WO2013007052A1

WO2013007052A1 - Fully human antibodies against human cd20

Info

Publication number: WO2013007052A1
Application number: PCT/CN2011/078190
Authority: WO
Inventors: Qingfa Liu
Original assignee: Qingfa Liu
Priority date: 2011-07-13
Filing date: 2011-08-10
Publication date: 2013-01-17
Also published as: CN102875678B; CA2857369A1; CN102875678A

Abstract

The present invention discloses anti human CD20 (hCD20) monoclonal antibodies and nucleic acid sequences encoding them. Preferably, the anti hCD20 antibodies of the present invention comprise fully human light and/or heavy chain variable regions derived from molecular evolution. Also disclosed are potentiality of pharmaceutical compositions comprising the human antibodies in human disease treatment and therapeutic methods for using the human antibodies.

Description

FULLY HUMAN ANTIBODIES AGAINST HUMAN CD20

FIELD OF THE INVENTION

The present invention relates to anti human CD20 (or hCD20) monoclonal antibodies (mAbs) and nucleic acid sequences encoding them. In particular, the present invention relates to anti CD20 monoclonal antibodies with a high binding affinity, and a low dissociation rate, with regard to CD20. Preferably, the anti CD20 antibodies of the present invention comprise fully human light and/or heavy chain variable regions derived from molecular evolution.

Also disclosed are pharmaceutical compositions comprising the human antibodies, and therapeutic methods for using the human antibodies.

BACKGROUND OF THE INVENTION

The CD20 protein, also called as human B-lymphocyte-restricted differentiation antigen or Bp35, is a non-glycosylated hydrophobic transmembrane phosphoprotein with a molecular weight of approximately 35kD expressed on the surface of all mature B-cells encoded by the MS4A1 gene (Valentine et al, 1989, J Biol Chem 264(19): 11282-11287; and Einfield et al, 1988, EMBO J 7(3):711-717).

In humans CD20 is expressed on all stages of B cell development except the first and last; it is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells (Bona C, et al, 1996, Textbook of Immunology. Martin Soohoo (2 edition). CRC Press p.102. ISBN 9783718605965). It has been believed that it may regulate a step in the B-cell activation process which is required for cell cycle initiation and differentiation and plays an important role in the development and differentiation of B-cells into plasma cells. It is found on B-cell lymphomas, hairy cell leukemia, and B-cell chronic lymphocytic leukemia. It is also found on skin/melanoma cancer stem cells (Fang D, et al., 2005, Cancer Res. 65 (20): 9328-37). CD20 is found on the surface of greater than 90% of B cells from peripheral blood or lymphoid organs and is expressed during early pre-B cell development and remains until plasma cell differentiation. CD20 is present on both normal B cells as well as malignant B cells. In particular, CD20 is expressed on greater than 90% of B cell non-Hodgkin's lymphomas (NHL) (Anderson, et al (1984) Blood 63(6): 1424-1433), but is not found on hematopoietic stem cells, pro-B cells, normal plasma cells, or other normal tissues (Tedder et al, 1985, J Immunol, 135(2):973-979).

B cells are lymphocytes that play a large role in the humoral immune response (as opposed to the cell-mediated immune response, which is governed by T cells). The principal functions of B cells are to make antibodies against antigens, perform the role of antigen-presenting cells (APCs) and eventually develop into memory B cells after activation by antigen interaction. B cells are an essential component of the adaptive immune system.

Another important aspect, as noted, is that it does not shed, modulate, or internalize (Cragg MS, et al., 2005, Curr Dir Autoimmun 8: 140-74). All these backgrounds lead to that it is appealing for targeted therapy.

Several monoclonal antibodies against hCD20 have been successfully used in therapy for malignant cancers relating to the target, such as rituximab, Ibritumomab tiuxetan, and tositumomab, which are all active agents in the treatment of all B cell lymphomas and leukemias. The anti-CD20 mAB Ofatumumab (developed by GenMab) was approved by FDA in Oct 2009 for Chronic lymphocytic leukemia. Additional anti-CD20 antibody therapeutics under development (phase II or III clinical trials in 2008) includes AME-133v (by Applied Molecular Evolution) and IMMU-106 (veltuzumab) (Morrow KJ, Methods for Maximizing Antibody Yields. Genetic Engineering & Biotechnology News (Mary Ann Liebert, Inc.): p. 36). Rituximab, sold under the trade names Rituxan and MabThera, is a genetically engineered chimeric murine/human monoclonal IgGl kappa antibody directed against hCD20 antigen. Rituximab has an approximate molecular weight of 145kD with a binding affinity for hCD20 antigen of approximately 8.0nM, and it can therefore destroy B cells efficiently.

The anti-CD20 antibody therapies have involved the administration of a therapeutic anti-CD20 antibody either alone or in conjunction with a second radiolabeled anti-CD20 antibody, or a chemotherapeutic agent. FDA has approved the therapeutic use of one such anti-CD20 antibody, Rituxan for use in relapsed and previously treated low-grade non-Hodgkin's lymphoma (NHL). However, while the use of Rituxan has generally been reported as effective for treating B-cell lymphomas, the treated patients are often subject to disease relapse.

More recently, Rituximab has been shown to be an effective Rheumatoid arthritis treatment ( Edwards J, et al, 2004, N Engl J Med 350 (25): 2572-81 ) and has been approved by FDA for use in combination with methotrexate (MTX) for reducing signs and symptoms in adult patients with moderately- to severely-active Rheumatoid arthritis (RA) who have had an inadequate response to one or more anti-TNF-alpha therapies.

There is some evidence for efficacy in a range of other autoimmune diseases, and rituximab is widely used off-label to treat difficult cases of multiple sclerosis (Stephen LH, et al, 2009, N Engl J Med 2008; 358:676-688), systemic lupus erythematosus and autoimmune anemias. There are significant concerns about progressive multifocal leukoencephalopathy (PML) infection in SLE patients and other conditions. Despite it is not very clear about the actual function and mechanism of CD20 in promoting proliferation and/or differentiation of B cells, it is an important target for antibody-based therapy to control or kill B cells involved in cancers and autoimmune disorders. In particular, the expression of CD20 on tumor cells, e.g., NHL, makes it an important target for antibody-based therapy to specifically target therapeutic agents against CD20-positive cancer cells. However, while the results obtained to date clearly establish CD20 as a useful target for immunotherapy, they also show that currently available murine, chimeric and even humanized or fully human antibodies do not constitute ideal therapeutic agents because of their HAMA or HACA reaction, massive doses up to 375mg/m² and frequent injection because of the very short interval between the injections.

Accordingly, the need exists for improved therapeutic antibodies against hCD20 which are more effective in preventing and/or treating a range of diseases involving cells expressing hCD20.

Pegylation is a very powerful tool to improve protein characteristics. The covalent attachment of PEG to a drug or therapeutic protein can "mask" the agent from the host's immune system (reduced immunogenicity and antigenicity), increase the hydrodynamic size (size in solution) of the agent which prolongs its circulatory time by reducing renal clearance. PEGylation can also provide water solubility to hydrophobic drugs and proteins. PEGylation can be used in improvement of monoclonal antibodies, expecially scFv, Fab formates characterized with short half life. The purified scFv or Fab is site-specifically conjugated with a branched molecule of PEG.

What is needed, are anti hCD20 mAbs that have a high binding affinity and low dissociation constant such that treated B-cell lymphoma patients do not relapse, and do not cause, or have a reduced potential to cause a HAMA or HACA reaction when administered to patients who are not immunosuppressed, and that have a prolonged half life in circulation to extend the time interval between the injections and lower cost.

SUMMARY OF THE INVENTION

In the present invention, a fully human anti hCD20 mAb molecule (abbreviated as anti hCD20 mAb in the following) and nucleic acid sequences encoding the said molecule are provided. In particular, the molecules of the present invention are of a high binding affinity and a low dissociation rate with regard to hCD20.

In the present invention, both light and/or heavy chains of the said antibody molecules are preferably fully human eventhough chimeric or humanized can be alternatives as fully human antibody molecules can avoid many side effects, such as those caused by HAMA and HACA, when used in human.

In some embodiments, the present invention provides compositions comprising anti hCD20 mAb, wherein the molecule comprises: a) a complete or an incomplete light chain comprising a variable region and Fc or a part of it, wherein the light chain variable region consists of amino acid sequence as set forth in SEQ. NO: l or SEQ. NO: 4, and b) a complete or an incomplete heavy chain comprising a variable region and Fc or a part of it, wherein the heavy chain variable region consists of amino acid sequence as set forth in SEQ. NO:2 or SEQ. NO:6.

In the present invention, the said anti hCD20 mAb comprises a light chain and a heavy chain. The said light chain comprises a variable region comprising the amino acid sequence as set forth in SEQ ID NO: 1, the said heavy chain comprises a variable region comprising amino acid sequence as set forth in SEQ ID NO:2; or the said light chain comprises a variable region comprising the amino acid sequence as set forth in SEQ ID NO: 4, the said heavy chain comprises a variable region comprising amino acid sequence as set forth in SEQ ID NO:6.

In the present invention, the preferred anti hCD20 mAb comprises fully human Fc region and frameworks, and fully human variable light and/or heavy variable regions obtained via molecular evolution.

In the present invention, the frameworks for both light and heavy chains are all fully human, wherein the frameworks are selected from human IgA, IgD, IgE, IgG or IgM, preferably the frameworks from human IgGl, and most preferably from IgGl kappa.

In the present invention, the Fc regions of both light and heavy chains are all fully human, wherein the Fc regions are selected from isotypes human IgA, IgD, IgE, IgG or IgM, preferably the Fc regions are from human IgGl. The said antibody molecule in the present invention could be a naive or altered (e.g., mutated) Fc region. The said Fc region could be altered to reduce or enhance the effector functions of the antibody with methods including but not limited to those disclosed in US Patent Application ( Publication No.: US2006/0251652).

In the present invention, the fully human frameworks and Fc regions are obtained directly or indirectly from human. The said direct methods include but are not limited to those involving genomic DNA cloning, cDNA, cDNA library. The said indirect methods include but are not limited to a partial or de novo fully DNA synthesis based on bioinformation including but not limieted to GenBank or publications, and DNA synthesis technologies including but are not limited to PCR-based DNA synthesis methods.

In some embodiments, the anti hCD20 antibody molecule comprises a full length molecule or a fragment of it (e.g., Fv, Fab, F(ab)₂, F(ab')₂ etc.). In particular embodiments, the anti hCD20 antibody molecule comprises a single domain (or CDR), single chain Fv, Fab, F(ab)2, F(ab')2, etc.

In some embodiments, the light chain variable region comprises a fully human framework. In other embodiments, the light chain variable region comprises a human germline framework. In particular embodiments, the light chain variable region comprises an amino acid sequence as set forth in SEQ ID NO:4. In certain embodiments, the heavy chain variable region comprises a fully human framework. In other embodiments, the heavy chain variable region comprises a human germline framework. In additional embodiments, the heavy chain variable region comprises an amino acid sequence as set forth in SEQ ID NO: 6.

In some embodiements, the anti hCD20 antibody molecule can be chemically modified with PEG to prolong its half life in circulation. PEGylation can be achieved by activation of a single cysteine residue in a truncated hinge region of the scFv or Fab, F(ab)₂, F(ab')₂, followed by reaction with (PEG)-lysyl maleimide as described in Chapman AP, et al, 1999, Nature Biotechnology 17, 780-783. The other alternatiable methods can be seen in detail in many publications, such as Knight DM, et al, 2004, Platelets 15 (7): 409-18, and US patent US5824784. In some embodiments, the anti hCD20 antibody molecule comprises a Fab molecule comprising a light chain and a heavy chain, wherein the light chain consists of amino acid sequence as set forth in SEQ ID NO: 8 encoded by the DNA segment as set forth in SEQ ID NO: 7 or its equivalents encoding the same amino acid sequence, and the heavy chain consists of amino acid sequence as set forth in SEQ ID NO: 10 encoded by the DNA segment as set forth in SEQ ID NO: 9 or its equivalents encoding the same amino acid sequence.

In some embodiments, the anti hCD20 antibody molecule comprises a Fab and further comprises a complete Fc region forming a full length mAb molecule or further comprises a part of a Fc fragment to form an incomplete full length mAb molecule. In particular embodiments, the anti hCD20 antibody molecule comprises an antibody.

Additionally, the Fc region should have complement dependent cytotoxicity (CDC) and antibody- dependent cell mediated cytotoxicity (ADCC) functions. These functions can be modified by amino acid substitutions to reduce or abolish or enhance these effector functions.

In the present invention, the anti hCD20 antibody molecules are expressed in a eukaryotic, or prokaryotic host cell. In other embodiments, the nucleic acid sequence encoding the light and/or heavy chain is contained within a plasmid or other expression vector.

The present invention provides methods for treating a disease. The methods comprise: (1) a composition consisting of the said anti hCD20 antibody molecule of the present invention; and (2) administration of the composition to the subject. The subject is a patient with symptoms of the disease such that the symptoms are reduced or eliminated. In particular embodiments, the disease is selected from the group consisting of: (1) B Cell-Related Diseases: relapsed Hodgkin's disease, resistant Hodgkin's disease, high grade, low grade and intermediate grade non-Hodgkin's lymphomas (NHLs), B cell chronic lymphocytic leukemia (B-CLL), lymphoplasmacytoid lymphoma (LPL), mantle cell lymphoma (MCL), follicular lymphoma (FL), diffuse large cell lymphoma (DLCL), Burkitt's lymphoma (BL), AIDS-related lymphomas, monocytic B cell lymphoma, angioimmunoblastic lymphoadenopathy, small lymphocytic; follicular, diffuse large cell; diffuse small cleaved cell; large cell immunoblastic lymphoblastoma; small, non-cleaved; Burkift's and non-Burkitt's; follicular, predominantly large cell; follicular, predominantly small cleaved cell; and follicular, mixed small cleaved and large cell lymphomas. (2) Autoimmune Diseases: Rheumatoid arthritis, Psoriasis vulgaris, Systemic Lupus erythematosus, Ankylosing spondylitis, multiple sclerosis and others.

DESCRIPTION OF THE FIGURES

FIG.1 is a schematic representation of a Fab expression vector pCOMb3M, where Plac is the promoter for expression in E. coli, ompA and pelB are sequences coding signal peptides, GPIII is the coding sequence of phage tail protein GPIII. MCS1 and MCS2 are cloning sites for light and heavy chain of a Fab molecule.

Fig.2 is a schematic representation of construction of pGP6C, the expression vector for full-length antibody production in mammalian cells such as CHO and HEK293 with double expression cassettes. In order to express both light and heavy chains in mammalian cells, an expression vector with double expression cassettes was constructed based on the following procedure. (1). A PCR-based gene synthesis (Xiong A S,Yao Q H,Peng R H,et al., 2004, NAR,32(12):e98. ) was used to synthesize a constant region (CL) of human IgGl light chain according to the sequence data obtained from GenBank Accession No.AB608262.1, and a multi-cloning site containing the following restriction sites (Pstl/Nhel/Bglll EcoRI EcoRV/XhoI) added to its 5 '-end and a 22bp fragment of the 3 '-end of SV40 poly A signal added to its 3 '-end (abbreviated as pASV40) for amplification of and integration with pA_SV4o fragment from pCi-Neo. (2). P3 ( ttccctttagtgagggttaatg , primer for pA_SV4o 5 '-end) and P4 (ccggatcgatccttatcggattt/ACCACATTT GTAGAGGTTTTA CTTG, primer for Pcmv3'-end and pA_SV4o 5 '-end) were used to amplify pA_SV4o fragment with pCi-Neo as template, the amplified fragment is 295 bp in length. PI ( ctgcag(Pstl) gctagcagatctg aattcgatatcc tcgag, a primer for multi cloning site and 5 '-end of CL) and P4 were used to integrate the above fragment via overlapping PCR to form MCS-CL-pA structure. The length is 618 bps. (3) P5 ( caagtaaaacctctacaaat gtggta/aaatccgataaggatcgatccgg, a primer for pA_SV4o 3'-end/P_CMv 5'-end) and P6 (ggtacc(Kpnl)CTGTGGAGAGAAAGGCAAA GTG, a primer for addition of KpnI/Pc_Mv 3'-end)were used to amplify the P_CMV fragment with length 1151 bps. Then, PI and P6 were used to joint the above two fragments to form the structure of 1791 bp in length PstI-MCS-CL-pASV40-PCMV-KpnI. This structure was inserted into phCMVl at Pstl pnl sites, and formed an expression vector with two expression cassettes in which a constant region for human IgGl (kappa) was pre-installed in the first cassette. After the synthesized constant region of human gamma chain (CH) based on the PCR-based gene synthesis as mentioned above was inserted at the positions ACC65I/NotI into the above structure, the final structure of the sail expression vector pGP6C with double expression cassettes and pre-installed human CL and CH respectively was achieved.

Fig.3 is a graph comparing the affinity of several Fab molecules after evolution from 7F2, their positive and negative controls C2B8- and Humira-Fab (in-house made) as determined by Friguet method .

Fig.4 is a graph comparing the affinity of full length F8G3 and the in-house made positive controls C2B8 (Rituxan) and 2F2 (HuMax-CD20) as determined by Friguet method.

Fig.5 shows the dissociation rate of F8G3 from CD20 was significantly lower than that of both C2B8 and 2F2.

Fig.6 shows the inhibition of anti CD20 antibody on tumour growth in immunodeficient mice inoculated with DHL4 cells.

Fig.7 shows cell lysis of Daudi cells (Fig.7A) and Raji cells (Fig.7B) induced by F8G3, 2F2 and Humira. Addition of antibodies induced cell lysis at about 5 minutes, F8G3 resulted in a marked cell lysis of more than 90%, and 2F2 induced more than 80% cell lysis in both B-cell lines, No lysis was observed with the negative control antibody, and not shown herein.

Fig.8 is the illustration of the ability of the antibody F8G3 to induce ADCC of Raji cells in comparison with 2F2 as positive control and with Humira as the negative control. A dose-effect relation with CD20 mAbs was observed in ADCC of Raji cells using MNC as effector cells. Both 2F2 and F8G3 induced specific lysis of Raji cells, 2F7 induced only 35% lysis of target cells at maximum but F8G3 did as high as 47%. Addition of the negative control antibody Humira did not induce specific lysis.

DESCRIPTION OF THE INVENTION

The present invention provides anti hCD20 mAb molecules and nucleic acid sequences encoding anti hCD20 mAb molecules. In particular, the present invention provides anti hCD20 mAb molecules with a high binding affinity, and a low dissociation rate, with regard to hCD20. Preferably, the anti hCD20 mAb molecules of the present invention comprise light and/or heavy chain variable regions with fully human frameworks. The description of the invention is divided into the following sections below for convenience: I. anti hCD20 mAb molecules; II. Generating anti hCD20 mAb molecules; III. Therapeutic Formulations and Uses; and IV. Additional anti hCD20 mAb molecule Uses.

I. ANTI HCD20 MONOCLONAL ANTIBODY MOLECULES

Monoclonal antibodies of the invention can be produced by a variety of techniques, including but not limited to the standard hybridoma technique published by Kohler and Milstein, Nature 256: 495 (1975). Although this procedure is preferred in principle, other techniques for producing monoclonal antibody can be employed, e.g. transgenic mice or antibody library techniques. Hybridoma technology in mouse has been very well established. Immunization and Fusion partners were well understood in the art. But the monoclonal antibodies produced by murine or other non-human hybridoma can trigger HAMA reactions that lead to side-effects for treating human. The chimeric or humanized monoclonal antibodies derived from these monoclonal antibodies are still able to trigger HACA reaction that will cause the similar, even though less than their prototype molecules, immunoreaction when used to treat human. Fully human hybridoma technology is still under development and not good enough for producing suitable monoclonal antibodies for treating human beings.

For treatment of human diseases, fully human monoclonal antibodies are needed to reduce or eliminate HAMA or HACA causing side effects. Even though transgenic mouse has established a very successful record, there have other technological choices.

Monoclonal antibody libray technology, particularly fully-human antibody library technology established by Cambridge Antibody Tehcnology (CAT) and others, is a preferred choice. The technology developed by CAT has in certain extent gained great success in some therapeutic mAb development and drawn worldwide attention, but it has still a very prominent problem that very infrequent are the obtained scFv molecules with ideal affinity. This leads to the need to improve the technology to meet the requirements of therapeutic monoclonal antibodies.

In the present invention, crucial improvements were applied to the existing antibody library technology: (1) An extra large scale antibody library of fully human naive Fab (called as HuLib) was biult up with blood samples from over 3000 individuals from different nationalities and different locations. It is obvious that the libray contained much higher genetic diversities compared with published libraries, and it is not difficult for a person skilled in this art to understand that this obviously increases genetic complexity and possibility to obtain a high affinity Fab molecule through panning or other practicable procedures. Alternatively, antibody library used herein can be synthetic, partially synthetic, scFv or other non-human animals starting materials such as mouse. (2) Molecular eveolution technology is applied to further improve the affinity or to alter characteristics other than affinity of the obtained Fab molecules to meet therapeutic requirements. The molecules improved by evolution are produced in a host cell, such as a mammalian host cell, a yeast host cell or a bacteria cell.

In the present invention, a prototype Fab molecule with high affinity is panned out against hCD20 from the above library, which is used as template for further affinity improvement through molecular evolution, to produce a candidate monoclonal antibody suitable for therapy.

The molecular evolution technology in the present invention introduces mutation by PCR that comprises: (1) Key Amino Acids (KA) scanning was introduced to identify the sites of greatest interest and profitable for substitutional mutagenesis before artificial evolution to decrease non-interest mutations. KA scanning is a procedure to identify the amino acid sites that can produce interest mutations by generating all possible mutants on each individual amino acid site and testing their binding affinity. If affinity of a mutant with an amino acid mutation at a specific site is changed after mutation, this site can be identified as an interest substitutional site, and vice versa. Based on this scanning, interest and/or non-interest sites can be identified and clasified before mutation design by the aid of Alanine Scanning as described by Cunningham and Wells (Science, 1998, 244: 1081-1085). And this will dramatically simplify the data handling for mutation design, and reduce or avoid non-interest mutant numbers, and this will in turn simplify the sub-library construction and panning procedure after mutation. (2)Design of mutation primers, which is a very crucial step for introduction of enough and potent mutations in this technology, was based on GCR (Goose Array CDR-in random) design schem as described in detail in PCT/CN2009/074839. In the present invention, the target regions (i.e., regions to be mutated) are CDRs of an antibody molecule, preferably CDR3 regions in both light and heavy chains. In the present invention, random mutagenesis is preferred to generate mutants saturated with all pssible 20 amino acids at each interest site. (3) In addition, the certain amino acids flanking the target CDRs according to Kabat could be important, at least in some cases and to some extent, for generation of interest mutants of affinity, too. Because of this, KA scanning should cover both target CDRs and their "flanking" amino acids to extend the interest residue category for generating mutants with improved affinity compared with their prototype or even positive control, such as HuMax-CD20.

In the present invention, the interest amino acid sites can be changed to a random amino acid or to a specific amino acid by methods well known in the art. Changes to the amino acid sequence may be generated by changing the nucleic acid sequence encoding the amino acid. A nucleic acid sequence encoding a mutant of a given CDR with one or more mutations may be prepared by methods well known in the art using the guidance of the present specification for particular sequences. The mutagenesis methods include, but are not limited to, site-directed (or oligonucleotide-mediated) mutagenesis, site-specific or random PCR mutagenesis, and cassette mutagenesis of an earlier prepared nucleic acid encoding the CDR. A preferred method for preparing substitution mutants is site-directed mutagenesis. This technique is well known in the art (see, e.g., Carter et al, 1985, NAR, 13: 4431-4443, and Kunkel et al, 1987, PNAS, 82: 488-492). PCR-based mutagenesis, in which the mutated nucleotides are incorporated into the PCR primers such that the PCR product contains the mutations, is another preferred method for this purpose, see Vallette et al, (1989) NAR, 723-733 for details. The most preferred method in the present invention is random mutagenesis at the interest sites by PCR with the primers designed according to GCR method as described in detail in PCT/CN2009/074839 or other applicable techniques. More than one interest sites can be simutaneously substituted to a random single amino acid so that a mutant with multi random substitutions can be obtained.

In the present invention, the CDRs may be numbered according to Kabat, EA, et al, 1991, Sequences of proteins of immunological interest, 5th ed. U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, Md.

In preferred embodiments, anti hCD20 mAb molecule in the present invention comprise a light and/or a heavy chain variable region integrated with fully human constant regions. It is not difficult for a person skilled in the art to understand that anti hCD20 mAb molecules of the present invention will illicit very little or no immunogenic response when administered to a human to treat a disease.

In some embodiments, the anti hCD20 mAb molecule in the present invention comprises further an Fc region, prefferably the Fc region is isolated directly from human germline or obtained through other procedures such as full length DNA synthesis, human genomic libraries, etc.

The present invention provides anti hCD20 mAb molecules with a high binding affinity (Kd) and a low dissociation rate (koff) with regard to hCD20, and able to be effective at low concentrations. It is not difficult to understand for a person skilled in this art that an anti hCD20 mAb molecule of the present invention, are particularly well suitabl for therapeutic use in humans and are less likely to trigger a HACA response than the chimeric anti-CD20 molecules containing mouse components, such as Rituxan.

The CDRs of the present invention may be integrated with any type of framework to form a functional scFv, Fab and/or further integrated a Fc region to form functional full length antibody molecule. Preferably, the CDRs are used with fully human frameworks or framework sub-regions and Fc region in germline or modified format. Examples of fully human frameworks which may be used with the CDRs of the present invention include, but are not limited to, KOL, NEWM, REI, EU, TUR, TEI, LAY and POM (See, (1) Kabat et al, 1991, Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, and (2) NIH, USA; and Wu et al, 1970, J Exp Med 132:211-250).

II. GENERATING CD20 BINDING MOLECULES

In the present invention, an antibody or antibody fragment of the present invention can be made by recombinant expression of light and heavy chain genes in a host cell. The host cell can be a mammalian, yeast or bacterial cell. In the present invention, expression of the light and heavy chains can be achieved by transient expression or stable expression. Both expression strategies comprise transfection (for mammalian and yeast system) or transformation (for bacterial system) of a host cell with one or more expression vectors carrying DNA fragments encoding the immunoglobulin light and heavy chains of the antibody such that the light and heavy chains are expressed in the host cell, and preferably, secreted into the medium in which the host cell is cultured, from which medium the antibody can be recovered by well known methods such as chromatograph. Standard recombinant DNA methodologies have been know well to obtain antibody heavy and light chain genes, insert them into expression vectors and introduce the vectors into host cells for expression.

The antibody molecules isolated by panning from the antibody library before and after molecular evolution are Fab-formated, which can be further converted into scFv, full length antibody or other formats without difficulty through well known genetic engineering techniques in the art.

Once DNA fragments encoding the desired VH and VL segments in this invention are obtained by the methods described above, they can be further converted to full-length antibody light and heavy chain genes respectively, Fab fragment genes or scFv genes through standard DNA operation.

To generate a full light chain gene, the isolated DNA encoding the VL region can be integrated with a human light chain constant region gene. Preferably, the light chain constant region is a kappa or lambda constant region, the most preferably the light constant region is a human kappa constant region. To generate a full length heavy chain gene, the isolated DNA encoding the VH region can be linked to a human heavy chain constant region gene that are in or out the expression vector. The heavy chain constant region can be selected from the follows, an IgG, IgA, IgE, IgM or IgD constant region, and preferably from IgGl to IgG4, most preferably an IgGl constant region (gamma) selected.

To create a single chain Fv gene, the obtained VH- and VL-encoding DNA fragments, which is obtained preferably by PCR from the above Fab molecule can be linked together via a linker encoding the amino acid sequence (Gly4)3 between the two fragments so that the VH and VL sequences can be expressed as a single-chain Fv protein molecule in Escherichia coli as described in McCafferty et al, 1990, Nature 348:552-554.

To express an antibody, or an antibody fragment of the present invention, their corresponding coding sequences of both light and heavy chains can be inserted between a transcriptional and a translational control sequences of an expression vector. In the present invention, the expression vectors comprises expression regulatory elements, such as promoter, enhancer and so on. The expression vector and expression control sequences should be compatible with the expression host cell. The genes coding light chain and heavy chain of an antibody can be inserted into two expression vectors separately or into the same expression vector by any applicable methods. The expression vector used herein may already have or have not the constant region sequences prior to insertion of the light and/or heavy chain variable sequences. If an antibody gene contains only variable region, an expression vector containing constant region should be used, and vice versa.

In addition to transcriptional and translational control sequences, in some embodiments in the present invention, the expression vectors further comprise: (1) a signal peptide coding sequence in each cassette, which facilitates secretion of the antibody chain from a host cell, (2) at least a replication origin, (3) one or more selectable marker genes, that facilitate selection of host cells into which the vector has been introduced. Typically selectable marker gene confers resistance to drugs on a host cell, such as antibiotics for bacteria and G418, hygromycin or methotrexate, etc for mammalian and other host cells. All these information has been well known in the art.

Preferred mammalian host cells for expressing the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO cells) with or without DHFR gene, HEK293. Production of antibodies is carried out by culturing host cells harbouring the expression vector (s) and subsequent purification procedure from the culture.

Host cells can also be used to produce truncated fragments of an intact antibody in Fab or scFv format. For this purpose, bacteria, such as E. coli, is preferred in the present invention even though mammalian or other host cells can be selected.

Recovery and purification of the antibodies or antibody fragments in the present invention comprise: (1) The sample is first conditioned, or prepared for purification. Cells, cell debris, lipids, and clotted material are first removed, typically by centrifugation followed by filtration with a 0.45 μιη filter. (2) Chromatogragh, including but not limited to affinity, ion exchange, size exclution chromatography. In addition, ultrafiltration or dialysis can be helpful in some cases. The preferred purification in the present invention is approached by the aid of Protein A/G affinity capture before either cation exchange chromatography is used at a low enough pH that the desired antibody binds to the column while anions flow through, or anion exchange chromatography is used at a high enough pH that the desired antibody flows through the column while anions bind to it. Various proteins can also be separated out along with the anions based on their isoelectric point (pi). (3) Size exclusion can be used to further polish the obtained raw material when needed.

To obtain high pure monoclonal antibody in the present invention, chromatogragh invovling MabselectSuRe, Capto S and anion Capto Q provided by GE Healthcare is used after filtration. For setting up a more effective procedure, a two step strategy involving MabselectSuRe and CaptoAdhere can be used.

III. THERAPEUTIC FORMULATIONS AND USES

Anti hCD20 mAb molecules of the present invention, including full length and truncated, are useful for treating and diagnosing human diseases related to CD20. In preferred embodiments, anti hCD20 mAb molecules are administered to a patient with B cell lymphoma or other CD20-related tumors or other diseases, and autoimmune diseases such as RA, SLE etc, as described in detail above.

It is known to those skilled in the art that an anti hCD20 mAb molecules conjugated to various radio- or non- radio labels is useful for both diagnostic and therapeutic purposes. The radio lablels useful for this purpose include but are not limited to ¹³¹I, ¹²⁵1, ⁹⁹Tc and ⁹⁰Y. The non-radio lablels useful for this purpose include but are not limited to an enzyme (i.e. HRP, AP, etc), a fluorescence dye, a toxin or others.

In preferred embodiments, the subject treat is not immunosuppressed (e.g. SLE, RA patient). While mechanism is still to be elucidate, it is believed that anti hCD20 mAb molecules of the present invention are less likely to illicit a HACA response than previously known anti-CD20 antibodies, especially in non-immunosuppressed patients. As such, non-immunosuppressed patients can be treated without the overriding concern for an adverse HACA reaction. In addition, the mAb molecules in the present invention has improved binding ability so that lower doses may be used in treatment to achieved effective dosages, this further avoid the risk of a HACA response in addition to that conferred by its fully human structure. Anti hCD20 mAb molecules of the present invention may be administered in combination with other anticancer therapies including but not limited to chemo- and radio-therapies, and in combination with some cytokines, such as G-CSF in certain other cases.

The anti hCD20 mAb molecules of the invention can be incorporated into pharmaceutical compositions suitable for administration to a patient, which may comprise a CD20 binding molecule (e.g. an antibody or antibody fragment) and a pharmaceutically acceptable carrier such as solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The acceptable carriers include one or more of the following: water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. Preferably, isotonic agents can be selected from sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride, and most preferably the isotonic agent is trehalose. The carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the said molecules.

The compositions of this invention may be in a variety of forms, such as injectable and infusible liquid solutions, dispersions or suspensions, etc. The preferred forms in this invention are injectable or infusible solutions.

IV. ADDITIONAL USES OF ANTI HCD20 MONOCLONAL ANTIBODIES

The anti hCD20 antibody molecules of the present invention are useful for immunoassays which detect or quantify CD20 in a sample. An immunoassay is a biochemical test that measures the presence or concentration of a substance in solutions that frequently contain a complex mixture of substances. In addition to binding specificity, the other key feature of all immunoassays is a means to produce a measurable signal in response to a specific binding. Nevertheless most immunoassays today depend on the use of an analytical reagent that is associated with a detectable label. Such labels serve for detection and quantitation of binding events either after separating free and bound labeled reagents or by designing the system in such a way that a binding event effects a change in the signal produced by the label. In the present invention, the useful labels are selected from the follows radioactive elements used in radioimmunoassays; enzymes, fluorescent, phosphorescent, and chemiluminescent dyes; latex and magnetic particles; dye crystalites, gold, silver, and selenium colloidal particles; metal chelates; coenzymes; electroactive groups; oligonucleotides, stable radicals, and others. The preferred labels in the present invention are enzymes such as HRP and AP, and influorescent dyes, and the most preferred is enzymes such as HRP and AP.

Various assay procedures are well known in the art and widely used clinically and scientifically for various purposes such as desease diagnosis, biological study and the like.

EXPERIMENTAL

The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof. EXAMPLE 1 CONSTRUCTION OF A LARGE FULLY HUMAN ANTIBODY LIBRARY

This example describes how an extra large fully human naive antibody library in Fab form was constructed. The Fab library in the present invention was constructed with blood samples of over 3000 individuals from different provinces and different nationalities based on the procedure disclosed in the following publications, and the procedure is described in detail after the publication lists.

1. Dantas, BC, et al, 2005, Construction of a human Fab phage display library from antibody repertoires of osteosarcoma patients. Gene. Mo. Res, 4 (2): 126-140.

2. Hiroshi, T, et al, 1999, Preparation of Recombinant Human Monoclonal Antibody Fab Fragments Specific for Entamoeba histolytica, Clinical and Diagnostic Labor Immunol, May 1999, 383-387.

3. Wu, BP, et al, 2001, Construction and selection of the natural immune Fab antibody phage display library from patients with colorectal cancer, World J Gastroenterol, 7(6):811-815.

4. Lee, CV, et al, 2004, High-affinity Human Antibodies from Phage-displayed Synthetic Fab Libraries with a Single Framework Scaffold, J Mol Biol, 340, 1073-1093.

5. Michael H, et al, 2005, Antibody phage display, Mod Asp Immunobiol, 15: 47-49.

6. De Haard HJ, et al, 1999, A large non-immunized human Fab fragment phage library that permits rapid isolation and kinetic analysis of high affinity antibodie. J Biol Chem, 1999, 274: 18218-18230.

7. Fellouse, FA, 2007, High-throughput generation of synthetic antibodies from highly functional minimalist phage-displayed libraries. J Mol Biol 373, 924-940. 1. Blood samples and cDNA synthesis

Peripheral blood mononuclear cells were isolated from mixed blood samples, 1ml each individual, by the aid of Lymphocyte Sepration Solution before total mRNA isolation with an mRNA isolation kit from Invitrogen or Roche. The mRNA sample was used in cDNA first chain synthesis proformed with a commercially available reverse transcription kit from GIBCO. All the steps were carried out according to mannufecturer's instruction.

2. Amplification of coding sequences for Fab light and heavy chain

For amplification of the genes encoding the kappa and lambda light chains and the Fd region of the gamma heavy chain, the primer sets shown in Table.1 were used ( see Ref.2, 3 and 6 ) . In addition to the sequence complementary to light or heavy chains said above, the primer sequences contain the certain restriction sites and protection bases for cloning. PCR amplification was performed in 100-μ1 reaction mixtures. Both sense and antisense primers were used at ImM. Twenty five cycles of PCR were performed as follows: denaturation at 94°C for 30 seconds, annealing at 50°C for 30 seconds, and polymerization at 72°C for lmin. An initial denaturation step of 4 min at 94°C and a final extention polymerization step of 5 min at 72°C were also included. The amplified DNA fragments were purified with the QIAquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany). The DNA fragments were treated with Sacl/ Hindlll or Xhol/ Spell and were then purified by agarose gel electrophoresis in combination with the QIAEX Gel Extraction Kit (QIAGEN).

Table 1. Primers used for PCR amplification of human immunoglobulin genes. Primer sequences are aligned from 59 to 39. Restriction sites are underlined. Degenerate nucleotides are indicated as follows: M= A or C, Y= C or T, W= A or T, R= A or G, H=A, C, or T, S= C or G, and K= T or G.

3. Cloning PC product of Fab light and heavy chain into Expression vector pC0Mb3M The DNA coding for light chain gene was ligated into an expression vector, phagemid pCOMb3M (modified by adding restriction sites Sacl Hindlll/Xbal at the sites Sacl/Xbal of pCOMb3M for subsequential cloning of light and heavy chains, see GenBank Accession No. AF268280 for detailed seuquence, its structure sketch shown in Fig. 1). Next, the DNA coding Fd heavy-chain was ligated into pCOMb3M in which the light-chain gene was pre-installed to form pCOMb3M Fab. The ligated phagemid DNA was separated from the unligated DNA by electrophoresis on 1.2% agar and recovered by the aid of QIAEX Gel Extraction Kit (QIAGEN, and stored in sterile pure water for use. The DNA must be completely free of salt prior to electroporation. The recombinant DNA was introduced into E. coli strain TGI by electroporation.

4. Transformation

Freshly innoculated E. coli strain TGI was cultured with shaking at 250 rpm until an A600 of 0.5-0.7 is achieved (approximately 2-2.5 hours). Then, the cells were washed twice with ice-cold sterile ImM HEPES (pH7.0) containing 10% glycol before dispensing in ΙΟΟμΙ aliquots and proceed to the electroporation.

A Bio-Rad Gene Pulser was programmed to give 25μΡ, 2.5kV at 200ohms to ΙΟΟμΙ of prechilled cells on ice in a pre-chilled 0.2cm cuvette. A hundred ng of pCOMb3M Fab DNA in 2μ1 prechilled pure water was added into the cuvette and pulse once. The obtained time constant is between 4.5-5msec. The cells were immediately resuspended in 1ml of fresh LB-G or 2> YT-G medium. Ten identical samples were made by repeating the above procedure and the mix of the ten repeats was cultured in a 50-ml culture tube containing 6 ml of ampicillin-free 2> YT-G medium for 1 hour at 37°C with shaking at 250 rpm. After cultured at the conditions as above, 75 μΐ of 20mg/ml Ampicillin and 6> 10¹² pfu of M13K07 were added to rescue the pCOMb3M Fab phagemid from the transformed E. coli TGI cells. The supernatant containing phagemid particles was collected after centrifuging at 1000xg for 20minutes.

Two hundred pulses by repeating the above electroporation were processed to set up an extra large Fab antibody library, and all the collected supernatant containing phagemid particles was mixed and designated as HuLib. The total size of the library was calcaulated based on the total unique molecule numbers obtained from each pulse (Ranging from 0.67 to 5.66x 10^s), and the final mixed library size was as high as 6.2x l0¹⁰. The rescued library was dispensed in 500μ1 aliquots (containing about 2.7x l0¹² phage particles), and used immediately or stored at 4°C for later use.

EXAMPLE 2 PANNING THE FULLY HUMAN ANTIBODY LIBRARY AGAINST HCD20

Recombinant human CD20 was used to pan an aliquot of the above HuLib with in-house made 2F2 (HuMax-CD20, GenMab) Fab as the positive control and Humira Fab as negative control.

The panning procedure was summarized as follows:

A liquot of the HuLib was added to a 25 -ml cell culture squre bottle precoated with recombinant human CD20 protein by conventional methods, and incubated for 1 hour at 37°C. After twenty washes with PBS containing 1% Tween-20, 1 ml of TGI cells at log phase was added and cultured for 16 hours at 37°C with shaking. The supernatant was transferred to a new 50ml tube and spined at 12000rpm for lOmins. 500μ1 of the supernatant was taken as an aliquot to repeat the above panning procedure, and four cycles of panning were repeatedly processed. After the last repeat, the bacterial cell suspension was diluted to lOOOOOcells/ml, then spreaded on a 1.5% agar plate containing 0.1% Ampicillin to obtain single colonies. Then ten 96- deep-well plates, containing 0.25ml LB with Amp in each well, were inoculated with the above single colonies, a single colony each well, and cultured at 37°C for 16 hours with vigorous shaking. Then the plates were spinned at 5000rpm for 20mins, and the supernatant in each well was transferred into ten new 96-deep-well plates and stored at 4°C for use.

Ten 96-well immunoassay plates were coated with recombinant human CD20 at 10μg/ml, and the above supernatants was transfered to the coated plates, ΙΟμΙ each well, incubated at 37°C for 1 hour. After twenty washes with PBS containing 1% Tween-20, Ιμΐ HRP-labelled goat anti M13 monoclonal antibody was added and incubated at 37°C for 30minutes. Then ten washes were processed as above. For chromogenic reaction, 200μ1 PBS containing 0.025% DAB and Ιμΐ 1% H₂0₂ was added before reading the OD data at 595nm. The wells with the highest OD value were corresponding to the clones that had Fab molecules with the highest affinities.

Based on the OD data obtained above, 396 positive clones with high OD values over the positive control were obtained, and further affinity assay showed that 5H3, 3D7, 6D2 and 7F2 were of relatively higher affinity, and 7F2 was of the highest affinity.

The dissociation constant (Kd) value of 7F2 was 2783pM as revealed by affinity assay according to Friguent et al. (Friguet, B. et al., 1985, J. Immunol. Methods, 77:305-319).

The amino acid sequences deduced from obtained DNA sequencing data of 7F2 are set forth in SEQ ID NO. l for the variable region of light chain and SEQ ID NO.2 for the variable region of heavy chain.

EXAMPLE 3 MOLECULAR EVOLUTION

Alanine scanning mutagenesism as described by Cunningham and Wells (Science, 244: 1081-1085, 1989) were used to identify the certain residues or regions from all CDRs of the clone 7F2 that demonstrated functional sensitivity to the alanine substitutions, these sites were the preferred sites for mutagenesis. Such sites in CDRs of 7F2 were listed in the following table. Herein, the underlined are those amino acide residues extreamly sensitive to substitution, and the dotted are those relatively sensitive to substitution, they were all designed as preferred mutation sites.

These sites were then refined by panning a phage display sublibrary containing random mutations introduced via oligonucleotide-directed random mutagenesis (Kunkel method) at all preferred substitution sites of the CDRs in 7F2. Briefly, to introduce the peptides with random mutations at the underlined and dotted residues in the above table the oligonucleotides, primers were designed according to Kunkel method and used in the Fab sublibrary construction with pCOMb3M as the vector. Panning was conducted against hCD20 by four rounds with conventional method described in Example 2 and well known in this art.

Take light chain CDR1 as an example to describe design and synthesis of the oligonucleotide. The oligonucleotide coding the light CDR1 with random mutations at preferred residue is:

5'-NNNGCCTCCNNNTTCGTGGGCNNNNNNATCNNN-3', where N means A, T, C or G.

This sequence was integrated with its flanking sequences at 5'- and 3 '-end, and formed the following fragment:

5'-gaaattgtgttgacacagtctccagccaccctgtctttgtctccaggggaaagagccaccc^

GCNNNNNN ATCNNNtggtaccaacagaaacctggccaggctcccaggctcctcatctat-3 ' ,

This sequence codes light CDR1 with random mutation at preferred residues and framework flanking this CDR.

The above sequence was synthesized by chemical or PCR-based DNA synthesis methods known well in this art. DNA Fragments with preferred mutations for other CDRs were designed and jointed with their flanking frame sequences by a method such as overlapping PCR known well in the art.. The fragments were further jointed together to form sequences coding Fab light and/or heavy chain by overlapping PCR well known in this art. The Fab sublibrary was constructed by insertion Fab light and heavy chain coding sequences into the vector pCOMb3M and introduced into E. coli TGI by electroporation as described in Example 1. After four rounds of panning against hCD20 as described in Example 2, 89 Fab clones with OD value over the positive control were obtained, and among them the clones 3D5, 6F4, 7A6 and 8G3 were with the highest OD values as shown in Fig. 3, and the affinity of the best one 8G3 was measured, this would be described in the following examples.

The DNA sequence coding light chain variable region of 8G3 was SEQ ID NO.3 encoding amino acid sequence as set forth in SEQ ID NO.4; and the DNA sequence coding heavy chain variable region of 8G3 was SEQ ID NO.5 encoding amino acid sequence as set forth in SEQ ID NO 6.

EXAMPLE 4 PREPARATION OF FULL LENGTH 8G3 PROTEIN

Full length 8G3 antibody protein was expressed in CHO DG44 cell by integration of the expression vector pGP6C (see Fig. 2 for details) into the host genome, the detailed procedure was as described below.

The heavy chain and light chain variable regions of the 8G3 antibody were cloned in the double cassette expression vector pGP6C, in which constant regions, Kozak and signal pepetide coding sequences were pre-installed.

The above recombinant construct, called as pGP6C/8G3, was transiently transfected in DG44 cells to check the constructs for proper production of 8G3 antibody, and shown normal expression. After this, linerized vector plasmid was prepared for stable transfection by digesting pGP6C/8G3 with a unique restriction enzyme, Kpn2I, cutting outside regions vital for expression.

Three transfections of DHFR-negative DG44 host cells, whic pre-adapted to serum-free suspension culture, were performed by electroporation with the above linear plasmid. Following transfection, the cells were subsequently subjected to a serial of single-round methotrexate selection at 20, 50, 100 and 200nM G418 concentrations, two weeks each round, before distributed into 96-wells plates and incubated. Selective medium (containing 5% dialysed fetal calf serum and an appropriate G418 level) was added and the plates were monitored to determine when the non-transfected cells died to leave foci of transfected cells. The transfected plates were incubated for approximately four weeks to allow colony formation. The resultant colonies were examined microscopically to verify that the colonies were of a suitable size for assay (>60% of the bottom of the well), and that only one colony was present in each well. Cell supernatants from 960 transfectants were screened for assembled antibody by IgG kappa ELISA, and 82 transfectants with relatively high expression level were selected for progression and further assessment in static culture. Cultures of the selected cell lines were expanded in suspension culture in serum-free EX302 (provided by JRH) without adaptation, and a further assessment of productivity was undertaken with ELISA and measurement of cell growth rate. Based upon harvest antibody concentration (by ELISA) and acceptable growth characteristics, two of the highest ranking cell lines were selected for assessment of the productivity in batch shake flask suspension culture in EX302. Both cell lines produced 8G3 full antibody (denoted F8G3) in good yields in the range of from 12.5~27 pg/cell/day as determined by protein A HPLC.

Purification of the recombinant monoclonal antibodies was precessed by the aid of MabSelect/ Capto S/Capto Q provided by GE Health, all operations were according to provider's manual.

Total mRNA was isolated from the above two clones by the aid of mRNA Isolation Kit from Invitrogen, and reversely transcripted by conventional method with oligo-dT15 to obtain cDNA which was cloned into pUC57. The positive clones identified by the aid of colony PCR.were sequenced by the conventional sequencing method. The results showed that both clones were full in length for both their light and heavy chain coding sequence, and the deduced amino acid sequences for both light and heavy chain were identical to that of expected. EXAMPLE 5 AFFINITY MEASUREMENT AFTER EVOLUTION

Affinity Measurement and Comparison

The samples used in this study were all purified by the aid of Protein L affinity chromatograghy and polished by size exclusive chromatograghy from the culture of E. coli strain DH5a harbouring pCOM3bM bearing Fab light and heavy chains. C2B8Fab and 2F2Fab proteins were in-house prepared by the above method using pCOM3bM bearing their Fab light and heavy chain genes synthesized according to the sequence data published in US patent 005736137 and publication 20040167319.

The antigen binding affinity of variants 3D5, 6F4, 7A6 and 8G3, and their prototype 7F2 was determined with hCD20 as antigen by ELISA, using in-house made C2B8 Fab as the control.

Briefly, antibody and hCD20 were incubated in solution until equilibrium was reached. The concentration of free antibody was then determined by ELISA using immobilized hCD20 and used to calculate affinity (Kd) according to Friguent et al. (Friguet, B t al, 1985, J Immunol Methods, 77:305-319).

According to the affinity measurement, 8G3 was the best clone, and was selected as the candidate for further biological activity tests to evaluate their potentiality in clinical therapy.

Fig.3 is the affinity data for 3D5, 6F4, 7A6 and 8G3, and their prototype 7F2, the in-house made positive Rituxan (C2B8) Fab. This figure showed that affinity of 8G3 was greatly improved after evolution compared with both its prototype 7F2 and positive control C2B8 Fab. The results of this improvement on biological functions will be tested in the following experiments. The negative control showed no binding and was not shown in the figure.

The Kd values for 7F2, 8G3 and positive control as by calculated are 2783, 465 and 1827pM.

In another experiment, comparison of affinity between full length F8G3, and in-house made 2F2 (HuMax-CD20) and C2B8 (Rituxan) was conducted according to the above procedure, the results were shown in Fig.4 which shows the affinity of full length 8G3, herein called F8G3, and commercially available Rituxan and HuMax-CD20. This figure showed that affinity of F8G3 was greatly improved compared with its positive control Rituxan.The Kd values of F8G3, 2F2 and C2B8 were 37, 121 and 3512 pM as calculated by Friguent's equation.

Dissociation Rate Assay:

To determine the dissociation rate of the mAbs, Ramos cells in 1ml were incubated in the presence of azide/2DOG for 2 hours at 37°C with 2 μg/ml ¹²⁵I-labelled mAbs to achieve maximum binding. Following centrifugation at 3000 rpm for 1.5 min, the supernatant was removed, the pellet quickly resuspended in lml medium, and immediately transferred to 9ml medium at 37°C in a 15ml conical tube and mixed well. At various times over the next 2 hours, 0.4 ml samples were removed and separated on phthalate oils to determine the level of radiolabeled mAbs remaining on the cell surface. As shown in Fig.5, dissociation rate of F8G3 from CD20 was significantly lower than that of both C2B8 and 2F2.

EXAMPLE 6 APOPOTOSIS INDUCTION

The target cell line was CD20 positive B lymphoma cell line DHL-4, with negative control Humira Fab and positive control C2B8 Fabo

After adding anti hCD20 antibodies, B lymphoma cell was induced to apoptoses. Five to seven days after adding the antibodies, the cells were accounted and conducted for MTT assay. The results were listed in Table 2.

Table 2. Apopotosis Effect of anti hCD20 antibodies (viable cell %)

Antibody concentration ( μg/ml ) 1 10 50 100

Humira Fab 98.9 97.8 97.2 98.1

C2B8 Fab 68.5 30.4 18.3 21.1

2F2 Fab 69.2 32.7 12.5 11.3

8G3 61.3 14.6 6 6 It was showed in the table that application of the anti hCD20 antibodies, in-house made C2B8 Fab, 2F2 Fab and 8G3 in the present invention, to the cells induced cell apopotosis and resulted reduction of viable cell rate while the application of the negative control Humira Fab did not. The reduction of the rate caused by 8G3 was much higher than that caused by both C2B8 Fab and 2F2 Fab, this revealed that 8G3 was of higher ability killing hCD20 positive cells.

EXAMPLE 7 IN VIVO ANTI TUMOUR FUCTION ASSAY

Immunodeficient mice were inoculated with DHL4 cell at 5x 10⁶ cells/mouse by subcutaneous injection.

Humira, C2B8 and F8G3 were subcutaneously injected while the tumour size reached 0.3x0.3x0.3 cm or above at the tenth day with dosing at 5mg each animal. At 0th, 10th, 15th, 20th, 25th and 30th days after injection, the tumour size was measured respectively. The results were shown in Fig. 6.

It was revealed that application of the anti hCD20 antibodies inhibited the tumour growth dramatically compared with negative control, but F8G3 allowing obviously less tumour growth over time compared to

C2B8.

EXAMPLE 8 CDC OF HUMAN ANTIBODIES AGAINST CD20

Two different B-cell lines, Daudi and Raji were used to test the CDC functions of 2F2 and F8G3, Humira as negative control antibody. Ten μg/ml antibody was added respectively to cultured cells, 10 minutes before freshly prepared human serum was added. At several time intervals (up to one hour) after induction of CDC, the cells were suspended in PI (Propidium Iodide)/ Hoechst33342 solution and incubated for 20minutes on ice or at 4°C. Then, the cells were washed three times with PBS before observed with fluorescent microscope to identify the normal (weak red+weak blue) , apoptosized (weak red+strong blue) and necrosized cells (strong red+strong blue), the total accounted cells should be not less than 500 cells for each sample.

The results are depicted in Fig.7A (Daudi cells) and Fig.7B (Raji cells). As seen, addition of antibodies induced cell lysis at about 5 minutes, F8G3 resulted in a marked cell lysis of more than 90%, and 2F2 induced more than 80% cell lysis in both B-cell lines. No lysis was observed with the negative control antibody.

EXAMPLE 9 ADCC ASSAY

Effector cells (mNC cells) prepared from 40ml fresh peripheral blood by Lymphocyte Separation Medium were seeded into round-bottom 96-well plates (Costar) in 100-μ1 aliquots/well and at appropriate concentrations. Raji cells were used as targets. Tumor target, Raji cells at l x lO⁶ cells/mL were incubated with ΙΟΟμΟ sodium chromate for 60 min at 37°C, after three washes in in PBS incubated for an additional 30 min to allow spontaneous ⁵¹Cr release. Then they are added to the effector cells at the indicated effector to target (E:T) ratios. Incubation is performed for 18h at 37°C in C0₂ incubators. All cultures are performed in triplicates and % cytotoxicity is calculated according to the formula:

Cytotoxicity %=100x(test ⁵¹Cr release-spontaneous ⁵¹Cr release) / (maximum ⁵¹Cr release- spontaneous ⁵¹Cr release),

where maximum and spontaneous counts are calculated from triplicates of target cells incubated with 2% Triton X-100 (Sigma) and in plain medium respectively.

F8G3 was tested for their ability to induce ADCC of Raji cells in comparison with 2F2 as positive control and with Humira as the negative control. A dose-effect relation with CD20 mAbs was observed in ADCC of Raji cells using MNC as effector cells (FIG. 8). Both 2F2 and F8G3 induced specific lysis of Raji cells, 2F7 induced only 35% lysis of target cells at maximum but F8G3 did as high as 47% . Addition of the isotype control antibody Humira did not induce specific lysis.

EAMPLE 10 USE OF CD20 BINDING MOLECULES TO TREAT HUMAN DISEASE

This example describes the use of CD20 binding molecules for the therapeutic and prophylactic treatment of certain diseases in a human patient including, but not limited to, a disorder selected from B cell-related cancers and autoimmune diseases.

For example, a patient with one of the above diseases may be administered an anti hCD20 monolonal antibody comprising 8G3 or its fragment, such as 8G3, F8G3, intravenously at 0.4 to 20.0 mg/kg body weight once a week for 4 to 8 doses.

The antibody or Fab fragment may also be labeled with ⁹⁰Yttrium or other radio materials for therapy and/or in vivo imaging procedures. Response to therapy may be monitored to determine the need for increased or reduced dosage and the need for repeat treatment.

The antibody or Fab fragment may labeled with radio, fluorescent, chromogenic or other detectable materials to detect a desase related to CD20.

All publications and patents mentioned in the above are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in chemistry, medicine, and molecular biology or related fields are intended to be within the scope of the following claims.

Claims

CLAIMS We claim:

1. An isolated fully human monoclonal antibody, the said antibody is able to bind specifically to human CD20 (hCD20).

2. The antibody of claim 1, wherein the antibody is selected from the group consisting of an IgGl, an IgG2, an IgG3, an IgG4, an IgM, an IgAl, an IgA2, a secretory IgA, an IgD, and an IgE antibody.

3. The antibody of claim 1, wherein the antibody comprises a light chain comprising a variable region as set forth in SEQ ID NO: lor a part of it, and a heavy chain comprising a variable region as set forth in SEQ ID NO: 2 or a part of it, or a light chain comprising a variable region as set forth in SEQ ID NO: 4 or a part of it and a heavy chain comprising a variable region as set forth in SEQ ID NO: 6 or a part of it.

4. The fully human antibody of claim 3, wherein the antibody is an antibody, an antibody fragment or a single chain antibody.

5. The fully human antibody of claim 3, wherein the antibody is a scFv, a Fab, a F(ab)2, a F(ab')2 or any other forms that is able to bind with hCD20.

6. The fully human antibody to hCD20 of claim 1, wherein the antibody comprises a light chain comprises a variable region as set forth in SEQ ID NO: 8, and a heavy chain comprises a variable region as set forth in SEQ ID NO: 10.

7. The fully human antibody to hCD20 of claim 1, wherein the antibody is PEGylated or non-PEGylated.

8. A transforma, eukaryotic or karyotic host cell, transgenic non-human animal or a plant, which is able to produce the antibody of claim 3 or a part of it, and the said a part of it is selected from scFv, Fab, a F(ab)2, a F(ab')2or any other forms that is able to bind specifically with hCD20.

9. A pharmaceutical composition for treating or preventing a disorder in human related to hCD20 or CD20-expressing cells, comprising the fully human antibody of claim 1 and pharmaceutically acceptable additives.

10. The pharmaceutical composition of claim 9, wherein the composition comprises the fully human antibody to hCD20 selected from IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, secretary IgA, IgD or IgE.

11. The pharmaceutical composition of claim 9, wherein the composition comprises a fully human anti hCD20 antibody with a light chain and a heavy chain, the light chain comprises a variable region as set forth in SEQ ID NO: l or a part of it, the heavy chain comprises a variable region as set forth in SEQ ID NO: 2 or a part of it; or the light chain comprises a variable region as set forth in SEQ ID NO:4 or a part of it, the heavy chain comprises a variable region as set forth in SEQ ID NO: 6 or a part of it.

12. The pharmaceutical composition of claim 11, wherein the fully human anti hCD20 antibody is a full length, a part of it or a combination of parts or a single chain antibody.

13. The pharmaceutical composition of claim 11, wherein the fully human anti hCD20 antibody is a scFv, Fab, a F(ab)2, a F(ab')2,or any form able to bind specifically to hCD20.

14. The pharmaceutical composition of claim 9, wherein the fully human anti hCD20 antibody comprising a light chain comprising amino acid sequence as set forth in SEQ ID NO: 8, and a heavy chain comprising the amino acid sequence as set forth in SEQ ID NO: 10.

15. The composition of claim 9, wherein the fully human anti human CD20 antibody is PEGylated or non-PEGylated.

16. A preventing or treating method for immunune or other diseases, comprising administrating an effective dosage of the antibody in claim 1.

17. The preventing or treating method of claim 16, wherein the diseases are correlated with hCD20 or CD20 expressing cells.

18. The methods of claim 16, wherein the fully human anti hCD20 antibody comprises a light chain and a heavy chain; the light chain comprises a variable region comprising amino acid sequence as set forth in SEQ ID NO: l or a part of it; the heavy chain comprises a variable region comprising the amino acid sequence as set forth in SEQ ID NO: 2 or a part of it; or the light chain comprises a variable region comprising the amino acid sequence as set forth in SEQ ID NO:4 or a part of it, the heavy chain comprises a variable region comprising the amino acid sequence as set forth in SEQ ID NO: 6 or a part of it.

19. The method described in claim 16, wherein the fully human anti hCD20 antibody is a full length antibody, a part of it or a combination of its parts or single chain antibody.

20. The method described in claim 16, wherein the fully human anti hCD20 antibody comprises a light chain comprising amino acid sequence as set forth in SEQ ID NO: 8, and a heavy chain comprising amino acid sequence as set forth in SEQ ID NO: 10.