WO2012150818A2 - 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트 - Google Patents

만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트 Download PDF

Info

Publication number
WO2012150818A2
WO2012150818A2 PCT/KR2012/003445 KR2012003445W WO2012150818A2 WO 2012150818 A2 WO2012150818 A2 WO 2012150818A2 KR 2012003445 W KR2012003445 W KR 2012003445W WO 2012150818 A2 WO2012150818 A2 WO 2012150818A2
Authority
WO
WIPO (PCT)
Prior art keywords
group
amplifying
snp
polymorphism
myeloid leukemia
Prior art date
Application number
PCT/KR2012/003445
Other languages
English (en)
French (fr)
Other versions
WO2012150818A3 (ko
WO2012150818A9 (ko
Inventor
김종원
김동환
이승태
원홍희
Original Assignee
사회복지법인 삼성생명공익재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 사회복지법인 삼성생명공익재단 filed Critical 사회복지법인 삼성생명공익재단
Publication of WO2012150818A2 publication Critical patent/WO2012150818A2/ko
Publication of WO2012150818A9 publication Critical patent/WO2012150818A9/ko
Publication of WO2012150818A3 publication Critical patent/WO2012150818A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a method for predicting the risk of chronic myeloid leukemia and a diagnostic kit using the same.
  • the present invention includes a group consisting of MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360 , and EBF1 .
  • the present invention relates to a composition for diagnosing chronic myelogenous leukemia, including a single nucleotide polymorphism (SNP) located at one or more genes and its transcriptional regulation region or a complementary sequence thereof, and a diagnostic kit using the same.
  • SNP single nucleotide polymorphism
  • Chronic myeloid leukemia is a rare clonal myeloproliferative disorder, a hereditary disorder characterized by the proliferation of cells of all myeloid cells due to hematopoietic stem cell abnormalities. It is characterized by long-term survival and reduction of apoptosis of hematopoietic stem cells (HSCs).
  • Chronic myeloid leukemia is a very rare hematologic cancer that typically has between 0.6 and 2 patients per 100,000 population, with a different incidence between Westerners and East Asians.
  • the BCR-ABL oncogene known as the major cause of development, is a gene that structurally encodes the activity of Bcr-Abl fusion tyrosine kinase (FTK) on the Philadelphia chromosome (Ph).
  • FTK Bcr-Abl fusion tyrosine kinase
  • Ph Philadelphia chromosome
  • SNP single nucleotide polymorphism
  • Single nucleotide polymorphism refers to a single base-pair variation in DNA between an individual and an individual, and is the most common form of DNA polymorphism (one per 1 kb).
  • Monobasic polymorphism can be used as a genetic marker on the genome in that it is not only the most frequent variant but also a fairly stable and low variant. This suggests that monobasic polymorphisms provide information about the different kinds of diversity that occur in genes. For example, if single nucleotide polymorphisms selected through linkage disequilibrium analysis are associated with the imbalance, the single nucleotide polymorphism is associated with the genetic imbalance because the changes in the genes within the single nucleotide polymorphisms are also associated with the same imbalance. Changes such as mutations have important implications for identifying which diseases have appeared. This linkage imbalance can predict important parts of recombination of genomic DNA, providing clues for predicting heredity and genetic disease to the next generation.
  • the present inventors conducted a genome-wide association analysis of a total of 2,733 patients (671 patients, 2,073 controls) to find a single nucleotide polymorphism that is specific to chronic myelogenous leukemia patients. As a result, a single nucleotide polymorphism site that is specific to chronic myeloid leukemia patients was found, and it was found that the single nucleotide polymorphism could serve as a molecular biological index for diagnosis of chronic myeloid leukemia.
  • the present invention MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, and one or more genes selected from the group consisting of EBF1 and its transcription (transcriptional regulation) single nucleotide polymorphisms located in the region It provides a composition for diagnosing chronic myeloid leukemia, comprising (SNP) or a sequence complementary thereto.
  • the present invention is a single nucleotide polymorphism located on MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, and at least one gene and its transcriptional control is selected from the group consisting of EBF1 (transcriptional regulation) region It provides a DNA chip for diagnosing chronic myelogenous leukemia, including (SNP) or a sequence complementary thereto.
  • EBF1 transcriptional regulation
  • the invention also rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, and at least one single nucleotide polymorphism (SNP) or the single nucleotide polymorphisms and linkage disequilibrium is selected from the group consisting of rs17055814 (linkage disequilibrium, r 2 > 0.1 ) provide primer pairs that can amplify single nucleotide polymorphisms.
  • SNP single nucleotide polymorphism
  • the present invention is a single nucleotide polymorphism located on MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, and at least one gene and its transcriptional control is selected from the group consisting of EBF1 (transcriptional regulation) region DNA chip for diagnosing chronic myelogenous leukemia (SNP) or a complementary sequence thereof, a primer pair capable of amplifying the single nucleotide polymorphism site, a labeling means for detecting DNA amplified by hybridization with the DNA chip, It provides a chronic myeloid leukemia diagnostic kit, characterized in that it comprises amplifying enzymes, nucleotides and buffers.
  • the present invention also provides a) one or more genes selected from the group consisting of MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360 , and EBF1 from DNA extracted from a sample, and transcriptional transcription thereof.
  • measuring a single nucleotide polymorphism (SNP) frequency located in the regulation region and b) obtaining a correlation by comparing the polymorphism frequency measured in step a) with a control group, thereby providing information for predicting susceptibility to chronic myeloid leukemia.
  • SNP single nucleotide polymorphism
  • At least one gene selected from the group consisting of MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360 , and EBF1 and its transcriptional regulation region Provided is a composition for diagnosing chronic myeloid leukemia comprising a single nucleotide polymorphism (SNP) or a sequence complementary thereto.
  • SNP single nucleotide polymorphism
  • the single base polymorphism is rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, or rs17055814.
  • monobasic polymorphisms are as described above.
  • transcriptional regulation region refers to a region located above or below a gene, and includes a specificity factor, a suppressor, a transcription factor, an activator, Means a part that regulates the transcription of the gene through a variety of transcriptional regulation mechanisms such as enhancers (enhancer).
  • Another aspect of the invention is a single base located at one or more genes selected from the group consisting of MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360 , and EBF1 and their transcriptional regulation regions
  • a DNA chip for diagnosing chronic myelogenous leukemia including polymorphism (SNP) or a sequence complementary thereto.
  • the present invention also provides primer pairs capable of amplifying at least one monobasic polymorphism (SNP) selected from the group consisting of rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, and rs17055814.
  • SNP monobasic polymorphism
  • a "primer” refers to template-directed DNA under appropriate conditions (eg, four different nucleoside triphosphates (ATP, GTP, CTP, TTP) and DNA polymerase) and appropriate temperatures in a suitable buffer. It refers to a single stranded oligonucleotide that can act as a starting point for synthesis.
  • the appropriate length of the primer may vary depending on the purpose of use, but is usually 10 to 100, preferably 10 to 80 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template.
  • the primer sequence need not be completely complementary to the template, but should be sufficiently complementary to template hybridization.
  • the primer hybridizes to the target DNA comprising the polymorphic site and initiates amplification in allelic form of DNA where the primer exhibits complete homology. This primer is used in pairs with a second primer that hybridizes to the other side.
  • the primer pair of the present invention comprises a) an oligonucleotide having the nucleotide sequence set forth in SEQ ID NOs: 1 and 2 and capable of amplifying rs3900024; b) oligonucleotides having the nucleotide sequences set forth in SEQ ID NOs: 3 and 4 and capable of amplifying rs7765741; c) oligonucleotides having the nucleotide sequences set forth in SEQ ID NOs: 5 and 6 and capable of amplifying rs6931104; d) oligonucleotides having the nucleotide sequences set forth in SEQ ID NOs: 7 and 8 and capable of amplifying rs4869742; e) oligonucleotides having the nucleotide sequences set forth in SEQ ID NOs: 9 and 10 and capable of amplifying rs33962847; f) oligonucle
  • Table 1 below shows primer pairs that can amplify monobasic polymorphisms of the present invention.
  • Another aspect of the invention relates to linkage disequilibrium, r 2 > 0.1 Provide primer pairs that can amplify a single nucleotide polymorphism.
  • EBF1 DNA chip for diagnosing chronic myelogenous leukemia comprising a single nucleotide polymorphism (SNP) located at one or more genes selected from the group consisting of and a transcriptional regulation region thereof or a sequence complementary thereto;
  • Chronic myeloid leukemia diagnosis comprising a primer pair capable of amplifying the single nucleotide polymorphism site, a labeling means for detecting DNA amplified by hybridization with the DNA chip, an amplifying enzyme, nucleotides and a buffer solution.
  • SNP single nucleotide polymorphism
  • the labeling means is Cy5, biotin binding compound, Cy3, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC) , but not limited to, x-rhodamine or Texas red.
  • Still another aspect of the present invention provides a) at least one gene selected from the group consisting of MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360 , and EBF1 from DNA extracted from a sample.
  • b) provides a method of providing information for predicting the susceptibility to chronic myeloid leukemia comprising the step of obtaining a correlation by comparing the frequency of polymorphism measured in step a) with the control.
  • the single base polymorphism may include rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, or rs17055814.
  • the present invention provides genes and monobasic polymorphic markers associated with chronic myeloid leukemia.
  • the markers can be used to effectively predict or diagnose the risk of developing chronic myeloid leukemia.
  • the present invention can be used for the treatment of chronic myelogenous leukemia and research on drug development.
  • 1 and 2 are tables showing monobasic polymorphisms associated with chronic myeloid leukemia susceptibility as verified in the Examples of the present invention.
  • FIG. 3 shows the overall experimental procedure of the present invention.
  • FIG. 4 shows a Manhattan plot of the genome-wide association analysis for chronic myelogenous leukemia.
  • FIG. 6 shows regional association plots of chromosome 7p11.1.
  • a total length of 2,733 subjects consisting of 671 patients who were clinically diagnosed with chronic myelogenous leukemia and 2,073 controls were subjected to full-length genetic association analysis, genes that cause chronic myeloid leukemia Is present on chromosomes 6 and 17, and it is a new gene site that is unknown until now.
  • the present invention provides a composition for diagnosing chronic myeloid leukemia comprising a single nucleotide polymorphism comprising rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, or rs17055814, and a method for diagnosing chronic myeloid leukemia using the same.
  • monobasic polymorphism that can be used for diagnosing chronic myelogenous leukemia may be present at chromosomes 6q25.1 and 17p11.1, preferably MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, At least one gene selected from the group consisting of WSB1, FAM27L, FLJ33360 , and EBF1 and a single nucleotide polymorphism located in its transcriptional regulation region.
  • chromosomes 6q25.1 and 17p11.1 were found to be associated with chronic myeloid leukemia susceptibility.
  • Five gene positions were initially identified as candidates in the discovery set (minimum P values of 3.5 ⁇ 10 ⁇ 5 to 1.4 ⁇ 10 ⁇ 6 ).
  • the 6q25.1 location was validated in the European cohort as well as the Korean Verification Cohort.
  • Several genes, including ZBTB2, RMND1, C6orf211, C6orf97 , and AKAP12 are located within 1 Mb of the 6q25.1 region.
  • ZBTB2 is a transcription factor belonging to POK (POZ domain Kr ⁇ ppel-like zinc finger) and is a potent inhibitor of ARF-HDM2-p53-p21 pathway in cell cycle regulation. ZBTB2 can inhibit p53 binding and inhibit transcriptional activation by p53. Thus, ZBTB2 is an important regulatory gene of the p53 pathway. ZBTB2 is also a potent transcriptional inhibitor of the cell cycle arrest gene p21, which inhibits p53 and Sp1. Thus, ZBTB2 will be involved in leukemogenesis by regulating the p53 pathway.
  • ZBTB2 SNPs in particular the SNPs located upstream of ZBTB2 , have been shown to be clearly associated with the susceptibility of chronic myeloid leukemia (CML). Based on the results of this study, further functional studies of ZBTB2 are needed to explain the role of ZBTB2 in the induction of chronic myelogenous leukemia (CML).
  • AKAP12 / gravin Another candidate gene is AKAP12 / gravin , which is down-regulated not only in chronic myeloid leukemia, but also in acute myeloid leukemia and myelodysplastic syndromes.
  • AKAP12 gene expression is associated with myeloid neoplasm leukemogenesis in bone marrow tumors.
  • inactivation of AKAP12 is associated with tumor growth inhibition.
  • the chromosomal locus of the SNP with the most significant P value at 6q25.1 is near the 3'-UTR position of AKAP12 (see Figure 6).
  • CML chronic myelogenous leukemia
  • 17p11.1 locus the association between the susceptibility of chronic myelogenous leukemia (CML) and the 17p11.1 locus showed that three SNPs (rs7221571, rs4795519, and rs3396847) had significant values in the Korean cohort (verification group 1) (P value of 3.3 ⁇ 10 ⁇ 8 to 8.0 ⁇ 10 ⁇ 7 ), but not valid in Western cohorts (validation group 2).
  • the 5'-end of the candidate gene WSBI gene is located. Although the detailed function of this gene is not yet known, WSBI is involved in resistance to apoptosis, cell cycle acceleration and protection from cell death due to cellular stress such as DNA damage and gene damage stress.
  • the copy number changes in the WSBI is associated with overexpression of WSBI, it is associated with survival of patients with neuroblastoma (neuroblastoma).
  • WSBI is known to be involved in the development of pancreatic cancer.
  • the 17p11.1 locus in which the WSBI is located is associated with chronic myeloid leukemia susceptibility, especially in the Korean population, it cannot be totally excluded from the chronic myeloid leukemia risk locus and more validation studies should be performed.
  • Table 2 shows the genes and locations of genes found to be associated with chronic myelogenous leukemia by the present invention
  • Table 3 shows the single nucleotide polymorphism and single nucleotide polymorphisms found to be related to chronic myeloid leukemia by the present invention. Location.
  • FIGS. 1 and 2 show the chromosome position and the frequency of single nucleotide polymorphism, which were found to be significantly associated with chronic myelogenous leukemia through the full-length genetic association analysis of the present invention.
  • Each SNP name refers to the name of a standard single nucleotide polymorphism (Reference SNP ID; rs), which has been associated with the National Institute of Health and Biotechnology Information Institute after the Human Genome Project. NCBI) is a name given to distinguish each single polymorphism from the database.
  • rs a standard single nucleotide polymorphism
  • Subjects were recruited under the approval of the Samsung Medical Center and Sungkyunkwan University for the full-length genetic analysis study, and were clinically diagnosed with chronic myelogenous leukemia, Korean experimental group, Korean validation set, and European verification. A population of subjects from a validation set was formed and the study was performed with prior consent.
  • the first group of subjects was a set of Koreans (disvovery set) consisting of 202 patients with chronic myelogenous leukemia and 497 normal patients.
  • the second and third subject groups were validation sets for verifying the genotype selected in the experimental group.
  • the validation group composed of Koreans (237 patients with chronic myelogenous leukemia and 1,000 normal persons) and the European Canadian group ( Two groups, 232 patients with chronic myelogenous leukemia and 576 normal subjects, were tested.
  • Table 4 below summarizes the size of the population of the subjects used in the Examples of the present invention.
  • the entire DNA set of the discovery set was analyzed for genotypes of 906,530 SNPs using Affymetrix Genome-Wide Human SNP Array 6.0 (Affymetrix, Inc., Santa Clara, Calif., USA). After genotyping, erroneous genotype cluster patterns were excluded by visual inspection and samples with a missing genotype ratio of 5% or more were excluded from the analysis. Also, 192,348 SNPs with a missing genotype of 1% or more, 274,345 SNPs with a minor allele frequency (MAF) of 5% or less, and a significant Hardy-Weinberg equilibrium in the normal group. , HWE), 6,532 SNPs showing a deviation (P ⁇ 0.001) were sequentially excluded. As a result, a total of 456,522 autosomal SNPs were analyzed in 201 patients and 497 normal groups.
  • Affymetrix Genome-Wide Human SNP Array 6.0 Affymetrix, Inc., Santa Clara, Calif., USA.
  • Verification Group 1 (237 patients, 1,000 normal patients) was composed of Korean cohorts, and MassARRAY ® system (Sequenom, Inc., San Diego, CA, USA) were used to analyze a total of 88 SNP genotypes. Genotyping for SNPs with Hardy-Weinberg equilibrium (HWE) deviations in Verification Group 1 was confirmed by sequence analysis (Applied Biosystems Inc., Foster City, CA, USA) SNPs were excluded from the analysis.
  • MassARRAY ® system Sequenom, Inc., San Diego, CA, USA
  • genotyping was performed in the same manner as Verification Group 1 to verify the nine SNPs demonstrated in the Korean cohort in the European cohort.
  • MDS multidimensional scaling
  • the inflation factor ( ⁇ ) was calculated based on the median chi-squared statistic.
  • the IMPUTE program version 1.0.0 was used to impute 633,644 polymorphic SNPs not covered in the Affymetrix 6.0 array.
  • the reference panel used for SNP missing estimates includes 90 Japanese and Chinese (JPT + CHB) haplotypes known from International HapMap Project data (Phase II Public Release # 22 NCBI Build 36). (haplotype).
  • MDS Multidimensional scaling
  • a minimum P value of 3.5 ⁇ 10 ⁇ 5 to 1.4 ⁇ 10 ⁇ 5 was observed for each locus.
  • About 18 annotated genes, including candidate genes potentially associated with cancer, RMND1, AKAP12, ZBTB2, EBF1, CTNNA3 , and WSB1 are located near the locus.
  • a regional association plot of disease-related SNPs around the five loci shows clusters of significant association peaks in the same region (see FIG. 5).
  • the Korean cohort (verification group 1) was tested for genotypes found in the experimental group, and a total of 88 using the MassARRAY ® system (Sequenom, Inc., San Diego, CA, USA) in 237 patients and 1,000 controls. SNP genotypes were analyzed. Genotyping for SNPs with Hardy-Weinberg equilibrium (HWE) deviations in Verification Group 1 was confirmed by sequence analysis (Applied Biosystems Inc., Foster City, CA, USA) SNPs were excluded from the analysis.
  • HWE Hardy-Weinberg equilibrium
  • 6q25.1 was found to be valid in both Korean and European cohorts.
  • the four SNPs at 6q25.1 (rs4869742, rs7765741, rs3900024, and rs6931104) showed significant association in both verification groups. (See Figures 1 and 2)
  • the P value of the SNP was in the range of 5.5 ⁇ 10 -5 to 8.4 ⁇ 10 -4
  • the verification group 1 the range of 2.6 ⁇ 10 -3 to 5.0 ⁇ 10 -2
  • the entire Korean cohort (experiment +
  • the verification group 1) was in the range of 2.4 ⁇ 10 ⁇ 6 to 2.8 ⁇ 10 ⁇ 5
  • the verification group 2 was in the range of 1.3 ⁇ 10 ⁇ 3 to 2.3 ⁇ 10 ⁇ 3 (see FIGS. 1 and 2).
  • rs4869742 was excluded from the analysis of the European test set because of the significant deviation of the Hardy-Weinberg equilibrium (HWE).
  • HWE Hardy-Weinberg equilibrium
  • the association direction is the same as that of the Korean experimental group and the verification group 1, and this association is still significant even after Bonferroni correction.
  • the 6q25.1 locus indicates that it is associated with the susceptibility of chronic myelogenous leukemia in all races.
  • the three SNPs at 17p11.1 were validated as Korean after the Bonferroni correction (P values: 2.9 ⁇ 10 -5 to 7.0 ⁇ 10 -5 ).
  • the group showed significance (P values: 3.3 ⁇ 10 ⁇ 8 to 8.0 ⁇ 10 ⁇ 7 ; see FIGS. 1 and 2), but not in the European test group.
  • These three SNPs increased in significance when combined with Korean test group and test group (Combined set) (P values: 1.3 ⁇ 10 -12 ⁇ 5.6 ⁇ 10 -10 ).
  • Regional association plots indicate that the locus is located near the 5 ′ end of the WSBI gene (see FIG. 6).
  • Significant SNPs are located in strong LD blocks that appear in East Asian samples.
  • the -log 10 (P) value dropped sharply (see FIG. 6).
  • a kit for predicting or diagnosing chronic myelogenous leukemia including a single nucleotide polymorphism rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs16875692, and rs17055814 associated with chronic myeloid leukemia, was prepared.
  • the method described in Example 2 was used to isolate genetic DNA from blood of a subject to diagnose or predict the onset or likelihood of chronic myeloid leukemia, and hybridize the labeling means to DNA.
  • the labeling means is Cy5, biotin binding compound, Cy3, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC) , but not limited to, x-rhodamine or Texas red.
  • the markers of the present invention can be used to effectively predict or diagnose the risk of developing chronic myeloid leukemia, and the present invention can be used for the treatment of chronic myeloid leukemia and drug development research.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트 에 관한 것으로서, 구체적으로 본 발명은 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 조성물 및 이를 이용하는 진단키트 등에 관한 것이다. 본 발명의 만성 골수성 백혈병과 연관성이 있는 유전자 및 단일염기다형성 마커를 이용하여 만성 골수성 백혈병 발생 위험도를 효과적으로 예측 또는 진단할 수 있다. 나아가 본 발명은 만성 골수성 백혈병의 치료 및 약물 개발 연구에 활용될 수 있다.

Description

만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트
본 발명은 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트에 관한 것으로서, 구체적으로 본 발명은 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 조성물 및 이를 이용하는 진단키트 등에 관한 것이다.
만성 골수성 백혈병(chronic myeloid leukemia, CML)은 희귀한 클로날 골수 증식성 질환(clonal myeloproliferative disorder)으로서, 조혈모 세포의 이상으로 모든 골수구계의 세포가 증식하는 것을 특징으로 하는 유전성 질환이며, 향상된 증식능과 조혈줄기세포(hematopoietic stem cells, HSCs)의 장기간 생존 및 세포사멸(apoptosis)의 감소에 특징이 있다. 만성 골수성 백혈병(CML)은 일반적으로 인구 100,000명 당 0.6 ~ 2명 정도의 환자가 있는 매우 드문 혈액암에 속하며, 서양인과 동아시아인 사이에 발병률이 다르게 나타난다.
주요 발병 원인으로 알려진 BCR-ABL 종양유전자(oncogene)는 필라델피아 염색체(Philadelphia chromosome, Ph)에서 구조적으로 Bcr-Abl 융합 티로신 키나아제(fusion tyrosine kinase, FTK)의 활성을 암호화 하는 유전자이다. Bcr-Abl FTK가 만성 골수성 백혈병의 중요한 분자 마커임에도 불구하고, 정확한 분자생물학적 원인은 아직 밝혀진 바가 없다.
최근 동일한 발암요인에 대해서도 개인이 지는 유전적 감수성에 따라 위험도가 달라지며 이러한 개인 및 인종 간의 감수성을 구분 짓는 가장 중요한 표지자로 단일염기다형성(single nucleotide polymorphism, SNP)이 제시되고 있다.
단일염기다형성이란 개인과 개인 간의 DNA에 존재하는 한 염기쌍의 차이(single base-pair variation)를 말하는 것으로, DNA 염기서열 다형성(polymorphism) 중에서 가장 많이 존재하는 형태이다 (약 1 kb 당 1개).
단일염기다형성은 가장 높은 빈도를 보이는 변이형태일 뿐만 아니라, 상당히 안정적이고 낮은 변이율을 보인다는 점에서, 유전체(genome) 상의 유전적 표지인자로서 사용될 수 있다. 이는 단일염기다형성이 유전자에서 일어나는 다른 종류의 다양성들에 대한 정보를 제공해 준다는 것이다. 예를 들면 연관불균형(linkage disequilibrium) 분석을 통하여 선택된 단일염기다형성들이 연관불균형을 이루고 있다면, 그 단일염기다형성들 내에 일어나는 유전자상의 변화들도 같은 연관불균형을 이루고 있기 때문에, 그 단일염기다형성은 유전자 상의 돌연변이와 같은 변화로 어떠한 질병이 나타나게 되었는지를 확인할 수 있는 중요한 단서로서의 의미를 지니게 된다. 이러한 연관불균형은 유전체 DNA의 재조합의 중요부분을 예측할 수 있으므로 다음 세대로의 유전 그리고 유전적 질병에 대하여도 예측할 수 있는 실마리를 제공한다.
전장유전체연관분석(genome-wide association analysis)에 의해 만성 림프성 백혈병(chronic lymphocytic leukemia), 급성 임파구성 백혈병(acute lymphoblastic leukemia)및 골수성 종양과 관련된 치료법 등 특정 형태의 혈액종양(hematologic malignancies)과 유전적 변이 사이의 연관성이 밝혀진바 있다. 만성 골수성 백혈병과 관련하여 BCL2 유전자 다형성이 CML 감수성과 관련이 있다는 선행 연구가 있으나, 만성 골수성 백혈병의 위험성과 관련된 유전적 마커를 밝히기 위해 전장유전체연관분석이 사용된 적은 없었다.
본 발명자들은 총 2,733명(환자 671명, 대조군 2,073명)을 대상으로 전장유전체연관분석(genome-wide association analysis)을 수행함으로써 만성 골수성 백혈병 환자에서 특이적으로 나타나는 단일염기다형성을 찾아내고자 연구를 거듭한 결과, 만성 골수성 백혈병 환자에 특이적으로 나타나는 단일염기다형성 부위를 발견하였으며, 상기 단일염기다형성은 만성 골수성 백혈병 진단을 위한 분자생물학적 지표로서 기능할 수 있다는 것을 발견하였다.
따라서, 본 발명은 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는, 만성 골수성 백혈병 진단용 조성물을 제공한다.
또한, 본 발명은 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는, 만성 골수성 백혈병 진단용 DNA 칩을 제공한다.
또한, 본 발명은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP) 또는 상기 단일염기다형성과 연관불균형(linkage disequilibrium, r 2 > 0.1) 관계에 있는 단일염기다형성을 증폭할 수 있는, 프라이머 쌍을 제공한다.
또한, 본 발명은 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 DNA 칩, 상기 단일염기다형성 부위를 증폭시킬 수 있는 프라이머 쌍, 상기 DNA 칩과 혼성화(hybridization)되어 증폭된 DNA를 탐지하기 위한 표지수단, 증폭 효소, 뉴클레오티드 및 완충용액을 포함하는 것을 특징으로 하는, 만성 골수성 백혈병 진단 키트를 제공한다.
또한, 본 발명은 a) 시료로부터 추출한 DNA로부터, MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 빈도를 측정하는 단계; 및 b) 상기 a) 단계에서 측정한 다형성 빈도를 대조군과 비교하여 상관관계를 구하는 단계를 포함하는, 만성 골수성 백혈병에 대한 감수성을 예측하기 위한 정보 제공 방법을 제공한다.
상기의 목적을 달성하기 위하여, MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 조성물을 제공한다.
본 발명에서 상기 단일염기다형성은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 또는 rs17055814를 포함하며, 이하 본 발명의 모든 양태에서 단일염기다형성은 상기와 같다.
본 발명에서 "전사조절(transcriptional regulation) 영역"이란 유전자의 상부 또는 하부에 위치하는 영역으로서, 특이인자(specificity factor), 억제자(repressor), 전사요소(transcription factor), 활성자(activator), 인핸서(enhancer) 등의 다양한 전사조절 메커니즘을 통해 해당 유전자의 전사를 조절하는 부분을 의미한다.
본 발명의 다른 양태는 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 DNA 칩을 제공한다.
또한, 본 발명은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)을 증폭시킬 수 있는 프라이머 쌍을 제공한다.
본 발명에서 "프라이머(primer)"란 적절한 버퍼 중의 적절한 조건 (예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 (ATP, GTP, CTP, TTP) 및 DNA 폴리머라제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일 가닥 올리고뉴클레오티드를 말한다. 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 10 내지 100, 바람직하게는 10 내지 80 뉴클레오티드이다. 짧은 프라이머 분자는 일반적으로 주형과 안정한 혼성체를 형성하기 위해서 더 낮은 온도를 필요로 한다. 프라이머 서열은 주형과 완전하게 상보적일 필요는 없으나, 주형화 혼성화 될 정도로 충분히 상보적이어야 한다. 상기 프라이머는 다형성 부위를 포함하는 표적 DNA에 혼성화 하고, 상기 프라이머가 완전한 상동성을 보이는 대립형질 형태의 DNA에서 증폭을 개시한다. 이 프라이머는 반대편에 혼성화 하는 제2 프라이머와 쌍을 이루어 사용된다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 프라이머 쌍은 a) 서열번호 1 및 2로 기재되는 염기서열을 갖고 rs3900024를 증폭시킬 수 있는 올리고뉴클레오티드; b) 서열번호 3 및 4로 기재되는 염기서열을 갖고 rs7765741를 증폭시킬 수 있는 올리고뉴클레오티드; c) 서열번호 5 및 6으로 기재되는 염기서열을 갖고 rs6931104를 증폭시킬 수 있는 올리고뉴클레오티드; d) 서열번호 7 및 8로 기재되는 염기서열을 갖고 rs4869742를 증폭시킬 수 있는 올리고뉴클레오티드; e) 서열번호 9 및 10으로 기재되는 염기서열을 갖고 rs33962847을 증폭시킬 수 있는 올리고뉴클레오티드; f) 서열번호 11 및 12로 기재되는 염기서열을 갖고 rs7221571을 증폭시킬 수 있는 올리고뉴클레오티드; g) 서열번호 13 및 14로 기재되는 염기서열을 갖고 rs4795519를 증폭시킬 수 있는 올리고뉴클레오티드; h) 서열번호 15 및 16으로 기재되는 염기서열을 갖고 rs16875692를 증폭시킬 수 있는 올리고뉴클레오티드; 및 i) 서열번호 17 및 18로 기재되는 염기서열을 갖고 rs17055814를 증폭시킬 수 있는 올리고뉴클레오티드로 이루어진 군에서 선택된 어느 하나일 수 있다.
하기 표 1은 본 발명의 단일염기다형성을 증폭시킬 수 있는 프라이머 쌍을 나타낸다.
표 1
SNP Primer Sequence
rs3900024 Forward ACGTTGGATGGTATGTGCCCCATTCTTCTG
Reverse ACGTTGGATGTCATCACAGAGCACATGTGG
rs7765741 Forward ACGTTGGATGAAGTGTGACTAGATGCCCTC
Reverse ACGTTGGATGAGGATTGCACCAAAAGCCAT
rs6931104 Forward ACGTTGGATGGCACTTCACATGCAAGCATC
Reverse ACGTTGGATGCTCAGTTTCCTCCTCTGTTC
rs4869742 Forward ACGTTGGATGAACATGTTCCAGCCATGGAG
Reverse ACGTTGGATGGGCATGAAATCTGGCAAGTG
rs33962847 Forward ACGTTGGATGGCCAGATGATTGATGCTTAC
Reverse ACGTTGGATGCCCCTCACCCTTATAACTTG
rs7221571 Forward ACGTTGGATGATTGCTTCCTCTCCTAAGGC
Reverse ACGTTGGATGCATGAACAATTAGAGGCCAC
rs4795519 Forward ACGTTGGATGGAGGCTTTGAGTCAACACAC
Reverse ACGTTGGATGTAATCATCCGCACACAGGAC
rs16875692 Forward ACGTTGGATGGTGTCTACTATTTCTGATGG
Reverse ACGTTGGATGACTGGCTGCGGTTTCTTAAC
rs17055814 Forward ACGTTGGATGGCATCTCGTATGTGCAACTC
Reverse ACGTTGGATGCCTGTTTGCCCAGTATACTC
본 발명의 또 다른 양태는 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)과 연관불균형(linkage disequilibrium, r 2 > 0.1) 관계에 있는 단일염기다형성을 증폭할 수 있는 프라이머 쌍을 제공한다.
본 발명의 또 다른 양태는 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 DNA 칩, 상기 단일염기다형성 부위를 증폭시킬 수 있는 프라이머 쌍, 상기 DNA 칩과 혼성화(hybridization)되어 증폭된 DNA를 탐지하기 위한 표지수단, 증폭 효소, 뉴클레오티드 및 완충용액을 포함하는 것을 특징으로 하는 만성 골수성 백혈병 진단 키트를 제공한다.
본 발명에서 상기 표지수단은 Cy5, 비오틴 결합 화합물, Cy3, EDANS(5-(2'-아미노에틸)아미노-1-나프탈렌 황산), 테트라메틸로다민(TMR), 테트라메틸로다민 이소시아네이트(TMRITC), x-로다민 또는 텍사스 레드(Texas red)를 포함할 수 있으나 이에 한정되지 아니한다.
또한, 본 발명의 또 다른 양태는 a) 시료로부터 추출한 DNA로부터, MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 빈도를 측정하는 단계; 및 b) 상기 a) 단계에서 측정한 다형성 빈도를 대조군과 비교하여 상관관계를 구하는 단계를 포함하는 만성 골수성 백혈병에 대한 감수성을 예측하기 위한 정보 제공 방법을 제공한다.
본 발명에서 상기 단일염기다형성은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 또는 rs17055814을 포함할 수 있다.
상기한 바와 같이, 본 발명은 만성 골수성 백혈병과 연관성이 있는 유전자 및 단일염기다형성 마커를 제공한다. 상기 마커를 이용하여 만성 골수성 백혈병 발생 위험도를 효과적으로 예측 또는 진단할 수 있다. 나아가 본 발명은 만성 골수성 백혈병의 치료 및 약물 개발 연구에 활용될 수 있다.
도 1 및 2는 본 발명의 실시예에서 검증된 만성 골수성 백혈병 감수성과 관련 있는 단일염기다형성을 나타낸 표이다.
도 3은 본 발명의 전반적인 실험 과정을 도시한 것이다.
도 4는 만성 골수성 백혈병에 대한 전장유전체연관분석(genome-wide association analysis)의 맨해튼 플롯(Manhattan plot)을 도시한 것이다.
도 5는 염색체 6q25.1 위치의 연관플롯(regional association plots)을 나타낸 것이다.
도 6은 염색체 7p11.1 위치의 연관플롯(regional association plots)을 나타낸 것이다.
만성 골수성 백혈병 감수성과 관련이 있는 유전자 마커 및 단일염기다형성 마커를 발견하기 위하여 본 발명자들은 피험자로부터 분리한 유전체 시료를 시퀀싱하여 전장유전체연관분석(genome-wide association analysis)을 수행하였다.
본 발명의 일 양태에 따르면, 임상적으로 만성 골수성 백혈병 진단을 받은 환자 671명과 정상인(control) 2,073명으로 구성된 총 2,733명의 피험자를 대상으로 전장유전체연관분석 분석을 실시하였으며, 만성 골수성 백혈병을 일으키는 유전자가 6번과 17번 염색체 등에 존재하는 것을 확인하고 이것이 이제까지 알려지지 않은 새로운 유전자 부위임을 밝혔다.
보다 구체적으로, 본 발명자들은 만성 골수성 백혈병과 관련이 있는 유전자 부위 및 단일염기다형성 위치를 확인하기 위하여, 한국인 만성 골수성 백혈병 환자군 (n=201)과 정상군 (n=497)으로 구성된 실험군(discovery set)의 유전체 시료를 얻어, Affymetrix Genome-Wide Human SNP Array 6.0(Affymetrix, Inc., Santa Clara, CA, USA)를 이용하여 906,530개의 SNP를 지노타이핑(genotyping) 하였다. 실험군의 SNP 지노타이핑 결과 정도 관리(quality control)를 통과한 상염색체 SNP가 총 456,222개 관찰되었다.
다음으로, 한국인을 대상으로 만성 골수성 백혈병 환자군 237명과 정상군 1,000명으로 이루어진 한국인 검증군(validation set)을 구성하여, 88개의 후보 SNP에 대한 유전자형을 분석하였다. 상기 한국인 검증군에서 유의한 빈도가 입증된 9개의 SNP에 대하여 유럽인 검증군(환자군 233명, 정상군 576명)의 유전자형 분석을 수행함으로써 최종적으로 유의한 SNP 마커를 동정하였다.
본 발명은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 또는 rs17055814를 포함하는 단일염기다형성을 포함하는 만성 골수성 백혈병 진단용 조성물 및 이를 이용하여 만성 골수성 백혈병을 진단하는 방법을 제공한다.
또한, 본 발명에 의하면, 만성 골수성 백혈병 진단에 사용될 수 있는 단일염기다형성은 염색체 6q25.1과 17p11.1 위치에 존재할 수 있으며, 바람직하게는 MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치하는 단일염기다형성을 포함한다.
본 발명의 전반적인 실험 과정은 도 3에 나타내었다.
본 발명에서는 염색체 6q25.1과 17p11.1 위치가 만성 골수성 백혈병 감수성과 관련이 있다는 것을 밝혔다. 실험군(discovery set)에서 처음에 5개의 유전자 위치가 후보로 밝혀졌다 (최소 P 값이 3.5 × 10-5 ~ 1.4 × 10-6). 6q25.1 위치는 한국인 검증군 코호트 뿐만 아니라 유럽인 코호트에서도 검증되었다. 6q25.1 지역의 1 Mb 이내에 ZBTB2, RMND1, C6orf211, C6orf97, 및 AKAP12를 포함하는 몇 개의 유전자가 위치한다.
ZBTB2는 POK (POZ domain Krㆌppel-like zinc finger)에 속하는 전사요소(transcription factor)이며, 세포 주기 조절에서 ARF-HDM2-p53-p21 경로의 강력한 억제자이다. ZBTB2는 p53 결합을 억제할 수 있고, p53에 의한 전사 활성화를 억제할 수 있다. 따라서, ZBTB2는 p53 경로의 중요한 조절 유전자라고 할 수 있다. ZBTB2는 또한 p53과 Sp1을 저해하는 세포 주기 저지 유전자 (cell cycle arrest gene) p21의 강력한 전사 억제자이다. 따라서, ZBTB2는 p53 경로를 조절함으로써 백혈병 유발(leukemogenesis)에 관여할 것이다. ZBTB2 SNP 중 특히 ZBTB2의 상부(upstream)에 위치한 SNP는, 만성 골수성 백혈병(CML)의 감수성과 분명하게 관련이 있다고 나타났다. 본 연구 결과에 기초하여 만성 골수성 백혈병(CML) 유발에 있어서 ZBTB2의 역할을 설명하기 위해 ZBTB2의 추가적인 기능적 연구가 필요하다.
다른 후보 유전자는 AKAP12/gravin으로서, 이는 만성 골수성 백혈병에서 뿐만 아니라, 급성 골수성 백혈병(acute myeloid leukemia)와 골수이형성 증후군(myelodysplastic syndromes)에서도 하향 조절(down-regulate)된다. AKAP12 유전자 발현은 골수 종양의 백혈병 유발(myeloid neoplasm leukemogenesis)과 연관 있다는 것을 제안한다. 또한, AKAP12의 불활성은 종양의 성장 저해와 관련이 있다. 6q25.1에서 가장 유의한 P 값을 갖는 SNP의 염색체 자리는 AKAP12의 3'-UTR 위치 부근이다 (도 6 참조).
또한, 만성 골수성 백혈병(CML)의 감수성과 17p11.1 유전자좌의 연관성은 한국인 코호트(검증군1)에서 3개의 SNP (rs7221571, rs4795519, and rs3396847)가 유의한 값을 갖는 것(P 값이 3.3 × 10-8 ~ 8.0 × 10-7)으로 검증되었으나, 서양인 코호트(검증군2)에서는 유효하지 않았다. 유의한 영역 주변의 유전자 중, 후보 유전자 WSBI 유전자의 5'-끝 부분이 위치해 있다. 이 유전자의 자세한 기능은 아직 밝혀지지 않았으나, WSBI는 세포사멸(apoptosis)에 대한 저항, 세포 주기 촉진 및 DNA 손상과 유전자 손상 스트레스와 같은 세포 스트레스로 인한 세포사멸로부터 보호와 관련이 있다. 또한, WSBI의 복제 수 변화는 WSBI의 과발현과 관련이 있으며, 신경모세포종(neuroblastoma) 환자의 생존과 연관되어 있다. 게다가, WSBI는 췌장암의 진행에 관여하는 것으로 알려져 있다. WSBI가 위치해 있는 17p11.1 유전자좌는 특히 한국인 집단에서만 만성 골수성 백혈병 감수성과 관련이 있지만, 만성 골수성 백혈병 위험 유전좌(risk locus)에서 완전히 배제할 수 없고 더 많은 검증 연구가 수행되어야 한다.
만성 골수성 백혈병 발병률이 상대적으로 낮기 때문에, GWAS를 위하여 환자군에서 많은 수(1,000명 이상)를 채용하는 것은 어렵다. 본 연구에서는 환자군 671명과 정상군 2,073명으로 구성된 총 2,744명을 대상으로 실험하였다. 본 발명의 전장유전체연관분석은 가능한 많은 만성 골수성 백혈병 환자군을 대상으로 수행하였을 뿐만 아니라, 한국인과 유럽계 캐나다인을 대상으로 수행함으로써 인종 간의 유의성도 검증하였다.
하기 표 2는 본 발명에 의해서 만성 골수성 백혈병과 관련이 있는 것으로 밝혀진 유전자와 유전자의 위치를 나타낸 것이고, 표 3은 본 발명에 의해서 만성 골수성 백혈병과 관련이 있는 것으로 밝혀진 단일염기다형성과 단일염기다형성의 위치를 나타낸 것이다.
표 2
유전자 염색체 번호 유전자 위치
MTHFD1L 6번 6q25.1
AKAP12 6번
ZBTB2 6번
RMND1 6번
C6orf211 6번
C6orf97 6번
ESR1 6번
WSB1 17번 17p11.1
FAM27L 17번
FLJ33360 5번 5p15.32
EBF1 5번 5q33.3
표 3
단일 염기 다형성 염색체 번호 단일염기다형성 위치
rs3900024 6번 6q25.1
rs7765741 6번
rs6931104 6번
rs4869742 6번
rs33962847 17번 17p11.1
rs7221571 17번
rs4795519 17번
rs16875692 5번 5p15.32
rs17055814 5번 5q33.3
또한, 본 발명의 전장유전체연관분석을 통하여 만성 골수성 백혈병과 유의한 연관성이 밝혀진 염색체 위치 및 단일염기다형성 빈도를 도 1 및 도 2에 나타내었다.
도 1 및 도 2에 표시된, 각각의 SNP 명칭은 표준 단일염기다형성의 명칭 (Reference SNP ID; rs)을 의미하며, 이는 인간게놈프로젝트(Human Genome Project)이후, 미국 국립보건원 산하 생물공학정보연구소 (NCBI)의 데이터베이스에서 각 단일염기다형성을 구분하기 위하여 붙인 이름이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. 피검자군(subjects)의 선정
전장유전체분석연구를 위한 피검자는 삼성의료원 연구원 및 성균관대학교의 승인을 받아 모집하였으며, 각각 임상적으로 만성 골수성 백혈병 진단을 받은 환자군과 정상군으로 구성된 한국인 실험군, 한국인 검증군(validation set) 및 유럽계 검증군(validation set)의 피검자 집단을 구성하였으며, 사전 동의를 받아 연구를 수행하였다.
첫 번째 피검자 집단은 한국인으로 구성된 실험군(disvovery set)으로서, 만성 골수성 백혈병 환자 202명과 정상인 497명으로 구성되었다.
두 번째와 세 번째 피검자 집단은 상기 실험군에서 선정된 유전자형을 검증하기 위한 검증군(validation set)으로서, 한국인으로 구성된 검증군 (만성 골수성 백혈병 환자 237명과 정상인 1,000명)과 유럽계 캐나다인으로 구성된 검증군(만성 골수성 백혈병 환자 232명과 정상인 576명)의 두 집단을 대상으로 검증 연구를 실시하였다.
하기 표 4는 본 발명의 실시예에서 사용된 피검자 군집의 크기를 정리한 것이다.
표 4
환자군 정상군(control) 총 합계
실험군(discovery set) 202 497 699
검증군1(validation set 1) 237 1,000 1,237
검증군 2(validation set 2) 232 576 808
총 합계 671 2,073 2,744
실시예 2. SNP 지노타이핑(genotyping)
상기 피검자군에서 말초 혈액 샘플 채취는 치료 과정 중 이루어 졌으며, 정제된 이중가닥 지놈 DNA 산출물은 QIAamp® DNA blood Maxi Kit (Qiagen Inc., Valencia, CA, USA)를 이용하여 결정되었으며, 50 ng/㎕로 표준화 하였고, 각 샘플마다 표준화된 지놈 DNA 5 ㎕를 Affymetrix 6.0 분석의 주형(template)으로 사용하였다.
실험군(discovery set)의 DNA 샘플 전체는 Affymetrix Genome-Wide Human SNP Array 6.0 (Affymetrix, Inc., Santa Clara, CA, USA)를 이용하여 총 906,530개의 SNP의 유전자형을 분석하였다. 지노타이핑 후, 잘못된 유전자형 클러스터 패턴은 육안 검사로 제외시켰고, 결측 유전자형(missing genotype) 비율이 5% 이상인 샘플도 분석에서 제외시켰다. 또한 1% 이상의 결측 유전자형(missing genotype)을 갖는 192,348개의 SNP, 소수 대립형질 빈도(minor allele frequency, MAF)가 5% 이하인 274,345개의 SNP, 및 정상군에서 유의한 하디-와인버그 평형(Hardy-Weinberg equilibrium, HWE)으로부터 편차(P < 0.001)를 보이는 6,532개의 SNP를 순차적으로 제외시켰다. 결과적으로, 201명의 환자 및 497명의 정상군에서 총 456,522개의 상염색체(autosomal) SNP를 분석하였다.
실험군의 유전자형 분석을 검증하기 위하여, 한국인 코호트를 대상으로 검증군1(환자군 237명, 정상군 1,000명)을 구성하였으며, 상기 검증군의 피검자 1,237명을 대상으로 MassARRAY® system (Sequenom, Inc., San Diego, CA, USA)를 이용하여 총 88개의 SNP 유전자형을 분석하였다. 검증군1에서 하디-와인버그 평형(Hardy-Weinberg equilibrium, HWE) 편차가 있는 SNP에 대한 유전자형 분석은 서열 분석(Applied Biosystems Inc., Foster City, CA, USA)에 의해 확정되었고, 유전자형이 일치하지 않는 SNP는 분석에서 제외되었다.
마지막으로, 한국인 코호트에서 입증된 9개의 SNP를 유럽계 코호트에서 입증하기 위하여, 상기 검증군 1과 같은 방법으로 유전자형 분석을 수행하였다.
실시예 3. 통계분석
유전적 동질성(genetic homogeneity)을 확인하고, 계층(stratification)을 평가하기 위하여 다차원 척도법 (multidimensional scaling, MDS)을 이용하여 샘플의 인구 구조를 분석하였다.
다차원 척도법(MDS) 분석을 위하여 국제 햅맵 프로젝트 (International HapMap Project)에서 동아시아인 (일본인; JPT, 중국인; CHB), 서양인 (CEU), 및 아프리카인 (YRI)에 대한 Affymetrix 6.0 data를 사용하였으며, 지놈 인플레이션 계수(genomic inflation factor, λ)는 중앙값 카이-제곱 통계 (median chi-squared statistic)에 기초하여 계산하였다.
SNP 마커와 질환 민감성 사이의 관계는 1차 자유도를 가지는 Cochran-Armitage trend 테스트를 통하여 측정하였다.
검증 연구를 위한 유전자 위치를 선택하기 위하여, 우리는 최소한 P value < 5.0 × 10-5 이고, 5개 이상의 SNP가 1 Mb 이내에서 P < 0.001 값을 갖는 후보 부위를 검색하였다.
한국인 코호트(검증군1)를 대상으로 유전자형을 검증하기 위하여, 중복되지 않는(non-redundant) 88개의 SNP를 선택하였으며, 이 88개에는 정도 관리(quality control)를 통과한 상위 50개 SNP 중에서 선정된 39개와 후보 부위에서 선정된 P < 0.001인 49개의 SNP가 포함된다. 본 발명자들은 상기 88개의 SNP 중에서 P < 0.05인 9개의 SNP를 선택하여, 유럽인 코호트(검증군2)에서 2차 검증을 실시하였다.
연관 분석을 포함한 모든 통계 분석은, PLINK version 1.06을 사용하여 수행되었다. 연관불균형(linkage disequilibrium, LD) 구조는 HaploView version 4.1.10를 이용하여 평가했다.
또한, 본 발명자들은 추가 분석을 위한 유전체 영역의 분석 범위를 증가시키기 위하여 SNP 결측치 추정(SNP imputation)을 수행하였다. IMPUTE program version 1.0.0은 Affymetrix 6.0 array에서 다루지 못한 633,644개의 다형적 SNP를 추정(impute)하기 위하여 사용되었다. SNP 결측치 추정(imputation)에 사용된 참조 패널(reference panel)은 국제 햅맵 프로젝트(International HapMap Project) 데이터 (Phase II Public Release #22 NCBI Build 36)로부터 알려진 90개의 일본인, 중국인(JPT+CHB) 일배체형(haplotype)이다.
실시예 4. 분석 결과
4-1. 실험군(Discovery set)
첫 번째 피검자 집단인 실험군으로서, 201명의 만성 골수성 백혈병 환자군과 497명의 정상군으로 구성된 피검자군에 대하여 456,522개의 SNP (MAF > 5%) 유전자형을 평가하였다. 다차원 척도법(MDS) 분석은 한국인에서 나타나는 유전적 변이가 International HapMap Project 데이터의 일본인(JPT) 및 중국인(CHB)의 변이와 일치하지만(overlap), 서양인(CEU) 및 아프리카인(YRI)의 변이와는 뚜렷이 구별된다는 것을 나타냈다.
실험에 사용된 모든 SNP 사이의 연관성 검사에 P value의 분포는 기대치로부터 전반적인 편중(overall systematic bias, λ=1.024)이 나타나지 않았으며, Q-Q 플롯(quantile-quantile plot) 상에서 낮은 P value를 보이는 SNP가 나타난 것은 SNP와 질환 사이에 연관성이 있음을 나타내는 것이다. 이러한 관찰 결과는 본 발명의 샘플이 유전적으로 동질성(homogeneous)을 갖는다는 것과 통계적으로 유의한 연관성(association)은 만성 골수성 백혈병 감수성에 대한 유전적 차이로부터 기인한다는 것을 나타낸다.
한국인 실험군(discovery set, n=698)에 대한 전장유전체연관분석에서 P < 5.0 × 10-5 (Cochran-Armitage trend test)를 갖는 56개의 SNP를 동정하였다. 5개의 유전자좌가 유의한 기준 (최소 P value < 5.0 × 10-5, 1 Mb 내에서 5개 이상의 SNP에 대한 P < 0.001)을 만족하였다. 상기 5개의 유전자좌는 5q33.3, 6p24.1, 6q25.1, 10q21.3, 및 17p11.1 이다 (도 4 참조).
각각의 유전자좌에 대하여 최소 P 값이 3.5 × 10-5 내지 1.4 × 10-5로 관찰되었다. 잠재적으로 암과 연관된 후보 유전자인 RMND1, AKAP12, ZBTB2, EBF1, CTNNA3, 및 WSB1를 포함하는 약 18개의 주석 유전자(annotated genes)는 상기 유전자좌 근처에 위치한다. 5개의 유전자좌 주변에 있는 질환 관련 SNP의 지역적 연관성(association) 그림(plot)은 같은 지역에서 유의한 연관(association) 피크들의 클러스터(cluster)를 나타낸다 (도 5 참조).
4-2. 검증군(Validation set)
한국인 코호트(검증군1)를 대상으로 상기 실험군에서 찾아낸 유전자형의 검증을 실시하였으며, 237명의 환자군과 1,000명의 대조군에서 MassARRAY® system (Sequenom, Inc., San Diego, CA, USA)을 이용하여 총 88개의 SNP 유전자형을 분석하였다. 검증군1에서 하디-와인버그 평형(Hardy-Weinberg equilibrium, HWE) 편차가 있는 SNP에 대한 유전자형 분석은 서열 분석(Applied Biosystems Inc., Foster City, CA, USA)에 의해 확정되었고, 유전자형이 일치하지 않는 SNP는 분석에서 제외되었다. 한국인 코호트(검증군1)에서 입증된 9개의 SNP는 유럽인 코호트(검증군2)에서 2차 검증 분석을 수행하였다.
한국인 코호트 (CML 환자군 237명, 정상군 1,000명)와 유럽계 코호트 (CML 환자군 232명, 정상군 576명)를 대상으로 상위 50개의 SNP 중 39개의 SNP 및 5개의 유의한 유전자 위치에서 선별된 49개의 SNP를 포함한 88개의 SNP에 대하여 검증 연구가 행해졌다.
6q25.1은 한국인과 유럽인 코호트 모두에서 유효함이 밝혀졌다. 6q25.1에 있는 4개의 SNP(rs4869742, rs7765741, rs3900024, 및 rs6931104)들은 두 검증군 모두에서 유의한 관련성을 나타내었다. (도 1 및 도 2 참조)
실험군(discovery set)에서 SNP의 P 값은 5.5 × 10-5 ~ 8.4 × 10-4 범위에 속하였으며, 검증군1에서는 2.6 × 10-3 ~ 5.0 × 10-2 범위, 한국인 코호트 전체(실험군+검증군1)에서는 2.4 × 10-6 ~ 2.8 × 10-5 범위에 속했고, 또한 검증군2에서는 1.3 × 10-3 ~ 2.3 × 10-3 범위에 속하였다 (도 1 및 도 2 참조).
한편, rs4869742는 하디-와인버그 평형(HWE)의 유의한 편차 때문에 유럽인 검증 세트에 대한 분석에서 제외되었다. 유럽인 세트에서 연관(association) 방향은 한국인 실험군 및 검증군1의 연관 방향과 동일하고, 이 관련성은 본페로니 검정(Bonferroni correction)을 한 후에도 여전히 유의하다. 6q25.1 유전자 위치는 모든 인종에서 만성 골수성 백혈병의 감수성과 연관이 있다는 것을 나타낸다.
도 1에 나타낸 바와 같이, 대표적인 SNP로서 rs7765741을 살펴 보면, 한국인 환자군에서 T 대립유전자(allele) 빈도는 정상군보다 낮았고 (0.35 vs 0.44), 유럽인에서는 T 대립유전자의 빈도가 한국인에서보다 높았지만, 비슷한 경향을 보였다 (0.67 vs. 0.75). 오즈비(odds ratio)는 한국인에서 0.69 (95% 신뢰구간(confidence interval, CI, 0.59 ~ 0.81), 유럽인에서 0.68 (95% 신뢰구간(CI), 0.53 ~ 0.85)을 나타내었다.
SNP 후보군 중에 17p11.1에 있는 3개의 SNP (rs7221571, rs4795519, 및 rs33962847)는 본페로니 검정(Bonferroni correction) (P values: 2.9 × 10-5 ~ 7.0 × 10-5)을 한 이후에도, 한국인 검증군에서 유의성을 보였으나 (P values: 3.3 × 10-8 ~ 8.0 × 10-7; 도 1 및 2 참조), 유럽인 검증군에서는 유의성이 나타나지 않았다. 이 3가지 SNP는 한국인 실험군과 검증군을 합쳐서 분석했을 때(Combined set) 그 유의성이 증가하였다 (P values: 1.3 × 10-12 ~ 5.6 × 10-10).
가장 유의한 SNP인 rs4795519의 소수 대립형질 빈도(minor allele frequency, MAF)는 환자군에서 0.37, 정상군에서 0.52를 나타내었으며, 오즈비(OR, odds ratio)는 0.54 (95% 신뢰구간, 0.46 ~ 0.64)였다. 지역적 연관성(association) 플롯은 유전자좌가 WSBI 유전자의 5' 끝부분 근처에 위치한다는 것을 나타낸다 (도 6 참조). 유의한 SNP는 동아시아 샘플에서 나타나는 강한 LD 블록에 위치한다. WSBI의 위쪽 부분에 위치하는 재조합 빈발부위(hotspot)을 교차했을 때 -log10(P) 값은 급격히 떨어졌다 (도 6 참조).
실시예 5. 만성 골수성 백혈병 발명 예측 또는 진단용 단일염기다형성 키트
본 발명에서는 만성 골수성 백혈병과 연관된 단일염기다형성 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs16875692, 및 rs17055814를 포함하는, 만성 골수성 백혈병 예측 또는 진단용 키트를 제조하였다. 상기 실시예 2에 설명되어 있는 방법을 사용하여 만성 골수성 백혈병의 발병 또는 발병 가능성을 진단 또는 예측하고자 하는 대상의 혈액으로부터 유전자 DNA를 분리하고, 표지수단을 DNA에 혼성화켰다.
본 발명에서 상기 표지수단은 Cy5, 비오틴 결합 화합물, Cy3, EDANS(5-(2'-아미노에틸)아미노-1-나프탈렌 황산), 테트라메틸로다민(TMR), 테트라메틸로다민 이소시아네이트(TMRITC), x-로다민 또는 텍사스 레드(Texas red)를 포함할 수 있으나 이에 한정되지 아니한다.
상기 대상이 본 발명에 따른 SNP 전부 또는 일부를 갖고 있는지를 확인함으로써, 만성 골수성 백혈병 질환의 발병 가능성을 예측하고, 만성 골수성 백혈병의 감수성을 특정하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 마커를 이용하여 만성 골수성 백혈병 발생 위험도를 효과적으로 예측 또는 진단할 수 있으며, 본 발명은 만성 골수성 백혈병의 치료 및 약물 개발 연구에 활용될 수 있다.
<110> Samsung Life Public Welfare Foundation
<120> Method for predicting chronic myeloid leukemia risk and kit for
diagnosing chronic myeloid leukemia risk using thereof
<130> PCT01460
<150> KR 10-2011-0041690
<151> 2011-05-02
<160> 18
<170> KopatentIn 1.71
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs3900024_forward primer
<400> 1
acgttggatg gtatgtgccc cattcttctg 30
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs3900024_reverse primer
<400> 2
acgttggatg tcatcacaga gcacatgtgg 30
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7765741_forward primer
<400> 3
acgttggatg aagtgtgact agatgccctc 30
<210> 4
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7765741_reverse primer
<400> 4
acgttggatg aggattgcac caaaagccat 30
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs6931104_forward primer
<400> 5
acgttggatg gcacttcaca tgcaagcatc 30
<210> 6
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs6931104_reverse primer
<400> 6
acgttggatg ctcagtttcc tcctctgttc 30
<210> 7
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs4869742_forward primer
<400> 7
acgttggatg aacatgttcc agccatggag 30
<210> 8
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs4869742_reverse primer
<400> 8
acgttggatg ggcatgaaat ctggcaagtg 30
<210> 9
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs33962847_forward primer
<400> 9
acgttggatg gccagatgat tgatgcttac 30
<210> 10
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs33962847_reverse primer
<400> 10
acgttggatg cccctcaccc ttataacttg 30
<210> 11
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7221571_forward primer
<400> 11
acgttggatg attgcttcct ctcctaaggc 30
<210> 12
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7221571_reverse primer
<400> 12
acgttggatg catgaacaat tagaggccac 30
<210> 13
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs4795519_forward primer
<400> 13
acgttggatg gaggctttga gtcaacacac 30
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs4795519_reverse primer
<400> 14
acgttggatg taatcatccg cacacaggac 30
<210> 15
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs16875692_forward primer
<400> 15
acgttggatg gtgtctacta tttctgatgg 30
<210> 16
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs16875692_reverse primer
<400> 16
acgttggatg actggctgcg gtttcttaac 30
<210> 17
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs17055814_forward primer
<400> 17
acgttggatg gcatctcgta tgtgcaactc 30
<210> 18
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> rs17055814_reverse primer
<400> 18
acgttggatg cctgtttgcc cagtatactc 30

Claims (12)

  1. MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는, 만성 골수성 백혈병 진단용 조성물.
  2. 제 1항에 있어서,
    상기 단일염기다형성은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)인 것을 특징으로 하는, 만성 골수성 백혈병 진단용 조성물.
  3. MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는, 만성 골수성 백혈병 진단용 DNA 칩.
  4. 제 3항에 있어서,
    상기 단일염기다형성은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)인 것을 특징으로 하는, 만성 골수성 백혈병 진단용 DNA 칩.
  5. rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)과 연관불균형(linkage disequilibrium, r 2 > 0.1) 관계에 있는 단일염기다형성을 증폭할 수 있는, 프라이머 쌍.
  6. rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)을 증폭시킬 수 있는, 프라이머 쌍.
  7. 제 6항에 있어서,
    상기 프라이머 쌍은
    a) 서열번호 1 및 2로 기재되는 염기서열을 갖고 rs3900024를 증폭시킬 수 있는 올리고뉴클레오티드;
    b) 서열번호 3 및 4로 기재되는 염기서열을 갖고 rs7765741를 증폭시킬 수 있는 올리고뉴클레오티드;
    c) 서열번호 5 및 6으로 기재되는 염기서열을 갖고 rs6931104를 증폭시킬 수 있는 올리고뉴클레오티드;
    d) 서열번호 7 및 8로 기재되는 염기서열을 갖고 rs4869742를 증폭시킬 수 있는 올리고뉴클레오티드;
    e) 서열번호 9 및 10으로 기재되는 염기서열을 갖고 rs33962847을 증폭시킬 수 있는 올리고뉴클레오티드;
    f) 서열번호 11 및 12로 기재되는 염기서열을 갖고 rs7221571을 증폭시킬 수 있는 올리고뉴클레오티드;
    g) 서열번호 13 및 14로 기재되는 염기서열을 갖고 rs4795519를 증폭시킬 수 있는 올리고뉴클레오티드;
    h) 서열번호 15 및 16으로 기재되는 염기서열을 갖고 rs16875692를 증폭시킬 수 있는 올리고뉴클레오티드; 및
    i) 서열번호 17 및 18로 기재되는 염기서열을 갖고 rs17055814를 증폭시킬 수 있는 올리고뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상인, 프라이머 쌍.
  8. MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 또는 이에 상보적인 서열을 포함하는 만성 골수성 백혈병 진단용 DNA 칩, 상기 단일염기다형성 부위를 증폭시킬 수 있는 프라이머 쌍, 상기 DNA 칩과 혼성화(hybridization)되어 증폭된 DNA를 탐지하기 위한 표지수단, 증폭 효소, 뉴클레오티드 및 완충용액을 포함하는 것을 특징으로 하는, 만성 골수성 백혈병 진단 키트.
  9. 제 8항에 있어서,
    상기 단일염기다형성은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)인 것을 특징으로 하는, 만성 골수성 백혈병 진단 키트.
  10. 제 8항에 있어서,
    상기 표지수단은 Cy5, 비오틴 결합 화합물, Cy3, EDANS(5-(2'-아미노에틸)아미노-1-나프탈렌 황산), 테트라메틸로다민(TMR), 테트라메틸로다민 이소시아네이트(TMRITC), x-로다민 및 텍사스 레드(Texas red)으로 이루어진 군에서 선택되는 것인, 만성 골수성 백혈병 진단 키트.
  11. a) 시료로부터 추출한 DNA로부터, MTHFD1L, AKAP12, ZBTB2, RMND1, C6orf211, C6orf97, ESR1, WSB1, FAM27L, FLJ33360, 및 EBF1로 이루어진 군에서 선택되는 하나 이상의 유전자 및 이의 전사조절(transcriptional regulation) 영역에 위치한 단일염기다형성(SNP) 빈도를 측정하는 단계; 및
    b) 상기 a) 단계에서 측정한 다형성 빈도를 대조군과 비교하여 상관관계를 구하는 단계를 포함하는, 만성 골수성 백혈병에 대한 감수성을 예측하기 위한 정보 제공 방법.
  12. 제 11항에 있어서,
    상기 단일염기다형성은 rs3900024, rs7765741, rs6931104, rs4869742, rs33962847, rs7221571, rs4795519, rs16875692, 및 rs17055814로 이루어지는 군에서 선택되는 하나 이상의 단일염기다형성(SNP)인 것을 특징으로 하는, 만성 골수성 백혈병에 대한 감수성을 예측하기 위한 정보 제공 방법.
PCT/KR2012/003445 2011-05-02 2012-05-02 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트 WO2012150818A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020110041690A KR20120124507A (ko) 2011-05-02 2011-05-02 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트
KR10-2011-0041690 2011-05-02

Publications (3)

Publication Number Publication Date
WO2012150818A2 true WO2012150818A2 (ko) 2012-11-08
WO2012150818A9 WO2012150818A9 (ko) 2013-02-21
WO2012150818A3 WO2012150818A3 (ko) 2013-04-11

Family

ID=47108140

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/003445 WO2012150818A2 (ko) 2011-05-02 2012-05-02 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트

Country Status (2)

Country Link
KR (1) KR20120124507A (ko)
WO (1) WO2012150818A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016042137A1 (en) * 2014-09-19 2016-03-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for diagnosing myeloproliferative chronic myelomonocytic leukemia or unclassified myeloproliferative myelodysplastic neoplasm

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100647806B1 (ko) * 2004-11-30 2006-11-23 경북대학교 산학협력단 한국인의 폐암 발생 위험도를 예측하는 방법 및 이를이용한 진단 키트
US20090208962A1 (en) * 2005-11-29 2009-08-20 Perlegen Sciences, Inc. Markers for breast cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100647806B1 (ko) * 2004-11-30 2006-11-23 경북대학교 산학협력단 한국인의 폐암 발생 위험도를 예측하는 방법 및 이를이용한 진단 키트
US20090208962A1 (en) * 2005-11-29 2009-08-20 Perlegen Sciences, Inc. Markers for breast cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 16 December 2010 Database accession no. rs3900024 *
KIM, D. H. ET AL.: 'A genome-wide association study identifies novel loci associated with susceptibility to chronic myeloid leukemia' BLOOD vol. 117, no. 25, 03 May 2011, pages 6906 - 6911 *
KIM, DONG HWAN: 'Massive Genome Study for Gene Mining Associated with Chronic Myelogenous Leukemia' MINISTRY OF EDUCATION, SCIENCE AND TECHNOLOGY, FINAL REPORT OF BASIC RESEARCH 28 February 2011, pages 20 - 22 *
'myelogenous leukemia: a meta-analysis' Leuk.' LYMPHOMA. vol. 51, no. 7, July 2010, pages 1288 - 1292 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016042137A1 (en) * 2014-09-19 2016-03-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for diagnosing myeloproliferative chronic myelomonocytic leukemia or unclassified myeloproliferative myelodysplastic neoplasm

Also Published As

Publication number Publication date
WO2012150818A3 (ko) 2013-04-11
WO2012150818A9 (ko) 2013-02-21
KR20120124507A (ko) 2012-11-14

Similar Documents

Publication Publication Date Title
WO2012081898A2 (ko) 위암의 예후 예측용 마커 및 이를 이용하는 위암의 예후 예측 방법
WO2015068957A1 (en) Method for the detection of multiple target nucleic acids using clamping probes and detection probes
WO2011055916A2 (ko) 장암 진단을 위한 장암 특이적 메틸화 마커 유전자의 메틸화 검출방법
WO2015023146A1 (ko) 전암병변의 검출방법
WO2012070861A2 (ko) 위암 진단을 위한 위암 특이적 메틸화 바이오마커
WO2017188669A2 (ko) 절단된 상보적인 태그 절편을 이용한 표적 핵산 서열 검출 방법 및 그 조성물
WO2018139826A1 (ko) Dna 메틸화를 이용한 연령 예측 방법
US20200216916A1 (en) Method for estimating additive and dominant genetic effects of single methylation polymorphisms (smps) on quantitative traits
WO2021182881A1 (ko) 유방암 진단용 다중 바이오마커 및 이의 용도
WO2015167087A1 (ko) Dna 복제수 변이를 이용한 강직성 척추염 발병 위험도 예측 방법
WO2020105873A1 (ko) 인간 알파코로나바이러스 전장유전체 증폭을 통한 진단키트 및 전장 유전체 서열 확인 방법
WO2017082655A1 (ko) 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물
WO2011139032A2 (ko) 표적 유전자의 다양한 변이가 존재하는 유전자 영역을 증폭하기 위한 프라이머 조성물
WO2012150818A2 (ko) 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트
WO2015108328A1 (ko) 대장암 마커로서의 신규 ntrk1 융합유전자 및 이의 용도
WO2011120398A1 (zh) 白血病融合基因的联合检测方法及其诊断试剂盒
WO2012050353A2 (ko) 표적 폴리뉴클레오티드의 염기서열을 비특이적으로 연장하는 방법
WO2017209575A1 (en) Evaluation of specificity of oligonucleotides
WO2011081501A2 (ko) 핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법
WO2023204522A1 (ko) 심근경색과 연관된 유전자 다형성 및 그의 용도
WO2019135477A2 (ko) 다복제유전자를 이용한 쯔쯔가무시병의 진단방법
WO2022055276A1 (ko) 여성형 탈모증 관련 유전자 다형성 마커 및 이의 용도
WO2022220575A1 (ko) 피부색 판단용 유전자 다형성 마커 및 이의 용도
WO2023106680A1 (ko) 비타민 c를 포함하는 처방의 피부 밝기 변화 예측 방법 및 시스템
WO2021034034A1 (ko) 핵산 단편간 거리 정보를 이용한 염색체 이상 검출 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12779701

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12779701

Country of ref document: EP

Kind code of ref document: A2