WO2013068847A2 - Compositions and methods for treatment of cytomegalovirus - Google Patents
Compositions and methods for treatment of cytomegalovirus Download PDFInfo
- Publication number
- WO2013068847A2 WO2013068847A2 PCT/IB2012/002854 IB2012002854W WO2013068847A2 WO 2013068847 A2 WO2013068847 A2 WO 2013068847A2 IB 2012002854 W IB2012002854 W IB 2012002854W WO 2013068847 A2 WO2013068847 A2 WO 2013068847A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vlp
- polypeptide
- protein
- epitope
- hcmv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/245—Herpetoviridae, e.g. herpes simplex virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
- C12N2710/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13023—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/20011—Rhabdoviridae
- C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
- C12N2760/20234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/20011—Rhabdoviridae
- C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
- C12N2760/20241—Use of virus, viral particle or viral elements as a vector
- C12N2760/20245—Special targeting system for viral vectors
Definitions
- HCMV Human cytomegalovirus
- HCMV infection is normally unnoticed, having at most mild and nonspecific symptoms.
- certain risk groups for example in immunosuppressed patients such as AIDS patients or transplant recipients, and after prenatal infection, HCMV infection has serious manifestations (Staras SA et al., 2006 Clin Infect Dis 43(9): 1143-51; Hebart H et al, 2004 Hum Immunol 65(5):432-6; Rowshani AT et al, 2005 Transplantation 79(4) :381-6).
- Existing therapies include the use of immunoglobulins and antiviral agents such as ganciclovir and its derivatives, which are most effective when used prophylactically or very early during infection in at risk populations.
- existing therapies are characterized by significant toxicity and limited efficacy, especially for late-onset disease (Boeckh M., 2004 Pediatr Transplant 8(Suppl. 5): 19-27; Limaye AP., 2004
- the present invention provides methods and compositions useful for prophylaxis, treatment, and/or study of human cytomegalovirus (HCMV) infection.
- the present invention provides virus-like particles (VLPs) which comprise one or more Moloney Murine leukemia virus (MMLV) core proteins and include one or more HCMV epitopes, such as, for example, from HCMV envelope glycoproteins gB and/or gH and/or tegument protein pp65.
- VLPs virus-like particles
- MMLV Moloney Murine leukemia virus
- HCMV epitopes such as, for example, from HCMV envelope glycoproteins gB and/or gH and/or tegument protein pp65.
- the present invention encompasses the recognition that a combination of antigens (e.g., envelope glycoproteins and structural proteins) can lead to improved induction of beneficial immune responses, for example that include both a humoral response (e.g., production of neutralizing antibodies) and a cellular response (e.g., T- cell activation).
- a combination of antigens e.g., envelope glycoproteins and structural proteins
- beneficial immune responses for example that include both a humoral response (e.g., production of neutralizing antibodies) and a cellular response (e.g., T- cell activation).
- Provided VLPs may be characterized in that they contain no viral DNA and are non-infectious.
- provided VLPs are surrounded by a lipid membrane, optionally containing one or more epitopes from viral envelope glycoproteins (e.g., gB and/or gH) which are antigens that play a role in induction of virus-neutralizing antibodies.
- viral envelope glycoproteins e.g., gB and/or gH
- provided VLPs contain one or more epitopes from viral structural proteins (e.g., pp65) which are antigens that play a role in induction of cellular immune responses (e.g., T-cell response).
- viral structural proteins e.g., pp65
- utilized viral structural proteins both stimulate formation of T-helper cells and also induce cytotoxic T lymphocytes (CTL) against HCMV.
- the present invention provides variants of viral envelope glycoproteins (e.g., gB and/or gH).
- a variant viral envelope glycoprotein is or comprises a fusion protein.
- a variant of a viral glycoprotein comprises a heterologous protein domain (e.g., a transmembrane and/or cytoplasmic domain from a different protein).
- a variant of a viral structural protein comprises a heterologous antigen or epitope.
- the present invention provides VLPs comprising variants of viral structural proteins.
- a variant of a viral structural protein is or comprises a fusion protein.
- Figure 1 shows the DNA expression plasmid map (A) and construction of exemplary recombinant expression plasmids (B).
- Figure 2 shows FACS analysis of exemplary heterologous surface antigens on
- HEK 293 packaging cells A
- western blot analysis of heterologous antigen expression in exemplary VLP compositions B
- Figure 3(A) and (B) show particle size determination and polydispersity index for two exemplary VLP compositions.
- Figure 4 shows ELISA titers in mice treated with exemplary gB/pp65 (A), gH-
- Figure 5 shows neutralizing antibody activity in mice treated with exemplary
- VLP compositions (assayed in human fibroblast cells).
- Figure 6 shows neutralizing antibody activity in mice treated with exemplary
- VLP compositions (assayed in human epithelial cells).
- Figure 7 shows neutralizing antibody activity in mice treated with exemplary
- VLP compositions versus a recombinant gB protein (assayed in human fibroblast cells).
- Figure 8 shows antigen- specific CTL responses in mice treated with exemplary
- VLP compositions expressed in HEK 293 cells depicted as CTL frequency based on CFSE decay, gating on CD3 + CD8 + T cells (A) or frequency of proliferating pp65-specific CTLs (B).
- Figure 9 shows anti-gB and neutralizing antibody titers in rabbits treated with exemplary VLP compositions expressed in HEK 293 cells (assayed in human fibroblast cells).
- Figure 10 shows neutralizing antibody titers in rabbits treated with exemplary
- VLP compositions expressed in HEK 293 cells (assayed in human epithelial cells).
- FIG. 11 shows negative-staining Electron Microscopy (EM) images of exemplary VLP compositions expressed in CHO cells purified by (A) Tangential Flow Filtration (TFF) or (B) Anion Exchange (AEX) Chromatography.
- EM Electron Microscopy
- Figure 12 shows neutralizing antibody titers in rabbits treated with exemplary
- Figure 13 shows neutralizing antibody titers in rabbits treated with exemplary
- VLP compositions expressed in CHO cells purified by Tangential Flow Filtration (TFF) and Anion Exchange (AEX) Chromatography (assayed in human epithelial cells).
- Figure 14 shows the avidity index of antibodies produced in rabbits treated with exemplary VLP compositions expressed in CHO cells and purified by Tangential Flow Filtration (TFF) and Anion Exchange (AEX) Chromatography.
- amino acid in its broadest sense, refers to any compound and/or substance that can be incorporated into a polypeptide chain.
- an amino acid has the general structure H 2 N-C(H)(R)-COOH.
- an amino acid is a naturally occurring amino acid.
- an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a d-amino acid; in some embodiments, an amino acid is an 1-amino acid.
- Standard amino acid refers to any of the twenty standard 1-amino acids commonly found in naturally occurring peptides.
- Nonstandard amino acid refers to any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source.
- synthetic amino acid encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and/or substitutions.
- Amino acids, including carboxy- and/or amino-terminal amino acids in peptides can be modified by methylation, amidation, acetylation, protecting groups, and/or substitution with other chemical groups that can change the peptide's circulating half-life without adversely affecting their activity. Amino acids may participate in a disulfide bond.
- Amino acids may comprise one or posttranslational modifications, such as association with one or more chemical entities (e.g., methyl groups, acetate groups, acetyl groups, phosphate groups, formyl moieties, isoprenoid groups, sulfate groups, polyethylene glycol moieties, lipid moieties, carbohydrate moieties, biotin moieties, etc.).
- chemical entities e.g., methyl groups, acetate groups, acetyl groups, phosphate groups, formyl moieties, isoprenoid groups, sulfate groups, polyethylene glycol moieties, lipid moieties, carbohydrate moieties, biotin moieties, etc.
- amino acid is used interchangeably with "amino acid residue,” and may refer to a free amino acid and/or to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a
- Antigen refers to a substance containing one or more epitopes (either linear, conformational or both) that are recognized by antibodies.
- an antigen is or comprises a virus or a viral polypeptide.
- the term "antigen” refers to a subunit antigen (i.e., an antigen which is separate and discrete from a whole virus with which the antigen is associated in nature; e.g., an antigen which is associated with a virus-like particle).
- a subunit antigen i.e., an antigen which is separate and discrete from a whole virus with which the antigen is associated in nature; e.g., an antigen which is associated with a virus-like particle.
- an antigen refers to killed, attenuated or inactivated viruses.
- an antigen is an "immunogen.”
- Amelioration is meant the prevention, reduction or palliation of a state, or improvement of the state of a subject. Amelioration includes, but does not require complete recovery or complete prevention of a disease, disorder or condition (e.g., HCMV infection).
- prevention refers to a delay of onset of a disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.
- Characteristic portion As used herein, the term a "characteristic portion" of a substance, in the broadest sense, is one that shares a designated degree of structural identity with intact substance. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance.
- a "characteristic portion" of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids.
- a characteristic portion of a substance is one that, in addition to the sequence and/or structural identity specified above, shares at least one functional characteristic with the relevant intact substance.
- a characteristic portion may be biologically active.
- Characteristic sequence is a sequence that is found in all members of a family of polypeptides or nucleic acids, and therefore can be used by those of ordinary skill in the art to define members of the family.
- Cytoplasmic domain As is known in the art, polypeptides sometimes have transmembrane, cytoplasmic, and/or extracellular domains.
- a "cytoplasmic domain" refers to a domain that has an attribute of being present in the cytoplasm. As will be appreciated, it is not required that every amino acid in a cytoplasmic domain be present in the cytoplasm.
- a cytoplasmic domain is characterized in that a designated stretch or portion of a protein is substantially located in the cytoplasm.
- amino acid or nucleic acid sequences may be analyzed using a variety of algorithms to predict protein subcellular localization (e.g., cytoplasmic localization).
- Dosage form As used herein, the terms “dosage form” and “unit dosage form” refer to a physically discrete unit of a therapeutic agent for the patient to be treated. Each unit contains a predetermined quantity of active material calculated to produce the desired therapeutic effect. It will be understood, however, that the total dosage of the composition will be decided by the attending physician within the scope of sound medical judgment.
- Dosing regimen is a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time.
- a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses.
- a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses.
- expression refers to one or more of the following events: (1) production of an R A template from a DNA sequence ⁇ e.g., by transcription); (2) processing of an RNA transcript ⁇ e.g. , by splicing, editing, 5 ' cap formation, and/or 3' end formation); (3) translation of an RNA into a polypeptide or protein; and/or (4) post-translational modification of a polypeptide or protein.
- Extracellular domain As is known in the art, polypeptides sometimes have transmembrane, cytoplasmic, and/or extracellular domains. In general, an "extracellular domain", as used herein, refers to a domain that has an attribute of being present outside a cell. As will be appreciated, it is not required that every amino acid in an extracellular domain be present outside the cell. For example, in some embodiments, an extracellular domain is characterized in that a designated stretch or portion of a protein is substantially located outside the cell. As is well known in the art, amino acid or nucleic acid sequences may be analyzed using a variety of algorithms to predict protein subcellular localization (e.g., extracellular localization). Exemplary such programs include psort (PSORT.org), Prosite
- Fusion protein generally refers to a polypeptide including at least two segments, each of which shows a high degree of amino acid identity to a peptide moiety that (1) occurs in nature, and/or (2) represents a functional domain of a polypeptide.
- a polypeptide containing at least two such segments is considered to be a fusion protein if the two segments are moieties that (1) are not included in nature in the same peptide, and/or (2) have not previously been linked to one another in a single polypeptide, and/or (3) have been linked to one another through action of the hand of man.
- the term “gene” may include gene regulatory sequences ⁇ e.g., promoters, enhancers, etc.) and/or intron sequences. It will further be appreciated that definitions of gene include references to nucleic acids that do not encode proteins but rather encode functional RNA molecules such as tR As, R Ai-inducing agents, etc.
- the term “gene” generally refers to a portion of a nucleic acid that encodes a protein; the term may optionally encompass regulatory sequences, as will be clear from context to those of ordinary skill in the art. This definition is not intended to exclude application of the term “gene” to non-protein- coding expression units but rather to clarify that, in most cases, the term as used in this document refers to a protein-coding nucleic acid.
- Gene product or expression product As used herein, the term “gene product” or
- expression product generally refers to an RNA transcribed from the gene (pre-and/or postprocessing) or a polypeptide (pre- and/or post-modification) encoded by an RNA transcribed from the gene.
- heterologous refers to a protein or polypeptide that is non-naturally occurring in a particular organism, such as a retrovirus or VLP. In some embodiments, a heterologous protein or polypeptide is non-naturally occurring in a particular retrovirus virion. As used herein, the term “heterologous” with respect to a protein domain generally refers to a protein domain that is non- naturally occurring in a particular protein.
- Immunogenic means capable of producing an immune response in a host animal against a non-host entity (e.g., an HCMV antigen). In certain embodiments, this immune response forms the basis of the protective immunity elicited by a vaccine against a specific infectious organism (e.g., an HCMV).
- a non-host entity e.g., an HCMV antigen
- Immune response refers to a response elicited in an animal.
- An immune response may refer to cellular immunity, humoral immunity or may involve both.
- An immune response may also be limited to a part of the immune system.
- an immunogenic composition may induce an increased IFNy response.
- an immunogenic composition may induce a mucosal IgA response (e.g., as measured in nasal and/or rectal washes).
- an immunogenic composition may induce a systemic IgG response (e.g., as measured in serum).
- an immunogenic composition may induce virus- neutralizing antibodies or a neutralizing antibody response.
- “reduce,” or grammatical equivalents indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of the treatment described herein.
- patient refer to a human or a non-human mammalian subject.
- the individual (also referred to as “patient” or “subject") being treated is an individual (fetus, infant, child, adolescent, or adult) suffering from a disease, for example, HCMV infection.
- the subject is at risk for HCMV infection.
- the subject is an immunosuppressed subject.
- the immunosuppressed subject is selected from the group consisting of an HIV-infected subject, an AIDS patient, a transplant recipient, a pediatric subject, and a pregnant subject.
- the subject has been exposed to HCMV infection.
- the subject is a human.
- Isolated refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from about 10%, about 20%>, about 30%>, about 40%>, about 50%>, about 60%>, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%o, about 97%, about 98%>, about 99%, or more than about 99% of the other components with which they were initially associated.
- isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%), about 98%>, about 99%, or more than about 99% pure.
- a substance is "pure” if it is substantially free of other components.
- calculation of percent purity of isolated substances and/or entities should not include excipients (e.g., buffer, solvent, water, etc.).
- Linker refers to, e.g., in a fusion protein, an amino acid sequence of an appropriate length other than that appearing at a particular position in the natural protein and is generally designed to be flexible and/or to interpose a structure, such as an a-helix, between two protein moieties.
- a linker allows two or more domains of a fusion protein to retain 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the biological activity of each of the domains.
- a linker may also be referred to as a spacer.
- nucleic acid refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain.
- a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage.
- nucleic acid refers to individual nucleic acid residues ⁇ e.g., nucleotides and/or nucleosides).
- nucleic acid refers to an oligonucleotide chain comprising individual nucleic acid residues.
- nucleic acid encompasses RNA as well as single and/or double-stranded DNA and/or cDNA.
- nucleic acid encompasses RNA as well as single and/or double-stranded DNA and/or cDNA.
- nucleic acid “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone.
- peptide nucleic acids which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.
- nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and/or encode the same amino acid sequence. Nucleotide sequences that encode proteins and/or RNA may include introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. A nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated.
- nucleic acid segment is used herein to refer to a nucleic acid sequence that is a portion of a longer nucleic acid sequence. In many embodiments, a nucleic acid segment comprises at least 3, 4, 5, 6, 7, 8, 9, 10, or more residues.
- a nucleic acid is or comprises natural nucleosides ⁇ e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxy cytidine); nucleoside analogs ⁇ e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl- cytidine, C5-methylcytidine, 2-aminoadenosine, 7-
- the present invention is specifically directed to "unmodified nucleic acids,” meaning nucleic acids ⁇ e.g., polynucleotides and residues, including nucleotides and/or nucleosides) that have not been chemically modified in order to facilitate or achieve delivery.
- nucleic acids e.g., polynucleotides and residues, including nucleotides and/or nucleosides
- compositions that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- Polypeptide As used herein, a "polypeptide”, generally speaking, is a string of at least two amino acids attached to one another by a peptide bond. In some embodiments, a polypeptide may include at least 3-5 amino acids, each of which is attached to others by way of at least one peptide bond. Those of ordinary skill in the art will appreciate that polypeptides sometimes include "non-natural" amino acids or other entities that nonetheless are capable of integrating into a polypeptide chain, optionally.
- Polyprotein As used herein, the term "polyprotein”, generally refers to a protein that, after synthesis, may be cleaved to produce several functionally distinct polypeptides.
- a polyprotein is typically encoded by a single amino acid sequence. In some embodiments, an uncleaved polyprotein retains biological activity of its component parts.
- Some viruses produce such polyproteins, e.g., a Gag polyprotein, which can be retained as a functional polyprotein or can be processed into several functionally distinct polypeptides.
- the Gag polyprotein is divided into three domains: the membrane binding domain, which targets the Gag polyprotein to the cellular membrane; the interaction domain which promotes Gag
- the form of the Gag protein that mediates viral particle assembly is the polyprotein.
- Self-assembling portion refers to a relevant stretch of an entity that adopts a defined arrangement without guidance or management from an outside source.
- the entity is a protein.
- the entity is a polyprotein.
- the relevant stretch is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more residues.
- Self-assembly may be exhibited, for example, within the context of a cell (e.g., in vivo). Alternatively or
- self-assembly may be exhibited outside the context of a cell (e.g., in vitro).
- Self- assembly may be intramolecular (e.g., folding) and/or intermolecular.
- self-assembly may be macromolecular whereby entities self-assemble into a complex and/or extended macromolecular structure.
- Self-assembled entities may exhibit a wide range of structural motifs, including, but not limited to particles, fibers, sheets, and ribbons.
- self-assembly of an entity is important for a biological function of the entity. For example, in some embodiments, self assembly of a lipid leads to formation of a cell membrane structure.
- a protein e.g., a viral structural protein
- a particle structure e.g., a viral particle structure
- a viral structural polyprotein may contain a targeting sequence that is capable of directing its localization to a cellular membrane of its host cell (e.g., plasma membrane, endosome, etc.) from which the viral structural polyprotein may bud out to form a VLP that contains host cellular membranous material surrounding the viral structural polyprotein.
- Substantial homology is used herein to refer to a comparison between amino acid or nucleic acid sequences. As will be appreciated by those of ordinary skill in the art, two sequences are generally considered to be “substantially homologous” if they contain homologous residues in corresponding positions. Homologous residues may be identical residues. Alternatively, homologous residues may be non-identical residues with appropriately similar structural and/or functional characteristics. For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as “hydrophobic” or “hydrophilic” amino acids, and/or as having "polar” or “non-polar” side chains. Substitution of one amino acid for another of the same type may often be considered a "homologous" substitution.
- amino acid or nucleic acid sequences may be compared using any of a variety of algorithms, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP, gapped BLAST, and PSI- BLAST for amino acid sequences.
- Exemplary such programs are described in Altschul, et al, Basic local alignment search tool, J. Mol. Biol, 215(3): 403-410, 1990; Altschul, et al, Methods in Enzymology 266:460-480 (1996); Altschul, et al, "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402, 1997;
- two sequences are considered to be substantially homologous if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%o, 99%) or more of their corresponding residues are homologous over a relevant stretch of residues.
- the relevant stretch is a complete sequence.
- the relevant stretch is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more residues.
- Substantial identity is used herein to refer to a comparison between amino acid or nucleic acid sequences. As will be appreciated by those of ordinary skill in the art, two sequences are generally considered to be “substantially identical” if they contain identical residues in corresponding positions. As is well known in this art, amino acid or nucleic acid sequences may be compared using any of a variety of algorithms, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences. Exemplary such programs are described in Altschul, et al., Basic local alignment search tool, J. Mol.
- two sequences are considered to be substantially identical if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of their corresponding residues are identical over a relevant stretch of residues.
- the relevant stretch is a complete sequence.
- the relevant stretch is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more residues.
- Susceptible to An individual who is "susceptible to" a disease, disorder, or condition ⁇ e.g., HCMV infection) is at risk for developing the disease, disorder, or condition.
- an individual who is susceptible to a disease, disorder, or condition does not display any symptoms of the disease, disorder, or condition.
- an individual who is susceptible to a disease, disorder, or condition has not been diagnosed with the disease, disorder, and/or condition.
- an individual who is susceptible to a disease, disorder, or condition is an individual who has been exposed to conditions associated with development of the disease, disorder, or condition (e.g., the individual has been exposed to HCMV).
- Symptoms are reduced: According to the present invention, "symptoms are reduced" when one or more symptoms of a particular disease, disorder or condition is reduced in magnitude ⁇ e.g., intensity, severity, etc.) or frequency. For purposes of clarity, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom. It is not intended that the present invention be limited only to cases where the symptoms are eliminated. The present invention specifically contemplates treatment such that one or more symptoms is/are reduced (and the condition of the subject is thereby "improved"), albeit not completely eliminated.
- therapeutically effective amount refers to an amount sufficient to confer a therapeutic effect on the treated subject, at a reasonable benefit/risk ratio applicable to any medical treatment.
- the therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect).
- therapeutically effective amount refers to an amount of a therapeutic protein or composition effective to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying the onset of the disease, and/or also lessening the severity or frequency of symptoms of the disease.
- a therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses.
- a therapeutically effective amount (and/or an appropriate unit dose within an effective dosing regimen) may vary, for example, depending on route of administration, on combination with other pharmaceutical agents.
- the specific therapeutically effective amount (and/or unit dose) for any particular patient may depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific pharmaceutical agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and/or rate of excretion or metabolism of the specific immunogenic composition employed; the duration of the treatment; and like factors as is well known in the medical arts.
- Transmembrane domain As is known in the art, polypeptides sometimes have transmembrane, cytoplasmic, and/or extracellular domains.
- a transmembrane domain refers to a domain having an attribute of being present in the membrane (e.g., spanning a portion or all of a cellular membrane). As will be appreciated, it is not required that every amino acid in a transmembrane domain be present in the membrane.
- a transmembrane domain is characterized in that a designated stretch or portion of a protein is substantially located in the membrane.
- amino acid or nucleic acid sequences may be analyzed using a variety of algorithms to predict protein subcellular localization (e.g., transmembrane localization).
- Exemplary such programs include psort (PSORT.org), Prosite (prosite.expasy.org), among others.
- treatment refers to any administration of an immunogenic composition that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of a particular disease, disorder, and/or condition (e.g., HCMV infection) or the predisposition toward the disease.
- a particular disease, disorder, and/or condition e.g., HCMV infection
- Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
- such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
- the term “treating” refers to the vaccination of a patient.
- Vaccination refers to the administration of a composition intended to generate an immune response, for example to a disease-causing agent (e.g., HCMV).
- a disease-causing agent e.g., HCMV
- vaccination can be administered before, during, and/or after exposure to a disease-causing agent, and in certain embodiments, before, during, and/or shortly after exposure to the agent.
- vaccination includes multiple administrations, appropriately spaced in time, of a vaccinating composition.
- Vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is associated.
- vectors are capable of extra-chromosomal replication and/or expression of nucleic acids to which they are linked in a host cell such as a eukaryotic and/or prokaryotic cell.
- vectors capable of directing the expression of operatively linked genes are referred to herein as "expression vectors.”
- the present invention provides methods and compositions useful for prophylaxis, treatment, and/or study of human cytomegalovirus (HCMV) infection.
- the present invention provides virus-like particles (VLPs) which comprise one or more Moloney Murine leukemia virus (MMLV) core proteins and include one or more HCMV epitopes, such as, for example, from HCMV envelope glycoproteins gB and/or gH and/or tegument protein pp65.
- VLPs virus-like particles
- MMLV Moloney Murine leukemia virus
- HCMV epitopes such as, for example, from HCMV envelope glycoproteins gB and/or gH and/or tegument protein pp65.
- the present invention encompasses the recognition that a combination of antigens (e.g., envelope glycoproteins and structural proteins) can lead to improved induction of beneficial immune responses, for example that include both a humoral response (e.g., production of neutralizing antibodies) and a cellular response (e.g., T- cell activation).
- a combination of antigens e.g., envelope glycoproteins and structural proteins
- beneficial immune responses for example that include both a humoral response (e.g., production of neutralizing antibodies) and a cellular response (e.g., T- cell activation).
- Provided VLPs may be characterized in that they contain no viral R A or DNA and are non-infectious.
- provided VLPs do contain viral RNA or DNA and are infectious.
- provided VLPs are useful as a DNA vaccine.
- the humoral immune response in a subject is sustained for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 12 months, at least about 13 months, at least about 14 months, at least about 15 months, at least about 16 months, at least about 17 months, at least about 18 months, at least about 19 months, at least about 20 months, at least about 21 months, at least about 22 months, at least about 23 months, at least about 24 months, at least about 28 months, at least about 32 months, at least about 36 months, at least about 40 months, at least about 44 months, at least about 48 months, or longer.
- the cellular immune response in a subject is sustained for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least 12 months.
- provided VLPs are surrounded by a lipid membrane, optionally containing one or more epitopes from viral envelope glycoproteins (e.g., gB and/or gH) which are antigens that play a role in induction of virus-neutralizing antibodies.
- viral envelope glycoproteins e.g., gB and/or gH
- provided VLPs contain one or more epitopes from viral structural proteins (e.g., pp65) which are antigens that play a role in induction of cellular immune responses (e.g., T-cell response).
- viral structural proteins e.g., pp65
- utilized viral structural proteins both stimulate formation of T-helper cells (T H ) and also induce cytotoxic T lymphocytes (CTL) against HCMV.
- the present invention provides variants of viral envelope glycoproteins (e.g., gB and/or gH).
- a variant viral envelope glycoprotein is or comprises a fusion protein.
- a variant of a viral glycoprotein comprises a heterologous protein domain (e.g., a transmembrane and/or cytoplasmic domain from a different protein).
- a variant of a viral structural protein comprises a heterologous antigen or epitope.
- the present invention provides VLPs comprising variants of viral structural proteins.
- a variant of a viral structural protein is or comprises a fusion protein.
- VLPs Virus-Like Particles
- Retroviruses are enveloped RNA viruses that belong to the family Retroviridae.
- RNA is transcribed into DNA via the enzyme reverse transcriptase. DNA is then incorporated into the host cell's genome by an integrase enzyme and thereafter replicates as part of the host cell's DNA.
- the Retroviridae family includes the following genus Alpharetrovirus, Betaretrovirus, Gammearetrovirus,
- Retroviruses produce an infectious virion containing a spherical nucleocapsid (the viral genome in complex with viral structural proteins) surrounded by a lipid bilayer derived from the host cell membrane.
- Retroviral vectors can be used to generate enveloped virions that are infectious and either replication-competent or replication-defective.
- Replication-competent infectious retroviral vectors contain all of the necessary genes for virion synthesis and continue to propagate themselves once infection of the host cell occurs.
- Replication-defective infectious retroviral vectors do not spread after the initial infection. This is accomplished by replacement of most of the coding regions of the retrovirus with genes or nucleotide sequences to be transferred; so that the vector is incapable of making proteins required for additional rounds of replication.
- retroviral vectors can be used to generate virus-like particles (VLPs) that lack a retrovirus-derived genome and are both non-infectious and non- replicating. Because of VLPs advantageous properties, VLPs may be utilized as an antigen delivery system. Furthermore, because VLPs are non-infectious, they can be administered safely as an immunogenic composition (e.g., a vaccine). VLPs are generally structurally similar to enveloped virions described above, but lack a retrovirus-derived genome, making it unlikely that viral replication will occur.
- capsid proteins e.g., Gag
- viruses e.g., murine leukemia viruses, such as Moloney Murine leukemia virus (MMLV)
- MMLV Moloney Murine leukemia virus
- VLPs including single or multiple capsid proteins either with or without envelope proteins and/or surface glycoproteins have been prepared.
- VLPs are non-enveloped and assemble by expression of just one major capsid protein, as shown for VLPs prepared from hepadnaviruses (e.g., EngerixTM, GSK and Recombivax HBTM, Merck), papillomaviruses (e.g., CervarixTM , GSK and GardasilTM, Merck), paroviruses, or polyomaviruses.
- VLPs are enveloped and can comprise multiple antigenic proteins found in the corresponding native virus.
- VLPs typically resemble their corresponding native virus and can be multivalent particulate structures.
- antigenic proteins may be presented internally within the VLP, as a component of the VLP structure, and/or on the surface of the VLP.
- the present invention encompasses the recognition that presentation of an antigen in the context of a VLP is advantageous for induction of neutralizing antibodies against the antigen as compared to other forms of antigen presentation, e.g., soluble antigens not associated with a VLP.
- Neutralizing antibodies most often recognize tertiary or quarternary structures; this often requires presenting antigenic proteins, like envelope glycoproteins, in their native viral conformation.
- VLPs may be useful for presenting antigens in a context which induces cellular immunity (e.g., T cell response).
- the present invention further encompasses the insight that use of antigen
- the present invention utilizes VLPs comprised of one or more retroviral structural proteins (e.g., Gag).
- a structural protein for use in accordance with the present invention is Alpharetrovirus (e.g., Avian Leukosis Virus), Betaretrovirus (Mouse Mammary Tumor Virus), Gammearetrovirus (Murine Leukemia Virus), Deltaretrovirus (Bovine Leukemia Virus), Epsilonretrovirus (Walley Dermal Sarcoma Virus), Lentivirus (Human Immunodeficiency Virus 1) or Spumavirus (Chimpanzee Foamy Virus) structural protein.
- Alpharetrovirus e.g., Avian Leukosis Virus
- Betaretrovirus Mammary Tumor Virus
- Gammearetrovirus Murine Leukemia Virus
- Deltaretrovirus Bovine Leukemia Virus
- Epsilonretrovirus Wiley Dermal Sarcoma Virus
- Lentivirus Human Immunodefic
- a structural polyprotein is a Murine Leukemia Virus (MLV) structural protein. Genomes of these retroviruses are readily available in databases. The Gag genes of all these retroviruses have an overall structural similarity and within each group of retroviruses are conserved at the amino acid level. Retroviral Gag proteins primarily function in viral assembly. The Gag gene in the form of a polyprotein gives rise to the core structural proteins of the VLP. The MLV Gag gene encodes a 65kDa polyprotein precursor which is proteo lyrically cleaved into 4 structural proteins (Matrix (MA); pi 2; Capsid (CA); and
- Retroviruses assemble immature capsid composed of the Gag polyprotein formed from the Gag polypeptide but devoid of other viral elements like viral protease with Gag as the structural protein of the immature virus particle. Functionally, the Gag polyprotein is divided into three domains: the membrane binding domain, which targets the Gag polyprotein to the cellular membrane; the interaction domain which promotes Gag polymerization; and the late domain which facilitates release of nascent virions from the host cell.
- the form of the Gag protein that mediates viral particle assembly is the polyprotein.
- a retroviral structural protein for use in accordance with the present invention is a Gag polypeptide.
- Gag polypeptide is the retrovirus derived structural polypeptide that is responsible for formation of the VLPs described herein and refers to a polypeptide sequence whose amino acid sequence includes at least one characteristic sequence of Gag.
- a wide variety of Gag sequences from various retroviruses are known in the art and those of ordinary skill in the art, referring to such sequences, can readily identify sequences that are characteristic of Gag proteins generally, and/or of particular Gag polypeptides.
- An exemplary Gag polypeptide for use in accordance with the present invention is shown as SEQ ID NO: l below.
- a suitable Gag polypeptide is
- a Gag polypeptide may be a modified retroviral Gag polypeptide containing one or more amino acid substitutions, deletions, and/or insertions as compared to a wild-type or naturally-occurring Gag polypeptide (e.g., SEQ ID NO: l), while retaining substantial self-assembly activity.
- a Gag polypeptide suitable for the present invention is substantially homologous to an MMLV Gag polypeptide (SEQ ID NO: l).
- a Gag polypeptide suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 1.
- a Gag polypeptide suitable for the present invention is substantially identical to an MMLV Gag polypeptide (SEQ ID NO:l).
- a Gag polypeptide suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: l .
- AAGACCCCAGACCTCCCTCCTGACCCTAGATGAC SEQ ID NO:2
- a Gag protein typically includes a large C-terminal extension which may contain retroviral protease, reverse transcriptase, and integrase enzymatic activity.
- Retroviral Gag protein alone e.g., lacking a C-terminal extension, lacking one or more of genomic R A, reverse transcriptase, viral protease, or envelope protein
- Retroviral Gag polyprotein alone can oligomerize and assemble into VLPs.
- a Gag polypeptide for use in accordance with the present invention lacks a C-terminal extension and/or contains a modified C-terminal extension.
- a Gag polypeptide may optionally include one or more additional polypeptides (e.g., a heterologous antigen).
- a Gag polypeptide is co-expressed with a heterologous antigen (e.g., under separate promoters and/or as separate proteins).
- a Gag polypeptide is expressed as a fusion protein with a heterologous antigen.
- the Gag polypeptide can be linked to a heterologous antigen to create a fusion protein without altering Gag function.
- a coding sequence for a heterologous antigen may be spliced into the Gag polypeptide coding sequence, e.g., at the 3' end of the Gag polypeptide coding sequence.
- a coding sequence for a heterologous antigen may be spliced in frame into the Gag polypeptide coding sequence.
- a Gag polypeptide-coding sequence and heterologous antigen may be expressed by a single promoter.
- a heterologous antigen is inserted at (e.g., fused to) the C-terminus of a Gag polypeptide.
- fusion of a self- assembling Gag polypeptide to a heterologous antigen creates a fusion protein that acts as unmodified Gag and as a result will allow the antigen to be incorporated into the structural components of a resulting VLP.
- VLP structural components serve as effective immunogens (e.g., for induction of cellular immune response).
- provided VLPs may comprise a retroviral Gag polypeptide (e.g., MMLV Gag) and a structural component of HCMV (e.g., pp65).
- pp65 is incorporated into the VLP and serves as an antigen for eliciting an immune response against HCMV.
- a suitable Gag polypeptide fusion protein includes all or a portion of a Gag polypeptide that is substantially homologous to a known retroviral Gag polypeptide and all or a portion of a pp65 polypeptide that is substantially homologous to a known pp65 polypeptide.
- a Gag-pp65 polypeptide fusion protein may contain one or more amino acid substitutions, deletions, and/or insertions as compared to a wild-type or naturally-occurring Gag polypeptide and/or pp65 polypeptide, while retaining substantial self-assembly activity.
- a Gag-pp65 polypeptide fusion protein suitable for the present invention is substantially homologous to SEQ ID NO:4.
- a Gag-pp65 polypeptide fusion protein suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO:4.
- a Gag-pp65 polypeptide fusion protein suitable for the present invention is substantially identical to SEQ ID NO:4.
- a Gag-pp65 polypeptide fusion protein suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:4.
- AAG ATTGTC C C A AG AAAC C AC G AGG AC C TC GGGG AC C AAG AC C C C AG AC C TC C
- AAG AATT AG AAGGG AAAC AG AGG AAAAGG AGG AAC GC C G AC GG AC TG AGG AT
- ATGGG AC AG AC C GTC AC AAC AC C C C TG AGC C TG AC C C TGGG AC ATTGG AAAG A C GTGG AG AGG ATC GC AC AT AAC C AG AGC GTGG AC GTG AAG AAAC GGAGATGG GTCACATTCTGCAGTGCTGAGTGGCCAACTTTTAATGTGGGATGGCCCCGAGA CGGCACTTTCAACAGGGATCTGATCACCCAGGTGAAGATCAAGGTCTTTAGCC CAGGACCTCACGGACATCCAGACCAGGTGCCTTATATCGTCACCTGGGAGGCA
- AAAGG ATT AG AAGGG AAAC TG AGG AAAAGG AGG AAC GC C GAC GGAC C G AGG A
- nucleic acids which encode a Gag polypeptide or a characteristic portion of a Gag polypeptide.
- nucleic acids can be DNA or R A, and can be single stranded or double-stranded.
- inventive nucleic acids may include one or more non-natural nucleotides; in other embodiments, inventive nucleic acids include only natural nucleotides.
- the present invention utilizes VLPs comprised of one or more envelope polypeptides from HCMV (e.g., gB and/or gH).
- HCMV e.g., gB and/or gH
- envelope polypeptide refers to a polypeptide sequence whose amino acid sequence includes at least one characteristic sequence of an envelope glycoprotein.
- envelope glycoprotein sequences from various viruses including, but not limited to HCMV, are known in the art and those of ordinary skill in the art, referring to such sequences, can readily identify sequences that are characteristic of envelope glycoproteins generally, and/or of particular envelope glycoproteins.
- an envelope polypeptide comprises a cytoplasmic, transmembrane and/or extracellular portion or domain.
- an envelope polypeptide from HCMV includes a transmembrane and cytoplasmic domain that is not found in nature in the HCMV protein.
- an envelope polypeptide from HCMV includes a
- transmembrane and cytoplasmic domain from another HCMV protein (e.g., gB or gH).
- an envelope polypeptide from HCMV includes a transmembrane domain and cytoplasmic domain found in nature in vesicular stomatitis virus (VSV).
- VSV vesicular stomatitis virus
- polypeptides sometimes have transmembrane, cytoplasmic, and/or extracellular domains.
- a "transmembrane domain” refers to a domain that has an attribute of being present in the membrane (e.g., spanning a portion or all of a cellular membrane).
- transmembrane domain is characterized in that a designated stretch or portion of a protein is substantially located in the membrane.
- amino acid or nucleic acid sequences may be analyzed using a variety of algorithms to predict protein subcellular localization (e.g., transmembrane localization).
- Exemplary such programs include psort (PSORT.org), Prosite (prosite.expasy.org), among others.
- a "cytoplasmic domain" refers to a domain that has an attribute of being present in the cytoplasm. As will be appreciated, it is not required that every amino acid in a cytoplasmic domain be present in the cytoplasm.
- a cytoplasmic domain is characterized in that a designated stretch or portion of a protein is substantially located in the cytoplasm.
- amino acid or nucleic acid sequences may be analyzed using a variety of algorithms to predict protein subcellular localization (e.g., cytoplasmic localization).
- Exemplary such programs include psort (PSORT.org), Prosite (prosite.expasy.org), among others.
- VSV-G functions to target the viral glycoprotein to the cell membrane (Compton T et al, 1989 Proc Natl Acad Sci USA 86:4112-4116).
- the present invention encompasses the recognition that VLPs containing a structural component of a virus (e.g., MLV) and one or more heterologous surface antigens (e.g., envelope protein) are especially effective for antigen delivery and induction of an immune response against the heterologous antigen.
- a structural component of a virus e.g., MLV
- heterologous surface antigens e.g., envelope protein
- Envelope proteins of HCMV are important targets for production of neutralizing antibodies against HCMV, as neutralizing antibodies are generally able to prevent infection.
- Therapies for HCMV infection such as a gB subunit vaccine, have been developed and tested in experimental animals and clinical studies. Results from such studies, however, have demonstrated that in humans, the antibody response was not long-lived and not sufficiently effective for the treatment of HCMV in all cases.
- an HCMV vaccine comprising one or more envelope polypeptide antigens presented in their native conformation on the surface of a VLP leads to induction of neutralizing antibodies (e.g., via a humoral immune response) and an HCMV vaccine comprising one or more structural protein antigens (e.g., tegument protein pp65) leads to induction of helper T cells (T# lymphocytes) and cytotoxic T cells (CTL) (e.g., via a cell-mediated immune response).
- T# lymphocytes helper T cells
- CTL cytotoxic T cells
- Neutralizing antibodies are generally formed against viral envelope proteins, and especially against HCMV glycoproteins gB and gH.
- T H cells are stimulated by tegument structural proteins of a virus, such as, for example, HCMV pp65 (ppUL83).
- pp65 plays an important role in induction of a CTL response against HCMV.
- VLPs may comprise any heterologous antigen, including heterologous antigens from HCMV.
- a VLP in accordance with the present invention comprises one or more HCMV envelope polypeptides.
- a VLP in accordance with the present invention comprises one or more HCMV structural polypeptides.
- a VLP in accordance with the present invention comprises one or more HCMV envelope polypeptides and one or more HCMV structural polypeptides.
- glycoprotein complex of HCMV is the gB complex
- HCMV gB polypeptide amino acid and nucleic acid sequence is shown below as SEQ ID NO:7 and SEQ ID NO:8, respectively.
- a suitable gB polypeptide is substantially homologous to a known HCMV gB polypeptide.
- a gB polypeptide may be a modified HCMV gB polypeptide containing one or more amino acid substitutions, deletions, and/or insertions as compared to a wild-type or naturally- occurring gB polypeptide (e.g., SEQ ID NO:7).
- a gB polypeptide suitable for the present invention is substantially homologous to an HCMV gB polypeptide (SEQ ID NO:7).
- an HCMV polypeptide suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO:7.
- a gB polypeptide suitable for the present invention is substantially identical to an HCMV gB polypeptide (SEQ ID NO:7).
- a gB polypeptide suitable for the present invention has an amino acid sequence at least 50%>, 55%, 60%>, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:7.
- a gB polypeptide for use in accordance with the present invention lacks a transmembrane domain and/or cytoplasmic domain and/or contains a modified transmembrane domain and/or cytoplasmic domain.
- a gB polypeptide may optionally include one or more additional polypeptides (e.g., a heterologous transmembrane domain and/or cytoplasmic domain polypeptide).
- a gB polypeptide is expressed as a fusion protein with a heterologous polypeptide.
- the gB polypeptide can be linked to a heterologous polypeptide to create a fusion protein without altering gB function and/or antigenicity.
- a coding sequence for a heterologous polypeptide may be spliced into the gB polypeptide coding sequence, e.g., at the 3' end of the gB polypeptide coding sequence.
- a coding sequence for a heterologous polypeptide may be spliced in frame into the gB polypeptide coding sequence.
- a gB polypeptide-coding sequence and heterologous polypeptide may be expressed by a single promoter.
- a heterologous polypeptide is inserted at (e.g., fused to) the C-terminus of a gB polypeptide.
- a heterologous polypeptide is or comprises a
- VSV Vesicular Stomatitis Virus
- a gB that is lacking a transmembrane domain and/or cytoplasmic domain is fused to a transmembrane domain and/or cytoplasmic domain from VSV.
- An exemplary gB- VSV fusion polypeptide for use in accordance with the present invention is shown below as SEQ ID NO: 10.
- a suitable gB-VSV polypeptide fusion protein includes all or a portion of a gB polypeptide that is substantially homologous to a known gB polypeptide and all or a portion of a VSV polypeptide that is substantially homologous to a known VSV polypeptide.
- a gB - VSV polypeptide fusion protein may contain one or more amino acid substitutions, deletions, and/or insertions as compared to a wild-type or naturally-occurring gB and/or VSV polypeptide.
- a gB-VSV polypeptide fusion protein suitable for the present invention is substantially homologous to SEQ ID NO: 10.
- a gB-VSV polypeptide fusion protein suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 10.
- a gB-VSV polypeptide fusion protein suitable for the present invention is substantially identical to SEQ ID NO: 10.
- a gB-VSV polypeptide fusion protein suitable for the present invention has an amino acid sequence at least 50%>, 55%, 60%>, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 10.
- gB-G refers to a HMCV gB - VSV TM/CTD fusion protein.
- the gc III complex contains glycoproteins gH (UL75), gL (UL115) and gO
- HCMV encodes two gH/gL complexes: gH/gL/gO and a gH/gL/UL128/UL130/UL131 complex (Wang D and Shenk T 2005 Proc Natl Acad USA
- the gO-containing complex is generally sufficient for fibroblast infection with HCMV, whereas the UL128/UL130/UL131-containing complex is needed in order for HCMV to infect endothelial and epithelial cells (Wang D and Shenk T 2005 J Virol 79 10330-8).
- Natural infection with HCMV typically elicits high titer neutralizing antibodies specific for epithelial cell entry and it has been demonstrated that antibodies against gH/gL/UL128/UL130/UL131 epitopes may comprise a significant component of this activity (Macagno A et al., 2010 J Virol 84: 1005- 13).
- HCMV gH polypeptide amino acid and nucleic acid sequence is shown below as SEQ ID NO: 13 and SEQ ID NO: 14, respectively.
- a suitable gH polypeptide is substantially homologous to a known HCMV gH polypeptide.
- a gH polypeptide may be a modified HCMV gH polypeptide containing one or more amino acid substitutions, deletions, and/or insertions as compared to a wild-type or naturally- occurring gH polypeptide (e.g., SEQ ID NO: 13).
- a gH polypeptide suitable for the present invention is substantially homologous to an HCMV gH polypeptide (SEQ ID NO: 13).
- an HCMV gH polypeptide suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 13.
- a gH polypeptide suitable for the present invention is substantially identical to an HCMV gH polypeptide (SEQ ID NO: 13).
- a gH polypeptide suitable for the present invention has an amino acid sequence at least 50%>, 55%>, 60%>, 65%>, 70%>, 75%>, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 13.
- a gH polypeptide for use in accordance with the present invention lacks a transmembrane domain and/or cytoplasmic domain and/or contains a modified transmembrane domain and/or cytoplasmic domain.
- a gH polypeptide may optionally include one or more additional polypeptides (e.g., a heterologous transmembrane domain and/or cytoplasmic domain polypeptide).
- a gH polypeptide is expressed as a fusion protein with a heterologous polypeptide.
- the gH polypeptide can be linked to a heterologous polypeptide to create a fusion protein without altering gH function and/or antigenicity.
- a coding sequence for a heterologous polypeptide may be spliced into the gH polypeptide coding sequence, e.g., at the 3' end of the gH polypeptide coding sequence.
- a coding sequence for a heterologous polypeptide may be spliced in frame into the gH polypeptide coding sequence.
- a gH polypeptide-coding sequence and heterologous polypeptide may be expressed by a single promoter.
- a heterologous polypeptide is inserted at (e.g., fused to) the C-terminus of a gH polypeptide.
- a heterologous polypeptide is or comprises a
- VSV Vesicular Stomatitis Virus
- a gH that is lacking a transmembrane domain and/or cytoplasmic domain is fused to a transmembrane domain and/or cytoplasmic domain from VSV.
- An exemplary gH- VSV fusion polypeptide for use in accordance with the present invention is shown below as SEQ ID NO: 16.
- a suitable gH-VSV polypeptide fusion protein includes all or a portion of a gH polypeptide that is substantially homologous to a known HCMV gH
- a gH - VSV polypeptide fusion protein may contain one or more amino acid substitutions, deletions, and/or insertions as compared to a wild-type or naturally-occurring gH and/or VSV polypeptide.
- a gH-VSV polypeptide fusion protein suitable for the present invention is substantially homologous to SEQ ID NO: 16.
- a gH-VSV polypeptide fusion protein suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%>, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 16.
- a gH-VSV polypeptide fusion protein suitable for the present invention is substantially identical to SEQ ID NO: 16.
- a gH-VSV polypeptide fusion protein suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 16.
- gH-G refers to a HMCV gH - VSV TM/CTD fusion protein.
- CTTGGAAAGTAA SEP ID NO: 17
- TM and CTD underlined
- a gH polypeptide includes a transmembrane domain and/or cytoplasmic domain found in gB.
- An exemplary nucleotide encoding an HCMV gH - HCMV gB TM/CTD fusion polypeptide for use in accordance with the present invention is shown below as SEQ ID NO:20.
- an HCMV gH - HCMV gB TM/CTD polypeptide suitable for the present invention is substantially homologous to the polypeptide encoded by SEQ ID NO:20.
- an HCMV gH - HCMV gB TM/CTD polypeptide suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the polypeptide encoded by SEQ ID NO:20.
- an HCMV gH - HCMV gB TM/CTD polypeptide suitable for the present invention is substantially identical to the polypeptide encoded by SEQ ID NO:20.
- an HCMV gH - HCMV gB TM/CTD polypeptide suitable for the present invention has an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%o, 99%) or more identical to the polypeptide encoded by SEQ ID NO:20.
- HCMV gH - HCMV gB TM/CTD Nucleotide Sequence SEP ID NO:20
- gcll complex containing gN (UL73) and gM (UL100), is of particular interest. Proteomic analyses of HCMV virions has demonstrated that gcll is the most abundantly expressed glycoprotein in virus particles, emphasizing its potential importance in protective immunity (Varnum SM et al., 2005 Human Gene Ther 16: 1143-50).
- HCMV infection elicits a gcll-specific antibody response in a majority of seropositive individuals (Shimamura M et al., 2006 J Virol 80:4591-600), and DNA vaccines containing gcll antigens gM and gN have been shown to elicit neutralizing antibody responses in rabbits and mice (Shen S et al., 2007 Vaccine 25:3319-27).
- pp65 pp65
- the cellular immune response to HCMV includes MHC class II restricted CD4 + and MHC class I restricted, cytotoxic CD8 + T-lymphocyte responses to a number of viral antigens, many of which are found in the viral tegument, the region of the viral particle that lies between the envelope and nucleocapsid.
- HCMV pp65 protein (UL83) has been shown to elicit a significant CD8 + T-lymphocyte response following HCMV infection
- This 65 kDa viral protein is one of the most abundantly expressed structural proteins of HCMV. Exemplary pp65 sequences are described herein.
- T-lymphocyte responses include the immediate early- 1
- a Gag polypeptide may optionally include one or more additional polypeptides (e.g., a heterologous antigen).
- a Gag polypeptide is co-expressed with a heterologous antigen (e.g., under separate promoters and/or as separate proteins).
- the Gag polypeptide can be co-expressed with a heterologous antigen without altering Gag function. Without wishing to be bound by any theory, it is thought that co-expression of a self-assembling Gag polypeptide with a heterologous envelope antigen will allow the antigen to be incorporated into the envelope or lipid bilayer of a resulting VLP.
- VLP envelope components serve as effective immunogens (e.g., for induction of humoral immune response).
- a Gag polypeptide is expressed as a fusion protein with a heterologous antigen.
- a coding sequence for a heterologous antigen may be spliced into the Gag polypeptide coding sequence, e.g., at the 3' end of the Gag polypeptide coding sequence.
- a coding sequence for a heterologous antigen may be spliced in frame into the Gag polypeptide coding sequence.
- a Gag polypeptide-coding sequence and heterologous antigen may be expressed by a single promoter.
- a heterologous antigen is inserted at (e.g., fused to) the C-terminus of a Gag polypeptide.
- VLP structural components serve as effective immunogens (e.g., for induction of cellular immune response).
- provided VLPs may comprise a retroviral gag polypeptide (e.g., MLV gag) and a structural component of HCMV (e.g., pp65).
- pp65 is incorporated into the VLP and serves as an antigen for eliciting an immune response against HCMV.
- Provided VLPs may contain a structural retroviral protein (e.g., Gag polypeptide) that is arranged and constructed such that it self-assembles to form the VLP and is positioned in the VLP interior.
- a structural retroviral protein e.g., Gag polypeptide
- provided VLPs contain an envelope protein (e.g., gB and/or gH) that is arranged and constructed such that one or more epitopes of the envelope protein (e.g., gB and/or gH) is positioned on the VLP surface.
- provided VLPs contain a fusion structural protein (e.g., Gag/pp65) that is arranged and constructed such that one or more epitopes of the structural protein (e.g., pp65) is positioned in the VLP interior.
- a fusion structural protein e.g., Gag/pp65
- a composition comprising VLPs will typically include a mixture of VLPs with a range of sizes. It is to be understood that the diameter values listed below correspond to the most frequent diameter within the mixture. In some embodiments > 90% of the vesicles in a composition will have a diameter which lies within 50% of the most frequent value (e.g., 1000 ⁇ 500 nm). In some embodiments the distribution may be narrower, e.g., > 90%) of the vesicles in a composition may have a diameter which lies within 40, 30, 20, 10 or 5% of the most frequent value. In some embodiments, sonication or ultra-sonication may be used to facilitate VLP formation and/or to alter VLP size. In some embodiments, filtration, dialysis and/or centrifugation may be used to adjust the VLP size distribution.
- VLPs produced in accordance with the methods of the present disclosure may be of any size.
- the composition may include VLPs with diameter in range of about 20 nm to about 300 nm.
- a VLP is
- VLPs within a population show an average diameter within a range bounded by a lower limit of 20, 30, 40, 50, 60, 70, 80, 90, or 100 nm and bounded by an upper limit of 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, or 170 nm.
- VLPs within a population show an average diameter within a range bounded by a lower limit of 20, 30, 40, 50, 60, 70, 80, 90, or 100 nm and bounded by an upper limit of 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, or 170 nm.
- VLPs in a population have a polydispersity index that is less than 0.5 (e.g., less than 0.45, less than 0.4, or less than 0.3).
- VLP diameter is determined by nanosizing. In some embodiments, VLP diameter is determined by electron microscopy.
- VLPs in accordance with the present invention may be prepared according to general methodologies known to the skilled person. For example, various nucleic acid molecules, genomes or reconstituted vectors or plasmids may be prepared using sequences of known viruses. Such sequences are available from banks, and material may be obtained from various collections, published plasmids, etc. These elements can be isolated and manipulated using techniques well known to the skilled artisan, or isolated from plasmids available in the art. Various synthetic or artificial sequences may also be produced from computer analysis or through (high throughput) screening of libraries. Recombinant expression of the polypeptides for VLPs requires construction of an expression vector containing a polynucleotide that encodes one or more polypeptide(s).
- the vector for production of the polypeptide may be produced by recombinant DNA technology using techniques known in the art.
- Expression vectors that may be utilized in accordance with the present invention include, but are not limited to mammalian expression vectors, baculovirus expression vectors, plant expression vectors (e.g., Cauliflower Mosaic Virus (CaMV), Tobacco Mosaic Virus (TMV)), plasmid expression vectors (e.g., Ti plasmid), among others.
- SEQ ID NO: 19 An exemplary VLP expression plasmid that may be used in accordance with the present invention is shown below as SEQ ID NO: 19:
- VLPs may be prepared according to techniques known in the art. For example, in some embodiments, provided VLPs may be produced in any available protein expression system. Typically, the expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce VLPs. In some embodiments, VLPs are produced using transient transfection of cells. In some embodiments, VLPs are produced using stably transfected cells.
- Typical cell lines that may be utilized for VLP production include, but are not limited to, mammalian cell lines such as human embryonic kidney (HEK) 293, WI 38, Chinese hamster ovary (CHO), monkey kidney (COS), HT1080, CIO, HeLa, baby hamster kidney (BHK), 3T3, CI 27, CV-1, HaK, NS/O, and L-929 cells.
- mammalian cell lines such as human embryonic kidney (HEK) 293, WI 38, Chinese hamster ovary (CHO), monkey kidney (COS), HT1080, CIO, HeLa, baby hamster kidney (BHK), 3T3, CI 27, CV-1, HaK, NS/O, and L-929 cells.
- BALB/c mouse myeloma line NSO/1, ECACC No: 85110503
- human retinoblasts PER.C6 (CruCell, Leiden, The Netherlands)
- monkey kidney CV1 line transformed by SV40 COS-7, ATCC CRL 1651
- human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al, J. Gen Virol, 36:59 (1977)
- baby hamster kidney cells BHK, ATCC CCL 10
- Chinese hamster ovary cells +/-DHFR CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Lubricants (AREA)
Priority Applications (22)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK12847559.7T DK2776567T3 (da) | 2011-11-11 | 2012-11-09 | Sammensætninger og fremgangsmåder til behandling af cytomegalovirus. |
| JP2014540570A JP6232544B2 (ja) | 2011-11-11 | 2012-11-09 | サイトメガロウイルスの治療のための組成物及び方法 |
| CA2889659A CA2889659C (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
| RU2014123465A RU2737530C1 (ru) | 2011-11-11 | 2012-11-09 | Композиции и способы для лечения цитомегаловируса |
| BR122019027913-6A BR122019027913B1 (pt) | 2011-11-11 | 2012-11-09 | Partícula vírus-like, composição farmacêutica compreendendo a referida partícula e método para produção da mesma |
| EP21152309.7A EP3854416A1 (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
| CN202010272504.4A CN111995664B (zh) | 2011-11-11 | 2012-11-09 | 用于治疗巨细胞病毒的组合物和方法 |
| KR1020147015909A KR102301463B1 (ko) | 2011-11-11 | 2012-11-09 | 사이토메갈로바이러스의 치료를 위한 조성물 및 방법 |
| AU2012335277A AU2012335277B2 (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
| CN201280066355.XA CN104271745A (zh) | 2011-11-11 | 2012-11-09 | 用于治疗巨细胞病毒的组合物和方法 |
| EP12847559.7A EP2776567B1 (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
| KR1020197025818A KR102340558B1 (ko) | 2011-11-11 | 2012-11-09 | 사이토메갈로바이러스의 치료를 위한 조성물 및 방법 |
| CN201711042348.7A CN107875382B (zh) | 2011-11-11 | 2012-11-09 | 用于治疗巨细胞病毒的组合物和方法 |
| ES12847559T ES2874233T3 (es) | 2011-11-11 | 2012-11-09 | Composiciones y métodos para el tratamiento de citomegalovirus |
| MX2014005653A MX353189B (es) | 2011-11-11 | 2012-11-09 | Composiciones y su uso en el tratamiento de citomegalovirus. |
| US14/357,423 US9777043B2 (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
| MX2017017128A MX387666B (es) | 2011-11-11 | 2012-11-09 | Composiciones y su uso en el tratamiento de citomegalovirus |
| BR112014011229-0A BR112014011229B1 (pt) | 2011-11-11 | 2012-11-09 | Partículas vírus-like (vlp), composição farmacêutica compreendendo a referida partícula, método de produção e uso da mesma |
| US15/683,355 US11248026B2 (en) | 2011-11-11 | 2017-08-22 | Compositions and methods for treatment of cytomegalovirus |
| AU2018203538A AU2018203538A1 (en) | 2011-11-11 | 2018-05-18 | Compositions and methods for treatment of cytomegalovirus |
| AU2020264275A AU2020264275B2 (en) | 2011-11-11 | 2020-11-03 | Compositions and methods for treatment of cytomegalovirus |
| US17/670,052 US12421283B2 (en) | 2011-11-11 | 2022-02-11 | Compositions and methods for treatment of cytomegalovirus |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161558800P | 2011-11-11 | 2011-11-11 | |
| US61/558,800 | 2011-11-11 | ||
| US201261654157P | 2012-06-01 | 2012-06-01 | |
| US61/654,157 | 2012-06-01 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/357,423 A-371-Of-International US9777043B2 (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
| US15/683,355 Continuation US11248026B2 (en) | 2011-11-11 | 2017-08-22 | Compositions and methods for treatment of cytomegalovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013068847A2 true WO2013068847A2 (en) | 2013-05-16 |
| WO2013068847A3 WO2013068847A3 (en) | 2014-10-30 |
Family
ID=48290708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2012/002854 Ceased WO2013068847A2 (en) | 2011-11-11 | 2012-11-09 | Compositions and methods for treatment of cytomegalovirus |
Country Status (14)
| Country | Link |
|---|---|
| US (3) | US9777043B2 (enExample) |
| EP (2) | EP2776567B1 (enExample) |
| JP (2) | JP6232544B2 (enExample) |
| KR (2) | KR102301463B1 (enExample) |
| CN (3) | CN111995664B (enExample) |
| AU (3) | AU2012335277B2 (enExample) |
| BR (2) | BR112014011229B1 (enExample) |
| CA (2) | CA3166278A1 (enExample) |
| DK (1) | DK2776567T3 (enExample) |
| ES (1) | ES2874233T3 (enExample) |
| MX (2) | MX353189B (enExample) |
| PT (1) | PT2776567T (enExample) |
| RU (2) | RU2737530C1 (enExample) |
| WO (1) | WO2013068847A2 (enExample) |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| JP2015536937A (ja) * | 2012-10-30 | 2015-12-24 | レッドヴァックス・ゲーエムベーハー | ヒトサイトメガロウイルス感染に対する組換え粒子ベースのワクチン |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| WO2016149426A1 (en) * | 2015-03-16 | 2016-09-22 | The Broad Institute, Inc. | Constructs for continuous monitoring of live cells |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| WO2017070613A1 (en) * | 2015-10-22 | 2017-04-27 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| WO2018075980A1 (en) * | 2016-10-21 | 2018-04-26 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10006096B2 (en) | 2012-03-27 | 2018-06-26 | Variation Biotechnologies Inc. | Methods for detection of anti-cytomegalovirus neutralizing antibodies |
| US10273285B2 (en) | 2014-06-18 | 2019-04-30 | Morphosys Ag | Fusion proteins and uses thereof |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10466232B2 (en) | 2009-06-18 | 2019-11-05 | Kiyatec Inc. | Co-culture bioreactor system |
| US10611800B2 (en) | 2016-03-11 | 2020-04-07 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| WO2021048081A1 (en) | 2019-09-09 | 2021-03-18 | Glaxosmithkline Biologicals Sa | Immunotherapeutic compositions |
| US11248026B2 (en) | 2011-11-11 | 2022-02-15 | Variation Biotechnologies Inc. | Compositions and methods for treatment of cytomegalovirus |
| US11406703B2 (en) | 2020-08-25 | 2022-08-09 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US11629172B2 (en) | 2018-12-21 | 2023-04-18 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US11857622B2 (en) | 2020-06-21 | 2024-01-02 | Pfizer Inc. | Human cytomegalovirus GB polypeptide |
| US12049480B2 (en) | 2015-10-20 | 2024-07-30 | Institut National De La Sante Et De La Recherche Medicale (INSERM) Paris, FRANCE | Methods and products for genetic engineering |
Families Citing this family (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9340800B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
| KR101678740B1 (ko) * | 2014-10-24 | 2016-11-23 | 단국대학교 천안캠퍼스 산학협력단 | 세포 부착활성 및 골분화 촉진활성을 나타내는 피브로넥틴 융합단백질 |
| WO2017162265A1 (en) * | 2016-03-21 | 2017-09-28 | Biontech Rna Pharmaceuticals Gmbh | Trans-replicating rna |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| CN110662556A (zh) | 2017-03-09 | 2020-01-07 | 哈佛大学的校长及成员们 | 癌症疫苗 |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| EP3784276A4 (en) * | 2018-04-24 | 2022-03-16 | Merck Sharp & Dohme Corp. | SCALABLE CHROMATOGRAPHY PROCEDURE FOR PURIFICATION OF HUMAN CYTOMEGALOVIRUS |
| JP7575096B2 (ja) | 2018-05-04 | 2024-10-29 | スパイバイオテック・リミテッド | ワクチン組成物 |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| WO2020154500A1 (en) | 2019-01-23 | 2020-07-30 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| MX2021011426A (es) | 2019-03-19 | 2022-03-11 | Broad Inst Inc | Metodos y composiciones para editar secuencias de nucleótidos. |
| WO2020214842A1 (en) | 2019-04-17 | 2020-10-22 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| KR20220038608A (ko) * | 2019-05-31 | 2022-03-29 | 배리에이션 바이오테크놀로지스 아이엔씨. | 다형성 교모세포종의 치료를 위한 면역치료 조성물 |
| CN114258398A (zh) | 2019-06-13 | 2022-03-29 | 总医院公司 | 工程化的人内源性病毒样颗粒及使用其递送至细胞的方法 |
| GB201910651D0 (en) * | 2019-07-25 | 2019-09-11 | Autolus Ltd | Virus-like particle |
| BR112023001272A2 (pt) | 2020-07-24 | 2023-04-04 | Massachusetts Gen Hospital | Partículas semelhantes a vírus aprimoradas e métodos de uso das mesmas para entrega às células |
| CN115948468A (zh) * | 2022-09-09 | 2023-04-11 | 青岛大学 | 一种人巨细胞病毒重组载体及其制备方法和应用 |
| WO2024243675A1 (en) * | 2023-06-02 | 2024-12-05 | Variation Biotechnologies Inc. | Compositions of mrna-encoded virus-like particles, compositions of mrna-lipid nanoparticles, and methods for use thereof |
Family Cites Families (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6267965B1 (en) | 1981-12-24 | 2001-07-31 | Virogenetics Corporation | Recombinant poxvirus—cytomegalovirus compositions and uses |
| JPS61103895A (ja) * | 1984-10-26 | 1986-05-22 | Green Cross Corp:The | HBsAgの精製方法 |
| JP2607712B2 (ja) * | 1988-01-29 | 1997-05-07 | カイロン コーポレイション | 組換えcmv中和タンパク |
| US5500161A (en) | 1993-09-21 | 1996-03-19 | Massachusetts Institute Of Technology And Virus Research Institute | Method for making hydrophobic polymeric microparticles |
| DE19856463B4 (de) * | 1998-11-26 | 2006-02-02 | Heinrich-Pette-Institut | Retrovirale, mit LCMV pseudotypisierte Hybrid-Vektoren |
| DE19910044A1 (de) | 1999-03-08 | 2000-09-14 | Bodo Plachter | Virale Partikel, die nach Infektion durch humanes Cytomegalovirus freigesetzt werden und ihre Verwendung als Impfstoff |
| US6413518B1 (en) | 1999-09-30 | 2002-07-02 | University Of Washington | Immunologically significant herpes simplex virus antigens and methods for identifying and using same |
| EP1201750A1 (en) * | 2000-10-26 | 2002-05-02 | Genopoietic | Synthetic viruses and uses thereof |
| US9045727B2 (en) * | 2002-05-17 | 2015-06-02 | Emory University | Virus-like particles, methods of preparation, and immunogenic compositions |
| PT2311848E (pt) | 2002-12-23 | 2013-10-03 | Vical Inc | Vacinas à base de polinucleótido optimizadas por codão contra a infecção do citomegalovírus humano |
| PT1651666E (pt) | 2003-07-11 | 2009-08-28 | Alphavax Inc | Vacinas de citomegalovírus à base de alfavírus |
| RU2290204C1 (ru) * | 2005-07-27 | 2006-12-27 | Общество с ограниченной ответственностью "Аванген" | Рекомбинантный гибридный белок, препарат для иммунотерапии на его основе и способ иммунотерапии рецидивирующего папилломатоза гортани |
| EP2044224A4 (en) * | 2006-07-27 | 2011-04-13 | Ligocyte Pharmaceuticals Inc | CHIMERIC VIRUS TYPE PARTICLES |
| US20090123494A1 (en) * | 2007-07-31 | 2009-05-14 | William Staplin | Momlv-based pseudovirion packaging cell line |
| WO2009120883A2 (en) * | 2008-03-26 | 2009-10-01 | Life Technologies Corporation | Virus-like particle mediated cellular delivery |
| GB0907935D0 (en) | 2009-05-08 | 2009-06-24 | Henderson Morley Plc | Vaccines |
| AU2012335277B2 (en) | 2011-11-11 | 2018-06-14 | Variation Biotechnologies Inc. | Compositions and methods for treatment of cytomegalovirus |
| WO2015089340A1 (en) | 2013-12-11 | 2015-06-18 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Human herpesvirus trimeric glycoprotein b, protein complexes comprising trimeric gb and their use as vaccines |
-
2012
- 2012-11-09 AU AU2012335277A patent/AU2012335277B2/en active Active
- 2012-11-09 CA CA3166278A patent/CA3166278A1/en active Pending
- 2012-11-09 WO PCT/IB2012/002854 patent/WO2013068847A2/en not_active Ceased
- 2012-11-09 CN CN202010272504.4A patent/CN111995664B/zh active Active
- 2012-11-09 EP EP12847559.7A patent/EP2776567B1/en active Active
- 2012-11-09 DK DK12847559.7T patent/DK2776567T3/da active
- 2012-11-09 CN CN201711042348.7A patent/CN107875382B/zh active Active
- 2012-11-09 CN CN201280066355.XA patent/CN104271745A/zh active Pending
- 2012-11-09 KR KR1020147015909A patent/KR102301463B1/ko active Active
- 2012-11-09 KR KR1020197025818A patent/KR102340558B1/ko active Active
- 2012-11-09 BR BR112014011229-0A patent/BR112014011229B1/pt active IP Right Grant
- 2012-11-09 MX MX2014005653A patent/MX353189B/es active IP Right Grant
- 2012-11-09 PT PT128475597T patent/PT2776567T/pt unknown
- 2012-11-09 JP JP2014540570A patent/JP6232544B2/ja active Active
- 2012-11-09 BR BR122019027913-6A patent/BR122019027913B1/pt active IP Right Grant
- 2012-11-09 EP EP21152309.7A patent/EP3854416A1/en active Pending
- 2012-11-09 CA CA2889659A patent/CA2889659C/en active Active
- 2012-11-09 RU RU2014123465A patent/RU2737530C1/ru active
- 2012-11-09 ES ES12847559T patent/ES2874233T3/es active Active
- 2012-11-09 MX MX2017017128A patent/MX387666B/es unknown
- 2012-11-09 RU RU2019139064A patent/RU2019139064A/ru unknown
- 2012-11-09 US US14/357,423 patent/US9777043B2/en active Active
-
2017
- 2017-08-04 JP JP2017151540A patent/JP6657150B2/ja active Active
- 2017-08-22 US US15/683,355 patent/US11248026B2/en active Active
-
2018
- 2018-05-18 AU AU2018203538A patent/AU2018203538A1/en not_active Abandoned
-
2020
- 2020-11-03 AU AU2020264275A patent/AU2020264275B2/en active Active
-
2022
- 2022-02-11 US US17/670,052 patent/US12421283B2/en active Active
Non-Patent Citations (8)
| Title |
|---|
| ARVIN AM ET AL., CLIN INFECT DIS, vol. 39, no. 2, 2004, pages 233 - 9 |
| BERNSTEIN ET AL., JOURNAL OF INFECTIOUS DISEASES, vol. 185, no. 5, pages 1171 - 1179 |
| BOECKH M., PEDIATR TRANSPLANT, vol. 8, no. 5, 2004, pages 19 - 27 |
| GONCZOL E ET AL.: "Expert Opinion on Biological Therapy", vol. 1, 1 May 2001, INFORMA HEALTHCARE |
| HEBART H ET AL., HUM IMMUNOL, vol. 65, no. 5, 2004, pages 432 - 6 |
| LIMAYE AP, TRANSPLANTATION, vol. 78, no. 9, 2004, pages 1390 - 6 |
| ROWSHANI AT ET AL., TRANSPLANTATION, vol. 79, no. 4, 2005, pages 381 - 6 |
| STARAS SA ET AL., CLIN INFECT DIS, vol. 43, no. 9, 2006, pages 1143 - 51 |
Cited By (75)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10466232B2 (en) | 2009-06-18 | 2019-11-05 | Kiyatec Inc. | Co-culture bioreactor system |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9447164B2 (en) | 2010-08-06 | 2016-09-20 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9937233B2 (en) | 2010-08-06 | 2018-04-10 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9657295B2 (en) | 2010-10-01 | 2017-05-23 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US10064959B2 (en) | 2010-10-01 | 2018-09-04 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9950068B2 (en) | 2011-03-31 | 2018-04-24 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US10751386B2 (en) | 2011-09-12 | 2020-08-25 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US10022425B2 (en) | 2011-09-12 | 2018-07-17 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US12421283B2 (en) | 2011-11-11 | 2025-09-23 | Variation Biotechnologies Inc. | Compositions and methods for treatment of cytomegalovirus |
| US11248026B2 (en) | 2011-11-11 | 2022-02-15 | Variation Biotechnologies Inc. | Compositions and methods for treatment of cytomegalovirus |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US9271996B2 (en) | 2011-12-16 | 2016-03-01 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US9295689B2 (en) | 2011-12-16 | 2016-03-29 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US10161010B2 (en) | 2012-03-27 | 2018-12-25 | Variation Biotechnologies Inc. | Methods for detection of anti-cytomegalovirus neutralizing antibodies |
| EP3613431A1 (en) * | 2012-03-27 | 2020-02-26 | Variation Biotechnologies Inc. | Methods for detection of anti-cytomegalovirus neutralizing antibodies |
| EP2831285B1 (en) * | 2012-03-27 | 2019-10-30 | Variation Biotechnologies Inc. | Methods for detection of anti-cytomegalovirus neutralizing antibodies |
| AU2018271276B2 (en) * | 2012-03-27 | 2021-06-03 | Variation Biotechnologies Inc. | Methods for detection of anti-cytomegalovirus neutralizing antibodies |
| US10006096B2 (en) | 2012-03-27 | 2018-06-26 | Variation Biotechnologies Inc. | Methods for detection of anti-cytomegalovirus neutralizing antibodies |
| US9233141B2 (en) | 2012-04-02 | 2016-01-12 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9149506B2 (en) | 2012-04-02 | 2015-10-06 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding septin-4 |
| US9301993B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding apoptosis inducing factor 1 |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9255129B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 |
| US9220792B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aquaporin-5 |
| US10501512B2 (en) | 2012-04-02 | 2019-12-10 | Modernatx, Inc. | Modified polynucleotides |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9221891B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | In vivo production of proteins |
| US9675668B2 (en) | 2012-04-02 | 2017-06-13 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding hepatitis A virus cellular receptor 2 |
| US9782462B2 (en) | 2012-04-02 | 2017-10-10 | Modernatx, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| US9814760B2 (en) | 2012-04-02 | 2017-11-14 | Modernatx, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9827332B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of proteins |
| US9828416B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9878056B2 (en) | 2012-04-02 | 2018-01-30 | Modernatx, Inc. | Modified polynucleotides for the production of cosmetic proteins and peptides |
| US9220755B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9089604B2 (en) | 2012-04-02 | 2015-07-28 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating galactosylceramidase protein deficiency |
| US9050297B2 (en) | 2012-04-02 | 2015-06-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator |
| US9216205B2 (en) | 2012-04-02 | 2015-12-22 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding granulysin |
| US9192651B2 (en) | 2012-04-02 | 2015-11-24 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9303079B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9114113B2 (en) | 2012-04-02 | 2015-08-25 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding citeD4 |
| US9061059B2 (en) | 2012-04-02 | 2015-06-23 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating protein deficiency |
| JP2015536937A (ja) * | 2012-10-30 | 2015-12-24 | レッドヴァックス・ゲーエムベーハー | ヒトサイトメガロウイルス感染に対する組換え粒子ベースのワクチン |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10273285B2 (en) | 2014-06-18 | 2019-04-30 | Morphosys Ag | Fusion proteins and uses thereof |
| WO2016149426A1 (en) * | 2015-03-16 | 2016-09-22 | The Broad Institute, Inc. | Constructs for continuous monitoring of live cells |
| US12060391B2 (en) | 2015-03-16 | 2024-08-13 | The Broad Institute, Inc. | Constructs for continuous monitoring of live cells |
| US12049480B2 (en) | 2015-10-20 | 2024-07-30 | Institut National De La Sante Et De La Recherche Medicale (INSERM) Paris, FRANCE | Methods and products for genetic engineering |
| US12365707B2 (en) | 2015-10-20 | 2025-07-22 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| US12202860B2 (en) | 2015-10-20 | 2025-01-21 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| WO2017070613A1 (en) * | 2015-10-22 | 2017-04-27 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10064935B2 (en) | 2015-10-22 | 2018-09-04 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US10383937B2 (en) | 2015-10-22 | 2019-08-20 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US11484590B2 (en) | 2015-10-22 | 2022-11-01 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US10716846B2 (en) | 2015-10-22 | 2020-07-21 | Modernatx, Inc. | Human cytomegalovirus RNA vaccines |
| US10611800B2 (en) | 2016-03-11 | 2020-04-07 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| US11197927B2 (en) | 2016-10-21 | 2021-12-14 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US11541113B2 (en) | 2016-10-21 | 2023-01-03 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| WO2018075980A1 (en) * | 2016-10-21 | 2018-04-26 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US10695419B2 (en) | 2016-10-21 | 2020-06-30 | Modernatx, Inc. | Human cytomegalovirus vaccine |
| US11629172B2 (en) | 2018-12-21 | 2023-04-18 | Pfizer Inc. | Human cytomegalovirus gB polypeptide |
| WO2021048081A1 (en) | 2019-09-09 | 2021-03-18 | Glaxosmithkline Biologicals Sa | Immunotherapeutic compositions |
| US11857622B2 (en) | 2020-06-21 | 2024-01-02 | Pfizer Inc. | Human cytomegalovirus GB polypeptide |
| US11406703B2 (en) | 2020-08-25 | 2022-08-09 | Modernatx, Inc. | Human cytomegalovirus vaccine |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12421283B2 (en) | Compositions and methods for treatment of cytomegalovirus | |
| Anderholm et al. | Cytomegalovirus vaccines: current status and future prospects | |
| CN104838000B (zh) | 一种递送ul128复合体和预防cmv感染的mva疫苗 | |
| US11253587B2 (en) | Vaccine compositions for the treatment of coronavirus | |
| DK2556150T3 (en) | A viral particle released after infection of mammalian cells by human cytomegalovirus (HCMV) containing a fusion protein and use thereof | |
| CN117177763A (zh) | 用于增强疫苗接种期间的t细胞启动的病毒构建体 | |
| WO2014128568A2 (en) | Compositions and methods for treatment of hepatitis c | |
| US20240350619A1 (en) | Vaccines and compositions based on sars-cov-2 s protein | |
| WO2023130637A1 (en) | Vaccines and compositions based on sars-cov-2 s protein | |
| US20220233682A1 (en) | Vaccine compositions for the treatment of coronavirus | |
| WO2015128731A2 (en) | Compositions and methods for treatment of hepatitis c |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12847559 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2014540570 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012847559 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14357423 Country of ref document: US Ref document number: MX/A/2014/005653 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 20147015909 Country of ref document: KR Kind code of ref document: A Ref document number: 2014123465 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2012335277 Country of ref document: AU Date of ref document: 20121109 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014011229 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2889659 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 112014011229 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140509 |