase
- the carbohydrate-source generating enzyme is a glucoamylase having a relative activity pH optimum at pH 5.0 of at least 90%, preferably at least 95%, preferably at least 97%, such as 100% determined as described in Example 4 (pH optimum).
- the carbohydrate-source generating enzyme is a glucoamylase having a pH stability at pH 5.0 of at least at least 80%, at least 85%, at least 90% determined as described in Example 4 (pH stability).
- the carbohydrate-source generating enzyme is a thermostable glucoamylase, preferably of fungal origin, preferably a filamentous fungi, such as from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum, in particular the Penicillium oxalicum glucoamylasedisclosed as SEQ ID NO: 2 in PCT/CN 10/071753 published as WO 201 1/127802 (which is hereby incorporated by reference) and shown in SEQ ID NO: 9 or 14 herein.
- a thermostable glucoamylase preferably of fungal origin, preferably a filamentous fungi, such as from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum, in particular the Penicillium oxalicum glucoamylasedisclosed as SEQ ID NO: 2 in PCT/CN 10/071753 published as WO 201 1/127802 (which is
- thermostable glucoamylase has at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the mature polypeptide shown in SEQ ID NO: 2 in WO 201 1/127802 or SEQ ID NOs: 9 or 14 herein.
- the carbohydrate-source generating enzyme in particular thermostable glucoamylase, is the Penicillium oxalicum glucoamylase.
- the carbohydrate-source generating enzyme is a variant of the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in WO 201 1/127802 and shown in SEQ ID NO: 9 and 14 herein, having a K79V substitution (referred to as PE001 ) (using the mature sequence shown in SEQ ID NO: 14 for numbering).
- the K79V glucoamylase variant has reduced sensitivity to protease degradation relative to the parent as disclosed in co-pending US application No. 61/531 ,189 or PCT/US12/053779 (which are hereby incorporated by reference).
- the thermostable glucoamylase is a variant of the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in WO 201 1/127802 and shown in SEQ ID NO:
- Penicillium oxalicum glucoamylase is the one disclosed as SEQ ID NO: 2 in WO 201 1/127802 and shown in SEQ ID NO: 9 and 14 herein having Val (V) in position 79 (using SEQ ID NO: 14 for numbering).
- Penicillium oxalicum glucoamylase variants are disclosed in co-pending
- these variants have reduced sensitivity to protease degradation.
- these variant have improved thermostability compared to the parent. More specifically, in an embodiment the glucoamylase has a K79V substitution (using
- SEQ ID NO: 14 for numbering corresponding to the PE001 variant, and further comprises at least one of the following substitutions or combination of substitutions:
- K79V substitution (using SEQ ID NO: 14 for numbering), corresponding to the PE001 variant, and further comprises one of the following mutations:
- the carbohydrate-source generating enzyme in particular, may be added in amounts from 0.1 - 100 micrograms EP/g, such as 0.5-50 micrograms EP/g, such as 1-25 micrograms
- EP/g such as 2-12 micrograms EP/g DS. Pullulanase Present and/or Added During Liquefaction
- a pullulanase may be present and/or added during liquefaction step i) together with an alpha-amylase and a thermostable protease.
- a carbohydrate-source generating enzyme preferably a thermostable glucoamylase, may also be present and/or added during liquefaction step i).
- the pullulanase may be present and/or added during liquefaction step i) and/or saccharification step ii) or simultaneous saccharification and fermentation.
- Pullulanases (E.C. 3.2.1.41 , pullulan 6-glucano-hydrolase), are debranching enzymes characterized by their ability to hydrolyze the alpha-1 ,6-glycosidic bonds in, for example, amylopectin and pullulan.
- Contemplated pullulanases include the pullulanases from Bacillus amyloderamificans disclosed in U.S. Patent No. 4,560,651 (hereby incorporated by reference), the pullulanase disclosed as SEQ ID NO: 2 in WO 01/151620 (hereby incorporated by reference), the Bacillus deramificans disclosed as SEQ ID NO: 4 in WO 01/151620 (hereby incorporated by reference), and the pullulanase from Bacillus acidopullulyticus disclosed as SEQ ID NO: 6 in WO 01/151620 (hereby incorporated by reference) and also described in FEMS Mic. Let. (1994) 1 15, 97-106.
- pullulanases contemplated according to the present invention included the pullulanases from Pyrococcus woesei, specifically from Pyrococcus woesei DSM No. 3773 disclosed in WO 92/02614.
- the pullulanase is a family GH57 pullulanase.
- the pullulanase includes an X47 domain as disclosed in US 61/289,040 published as WO 201 1/087836 (which are hereby incorporated by reference).
- the pullulanase may be derived from a strain of the genus Thermococcus, including Thermococcus litoralis and Thermococcus hydrothermalis, such as the Thermococcus hydrothermalis pullulanase shown in SEQ ID NO: 1 1 truncated at site X4 right after the X47 domain (i.e., amino acids 1-782 in SEQ ID NOS: 1 1 and 12 herein).
- the pullulanase may also be a hybrid of the Thermococcus litoralis and Thermococcus hydrothermalis pullulanases or a T hydrothermalis/T. litoralis hybrid enzyme with truncation site X4 disclosed in US 61/289,040 published as WO 201 1/087836 (which is hereby incorporated by reference) and disclosed in SEQ ID NO: 12 herein.
- the pullulanase is one comprising an X46 domain disclosed in WO 201 1/076123 (Novozymes).
- the pullulanase may according to the invention be added in an effective amount which include the preferred amount of about 0.0001-10 mg enzyme protein per gram DS, preferably 0.0001-0.10 mg enzyme protein per gram DS, more preferably 0.0001 -0.010 mg enzyme protein per gram DS.
- Pullulanase activity may be determined as NPUN. An Assay for determination of NPUN is described in the "Materials & Methods' -section below.
- Suitable commercially available pullulanase products include PROMOZYME D, PROMOZYMETM D2 (Novozymes A/S, Denmark), OPTIMAX L-300 (Genencor Int., USA), and AMANO 8 (Amano, Japan).
- a carbohydrate-source generating enzyme preferably a glucoamylase, is present and/or added during saccharification and/or fermentation.
- the carbohydrate-source generating enzyme is a glucoamylase, of fungal origin, preferably from a stain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably T. emersonii, Glucoamylase
- the glucoamylase present and/or added during saccharification and/or fermentation may be derived from any suitable source, e.g., derived from a microorganism or a plant.
- Preferred glucoamylases are of fungal or bacterial origin, selected from the group consisting of Aspergillus glucoamylases, in particular Aspergillus niger G * ! or G2 glucoamylase (Boel et al. (1984), EMBO J. 3 (5), p. 1097-1 102), or variants thereof, such as those disclosed in WO 92/00381 , WO 00/04136 and WO 01/04273 (from Novozymes, Denmark); the A.
- Aspergillus oryzae glucoamylase disclosed in WO 84/02921 , Aspergillus oryzae glucoamylase (Agric. Biol. Chem. (1991 ), 55 (4), p. 941-949), or variants or fragments thereof.
- Other Aspergillus glucoamylase variants include variants with enhanced thermal stability: G137A and G139A (Chen et al. (1996), Prot. Eng. 9, 499-505); D257E and D293E/Q (Chen et al. (1995), Prot. Eng. 8, 575-582); N182 (Chen et al. (1994), Biochem. J.
- glucoamylases include Athelia rolfsii (previously denoted Corticium rolfsii) glucoamylase (see US patent no. 4,727,026 and (Nagasaka et al. (1998) "Purification and properties of the raw-starch-degrading glucoamylases from Corticium rolfsii, Appl Microbiol Biotechnol 50:323-330), Talaromyces glucoamylases, in particular derived from Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (US patent no. Re.
- the glucoamylase used during saccharification and/or fermentation is th eTalaromyces emersonii glucoamylase disclosed in WO 99/28448.
- Bacterial glucoamylases contemplated include glucoamylases from the genus Clostridium, in particular C. thermoamylolyticum (EP 135,138), and C. thermohydrosulfuricum (WO 86/01831 ).
- Contemplated fungal glucoamylases include Trametes cingulata, Pachykytospora papyracea; and Leucopaxillus giganteus all disclosed in WO 2006/069289; and Peniophora rufomarginata disclosed in WO2007/124285; or a mixture thereof.
- hybrid glucoamylase are contemplated according to the invention. Examples include the hybrid glucoamylases disclosed in WO 2005/045018. Specific examples include the hybrid glucoamylase disclosed in Table 1 and 4 of Example 1 (which hybrids are hereby incorporated by reference).
- the glucoamylase is derived from a strain of the genus Pycnoporus, in particular a strain of Pycnoporus as described in US 61/264,977 published as WO 201 1/066576 (SEQ ID NOs 2, 4 or 6), or from a strain of the genus Gloephyllum, in particular a strain of Gloephyllum as described in US 61/406,741 published as WO 201 1/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16) or a strain of the genus Nigrofomes, in particular a strain of Nigrofomes sp.
- glucoamylases which exhibit a high identity to any of the above-mentioned glucoamylases, i.e., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to any one of the mature parts of the enzyme sequences mentioned above.
- Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 0.0001-20 AGU/g DS, preferably 0.001-10 AGU/g DS, especially between 0.01-5 AGU/g DS, such as 0.1 -2 AGU/g DS.
- compositions comprising glucoamylase include AMG 200L; AMG 300 L; SANTM SUPER, SANTM EXTRA L, SPIRIZYMETM PLUS, SPIRIZYMETM FUEL, SPIRIZYMETM B4U, SPIRIZYMETM ULTRA, SPIRIZYMETM EXCEL and AMGTM E (from Novozymes MS); OPTIDEXTM 300, GC480, GC417 (from Genencor Int.); AMIGASETM and AMIGASETM PLUS (from DSM); G-ZYMETM G900, G-ZYMETM and G990 ZR (from Genencor Int.).
- the carbohydrate-source generating enzyme present and/or added during saccharification and/or fermentation may also be a maltogenic alpha-amylase.
- a "maltogenic alpha-amylase” (glucan 1 ,4-alpha-maltohydrolase, E.C. 3.2.1.133) is able to hydrolyze amylose and amylopectin to maltose in the alpha-configuration.
- a maltogenic amylase from Bacillus stearothermophilus strain NCIB 1 1837 is commercially available from Novozymes A/S. Maltogenic alpha-amylases are described in US Patent nos. 4,598,048, 4,604,355 and 6,162,628, which are hereby incorporated by reference.
- the maltogenic amylase may in a preferred embodiment be added in an amount of 0.05-5 mg total protein/gram DS or 0.05-5 MANU/g DS. Examples of Preferred Processes of the Invention
- protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C;
- Penicillium oxalicum glucoamylase optionally a Penicillium oxalicum glucoamylase
- an alpha-amylase preferably derived from Bacillus stearothermophilus, having a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 of at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, such as between 10-70; such as between 15- 70, such as between 20-70; such as between 25-70; such as between 30-70; such as between 40-70; such as between 50-70; such as between 60-70;
- a protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 105%, more than 1 10%, more than 1 15%, more than 120%; such as between 20 and 50%, between 20 and 40%, 20 and 30%, between 50 and 1 15%, between 50 and 70%, between 50 and 60%, between 100 and 120%, between 105 and 1 15% determined as Relative Activity at 80°C/70°C determined as Relative Activity at 80°C/70°C;
- Penicillium oxalicum glucoamylase optionally a Penicillium oxalicum glucoamylase
- an alpha-amylase preferably derived from Bacillus stearothermophilus, having a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 of at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, such as between 10-70; such as between 15- 70, such as between 20-70; such as between 25-70; such as between 30-70; such as between 40-70; such as between 50-70; such as between 60-70;
- a protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 105%, more than 1 10%, more than 1 15%, more than 120%; such as between 20 and 50%, between 20 and 40%, 20 and 30%, between 50 and 1 15%, between 50 and 70%, between 50 and 60%, between 100 and 120%, between 105 and 1 15% determined as Relative Activity at 80°C/70°C determined as Relative Activity at 80°C/70°C;
- Penicillium oxalicum glucoamylase optionally a Penicillium oxalicum glucoamylase
- alpha-amylase derived from Bacillus stearothermophilus having a double deletion 1181 + G182 and optionally substitution N193F; and optionally further one of the following set of substitutions:
- protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at
- Penicillium oxalicum glucoamylase in SEQ I D NO: 14 having substitutions selected from the group of:
- alpha-amylase derived from Bacillus stearothermophilus having a double deletion 1181 + G182 and optional substitution N193F; and optionally further one of the following set of substitutions:
- protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C;
- Penicillium oxalicum glucoamylase in SEQ ID NO: 14 having substitutions selected from the group of:
- the protease mentioned above derived from Pyrococcus furiosus (SEQ ID NO: 13) and/or Thermoascus aurantiacus (SEQ ID NO: 3), or a variant thereof, is the mature protease or corresponding mature proteases having at least 80% identity, at least 90% identity, at least 95% identity at least 96% identity at least 97% identity at least 99% identity to the SEQ ID NO: 13 or SEQ ID NO: 3 respectively.
- the glucoamylase mentioned above derived from Penicillium oxalicum is the mature glucoamylase or corresponding mature glucoamylase having at least 80% identity, at least 90% identity, at least 95% identity at least 96% identity at least 97% identity at least 99% identity to the SEQ ID NO: 14 herein.
- a composition of the invention comprises an alpha-amylase, such as a thermostable alpha-amylase, and a thermostable protease.
- the composition may also further comprise a thermostable carbohydrate-source generating enzyme, in particular a glucoamylase, and/or optionally a pullulanase too.
- composition comprising:
- a protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, has a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C;
- the alpha-amylase may be any alpha-amylase, such as bacterial alpha- amylases, such as alpha-amylases derived from the genus Bacillus, such as Bacillus stearomthermphilus.
- the alpha-amylase may be a thermostable alpha-amylase.
- the thermostable alpha- amylase may have a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 ) of at least 10, such as at least 15, such as at least 20, such as at least 25, such as at least 30, such as at least 40, such as at least 50, such as at least 60, such as between 10-70, such as between 15-70, such as between 20-70, such as between 25-70, such as between 30-70, such as between 40-70, such as between 50-70, such as between 60-70.
- the alpha-amylase is selected from the group of Bacillus stearomthermphilus alpha-amylase variants, in particular truncated to be 491 amino acids long, such as from 480 to 495 amino acids long, with mutations selected from the group of: - I 181 * +G182 * +N193F+E129V+K177L+R179E;
- alpha-amylases are only specific examples. Any alpha-amylase disclosed above in the "Alpha-Amylase Present and/or Added During Liquefaction"-section above may be used as the alpha-amylase component in a composition of the invention.
- a composition of the invention comprises a thermostable protease.
- the protease is a variant of the Thermoascus aurantiacus protease mentioned above having a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C determined as described in Example 2.
- the protease is a variant of the metallo protease derived from Thermoascus aurantiacus disclosed as the mature part of SEQ ID NO. 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein with mutations selected from the group of:
- the protease is derived from a strain of Pyrococcus furiosus, such as the one shown in SEQ ID NO: 1 in US 6,358,726 or SEQ ID NO: 13 herein.
- a composition of the invention may further comprise a carbohydrate-source generating enzyme, in particular a glucoamylase, which has a heat stability at 85°C, pH 5.3, of at least 30%, preferably at least 35%.
- Said carbohydrate-source generating enzyme may be a thermostable glucoamylase having a Relative Activity heat stability at 85°C of at least 20%, at least 30%, preferably at least 35% determined as described in Example 4 (Heat stability).
- the carbohydrate-source generating enzyme is a glucoamylase having a relative activity pH optimum at pH 5.0 of at least 90%, preferably at least 95%, preferably at least 97%, such as 100% determined as described in Example 4 (pH optimum).
- the carbohydrate-source generating enzyme is a glucoamylase having a pH stability at pH 5.0 of at least at least 80%, at least 85%, at least 90% determined as described in Example 4 (pH stability).
- the carbohydrate-source generating enzyme is a thermostable glucoamylase, preferably of fungal origin, preferably a filamentous fungi, such as from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum disclosed as SEQ ID NO: 2 in PCT/CN10/071753 published as WO 201 1/127802 (which is hereby incorporated by reference), or a variant thereof, and shown in SEQ ID NO: 9 or 14 herein.
- a thermostable glucoamylase preferably of fungal origin, preferably a filamentous fungi, such as from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum disclosed as SEQ ID NO: 2 in PCT/CN10/071753 published as WO 201 1/127802 (which is hereby incorporated by reference), or a variant thereof, and shown in SEQ ID NO: 9 or 14 herein.
- the glucoamylase may have at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the mature polypeptide shown in SEQ ID NO: 2 in WO 201 1/127802 or SEQ ID NO: 9 or 14 herein.
- the carbohydrate-source generating enzyme is a variant of the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in WO 201 1/127802 and shown in SEQ ID NO: 9 and 14 herein, having a K79V substitution (using the mature sequence shown in SEQ ID NO: 14 for numbering).
- the K79V glucoamylase variant has reduced sensitivity to protease degradation relative to the parent as disclosed in co-pending US application No. 61/531 ,189 (which is hereby incorporated by reference).
- thermostable Penicillium oxalicum glucoamylase variants examples include thermostable Penicillium oxalicum glucoamylase variants.
- the carbohydrate-source generating enzyme has pullulanase side activity.
- a composition of the invention may further comprise a pullulanase.
- the pullulanase is a family GH57 pullulanase.
- the pullulanase includes an X47 domain as disclosed in US 61/289,040 published as WO 201 1/087836 (which are hereby incorporated by reference).
- the pullulanase may be derived from a strain from the genus Thermococcus, including Thermococcus litoralis and Thermococcus hydrothermalis or a hybrid thereof.
- the pullulanase may be Thermococcus hydrothermalis pullulanase truncated at site X4 or a Thermococcus hydrothermalis/T. litoralis hybrid enzyme with truncation site X4 as disclosed in US 61/289,040 published as WO 201 1/087836.
- the another embodiment the pullulanase is one comprising an X46 domain disclosed in WO 201 1/076123(Novozymes).
- pullulanases are only specific examples. Any pullulanase disclosed above in the "Pullulanase Present and/or Added During Liquefaction" section above may be used as the optional pullulanase component in a composition of the invention.
- protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus having a thermostability value of more than 20% determined as Relative Activity at
- glucoamylase derived from Penicillium oxalicum.
- alpha-amylase preferably derived from Bacillus stearothermophilus, having a T1 ⁇ 2 (min) at pH 4.5, 85°C, 0.12 mM CaCI 2 of at least 10;
- protease preferably derived from Pyrococcus furiosus or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C;
- glucoamylase derived from Penicillium oxalicum.
- protease preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at 80°C/70°C;
- Penicillium oxalicum glucoamylase in SEQ ID NO: 14 having substitutions selected from the group of:
- Bacillus stearothermophilus alpha-amylase (SEQ ID NO: 1 herein), or a variant thereof, is the mature alpha-amylase or corresponding mature alpha- amylases having at least 80% identity, at least 90% identity, at least 95% identity at least 96% identity at least 97% identity at least 99% identity to the SEQ ID NO: 1.
- the Pyrococcus furiosus protease (SEQ ID NOI: 13) and/or Thermoascus aurantiacus protease (SEQ ID NO: 3), or a variant thereof is the mature protease or corresponding mature protease having at least 80% identity, at least 90% identity, at least
- Penicillium oxalicum glucoamylase (SEQ ID NO: 14 herein), or a variant thereof, is the mature glucoamylase or corresponding mature glucoamylase having at least 80% identity, at least 90% identity, at least 95% identity at least 96% identity at least 97% identity at least 99% identity to the SEQ ID NO: 14 herein.
- the carbohydrate-source generating enzyme in particular glucoamylase, is the Penicillium oxalicum glucoamylase.
- the glucoamylase may optionally be substituted or combined with a pullulanase, as described above in the "Pullulanase"-section, preferably derived from Thermococcus litoralis or Thermococcus hydrothermalis.
- the invention relates to an alpha-amylase variant.
- the alpha-amylase variant is a thermostable variant suitable for use in a process of the invention.
- the alpha- amylase variant may also be an alpha-amylase (e.g., thermostable alpha-amylase) in a composition of the invention.
- the alpha-amylase variant has increased stability. The stability can be tested as described in Example 1 herein by comparison to a reference alpha-amylase.
- An alpha-amylase variant of the invention may be prepared as described in WO 201 1/082425 (hereby incorporated by reference).
- a specifically contemplates variant (AA369) is used in Example 20 in a process of the invention.
- the invention relates to variant alpha-amylases, comprising mutations in positions corresponding to positions 59, 89, 129, 177, 179, 254, 284, wherein the variant has at least 65% and less than 100% sequence identity with the mature polypeptide of SEQ ID NO: 1 , and the variant has alpha-amylase activity.
- the variant of the invention comprises a substitution at a position corresponding to position 59 with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, or Tyr, in particular with Ala, Gin, Glu, Gly, lie, Leu, Pro, or Thr.
- the variant of the invention comprises a substitution at a position corresponding to position 89 with Ala, Arg, Asn, Asp, Cys, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in particular with Arg, His, or Lys.
- the variant of the invention comprises a substitution at a position corresponding to position 129 with Ala, Arg, Asn, Asp, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in particular with Ala, Thr, or Val.
- the variant of the invention comprises a substitution at a position corresponding to position 177 with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in particular with Arg, Leu, or Met.
- the variant of the invention comprises a substitution at a position corresponding to position 179 with Ala, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in particular with Gin, Glu, lie, Leu, Lys, or Val.
- the variant of the invention comprises a substitution at a position corresponding to position 254 with Ala, Arg, Asn, Asp, Cys, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in particular with Ala, Ser, or Thr.
- the variant of the invention comprises a substitution at a position corresponding to position 284 with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in particular with His, Thr, or Val.
- the variant of the invention comprises or consists of the following mutations: V59A+ Q89R+ E129V+ K177L+ R179E+ Q254S+ M284V.
- the variant of the invention is a variant of a parent alpha-amylase from a polypeptide with at least 60% sequence identity with the mature polypeptide of SEQ ID NO: 1 herein, or a fragment of the mature polypeptide of SEQ ID NO: 1 , which has alpha-amylase activity.
- the parent alpha-amylase comprises or consists of the amino acid sequence of the mature polypeptide of SEQ ID NO: 1 .
- the parent alpha-amylase is a fragment of the amino acid sequence of the mature polypeptide of SEQ ID NO: 1 , wherein the fragment has alpha-amylase activity.
- the variant of the invention is a variant of a parent wild-type alpha- amylase.
- the parent alpha-amylase is a Bacillus alpha-amylase.
- parent alpha-amylase is a Bacillus stearothermophilus.
- parent alpha-amylase is the alpha-amylase shown in SEQ ID NO: 1 comprising the following mutations: double deletion of positions 1181 + G182 and optionally a N193F substitution, or double deletion of positions R179 + G180.
- the variant of the invention comprises or consists of the following mutations: I 181 * +G182 * +N193F+V59A Q89R+E129V+ K177L+ R179E+ Q254S+ M284V (using SEQ ID NO: 1 for numbering).
- the variant of the invention has a sequence identity of at least 65%, e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, to the amino acid sequence of the parent alpha-amylase.
- the variant of the invention has a sequence identity of at least 65%, e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%, but less than 100%, with the mature polypeptide of SEQ ID NO: 1 .
- the alpha-amylase variant has the sequence shown in SEQ ID NO: 1 herein (naturally) truncated so it is around 491 amino acids long, such as from 480-495 amino acids long.
- the invention relates to the use of a variant of the invention for washing and/or dishwashing.
- the invention relates to the use of a variant of the invention for desizing a textile.
- the invention relates to the use of a variant of the invention for producing a baked product.
- the invention relates to the use of a variant of the invention for liquefying a starch-containing material.
- the invention relates to a method of producing liquefied starch, comprising liquefying a starch-containing material with a variant of the invention.
- the invention relates to an isolated polynucleotide encoding the variant of the invention.
- the invention relates to a nucleic acid construct comprising the polynucleotide of the invention.
- the invention relates to an expression vector comprising the nucleic acid construct of the invention.
- the invention relates to a host cell comprising the nucleic acid construct of the invention.
- the invention relates to a method of producing a variant alpha- amylase, comprising:
- the invention relates to a transgenic plant, plant part or plant cell transformed with the polynucleotide of the invention.
- the invention relates to a method for obtaining a variant alpha- amylase, comprising
- the mature polypeptide is the alpha-amylase shown in SEQ ID NO: 1 comprising the following mutations: double deletion of positions 1181 + G182, and optionally a N193F substitution,
- Alpha-Amylase A Bacillus stearothermophilus alpha-amylase with the mutations I 181 * +G182 * +N193F truncated to 491 amino acids (SEQ ID NO: 1 )
- Alpha-Amylase 1407 Bacillus stearothermophilus alpha-amylase with the mutations 1181 * +G182 * +N 193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S truncated to 491 amino acids (SEQ ID NO: 1 )
- Alpha-Amylase 369 Bacillus stearothermophilus alpha-amylase with the mutations: I 181 * +G182 * +N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V truncated to 491 amino acids (SEQ ID NO: 1 ).
- Protease WT Metallo protease derived from Thermoascus aurantiacus CGMCC No. 0670 disclosed as amino acids 1-177 in SEQ ID NO: 3 herein and amino acids 1-177 in SEQ ID NO: 2 in WO 2003/048353
- Protease 036 Metallo protease derived from Thermoascus aurantiacus CGMCC No. 0670 disclosed as amino acids 1-177 in SEQ ID NO: 3 herein and amino acids 1-177 in SEQ ID NO: 2 in WO 2003/048353 with the following mutations: D079L+S87P+0142L.
- Protease 050 Metallo protease derived from Thermoascus aurantiacus CGMCC No. 0670 disclosed as amino acids 1-177 in SEQ ID NO: 3 herein and amino acids 1-177 in SEQ ID NO: 2 in WO 2003/048353 with the following mutations: D79L+S87P+ A1 12P+ D142L.
- Protease 196 Metallo protease derived from Thermoascus aurantiacus CGMCC No. 0670 disclosed as amino acids 1-177 in SEQ ID NO: 3 herein and amino acids 1-177 in SEQ ID NO: 2 in WO 2003/048353 with the following mutations: A27K+D79L+Y82F+S87G+D104P+A1 12P+A126V+D142L.
- Protease Pfu Protease derived from Pyrococcus furiosus purchased from Takara Bio (Japan) as Pfu Protease S (activity 10.5 mg/mL) and also shown in SEQ ID NO: 13 herein.
- Glucoamylase PO Mature part of the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in PCT/CN 10/071753 published as WO 201 1/127802 and shown in SEQ ID NO: 9 herein.
- Glucoamylase PE001 Variant of the Penicillium oxalicum glucoamylase having a K79V substitution using the mature sequence shown in SEQ ID NO: 14 for numbering.
- Glucoamylase 493 (GA493): Variant of Penicillium oxalicum glucoamylase variant PE001 further having the following mutations: P1 1 F+ T65A+ Q327F (using SEQ ID NO: 14 for numbering).
- Glucoamylase BL Blend of Talaromyces emersonii glucoamylase disclosed in WO 99/28448 as SEQ ID NO: 7 and Trametes cingulata glucoamylase disclosed in WO 06/069289 in a ratio of about 9:1.
- Glucoamylase BL2 Blend comprising Talaromyces emersonii glucoamylase disclosed in W099/28448, Trametes cingulata glucoamylase disclosed in WO 06/69289, and Rhizomucor pusillus alpha-amylase with Aspergillus niger glucoamylase linker and SBD disclosed as V039 in Table 5 in WO 2006/069290 as side activities (ratio about 65:15:1 ).
- Yeast RED STAR ETHANOL REDTM available from Red Star/Lesaffre, USA.
- Substrate in Examples 6 and 20 Ground corn and backset was obtained from commercial plants in the USA.
- Identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity”.
- the degree of identity between two amino acid sequences may be determined by the program "align” which is a Needleman-Wunsch alignment (i.e. a global alignment).
- the program is used for alignment of polypeptide, as well as nucleotide sequences.
- the default scoring matrix BLOSUM50 is used for polypeptide alignments, and the default identity matrix is used for nucleotide alignments.
- the penalty for the first residue of a gap is -12 for polypeptides and -16 for nucleotides.
- the penalties for further residues of a gap are -2 for polypeptides, and -4 for nucleotides.
- FASTA is part of the FASTA package version v20u6 (see W. R. Pearson and D. J. Lipman (1988), “Improved Tools for Biological Sequence Analysis”, PNAS 85:2444-2448, and W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA," Methods in Enzymology 183:63- 98).
- FASTA protein alignments use the Smith-Waterman algorithm with no limitation on gap size (see “Smith-Waterman algorithm", T. F. Smith and M. S. Waterman (1981 ) J. Mol. Biol. 147:195-197).
- a solution of 0.2% of the blue substrate AZCL-casein is suspended in Borax/NaH 2 P0 4 buffer pH9 while stirring. The solution is distributed while stirring to microtiter plate (100 microL to each well), 30 microL enzyme sample is added and the plates are incubated in an Eppendorf Thermomixer for 30 minutes at 45° C and 600 rpm. Denatured enzyme sample (100 ° C boiling for 20min) is used as a blank. After incubation the reaction is stopped by transferring the microtiter plate onto ice and the coloured solution is separated from the solid by centrifugation at 3000rpm for 5 minutes at 4 ° C. 60 microL of supernatant is transferred to a microtiter plate and the absorbance at 595nm is measured using a BioRad Microplate Reader.
- protease-containing sample is added to a microtiter plate and the assay is started by adding 100 microL 1 mM pNA substrate (5 mg dissolved in 100 microL DMSO and further diluted to 10 mL with Borax/NaH 2 P0 4 buffer pH 9.0). The increase in OD 405 at room temperature is monitored as a measure of the protease activity.
- Glucoamylase activity AGU
- Glucoamylase activity may be measured in Glucoamylase Units (AGU).
- the Novo Glucoamylase Unit is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37°C, pH 4.3, substrate: maltose 23.2 mM, buffer: acetate 0.1 M, reaction time 5 minutes.
- An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration.
- Enzyme working range 0.5-4.0 AGU/mL
- KNU Alpha-amylase activity
- the alpha-amylase activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reaction is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue color is formed, but during the break-down of the starch the blue color gets weaker and gradually turns into a reddish-brown, which is compared to a colored glass standard.
- KNU Kilo Novo alpha amylase Unit
- Endo-pullulanase activity in NPUN is measured relative to a Novozymes pullulanase standard.
- One pullulanase unit (NPUN) is defined as the amount of enzyme that releases 1 micro mol glucose per minute under the standard conditions (0.7% red pullulan (Megazyme), pH 5, 40°C, 20 minutes). The activity is measured in NPUN/ml using red pullulan.
- the stability of a reference alpha-amylase (Bacillus stearothermophilus alpha-amylase with the mutations I 181 * +G182 * +N193F truncated to 491 amino acids (SEQ ID NO: 1 numbering)) and alpha-amylase variants thereof was determined by incubating the reference alpha-amylase and variants at pH 4.5 and 5.5 and temperatures of 75°C and 85°C with 0.12 mM CaCI 2 followed by residual activity determination using the EnzChek® substrate (EnzChek® Ultra Amylase assay kit, E33651 , Molecular Probes).
- Purified enzyme samples were diluted to working concentrations of 0.5 and 1 or 5 and
- enzyme dilution buffer (10 mM acetate, 0.01 % Triton X100, 0.12 mM CaCI 2 , pH 5.0). Twenty microliters enzyme sample was transferred to 48-well PCR MTP and 180 microliters stability buffer (150 mM acetate, 150 mM MES, 0.01 % Triton X100, 0.12 mM CaCI 2 , pH 4.5 or 5.5) was added to each well and mixed. The assay was performed using two concentrations of enzyme in duplicates. Before incubation at 75°C or 85°C, 20 microliters was withdrawn and stored on ice as control samples. Incubation was performed in a PCR machine at 75°C and 85°C.
- T1 ⁇ 2 (min) T(min) * LN(0.5)/LN(%RA/100), where T is assay incubation time in minutes, and %RA is % residual activity determined in assay.
- E. coli DH12S (available from Gibco BRL) was used for yeast plasmid rescue.
- pJTPOOO is a S. cerevisiae and E. coli shuttle vector under the control of TPI promoter, constructed from pJC039 described in WO 01/92502, in which the Thermoascus aurantiacus M35 protease gene (WO 03/048353) has been inserted.
- Saccharomyces cerevisiae YNG318 competent cells MATa Dpep4[cir+] ura3-52, Ieu2- D2, his 4-539 was used for protease variants expression. It is described in J. Biol. Chem. 272 (15), pp 9720-9727, 1997.
- the solution is sterilized using a filter of a pore size of 0.20 micrometer.
- Agar (2%) and H 2 0 (approx. 761 ml) is autoclaved together, and the separately sterilized SC-glucose solution is added to the agar solution.
- YPD Bacto peptone 20 g/l, yeast extract 10 g/l, 20 % glucose 100 ml/l.
- YPD+Zn YPD+0.25 mM ZnS0 4.
- PEG/LiAc solution 40 % PEG4000 50 ml, 5 M Lithium Acetate 1 ml.
- Each well contains 200 microL of 0.05-0.1 % of zein (Sigma), 0.25 mM ZnS0 4 and 1 % of agar in 20 mM sodium acetate buffer, pH 4.5. DNA manipulations
- Yeast transformation was performed using the lithium acetate method. 0.5 microL of vector (digested by restriction endnucleases) and 1 microL of PCR fragments is mixed. The DNA mixture, 100 microL of YNG318 competent cells, and 10 microL of YEAST MAKER carrier DNA (Clontech) is added to a 12 ml polypropylene tube (Falcon 2059). Add 0.6 ml PEG/LiAc solution and mix gently. Incubate for 30 min at 30°C, and 200 rpm followed by 30 min at 42°C (heat shock). Transfer to an eppendorf tube and centrifuge for 5 sec. Remove the supernatant and resolve in 3 ml of YPD.
- E. coli transformation for DNA sequencing was carried out by electroporation (BIO-RAD Gene Pulser).
- DNA Plasmids were prepared by alkaline method (Molecular Cloning, Cold Spring Harbor) or with the Qiagen® Plasmid Kit. DNA fragments were recovered from agarose gel by the Qiagen gel extraction Kit. PCR was performed using a PTC-200 DNA Engine. The ABI PRISMTM 310 Genetic Analyzer was used for determination of all DNA sequences. Construction of protease expression vector
- Themoascus M35 protease gene was amplified with the primer pair Prot F (SEQ ID NO: 4) and Prot R (SEQ ID NO: 45).
- the resulting PCR fragments were introduced into S. cerevisiae YNG318 together with the pJC039 vector (described in WO2001/92502) digested with restriction enzymes to remove the Humicola insolens cutinase gene.
- Plasmid in yeast clones on SC-glucose plates was recovered to confirm the internal sequence and termed as pJTPOOI .
- the primers AM34 (SEQ ID NO:5) and AM35 (SEQ ID NO:6) were used to make DNA fragments containing any mutated fragments by the SOE method together with degenerated primers (AM34 + Reverse primer and AM35 + forward primer) or just to amplify a whole protease gene (AM34 + AM35).
- DNA fragments were recovered from agarose gel by the Qiagen gel extraction Kit. The resulting purified fragments were mixed with the vector digest. The mixed solution was introduced into Saccharomyces cerevisiae to construct libraries or site-directed variants by in vivo recombination. Relative activity assay
- Yeast clones on SC-glucose were inoculated to a well of a 96-well micro titre plate containing YPD+Zn medium and cultivated at 28°C for 3 days.
- the culture supernatants were applied to a 96-well zein micro titer plate and incubated at at least 2 temperatures (ex. 60°C and 65°C, 70°C and 75°C, 70°C and 80°C) for more than 4 hours or overnight.
- the turbidity of zein in the plate was measured as A630 and the relative activity (higher/lower temperatures) was determined as an indicator of thermoactivity improvement.
- the clones with higher relative activity than the parental variant were selected and the sequence was determined. Remaining activity assay
- Yeast clones on SC-glucose were inoculated to a well of a 96-well micro titre plate and cultivated at 28°C for 3 days. Protease activity was measured at 65°C using azo-casein (Megazyme) after incubating the culture supernatant in 20 mM sodium acetate buffer, pH 4.5, for 10 min at a certain temperature (80°C or 84°C with 4°C as a reference) to determine the remaining activity. The clones with higher remaining activity than the parental variant were selected and the sequence was determined.
- the constructs comprising the protease variant genes were used to construct expression vectors for Aspergillus.
- the Aspergillus expression vectors consist of an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans triose phosphate isomerase non translated leader sequence (Pna2/tpi) and the Aspergillus niger amyloglycosidase terminator (Tamg). Also present on the plasmid was the Aspergillus selective marker amdS from Aspergillus nidulans enabling growth on acetamide as sole nitrogen source.
- fractions are assayed by an endo-protease assay (cf. below) followed by standard SDS-PAGE (reducing conditions) on selected fractions. Fractions are pooled based on the endo-protease assay and SDS-PAGE.
- Protazyme OL tablet/5 ml 250 mM Na-acetate pH 5.0 is dissolved by magnetic stirring (substrate: endo-protease Protazyme AK tablet from Megazyme - cat. # PRAK 1 1/08).
- the tubes are incubated on a Thermomixer with shaking (1000 rpm) at 50°C for 15 minutes.
- Zein-BCA assay was performed to detect soluble protein quantification released from zein by variant proteases at various temperatures.
- Penicillium oxalicum glucoamylase is disclosed in SEQ ID NO: 9 herein.
- Substrate 1 % soluble starch (Sigma S-9765) in deionized water
- Reaction buffer 0.1 M Acetate buffer at pH 5.3
- Glucose concentration determination kit Wako glucose assay kit (LabAssay glucose, WAKO, Cat# 298-65701 ).
- the glucose concentration was determined by Wako kits.
- the optimal temperature for Penicillium oxalicum glucoamylase at the given conditions is between 50°C and 70°C and the glucoamylase maintains more than 80% activity at 95°C.
- Penicillium oxalicum glucoamylase at the given conditions has the highest activity at pH 5.0.
- the Penicillium oxalicum glucoamylase is active in a broad pH range in the it maintains more than 50% activity from pH 2 to 7.
- the Reaction condition assay was modifed in that the enzyme solution (50micro g/mL) was preincubated for 20 hours in buffers with pH 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0 7.0, 8.0, 9.0, 10.0 and 1 1 .0 using the buffers described under pH optimum. After preincubation, 20 microL soluble starch to a final volume of 100 microL was added to the solution and the assay was performed as described above.
- Penicillium oxalicum glucoamylase is stable from pH 3 to pH 7 after preincubation for 20 hours and it decreases its activity at pH 8.
- thermostability of the Pyrococcus furiosus protease purchased from Takara Bio Inc, (Japan) was tested using the same methods as in Example 2. It was found that the thermostability (Relative Activity) was 1 10% at (80°C/70°C) and 103% (90°C/70°C) at pH 4.5.
- Relative Activity was 1 10% at (80°C/70°C) and 103% (90°C/70°C) at pH 4.5.
- Each liquefaction received ground corn (84.19% DS), backset (6.27% DS), and tap water targeting a total weight of 100 g at 32.50% Dry Solids (DS).
- Backset was blended at 30% w/w of total slurry weight.
- Initial slurry pH was approximately 5.2 and was adjusted to pH 5.4 or 5.8 with 50% w/w sodium hydroxide prior to liquefaction.
- All enzymes were added according to the experimental design listed in Table 1 1 below. Liquefaction took place in a Labomat using the following conditions: 5°C/min. Ramp, 17 minute Ramp, 103 minute hold time at 85°C, 40 rpm for the entire run, 200 mL stainless steel canisters. After liquefaction, all canisters were cooled in an ice bath and prepared for fermentation based on the protocol listed below under SSF.
- Each mash was adjusted to pH 5.0 with 50% w/w Sodium Hydroxide or 40% v/v sulfuric acid. Penicillin was applied to each mash to a total concentration of 3 ppm.
- the tubes were prepared with mash by aliquoting approximately 4.5 g of mash per 15 mL pre-drilled test tubes to allow C0 2 release. The test tubes sat, overnight, at 4°C until the next morning.
- test tubes of mash were removed from cold storage and warmed up to 32°C in the walk-in incubation chamber. Once warmed, Glucoamylase BL2, was dosed to each tube of mash at 0.50 AGU/g DS, water was added so that all tubes received 120 ⁇ of liquid and each mash sample received 100 ⁇ of rehydrated yeast. Rehydrated yeast was prepared by mixing 5.5 g of Fermentis RED STAR into 100 mL of 32°C tap water for at least 15 minutes.
- each unit of C0 2 generated and lost is converted to gram ethanol produced per gram of dry solids (g EtOH/g DS) by the following:
- Fermentation sampling took place after 54 hours of fermentation by taking 3 tubes per treatment. Each sample was deactivated with 50 ⁇ of 40% v/v H 2 S0 4 , vortexing, centrifuging at 1460xg for 10 minutes, and filtering through a 0.45 ⁇ Whatman PP filter. 54 hour samples were analyzed under HPLC without further dilution. Samples were stored at 4°C prior to and during HPLC analysis.
- the method quantified analyte(s) using calibration standards for ethanol (% w/v). A four point calibration including the origin is used for quantification.
- Ground corn, backset and tap water were blended to 32.50 % DS and adjusted to pH 5.4 with 50% v/v sodium hydroxide. Each respective protease was added, mixed well, and followed by Alpha-Amylase A addition at a dose of 0.02% (w/w) per g corn. Samples were incubated in a water bath set to 85°C for two hours and received frequent mixing during the first 15 minutes of incubation, every 15 minutes thereafter. All mashes were refrigerated after liquefaction and remained there until fermentation.
- Mashes were adjusted to 32% DS with tap water prior to SSF as needed and dosed to a total concentration of 500 ppm urea and 3 ppm penicillin. No pH adjustment was made for SSF after liquefaction. Approximately 4.5g of mash was added to 15ml_ test tubes that were pre- drilled in the top to allow for C0 2 release. Glucoamylase BL2 was dosed at 0.50 AGU/g DS, and water was added to each tube to ensure all samples were processed at equal solids.
- Rehydrated yeast was prepared by mixing 5.5 g of Fermentis RED STAR in 100ml_ of 32°C tap water for at least 15 minutes and each test tube was inoculated with 100 ⁇ _, corresponding to 30 million cells per mL of mash.
- the cDNA was synthesized by following the instruction of 3' Rapid Amplifiction of cDNA End System (Invitrogen Corp., Carlsbad, CA, USA).
- Penicillium oxalicum glucoamylase gene was cloned using the oligonucleotide primer shown below designed to amplify the glucoamylase gene from 5' end.
- the full length gene was amplified by PCR with Sense primer and AUAP (supplied by 3' Rapid Amplifiction of cDNA End System) by using Platinum HIFI Taq DNA polymerase (Invitrogen Corp., Carlsbad, CA, USA).
- the amplification reaction was composed of 5 ⁇ of 10x PCR buffer, 2 ⁇ of 25mM MgCI 2 , 1 ⁇ of 10mM dNTP, 1 ⁇ of 10uM Sense primer, 1 ⁇ of 10 uM AUAP, 2 ⁇ of the first strand cDNA, 0.5 ⁇ of HIFI Taq, and 37.5 ⁇ of deionized water.
- the PCR program was: 94°C, 3mins; 10 cycles of 94°C for 40secs, 60°C 40secs with 1 °C decrease per cycle, 68°C for 2min; 25 cycles of 94°C for 40secs, 50°C for 40secs, 68°C for 2min; final extension at 68°C for 10 mins.
- the obtained PCR fragment was cloned into pGEM-T vector (Promega Corporation, Madison, Wl, USA) using a pGEM-T Vector System (Promega Corporation, Madison, Wl, USA) to generate plasmid AMG 1 .
- the glucoamylase gene inserted in the plasmid AMG 1 was sequencing confirmed.
- E. coli strain TOP10 containing plasmid AMG 1 (designated NN059173), was deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) on November 23, 2009, and assigned accession number as DSM 23123.
- DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
- Penicillium oxalicum glucoamylase gene was re-cloned from the plasmid AMG 1 into an Aspergillus expression vector by PCR using two cloning primer F and primer R shown below, which were designed based on the known sequence and added tags for direct cloning by IN-FUSIONTM strategy.
- Primer F 5' ACAC AACTG G G G AT C C AC CAT G C GT CT C ACTCTATTATC (SEQ ID NO: 16)
- Primer R 5' AG AT CT C G AG AAG CTTAAAACTG C C AC AC GT C GTTG G (SEQ ID NO: 17)
- a PCR reaction was performed with plasmid AMG 1 in order to amplify the full-length gene.
- the PCR reaction was composed of 40 ⁇ g of the plasmid AMG 1 DNA, 1 ⁇ of each primer (100 ⁇ ); 12.5 ⁇ of 2X Extensor Hi-Fidelity master mix (Extensor Hi-Fidelity Master Mix, ABgene, United Kingdom), and 9.5 ⁇ of PCR-grade water.
- the PCR reaction was performed using a DYAD PCR machine (Bio-Rad Laboratories, Inc., Hercules, CA, USA) programmed for 2 minutes at 94°C followed by a 25 cycles of 94°C for 15 seconds, 50°C for 30 seconds, and 72°C for 1 minute; and then 10 minutes at 72°C.
- DYAD PCR machine Bio-Rad Laboratories, Inc., Hercules, CA, USA
- the reaction products were isolated by 1.0% agarose gel electrophoresis using 1 x TAE buffer where an approximately 1.9 kb PCR product band was excised from the gel and purified using a GFX® PCR DNA and Gel Band Purification Kit (GE Healthcare, United Kingdom) according to manufacturer's instructions.
- DNA corresponding to the Penicillium oxalicum glucoamylase gene was cloned into an Aspergillus expression vector linearized with SamHI and Hind ⁇ , using an IN-FUSIONTM Dry-Down PCR Cloning Kit (BD Biosciences, Palo Alto, CA, USA) according to the manufacturer's instructions.
- the linearized vector construction is as described in WO 2005/042735 A1 .
- a 2 ⁇ volume of the ligation mixture was used to transform 25 ⁇ of Fusion Blue E. coli cells (included in the IN-FUSIONTM Dry-Down PCR Cloning Kit). After a heat shock at 42°C for 45 sec, and chilling on ice, 250 ⁇ of SOC medium was added, and the cells were incubated at 37°C at 225 rpm for 90 min before being plated out on LB agar plates containing 50 ⁇ g of ampicillin per ml, and cultivated overnight at 37°C. Selected colonies were inoculated in 3 ml of LB medium supplemented with 50 ⁇ g of ampicillin per ml and incubated at 37°C at 225 rpm overnight.
- Plasmid DNA from the selected colonies was purified using Mini JETSTAR (Genomed, Germany) according to the manufacturer's instructions. Penicillium oxalicum glucoamylase gene sequence was verified by Sanger sequencing before heterologous expression. One of the plasmids was selected for further expression, and was named XYZ XYZ1471-4. Protoplasts of Aspergillus niger MBin1 18 were prepared as described in WO 95/02043.
- the selected transformant was inoculated in 100ml of MLC media and cultivated at 30 °C for 2 days in 500 ml shake flasks on a rotary shaker. 3 ml of the culture broth was inoculated to 100ml of M410 medium and cultivated at 30°C for 3 days. The culture broth was centrifugated and the supernatant was filtrated using 0.2 ⁇ membrane filters.
- Alpha-cyclodextrin affinity gel Ten grams of Epoxy-activated Sepharose 6B (GE Healthcare, Chalfont St. Giles, U.K) powder was suspended in and washed with distilled water on a sintered glass filter. The gel was suspended in coupling solution (100 ml of 12.5 mg/ml alpha-cyclodextrin, 0.5 M NaOH) and incubated at room temperature for one day with gentle shaking. The gel was washed with distilled water on a sintered glass filter, suspended in 100 ml of 1 M ethanolamine, pH 10, and incubated at 50 ° C for 4 hours for blocking.
- Epoxy-activated Sepharose 6B GE Healthcare, Chalfont St. Giles, U.K
- the gel was then washed several times using 50 mM Tris-HCI, pH 8 and 50 mM NaOAc, pH 4.0 alternatively.
- the gel was finally packed in a 35-40 ml column using equilibration buffer (50 mM NaOAc, 150 mM NaCI, pH 4.5).
- A. niger MBin1 18 harboring the glucoamylase gene was filtrated through a 0.22 ⁇ PES filter, and applied on a alpha-cyclodextrin affinity gel column previously equilibrated in 50 mM NaOAc, 150 mM NaCI, pH 4.5 buffer. Unbound material was washed off the column with equilibration buffer and the glucoamylase was eluted using the same buffer containing 10 mM beta- cyclodextrin over 3 column volumes.
- the glucoamylase activity of the eluent was checked to see, if the glucoamylase had bound to the alpha-cyclodextrin affinity gel.
- the purified glucoamylase sample was then dialyzed against 20 mM NaOAc, pH 5.0. The purity was finally checked by SDS-PAGE, and only a single band was found.
- Two PCR reactions were performed with plasmid XYZ1471 -4, described in Example 9, using primers K79V F and K79VR shown below, which were desined to substitute lysine K at position 79 from the mature seequence to varin V and primers F-NP003940 and R-NP003940 shown below, which were designed based on the known sequence and added tags for direct cloning by IN-FUSIONTM strategy.
- Primer K79V F 18mer GCAGTCTTTCCAATTGAC (SEQ ID NO: 18)
- Primer F-NP003940 5' AC AC AACTG G G G G AT CC AC CAT G C GT CT C ACTCTATT ATC (SEQ ID NO: 20)
- Primer R-NP003940 5' AGATCTCGAGAAGCTTAAAACTGCCACACGTCGTTGG (SEQ ID NO: 21 )
- the PCR was performed using a PTC-200 DNA Engine under the conditions described below.
- the ligation mixture was used to transform E. coli DH5a cells (TOYOBO). Selected colonies were inoculated in 3 ml of LB medium supplemented with 50 ⁇ g of ampicillin per ml and incubated at 37°C at 225 rpm overnight. Plasmid DNA from the selected colonies was purified using Qiagen plasmid mini kit (Qiagen) according to the manufacturer's instructions. The sequence of Penicillium oxalicum glucoamylase site-directed variant gene sequence was verified before heterologous expression and one of the plasmids was selected for further expression, and was named pPoPEOOL
- Protoplasts of Aspergillus niger MBin1 18 were prepared as described in WO 95/02043.
- One hundred microliters of protoplast suspension were mixed with 2.5 ⁇ g of the pPoPE001 plasmid and 250 microliters of 60% PEG 4000 (Applichem) (polyethylene glycol, molecular weight 4,000), 10 mM CaCI 2 , and 10 mM Tris-HCI pH 7.5 were added and gently mixed.
- the mixture was incubated at 37°C for 30 minutes and the protoplasts were mixed with 1 % agarose L (Nippon Gene) in COVE sucrose (Cove, 1996, Biochim. Biophys.
- Penicillium oxalicum glucoamylase described in Example 8 was cultivated in 100 ml of YP- 2% maltose medium and the culture was filtrated through a 0.22 ⁇ PES filter, and applied on a alpha-cyclodextrin affinity gel column previously equilibrated in 50 mM NaOAc, 150 mM NaCI, pH 4.5 buffer. Unbound materias was washed off the column with equilibration buffer and the glucoamylase was eluted using the same buffer containing 10 mM beta-cyclodextrin over 3 column volumes.
- the glucoamylase activity of the eluent was checked to see, if the glucoamylase had bound to the alpha-cyclodextrin affinity gel.
- the purified glucoamylase samples were then dialyzed against 20 mM NaOAc, pH 5.0.
- protease solutions such as aspergillopepsinl described in Biochem J. 1975 Apr; 147(1 ): 45-53 or the commercially availble product from Sigma and aorsin descrived in Biochemical journal [0264-6021 ] Ichishima, 2003, 371 (2): 541 and incubated at 4 or 32°C overnight.
- H 2 0 was added to the sample instead of proteases. The samples were loaded on SDS-PAGE to see if the glucoamylases are cleaved by proteases.
- PE001 only showed one band corresponding to the intact molecule, while the wild type glucoamylase was degraded by proteases and showed a band at lower molecular size at 60 kCa.
- Aspergillus transformant of the variant and the wild type Penicillium oxalicum glucoamylase were cultivated in 6-well MT plates containing 4X diluted YP-2% maltose medium supplemented with 10 mM sodium acetate buffer, pH4.5, at 32°C for 1 week.
- the culture supernatants were loaded on SDS-PAGE.
- the wild type glucoamylase was cleaved by host proteasaes during fermentation, while the variant yielded only intact molecule.
- the glucoamylase activity measures as AGU as described above was checked for the purified enzymes of the wild type Penicillium oxalicum and the variant glucoamylase.
- the Glucoamylase Unit was defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions (37°C, pH 4.3, substrate: maltose 100 mM, buffer: acetate 0.1 M, reaction time 6 minutes).
- variants showing increased thermostability may be constructed and expressed similar to the procedure described in Example 10. All variants were derived from the PE001 . After expression in YPM medium, variants comprising the T65A or Q327F substitution was micro-purified as follows:
- Mycelium was removed by filtration through a 0.22 ⁇ filter.
- 50 ⁇ column material (alpha-cyclodextrin coupled to Mini-Leak divinylsulfone-activated agarose medium according to manufacturers recommendations) was added to the wells of a filter plate (Whatman, Unifilter 800 ⁇ , 25-30 ⁇ MBPP).
- the column material was equilibrated with binding buffer (200 mM sodium acetate pH 4.5) by two times addition of 200 ⁇ buffer, vigorous shaking for 10 min (Heidolph, Titramax 101 , 1000 rpm) and removal of buffer by vacuum (Whatman, UniVac 3). Subsequently, 400 ⁇ culture supernatant and 100 ⁇ binding buffer was added and the plate incubated 30 min with vigorous shaking.
- Unbound material was removed by vacuum and the binding step was repeated. Normally 4 wells were used per variant. Three washing steps were then performed with 200 ⁇ buffer of decreasing ionic strength added (50/10/5 mM sodium acetate, pH 4.5), shaking for 15 min and removal of buffer by vacuum. Elution of the bound AMG was achieved by two times addition of 100 ⁇ elution buffer (250 mM sodium acetate, 0.1 % alpha-cyclodextrin, pH 6.0), shaking for 15 min and collection of eluted material in a microtiter plate by vacuum.
- 100 ⁇ elution buffer 250 mM sodium acetate, 0.1 % alpha-cyclodextrin, pH 6.0
- TSA Protein thermal unfolding analysis
- Protein thermal unfolding of the T65A and Q327F variants was monitored using Sypro Orange (ln-vitrogen, S-6650) and was performed using a real-time PCR instrument (Applied Biosystems; Step-One-Plus).
- Tm-values were calculated as the maximum value of the first derivative (dF/dK) (ref.: Gregory et al., 2009, J. Biomol. Screen. 14: 700).
- Example 10 Additional site specific variants having substitutions and /or deletions at specific positions were constructed basically as described in Example 10 and purified as described in Example 1 1.
- thermostability of the purified Po-AMG PE001 derived variants were determined at pH 4.0 or 4.8 (50 mM Sodium Acetate) by Differential Scanning Calorimetry (DSC) using a VP- Capillary Differential Scanning Calorimeter (MicroCal Inc., Piscataway, NJ, USA).
- the thermal denaturation temperature, Td (°C) was taken as the top of the denaturation peak (major endothermic peak) in thermograms (Cp vs. T) obtained after heating enzyme solutions in selected buffers (50 mM Sodium Acetate, pH 4.0 or 4.8)at a constant programmed heating rate of 200 K/hr.
- Sample- and reference-solutions (approximately 0.3 ml) were loaded into the calorimeter (reference: buffer without enzyme) from storage conditions at 10°C and thermally pre- equilibrated for 10 minutes at 20°C prior to DSC scan from 20°C to 1 10°C. Denaturation temperatures were determined with an accuracy of approximately +/- 1 °C.
- the Penicillium oxalicum glucoamylase pNPG activity assay is a spectrometric endpoint assay where the samples are split in two and measured thermo-stressed and non-thermo- stressed. The data output is therefore a measurement of residual activity in the stressed samples.
- a sterile micro titer plate (MTP) was added 200 microliters rich growth media (FT X-14 without Dowfax) to each well.
- the strains of interest were inoculated in triplicates directly from frozen stocks to the MTP.
- Benchmark was inoculated in 20 wells. Non-inoculated wells with media were used as assay blanks.
- the MTP was placed in a plastic box containing wet tissue to prevent evaporation from the wells during incubation. The plastic box was placed at 34°C for 4 days.
- the reaction was stopped and the colour developed by adding 50 microliters 0.5 M Na 2 C0 3.
- the yellow colour was measured on a plate reader (Molecular Devices) at 405 nm.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Botany (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN4905CHN2014 IN2014CN04905A (https=) | 2011-12-02 | 2012-11-30 | |
| EP12799456.4A EP2785847B1 (en) | 2011-12-02 | 2012-11-30 | Liquefaction process with selected alpha-amylases and proteases |
| MX2014006464A MX348696B (es) | 2011-12-02 | 2012-11-30 | Procesos para la produccion de productos de fermentacion. |
| CA2857963A CA2857963C (en) | 2011-12-02 | 2012-11-30 | Processes for producing fermentation products |
| EA201491087A EA201491087A1 (ru) | 2011-12-02 | 2012-11-30 | Способы получения продуктов ферментации |
| CN201280068841.5A CN104245942A (zh) | 2011-12-02 | 2012-11-30 | 用于制造发酵产物的方法 |
| US14/362,002 US20140315243A1 (en) | 2011-12-02 | 2012-11-30 | Processes for producing fermentation products |
| ES12799456.4T ES2644727T3 (es) | 2011-12-02 | 2012-11-30 | Proceso de licuefacción con alfa-amilasas y proteasas seleccionadas |
| DK12799456.4T DK2785847T3 (en) | 2011-12-02 | 2012-11-30 | Transfer process with selected alpha-amylases and proteases |
| US16/811,019 US20200199559A1 (en) | 2011-12-02 | 2020-03-06 | Processes for Producing Fermentation Products |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161566281P | 2011-12-02 | 2011-12-02 | |
| US61/566,281 | 2011-12-02 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/362,002 A-371-Of-International US20140315243A1 (en) | 2011-12-02 | 2012-11-30 | Processes for producing fermentation products |
| US16/811,019 Continuation US20200199559A1 (en) | 2011-12-02 | 2020-03-06 | Processes for Producing Fermentation Products |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013082486A1 true WO2013082486A1 (en) | 2013-06-06 |
Family
ID=47352024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/067380 Ceased WO2013082486A1 (en) | 2011-12-02 | 2012-11-30 | Processes for producing fermentation products |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US20140315243A1 (https=) |
| EP (1) | EP2785847B1 (https=) |
| CN (2) | CN107267558A (https=) |
| CA (1) | CA2857963C (https=) |
| DK (1) | DK2785847T3 (https=) |
| EA (1) | EA201491087A1 (https=) |
| ES (1) | ES2644727T3 (https=) |
| IN (1) | IN2014CN04905A (https=) |
| MX (1) | MX348696B (https=) |
| WO (1) | WO2013082486A1 (https=) |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014209800A1 (en) | 2013-06-24 | 2014-12-31 | Novozymes A/S | Processes for recovering oil from fermentation product processes and processes for producing fermentation products |
| WO2015066667A1 (en) * | 2013-11-04 | 2015-05-07 | Danisco Us Inc. | Proteases in wheat processing |
| WO2016196202A1 (en) | 2015-05-29 | 2016-12-08 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
| WO2017015329A1 (en) | 2015-07-23 | 2017-01-26 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2018075430A1 (en) | 2016-10-17 | 2018-04-26 | Novozymes A/S | Methods of reducing foam during ethanol fermentation |
| WO2018098124A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
| WO2018098381A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Improved yeast for ethanol production |
| CN108699573A (zh) * | 2015-12-22 | 2018-10-23 | 诺维信公司 | 用于生产发酵产物的方法 |
| WO2018222990A1 (en) | 2017-06-02 | 2018-12-06 | Novozymes A/S | Improved yeast for ethanol production |
| WO2019070883A1 (en) | 2017-10-04 | 2019-04-11 | Novozymes A/S | POLYPEPTIDES WITH PROTEASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME |
| WO2019113413A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019113415A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019148192A1 (en) | 2018-01-29 | 2019-08-01 | Novozymes A/S | Microorganisms with improved nitrogen utilization for ethanol production |
| WO2019161227A1 (en) | 2018-02-15 | 2019-08-22 | Novozymes A/S | Improved yeast for ethanol production |
| WO2021021458A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Microorganisms with improved nitrogen transport for ethanol production |
| US10941422B2 (en) | 2010-12-22 | 2021-03-09 | Novozymes A/S | Processes for producing fuel ethanol |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| US11939552B2 (en) | 2013-06-24 | 2024-03-26 | Novozymes A/S | Process of recovering oil |
| WO2024137246A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137248A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization |
| WO2024137250A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137252A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Process for reducing syrup viscosity in the backend of a process for producing a fermentation product |
| WO2024137704A2 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast |
| WO2024258820A2 (en) | 2023-06-13 | 2024-12-19 | Novozymes A/S | Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase |
| WO2025071409A1 (en) * | 2023-09-26 | 2025-04-03 | Mauri Technology B.V. | Bakery product with reduced fodmap content |
| WO2025128568A1 (en) | 2023-12-11 | 2025-06-19 | Novozymes A/S | Composition and use thereof for increasing hemicellulosic fiber solubilization |
| WO2026008449A2 (en) | 2024-07-04 | 2026-01-08 | Novozymes A/S | A process for producing a fermentation product and a concentrated protein co-product |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104334738B (zh) | 2012-03-30 | 2019-01-29 | 诺维信北美公司 | 生产发酵产物的方法 |
Citations (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1984002921A2 (en) | 1983-01-28 | 1984-08-02 | Cetus Corp | Glucoamylase cdna |
| EP0135138A2 (en) | 1983-08-17 | 1985-03-27 | Cpc International Inc. | A novel thermostable glucoamylase and method for its production |
| US4560651A (en) | 1981-04-20 | 1985-12-24 | Novo Industri A/S | Debranching enzyme product, preparation and use thereof |
| WO1986001831A1 (en) | 1984-09-18 | 1986-03-27 | Michigan Biotechnology Institute | Thermostable starch converting enzymes |
| US4587215A (en) | 1984-06-25 | 1986-05-06 | Uop Inc. | Highly thermostable amyloglucosidase |
| USRE32153E (en) | 1978-09-01 | 1986-05-20 | Cpc International Inc. | Highly thermostable glucoamylaseand process for its production |
| US4598048A (en) | 1983-03-25 | 1986-07-01 | Novo Industri A/S | Preparation of a maltogenic amylase enzyme |
| US4727026A (en) | 1985-11-26 | 1988-02-23 | Godo Shusei Co., Ltd. | Method for direct saccharification of raw starch using enzyme produced by a basidiomycete belonging to the genus Corticium |
| WO1992000381A1 (en) | 1990-06-29 | 1992-01-09 | Novo Nordisk A/S | Enzymatic hydrolysis of starch to glucose, using a genetically engineered enzyme |
| WO1992002614A1 (en) | 1990-08-01 | 1992-02-20 | Novo Nordisk A/S | Novel thermostable pullulanases |
| WO1995002043A1 (en) | 1993-07-06 | 1995-01-19 | Novo Nordisk A/S | DNA ENCODING AN ENZYME WITH ENDOGLUCANASE ACTIVITY FROM $i(TRICHODERMA HARZIANUM) |
| WO1996023874A1 (en) | 1995-02-03 | 1996-08-08 | Novo Nordisk A/S | A method of designing alpha-amylase mutants with predetermined properties |
| WO1996023873A1 (en) | 1995-02-03 | 1996-08-08 | Novo Nordisk A/S | Amylase variants |
| WO1997041213A1 (en) | 1996-04-30 | 1997-11-06 | Novo Nordisk A/S | α-AMYLASE MUTANTS |
| WO1999019467A1 (en) | 1997-10-13 | 1999-04-22 | Novo Nordisk A/S | α-AMYLASE MUTANTS |
| WO1999028448A1 (en) | 1997-11-26 | 1999-06-10 | Novo Nordisk A/S | Thermostable glucoamylase |
| WO2000004136A1 (en) | 1998-07-15 | 2000-01-27 | Novozymes A/S | Glucoamylase variants |
| US6093562A (en) | 1996-02-05 | 2000-07-25 | Novo Nordisk A/S | Amylase variants |
| WO2000060059A2 (en) | 1999-03-30 | 2000-10-12 | NovozymesA/S | Alpha-amylase variants |
| US6162628A (en) | 1998-02-27 | 2000-12-19 | Novo Nordisk A/S | Maltogenic alpha-amylase variants |
| WO2001004273A2 (en) | 1999-07-09 | 2001-01-18 | Novozymes A/S | Glucoamylase variant |
| WO2001051620A2 (en) | 2000-01-12 | 2001-07-19 | Novozymes A/S | Pullulanase variants and methods for preparing such variants with predetermined properties |
| WO2001092502A1 (en) | 2000-06-02 | 2001-12-06 | Novozymes A/S | Cutinase variants |
| WO2002010355A2 (en) | 2000-08-01 | 2002-02-07 | Novozymes A/S | Alpha-amylase mutants with altered stability |
| US6358726B1 (en) | 1997-06-10 | 2002-03-19 | Takara Shuzo Co., Ltd. | Thermostable protease |
| WO2003048353A1 (en) | 2001-12-07 | 2003-06-12 | Novozymes A/S | Polypeptides having protease activity and nucleic acids encoding same |
| WO2005042735A1 (en) | 2003-10-30 | 2005-05-12 | Novozymes A/S | Carbohydrate-binding modules of a new family |
| WO2005045018A1 (en) | 2003-10-28 | 2005-05-19 | Novozymes North America, Inc. | Hybrid enzymes |
| WO2006069290A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes A/S | Enzymes for starch processing |
| WO2006086792A2 (en) * | 2005-02-07 | 2006-08-17 | Novozymes North America, Inc. | Fermentation product production processes |
| DE102005062984A1 (de) * | 2005-12-28 | 2007-07-05 | Henkel Kgaa | Wasch- oder Reinigungsmittel mit spezieller Amylase |
| WO2007124285A2 (en) | 2006-04-19 | 2007-11-01 | Novozymes North America, Inc. | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2007134207A2 (en) | 2006-05-12 | 2007-11-22 | Novozymes North America, Inc. | Use of a thermococcales-derived alpha-amylase for starch liquefaction or saccharification |
| WO2010008841A2 (en) | 2008-06-23 | 2010-01-21 | Novozymes A/S | Processes for producing fermentation products |
| US7713723B1 (en) | 2000-08-01 | 2010-05-11 | Novozymes A/S | Alpha-amylase mutants with altered properties |
| WO2011066576A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011072191A2 (en) * | 2009-12-11 | 2011-06-16 | Novozymes A/S | Protease variants |
| WO2011076123A1 (en) | 2009-12-22 | 2011-06-30 | Novozymes A/S | Compositions comprising boosting polypeptide and starch degrading enzyme and uses thereof |
| WO2011082425A2 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| US8048657B2 (en) * | 2007-10-18 | 2011-11-01 | Danisco Us Inc. | Enzyme compositions comprising a glucoamylase, an acid stable alpha amylase, and an acid fungal protease |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5756339A (en) * | 1994-06-13 | 1998-05-26 | Takara Shuzo Co., Ltd. | Hyperthermostable protease gene |
| CN1128879C (zh) * | 1995-12-12 | 2003-11-26 | 宝酒造株式会社 | 超耐热蛋白酶基因 |
| AR032392A1 (es) * | 2001-01-19 | 2003-11-05 | Solvay Pharm Gmbh | Mezcla de enzimas, preparado farmaceutico y utilizacion de dicho preparado. |
| US20030180900A1 (en) * | 2002-02-08 | 2003-09-25 | Oreste Lantero | Methods for producing ethanol from carbon substrates |
| US20070184150A1 (en) * | 2004-07-13 | 2007-08-09 | Novozymes North America,Inc. | Liquefaction process |
| MX2010008358A (es) * | 2008-02-04 | 2010-08-30 | Danisco Us Inc | Variantes de alfa-amilasa de bacillus stearothermophilus y usos de las mismas. |
| EP2654567B1 (en) * | 2010-12-22 | 2018-04-04 | Novozymes North America, Inc. | Process for producing fermentation products from starch containing materials |
-
2012
- 2012-11-30 IN IN4905CHN2014 patent/IN2014CN04905A/en unknown
- 2012-11-30 CA CA2857963A patent/CA2857963C/en active Active
- 2012-11-30 EP EP12799456.4A patent/EP2785847B1/en active Active
- 2012-11-30 DK DK12799456.4T patent/DK2785847T3/en active
- 2012-11-30 MX MX2014006464A patent/MX348696B/es active IP Right Grant
- 2012-11-30 ES ES12799456.4T patent/ES2644727T3/es active Active
- 2012-11-30 WO PCT/US2012/067380 patent/WO2013082486A1/en not_active Ceased
- 2012-11-30 EA EA201491087A patent/EA201491087A1/ru unknown
- 2012-11-30 CN CN201710458195.8A patent/CN107267558A/zh active Pending
- 2012-11-30 CN CN201280068841.5A patent/CN104245942A/zh active Pending
- 2012-11-30 US US14/362,002 patent/US20140315243A1/en not_active Abandoned
-
2020
- 2020-03-06 US US16/811,019 patent/US20200199559A1/en active Pending
Patent Citations (47)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| USRE32153E (en) | 1978-09-01 | 1986-05-20 | Cpc International Inc. | Highly thermostable glucoamylaseand process for its production |
| US4560651A (en) | 1981-04-20 | 1985-12-24 | Novo Industri A/S | Debranching enzyme product, preparation and use thereof |
| WO1984002921A2 (en) | 1983-01-28 | 1984-08-02 | Cetus Corp | Glucoamylase cdna |
| US4598048A (en) | 1983-03-25 | 1986-07-01 | Novo Industri A/S | Preparation of a maltogenic amylase enzyme |
| US4604355A (en) | 1983-03-25 | 1986-08-05 | Novo Industri A/S | Maltogenic amylase enzyme, preparation and use thereof |
| EP0135138A2 (en) | 1983-08-17 | 1985-03-27 | Cpc International Inc. | A novel thermostable glucoamylase and method for its production |
| US4587215A (en) | 1984-06-25 | 1986-05-06 | Uop Inc. | Highly thermostable amyloglucosidase |
| WO1986001831A1 (en) | 1984-09-18 | 1986-03-27 | Michigan Biotechnology Institute | Thermostable starch converting enzymes |
| US4727026A (en) | 1985-11-26 | 1988-02-23 | Godo Shusei Co., Ltd. | Method for direct saccharification of raw starch using enzyme produced by a basidiomycete belonging to the genus Corticium |
| WO1992000381A1 (en) | 1990-06-29 | 1992-01-09 | Novo Nordisk A/S | Enzymatic hydrolysis of starch to glucose, using a genetically engineered enzyme |
| WO1992002614A1 (en) | 1990-08-01 | 1992-02-20 | Novo Nordisk A/S | Novel thermostable pullulanases |
| WO1995002043A1 (en) | 1993-07-06 | 1995-01-19 | Novo Nordisk A/S | DNA ENCODING AN ENZYME WITH ENDOGLUCANASE ACTIVITY FROM $i(TRICHODERMA HARZIANUM) |
| WO1996023874A1 (en) | 1995-02-03 | 1996-08-08 | Novo Nordisk A/S | A method of designing alpha-amylase mutants with predetermined properties |
| WO1996023873A1 (en) | 1995-02-03 | 1996-08-08 | Novo Nordisk A/S | Amylase variants |
| US6297038B1 (en) | 1995-02-03 | 2001-10-02 | Novozymes A/S | Amylase variants |
| US6093562A (en) | 1996-02-05 | 2000-07-25 | Novo Nordisk A/S | Amylase variants |
| WO1997041213A1 (en) | 1996-04-30 | 1997-11-06 | Novo Nordisk A/S | α-AMYLASE MUTANTS |
| US6358726B1 (en) | 1997-06-10 | 2002-03-19 | Takara Shuzo Co., Ltd. | Thermostable protease |
| US6187576B1 (en) | 1997-10-13 | 2001-02-13 | Novo Nordisk A/S | α-amylase mutants |
| WO1999019467A1 (en) | 1997-10-13 | 1999-04-22 | Novo Nordisk A/S | α-AMYLASE MUTANTS |
| WO1999028448A1 (en) | 1997-11-26 | 1999-06-10 | Novo Nordisk A/S | Thermostable glucoamylase |
| US6162628A (en) | 1998-02-27 | 2000-12-19 | Novo Nordisk A/S | Maltogenic alpha-amylase variants |
| WO2000004136A1 (en) | 1998-07-15 | 2000-01-27 | Novozymes A/S | Glucoamylase variants |
| WO2000060059A2 (en) | 1999-03-30 | 2000-10-12 | NovozymesA/S | Alpha-amylase variants |
| WO2001004273A2 (en) | 1999-07-09 | 2001-01-18 | Novozymes A/S | Glucoamylase variant |
| WO2001051620A2 (en) | 2000-01-12 | 2001-07-19 | Novozymes A/S | Pullulanase variants and methods for preparing such variants with predetermined properties |
| WO2001092502A1 (en) | 2000-06-02 | 2001-12-06 | Novozymes A/S | Cutinase variants |
| WO2002010355A2 (en) | 2000-08-01 | 2002-02-07 | Novozymes A/S | Alpha-amylase mutants with altered stability |
| US7713723B1 (en) | 2000-08-01 | 2010-05-11 | Novozymes A/S | Alpha-amylase mutants with altered properties |
| WO2003048353A1 (en) | 2001-12-07 | 2003-06-12 | Novozymes A/S | Polypeptides having protease activity and nucleic acids encoding same |
| WO2005045018A1 (en) | 2003-10-28 | 2005-05-19 | Novozymes North America, Inc. | Hybrid enzymes |
| WO2005042735A1 (en) | 2003-10-30 | 2005-05-12 | Novozymes A/S | Carbohydrate-binding modules of a new family |
| WO2006069290A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes A/S | Enzymes for starch processing |
| WO2006069289A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes North America, Inc | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2006086792A2 (en) * | 2005-02-07 | 2006-08-17 | Novozymes North America, Inc. | Fermentation product production processes |
| DE102005062984A1 (de) * | 2005-12-28 | 2007-07-05 | Henkel Kgaa | Wasch- oder Reinigungsmittel mit spezieller Amylase |
| WO2007124285A2 (en) | 2006-04-19 | 2007-11-01 | Novozymes North America, Inc. | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2007134207A2 (en) | 2006-05-12 | 2007-11-22 | Novozymes North America, Inc. | Use of a thermococcales-derived alpha-amylase for starch liquefaction or saccharification |
| US8048657B2 (en) * | 2007-10-18 | 2011-11-01 | Danisco Us Inc. | Enzyme compositions comprising a glucoamylase, an acid stable alpha amylase, and an acid fungal protease |
| WO2010008841A2 (en) | 2008-06-23 | 2010-01-21 | Novozymes A/S | Processes for producing fermentation products |
| WO2011066576A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011072191A2 (en) * | 2009-12-11 | 2011-06-16 | Novozymes A/S | Protease variants |
| WO2011076123A1 (en) | 2009-12-22 | 2011-06-30 | Novozymes A/S | Compositions comprising boosting polypeptide and starch degrading enzyme and uses thereof |
| WO2011087836A2 (en) | 2009-12-22 | 2011-07-21 | Novozymes A/S | Pullulanase variants and uses thereof |
| WO2011082425A2 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
Non-Patent Citations (23)
| Title |
|---|
| "Handbook of Proteolytic Enzymes", 1998, ACADEMIC PRESS |
| "PCR: A practical approac", OXFORD UNIVERSITY PRESS, pages: 207 - 209 |
| AGRIC. BIOL. CHEM., vol. 55, no. 4, 1991, pages 941 - 949 |
| BIOCHEM J., vol. 147, no. 1, April 1975 (1975-04-01), pages 45 - 53 |
| BIOCHEMICAL JOURNAL, pages 0264 - 6021 |
| BOEL ET AL., EMBO J., vol. 3, no. 5, 1984, pages 1097 - 1102 |
| CHEN ET AL., BIOCHEM. J., vol. 301, 1994, pages 275 - 281 |
| CHEN ET AL., PROT. ENG., vol. 8, 1995, pages 575 - 582 |
| CHEN ET AL., PROT. ENG., vol. 9, 1996, pages 499 - 505 |
| COVE, BIOCHIM. BIOPHYS. ACTA, vol. 133, 1996, pages 51 - 56 |
| FEMS MIC. LET., vol. 115, 1994, pages 97 - 106 |
| FIEROBE ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 8698 - 8704 |
| GREGORY ET AL., J. BIOMOL. SCREEN., vol. 14, 2009, pages 700 |
| ICHISHIMA, vol. 371, no. 2, 2003, pages 541 |
| J. BIOL. CHEM., vol. 272, no. 15, 1997, pages 9720 - 9727 |
| LASSEN ET AL., APPL. ENVIRON. MICROBIOL., vol. 67, 2001, pages 4701 - 4707 |
| LI ET AL., PROTEIN ENG., vol. 10, 1997, pages 1199 - 1204 |
| NAGASAKA ET AL.: "Purification and properties of the raw-starch-degrading glucoamylases from Corticium rolfsii", APPL MICROBIOL BIOTECHNOL, vol. 50, 1998, pages 323 - 330, XP002506425, DOI: doi:10.1007/s002530051299 |
| PEREZ-CARRILLO ET AL: "Addition of protease during starch liquefaction affects free amino nitrogen, fusel alcohols and ethanol production of fermented maizeand whole and decorticated sorghum mashes", BIOCHEMICAL ENGINEERING JOURNAL, vol. 67, 2 May 2012 (2012-05-02), pages 1 - 9, XP028408603 * |
| RICHARDSON ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 277, no. 29, 2002, pages 267501 - 26507 |
| T. F. SMITH; M. S. WATERMAN: "Smith-Waterman algorithm", J. MOL. BIOL., vol. 147, 1981, pages 195 - 197 |
| W. R. PEARSON: "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", METHODS IN ENZYMOLOGY, vol. 183, 1990, pages 63 - 98, XP000670614, DOI: doi:10.1016/0076-6879(90)83007-V |
| W. R. PEARSON; D. J. LIPMAN: "Improved Tools for Biological Sequence Analysis", PNAS, vol. 85, 1988, pages 2444 - 2448 |
Cited By (47)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12227785B2 (en) | 2010-12-22 | 2025-02-18 | Novozymes A/S | Compositions comprising a low pH alpha-amylase and a thermostable protease for liquefaction |
| US10941422B2 (en) | 2010-12-22 | 2021-03-09 | Novozymes A/S | Processes for producing fuel ethanol |
| US10947567B2 (en) | 2010-12-22 | 2021-03-16 | Novozymes A/S | Processes for producing ethanol |
| US11499170B2 (en) | 2010-12-22 | 2022-11-15 | Novozymes A/S | Processes for producing ethanol |
| US11566266B2 (en) | 2010-12-22 | 2023-01-31 | Novozymes A/S | Processes for producing ethanol |
| US11840718B2 (en) | 2010-12-22 | 2023-12-12 | Novozymes A/S | Processes for producing ethanol |
| US11505765B2 (en) | 2013-06-24 | 2022-11-22 | Novozymes A/S | Process of recovering oil |
| CN117089583A (zh) * | 2013-06-24 | 2023-11-21 | 诺维信公司 | 用于从发酵产物过程中回收油的方法以及用于生产发酵产物的方法 |
| US11939552B2 (en) | 2013-06-24 | 2024-03-26 | Novozymes A/S | Process of recovering oil |
| US10035973B2 (en) | 2013-06-24 | 2018-07-31 | Novozymes A/S | Process of extracting oil from thin stillage |
| US10093882B2 (en) | 2013-06-24 | 2018-10-09 | Novozymes A/S | Processes for recovering oil from fermentation product processes and processes for producing fermentation products |
| WO2014209800A1 (en) | 2013-06-24 | 2014-12-31 | Novozymes A/S | Processes for recovering oil from fermentation product processes and processes for producing fermentation products |
| US10781398B2 (en) | 2013-06-24 | 2020-09-22 | Novozymes A/S | Process of recovering oil |
| US11965143B2 (en) | 2013-06-24 | 2024-04-23 | Novozymes A/S | Process of recovering oil |
| EP3013967A4 (en) * | 2013-06-24 | 2016-12-28 | Novozymes As | METHOD FOR OBTAINING OIL FROM FERMENTATION PRODUCT PROCESSES AND METHOD FOR PRODUCING FERMENTATION PRODUCTS |
| US10844318B2 (en) | 2013-06-24 | 2020-11-24 | Novozymes A/S | Processes for recovering oil from ethanol production processes |
| US10731104B2 (en) | 2013-06-24 | 2020-08-04 | Novozymes A/S | Process of recovering oil |
| CN105339501A (zh) * | 2013-06-24 | 2016-02-17 | 诺维信公司 | 用于从发酵产物过程中回收油的方法以及用于生产发酵产物的方法 |
| US10920172B2 (en) | 2013-06-24 | 2021-02-16 | Novozymes A/S | Process of recovering oil |
| WO2015066667A1 (en) * | 2013-11-04 | 2015-05-07 | Danisco Us Inc. | Proteases in wheat processing |
| WO2016196202A1 (en) | 2015-05-29 | 2016-12-08 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
| WO2017015329A1 (en) | 2015-07-23 | 2017-01-26 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| CN108699573A (zh) * | 2015-12-22 | 2018-10-23 | 诺维信公司 | 用于生产发酵产物的方法 |
| WO2018075430A1 (en) | 2016-10-17 | 2018-04-26 | Novozymes A/S | Methods of reducing foam during ethanol fermentation |
| WO2018098381A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Improved yeast for ethanol production |
| WO2018098124A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
| CN110072997A (zh) * | 2016-11-23 | 2019-07-30 | 诺维信公司 | 具有蛋白酶活性的多肽和编码其的多核苷酸 |
| WO2018222990A1 (en) | 2017-06-02 | 2018-12-06 | Novozymes A/S | Improved yeast for ethanol production |
| CN111148830A (zh) * | 2017-10-04 | 2020-05-12 | 诺维信公司 | 具有蛋白酶活性的多肽和编码其的多核苷酸 |
| WO2019070883A1 (en) | 2017-10-04 | 2019-04-11 | Novozymes A/S | POLYPEPTIDES WITH PROTEASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME |
| WO2019113415A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| US11326153B2 (en) | 2017-12-08 | 2022-05-10 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| US11384347B2 (en) | 2017-12-08 | 2022-07-12 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019113413A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019148192A1 (en) | 2018-01-29 | 2019-08-01 | Novozymes A/S | Microorganisms with improved nitrogen utilization for ethanol production |
| WO2019161227A1 (en) | 2018-02-15 | 2019-08-22 | Novozymes A/S | Improved yeast for ethanol production |
| WO2021021458A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Microorganisms with improved nitrogen transport for ethanol production |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| WO2024137246A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137248A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization |
| WO2024137250A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137252A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Process for reducing syrup viscosity in the backend of a process for producing a fermentation product |
| WO2024137704A2 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast |
| WO2024258820A2 (en) | 2023-06-13 | 2024-12-19 | Novozymes A/S | Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase |
| WO2025071409A1 (en) * | 2023-09-26 | 2025-04-03 | Mauri Technology B.V. | Bakery product with reduced fodmap content |
| WO2025128568A1 (en) | 2023-12-11 | 2025-06-19 | Novozymes A/S | Composition and use thereof for increasing hemicellulosic fiber solubilization |
| WO2026008449A2 (en) | 2024-07-04 | 2026-01-08 | Novozymes A/S | A process for producing a fermentation product and a concentrated protein co-product |
Also Published As
| Publication number | Publication date |
|---|---|
| US20140315243A1 (en) | 2014-10-23 |
| EA201491087A1 (ru) | 2014-09-30 |
| US20200199559A1 (en) | 2020-06-25 |
| IN2014CN04905A (https=) | 2015-09-18 |
| EP2785847A1 (en) | 2014-10-08 |
| CN104245942A (zh) | 2014-12-24 |
| MX348696B (es) | 2017-06-26 |
| EP2785847B1 (en) | 2017-07-26 |
| CA2857963A1 (en) | 2013-06-06 |
| ES2644727T3 (es) | 2017-11-30 |
| MX2014006464A (es) | 2014-09-01 |
| CA2857963C (en) | 2022-08-30 |
| DK2785847T3 (en) | 2017-10-16 |
| CN107267558A (zh) | 2017-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11987831B2 (en) | Processes for producing a fermentation product | |
| US20200199559A1 (en) | Processes for Producing Fermentation Products | |
| US20230323315A1 (en) | Processes for producing fermentation products | |
| US11130977B2 (en) | Processes for producing fermentation products | |
| WO2018098381A1 (en) | Improved yeast for ethanol production | |
| AU2019222480A1 (en) | Improved yeast for ethanol production | |
| WO2016153924A1 (en) | Processes for producing ethanol and ethanol producing yeast | |
| EP2766490A1 (en) | Processes for producing fermentation products | |
| US20170283834A1 (en) | Processes for Producing A Fermentation Product Using A Fermenting Organism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12799456 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/006464 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14362002 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2857963 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012799456 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012799456 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201491087 Country of ref document: EA |