Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/55—Fab or Fab'
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
  • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
  • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

• the present invention relates to anti human HER2 (or HER2) monoclonal antibodies (mAbs) and nucleic acid sequences encoding them.
• the present invention relates to anti HER2 monoclonal antibodies with a high binding affinity, and a low dissociation rate, with regard to HER2.
• the anti HER2 antibodies of the present invention comprise fully human light and/or heavy chain variable regions derived from molecular evolution.
• compositions comprising the human antibodies, and therapeutic methods for using the human antibodies.
• HER2 Human Epidermal growth factor Receptor 2
• HER2/neu also known as HER2/neu, ErbB-2, CD340 and pi 85
• HER2/neu is a protein encoded encoded by the HER2/neu gene homologous to the epidermal growth factor receptor, which gives higher aggressiveness in breast cancers (Dank M, 2001, Orv Hetil 142(46):2563-8).
• HER2 is a member of the ErbB protein family or epidermal growth factor receptor (EGFR) of four structurally related transmembrane receptor tyrosine kinases that regulates cell growth, survival and differentiation via multiple signal transduction pathways.
• This family includes ErbB-1 (also named epidermal growth factor receptor, EGFR), ErbB-2 (also named HER2 in humans and neu in rodents), ErbB-3 (also named HER3) and ErbB-4 (also named HER4) (Yeon CH, Pegram MD, 2005, Invest New Drugs, 23(5):391-409).
• ErbB signaling in humans is associated with the development of neuron degenerative diseases, such as multiple sclerosis and Alzheimer's Diseases (Bublil EM and Yarden Y, 2007, Curr Opin Cell Biol, 19 (2): 124-134).
• loss of signaling by any member of the ErbB family results in embryonic lethality with defects in organs including the lungs, skin, heart, and brain.
• Excessive ErbB signaling is associated with the development of a wide variety of types of solid tumor. ErbB-1 and ErbB-2 are found in many human cancers, and their excessive signaling may be critical factors in the development and malignancy of these tumors (Cho HS and Leahy DJ, 2002, Science 297 (5585): 1330-1333).
• HER2 is a cell membrane surface-bound receptor tyrosine kinase and is normally involved in the signal transduction pathways leading to cell growth and differentiation. It is encoded within the genome by HER2/neu, a known proto-oncogene. HER2 is thought to be an orphan receptor, with none of the EGF family of ligands able to activate it. However, ErbB receptors dimerise on ligand binding, and HER2 is the preferential dimerisation partner of other members of the ErbB family (Olayioye MA, 2001, Breast Cancer Res, 3 (6): 385-389).
• the HER2 gene is a proto-oncogene located at the long arm of human chromosome 17(17q21-q22) (Coussens L, et al, 1985,. Science, 230 (4730): 1132-1139). HER2 and cancer
• Amplification of the HER2 gene occurs in 20-25% of human breast cancers. This amplification event is an independent adverse prognostic factor as well as a predictive factor for increased response to doxorubicin-based combination chemotherapy, response to trastuzumab and decreased response to hormonal therapy (Yeon CH, Pegram MD, 2005, Invest New Drugs.23(5): 391-409). Overexpression of this receptor in breast cancer is associated with increased disease recurrence and worse prognosis. Because of its prognostic role as well as its ability to predict response to trastuzumab (Herceptin US brand name) (see below), breast tumors are routinely checked for overexpression of HER2/neu.
• Overexpression also occurs in other cancer such as ovarian cancer, stomach cancer, and biologically aggressive forms of uterine cancer, such as uterine serous endometrial carcinoma (Santin AD, et al, 2008, Int J Gynaecol Obstet, 102 (2): 128-31).
• the oncogene was later found to code for EGFR.
• Gene cloning showed that neu, HER2, and ErbB2 are the same.
• HER2 is genetically closely linked and so co-amplified with the gene GRB7, which is also a proto-oncogene (active in, e.g., breast cancer, testicular germ cell tumor, gastric cancer, and esophageal cancer). It is revealed that patients with ER+ HER2+ compared with ER- HER2+ breast cancers may actually benefit more from drugs that inhibit the PI3K/AKT molecular pathway (Estrogen Receptor Status of HER2+ Breast Cancer Correlates With Response to Anti-HER Therapies. Science Daily, May 6, 2010). HER2 is known to form clusters which might play a role in tumorigenesis (Nagy P, et al, 1999, J Cell Sci. 112, 1733-1741; Rainer Kaufmann, et al, 2010, J Microscopy, doi: 10.1111/j. l365-2818.2010.03436.x ).
• the HER2 gene is overexpressed or amplified in approximately 30% of breast cancers. Breast cancer patients with HER2 overexpression or amplification have shortened disease-free and overall survivals.
• the HER2 protein is thought to be a unique and useful target for antibody therapy of cancers overexpressing the HER2 gene.
• trastuzumab Herceptin, developed by Genentech
• this antibody has significant anti-tumor activity as a single agent and has synergy with certain chemotherapeutic drugs (Yeon CH, Pegram MD, 2005, Invest New Drugs, 23(5):391-409).
• Herceptin has demonstrated activity in clinical trials in women with metastatic breast cancer overexpressing HER2.
• the mechanisms of the action of this antibody involve disruption of DNA repair and induction of antibody- dependent cellular cytotoxicity (Dank M, 2001, Orv Hetil, 142(46): 2563-8).
• trastuzumab is effective only in cancers where the HER2/neu receptor is overexpressed.
• One of the mechanisms of how trastuzumab works after it binds to HER2 is by increasing p27, a protein that halts cell proliferation (XF Le, Franz Pruefer, Robert Bast, 2005, Cell Cycle, 4 (1): 87-95).
• HER2 gene Overexpression of the HER2 gene can be suppressed by the amplification of other genes and the use of the drug Herceptin. Research is currently being conducted to discover which disregulated genes may have this desired effect.
• HER2 ERBB2 protein is regulated by estrogen receptors. Furthermore, estradiol and tamoxifen acting through the estrogen receptor normally down-regulates the expression of HER2 ERBB2. However, when the ratio of the coactivator AIB-3 exceeds that of the corepressor PAX2, the expression of HER2 ERBB2 is upregulated in the presence of tamoxifen, leading to tamoxifen-resistant breast cancer (Hurtado A, et al. 2008, Nature, 456 (7222): 663-666).
• Herceptin A monoclonal antibody anti-HER2, Herceptin, has been successfully used in therapy for malignant cancers relating to this target, which was approved by FDA in 1998 for the treatment of HER2 overexpressing breast cancer. Herceptin is also being studied for use with other cancers (Loredana Vecchione, et al.k 2009, Expert Opinion on Investigational Drugs, 18(7):945-955). It has been used with some success in women with uterine papillary serous carcinomas that overexpress HER2/neu (Santin AD, et al, 2008, Int J Gynaecol Obstet, 102 (2): 128-31).
• Pertuzumab Another monoclonal antibody, Pertuzumab (de Bono, et al., 2007, J Clin Onco, 25(3): 257-262), which inhibits dimerization of HER2 and HER3 receptors, is in advanced clinical trials.
• Pertuzumab also called h2C4, trade name Omnitarg
• HER dimerization inhibitors By binding to HER2, it inhibits the dimerization of HER2 with other HER receptors, which is hypothesized to result in slowed tumor growth.
• Pertuzumab is currently being developed by Genentech. Early clinical trials of pertuzumab in prostate, breast, and ovarian cancers have been met with limited success.
• the anti-HER2 antibody therapies have involved the administration of a therapeutic anti-HER2 antibody either alone or in conjunction with a second radiolabeled anti-HER2 antibody, or a chemotherapeutic agent.
• FDA has approved the therapeutic use of one such anti-HER2 antibody, Herceptin for use in HER2 overexpressing breast cancer.
• HER2 is an important target for antibody-based therapy to control or kill HER2 positive cells involved in cancers.
• the expression of HER2 on tumor cells, e.g., breast cancer makes it an important target for antibody-based therapy to specifically target therapeutic agents against HER2 -positive cancer cells.
• HER2 is a useful target for immunotherapy for breast cancer, they also show that currently available humanized antibodies do not constitute ideal therapeutic agents because of their HAMA or HACA reaction, massive doses up to 440mg/dosage and frequent injection because of the relatively short interval between the injections.
• Pegylation is a very powerful tool to improve protein characteristics.
• the covalent attachment of PEG to a drug or therapeutic protein can "mask" the agent from the host's immune system (reduced immunogenicity and antigenicity), increase the hydrodynamic size in solution of the agent which prolongs its circulatory time by reducing renal clearance.
• PEGylation can also provide water solubility to hydrophobic drugs and proteins. PEGylation can be used in improvement of monoclonal antibodies, expecially scFv, Fab formates characterized with short half life.
• anti HER2 mAbs that have a high binding affinity and low dissociation constant such that the treated breast cancer patients do not relapse, and do not cause or have a reduced potential to cause a HAMA or HACA reaction when administered to patients who are not immunosuppressed, and that have a prolonged half life in circulation to extend the time interval between the injections and lower cost.
• HER2 mAb molecule (abbreviated as anti HER2 mAb in the following) and nucleic acid sequences encoding the said molecule are provided.
• the molecules of the present invention are of a high binding affinity and a low dissociation rate with regard to HER2.
• both light and/or heavy chains of the said antibody molecules are preferably fully human eventhough chimeric or humanized can be alternatives as fully human antibody molecules can avoid many side effects, such as those caused by HAMA and HACA, when used in human.
• the present invention provides compositions comprising anti HER2 mAb, wherein the molecule comprises: a) a complete or an incomplete light chain comprising a variable region and Fc or a part of it, wherein the light chain consists of amino acid sequence as set forth in SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7, and b) a complete or an incomplete heavy chain comprising a variable region and Fc or a part of it, wherein the heavy chain consists of amino acid sequence as set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8
• the said anti HER2 mAb comprises a light chain and a heavy chain.
• the said light chain comprises a region comprising the amino acid sequence selected from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 5 or SEQ ID NO: 7;
• the said heavy chain comprises a region comprising amino acid sequence selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8.
• the preferred anti HER2 mAb comprises fully human Fc region and frameworks, and fully human variable light and/or heavy variable regions obtained via molecular evolution.
• the frameworks for both light and heavy chains are all fully human, wherein the frameworks are selected from human IgA, IgD, IgE, IgG or IgM, preferably the frameworks from human IgGl, and most preferably from IgGlK.
• the Fc regions of both light and heavy chains are all fully human, wherein the Fc regions are selected from isotypes human IgA, IgD, IgE, IgG or IgM, preferably the Fc regions are from human IgGl .
• the said antibody molecule in the present invention could be a naive or altered (e.g., mutated) Fc region.
• the said Fc region could be altered to reduce or enhance the effector functions of the antibody with methods including but not limited to those disclosed in many publications such as Kabat, EA, et al, 1991, Sequences of proteins of immunological interest, 5th ed. U.S. Department of Health and Human Services, Nat Inst Health, Bethesda, Md.
• the fully human frameworks and Fc regions are obtained directly or indirectly from human.
• the said direct methods include but are not limited to those involving genomic DNA cloning, cDNA, cDNA library.
• the said indirect methods include but are not limited to a partial or de novo fully DNA synthesis based on bioinformation including but not limieted to GenBank or publications, and DNA synthesis technologies including but are not limited to PCR-based DNA synthesis methods.
• the anti HER2 antibody molecule comprises a full length molecule or a fragment of it (e.g., Fv, Fab, F(ab') 2 , etc.). In particular embodiments, the anti HER2 antibody molecule comprises a single domain (or CDR), single chain Fv, Fab, or F(ab) 2 , etc.
• the anti HER2 antibody molecule can be chemically modified with PEG to prolong its half life in circulation.
• PEGylation can be achieved by activation of a single cysteine residue in a truncated hinge region of the scFv or Fab, Fab' 2 , followed by reaction with (PEG)-lysyl maleimide as described in Chapman AP, et al, 1999, Nature Biotechnology 17, 780-783.
• the other alternatiable methods can be seen indetail in many publications, such as Knight DM, et al, 2004, Platelets 15 (7): 409-18.
• the anti HER2 antibody molecule comprises a Fab molecule comprising a light chain and a heavy chain, wherein the light chain consists of amino acid sequence selected from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7; and the heavy chain consists of amino acid sequence selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8.
• the anti HER2 antibody molecule comprises a Fab and further comprises a complete Fc region forming a full length mAb molecule or further comprises a part of a Fc fragment to form an incomplete full length mAb molecule.
• the anti HER2 antibody molecule comprises an antibody.
• the Fc region should have complement dependent cytotoxicity (CDC) and antibody-dependent cell mediated cytotoxicity (ADCC) functions. These functions can be modified by amino acid substitutions to reduce or abolish or enhance these effector functions.
• CDC complement dependent cytotoxicity
• ADCC antibody-dependent cell mediated cytotoxicity
• the anti HER2 antibody molecules are expressed in a eukaryotic, or prokaryotic host cell.
• the nucleic acid sequence encoding the light and/or heavy chain is contained within a plasmid or other expression vector.
• the present invention provides methods for treating a disease.
• the methods comprise: (1) a composition consisting of the said anti HER2 antibody molecule of the present invention; and (2) administration of the composition to the subject.
• the subject is a patient with symptoms of the disease such that the symptoms are reduced or eliminated.
• the disease is selected from the group consisting of: (1) HER2 -positive breast cancer. (2) endometrial HER2 -positive carcinoma, gastric cancer.
• Fig. 1 is a schematic representation of a Fab expression vector pCOMb3M, where Plac is the promoter for expression in E. coli, ompA and pelB are sequences coding signal peptides, GPIII is the coding sequence of phage tail protein GPIII. MCS1 and MCS2 are cloning sites for light and heavy chain of a Fab molecule.
• Fig. 2 is a schematic representation of construction of pGP6C, the expression vector for full-length antibody production in mammalian cells such as CHO and HEK293 with double expression cassettes.
• mammalian cells such as CHO and HEK293 with double expression cassettes.
• an expression vector with double expression cassettes was constructed based on the following procedure. (1).
• a PCR-based gene synthesis (Xiong AS, et al., 2004, NAR,32(12):e98.)was used to synthesize a constant region (CL) of human IgGl light chain according to the sequence data obtained from GenBank Accession No.AB608262.1, and a multi-cloning site containing the following restriction sites (Pstl/Nhel/Bglll/EcoPJ/EcoRV/XhoI) added to its 5 '-end and a 22bp fragment of the 3 '-end of SV40 poly A signal added to its 3 '-end (abbreviated as pASV40) for amplification of and integration with pA SV 4o fragment from pCi-Neo.
• P3(ttccctttagtgagggttaatg, primer for pA SV 4o 5 '-end) and P4(ccggatcgatccttatcggattt/ACCACATTT GTAGAGGTTTTACTTG, primer for Pcmv3'-end and pA S v4o 5'-end) were used to amplify pA SV 4o fragment with pCi-Neo as template, the amplified fragment is 295 bp in length.
• Pl(ctgcag(PstI) gctagcagatctgaattcgatatcc tcgag, a primer for multi cloning site and 5 '-end of CL) and P4 were used to integrate the above fragment via overlapping PCR to form MCS-CL-pA structure.
• the length is 618 bps.
• This structure was inserted into phCMVl at Pstl pnl sites, and formed an expression vector with two expression cassettes in which a constant region for human IgGl ( ⁇ ) was pre-installed in the first cassette.
• a constant region for human IgGl ⁇
• CH human ⁇ chain
• Fig. 3 is a graph comparing the affinity of Fab molecules after evolution from their prototypes, their positive and negative controls as determined by Friguet method.
• Fig.3(A) is the affinity data of A2D5, B5F4, C3A6 E5D2, F2G6 and their prototype E3F2, the in-house made positive h4D5Fab.
• Fig. 3(B) is the affinity data of A6E7, B2F7, D3E5, F5E2, H2D3 and their prototype Fab molecule G6E7, the in-house made positive control h2C4. The data were obtained via the described methods as above and the results were shown.
• Fig. 4 is a graph comparing the affinity of F2G6F, H2D3F and their corresponding positive controls h4D5F and h2C4F.
• Fig. 5 shows the dissociation rate of of both F2G6F and H2D3F from HER2 were significantly lower than that of their corresponding positive control h4D5 and h2C4.
• Fig. 6 shows the inhibition of anti HER2 antibodies F2G6F, H2D3F, h4D5F and h2C4F and negative control C2B8 on tumour growth in immunodeficient mice inoculated with SKBR3 cells.
• Fig. 7 showes the CDC functions of the antibodies h4D5F, F2G6F, h2C4F, H2D3F (with C2B8 as negative control) on HER2 -positive cell line SKBR3 and HER2 -negative cell line A431.
• a set concentration of the said antibodies was applied.
• the target and control cells were incubated for 2 or 6 hours with the said antibodies at a concentration of 3 or l( ⁇ g/ml in the absence or the presence of human serum as a source of complement.
• Fig. 8 is the illustration of the ability of anti HER2 Antibodies on HER2-positive (SKBR3) and HER2 -negative (A431) cells with C2B8 as the negative control. All anti HER2 antibodies possesed ADCC effect on SKBR3, but no effect on A431(data not shown here). C2B8 possesed no effects on both SKBR3 and A431 cells.
• the present invention provides anti HER2 mAb molecules and nucleic acid sequences encoding anti HER2 mAb molecules.
• the present invention provides anti HER2 mAb molecules with a high binding affinity, and a low dissociation rate, with regard to HER2.
• the anti HER2 mAb molecules of the present invention comprise light and/or heavy chain variable regions with fully human frameworks. The description of the invention is divided into the following sections below for convenience: I. anti HER2 mAb molecules; II. Generating anti HER2 mAb molecules; III. Therapeutic Formulations and Uses; and IV. Additional anti HER2 mAb molecule Uses.
• Monoclonal antibodies of the invention can be produced by a variety of techniques, including but not limited to the standard hybridoma technique published by Kohler and Milstein (1975). Although this procedure is preferred in principle, other techniques for producing monoclonal antibody can be employed, e.g. transgenic mice or antibody library techniques. Hybridoma technology in mouse has been very well established. Immunization and Fusion partners were well understood in the art. But the monoclonal antibodies produced by murine or other non-human hybridoma can trigger HAMA reactions that lead to side-effects for treating human. The chimeric or humanized monoclonal antibodies derived from these monoclonal antibodies are still able to trigger HACA reaction that will cause the similar, even though less than their prototype molecules, immunoreaction when used to treat human. Fully human hybridoma technology is still under development and not good enough for producing suitable monoclonal antibodies for treating human beings.
• a prototype Fab molecule with high affinity is panned out against HER2 from the above library, which is used as template for further affinity improvement through molecular evolution, to produce a candidate monoclonal antibody suitable for therapy.
• the molecular evolution technology in the present invention introduces mutation by PCR that comprises: (1) Key Amino Acids (KA) scanning was introduced to identify the sites of greatest interest and profitable for substitutional mutagenesis before artificial evolution to decrease non-interest mutations.
• KA scanning is a procedure to identify the amino acid sites that can produce interest mutations by generating all possible mutants on each individual amino acid site and testing their binding affinity. If affinity of a mutant with an amino acid mutation at a specific site is changed after mutation, this site can be identified as an interest substitutional site, and vice versa. Based on this scanning, interest and/or non-interest sites can be identified and clasified before mutation design by the aid of Alanine Scanning as described by Cunningham and Wells (Science, 1998, 244: 1081-1085).
• the target regions are CDRs of an antibody molecule, preferably CDR3 regions in both light and heavy chains.
• random mutagenesis is preferred to generate mutants saturated with all pssible 20 amino acids at each interest site.
• KA scanning should cover both target CDRs and their "flanking" amino acids to extend the interest residue category for generating mutants with improved affinity compared with their prototype or even positive control, such as Herceptin.
• the interest amino acid sites can be changed to a random amino acid or to a specific amino acid by methods well known in the art. Changes to the amino acid sequence may be generated by changing the nucleic acid sequence encoding the amino acid.
• a nucleic acid sequence encoding a mutant of a given CDR with one or more mutations may be prepared by methods well known in the art using the guidance of the present specification for particular sequences.
• the mutagenesis methods include, but are not limited to, site-directed (or oligonucleotide-mediated) mutagenesis, site-specific or random PCR mutagenesis, and cassette mutagenesis of an earlier prepared nucleic acid encoding the CDR.
• a preferred method for preparing substitution mutants is site-directed mutagenesis.
• PCR-based mutagenesis in which the mutated nucleotides are incorporated into the PCR primers such that the PCR product contains the mutations, is another preferred method for this purpose, see Vallette et al, (1989) NAR, 723-733 for details.
• the most preferred method in the present invention is random mutagenesis at the interest sites by PCR with the primers designed according to GCR method as described in detail in PCT/CN2009/074839 or other applicable techniques. More than one interest sites can be simutaneously substituted to a random single amino acid so that a mutant with multi random substitutions can be obtained.
• the CDRs may be numbered according to Kabat, EA, et al, 1991, as mentione above.
• anti HER2 mAb molecule in the present invention comprise a light and/or a heavy chain variable region integrated with fully human constant regions. It is not difficult for a person skilled in the art to understand that anti HER2 mAb molecules of the present invention will illicit very little or no immunogenic response when administered to a human to treat a disease.
• the anti HER2 mAb molecule in the present invention comprises further an Fc region, prefferably the Fc region is isolated directly from human germline or obtained through other procedures such as full length DNA synthesis, human genomic libraries, etc.
• the present invention provides anti HER2 mAb molecules with a high binding affinity (Kd) and a low dissociation rate (koff) with regard to HER2, and able to be effective at low concentrations. It is not difficult to understand for a person skilled in this art that an anti HER2 mAb molecule of the present invention, are particularly well suitabl for therapeutic use in humans and are less likely to trigger a HACA response than the humanized anti- HER2 molecules containing mouse components, such as Rituxan.
• the CDRs of the present invention may be integrated with any type of framework to form a functional scFv, Fab and/or further integrated a Fc region to form functional full length antibody molecule.
• the CDRs are used with fully human frameworks or framework sub-regions and Fc region in germline or modified format.
• Examples of fully human frameworks which may be used with the CDRs of the present invention include, but are not limited to, KOL, EWM, REI, EU, TUR, TEI, LAY and POM (See, (1) Kabat et al, 1991, as mentioned above, and (2) NIH, USA; and Wu et al, 1970, J Exp Med 132:211-250).
• an antibody or antibody fragment of the present invention can be made by recombinant expression of light and heavy chain genes in a host cell.
• the host cell can be a mammalian, yeast or bacterial cell.
• expression of the light and heavy chains can be achieved by transient expression or stable expression.
• Both expression strategies comprise transfection (for mammalian and yeast system) or transformation (for bacterial system) of a host cell with one or more expression vectors carrying DNA fragments encoding the immunoglobulin light and heavy chains of the antibody such that the light and heavy chains are expressed in the host cell, and preferably, secreted into the medium in which the host cell is cultured, from which medium the antibody can be recovered by well known methods such as chromatograph. Standard recombinant DNA methodologies have been know well to obtain antibody heavy and light chain genes, insert them into expression vectors and introduce the vectors into host cells for expression.
• the antibody molecules isolated by panning from the antibody library before and after molecular evolution are Fab-formated, which can be further converted into scFv, full length antibody or other formats without difficulty through well known genetic engineering techniques in the art.
• DNA fragments encoding the desired VH and VL segments in this invention are obtained by the methods described above, they can be further converted to full-length antibody light and heavy chain genes respectively, Fab fragment genes or scFv genes through standard DNA operation.
• the isolated DNA encoding the VL region can be integrated with a human light chain constant region gene.
• the light chain constant region is a ⁇ or ⁇ constant region, the most preferably the light constant region is a human ⁇ constant region.
• the isolated DNA encoding the VH region can be linked to a human heavy chain constant region gene that are in or out the expression vector.
• the heavy chain constant region can be selected from the follows, an IgG, IgA, IgE, IgM or IgD constant region, and preferably from IgGl to IgG4, most preferably an IgGl constant region ( ⁇ ) selected.
• the obtained VH- and VL-encoding DNA fragments which is obtained preferably by PCR from the above Fab molecule can be linked together via a linker encoding the amino acid sequence (Gly4)3 between the two fragments so that the VH and VL sequences can be expressed as a single-chain Fv protein molecule in Escherichia coli as described in McCafferty et al, 1990, Nature 348:552-554.
• the expression vectors comprises expression regulatory elements, such as promoter, enhancer and so on.
• the expression vector and expression control sequences should be compatible with the expression host cell.
• the genes coding light chain and heavy chain of an antibody can be inserted into two expression vectors separately or into the same expression vector by any applicable methods.
• the expression vector used herein may already have or have not the constant region sequences prior to insertion of the light and/or heavy chain variable sequences. If an antibody gene contains only variable region, an expression vector containing constant region should be used, and vice versa.
• the expression vectors further comprise: (1) a signal peptide coding sequence in each cassette, which facilitates secretion of the antibody chain from a host cell, (2) at least a replication origin, (3) one or more selectable marker genes, that facilitate selection of host cells into which the vector has been introduced.
• selectable marker gene confers resistance to drugs on a host cell, such as antibiotics for bacteria and G418, hygromycin or methotrexate, etc for mammalian and other host cells. All these information has been well known in the art.
• Preferred mammalian host cells for expressing the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO cells) with or without DHFR gene, HEK293. Production of antibodies is carried out by culturing host cells harbouring the expression vector (s) and subsequent purification procedure from the culture.
• Host cells can also be used to produce truncated fragments of an intact antibody in Fab or scFv format.
• bacteria such as E. coli, is preferred in the present invention even though mammalian or other host cells can be selected.
• Recovery and purification of the antibodies or antibody fragments in the present invention comprise: (1) The sample is first conditioned, or prepared for purification. Cells, cell debris, lipids, and clotted material are first removed, typically by centrifugation followed by filtration with a 0.45 ⁇ filter. (2) Chromatogragh, including but not limited to affinity, ion exchange, size exclution chromatography. In addition, ultrafiltration or dialysis can be helpful in some cases.
• the preferred purification in the present invention is approached by the aid of Protein A/G affinity capture before either cation exchange chromatography is used at a low enough pH that the desired antibody binds to the column while anions flow through, or anion exchange chromatography is used at a high enough pH that the desired antibody flows through the column while anions bind to it.
• Various proteins can also be separated out along with the anions based on their isoelectric point (pi).
• Size exclusion can be used to further polish the obtained raw material when needed.
• Anti HER2 mAb molecules of the present invention are useful for treating and diagnosing human diseases related to HER2.
• anti HER2 mAb molecules are administered to a patient with breast cancer or other HER2-related tumors or other diseases, and autoimmune diseases such as RA, SLE etc, as described in detail above.
• the radio lablels useful for this purpose include but are not limited to 131 I, 125 I, 99 Tc and 90 Y.
• the non-radio lablels useful for this purpose include but are not limited to an enzyme (i.e. HRP, AP, etc), a fluorescence dye, a toxin or others.
• the subject treat is not immunosuppressed (e.g. SLE, RA patient). While mechanism is still to be elucidate, it is believed that anti HER2 mAb molecules of the present invention are less likely to illicit a HACA response than previously known anti-HER2 antibodies, especially in non-immunosuppressed patients. As such, non-immunosuppressed patients can be treated without the overriding concern for an adverse HACA reaction.
• the mAb molecules in the present invention has improved binding ability so that lower doses may be used in treatment to achieved effective dosages, this further avoid the risk of a HACA response in addition to that conferred by its fully human structure.
• Anti HER2 mAb molecules of the present invention may be administered in combination with other anticancer therapies including but not limited to chemo- and radio-therapies, and in combination with some cytokines, such as G-CSF in certain other cases.
• other anticancer therapies including but not limited to chemo- and radio-therapies, and in combination with some cytokines, such as G-CSF in certain other cases.
• the anti HER2 mAb molecules of the invention can be incorporated into pharmaceutical compositions suitable for administration to a patient, which may comprise a HER2 binding molecule (e.g. an antibody or antibody fragment) and a pharmaceutically acceptable carrier such as solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
• a pharmaceutically acceptable carrier such as solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
• the acceptable carriers include one or more of the following: water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
• isotonic agents can be selected from sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride, and most preferably the isotonic agent is trehalose.
• the carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the said molecules.
• compositions of this invention may be in a variety of forms, such as injectable and infusible liquid solutions, dispersions or suspensions, etc.
• the preferred forms in this invention are injectable or infusible solutions.
• the anti HER2 antibody molecules of the present invention are useful for immunoassays which detect or quantify HER2 in a sample.
• An immunoassay is a biochemical test that measures the presence or concentration of a substance in solutions that frequently contain a complex mixture of substances.
• the other key feature of all immunoassays is a means to produce a measurable signal in response to a specific binding.
• most immunoassays today depend on the use of an analytical reagent that is associated with a detectable label.
• Such labels serve for detection and quantitation of binding events either after separating free and bound labeled reagents or by designing the system in such a way that a binding event effects a change in the signal produced by the label.
• the useful labels are selected from the follows radioactive elements used in radioimmunoassays; enzymes, fluorescent, phosphorescent, and chemiluminescent dyes; latex and magnetic particles; dye crystalites, gold, silver, and selenium colloidal particles; metal chelates; coenzymes; electroactive groups; oligonucleotides, stable radicals, and others.
• the preferred labels in the present invention are enzymes such as HRP and AP, and influorescent dyes, and the most preferred is enzymes such as HRP and AP.
• This example describes how an extra large fully human naive antibody library in Fab form was constructed.
• the Fab library in the present invention was constructed with blood samples of over 3000 individuals from different provinces and different nationalities based on the procedure disclosed in the following publications, and the procedure is described in detail after the publication lists.
• Peripheral blood mononuclear cells were isolated from mixed blood samples, 1ml each individual, by the aid of Lymphocyte Sepration Solution before total mRNA isolation with an mRNA isolation kit from Invitrogen or Roche.
• the mRNA sample was used in cDNA first chain synthesis proformed with a commercially available reverse transcription kit from GIBCO. All the steps were carried out according to mannufecturer's instruction.
• the primer sets shown in Table.1 were used(see Ref.2, 3 and 6).
• the primer sequences contain the certain restriction sites and protection bases for cloning.
• PCR amplification was performed in 100- ⁇ 1 reaction mixtures. Both sense and antisense primers were used at ImM. Twenty five cycles of PCR were performed as follows: denaturation at 94°C for 30 seconds, annealing at 50°C for 30 seconds, and polymerization at 72°C for lmin.
• the DNA coding for light chain gene was ligated into an expression vector, phagemid pCOMb3M (modified by adding restriction sites Sacl Hindlll/Xbal at the sites Sacl/Xbal of pCOMb3M for subseqiiential cloning of light and heavy chains, see GenBank Accession No. AF268280 for detailed seuquence, its structure sketch shown in Fig. 1).
• phagemid pCOMb3M modified by adding restriction sites Sacl Hindlll/Xbal at the sites Sacl/Xbal of pCOMb3M for subseqiiential cloning of light and heavy chains, see GenBank Accession No. AF268280 for detailed seuquence, its structure sketch shown in Fig. 1).
• the DNA coding Fd heavy-chain was ligated into pCOMb3M in which the light-chain gene was pre-installed to form pCOMb3M/Fab.
• the ligated phagemid DNA was separated from the unligated DNA by electrophoresis on 1.2% agar and recovered by the aid of QIAEX Gel Extraction Kit (QIAGEN, and stored in sterile pure water for use. The DNA must be completely free of salt prior to electroporation.
• the recombinant DNA was introduced into E. coli strain TGI by electroporation.
• Freshly innoculated E. coli strain TGI was cultured with shaking at 250 rpm until an A600 of 0.5-0.7 is achieved (approximately 2-2.5 hours). Then, the cells were washed twice with ice-cold sterile ImM HEPES (pH7.0) containing 10% glycol before dispensing in ⁇ aliquots and proceed to the electroporation.
• a Bio-Rad Gene Pulser was programmed to give 25 ⁇ , 2.5kV at 200ohms to ⁇ of prechilled cells on ice in a pre-chilled 0.2cm cuvette. A hundred ng of pCOMb3M Fab DNA in 2 ⁇ 1 prechilled pure water was added into the cuvette and pulse once.
• the obtained time constant is between 4.5-5msec.
• the cells were immediately resuspended in 1ml of fresh LB-G or 2 X YT-G medium.
• Ten identical samples were made by repeating the above procedure and the mix of the ten repeats was cultured in a 50-ml culture tube containing 6 ml of ampicillin-free 2 X YT-G medium for 1 hour at 37°C with shaking at 250 rpm. After cultured at the conditions as above, 75 ⁇ of 20mg/ml Ampicillin and 6 X 10 12 pfu of M13K07 were added to rescue the pCOMb3M Fab phagemid from the transformed E. coli TGI cells. The supernatant containing phagemid particles was collected after centrifuging at 1000 X g for 20minutes.
• Humanized HER2 was used to pan an aliquot of the above HuLib with in-house made humanized h4D5 Fab and humanized h2C4 Fab as the positive controls, and C2B8 Fab as negative control.
• Humanized h4D5 is the prototype of Herceptin
• h2C4 is the prototype of Pertuzumab.
• h4D5 and h2C4 recognizes different epitopes of human HER2.
• the panning procedure was summarized as follows:
• a liquot of the HuLib was added to a 25 -ml cell culture squre bottle precoated with recombinant HER2 protein by conventional methods, and incubated for 1 hour at 37°C. After twenty washes with PBS containing 1% Tween-20, 1 ml of TGI cells at log phase was added and cultured for 16 hours at 37° C with shaking. The supernatant was transferred to a new 50ml tube and spined at 12000rpm for lOmins. 500 ⁇ 1 of the supernatant was taken as an aliquot to repeat the above panning procedure, and four cycles of panning were repeatedly processed.
• the bacterial cell suspension was diluted to lOOOOOcells/ml, then spreaded on a 1.5% agar plate containing 0.1% Ampicillin to obtain single colonies. Then ten 96-deep-well plates, containing 0.25ml LB with Amp in each well, were inoculated with the above single colonies, a single colony each well, and cultured at 37° C for 16 hours with vigorous shaking. Then the plates were spinned at 5000rpm for 20mins, and the supernatant in each well was transferred into ten new 96-deep-well plates and stored at 4°C for use.
• E3F2 and D6C2 were competive to h4D5, and G6E7 to h2C4 with very high affinity.
• the dissociation constant (Kd) value of E3F2, D6C2 and G6E7 were 2379, 2783 and 1876 pM as revealed by affinity assay according to Friguent et al. (Friguet, B. et al., 1985, J. Immunol. Methods, 77:305-319). E3F2 and G6E7 were selected as the prototype for molecular evolution.
• amino acid sequences deduced from obtained DNA sequencing data were set forth in SEQ ID NO. l for Fab light chain and SEQ ID NO.2 for the heavy chain of E3F2, and set forth in SEQ ID NO.3 for Fab light chain and SEQ ID NO.4 for Fab heavy chain of G6E7.
• N means A, T, C or G.
• This sequence was integrated with its flanking sequences at 5'- and 3 '-end, and formed the following fragment:
• This sequence codes light CDR1 of E3F2 with random mutation at preferred residues and framework flanking this CDR.
• DNA Fragments with preferred mutations for other CDRs were designed and jointed with their flanking frame sequences by a method such as overlapping PCR known well in the art.. The fragments were further jointed together to form sequences coding Fab light and/or heavy chain by overlapping PCR well known in this art.
• the Fab sublibrary was constructed by insertion Fab light and heavy chain coding sequences into the vector pCOMb3M and introduced into E. coli TGI by electroporation as described in Example 1. After four rounds of panning against HER2 as described in Example 2, 176 Fab clones with OD value over the positive control h4D5 Fab were obtained, and among them the clones A2D5, B5F4, C3A6, E5D2 and F2G6 were of the highest OD values, and 145 Fab clones with OD value over the positive control h2C4 Fab were obtained and among them the clones A6E7, B2F7, D3E5, F5E2 and H2D3 were of the highest OD values as shown in Fig. 3(A) and (B), and the affinity of the best clones F2G6 and H2D3 was measured, this would be described in the following examples.
• amino acid sequences deduced from obtained DNA sequencing data were set forth in SEQ ID NO.5 for the Fab light chain and SEQ ID NO.6 for the Fab heavy chain of F2G6, and SEQ ID NO.7 for the Fab light chain and SEQ ID NO.8 for the Fab heavy chain of H2D3.
• Full length protein of both F2G6 and H2D3 antibody was expressed in CHO DG44 cell by integration of the expression vector pGP6C (see Fig. 2 for details) into the host genome.
• the preparation of full length F2G6 will be taken as an example to describe the procedure in detail.
• the heavy and light chain variable regions of F2G6 Fab molecule were cloned in the double cassette expression vector pGP6C, in which constant regions, Kozak and signal pepetide coding sequences were pre-installed.
• pGP6C F2G6F The above recombinant construct, called as pGP6C F2G6F, was transiently transfected in DG44 cells to check the constructs for proper production of F2G6 antibody, and shown normal expression.
• linerized vector plasmid was prepared for stable transfection by digesting pGP6C/F2G6F with a unique restriction enzyme, Kpn2I, cutting outside regions vital for expression.
• DHFR-negative DG44 host cells Three transfections of DHFR-negative DG44 host cells, whic pre-adapted to serum-free suspension culture, were performed by electroporation with the above linear plasmid. Following transfection, the cells were subsequently subjected to a serial of single-round methotrexate selection at 0.50mg/L G418 concentration, two weeks each round, before distributed into 96-wells plates and incubated. Selective medium (containing 5% dialysed fetal calf serum and an appropriate G418 level) was added and the plates were monitored to determine when the non-transfected cells died to leave foci of transfected cells. The transfected plates were incubated for approximately four weeks to allow colony formation.
• Selective medium containing 5% dialysed fetal calf serum and an appropriate G418 level
• the resultant colonies were examined microscopically to verify that the colonies were of a suitable size for assay (>60% of the bottom of the well), and that only one colony was present in each well.
• Cell supernatants from 960 transfectants were screened for assembled antibody by IgG ⁇ ELISA, and 82 transfectants with relatively high expression level were selected for progression and further assessment in static culture.
• Cultures of the selected cell lines were expanded in suspension culture in serum-free EX302 (provided by JRH) without adaptation, and a further assessment of productivity was undertaken with ELISA and measurement of cell growth rate. Based upon harvest antibody concentration (by ELISA) and acceptable growth characteristics, two of the highest ranking cell lines were selected for assessment of the productivity in batch shake flask suspension culture in EX302. Both cell lines produced F2G6 full antibody (denoted F2G6F) in good yields in the range of from 17.1 ⁇ 20.2 pg/cell/day as determined by protein A HPLC.
• Total mR A was isolated from the above two clones by the aid of mR A Isolation Kit from Invitrogen, and reversely transcripted by conventional method with oligo-dT15 to obtain cDNA which was cloned into pUC57.
• the positive clones identified by the aid of colony PCR. were sequenced by the conventional sequencing method. The results showed that both clones were full in length for both their light and heavy chain coding sequence, and the deduced amino acid sequences for both light and heavy chain were identical to that of expected.
• the antigen binding affinities of variants A2D5, B5F4, C3A6 E5D2, F2G6 and their prototype E3F2 were determined with HER2 as antigen by ELISA, using in-house made h4D5Fab as the control. The same work was carried out for A6E7, B2F7, D3E5, F5E2 and H2D3 and their prototype G6E7.
• F2G6 and H2D3 were the best clones with different epitopes on HER2 and was selected as the candidate for further biological activity tests to evaluate their potentiality in clinical therapy.
• Fig.3(A) is the affinity data of A2D5, B5F4, C3A6 E5D2, F2G6 and their prototype E3F2, the in-house made positive h4D5Fab.
• affinity of F2G6 was greatly improved after evolution compared with both its prototype E3F2 and positive control h4D5Fab.
• the results of this improvement on biological functions will be tested in the following experiments. The negative control showed no binding and was not shown in the figure.
• Fig. 3(B) is the affinity data of A6E7, B2F7, D3E5, F5E2, H2D3 and their prototype Fab molecule G6E7, the in-house made positive control h2C4. The data were obtained via the described methods as above and the results were shown.
• SKBR3 cells in 1ml were incubated in the presence of azide/2DOG for 2 hours at 37°C with 2 ⁇ g/ml 125 I-labelled mAbs to achieve maximum binding. Following centrifugation at 3000 rpm for 1.5 min, the supernatant was removed, the pellet quickly resuspended in 1ml medium, and immediately transferred to 9ml medium at 37°C in a 15ml conical tube and mixed well. At various times over the next 2 hours, 0.4 ml samples were removed and separated on phthalate oils to determine the level of radiolabeled mAbs remaining on the cell surface. As shown in Fig.5, dissociation rates of both F2G6F and H2D3F from HER2 were significantly lower than that of their corresponding positive control h4D5 and h2C4.
• Example 6 Apopotosis Induction
• the target cell line was HER2 positive cell line SKBR3; the negative control was C2B8 Fab and positive controls were h4D5Fab and h2C4Fab.
• SKBR3 was induced to apoptoses. Five to seven days after adding antibodies, the cells were accounted and conducted for MTT assay. The results were listed in Table 2.
• Immunodeficient mice were inoculated with SKBR3 cell at 5 X 10 6 cells/mouse by subcutaneous injection.
• F2G6F and H2D3F developed in the present invention, positive control h4D5F and h2C4F, and negative control C2B8F were subcutaneously injected while the tumour size reached 0.3 X 0.3 X 0.3 cm or above at the tenth day with dosing at 5mg each animal.
• the tumour size was measured respectively. The results were shown in Fig.6.
• HER2 -positive cell line SKBR3 and HER2 -negative cell line A431 were used to test the CDC functions of the antibodies h4D5F, F2G6F, h2C4F, H2D3F with C2B8 as negative control antibody.
• Target and control cells were detached from culture dishes with a cell dissociation solution (Sigma) and transferred to round-bottom 96-well plates (2 ⁇ 10 4 cells per well).
• cells were incubated at 37° C with human serum. Cultures were performed in triplicate in a final volume of 200 ⁇ 1. Controls and target cells incubated in the absence of effector, or in the presence of either serum or immunoagent alone.
• Tumour cell lysis was determined by measuring the release of lactate dehydrogenase (LDH) using a LDH detection kit (Roche). CDC were calculated as the percent of cytolysis measured in the presence of human serum, taking as 100% the maximal LDH release determined by lysis of target cells with 1% Triton X-100.
• LDH lactate dehydrogenase
• a set concentration of the said antibodies was applied.
• the target and control cells were incubated for 2 or 6 hours with the said antibodies at a concentration of 3 or l( ⁇ g/ml in the absence or the presence of human serum as a source of complement.
• F2G6F and H2D3F were found to effectively lyse SKBR3 cells in the presence of serum with an average specific lysis of 65% after 2 hours, and increased to around 80% after additional 4 hours of incubation, but less than 50% for the positive control h2C4F.
• Humanized 4D5F- and C2B8-induced CDC was not observed.
• Target SKBR3 and control A431 cells were detached from culture dishes with a cell dissociation solution (Sigma) and transferred to round-bottom 96-well plates (2 ⁇ 10 4 cells per well).
• target or control cells were treated with the immunoagents (3 (3 ⁇ 4/ml of serum-free medium) and freshly prepared peripheral blood lymphocytes (PBL) at 37° C for 3 to 4 hours. Cultures were performed in triplicate in a final volume of 200 ⁇ 1. Controls and target cells incubated in the absence of effector, or in the presence of either serum or immunoagent alone.
• Tumour cell lysis was determined by measuring the release of lactate dehydrogenase (LDH) using a LDH detection kit (Roche).
• ADCC were calculated as the percent of cytolysis measured in the presence of immunoagent and PBL or human serum, taking as 100% the maximal LDH release determined by lysis of target cells with 1% Triton X-100.
• SKBR3 and A431 cells were incubated for 3 hours with increasing amounts of effector PBL in the absence or in the presence of h4D5F, F2G6F, h2C4F, H2D3F and positive contol C2B8 (3 ⁇ /ml).
• F2G6F effectively lysed SKBR3 target cells in the presence of PBL.
• the extent of lysis reached almost 100% of treated cells, whereas h4D5F, used as a positive control, induced about 60% lysis.
• the basal level of cytotoxicity was measured in the presence of PBL (see Fig.8) or F2G6F alone (data not shown). No effects were detected in parallel assays carried out with HER2 -negative cell A431 (data not shown), or when F2G6F was replaced by the parental F2G6 Fab, lacking the Fc domain (see Fig.8).

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Genetics & Genomics (AREA)
• Biochemistry (AREA)
• Immunology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Oncology (AREA)
• Biophysics (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=46183906

Family Applications (1)

Country Status (2)

Cited By (1)

Families Citing this family (4)

Citations (3)

Family Cites Families (1)

• 2011
  • 2011-11-21 CN CN201110371657.5A patent/CN102492039B/zh active Active
  • 2011-12-29 WO PCT/CN2011/084950 patent/WO2013075382A1/en active Application Filing

Patent Citations (3)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events