WO2012145697A1

WO2012145697A1 - Modulation of hepatitis b virus (hbv) expression

Info

Publication number: WO2012145697A1
Application number: PCT/US2012/034550
Authority: WO
Inventors: Eric E. Swayze; Susan M. Freier; Michael L. Mccaleb
Original assignee: Isis Pharmaceuticals, Inc.
Priority date: 2011-04-21
Filing date: 2012-04-20
Publication date: 2012-10-26
Also published as: EP3312189A1; SI3505528T1; EP3816288A2; AU2012245243B2; PE20181267A1; EP2699583A4; JP2019022521A; KR20200110822A; JP6426678B2; CR20130551A; US20140357701A1; UA118951C2; CN103582648B; CN106191060B; KR102247463B1; US20140107184A1; NZ616512A; US20170369883A1; PE20141177A1; BR112013027046A8

Abstract

Disclosed herein are antisense compounds and methods for decreasing HBV mRNA, DNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases, disorders or conditions.

Description

MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION

Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The

Sequence Listing is provided as a file entitled BIOL0175WOSEQ.txt created April 18, 2012, which is approximately 256 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

In certain embodiments provided are methods, compounds, and compositions for inhibiting expression of hepatitis B virus (HBV) mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases and disorders.

Background Hepatitis B is a viral disease transmitted parenterally by contaminated material such as blood and blood products, contaminated needles, sexually and vertically from infected or carrier mothers to their offspring. It is estimated by the World Health Organization that more than 2 billion people have been infected worldwide, with about 4 million acute cases per year, 1 million deaths per year, and 350-400 million chronic carriers (World Health Organization: Geographic Prevalence of Hepatitis B Prevalence, 2004. http ://www .who . int/ vaccines-surveillance/ graphics/htmls/hepbprev.htm) .

The virus, HBV, is a double-stranded hepatotropic virus which infects only humans and non-human primates. Viral replication takes place predominantly in the liver and, to a lesser extent, in the kidneys, pancreas, bone marrow and spleen (Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Viral and immune markers are detectable in blood and characteristic antigen-antibody patterns evolve over time. The first detectable viral marker is HBsAg, followed by hepatitis B e antigen (HBeAg) and HBV DNA. Titers may be high during the incubation period, but HBV DNA and HBeAg levels begin to fall at the onset of illness and may be undetectable at the time of peak clinical illness (Hepatitis B virus infection— natural history and clinical consequences. N Engl J Med.. 350: 2004; 1 1 18-1 129). HBeAg is a viral marker detectable in blood and correlates with active viral replication, and therefore high viral load and infectivity (Hepatitis B e antigen— the dangerous end game of hepatitis B. N Engl J Med. 347: 2002; 208-210). The presence of anti-HBsAb and anti-HBcAb (IgG) indicates recovery and immunity in a previously infected individual.

Currently the recommended therapies for chronic HBV infection by the American Association for the Study of Liver Diseases (AASLD) and the European Association for the Study of the Liver (EASL) include interferon alpha (INFa), pegylated interferon alpha-2a (Peg-IFN2a), entecavir, and tenofovir. The nucleoside and nucleotide therapies, entecavir and tenofovir, are successful at reducing viral load, but the rates of HBeAg seroconversion and HBsAg loss are even lower than those obtained using IFNa therapy. Other similar therapies, including lamivudine (3TC), telbivudine (LdT), and adefovir are also used, but for nucleoside/nucleotide therapies in general, the emergence of resistance limits therapeutic efficacy.

Thus, there is a need in the art to discover and develop new anti-viral therapies. Additionally, there is a need for new anti-HBV therapies capable of increasing HBeAg and HBsAg seroconversion rates. Recent clinical research has found a correlation between seroconversion and reductions in HBeAg (Fried et al (2008) Hepatology 47:428) and reductions in HBsAg (Moucari et al (2009) Hepatology 49: 1151). Reductions in antigen levels may have allowed immunological control of HBV infection because high levels of antigens are thought to induce immunological tolerance. Current nucleoside therapies for HBV are capable of dramatic reductions in serum levels of HBV but have little impact on HBeAg and HBsAg levels.

Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of HBV expression (See U.S. Patent Publication Nos. 2008/0039418 and 2007/0299027). Antisense therapy differs from nucleoside therapy in that it can directly target the transcripts for the HBV antigens and thereby reduce serum HBeAg and HBsAg levels. Because of the multiple, overlapping transcripts produced upon HBV infection, there is also an opportunity for a single antisense oligomer to reduce HBV DNA in addition to both HBeAg and HBsAg. Therefore, antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of HBV.

Summary

Provided herein are methods, compounds, and compositions for modulating expression of HBV mRNA and protein. In certain embodiments, compounds useful for modulating expression of HBV mRNA and protein are antisense compounds. In certain embodiments, the antisense compounds are antisense oligonucleotides.

In certain embodiments, modulation can occur in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human. In certain embodiments, HBV mRNA levels are reduced. In certain embodiments, HBV DNA levels are reduced. In certain embodiments, HBV protein levels are reduced. In certain embodiments, HBV antigen levels are reduced. In certain embodiments, HBV s-antigen (HBsAg) levels are reduced. In certain embodiments, HBV e-antigen (HBeAg) levels are reduced. Such reduction can occur in a time-dependent manner or in a dose-dependent manner. Also provided are methods, compounds, and compositions useful for preventing, treating, and ameliorating diseases, disorders, and conditions. In certain embodiments, such HBV related diseases, disorders, and conditions are liver diseases. In certain embodiments, such liver diseases, disorders, and conditions includes jaundice, liver cancer, liver inflammation, liver fibrosis, inflammation, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, and liver disease-related transplantation. In certain embodiments, such HBV related diseases, disorders, and conditions are hyperproliferative diseases, disorders, and conditions. In certain embodiments such hyperproliferative diseases, disorders, and conditions include cancer as well as associated malignancies and metastases. In certain embodiments, such cancers include liver cancer and hepatocellular cancer (HCC).

Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of liver disease or a hyperproliferative disease include growing older; tobacco use; exposure to sunlight and ionizing radiation; contact with certain chemicals; infection with certain viruses and bacteria; certain hormone therapies; family history of cancer; alcohol use; and certain lifestyle choices including poor diet, lack of physical activity, and/or being overweight. Certain symptoms and outcomes associated with development of a liver disease or a hyperproliferative disease include but are not limited to: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, jaundice, nausea and vomiting, pain over the liver area of the body, clay- or grey- colored stool, itching all over, and dark-colored urine.

In certain embodiments, methods of treatment include administering a HBV antisense compound to an individual in need thereof. In certain embodiments, methods of treatment include administering a HBV antisense oligonucleotide to an individual in need thereof.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

"2'-0-methoxyethyl" (also 2'-MOE and 2'-0(CH2)₂-OCH₃) refers to an O-methoxy-ethyl modification at the 2' position of a furanose ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.

"2'-MOE nucleoside" (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a 2'- MOE modified sugar moiety. "2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2 '-position of the furanosyl ring other than H or OH. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications.

"3' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound. "5' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 5 '-most nucleotide of a particular antisense compound.

"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5- methylcytosine is a modified nucleobase.

"About" means within ±7% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of HBV", it is implied that the HBV levels are inhibited within a range of 63% and 77%. "Acceptable safety profile" means a pattern of side effects that is within clinically acceptable limits.

"Active pharmaceutical agent" means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to HBV is an active pharmaceutical agent. "Active target region" means a target region to which one or more active antisense compounds is targeted. "Active antisense compounds" means antisense compounds that reduce target nucleic acid levels or protein levels.

"Acute hepatitis B infection" results when a person exposed to the hepatitis B virus begins to develop the signs and symptoms of viral hepatitis. This period of time, called the incubation period, is an average of 90 days, but could be as short as 45 days or as long as 6 months. For most people this infection will cause mild to moderate discomfort but will go away by itself because of the body's immune response succeeds in fighting the virus. However, some people, particularly those with compromised immune systems, such as persons suffering from AIDS, undergoing chemotherapy, taking immunosuppressant drugs, or taking steroids, have very serious problems as a result of the acute HBV infection, and go on to more severe conditions such as fulminant liver failure.

"Administered concomitantly" refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

"Administering" means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.

"Agent" means an active substance that can provide a therapeutic benefit when administered to an animal. "First Agent" means a therapeutic compound described herein. For example, a first agent can be an antisense oligonucleotide targeting HBV. "Second agent" means a second therapeutic compound described herein (e.g. a second antisense oligonucleotide targeting HBV) and/or a non- HBV therapeutic compound.

"Amelioration" refers to a lessening of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures which are known to those skilled in the art. "Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

"Antibody" refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, F_ab region, and F_c region.

"Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid. "Antisense compound" means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, snoRNAs, miRNAs, and satellite repeats.

"Antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

"Antisense mechanisms" are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

"Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.

"Bicyclic sugar" means a furanose ring modified by the bridging of two non-geminal carbon atoms. A bicyclic sugar is a modified sugar. "Body weight" refers to an animal's whole body weight, inclusive of all tissues including adipose tissue.

"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound. "cEt" or "constrained ethyl" means a bicyclic sugar moiety comprising a bridge connecting the 4'- carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH₃)-0-2'.

"Constrained ethyl nucleoside" (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH₃)-0-2' bridge.

"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'- O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0- methoxyethyl modifications.

"Chimeric antisense compounds" means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits. "Chronic hepatitis B infection" occurs when a person initially suffers from an acute infection but is then unable to fight off the infection. Whether the disease becomes chronic or completely resolves depends mostly on the age of the infected person. About 90% of infants infected at birth will progress to chronic disease. However, as a person ages, the risk of chronic infection decreases such that between 20%-50% of children and less than 10% of older children or adults will progress from acute to chronic infection. Chronic HBV infections are the primary treatment goal for embodiments of the present invention, although ASO compositions of the present invention are also capable of treating HBV-related conditions, such as inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, and more.

"Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses administration in parallel or sequentially.

"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid. "Comply" means the adherence with a recommended therapy by an individual. "Comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

"Contiguous nucleobases" means nucleobases immediately adjacent to each other. "Cure" means a method or course that restores health or a prescribed treatment for an illness.

"Deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.

"Designing" or "Designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule. "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.

"Dosage unit" means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art. "Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

"Dosing regimen" is a combination of doses designed to achieve one or more desired effects.

"Duration" means the period of time during which an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.

"Effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of active ingredient to a subject in need of such modulation, treatment or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount will vary depending upon the health and physical condition of the subject to be treated, the taxonomic group of subjects to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors. "Efficacy" means the ability to produce a desired effect.

"Expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.

"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

"Fully modified motif refers to an antisense compound comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a sugar modified nucleoside having uniform modification.

"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings."

"Gap-widened" means an antisense compound having a gap segment of 12 or more contiguous 2'- deoxyribonucleotides positioned between 5' and 3' wing segments having from one to six nucleotides having modified sugar moieties.

"HBV" means mammalian hepatitis B virus, including human hepatitis B virus. The term encompasses geographical genotypes of hepatitis B virus, particularly human hepatitis B virus, as well as variant strains of geographical genotypes of hepatitis B virus.

"HBV antigen" means any hepatitis B virus antigen or protein, including core proteins such as

"hepatitis B core antigen" or "HBcAG" and "hepatitis B E antigen" or "HBeAG" and envelope proteins such as "HBV surface antigen", or "HBsAg" or "HBsAG".

"Hepatitis B E antigen" or "HBeAg" or "HBeAG" is a secreted, non-particulate form of HBV core protein. HBV antigens HBeAg and HBcAg share primary amino acid sequences, so show cross-reactivity at the T cell level. HBeAg is not required for viral assembly or replication, although studies suggest they may be required for establishment of chronic infection. Neonatal infection with HBeAg-negative mutant often results in fulminant acute rather than chronic HBV infection (Terezawa et al (1991) Pediatr. Res. 29:5), whereas infection of young woodchucks with WHeAg-negative mutant results in a much lower rate of chronic WHV infection (Cote et al (2000) Hepatology 31 : 190). HBeAg may possibly function as a toleragen by inactivating core specific T cells through deletion or clonal anergy (Milich et al (1998) J. Immunol. 160:8102). There is a positive correlation between reduction of HBV viral load and antigens, and a decrease of expression, by T cells, of the inhibitory receptor programmed death-1 (PD-1 ; also known as PDCD1), a negative regulator of activated T cells, upon antiviral therapy and HBeAg seroconversion (Evans et al (2008) Hepatology 48:759).

"HBV mRNA" means any messenger RNA expressed by hepatitis B virus.

"HBV nucleic acid" or 'HBV DNA" means any nucleic acid encoding HBV. For example, in certain embodiments, a HBV nucleic acid includes, without limitation, any viral DNA sequence encoding a HBV genome or portion thereof, any RNA sequence transcribed from a viral DNA including any mRNA sequence encoding a HBV protein.

"HBV protein" means any protein secreted by hepatitis B virus The term encompasses various HBV antigens, including core proteins such as "Hepatitis E antigen", "HBeAg" or "HBeAG" and envelope proteins such as "HBV surface antigen", or "HBsAg".

"HBV surface antigen", or "HBsAg", or "HBsAG" is the envelope protein of infectious HBV viral particles but is also secreted as a non-infectious particle with serum levels 1000-fold higher than HBV viral particles. The serum levels of HBsAg in an infected person or animal can be as high as 1000 μg/mL (Kann and Gehrlich (1998) Topley & Wilson's Microbiology and Microbial Infections, 9^th ed. 745). In acute HBV infections, the half-life of HBsAg in the serum, or serum t_½, is 8.3 days (Chulanov et al (2003) J. Med. Virol. 69: 313). Internalization of HBsAg by myeloid dendritic cells inhibits up-regulation of co-stimulatory molecules (i.e. B7) and inhibits T cell stimulatory capacity (den Brouw et al (2008) Immunology 126:280), and dendritic cells from chronically infected patients also show deficits in expression of co-stimulatory molecules, secretion of IL-12, and stimulation of T cells in the presence of HBsAg (Zheng et al (2004) J. Viral Hepatitis 1 1 :217). HBsAg specific CD8 cells from CHB patients show altered tetramer binding. These CD8 cells are not anergic but may have TCR topology that confers partial tolerance or ignorance (Reignat et al (2002) J. Exp. Med. 195: 1089). Moreover, reduction in serum HBsAg > 1 log at week 24 has a high predictive value (92%) for sustained virological response (SVR - defined as nondetectable HBV DNA by PCR at 1 year after treatment) during Peg-IFNa2a therapy (Moucari et al (2009) Hepatology 49: 1151).

"Hepatitis B-related condition" or "HBV-related condition" means any disease, biological condition, medical condition, or event which is exacerbated, caused by, related to, associated with, or traceable to a hepatitis B infection, exposure, or illness. The term hepatitis B-related condition includes chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, liver disease related to transplantation, and conditions having symptoms which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen..

"Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.

"Identifying an animal having an HBV infection" means identifying an animal having been diagnosed with an HBV; or, identifying an animal having any symptom of an HBV infection including, but not limited to chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, liver disease related to transplantation, and conditions having symptoms which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen. "Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.

"Individual" means a human or non-human animal selected for treatment or therapy.

"Individual compliance" means adherence to a recommended or prescribed therapy by an individual.

"Induce", "inhibit", "potentiate", "elevate", "increase", "decrease" or the like, generally denote quantitative differences between two states. Such terms may refer to a statistically significant difference between the two states. For example, "an amount effective to inhibit the activity or expression of HBV" means that the level of activity or expression of HBV in a treated sample will quantitatively differ, and may be statistically significant, from the level of HBV activity or expression in untreated cells. Such terms are applied to, for example, levels of expression, and levels of activity.

"Inhibiting HBV" means reducing the level or expression of an HBV mRNA, DNA and/or protein. In certain embodiments, HBV is inhibited in the presence of an antisense compound targeting HBV, including an antisense oligonucleotide targeting HBV, as compared to expression of HBV mRNA, DNA and/or protein levels in the absence of a HBV antisense compound, such as an antisense oligonucleotide.

"Inhibiting the expression or activity" refers to a reduction, blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity. "Injection site reaction" means inflammation or abnormal redness of skin at a site of injection in an individual.

"Internucleoside linkage" refers to the chemical bond between nucleosides.

"Intraperitoneal administration" means administration through infusion or injection into the peritoneum. "Intravenous administration" means administration into a vein.

"Lengthened" antisense oligonucleotides are those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein.

"Linked deoxynucleoside" means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide. "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.

"Locked nucleic acid" or " LNA" or "LNA nucleosides" means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2 'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) a-L- Methyleneoxy (4'-CH₂-0-2') LNA , (B) β-D-Methyleneoxy (4'-CH₂-0-2') LNA , (C) Ethyleneoxy (4'- (CH₂)₂-0-2') LNA , (D) Aminooxy (4'-CH₂-0-N(R)-2') LNA and (E) Oxyamino (4'-CH₂-N(R)-0-2') LNA, as depicted below.

As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ri)(R₂)]_n-, -C(Ri)=C(R₂)-, -C(R])=N-, -C(=NR,)-, -C(=0)-, -C(=S)-, -0-, -Si(R,)₂-, -S(=0)_x- and -N(R,)-; wherein: x is 0, 1 , or 2; n is

1 , 2, 3, or 4; each Ri and R₂ is, independently, H, a protecting group, hydroxyl, Ci-C]₂ alkyl, substituted C C₎₂ alkyl, C₂-Ci₂ alkenyl, substituted C₂-C_]2 alkenyl, C₂-Ci₂ alkynyl, substituted C₂-Ci₂ alkynyl, C5-C2₀ aryl, substituted C₅-C₂o aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C₅-C₇ alicyclic radical, halogen, OJi, NJiJ₂, SJ], N₃, COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl

or sulfoxyl (S(=0)-J,); and each J, and J₂ is, independently, H, Ci-C₎₂ alkyl, substituted C C₁₂ alkyl, C₂-Ci₂ alkenyl, substituted C₂-Ci₂ alkenyl, C₂-Ci₂ alkynyl, substituted C₂-C_]2 alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂o aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C_rCi₂ aminoalkyl, substituted C_rC|₂ aminoalkyl or a protecting group.

Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(R (R₂)]_n-, -[C(R,)(R₂)]n-0-, -C(R,R₂)-N(R,)-0- or -C(R,R₂)-O-N(R -. Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH₂-2', 4'-(CH₂)₂-2', 4'- (CH₂)₃-2', 4'-CH₂-0-2', 4'-(CH₂)₂-0-2', 4^,-CH₂-0-N(R,)-2' and 4'-CH₂-N(R,)-0-2'- bridges, wherein each R, and R₂ is, independently, H, a protecting group or C_rC₁₂ alkyl.

Also included within the definition of LNA according to the invention are LNAs in which the 2'- hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH₂-0-2') bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (-CH₂-) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'- CH₂-0-2') LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4'-CH₂CH₂-0-2') LNA is used, a -L- methyleneoxy (4'-CH₂- 0-2'), an isomer of methyleneoxy (4'-CH₂-0-2') LNA is also encompassed within the definition of LNA, as used herein.

"Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid. "Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond). "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.

"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.

"Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase. "Modified sugar" means substitution and/or any change from a natural sugar moiety.

"Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.

"Motif means the pattern of unmodified and modified nucleosides in an antisense compound.

"Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2' -OH). "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

"Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

"Nucleic acid" refers to molecules composed of monomelic nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

"Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification. "Nucleoside" means a nucleobase linked to a sugar.

"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=0)-0- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/ or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside. "Off-target effect" refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

"Oligomeric compound" means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

"Oligonucleoside" means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.

"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

"Parenteral administration" means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.

"Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, "peptide" refers to polypeptides and proteins. "Pharmaceutically acceptable carrier" means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.

"Pharmaceutically acceptable derivative" encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

"Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to HBV is a pharmaceutical agent.

"Pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

"Portion" means a defined number of contiguous (i.e:, linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

"Prevention" or "preventing" refers to delaying or forestalling the onset or development of a condition or disease for a period of time from hours to days, preferably weeks to months. "Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.

"Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.

"Recommended therapy" means a therapeutic regimen recommended by a medical professional for the treatment, amelioration, or prevention of a disease.

"Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. "Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.

"Salts" mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto. "Segments" are defined as smaller or sub-portions of regions within a target nucleic acid.

"Seroconversion" is defined as serum HBeAg absence plus serum HBeAb presence, if monitoring HBeAg as the determinant for seroconversion, or defined as serum HBsAg absence, if monitoring HBsAg as the determinant for seroconversion, as determined by currently available detection limits of commercial ELISA systems. "Shortened" or "truncated" versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted.

"Side effects" means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality. "Significant," as used herein means measurable or observable, e.g, a significant result, such as, a significant improvement or significant, reduction generally refers to a measurable or observable result, such as a measurable or observable improvement or reduction.

"Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid.

"Slows progression" means decrease in the development of the said disease.

"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.

"Statistically Significant," as used herein means a measurable or observable parameter that is unlikely to occur by chance.

"Subcutaneous administration" means administration just below the skin.

"Subject" means a human or non-human animal selected for treatment or therapy.

"Target" refers to a protein, the modulation of which is desired.

"Target gene" refers to a gene encoding a target.

"Targeting" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

"Target nucleic acid," "target RNA," "target RNA transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by antisense compounds.

"Target region" means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment. "Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

"Treatment" refers to administering a composition to effect an alteration or improvement of the disease or condition. "Unmodified" nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside). "Validated target segment" is defined as at least an 8-nucleobase portion (i.e. 8 consecutive nucleobases) of a target region to which an active oligomeric compound is targeted.

"Wing segment" means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases. Certain Embodiments

Certain embodiments provide methods, compounds, and compositions for inhibiting HBV mRNA expression.

Certain embodiments provide antisense compounds targeted to a HBV nucleic acid. In certain embodiments, the HBV nucleic acid is the sequences set forth in GENBANK Accession No. U95551.1 (incorporated herein as SEQ ID NO: 1).

In certain embodiments, the compounds provided herein are or comprise a modified oligonucleotide. In certain embodiments the compounds comprise a modified oligonucleotide and a conjugate as described herein. In certain embodiments, the modified oligonucleotide is a pharmaceutically acceptable derivative.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. The HBV target can have a sequence recited in SEQ ID NO: 1 or a portion thereof or a variant thereof.

In certain embodiments, the compounds or modified oligonucleotides provided herein are 10 to 30 linked nucleosides in length and are targeted to HBV. In certain embodiments, the HBV target has the sequence recited in SEQ ID NO: 1. In certain embodiments, such compounds or oligonucleotides target one of the following nucleotide regions of HBV: CCTGCTGGTGGCTCCAGTTC (SEQ ID NO: 1273 ); AGAGTCTAGACTCGTGGTGGACTTCTCTCA (SEQ ID NO: 1354);

CATCCTGCTGCTATGCCTCATCTTCTT (SEQ ID NO: 1276); CAAGGTATGTTGCCCGT (SEQ ID NO:

1277) ; CCTATGGGAGTGGGCCTCAG (SEQ ID NO: 1279; TGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCG (SEQ ID NO: 1287);

TATATGGATGATGTGGT (SEQ ID NO: 1359); TGCCAAGTGTTTGCTGA (SEQ ID NO: 1360); TGCCGATCCATACTGCGGAACTCCT (SEQ ID NO: 1361);

CCGTGTGCACTTCGCTTCACCTCTGCACGT (SEQ ID NO: 1352);

GGAGGCTGTAGGCATAAATTGGT (SEQ ID NO: 1353); CTTTTTCACCTCTGCCTA (SEQ ID NO: 1362); TTCAAGCCTCCAAGCTGTGCCTTGG (SEQ ID NO: 1363);

AGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGG (SEQ ID NO: 1274); TGGATGTGTCTGCGGCGTTTTATCAT (SEQ ID NO: 1275); TGTATTCCCATCCCATC (SEQ ID NO:

1278) ; TGGCTCAGTTTACTAGTGC (SEQ ID NO: 1280); GGGCTTTCCCCCACTGT (SEQ ID NO: 1281); TCCTCTGCCGATCCATACTGCGGAACTCCT (SEQ ID NO: 1282); CGCACCTCTCTTTACGCGG (SEQ ID NO: 1283); GGAGTGTGGATTCGCAC (SEQ ID NO: 1284); or GAAGAAGAACTCCCTCGCCT (SEQ ID NO: 1285). In certain embodiments, such compounds or oligonucleotides have a gap segment of 9, 10, or more linked deoxynucleosides. In certain embodiments, such compounds or oligonucleotides have a gap segment of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1 , 2, 3, 4, 5, 6, 7, or 8 linked modified nucleosides. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2'-substituted nucleoside. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside. In certain embodiments, the modified nucleoside is a constrained ethyl (cEt) nucleoside.

In certain embodiments, the compounds or compositions comprise modified oligonucleotides consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising a portion at least 8,

9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases complementary to an equal length portion of any of the nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274,

1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360,

1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1. In certain embodiments, such oligonucleotides have a gap segment of 9, 10, or more linked deoxynucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1 , 2, 3, 4, 5, 6, 7, or 8 linked modified nucleosides. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2 '-substituted nucleoside. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside. In certain embodiments, the modified nucleoside is a constrained ethyl (cEt) nucleoside. In certain embodiments, each modified nucleoside in each wing segment is independently a 2'-MOE nucleoside or a nucleoside with a bicyclic sugar modification such as a constrained ethyl (cEt) nucleoside or LNA nucleoside.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 5-310, 321-802, 804- 1272, 1288-1350, 1364-1372, 1375, 1376, or 1379. In certain embodiments, such oligonucleotides have a gap segment of 9, 10, or more linked deoxynucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1 -5, 1 -4, 1 -3, 2-5, 2-4 or 2-3 linked modified nucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1 , 2, 3, 4, 5, 6, 7, or 8 linked modified nucleosides. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2'-substituted nucleoside. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside. In certain embodiments, the modified nucleoside is a constrained ethyl (cEt) nucleoside.

In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, or 4 sugar modified nucleosides. In certain embodiments, each sugar modified nucleoside is independently a 2'-MOE nucleoside or a nucleoside with a bicyclic sugar moiety such as a constrained ethyl (cEt) nucleoside or LNA nucleoside. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides. In certain embodiments, each sugar modified nucleoside is independently a 2'-MOE nucleoside or a bicyclic nucleoside such as a constrained ethyl (cEt) nucleoside or LNA nucleoside.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 5-310, 321 -802, 804- 1272, 1288-1350, 1364-1372, 1375, 1376, or 1379. In certain embodiments, such oligonucleotides have a gap segment of 10 or more linked deoxynucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1-5, 1 -4, 1 -3, 2-5, 2-4 or 2-3 linked modified nucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 2, 3, 4, 5, 6, 7, or 8 linked modified nucleosides. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2 '-substituted nucleoside. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 5, 15, 16, 33, 39-95, 123- 135, 163-175, 180-310, 321-406, 413-455, 461-802, or 804-1272. In certain embodiments, such oligonucleotides have a gap segment of 10 or more linked deoxynucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1-5, 1 -4, 1-3, 2-5, 2-4 or 2-3 linked modified nucleosides. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2'- substituted nucleoside. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 6-14, 17-32, 34-38, 96- 122, 136-162, 176-179, 407-412, 456-462, 523-538. In certain embodiments, such oligonucleotides have a gap segment of 10 or more linked deoxynucleosides. In certain embodiments, such gap segment is between two wing segments that independently have 1 -5, 1 -4, 1 -3, 2-5, 2-4 or 2-3 linked modified nucleosides. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified nucleoside is a 2 '-substituted nucleoside. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside. In certain embodiments, the modified oligonucleotide is 14 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -3 or 2 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1-5, 2-4 or 3 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides, such as 2'-MOE nucleosides.

In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, 2-4 or 3-4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, 5, or 6 sugar modified nucleosides, such as 2'-MOE nucleosides.

In certain embodiments, the modified oligonucleotide is 18 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, 3-5, or 4 sugar modified nucleosides.

In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, or 5 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, 5, 6, 7, or 8 sugar modified nucleosides, such as 2'-MOE nucleosides.

In certain embodiments, the compounds or compositions comprise a salt of the modified oligonucleotide.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO: 1 , as measured over the entirety of the modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to any one of SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, as measured over the entirety of the modified oligonucleotide. In certain embodiments, the compound or modified oligonucleotide is single-stranded.

In certain embodiments, the modified oligonucleotide consists of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 14 linked nucleosides.

In certain embodiments, at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage. In certain embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage.

In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-0-methoxyethyl group (2'- 0(CH₂)2-OCH₃). In certain embodiments, the modified sugar comprises a 2'-0-CH3 group.

In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar the bicyclic sugar comprises a 4'- (CH₂)_n-0-2' bridge, wherein n is 1 or 2. In certain embodiments, the bicyclic sugar comprises a 4'- CH₂-0-2' bridge. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH₃)-0-2' bridge.

In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of a single-stranded modified oligonucleotide.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5' wing segment consisting of linked nucleosides; and c) a 3' wing segment consisting of linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of 10 linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-mefhoxyethyl sugar and/or a constrained ethyl (cEt) sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. In some aspects, each of the three linked nucleosides of the 5' wing segment is a 2'-0-methoxyethyl sugar and each of the three linked nucleosides of the 3' wing segment is a constrained ethyl (cEt) sugar. In other aspects, the three linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and the three linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2'-0-methoxyethyl sugar in the 5' to 3' direction. In other aspects, the three linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and the three linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of 10 linked deoxynucleosides, the 5' wing segment consisting of two linked nucleosides, the 3' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar and a constrained ethyl (cEt) sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. In some aspects, the two linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and the four linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a 2'-0-methoxyethyl sugar in the 5' to 3' direction.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of 9 linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of two linked nucleosides; the five linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2 '-deoxynucleoside, a constrained ethyl (cEt) sugar, a 2'- deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the two linked nucleosides of the 3' wing segment are a 2'-0-methoxyethyl sugar and a 2'-0-methoxyethyl sugar in the 5' to 3' direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of 8 linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of five linked nucleosides; the three linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the five linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of 8 linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of five linked nucleosides; each of the three linked nucleosides of the 5' wing segment is a constrained ethyl (cEt) sugar; each of the five linked nucleosides of the 3' wing segment is a 2'- O-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5- methylcytosine. In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 9 linked deoxynucleosides, the 5' wing segment consisting of four linked nucleosides, the 3 ' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar and a constrained ethyl (cEt) sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. In some aspects, the four linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and the four linked nucleosides of the 3' wing segment are a 2'-0-methoxyethyl sugar, constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a 2'-0-methoxyethyl sugar in the 5' to 3' direction.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 9 linked deoxynucleosides, the 5' wing segment consisting of four linked nucleosides, the 3' wing segment consisting of four linked nucleosides; the four linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the four linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, and a 2'-0-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 9 linked deoxynucleosides, the 5 ' wing segment consisting of four linked nucleosides, the 3' wing segment consisting of four linked nucleosides; the four linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'- O-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5- methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 8 linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of four linked nucleosides; the five linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, a constrained ethyl (cEt) sugar, a 2'- deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 8 linked deoxynucleosides, the 5 ' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of four linked nucleosides; the five linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 7 linked deoxynucleosides, the 5 ' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides; the five linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the five linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, and a 2'-0-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 7 linked deoxynucleosides, the 5' wing segment consisting of six linked nucleosides, the 3' wing segment consisting of four linked nucleosides; the six linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5 ' to 3 ' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of 7 linked deoxynucleosides, the 5' wing segment consisting of six linked nucleosides, the 3' wing segment consisting of four linked nucleosides; the six linked nucleosides of the 5' wing segment are a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-mefhoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of 10 linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of 10 linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, wherein the five linked nucleosides of the 5' wing are a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and each of the five linked nucleosides of the 3' wing are a 2'-0-methoxyethyl sugar.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of three linked nucleosides. In some aspects, the gap segment is positioned between the 5' wing segment and the 3' wing segment; each of the three linked nucleosides of the 5' wing segment is a 2'-0- methoxyethyl sugar and each of the three linked nucleosides of the 3' wing segment is a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine residue is a 5- methylcytosine. In other aspects, the gap segment is positioned between the 5' wing segment and the 3' wing segment; the three linked nucleosides of the 5' wing segment are a 2'-0-mefhoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the three linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2'-0- methoxyethyl sugar in the 5' to 3' direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine residue is a 5-methylcytosine. In other aspects, the three linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and the three linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of two linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides. In some aspects, the gap segment is positioned between the 5' wing segment and the 3' wing segment; the two linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the four linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, 2'-0-methoxyethyl sugar, constrained ethyl (cEt) sugar, and 2'-0-methoxyethyl sugar in the 5' to 3' direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) gap segment consisting of 9 linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of two linked nucleosides, wherein the five linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the two linked nucleosides of the 3' wing segment are a 2'-0-methoxyethyl sugar and a 2'-0-methoxyethyl sugar in the 5' to 3' direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 8 linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides, wherein the three linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the five linked nucleosides of the 3' wing segment is a 2 '-O-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 8 linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides, wherein each of the three linked nucleosides of the 5' wing segment is a constrained ethyl (cEt) sugar; each of the five linked nucleosides of the 3' wing segment is a 2'-0- methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5- methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ED NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 9 linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar and a constrained ethyl (cEt) sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. In some aspects, the four linked nucleosides of the 5' wing segment are a 2'- O-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and the four linked nucleosides of the 3' wing segment are a 2'-0- methoxyethyl sugar, constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a 2'-0-methoxyethyl sugar in the 5' to 3' direction.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 9 linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides, wherein the four linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the four linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, and a 2'-0-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 9 linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) the 3' wing segment consisting of four linked nucleosides, wherein the four linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar, a constrained ethyl (cEt) sugar, a 2'-0-methoxyethyl sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0- methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5- methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 8 linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides, wherein the five linked nucleosides of the 5' wing segment are a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 8 linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides, wherein the five linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar, a 2'-0-methoxyethyl sugar, 2'-0-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 7 linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides, wherein the five linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar, a 2 '-O-methoxyethyl sugar, a 2 '-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; the five linked nucleosides of the 3' wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2 '-O-methoxyethyl sugar, a 2'- O-methoxyethyl sugar, and a 2 '-O-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ E) NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 7 linked deoxynucleosides; b) a 5' wing segment consisting of six linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides, wherein the six linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2'-0-methoxyethyl sugar, a 2 '-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2' -O-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 7 linked deoxynucleosides; b) a 5' wing segment consisting of six linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides, wherein the six linked nucleosides of the 5' wing segment are a 2'-0- methoxyethyl sugar, a constrained ethyl (cEt) sugar, a 2 '-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction; each of the four linked nucleosides of the 3' wing segment is a 2'-0-methoxyethyl sugar; each intemucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 10 linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5- methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of 10 linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, wherein the five linked nucleosides of the 5' wing are a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, a constrained ethyl (cEt) sugar, a 2'-deoxynucleoside, and a constrained ethyl (cEt) sugar in the 5' to 3' direction, and each of the five linked nucleosides of the 3' wing are a 2'-0- methoxyethyl sugar.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of two linked nucleosides, the 3 ' wing segment consisting of eight linked nucleosides, each nucleoside of each wing segment comprises a 2 '-O-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of eight linked nucleosides, the 3 ' wing segment consisting of two linked nucleosides, each nucleoside of each wing segment comprises a 2 '-O-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of seven linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of seven linked nucleosides, the 3 ' wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of four linked nucleosides, the 3' wing segment consisting of six linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of six linked nucleosides, the 3' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5 ' wing segment consisting of four linked nucleosides, the 3 ' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of two linked nucleosides, the 3 ' wing segment consisting of six linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of six linked nucleosides, the 3 ' wing segment consisting of two linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of four linked nucleosides, the 3' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3 ' wing segment consisting of two linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of two linked nucleosides, the 3' wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of four linked nucleosides, the 3' wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, the gap segment consisting of nine linked deoxynucleosides, the 5' wing segment consisting of three linked nucleosides, the 3' wing segment consisting of four linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 14 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of two linked nucleosides, the 3' wing segment consisting of two linked nucleosides, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of two linked nucleosides; and c) a 3' wing segment consisting of eight linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ E) NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of eight linked nucleosides; and c) a 3' wing segment consisting of two linked nucleosides. The gap segment is positioned between the 5 ' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5 ' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of seven linked nucleosides. The gap segment is positioned between the 5 ' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of seven linked nucleosides; and c) a 3' wing segment consisting of three linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ E)

NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353,

1354, 1359, 1360, 1361 , 1362, and 1 363, wherein the nucleobase sequence is complementary to SEQ ID NO:

1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) a 3' wing segment consisting of six linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ED NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of six linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 18 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides. The gap segment is positioned between the 5 ' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of two linked nucleosides; and c) a 3' wing segment consisting of six linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ DD NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of six linked nucleosides; and c) a 3' wing segment consisting of two linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) a 3' wing segment consisting of four linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of three linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 17 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3' wing segment consisting of three linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353,

1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO:

1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of two linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5 -methyl cytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of two linked nucleosides; and c) a 3 ' wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of four linked nucleosides; and c) a 3' wing segment consisting of three linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3 ' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of nine linked deoxynucleosides; b) a 5' wing segment consisting of three linked nucleosides; and c) a 3 ' wing segment consisting of four linked nucleosides. The gap segment is positioned between the 5 ' wing segment and the 3 ' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 14 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of any of nucleobases set forth in SEQ DD NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362, and 1363, wherein the nucleobase sequence is complementary to SEQ ID NO: 1 and wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of two linked nucleosides; and c) a 3' wing segment consisting of two linked nucleosides. The gap segment is positioned between the 5 ' wing segment and the 3 ' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the provided methods, compounds, and compositions inhibit HBV mRNA expression and/or DNA levels and or protein levels and/or antigen levels.

Another embodiment provides a method for treating a HBV-related diseases, disorders, and conditions in a mammal, the method comprising administering a therapeutically effective amount of any pharmaceutical composition as described above to a mammal in need thereof, so as to treat the HBV-related diseases, disorders, and condition. In related embodiments, the mammal is a human and the HBV-related disease, disorder, and condition is a hepatitis B virus infection from a human hepatitis B virus. More particularly, the human hepatitis B virus may be any of the human geographical genotypes: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America).

In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid is complementary within the following nucleotide regions of SEQ ID NO: 1 : 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61-76, 61 -77, 61 -80, 62-77, 63-84, 68-1 14, 101 -123, 98-123, 1 13-138, 1 16-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191 -215, 196-224, 196-215, 196-218, 199-228, 199-218, 199- 224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-274; 245-260, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-266, 251-268, 251-269, 245-269, 245-266, 245-261 , 250-265, 250-266, 250-267, 250-268, 250-269, 251 -270, 252-267, 253- 268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255-271 , 255-274, 255-401 , 255-400,

255-274, 255-273, 255-272, 255-271 , 256-271, 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-

276, 258-273, 259-274, 260-279, 262-281 , 262-321 , 262-315, 262-312, 265-312, 266-288, 266-291 , 266-285,

281 -321 , 281 -303, 290-321 , 290-312, 292-31 1 , 290-312, 293-312, 293-315, 293-321 , 296-321 , 302-321 , 324-

343, 339-361 , 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381 , 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400, 384-401, 385- 401, 405-424, 409-428, 405-428, 411-426, 411-427, 411-430, 411-431, 411-437, 412-431, 411-426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414- 429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419- 434, 421-436, 422-437, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463- 482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457- 473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-754, 639- 658, 639-654, 641-656, 642-657, 643-658, 642-754, 653-672, 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689, 671-690, 671-691, 671-686, 671-687, 672-693, 672-697, 672-707, 672- 687, 672-688, 673-688, 674-693, 678-693, 679-694, 679-707, 679-698, 679-701, 679-702, 679-707, 680-695, 680-699, 679-699, 681-706, 681-696, 682-697, 682-706, 682-707, 682-702, 682-701, 683-698, 684-699, 685- 700, 686-701, 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689- 705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-711, 693-716, 693-712, 695-715, 697-716, 697- 716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 738-753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811- 906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945- 964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121-1140, 1127-1146, 1127-1193, 1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176-1192, 1176-1285, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261-1296, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535 1515-1563 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605 1518-1602, 1518-1537 1521-1563 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599 1553-1590, 1565-1584 1571-1595 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593 1578-1594, 1578-1597 1578-1598 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596 1580-1599, 1580-1605 1580-1602 1581-1596, 1581 -1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601 1582-1602, 1553-1655 1583-1598 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600 1585-1601 , 1585-1604 1586-1601 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603 1588-1604, 1589-1604 1589-1605 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651 -1720 1651 -1673, 1655-1679 1695-1720 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777- 1796 1777- 1800,

1778- 1800 1778-1793 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795 1779-1794, 1780-1799 1780-1796 1780-1795, 1781-1797, 1781-1796, 1781-1796, 1781-1800, 1781-1797 1782-1799, 1782-1797 1782-1798 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778- 1889 1778- 1794,

1779- 1795 1780-1799 1785-1800, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828 1812-1843, 1812-1837. 1812-1831 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821 -1840 1821 -1844, 1821-1837 1822-1843 1822-1839, 1822-1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846 1861 -1884, 1861-1880 1865-1885 1866-1881 , 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884 1870-1885, 1871-1886 1872-1887 1874-1889, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891 -1914 1895-1938, 1895-1935 1913-1935 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934 1921 -1934, 1928-1956 1957-1976 2035-2057, 2083-2141 , 2230-2261, 2368-2393, 2381-2397, 2368-2394_: 2379-2394, 2381-2396 2368-2397 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838 2873-2892, and 3161-3182.

In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid target the following nucleotide regions of SEQ ID NO: 1 : 1 -20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25- 50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61 -76, 61 -77, 61 -80, 62-77, 63-84, 68-114, 101 -123, 98-123, 113-138, 1 16-138, 131 -150, 137-162, 152-186, 158-177, 167-186, 191 -215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205- 224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-274; 245-260, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251 -266, 251-268, 251-269, 245-269, 245- 266, 245-261 , 250-265, 250-266, 250-267, 250-268, 250-269, 251 -270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255-271 , 255-274, 255-401, 255-400, 255-274, 255-273, 255- 272, 255-271 , 256-271 , 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281 , 262-321 , 262-315, 262-312, 265-312, 266-288, 266-291 , 266-285, 281 -321 , 281 -303, 290- 321 , 290-312, 292-31 1 , 290-312, 293-312, 293-315, 293-321 , 296-321 , 302-321 , 324-343, 339-361 , 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381 , 366-388, 369-388, 366- 385, 366-392, 370-389, 370-392, 380-399, 382-401 , 384-433, 384-400, 384-401 , 385-401 , 405-424, 409-428, 405-428, 411-426, 411-427, 411-430, 411-431, 411-437, 412-431, 411-426, 411-427, 412-428, 412-431, 412- 427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416-429, 416-435, 417-432, 417-433, 417- 436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 421-436, 422-437, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458- 485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466- 494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554- 573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-754, 639-658, 639-654, 641-656, 642-657, 643-658, 642-754, 653-672, 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670- 686, 670-689, 671-690, 671-691, 671-686, 671-687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693, 678-693, 679-694, 679-707, 679-698, 679-701, 679-702, 679-707, 680-695, 680-699, 679-699, 681- 706, 681-696, 682-697, 682-706, 682-707, 682-702, 682-701, 683-698, 684-699, 685-700, 686-701, 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691 -710, 690-754, 690-706, 684- 703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-746, 724- 752, 724-754, 724-758, 733-752, 738-754, 738-753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822- 867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951- 1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031- 1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082- 1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121- 1140, 1127-1146, 1127-1193, 1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176- 1192, 1176-1285, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245- 1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261-1296, 1261-1285, 1261- 1276, 1261-1277, 1261-1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263- 1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266- 1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269- 1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-

1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1282-1301, 1286-

1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353- 1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515- 1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521-1563, 1521- 1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571 -1595, 1577- 1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1571- 1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581- 1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601 , 1582-1602, 1553-1655, 1583-1598, 1583- 1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-1604, 1586-1601 , 1586- 1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590- 1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651-1720, 1651 -1673, 1655-1679, 1695-1720, 1716- 1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778- 1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780- 1795, 1781 -1797, 1781-1796, 1781-1796, 1781-1800, 1781-1797, 1782-1799, 1782-1797, 1782-1798, 1783- 1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1889, 1778-1794, 1779-1795, 1780-1799, 1785- 1800, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831, 1815- 1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821 -1840, 1821 -1844, 1821-1837, 1822-1843, 1822- 1839, 1822-1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1866- 1881 , 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884, 1870-1885, 1871-1886, 1872-1887, 1874- 1889, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898- 1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921 -1934, 1928-1956, 1957-1976, 2035- 2057, 2083-2141 , 2230-2261 , 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381 -2396, 2368-2397, 2368- 2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892, and 3161 -3182.

In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid is complementary within the HBV pre-Sl second portion gene region corresponding to nucleotide region 1- 1932 of SEQ ID NO: 1. In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid is complementary within the HBV pre-Sl first portion gene region corresponding to nucleotide region 2831 -3182 of SEQ ID NO: 1.

In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid target the HBV pre-Sl second portion gene region corresponding to nucleotide region 1-1932 of SEQ ID NO: 1. In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid target the HBV pre-S 1 first portion gene region corresponding to nucleotide region 2831 -3182 of SEQ ID NO: 1.

In certain embodiments, antisense compounds or oligonucleotides target a region of a HBV nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a HBV nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1 : 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58- 79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61 -76, 61 -77, 61 -80, 62-77, 63-84, 68-1 14, 101 - 123, 98-123, 1 13-138, 1 16-138, 131 -150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243- 262, 244-263, 245-274; 245-260, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245- 266, 250-269, 251 -266, 251-268, 251 -269, 245-269, 245-266, 245-261 , 250-265, 250-266, 250-267, 250-268, 250-269, 251 -270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255- 271 , 255-274, 255-401 , 255-400, 255-274, 255-273, 255-272, 255-271 , 256-271 , 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281 , 262-321 , 262-315, 262-312, 265- 312, 266-288, 266-291 , 266-285, 281 -321 , 281 -303, 290-321 , 290-312, 292-31 1 , 290-312, 293-312, 293-315, 293-321 , 296-321, 302-321 , 324-343, 339-361 , 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360- 383, 360-388, 360-385, 362-381 , 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401 , 384-433, 384-400, 384-401 , 385-401 , 405-424, 409-428, 405-428, 41 1-426, 411-427, 41 1-430, 41 1 -431 , 411- 437, 412-431 , 41 1-426, 41 1-427, 412-428, 412-431 , 412-427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431 , 415-434, 416- 431, 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 421 -436, 422-437, 422-441 , 423-436, 425-465, 454-473, 454-472, 457- 476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491 , 458-491 , 459-491, 460-491, 463-491 , 466-491 , 472-491 , 472- 493, 473-492, 475-491 , 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524- 546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611 -645, 617-363, 623-642, 617-645, 639-754, 639-658, 639-654, 641 -656, 642-657, 643-658, 642-754, 653-672, 662-685, 665- 685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689, 671 -690, 671-691 , 671 -686, 671 -687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693, 678-693, 679-694, 679-707, 679-698, 679- 701 , 679-702, 679-707, 680-695, 680-699, 679-699, 681-706, 681 -696, 682-697, 682-706, 682-707, 682-702, 682-701 , 683-698, 684-699, 685-700, 686-701 , 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679- 710, 679-706, 690-710, 691 -710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-71 1 , 693-716, 693- 712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 738- 753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 81 1 -833, 81 1 -844, 814-833, 81 1 -906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845- 909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951 -970, 951 -985, 951 -1044, 951 -1024, 951 -1056, 951 -997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031 -1056, 1037-1056, 1046-1083, 1049-1068, 1070- 1089 1070-1095 1082-1 101 1081 -1134 1081 -1143 1082-1 101 , 1088-1 107 1088-1 134 1094-1 1 19 1097- 1 1 19 1 1 12-1134 1118-1143 1118-1 146 1088-1146 1 121-1140, 1 127-1146 1127-1 193 1150-1 193 1156- 1 187 1165-1187 1170-1192 1171 -1 191 1 172-1191 1 176-1 192, 1 176-1285 1 177-1192 1 176-1191 1203- 1297 1206-1228 1206-1255 1209-1228 1215-1255 1245-1265, 1251 -1280 1262-1285 1251-1285 1259- 1296 1259-1290 1259-1287 1261-1296 1261-1285 1261-1276, 1261-1277 1261-1280 1262-1296 1262- 1277 1262-1278 1262-1281 1263-1278 1263-1279 1263-1282, 1264-1279 1264-1280 1264-1283 1264- 1297 1265-1280 1265-1281 1265-1284 1266-1281 1266-1282, 1266-1285 1267-1282 1267-1283 1268- 1283 1268-1284 1268-1296 1269-1284 1269-1285 1269-1288, 1270-1285 1271-1290 1271-1296 1277- 1296 1261-1290 1262-1290 1268-1290 1263-1305 1259-1305, 1259-1305 1266-1305 1259-1302 1275- 1294 1281 -1306 1281-1324 1281-1336 1282-1301 1286-1306, 1290-1324 1293-1318 1290-1324 1293- 1315 1296-1315 1311-1336 1311-1333 1326-1345 1353-1381, 1359-1378 1395-1414 1498-1532 1498- 1523 1498-1535 1510-1529 1515-1535 1515-1563 1515-1596, 1515-1605 1515-1602 1515-1540 1515- 1535 1518-1605 1518-1602 1518-1537 1521-1563 1521-1540, 1550-1655 1550-1563 1550-1569 1553- 1578 1553-1599 1553-1590 1565-1584 1571-1595 1577-1605, 1577-1606 1577-1592 1577-1593 1577- 1596 1578-1593 1578-1594 1578-1597 1578-1598 1571 -1598, 1579-1594 1579-1594 1579-1598 1580- 1595 1580-1596 1580-1599 1580-1605 1580-1602 1581-1596, 1581-1597 1581-1600 1582-1597 1582- 1598 1582-1601 1582-1602 1553-1655 1583-1598 1583-1599, 1583-1602 1584-1599 1584-1600 1584- 1603 1585-1600 1585-1601 1585-1604 1586-1601 1586-1602, 1586-1605 1587-1602 1587-1603 1587- 1606 1588-1603 1588-1604 1589-1604 1589-1605 1590-1605, 1590-1606 1591 -1606 1586-1652 1642- 1664 1651-1720 1651 -1673 1655-1679 1695-1720 1716-1738, 1743-1763 1743-1768 1764-1783 1773- 1792 1777- 1796 1777- 1800 1778- 1800 1778-1793 1778-1794, 1778-1797 1779-1798 1779-1797 1779- 1796 1779-1795 1779-1794 1780-1799 1780-1796 1780-1795, 1781 -1797 1781-1796 1781 -1796 1781- 1800 1781 -1797 1782-1799 1782-1797 1782-1798 1783-1798, 1783-1799 1784-1800 1784-1799 1779- 1799 1778- 1889 1778- 1794 1779- 1795 1780-1799 1785-1800, 1794-1813 1806-1837 1806-1828 1806- 1825 1809-1828 1812-1843 1812-1837 1812-1831 1815-1843, 1815-1844 1815-1840 1815-1834 1818- 1837 1821 -1840 1821-1844 1821-1837 1822-1843 1822-1839, 1822-1837 1823-1843 1823-1838 1824- 1839 1827-1846 1861-1884 1861-1880 1865-1885 1866-1881 , 1867-1882 1867-1886 1868-1883 1869- 1885 1869-1884 1870-1885 1871 -1886 1872-1887 1874-1889, 1876-1895 1888-1914 1888-1908 1891- 1910 1891-1914 1895-1938 1895-1935 1913-1935 1898-1920, 1907-1929 1913-1935 1918-1934 1919- 1938 1919-1934 1921-1934 1928-1956 1957-1976 2035-2057, 2083-2141 2230-2261 2368-2393 2381- 2397 2368-2394 2379-2394 2381 -2396 , 2368-2397_; 2368-2396, 2420-2439 2458-2476 2459-2478 2819- 2838 2818-2838 2873-2892 and 3161-3 182..

In certain embodiments, antisense compounds or oligonucleotides target a region of a HBV nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a HBV nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1 : 58-73, 58-74, 58-77, 59-74, 60-75, 61 -76, 62-77, 245-274; 245-260, 250-265, 251-266, 252-267, 253-268, 254-269, 255-270, 256-271 , 256-272, 258-273, 259-274, 380-399, 382-401 , 41 1-437, 41 1-427, 41 1 -426, 412- 427, 413-428, 413-432, 414-429, 415-430, 416-431, 417-432, 418-433, 419-434, 420-435, 421-436, 422-437, 457-472, 458-473, 639-754, 639-658, 639-654, 641 -656, 642-657, 643-658, 670-754, 670-706, 670-685, 671 - 686, 672-687, 673-688, 678-693, 679-694, 680-695, 681-706, 681 -696, 682-697, 683-698, 684-699, 685-700,

686- 701 , 687-702, 688-703, 689-704, 690-705, 691 -706, 738-754, 738-753, 739-754, 1 176-1285, 1 176-1 191 , 1 177-1 192, 1261 -1285, 1261 -1276, 1262-1277, 1263-1278, 1264-1279, 1265-1280, 1266-1281 , 1267-1282,

1268-1283, 1269-1284, 1270-1285, 1577-1606, 1577-1592, 1578-1593, 1579-1594, 1580-1595, 1581-1596, 1582-1597, 1583-1598, 1584-1599, 1585-1600, 1586-1601 , 1587-1602, 1588-1603, 1589-1604, 1590-1605, 1591-1606, 1778-1889, 1778-1800, 1778-1793, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1796,

1782- 1797, 1783-1798, 1784-1799, 1785-1800, 1822-1839, 1822-1837, 1823-1838, 1824-1839, 1866-1881 , 1867-1882, 1868-1883, 1869-1884, 1870-1885, 1871-1886, 1872-1887, or 1874-1889, and wherein at least one nucleoside of the compound or modified oligonucleotide comprises at least one 2'-0-methoxyethyl or constrained ethyl (cEt) sugar.

In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid is complementary within the following nucleotide regions of SEQ ID NO: 1 : 58-73, 58-74, 58-77, 59-74, 59-75, 60-75, 60-76, 61 -76, 61 -77, 62-77, 253-272, 253-269, 254-270, 255-271 , 256-272, 411-437, 41 1 -426, 41 1 - 427, 41 1 -430, 412-427, 412-428, 412-431 , 413-428, 413-429, 413-432, 414-429, 414-430, 414-433, 415-430, 415-431 , 415-434, 416-431 , 416-432, 416-435, 417-432, 417-433, 417-436, 418-433, 418-434, 418-437, 457- 472, 457-473, 458-473, 670-706, 670-685, 670-686, 671-686, 671 -687, 672-687, 672-688, 673-688, 687-702,

687- 703, 687-706, 688-703, 688-704, 689-704, 689-705, 690-705, 690-706, 691 -706, 1261 -1285, 1261-1276, 1261-1277, 1261 -1280, 1262-1277, 1262-1278, 1262-1281 , 1263-1278, 1263-1279, 1263-1282, 1264-1279,

1264-1280, 1264-1283, 1265-1280, 1265-1281 , 1265-1284, 1266-1281 , 1266-1282, 1266-1285, 1267-1282,

1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1270-1285, 1577-1606, 1577-1592, 1577-1593,

1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596,

1580-1599, 1581 -1596, 1581 -1597, 1581 -1600, 1582-1597, 1582-1598, 1582-1601 , 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-1604, 1586-1601 , 1586-1602,

1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605,

1590-1606, 1591-1606, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1794, 1779-1795, 1779-1798,

1780-1795, 1780-1796, 1780-1799, 1781 -1796, 1781 -1797, 1781 -1800, 1782-1797, 1782-1798, 1783-1798,

1783- 1799, 1784-1799, and 1784-1 800. In certain embodiments, an antisense compound or oligonucleotide targeted to a HBV nucleic acid target the following nucleotide regions of SEQ ID NO: 1 : 58-73, 58-74, 58-77, 59-74, 59-75, 60-75, 60-76, 61-76, 61 -77, 62-77, 253-272, 253-269, 254-270, 255-271 , 256-272, 411-437, 41 1 -426, 411 -427, 411-430, 412-427, 412-428, 412-431 , 413-428, 413-429, 413-432, 414-429, 414-430, 414-433, 415-430, 415-431, 415- 434, 416-431 , 416-432, 416-435, 417-432, 417-433, 417-436, 418-433, 418-434, 418-437, 457-472, 457-473, 458-473, 670-706, 670-685, 670-686, 671 -686, 671 -687, 672-687, 672-688, 673-688, 687-702, 687-703, 687- 706, 688-703, 688-704, 689-704, 689-705, 690-705, 690-706, 691-706, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281 , 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265-1281 , 1265-1284, 1266-1281 , 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1270-1285, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601 , 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-1604, 1586-1601 , 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591 -1606, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1794, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781-1797, 1781-1800, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1799, and 1784-1800.

In certain embodiments, antisense compounds or oligonucleotides target a region of a HBV nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a HBV nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1 : 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58- 79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61 -76, 61 -77, 61 -80, 62-77, 63-84, 68-114, 101 - 123, 98-123, 113-138, 116-138, 131 -150, 137-162, 152-186, 158-177, 167-186, 191 -215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243- 262, 244-263, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251 -268, 251-269, 245-269, 245-266, 245-261 , 250-266, 250-267, 250-268, 250-269, 251-270, 253-269, 253-272, 253- 274, 254-270, 254-274, 255-271 , 255-274, 255-401 , 255-400, 255-274, 255-273, 255-272, 255-271, 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 260-279, 262-281 , 262-321 , 262-315, 262-312, 265- 312, 266-288, 266-291, 266-285, 281 -321 , 281 -303, 290-321 , 290-312, 292-31 1 , 290-312, 293-312, 293-315, 293-321 , 296-321 , 302-321 , 324-343, 339-361 , 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360- 383, 360-388, 360-385, 362-381 , 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 384-433, 384-400, 384-401 , 385-401 , 405-424, 409-428, 405-428, 41 1 -426, 41 1 -427, 41 1 -430, 41 1 -431 , 41 1 -437, 412-431 , 41 1 - 426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-^■428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416- 429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418·■434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455- 472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-^■485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460- 494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-■472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550- 570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-■363, 623-642, 617-645, 642-754, 653-672, 662-685, 665-685, 665-689, 668-687, 670-706, 670-685, 670-686, 670-689, 671-690, 671-691, 671-686, 671- 687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-■693, 679-707, 679-698, 679-701, 679-702, 679-707, 680-699, 679-699, 682-706, 682-707, 682-702, 682-701, 687-754, 688-704, 689-709, 689-710, 690- 705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-■706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692- 711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-■746, 724-752, 724-754, 724-758, 733-752, 738-754, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793- 812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-^■867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905- 933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951 -1044, 951-1024, 951-1056, 951-997, 960- 985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031- 1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082 1101, 1088-1107, 1088-1134 1094-1119,

1097-1119 1112-1134, 1118-1143, 1118-1146 1088-1146, 1121 1140, 1127-1146, 1127-1193 1150-1193, 1156-1187 1165-1187, 1170-1192, 1171-1191 1172-1191, 11761192, 1177-1192, 1176-1191 1203-1297, 1206-1228_: 1206-1255, 1209-1228, 1215-1255 1245-1265, 1251 1280, 1262-1285, 1251-1285 1259-1296, 1259-1290 1259-1287, 1261-1296, 1261-1285 1261-1276, 1261 1277, 1261-1280, 1262-1296 1262-1277, 1262-1278 1262-1281, 1263-1278, 1263-1279 1263-1282, 1264- 1279, 1264-1280, 1264-1283 1264-1297, 1265-1280 1265-1281, 1265-1284, 1266-1281 1266-1282, 12661285, 1267-1282, 1267-1283 1268-1283, 1268-1284 1268-1296, 1269-1284, 1269-1285 1269-1288, 1270· 1285, 1271-1290, 1271-1296 1277-1296, 1261-1290 1262-1290, 1268-1290, 1263-1305 1259-1305, 1259- 1305, 1266-1305, 1259-1302 1275-1294, 1281-1306 1281-1324, 1281-1336, 1282-1301 1286-1306, 1290- 1324, 1293-1318, 1290-1324 1293-1315, 1296-1315 1311-1336, 1311-1333, 1326-1345 1353-1381, 13591378, 1395-1414, 1498-1532 1498-1523, 1498-1535 1510-1529, 1515-1535, 1515-1563 1515-1596, 1515- 1605, 1515-1602, 1515-1540 1515-1535, 1518-1605 1518-1602, 1518-1537, 1521-1563 1521-1540, 1550- 1655, 1550-1563, 1550-1569 1553-1578, 1553-1599 1553-1590, 1565-1584, 1571-1595 1577-1605, 1577- 1606, 1577-1592, 1577-1593 1577-1596, 1578-1593 1578-1594, 1578-1597, 1578-1598 1571-1598, 1579- 1594, 1579-1594, 1579-1598 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581 -1596, 1581 -1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601 , 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651 -1720, 1651 -1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792,

1777- 1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1797, 1781-1796, 1781-1796, 1781 -1800, 1781-1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799,

1778- 1794, 1779-1795, 1780-1799, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831 , 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821-1844,

1821-1837, 1822-1843, 1822-1839, 1823-1843, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1867-1886, 1869-1885, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891 -1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921-1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261 , 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381 -2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892, and 3161-3182.

In certain embodiments, antisense compounds or oligonucleotides target a region of a HBV nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a HBV nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ DD NO: 1 : 233-264, 242-263, 243-262, 244-263, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-268, 251-269, 245-269, 245-266, 245-261, 250-266, 250-267, 250-268, 250-269, 251- 270, 253-272, 253-274, 254-274, 255-274, 255-401 , 255-400, 255-274, 255-273, 255-272, 255-271 , 256-275, 255-276, 256-276, 253-275, 256-279, 257-276, 260-279, 262-281, 262-321 , 262-315, 262-312, 265-312, 266- 288, 266-291 , 266-285, 281 -321 , 281-303, 405-424, 409-428, 405-428, 411 -430, 411-431 , 41 1 -431, 412- 431 , 41 1-426, 411 -427, 412-428, 412-431 , 412-427, 413-433, 413-432, 413-428, 413-433, 41 1-427, 414-427, 415-427, 415-428, 415-429, 416-432, 416-429, 418-435, 418-434, 419-435, 419-434, 420-435, 419-432, 419- 434, 422-441 , 423-436, 425-465, 584-606, 61 1-645, 617-363, 623-642, 617-645, 642-754, 653-672, and wherein at least one nucleoside of the compound or modified oligonucleotide comprises at least one 2'-0- methoxyethyl sugar.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 50% inhibition: 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-77, 58-74, 58-73, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-79, 60-75, 60-76, 61-80, 61-76, 61-77, 62-77, 63-84, 68-114, 101-123, 98-123, 113-138, 116-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199- 224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-268, 251-269, 245-269, 245-266, 245- 261, 250-265, 250-266, 250-267, 250-268, 250-269, 251-266, 251-270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 255- 270, 256-271, 256-272, 256-275, 255-276, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 290-321, 290-312, 292-311, 290-312, 293-312, 293-315, 293-321, 296-321, 302-321, 324-343, 339-361, 339-367, 348- 367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381, 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400, 384-401, 385-401, 405-424, 409-428, 405- 428,411-430,411-431,411-431,412-431,411-426,411-427,411-430,411-437,412-428,412-431,412-427, 413-432, 413-428, 413-429, 413-433, 411-427, 414-427, 414-429, 414-430, 414-433, 415-427, 415-428, 415- 429, 415-430, 415-431, 415-434, 416-435, 416-432, 416-431, 416-429, 417-432, 417-433, 417-436, 418-437, 418-435, 418-434, 418-433, 419-435, 419-434, 420-435, 419-432, 419-434, 421-436, 422-441, 422-437, 423- 436, 425-465, 454-473, 454-472, 457-476, 454-476, 455-472, 457-485, 457-473, 457-472, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460- 491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485- 519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-654, 641-656, 642-657, 642-754, 643-658, 653- 672, 662-685, 665-685,665-689, 668-687, 670-689, 670-706, 670-685, 670-686, 671-686, 671-687, 671-690, 671-691, 672-687, 672-688, 672-693, 672-697, 672-707, 673-688, 674-693, 678-693, 679-707, 679-694, 679- 698, 679-701, 679-702, 679-707, 680-699, 679-699, 680-695, 681-696, 682-706, 682-707, 682-702, 682-701, 682-697, 683-698, 684-699, 685-700, 686-701, 687-702, 687-703, 687-706, 687-754, 688-703, 688-704, 689- 704, 689-705, 689-709, 689-710, 690-705, 690-706, 691-706, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-703, 687-706, 688-705, 689-708, 690-709, 692-711, 693-716, 693- 712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-753, 738-754, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811- 833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845- 909, 845-906, 854-876, 854-873, 863-882, 863-885, 878-900, 878-897, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 966-985, 972-1015, 978-997, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121-1140, 1 127-1 146, 1127-1 193, 1 150-1 193, 1156-1187, 1165-1 187, 1170-1192, 1 171 -1 191 , 1 172-1 191 , 1 176-1192, 1177-1 192, 1 176-1 191 , 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1215-1234, 1218-1237, 1221 -1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1265, 1251 -1280, 1251 -1285, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1296, 1259-1290, 1259-1287, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1261-1296, 1262-1277, 1262-1278, 1262-1281, 1262-1285, 1262-1296, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281 , 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271 -1290, 1271 -1296, 1277-1296, 1261 -1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281 -1324, 1281-1336, 1782-1797, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311 -1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521-1563, 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571-1595, 1577-1606, 1577-1605, 1577-1596, 1577-1592, 1577-1593, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1579-1594, 1579-1595, 1579-1598, 1571 -1598, 1580-1605, 1580-1602, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601 , 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-1604, 1586-1601 , 1586-1602, 1586-1605, 1586-1652, 1587-1602, 1587.1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651 -1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1796, 1781-1797, 1781-1796, 1781 -1800, 1781 -1797, 1782-1799, 1784-1800, 1779-1799, 1778-1794, 1779-1795, 1780-1799, 1794-1813, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781 -1797, 1781 -1800, 1782-1798, 1783-1799, 1784-1799, 1784-1800, 1785-1800, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831 , 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821 -1844, 1821-1837, 1822-1843, 1822-1839, 1823-1843, 1827-1846, 1861 -1884, 1861 -1880, 1865-1885, 1867-1886, 1869-1885, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921 -1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141 , 2230-2261 , 2278-2297, 2281 -2300, 2284-2303, 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892, and 3161 -3182.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1 , when targeted by antisense compounds or oligonucleotides, display at least 60% inhibition: 1 -20, 10-29, 10-53, 13-38, 25-50, 43-68, 55-74, 58-84, 58-77, 58-74, 58-73, 58-79, 59-80, 59-74, 59-75, 60-75, 60-76, 61 -77, 61 -76, 61 -80, 62- 77, 68-1 14, 98-123, 101 -123, 1 13-138, 1 16-138, 131-150, 137-162, 152-186, 191 -215, 196-224, 196-215, 199-228, 199-218, 200-223, 199-218, 205-224, 206-228, 218-237, 224-243, 233-263, 244-263, 245-264, 247- 266, 250-265, 251-266, 252-267, 253-272, 253-269, 251-267, 253-274, 254-270, 255-276, 256-279, 256-276, 256-274, 256-272, 256-271, 258-273, 259-274, 265-388, 265-284, 266-291, 266-288, 260-279, 281-321, 281- 303, 290-321, 290-312, 293-312, 296-315, 302-321, 324-343, 339-367, 339-361, 342-367, 348-367, 358-392, 358-378, 360-392, 360-379, 366-392, 366-385, 369-388, 370-392, 382-401, 405-428, 405-424, 409-428, 411- 436,411-433,411-431,411-426,411-430,411-427,412-431,412-428,412-427,413-428,413-429,413-433, 414-433, 414-430, 414-429, 414-433, 415-430, 415-431, 415-434, 415-435, 415-436, 416-429, 416-434, 416- 431, 416-432, 416-436, 416-435, 417-436, 417-433, 417-432, 418-434, 418-433, 418-437, 419-434, 420-435, 421-436, 422-437, 423-436, 425-465, 454-472, 455-472, 457-476, 457-472, 457-473, 458-485, 458-473, 458- 483, 463-498, 467-498, 463-482, 470-493, 472-491, 485-519, 485-513, 500-519, 512-534, 524-546, 536-558, 548-567, 554-573, 548-576, 560-594, 584-606, 608-648, 639-654, 640-656, 641-656, 642-657, 642-658, 643- 658, 653-672, 662-685, 665-685, 670-706, 670-689, 670-685, 670-686, 671-690, 671-686, 671-687, 672-707, 672-697, 672-693, 672-687, 672-688, 673-688, 679-707, 679-698, 679-694, 680-695, 681-696, 682-697, 682- 701, 683-698, 684-699, 685-700, 686-701, 687-754, 687-702, 687-705, 687-703, 687-706, 688-704, 688-703, 688-704, 688-705, 688-707, 689-710, 689-709, 689-705, 689-704, 690-754, 690-705, 690-706, 691-706, 691- 710, 692-711, 697-716, 724-758, 724-754, 724-752, 724-746, 738-754, 738-753, 739-754, 742-785, 757-785, 790-815, 811-906, 811-844, 811-833, 822-867, 822-844, 823-842, 845-867, 854-906, 854-873, 878-897, 899- 958, 899-933, 936-958, 945-964, 951-1044, 951-1024, 951-985, 951-997, 963-1044, 963-1024, 963-997, 966-985, 978-997, 1031-1056, 1046-1083, 1070-1095, 1081-1143, 1081-1134, 1082-1101, 1088-1146, 1088- 1134, 1118-1146, 1118-1143, 1127-1193, 1170-1189, 1176-1192, 1176-1191, 1177-1192, 1203-1297, 1206-

1255 1209-1228 1215-1234 1218-1237. 1221-1240 1224-1243 1227- -1246, 1230 -1249, 1233- -1252, 1236- 1255 1251-1270 1251-1285 1254-1273 1254-1279 1257-1276 1258- -1277, 1259- -1278, 1260- -1279, 1261- 1276 1261-1285 1261-1276 1261-1277 1261-1280 1262-1281 1262- -1277, 1262- -1278, 1262- 1281, 1263- 1278 1263-1279 1263-1282 1264-1297 1264-1279 1264-1280 1264- 1283, 1265- 1280, 1265- 1281, 1265- 1284 1266-1281 1266-1282 1266-1285 1267-1282 1267-1283 1268- -1283, 1268- -1284, 1268- -1287, 1269- 1284 1269-1285 1270-1285 1281-1336 1281-1324 1281-1306 1286- -1305, 1290- -1324, 1311- -1336, 1326- 1345 1353-1381 1395-1414 1498-1535 1498-1532 1515-1535 1515- 1534, 1521- 1540, 1550- 1655, 1553- 1599 1553-1590 1577-1606 1577-1592 1577-1593 1577-1596 1578- 1593, 1578- 1594, 1578- 1597, 1579- 1594 1579-1595 1579-1598 1580-1595 1580-1596 1580-1599 1581- 1596, 1581- -1597, 1581- 1600, 1582- 1597 1582-1598 1582-1601 1583-1598 1583-1599 1583-1602 1584- 1599, 1584- 1600, 1584- 1603, 1585- 1600 1585-1601 1585-1604 1586-1601 1586-1602 1586-1605 1587- 1602, 1587- 1603, 1587- 1606, 1588- 1603 1588-1604 1589-1604 1589-1605 1590-1605 1590-1606 1591- 1606, 1642- 1664, 1651- 1720, 1716- 1738 1743-1763 1764-1783 1773-1792 1777- 1800 1777- 1797 1655- 1674, 1778- 1794, 1778- 1800, 1781- 1800 1781-1797 1784-1800 1779-1799 1778- 1794 1778- 1797 1779- 1795, 1779- 1798, 1780- 1795, 1780- 1796 1780-1799 1781-1796 1781-1797 1781-1800 1782-1797 1794- 1813, 1806- 1837, 1806- 1825, 1812- 1837, 1812-1831 , 1815-1844, 1815-1834, 1818-1837, 1821-1837, 1822-1838, 1827-1846, 1861-1884, 1821- 1840, 1866-1885, 1867-1886, 1888-1914, 1888-1907, 1891-1914, 1895-1938, 1895-1935, 1919-1938, 1928- 1956, 1957-1976, 2035-2057, 2083-2141 , 2230-2261 , 2278-2297, 2281 -2300, 2284-2303, 2368-2397, 2368- 2396, 2368-2394, 2368-2393, 2379-2394, 2381 -2396, 2420-2439, 2458-2476, 2819-2838, 2873-2892, and 3161-3182.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1 , when targeted by antisense compounds or oligonucleotides, display at least 65% inhibition: 1-20, 10-29, 10-53, 13-38, 25-50, 43-68, 55-74, 58-84, 58-79, 58-74, 58-73, 58-77, 59-75, 59-80, 58-77, 60-75, 60-76, 61-77, 61-76, 61 -80, 62- 77, 68-1 14, 98-123, 101-123, 113-138, 116-138, 131 -150, 137-162, 152-186, 191-215, 196-215, 199-228, 199-218, 200-223,199-218, 205-224, 206-228, 218-237, 224-243, 233-263, 244-263, 245-264, 250-265, 251- 266, 253-269, 253-274, 255-276, 256-279, 256-276, 256-274, 256-272, 256-271, 247-266, 253-272, 258-273, 266-291 , 266-288, 260-279, 281-321, 281 -303, 290-321 , 290-312, 296-315, 293-312, 302-321 , 324-343, 339- 367, 339-361 , 342-367, 348-367, 358-392, 358-378, 360-392, 360-379, 366-392, 366-385, 369-388, 370-392, 382-401 , 405-428, 405-424, 409-428, 411-433, 41 1-431 , 41 1-430, 41 1 -427, 411 -426, 412-431 , 412-428, 412- 427, 413-433, 413-428, 413-429, 413-432, 414-433, 414-430, 414-429, 415-430, 415-431 , 415-434, 415-435, 415-436, 416-434, 416-436, 416-435, 416-432, 416-431 , 417-436, 417-433, 417-432, 418-433, 418-434, 418- 437, 420-435, 422-437, 423-436, 425-465, 454-472, 455-472, 457-472, 458-485, 458-483, 458-473, 463-498, 467-498, 457-476, 470-493, 472-491, 485-519, 485-513, 500-519, 512-534, 524-546, 536-558, 548-567, 554- 573, 548-576, 560-594, 584-606, 608-648, 639-654, 640-656, 641 -656, 642-657, 642-658, 643-658, 653-672, 662-685, 665-685, 670-685, 670-706, 670-689, 670-686, 670-685, 671 -686, 671 -687, 671-690, 672-688, 672- 687, 672-707, 672-697, 672-693, 673-688, 679-698, 680-695, 681 -696, 682-697, 682-701, 683-698, 684-699, 685-700, 686-701, 687-702, 688-703, 688-707, 687-754, 690-754, 690-706, 690-705, 687-705, 687-703, 687- 706, 687-702, 688-705, 688-703, 688-704, 689-705, 691-706, 692-71 1, 697-716, 724-758, 724-754, 724-752, 724-746, 738-754, 739-754, 742-785, 757-785, 790-815, 81 1-906, 81 1 -844, 81 1-833, 822-867, 822-844, 823- 842, 845-867, 854-906, 854-873, 878-897, 899-958, 899-933, 936-958, 945-964, 951-1044, 951 -1024, 951 - 985, 951-997, 963-1044, 963-1024, 963-997, 966-985, 978-997, 1031-1056, 1046-1083, 1070-1095, 1081- 1 143, 1081-1134, 1082-1101, 1088-1146, 1088-1 134, 11 18-1 146, 1 1 18-1 143, 1 127-1 193, 1 170-1189, 1 176- 1 192, 1177-1 192, 1203-1297, 1206-1255, 1209-1228, 1215-1234, 1218-1237, 1221 -1240, 1224-1243, 1227- 1246, 1230-1249, 1233-1252, 1236-1255, 1251-1270, 1251 -1285, 1254-1273, 1254-1279, 1257-1276, 1258- 1277, 1259-1278, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1281, 1262-1277, 1262- 1278, 1263-1278, 1263-1279, 1263-1282, 1264-1297, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265- 1281 , 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268- 1287, 1269-1284, 1269-1285, 1270-1285, 1281-1336, 1281 -1324, 1281 -1306, 1290-1324, 1311 -1336, 1326- 1345, 1353-1381 , 1395-1414, 1498-1535, 1498-1532, 1515-1535, 1515-1534, 1550-1655, 1553-1599, 1553- 1590, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579- 1595, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582- 1598, 1582-1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585- 1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588- 1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651-1720, 1655-1674, 1716- 1738, 1743-1763, 1764-1783, 1773-1792, 1777-1800, 1777-1797, 1778-1800, 1778-1797, 1779-1799, 1778- 1794, 1779-1794, 1779-1795, 1779-1798, 1780-1796, 1780-1799, 1780-1795, 1781-1796, 1781-1797, 1781- 1800, 1782-1797, 1794-1813, 1806-1837, 1806-1825, 1812-1837, 1812-1831, 1815-1844, 1815-1834, 1818- 1837, 1821-1837, 1822-1838, 1827-1846, 1861-1884, 1866-1885, 1867-1886, 1888-1914, 1888-1907, 1891- 1914, 1895-1938, 1895-1935, 1919-1938, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2278- 2297, 2281-2300, 2284-2303, 2368-2397, 2368-2396, 2368-2394, 2368-2393, 2379-2394, 2381-2396, 2420- 2439, 2458-2476, 2819-2838, 2873-2892, and 3161-3182.

In certain embodiments, the following nucleotide regions of SEQ ED NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 70% inhibition: 1-20, 10-29, 10-53, 13-38, 25-50, 43-68, 55-74, 58-84, 58-79, 58-74, 59-75, 59-80, 58-77, 60-75, 60-76, 61-77, 68-114, 98-123, 101-123, 113- 138, 116-138, 131-150, 137-162, 152-186, 191-215, 199-228, 199-218,200-223,205-224,206-228,218-237, 224-243, 233-263, 244-263, 245-264, 253-269, 253-274, 255-276, 256-279, 256-276, 256-274, 256-272, 247- 266, 250-265, 251-266, 253-272, 256-271, 266-291, 266-288, 260-279, 281-321, 281-303, 290-321, 290-312, 293-312, 302-321, 324-343, 339-367, 339-361, 342-367, 348-367, 358-392, 358-378, 360-392, 360-379, 366- 392, 366-385, 370-392, 382-401, 405-428, 405-424, 409-428, 411-433, 411-431, 411-430, 411-427, 411-426, 412-431, 412-428, 412-427, 413-428, 413-429, 413-432, 414-433, 414-430, 414-429, 415-430, 414-433, 415- 434, 415-435, 415-436, 416-431, 416-434, 416-436, 416-435, 416-432, 417-436, 417-433, 418-433, 418-437, 423-436, 425-465, 454-472, 455-472, 457-472, 457-476, 458-473, 458-485, 458-483, 463-498, 467-498, 457- 476, 470-493, 470-493, 472-491, 485-519, 485-513, 485-519, 485-513, 500-519, 512-534, 524-546, 536-558, 548-567, 554-573, 548-576, 560-594, 584-606, 608-648, 639-654, 640-656, 641-656, 642-657, 642-658, 643- 658, 653-672, 662-685, 665-685, 670-706, 670-689, 670-685, 670-686, 671-690, 671-686, 671-687, 672-687, 672-688, 672-707, 672-697, 672-693, 673-688, 679-698, 681-696, 682-697, 682-701, 683-698, 684-699, 686- 701, 687-702, 687-754, 687-702, 688-703, 690-754, 690-706, 687-705, 687-703, 687-706, 692-711, 697-716, 724-758, 724-754, 724-752, 724-746, 738-754, 739-754, 738-754, 742-785, 757-785, 790-815, 811-906, 811- 844, 811-833, 822-867, 822-844, 845-867, 854-906, 854-873, 878-897, 899-958, 899-933, 936-958, 945-964, 951-1044, 951-1024, 951-985, 951-997, 963-1044, 963-1024, 963-997, 966-985, 978-997, 1031-1056, 1046- 1083, 1070-1095, 1081-1143, 1081-1134, 1082-1101, 1088-1146, 1088-1134, 1118-1146, 1118-1143, 1127- 1193, 1170-1189, 1176-1192, 1177-1192, 1203-1297, 1206-1255, 1209-1228, 1215-1234, 1218-1237, 1221- 1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1251-1285, 1251-1270, 1254-1273, 1254- 1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262- 1281, 1262-1277, 1262-1278, 1263-1278, 1263-1279, 1263-1282, 1264-1297, 1264-1279, 1264-1280, 1264- 1283, 1265-1281 , 1265-1284, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268- 1287, 1269-1284, 1269-1285, 1270-1285, 1281 -1336, 1281 -1324, 1281 -1306, 1290-1324, 131 1-1336, 1326- 1345, 1353-1381, 1395-1414, 1498-1535, 1498-1532, 1515-1535, 1550-1655, 1553-1599, 1553-1590, 1577- 1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1595, 1579- 1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581 -1597, 1581 -1600, 1582-1597, 1582-1598, 1582- 1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-

1604, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-

1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651-1720, 1716-1738, 1743-1763, 1764-1783, 1773- 1792, 1777-1800, 1777-1797, 1778-1800, 1778-1797, 1779-1799, 1778-1794, 1779-1795, 1779-1798, 1780- 1795, 1780-1796, 1780-1799, 1781 -1800, 1782-1797, 1794-1813, 1806-1837, 1806-1825, 1812-1837, 1812- 1831 , 1815-1844, 1815-1834, 1818-1837, 1821-1837, 1822-1838, 1827-1846, 1861-1884, 1866-1885, 1867- 1886, 1888-1914, 1888-1907, 1891-1914, 1895-1938, 1895-1935, 1919-1938, 1928-1956, 1957-1976, 2035- 2057, 2083-2141, 2230-2261 , 2278-2297, 2281-2300, 2284-2303, 2368-2397, 2368-2396, 2368-2394, 2368- 2393, 2379-2394, 2381-2396, 2420-2439, 2458-2476, 2819-2838, 2873-2892, and 3161 -3182.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1 , when targeted by antisense compounds or oligonucleotides, display at least 75% inhibition: 13-32, 16-35, 19-38, 25-44, 28-47, 31-50, 43-62, 46-65, 49-68, 55-74, 58-82, 58-74, 58-77, 59-75, 60-75, 60-76, 61-77, 65-84, 98-1 17, 101 -120, 104-123, 116-135, 119-138, 131 -150, 137-156, 140-159, 143-162, 158-177, 161 -180, 164-183, 167-186, 200- 219, 203-226, 209-228, 218-237, 233-252, 236-255, 239-258, 242-264, 247-266, 251-266, 253-272, 255-276, 266-285, 269-288, 281-300, 284-303, 290-313, 298-317, 302-321 , 324-343, 339-358, 342-361 , 348-367, 358- 381, 364-383, 366-386, 370-389, 373-392, 382-401 , 405-424, 409-428, 411-430, 411-426, 411-427, 412-427, 412-431 , 413-428, 413-429, 413-432, 414-436, 414-430, 414-429, 415-430, 416-431, 416-432, 417-433, 418- 437, 422-441 , 425-444, 428-447, 434-453, 440-459, 443-462, 446-465, 456-477, 458-473, 464-483, 470-493, 476-495, 479-498, 488-507, 491-510, 494-513, 500-519, 512-531 , 515-534, 524-543, 527-546, 536-555, 539- 558, 560-579, 566-585, 569-588, 572-591 , 575-594, 584-603, 587-606, 608-627, 614-633, 617-636, 620-639, 623-642, 626-645, 629-648, 639-654, 641-656, 642-657, 643-658, 653-672, 665-684, 668-688, 670-706, 670- 686, 670-685, 671-691 , 671-687, 671 -686, 672-688, 673-688, 679-703, 681-696, 682-697, 686-701 , 686-706, 687-702, 687-703, 688-703, 689-708, 693-712, 695-714, 696-715, 697-716, 727-746, 739-754, 742-761 , 748- 767, 751 -770, 754-773, 757-776, 760-779, 763-782, 766-785, 790-809, 793-812, 796-815, 811 -830, 814-833, 817-836, 820-839, 822-844, 845-864, 854-873, 857-876, 863-882, 866-885, 872-891 , 875-894, 878-897, 881 - 900, 884-903, 887-906, 899-918, 902-921 , 905-924, 908-927, 911 -930, 914-933, 936-955, 939-958, 951 -970, 954-973, 957-976, 960-979, 963-982, 966-985, 969-988, 972-991 , 975-994, 978-997, 996-1015, 1002-1021 , 1025-1044, 1031 -1050, 1034-1053, 1037-1056, 1046-1065, 1049-1068, 1052-1071 , 1055-1074, 1058-1077, 1061-1080, 1064-1083, 1070-1089, 1073-1092, 1076-1095, 1082-1 101 , 1088-1 107, 1094-1 1 13, 1097-1 1 16, 1 100-1 1 19, 1 103-1 122, 1 106-1 125, 1 109-1 128, 1 1 12-1 131 , 1 1 15-1 134, 1 121-1 140, 1 127-1 146, 1 153-1 172, 1156-1175 1159-1178, 1162-1181, 1165-1184 1168-1191, 1174-1193, 1206-1225, 1209-1228, 1212-1231, 1215-1234 1218-1237, 1221-1240, 1224-1243 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1239-1258, 1242-1261 1245-1264, 1251-1270, 1254-1273 1254-1279, 1257-1283, 1257-1276, 1258-1277, 1260-1279, 1261-1285 1261-1276, 1261-1277, 1261-1280 1262-1277, 1262-1278, 1263-1278, 1263-1279, 1263-1282, 1264-1279 1264-1280, 1264-1283, 1265-1281 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283 1268-1283, 1268-1284, 1268-1287 1269-1284, 1269-1285, 1270-1285, 1272-1291, 1275-1294, 1282-1303 1286-1306, 1290-1309, 1293-1312 1296-1315, 1299-1318, 1305-1324, 1311-1330, 1314-1333, 1317-1336 1353-1381, 1356-1375, 1359-1378 1498-1517, 1501-1520, 1504-1523, 1510-1529, 1553-1572, 1556-1575 1559-1578, 1562-1581, 1565-1584 1571-1590, 1574-1599, 1577-1606, 1577-1592, 1577-1593, 1577-1596 1578-1593, 1578-1594, 1578-1597 1579-1594, 1579-1595, 1579-1598, 1580-1595, 1580-1596, 1581-1596 1581-1597, 1581-1600, 1582-1597 1582-1598, 1582-1601, 1582-1602, 1583-1598, 1583-1599, 1583-1602 1584-1599, 1584-1600, 1584-1603 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1605, 1586-1602 1587-1602, 1587-1603, 1587-1606 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606 1591-1606, 1604-1623, 1607-1626, 1630-1649, 1633-1652, 1645-1664, 1651-1670, 1654-1674, 1657-1676 1660-1679, 1663-1682, 1666-1685, 1689-1708, 1695-1714, 1698-1717, 1701-1720, 1716-1735, 1778-1797 1778-1794, 1778-1797, 1779-1795 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1800, 1794-1813 1895-1914, 1898-1917, 1901-1920 1907-1926, 1910-1929, 1913-1932, 1916-1935, 1919-1938, 2278-2297 2281-2300, ind 2284-2:

In certain embodiments, the following nucleotide regions of SEQ ED NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 80% inhibition: 13-32, 16-35, 19-38, 25-44, 28-47, 46-65, 49-68, 58-77, 59-80, 63-82, 98-120, 116-135, 137-159, 158-177, 167-186, 203-224, 205-224, 209- 228, 218-237, 233-252, 236-263, 245-264, 253-272, 256-275, 257-276, 266-288, 281-300, 290-312, 293-312, 324-343, 339-358, 348-367, 358-378, 360-379, 361-383, 366-385, 373-392, 382-401, 405-424, 411-431, 411- 426, 411-427, 411-430, 413-428, 414-433, 414-434, 415-430, 415-434, 416-431, 416-435, 417-436, 418-437, 422-441, 425-444, 434-453, 456-476, 458-473, 458-477, 464-483, 471-493, 488-507, 494-513, 512-531, 524- 543, 527-546, 536-558, 560-579, 566-585, 572-591, 575-594, 584-603, 587-606, 608-627, 614-633, 617-636, 620-639, 623-642, 626-645, 629-648, 639-654, 641-656, 642-657, 643-658, 665-688, 670-687, 670-686, 671- 686, 671-687, 671-691, 673-688, 679-699, 682-697, 682-706, 686-701, 687-702, 687-706, 687-703, 693-715, 727-746, 742-761, 748-767, 757-776, 766-785, 790-815, 814-833, 820-839, 822-844, 845-864, 854-873, 854- 876, 863-885, 872-906, 878-897, 899-918, 905-933, 936-955, 951-979, 963-985, 966-985, 972-1015, 978- 997, 1002-1021, 1025-1044, 1031-1056, 1049-1074, 1061-1083, 1070-1089, 1082-1101, 1088-11107, 1094- 1119, 1109-1134, 1121-1140, 1127-1146, 1159-1187, 1171-1191, 1206-1228, 1209-1228, 1215-1255, 1215- 1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251- 1279, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261- 1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1282, 1264-1279, 1264- 1283, 1265-1284, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1269- 1288, 1270-1285, 1275-1294, 1282-1301 , 1286-1306, 1293-1318, 1311 -1333, 1326-1345, 1359-1378, 1553- 1578, 1565-1584, 1571 -1590, 1574-1599, 1577-1592, 1577-1596, 1577-1593, 1577-1596, 1578-1593, 1578- 1594, 1578-1597, 1579-1595, 1579-1598, 1580-1596, 1580-1599, 1581 -1596, 1581 -1597, 1581 -1600, 1582- 1597, 1582-1601 , 1582-1602, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1603, 1585-1601, 1585- 1604, 1586-1605, 1587-1602, 1587-1606, 1588-1603, 1589-1604, 1589-1605, 1657-1679, 1780-1795, 1780- 1796, 1780-1799, 1913-1935, 2278-2297, 2281-2300, and 2284-2303.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1 , when targeted by antisense compounds or oligonucleotides, display at least 85% inhibition: 13-32, 16-35, 19-38, 25-44, 46-65, 59-80, 101 -120, 140-159, 158-177, 167-186, 200-219, 205-224, 209-228, 233-252, 242-263, 253-272, 266- 285, 281-300, 290-311 , 293-312, 359-379, 361-381, 370-389, 382-401, 411-426, 41 1-430, 411-427, 413-428, 414-433, 415-430, 416-435, 417-436, 422-441 , 456-476, 458-473, 470-493, 512-531 , 524-543, 536-558, 566- 585, 575-594, 587-606, 608-627, 614-636, 623-645, 639-654, 665-687, 671-686, 671 -687, 680-699, 682-703, 687-706, 687-703, 727-746, 742-761 , 757-776, 793-812, 822-843, 854-876, 854-873, 863-885, 878-900, 878- 897, 887-906, 899-918, 905-927, 914-933, 936-955, 951-985, 966-985, 972-1015, 978-997, 1002-1021 , 1025-1044, 1037-1056, 1049-1074, 1064-1083, 1070-1089, 1088-1 107, 1094-1119, 1109-1 128, 1 121-1 140, 1 156-1 175, 1 162-1 187, 1 172-1191 , 1206-1228, 1209-1228, 1215-1255, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251 -1279, 1251 -1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261 -1285, 1261-1276, 1261-1277, 1261 -1280, 1262-1277, 1262-1278, 1262-1281 , 1263-1278, 1263-1282, 1264-1279, 1264-1283, 1265-1284, 1266-1285, 1267-1282, 1267-1283, 1268-1284, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1275-1294, 1282-1301 , 1293-1315, 131 1-1330, 1359-1378, 1574-1593, 1577-1592, 1577-1593, 1577-1596, 1577-1606, 1578-1593, 1578-1594, 1578-1597, 1579-1598, 1580-1596, 1580-1599, 1581-1597, 1581 -1600, 1582-1601 , 1583-1598, 1583-1602, 1584-1603, 1585-1601, 1585-1604, 1586-1605, 1587-1602, 1588-1603, 1780-1799, 1780-1796, and 2278-2297, 2281-2300, and 2284-2303.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1 , when targeted by antisense compounds or oligonucleotides, display at least 90% inhibition: 13-32, 16-35, 60-80, 140-159, 158- 177, 167-186, 242-261 , 292-31 1 , 362-381 , 370-389, 382-401 , 41 1 -427, 41 1-426, 413-428, 415-430, 416-435, 422-441 , 473-492, 617-636, 623-642, 639-654, 668-687, 680-699, 682-701 , 684-703, 687-706, 727-746, 757- 776, 824-843, 854-873, 854-876, 863-882, 878-897, 878-900, 887-906, 899-918, 905-927, 914-933, 936-955, 951-970, 960-985, 966-985, 972-1015, 978-997, 1025-1044, 1037-1056, 1070-1089, 1097-1 1 19, 1 109-1 128, 1 121 -1 140, 1 165-1 187, 1 172-1191 , 1206-1228, 1209-1228, 1215-1234, 1215-1234, 1215-1255, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251 -1279, 1251 -1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261 -1285, 1261 -1280, 1262-1278, 1261-1276, 1262-1281, 1262-1277, 1263-1282, 1263-1278, 1264-1283, 1265-1284, 1266-1285, 1268-1284, 1269-1284, 1269-1285, 1269-1288, 1296-1315, 1577-1605, 1577-1596, 1577-1593, 1577-1592, 1578-1597, 1581-1600, 1582-1601 , 1583-1602, 1583-1598, 1585-1601 , 1585-1604, 1586-1605, 1588-1603, 1780-1799, 1780-1796, 2278-2297, 2281-2300, and 2284-2303. In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 95% inhibition: 41 1-426, 41 1-427, 413-428, 617- 636, 623-642, 668-687, 680-699, 682-701 , 854-873, 878-897, 887-906, 914-933, 966-985, 978-997, 1209- 1228, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245- 1264, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261 - 1280, 1262-1281 , 1263-1282, 1263-1278, 1264-1283, 1265-1284, 1266-1285, 1268-1284, 1269-1288, 1577- 1592, 1577-1596, 1577-1601 , 1583-1598, 1585-1601 , 1588-1603, 1780-1799, 2278-2297, 2281-2300, and 2284-2303.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 50% inhibition of a HBV mRNA, ISIS IDs: 510088, 510089, 510090, 510092, 510096, 510097, 510098, 510099, 510100, 510101 , 510102, 505330, 509928, 510104, 509929, 510105, 509930, 510106, 510107, 510108, 5101 1 1 , 5101 15, 509931 , 510116, 5101 17, 510118, 510119, 510120, 510121, 509932, 510122, 509933, 510123, 509934, 510124, 509935, 510125, 510126, 510127, 510128, 510140, 146779, 505314, 505315, 505316, 505317, 146821 , 505318, 509922, 505319, 509925, 505320, 509952, 505321 , 505322, 505323, 505324, 505325, 505326, 505327, 505328, 505329, 509956, 509957, 509927, 509958, 510038, 505330, 509959, 510039, 509960, 510040, 509961, 510041 , 509962, 509963, 505331 , 505332, 509968, 509969, 510050, 510052, 505333, 505334, 505335, 505336, 509972, 146823, 509974, 505338, 505339, 509975, 505340, 509978, 505341 , 509979, 510058, 505342, 509981 , 510061, 505344, 505345, 509983, 505346, 509984, 505347, 505348, 505350, 505352, 505353, 505354, 505355, 505356, 146786, 505357, 505358, 505359, 505360, 509985, 509986, 509987, 509988, 505363, 505364, 505365, 505366, 146787, 510079, 524410, 52441 1 , 524413, 524414, 524415, 524416, 524417, 524418, 524419, 524420, 524421 , 524422, 524424, 524425, 524426, 524427, 524428, 524429, 524431 , 524432, 524433, 524434, 524435, 524436, 524439, 524440, 524442, 524444, 524446, 524447, 524448, 524450, 524451 , 524452, 524453, 524454, 524455, 524456, 524457, 524458, 524459, 524460, 524461 , 524462, 524464, 524466, 524467, 524468, 524469, 524470, 524471 , 524472, 524473, 524474, 524475, 524477, 524478, 524479, 524480, 524481 , 524482, 524483, 524484, 524485, 524486, 524487, 524489, 524490, 524491 , 524492, 524493, 524494, 524495, 524496, 524498, 524499, 524500, 524501 , 524502, 524503, 524504, 524506, 524507, 524508, 524509, 524510, 52451 1 , 524512, 524513, 524514, 524515, 524516, 524517, 524518, 524519, 524520, 524521 , 524522, 524523, 524524, 524525, 524526, 524527, 524528, 524529, 524530, 524531 , 524532, 524533, 524534, 524535, 524536, 524537, 524538, 524539, 524540, 524541 , 524543, 524544, 524546, 524547, 524548, 524549, 524550, 524551 , 524552, 524553,

524554, 524555, 524556, 524557, 524558, 524559, 524560, 524561 , 524562, 524563, 524564, 524565,

524568, 524569, 524570, 524571 , 524572, 524573, 524574, 524575, 524576, 524577, 524578, 524579,

524580, 524581 , 524582, 524584, 524585, 524586, 524587, 524588, 524589, 524590, 524591 , 524592,

524593, 524594, 524595, 524598, 524599, 524600, 524601 , 524602, 524603, 524604, 524605, 524606,

524607, 524608, 524609, 524610, 524611 , 524614, 524615, 524616, 524617, 524618, 524619, 524620,

524621 , 524622, 524623, 524624, 524625, 524626, 524627, 524629, 524632, 524633, 524634, 524635,

524636, 524637, 524638, 524639, 524640, 524641 , 524642, 524643, 524644, 524646, 524647, 524648,

524649, 524650, 524651 , 524652, 524654, 524656, 524657, 524658, 524659, 524660, 524661 , 524662,

524663, 524664, 524665, 524666, 524667, 524668, 524669, 524670, 524672, 524673, 524675, 524676,

524678, 524679, 524680, 524682, 524683, 524684, 524685, 524686, 524687, 524688, 524689, 524690,

524691 , 524692, 524693, 524694, 524695, 524696, 524697, 524698, 524699, 524700, 524701 , 524702,

524703, 524704, 524705, 524706, 524707, 524708, 524709, 524710, 524712, 524713, 524714, 524715,

524716, 524717, 524718, 524719, 524721, 524722, 524723, 524724, 524726, 524727, 524728, 524729,

524730, 524731 , 524732, 524733, 524734, 524735, 524736, 524737, 524738, 524739, 524740, 524741 ,

524742, 524743, 524744, 524745, 524746, 524747, 524748, 524749, 524750, 524751 , 524752, 524753,

524754, 524755, 524756, 524757, 524758, 524759, 524760, 524761 , 524762, 524763, 524764, 524765,

524766, 524767, 524768, 524769, 524770, 524771, 524772, 524773, 524774, 524775, 524776, 524777,

524778, 524779, 524780, 524781, 524782, 524783, 524784, 524785, 524786, 524787, 524788, 524789,

524790, 524791 , 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524799, 524800, 524801,

524802, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 52481 1 , 524812, 524813,

524814, 524815, 524816, 524817, 524818, 524819, 524820, 524821, 524822, 524823, 524824, 524825,

524826, 524827, 524828, 524829, 524830, 524831 , 524632, 524833, 524834, 524835, 524842, 524843,

524844, 524845, 524847, 524848, 524856, 524857, 524861 , 524866, 524867, 524868, 524869, 524870,

524871 , 524872, 524873, 524875, 524876, 524877, 524878, 524879, 524880, 524881 , 524882, 524883,

524884, 524885, 524886, 524887, 524888, 524889, 524890, 524891 , 524892, 524893, 524894, 524895,

524896, 524897, 524898, 524899, 524900, 524901 , 524902, 524903, 524904, 524905, 524906, 524907,

524908, 524909, 524910, 52491 1 , 524912, 524913, 524914, 524915, 524916, 524917, 524918, 524919,

524921 , 524922, 524923, 524924, 524925, 524926, 524927, 524928, 524929, 524930, 524931 , 524932,

524933, 524934, 524935, 524936, 524937, 524938, 524939, 524940, 524941 , 524942, 524943, 524944,

524945, 524946, 524947, 524948, 524949, 524950, 524951 , 524952, 524953, 524954, 524955, 524956,

524957, 524958, 524959, 524960, 524961 , 524962, 524964, 524965, 524976, 524977, 524978, 524979,

524980, 524981 , 524982, 524983, 524984, 524985, 524986, 524987, 524988, 524989, 524991 , 524992,

524993, 524994, 524997, 524998, 525021 , 525022, 525037, 525039, 525043, 525050, 525052, 525086,

525090, 525100, 551909, 551910, 55191 1 , 551912, 551913, 551916, 551917, 551918, 551919, 551920, 551921 , 551922, 551923, 551924, 551925, 551926, 551927 551928, 551929, 551930, 551932, 551933, 551934, 551935, 551936, 551937, 551939, 551940, 551941 551942, 551943, 551944, 551945, 551946, 551947, 551948, 551949, 551950, 551951 , 551952, 551953 551954, 551955, 551956, 551957, 551958, 551959, 551960, 551962, 551963, 551964, 551965, 551966 551967, 551968, 551971 , 551972, 551973, 551974, 551975, 551976, 551977, 551978, 551979, 551980 551981 , 551982, 551983, 551984, 551985, 551986, 551987, 551988, 551989, 551990, 551992, 551993 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552001 , 552002, 552003, 552004, 552005 552006, 552007, 552009, 552010, 55201 1 , 552012, 552013, 552014, 552015, 552016, 552017, 552018 552019, 552020, 552021 , 552022, 552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030 552031 , 552032, 552033, 552034, 552035, 552036, 552037, 552038, 552039, 552040, 552041 , 552042 552043, 552044, 552045, 552046, 552047, 552048, 552049, 552050, 552051 , 552052, 552053, 552054 552055, 552056, 552057, 552058, 552059, 552060, 552061 , 552062, 552063, 552064, 552065, 552067 552068, 552069, 552070, 552071 , 552072, 552073, 552074, 552075, 552076, 552077, 552078, 552079 552080, 552081 , 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091 552092, 552093, 552094, 552095, 552096, 552097, 552098, 552099, 552100, 552101 , 552102, 5521 14 552115, 552116, 552117, 5521 18, 552119, 552122, 552123, 552124, 552125, 552126, 552127, 552128 552129, 552131 , 552132, 552133, 552134, 552135, 552136, 552137, 552138, 552139, 552140, 552141 552142, 552143, 552144, 552145, 552146, 552147, 552148, 552149, 552150, 552151 , 552152, 552153 552154, 552155, 552158, 552159, 552160, 552161 , 552162, 552163, 552164, 552165, 552167, 552168 552169, 552170, 552171 , 552175, 552176, 552177, 552178, 552179, 552180, 552181 , 552182, 552183 552185, 552186, 552187, 552188, 552189, 552191, 552192, 552193, 552194, 552195, 552196, 552197 552198, 552199, 552200, 552201 , 552202, 552203, 552204, 552205, 552206, 552207, 552208, 552209 552210, 55221 1, 552212, 552213, 552214, 552215, 552216, 552217, 552218, 552220, 552222, 552224 552225, 552230, 552239, 552240, 552241 , 552242, 552243, 552246, 552247, 552248, 552249, 552250 552251, 552252, 552253, 552254, 552255, 552256, 552257, 552258, 552259, 552260, 552261 , 552262 552263, 552264, 552265, 552266, 552267, 552268, 552269, 552270, 552271 , 552279, 552285, 552288 552293, 552294, 552295, 552296, 552297, 552300, 552301 , 552302, 552303, 552304, 552305, 552306 552307, 552308, 552309, 552310, 552312, 552313, 552314, 552315, 552316, 552317, 552318, 552319 552320, 552321 , 552322, 552323, 552325, 552326, 552330, 552331 , 552332, 552333, 552337, 552338 552339, 552340, 552341 , 552342, 552343, 552344, 552345, 552347, 552348, 552349, 552350, 552351 552352, 552354, 552355, 552356, 552357, 552358, 552359, 552360, 552361 , 552362, 552363, 552364 552365, 552366, 552367, 552368, 552369, 552370, 552371 , 552372, 552373, 552374, 552375, 552376 552377, 552378, 552379, 552380, 552385, 552386, 552390, 552391 , 552393, 552394, 552395, 552396 552397, 552398, 552399, 552400, 552401 , 552402, 552403, 552408, 552409, 552410, 55241 1 , 552412 552413, 552414, 552415, 552416, 552417, 552418, 552419, 552420, 552421 , 552422, 552423, 552424, 552425, 552428, 552430, 552431 , 552432, 552433, 552440, 552442, 552443, 552444, 552445, 552446, 552447, 552448, 552449, 552450, 552452,

552453, 552455, 552456, 552458, 552459, 552464, 552465, 552466, 552467, 552468, 552469, 552470,

552471 , 552472, 552473, 552474, 552475, 552476, 552477, 552478, 552479, 552480, 552481 , 552482,

552484, 552485, 552486, 552487, 552488, 552490, 552491, 552493, 552497, 552499, 552500, 552501,

552502, 552503, 552504, 552505, 552506, 552508, 552509, 552510, 55251 1 , 552512, 552513, 552514,

552515, 552516, 552517, 552520, 552521, 552522, 552523, 552525, 552526, 552527, 552528, 552529,

552530, 552531 , 552532, 552533, 552534, 552535, 552538, 552539, 552540, 552541 , 552542, 552544,

552547, 552548, 552553, 552554, 552555, 552557, 552558, 552559, 552561 , 552562, 552565, 552566,

552567, 552568, 552569, 552570, 552571 , 552572, 552576, 552577, 552578, 552579, 552580, 552581,

552582, 552583, 552584, 552585, 552586, 552587, 552588, 552589, 552590, 552591, 552592, 552594,

552595, 552596, 552597, 552598, 552600, 552606, 552608, 552787, 552788, 552789, 552790, 552791,

552794, 552795, 552796, 552797, 552798, 552799, 552800, 552801 , 552802, 552803, 552804, 552805,

552806, 552807, 552808, 552809, 552810, 552811 , 552812, 552813, 552814, 552815, 552816, 552817,

552818, 552819, 552820, 552821 , 552822, 552823, 552824, 552825, 552826, 552827, 552828, 552829,

552830, 552831 , 552832, 552833, 552834, 552835, 552836, 552837, 552838, 552839, 552840, 552841,

552842, 552843, 552844, 552845, 552846, 552847, 552848, 552849, 552850, 552851 , 552852, 552853,

552854, 552855, 552856, 552857, 552858, 552859, 552860, 552861 , 552862, 552863, 552864, 552865,

552866, 552868, 552870, 552871 , 552872, 552876, 552889, 552890, 552891 , 552892, 552893, 552894,

552895, 552896, 552898, 552899, 552901, 552902, 552903, 552904, 552905, 552907, 552908, 552909,

552910, 552911, 552912, 552913, 552914, 552915, 552916, 552917, 552918, 552919, 552922, 552923,

552925, 552926, 552927, 552928, 552929, 552930, 552931 , 552932, 552933, 552934, 552935, 552936,

552937, 552938, 552939, 552940, 552941, 552942, 552943, 552944, 552945, 552946, 552947, 552948,

552950, 552951 , 552953, 552954, 552955, 552956, 552957, 552958, 552959, 552960, 552961 , 552965,

552966, 552969, 552970, 552971 , 552972, 552973, 552974, 552975, 552976, 552977, 552979, 552980,

552981 , 552982, 552983, 552984, 552987, 552988, 552989, 552990, 552991 , 552992, 552993, 552994,

552995, 552996, 552997, 552998, 552999, 553000, 553001 , 553002, 553003, 553004, 553005, 553006,

553007, 553008, 553009, 553010, 553011 , 553012, 553014, 553015, 553016, 566828, 566829, 566830,

566831 , 566832, 577120, 577121 , 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577129,

577130, 577131 , 577132, 577133, 577134, 577135, 577136, 582665, and 582666.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a

HBV nucleic acid and effect at least a 50% inhibition of a HBV mRNA, SEQ ID NOs: 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 33, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 74, 83, 85, 86, 87, 88, 89, 92, 96, 98, 99, 100, 102, 103, 104, 106, 108, 109, 1 1 1 , 1 12, 1 15, 1 17, 121 , 122, 123, 124, 125, 126, 127, 128, 136, 137, 139, 140, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 , 153, 155, 157, 159, 161 , 165, 166, 167, 168, 169, 171 , 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 , 186, 187, 188, 189, 190, 191 , 192, 193, 194, 197, 198, 199, 201 , 203, 206, 207, 208, 209, 210, 21 1, 212, 213, 215, 217, 218, 220, 221 , 222, 224, 225, 226, 227, 228, 230, 231 , 232, 233, 234, 235, 236, 237, 240, 241 , 242, 243, 244, 250, 283, 321, 322, 324, 325, 326, 327, 328, 329, 330, 331 , 332, 333, 335, 336, 337, 338, 339, 340, 342, 343, 344, 345, 346, 347, 350, 351 , 353, 355, 357, 358, 359, 361 , 362, 363, 364, 365, 366, 367, 368, 369, 370, 371 , 372, 373, 375, 376, 377, 378, 379, 380, 381 , 382, 383, 384, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 399, 400, 401 , 402, 403, 404, 405, 406, 408, 409, 410, 41 1 , 412, 413, 414, 416, 417, 418, 419, 420 421 , 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441 , 442, 443, 444, 445, 446, 447, 448, 449, 450, 451 , 453, 454, 456, 457, 458, 459, 460, 461 , 462, 463, 464, 465, 466, 467, 468, 469, 470, 471 , 473, 474, 475, 478, 479, 480, 481 , 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 494, 495, 496, 497, 498, 499, 500, 501 , 502, 503, 504, 505, 508, 509, 510, 51 1 , 512, 513, 514, 515, 516, 517, 518, 519, 520, 521 , 524, 525, 526, 527, 528, 529, 530, 531 , 532, 533, 534, 535, 536, 537, 539, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551 , 552, 553, 554, 555, 556, 557, 558, 559, 560, 561 , 562, 564, 566, 567, 568, 569, 570, 571 , 572, 573, 574, 575, 576, 577, 578, 579, 580, 582, 583, 585, 586, 588, 589, 590, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601 , 602, 603, 604, 605, 606, 607, 608, 609, 610, 61 1, 612, 613, 614, 615, 616, 617, 618, 619, 620, 622, 623, 624, 625, 626, 627, 628, 629, 631 , 632, 633, 634, 636, 637, 638, 639, 640, 641 , 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661 , 662, 663, 664, 665, 666, 667, 668, 669, 670, 671 , 672, 673, 674, 675, 676, 677, 678, 679, 680, 681 , 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701 , 702, 703, 704, 705, 706, 707, 708, 709, 710, 71 1 , 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 , 722, 723, 724, 725, 726, 727, 728, 729, 730, 731 , 732, 733, 734, 735, 736, 737, 738, 739, 740, 741 , 742, 743, 744, 745, 746, 747, 754, 755, 756, 757, 759, 760, 768, 769, 773, 777, 778, 779, 780, 781, 782, 783, 784, 786, 787, 788, 789, 790, 791 , 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 81 1 , 812, 813, 814, 815, 816, 817, 818, 819, 820, 821 , 822, 823, 824, 825, 826, 827, 828, 829, 830, 831 , 833, 834, 835, 836, 837, 838, 839, 840, 841 , 842, 843, 844, 845, 846, 847, 848, 849, 850, 851 , 852, 853, 854, 855, 856, 857, 858, 859, 860, 861 , 862, 863, 864, 865, 866, 867, 868, 869, 870, 871 , 872, 873, 874, 876, 877, 888, 889, 890, 891 , 892, 893, 894, 895, 896, 897, 898, 899, 900, 901 , 903, 904, 905, 906, 909, 910, 933, 934, 949, 951 , 955, 962, 964, 998, 1002, 1013, 1052, 1267, 1271 , 1272, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301 , 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311 , 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321 , 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331 , 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341 , 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371 , 1372, 1375, and 1376.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 60% inhibition of a HBV mRNA, ISIS IDs: 510090, 510100, 510102, 505330, 509928, 510104, 509929, 510105, 509930, 510106, 510107, 5101 1 1 , 509931 , 5101 16, 5101 17, 5101 1 8, 5101 19, 510120, 510121 , 509932, 510122, 509933, 510123, 509934, 510124, 509935, 510125, 510128, 146779, 505314, 505315, 505316, 505317, 146821 , 505318, 505319, 505322, 505323, 505324,

505325, 505326, 505327, 505328, 505329, 509956, 509957, 509958, 505330, 509959, 510041 , 505332,

509968, 505333, 505335, 146823, 509974, 505338, 505339, 509975, 505340, 505341, 509979, 505342,

509981 , 505344, 505345, 509983, 505346, 509984, 505347, 505348, 505353, 505354, 505356, 146786,

505357, 505358, 505359, 505360, 509985, 509986, 505363, 505366, 524410, 524413, 524414, 524415,

524416, 524417, 524418, 524419, 524420, 524421 , 524422, 524424, 524425, 524426, 524428, 524431 ,

524432, 524433, 524434, 524435, 524439, 524440, 524446, 524447, 524448, 524451, 524452, 524453,

524454, 524455, 524456, 524457, 524459, 524460, 524461 , 524464, 524466, 524467, 524468, 524469,

524471 , 524472, 524473, 524474, 524475, 524477, 524478, 524479, 524480, 524481 , 524482, 524485,

524486, 524487, 524489, 524490, 524491 , 524492, 524493, 524494, 524495, 524496, 524499, 524500,

524501 , 524502, 524503, 524504, 524506, 524507, 524508, 524509, 524510, 524511 , 524512, 524513,

524514, 524515, 524516, 524517, 524519, 524520, 524521 , 524523, 524525, 524526, 524527, 524528,

524529, 524532, 524533, 524534, 524535, 524536, 524537, 524538, 524539, 524540, 524541, 524543,

524546, 524547, 524549, 524550, 524552, 524553, 524554, 524555, 524556, 524557, 524558, 524559,

524560, 524561 , 524562, 524563, 524564, 524565, 524568, 524569, 524570, 524571 , 524572, 524573,

524574, 524575, 524576, 524577, 524578, 524579, 524580, 524581, 524582, 524585, 524586, 524587,

524588, 524589, 524590, 524591 , 524593, 524594, 524595, 524598, 524599, 524600, 524602, 524603,

524604, 524605, 524606, 524607, 524610, 52461 1 , 524614, 524615, 524616, 524617, 524618, 524619,

524620, 524621 , 524622, 524623, 524625, 524627, 524629, 524632, 524633, 524634, 524635, 524636,

524637, 524638, 524639, 524640, 524641 , 524642, 524643, 524644, 524646, 524647, 524648, 524649,

524650, 524651 , 524654, 524656, 524657, 524658, 524659, 524661 , 524662, 524663, 524664, 524665,

524666, 524667, 524668, 524669, 524670, 524673, 524675, 524676, 524678, 524679, 524680, 524683,

524684, 524685, 524686, 524687, 524688, 524689, 524690, 524691 , 524692, 524694, 524695, 524696,

524697, 524698, 524699, 524700, 524701, 524702, 524703, 524704, 524705, 524706, 524707, 524708,

524709, 524710, 524713, 524714, 524715, 524716, 524717, 524718, 524719, 524721 , 524722, 524724,

524726, 524727, 524728, 524729, 524730, 524731 , 524732, 524733, 524734, 524735, 524736, 524737,

524738, 524739, 524741 , 524742, 524743, 524744, 524746, 524747, 524748, 524749, 524750, 524751 ,

524752, 524753, 524754, 524755, 524756, 524757, 524758, 524759, 524760, 524761 , 524762, 524763,

524764, 524765, 524766, 524767, 524768, 524769, 524770, 524771 , 524772, 524773, 524774, 524775,

524776, 524777, 524778, 524779, 524780, 524781 , 524782, 524783, 524784, 524785, 524787, 524788,

524789, 524790, 524791 , 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524799, 524800,

524801, 524802, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 52481 1 , 524812,

524813, 524814, 524815, 524816, 524817, 524818, 524819, 524820, 524821, 524822, 524823, 524824,

524825, 524826, 524827, 524828, 524829, 524830, 524632, 524833, 524842, 524843, 524844, 524845,

524847, 524856, 524866, 524867, 524868, 524869, 524870, 524871 , 524872, 524873, 524876, 524878, 524879, 524880, 524881 , 524882, 524883, 524884, 524885, 524886, 524887, 524888, 524889, 524890,

524891 , 524892, 524893, 524894, 524895, 524896, 524897, 524898, 524899, 524900, 524901 , 524902,

524903, 524904, 524905, 524906, 524907, 524908, 524909, 524910, 52491 1 , 524912, 524913, 524914,

524915, 524916, 524921 , 524922, 524923, 524924, 524925, 524926, 524928, 524929, 524930, 524931 ,

524932, 524933, 524936, 524937, 524938, 524939, 524940, 524941 , 524942, 524944, 524946, 524947,

524948, 524949, 524950, 524952, 524953, 524954, 524955, 524961 , 524977, 524978, 524979, 524980,

524981 , 524982, 524983, 524984, 524985, 524986, 524987, 524988, 524991, 524992, 524993, 524994,

525037, 525052, 551909, 55191 1 , 551919, 551920, 551921 , 551922, 551924, 551925, 551926, 551927,

551928, 551932, 551933, 551934, 551935, 551936, 551941 , 551943, 551944, 551948, 551949, 551950,

551951 , 551952, 551953, 551954, 551955, 551956, 551957, 551958, 551959, 551960, 551962, 551963,

551965, 551966, 551967, 551968, 551973, 551975, 551979, 551981 , 551982, 551983, 551984, 551985,

551986, 551987, 551989, 551990, 551992, 551993, 551994, 551995, 551996, 551997, 551998, 551999,

552000, 552001 , 552002, 552003, 552005, 552006, 552007, 552009, 552010, 552012, 552013, 552014,

552015, 552016, 552017, 552018, 552019, 552020, 552021 , 552022, 552023, 552024, 552025, 552026,

552027, 552028, 552029, 552030, 552031 , 552032, 552033, 552034, 552035, 552036, 552038, 552039,

552041 , 552042, 552044, 552045, 552046, 552047, 552048, 552049, 552050, 552051 , 552052, 552053,

552054, 552055, 552056, 552057, 552058, 552059, 552060, 552061 , 552062, 552063, 552064, 552065,

552068, 552069, 552070, 552071 , 552073, 552074, 552075, 552076, 552077, 552078, 552079, 552080,

552081 , 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091 , 552092,

552093, 552094, 552095, 552096, 552097, 552098, 552099, 552100, 552101 , 552102, 552114, 552115,

5521 16, 552117, 5521 18, 552119, 552123, 552124, 552125, 552126, 552127, 552128, 552129, 552131 ,

552132, 552133, 552134, 552135, 552136, 552138, 552139, 552140, 552141 , 552143, 552144, 552145,

552146, 552147, 552148, 552149, 552150, 552151 , 552152, 552153, 552155, 552158, 552159, 552160,

552162, 552163, 552168, 552169, 552170, 552171 , 552176, 552178, 552179, 552180, 552182, 552183,

552185, 552187, 552188, 552191 , 552192, 552193, 552194, 552195, 552196, 552197, 552198, 552199,

552200, 552201 , 552202, 552203, 552204, 552205, 552206, 552207, 552208, 552209, 552210, 55221 1,

552212, 552213, 552214, 552215, 552216, 552222, 552224, 552225, 552239, 552240, 552242, 552246,

552247, 552248, 552252, 552253, 552254, 552255, 552256, 552257, 552258, 552259, 552261 , 552263,

552265, 552266, 552268, 552285, 552293, 552294, 552295, 552296, 552301 , 552302, 552303, 552306,

552307, 552308, 552309, 552310, 552312, 552313, 552314, 552315, 552316, 552317, 552318, 552320,

552321 , 552322, 552323, 552325, 552326, 552331 , 552332, 552337, 552338, 552339, 552340, 552343,

552345, 552347, 552348, 552349, 552351 , 552354, 552355, 552356, 552358, 552359, 552360, 552361 ,

552362, 552363, 552364, 552365, 552366, 552367, 552368, 552369, 552370, 552371 , 552372, 552373,

552374, 552375, 552376, 552377, 552378, 552379, 552396, 552397, 552398, 552403, 552408, 552409,

552410, 55241 1 , 552412, 552414, 552416, 552418, 552419, 552420, 552421 , 552422, 552423, 552424, 552431 , 552442, 552445, 552449, 552455, 552456, 552459, 552464, 552465, 552466, 552467, 552469,

552472, 552473, 552474, 552475, 552477, 552478, 552479, 552480, 552484, 552487, 552497, 552508,

552509, 55251 1 , 552512, 552515, 552516, 552520, 552521 , 552522, 552523, 552526, 552527, 552528,

552529, 552530, 552531 , 552534, 552540, 552541 , 552542, 552559, 552567, 552568, 552569, 552570,

552572, 552576, 552577, 552578, 552579, 552582, 552583, 552584, 552585, 552586, 552587, 552588,

552590, 552595, 552596, 552597, 552788, 552789, 552790, 552791, 552796, 552800, 552801 , 552803,

552804, 552805, 552806, 552807, 552808, 552809, 552811 , 552812, 552813, 552814, 552815, 552816,

552817, 552818, 552819, 552820, 552821 , 552822, 552823, 552824, 552826, 552827, 552828, 552829,

552830, 552831, 552832, 552833, 552834, 552835, 552836, 552837, 552838, 552839, 552841 , 552842,

552843, 552844, 552845, 552846, 552847, 552848, 552849, 552850, 552851 , 552852, 552853, 552854,

552855, 552856, 552857, 552858, 552859, 552860, 552861, 552862, 552863, 552864, 552865, 552866,

552872, 552891 , 552892, 552893, 552894, 552902, 552903, 552904, 552905, 552907, 552908, 552909,

552910, 552911 , 552912, 552913, 552914, 552915, 552916, 552917, 552918, 552922, 552923, 552925,

552927, 552928, 552929, 552930, 552931 , 552932, 552933, 552934, 552935, 552936, 552937, 552938,

552939, 552940, 552941 , 552942, 552943, 552944, 552945, 552946, 552951 , 552955, 552956, 552957,

552958, 552960, 552961 , 552966, 552969, 552971, 552972, 552973, 552974, 552975, 552976, 552977,

552979, 552980, 552981 , 552982, 552983, 552984, 552988, 552989, 552990, 552991, 552992, 552993,

552994, 552995, 552996, 552998, 552999, 553000, 553001 , 553002, 553003, 553004, 553005, 553006,

553007, 553008, 553009, 553010, 55301 1 , 553012, 553016, 566828, 566829, 566830, 566831 , 566832,

577120, 577121 , 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577129, 577130, 577131 ,

577132, 577133, 577134, 577135, 577136, and 582666.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 60% inhibition of a HBV mRNA, SEQ ID NOs: 7, 9, 10, 12, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 33, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 56, 83, 85, 86, 87, 88, 89, 92, 96, 98, 100, 102, 103, 112, 115, 1 17, 122, 123, 124, 125, 126, 127, 128, 136, 137, 139, 140, 142, 143, 145, 147, 149, 150, 151 , 153, 155, 157, 159, 161, 166, 167, 168, 172, 174, 176, 177, 178, 179, 180, 181 , 186, 187, 188, 189, 190, 191 , 192, 193, 194, 198, 199, 201 , 206, 207, 208, 209, 210, 21 1 , 212, 213, 218, 220, 222, 224, 225, 226, 227, 228, 230, 231 , 232, 233, 234, 240, 243, 321 , 324, 325, 326, 327, 328, 329, 330, 331 , 332, 333, 335, 336, 337, 339, 342, 343, 344, 345, 346, 350, 351 , 357, 358, 359, 362, 363, 364, 365, 366, 367, 368, 370, 371 , 372, 375, 376, 377, 378, 379, 381 , 382, 383, 384, 387, 388, 389, 390, 391 , 392, 395, 396, 397, 399, 400, 401 , 402, 403, 404, 405, 406, 409, 410, 411, 412, 413, 414, 416, 417, 418, 419, 420 421 , 422, 423, 424, 425, 426, 427, 429, 430, 431 , 433, 435, 436, 437, 438, 439, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451 , 453, 456, 457, 459, 460, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471 , 473, 474, 475, 478, 479, 480, 481 , 482, 483, 484, 485, 486, 487, 488, 489, 490, 491 , 492, 495, 496, 497, 498, 499, 500, 501 , 503, 504, 505, 508, 509, 510, 512, 513, 514, 515, 516, 517, 520, 521 , 524, 525, 526, 527, 528, 529, 530, 531 , 532, 533, 535, 537, 539, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551 , 552, 553, 554, 555, 556, 557, 558, 559, 560, 561 , 564, 566, 567, 568, 569, 571 , 572, 573, 574, 575, 576, 577, 578, 579, 580, 583, 585, 586, 588, 589, 590, 593, 594, 595, 596, 597, 598, 599, 600, 601 , 602, 604, 605, 606, 607, 608, 609, 610, 611 , 612, 613, 614, 615, 616, 617, 618, 619, 620, 623, 624, 625, 626, 627, 628, 629, 631 , 632, 634, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 652, 653, 654, 655, 657, 658, 659, 660, 661 , 662, 663, 664, 665, 666, 667, 668, 669, 670, 671 , 672, 673, 674, 675, 676, 677, 678, 679, 680, 681 , 682, 683, 684, 685, 686, 687, 688, 689, 690, 691 , 692, 693, 694, 695, 696, 698, 699, 700, 701 , 702, 703, 704, 705, 706, 707, 708, 709, 710, 71 1 , 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 , 722, 723, 724, 725, 726, 727, 728, 729, 730, 731 , 732, 733, 734, 735, 736, 737, 738, 740, 741 , 742, 744, 745, 754, 755, 756, 757, 759, 768, 777, 778, 779, 780, 781 , 782, 783, 784, 787, 789, 790, 791 , 792, 793, 794, 795, 796, 797, 798, 799, 800, 801 , 802, 803, 804, 805, 806, 807, 808, 809, 810, 81 1, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821 , 822, 823, 824, 825, 826, 827, 828, 833, 834, 835, 836, 837, 838, 840, 841 , 842, 843, 844, 845, 848, 849, 850, 851 , 852, 853, 854, 856, 858, 859, 860, 861 , 862, 864, 865, 866, 867, 873, 889, 890, 891 , 892, 893, 894, 895, 896, 897, 898, 899, 900, 903, 904, 905, 906, 949, 964, 1271 , 1288, 1289, 1290, 1291 , 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301 , 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 131 1 , 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331 , 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341 , 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1365, 1366, 1367, 1368, 1369, 1370, 1371 , 1372, and 1376.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 70% inhibition of a HBV mRNA, ISIS IDs: 510100, 505330, 509928, 509929, 509930, 510106, 509931 , 510116, 5101 19, 510120, 510121 , 509932, 510122, 509933, 510123, 509934, 510124, 509935, 146779, 505317, 146821 , 505318, 505319, 505323, 505325, 505326, 505327, 509957, 505330, 505332, 505335, 509974, 505338, 505339, 509975, 505342, 509981 , 505345, 505346, 505347, 505348, 146786, 505357, 505358, 505359, 505363, 524410, 524413, 524414, 524415, 524416, 524418, 524419, 524420, 524421 , 524424, 524425, 524426, 524428, 524431 , 524432, 524433, 524434, 524435, 524446, 524447, 524448, 524452, 524453, 524457, 524459, 524460, 524461 , 524464, 524466, 524467, 524468, 524469, 524472, 524473, 524474, 524475, 524477, 524478, 524479, 524480, 524481 , 524482, 524485, 524487, 524490, 524491 , 524492, 524493, 524494, 524495, 524499, 524500, 524502, 524503, 524507, 524508, 524510, 52451 1 , 524512, 524513, 524514, 524515, 524516, 524517, 524520, 524525, 524526, 524528, 524532, 524533, 524534, 524535, 524536, 524537, 524538, 524539, 524540, 524541 , 524547, 524549, 524552, 524553, 524554, 524555, 524556, 524557, 524558, 524559, 524560, 524561 , 524563, 524564, 524565, 524568, 524569, 524570, 524571 , 524572, 524573, 524574, 524575, 524577, 524578, 524579, 524580, 524582, 524586, 524587, 524590, 524591 , 524594, 524595, 524598, 524600, 524602, 524603, 524604, 524605, 524606, 524607, 524610, 52461 1 , 524614, 524615, 524616, 524617, 524618, 524619, 524620, 524621 , 524629, 524633, 524634, 524635, 524636, 524637, 524638, 524641 , 524642, 524643, 524644, 524646, 524647, 524648, 524649, 524650, 524651 , 524656, 524657,

524659, 524661, 524662, 524663, 524664, 524665, 524666, 524667, 524668, 524669, 524670, 524678,

524679, 524680, 524685, 524686, 524687, 524688, 524689, 524690, 524691 , 524692, 524695, 524696,

524698, 524699, 524700, 524701 , 524702, 524703, 524704, 524705, 524706, 524707, 524708, 524709,

524713, 524714, 524715, 524716, 524717, 524718, 524721, 524722, 524724, 524726, 524727, 524728,

524729, 524730, 524731, 524732, 524733, 524734, 524735, 524736, 524737, 524738, 524739, 524741 ,

524742, 524743, 524746, 524747, 524748, 524749, 524750, 524751, 524752, 524754, 524755, 524756,

524758, 524760, 524761 , 524762, 524763, 524764, 524765, 524766, 524767, 524768, 524769, 524771 ,

524773, 524775, 524776, 524777, 524778, 524779, 524780, 524781, 524782, 524783, 524784, 524785,

524787, 524788, 524789, 524790, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798,

524799, 524800, 524801 , 524802, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810,

52481 1 , 524812, 524813, 524814, 524815, 524816, 524817, 524818, 524819, 524821 , 524822, 524823,

524824, 524825, 524826, 524827, 524828, 524829, 524830, 524833, 524842, 524843, 524844, 524845,

524856, 524866, 524867, 524868, 524869, 524870, 524871 , 524873, 524879, 524880, 524881 , 524882,

524883, 524884, 524885, 524886, 524887, 524888, 524889, 524890, 524891 , 524892, 524893, 524894,

524895, 524896, 524897, 524898, 524899, 524900, 524902, 524903, 524905, 524906, 524907, 524908,

524909, 524910, 524911, 524912, 524913, 524914, 524915, 524916, 524921, 524922, 524930, 524931 ,

524932, 524937, 524940, 524942, 524948, 524980, 524981, 524982, 524983, 524984, 524985, 524986,

524987, 524988, 551919, 551921 , 551922, 551924, 551925, 551926, 551933, 551941 , 551950, 551951 ,

551952, 551953, 551955, 551956, 551957, 551958, 551966, 551983, 551984, 551985, 551986, 551987,

551989, 551990, 551992, 551993, 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552005,

552006, 552009, 552012, 552013, 552014, 552015, 552017, 552018, 552019, 552020, 552021 , 552022,

552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030, 552031 , 552032, 552033, 552034,

552038, 552039, 552041, 552044, 552046, 552047, 552049, 552050, 552051 , 552052, 552053, 552054,

552055, 552056, 552057, 552058, 552059, 552060, 552061, 552062, 552063, 552064, 552065, 552068,

552069, 552070, 552071, 552073, 552074, 552075, 552076, 552077, 552078, 552079, 552080, 552081 ,

552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091 , 552092, 552093,

552094, 552095, 552096, 552097, 552098, 552099, 552100, 552101 , 552115, 5521 17, 552123, 552125,

552127, 552128, 552129, 552132, 552133, 552138, 552139, 552140, 552141 , 552143, 552144, 552145,

552146, 552147, 552148, 552149, 552150, 552151 , 552152, 552158, 552159, 552160, 552163, 552168,

552179, 552187, 552188, 552192, 552193, 552195, 552199, 552200, 552201 , 552202, 552203, 552204,

552205, 552206, 552207, 552208, 552210, 55221 1 , 552213, 552214, 552222, 552246, 552247, 552248,

552253, 552254, 552255, 552258, 552294, 552301 , 552302, 552306, 552307, 552308, 552309, 552310,

552312, 552314, 552315, 552317, 552318, 552321 , 552322, 552323, 552325, 552332, 552337, 552339,

552347, 552348, 552349, 552354, 552355, 552358, 552359, 552360, 552361 , 552362, 552363, 552364, 552365, 552366, 552367, 552368, 552369, 552371 , 552373, 552374, 552375, 552376, 552377, 552378, 552379, 552403, 552408, 552409, 55241 1 , 552418, 552419, 552420, 552424, 552442, 552464, 552465, 552466, 552467, 552472, 552474, 552475, 552477, 552478, 552521 , 552522, 552523, 552527, 552528, 552529, 552530, 552534, 552567, 552578, 552579, 552584, 552586, 552587, 552588, 552590, 552789, 552803, 552804, 552805, 552808, 552816, 552817, 552818, 552819, 552820, 552821 , 552822, 552823, 552824, 552828, 552829, 552830, 552833, 552834, 552835, 552842, 552843, 552844, 552846, 552848, 552849, 552850, 552851 , 552852, 552853, 552854, 552855, 552856, 552857, 552858, 552859, 552860, 552861 , 552863, 552864, 552865, 552872, 552894, 552903, 552904, 552907, 552909, 552910, 55291 1 , 552913, 552914, 552915, 552916, 552917, 552918, 552922, 552923, 552925, 552927, 552928, 552929, 552930, 552931 , 552932, 552933, 552934, 552935, 552936, 552937, 552938, 552939, 552940, 552941 , 552942, 552943, 552944, 552945, 552946, 552957, 552961 , 552966, 552969, 552971, 552972, 552974, 552976, 552979, 552980, 552981 , 552983, 552984, 552988, 552989, 552990, 552991 , 552995, 552996, 552998, 552999, 553001 , 553002, 553003, 553004, 553006, 553008, 553009, 553010, 553011 , 553012, 566828, 566829, 566830, 566831 , 566832, 577120, 577121 , 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577129, 577130, 577131 , 577132, 577133, 577134, 577135, 577136, and 582666.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 70% inhibition of a HBV mRNA, SEQ ID NOs: 12, 17, 18, 20, 21 , 22, 24, 25, 26, 27, 28, 29, 39, 40, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 83, 89, 92, 96, 98, 100, 103, 1 12, 123, 125, 126, 127, 136, 137, 139, 140, 142, 143, 145, 147, 149, 151 , 153, 166, 167, 168, 174, 176, 177, 178, 179, 181 , 186, 187, 188, 190, 198, 201 , 207, 209, 210, 21 1 , 212, 213, 224, 225, 226, 227, 232, 234, 240, 321 , 324, 325, 326, 327, 329, 330, 331 , 332, 335, 336, 337, 339, 342, 343, 344, 345, 346, 357, 358, 359, 363, 364, 368, 370, 371 , 372, 375, 376, 377, 378, 379, 382, 383, 384, 387, 388, 389, 390, 391, 392, 395, 397, 400, 401 , 402, 403, 404, 405, 409, 410, 412, 413, 417, 418, 420 421 , 422, 423, 424, 425, 426, 427, 430, 435, 436, 438, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451 , 457, 459, 462, 463, 464, 465, 466, 467, 468, 469, 470, 473, 474, 475, 478, 479, 480, 481 , 482, 483, 484, 485, 487, 488, 489, 490, 492, 496, 497, 500, 501, 504, 505, 508, 510, 512, 513, 514, 515, 516, 517, 520, 521 , 524, 525, 526, 527, 528, 529, 530, 531 , 539, 543, 544, 545, 546, 547, 548, 551 , 552, 553, 554, 555, 556, 557, 558, 559, 560, 561 , 566, 567, 569, 571 , 572, 573, 574, 575, 576, 577, 578, 579, 580, 588, 589, 590, 595, 596, 597, 598, 599, 600, 601 , 602, 605, 606, 608, 609, 610, 61 1 , 612, 613, 614, 615, 616, 617, 618, 619, 623, 624, 625, 626, 627, 628, 631 , 632, 634, 636, 637, 638, 639, 640, 641 , 642, 643, 644, 645, 646, 647, 648, 649, 650, 652, 653, 654, 657, 658, 659, 660, 661 , 662, 663, 665, 666, 667, 669, 671 , 672, 673, 674, 675, 676, 677, 678, 679, 680, 682, 684, 686, 687, 688, 689, 690, 691 , 692, 693, 694, 695, 696, 698, 699, 700, 701 , 702, 703, 704, 705, 706, 707, 708, 709, 710, 71 1 , 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 , 722, 723, 724, 725, 726, 727, 728, 729, 730, 731 , 733, 734, 735, 736, 737, 738, 740, 741 , 742, 745, 754, 755, 756, 757, 768, 777, 778, 779, 780, 781 , 782, 784, 790, 791 , 792, 793, 794, 795, 796, 797, 798, 799, 800, 801 , 802, 803, 804, 805, 806, 807, 808, 809, 810, 81 1 , 812, 814, 815, 817, 818, 819, 820, 821 , 822, 823, 824, 825, 826, 827, 828, 833, 834, 842, 843, 844, 849, 852, 854, 860, 892, 893, 894, 895, 896, 897, 898, 899, 900, 1288, 1289, 1290, 1291 , 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301 , 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 131 1 , 1312, 1313, 1314, 1315, 1316, 1317, 1320, 1322, 1323, 1324, 1325, 1326, 1327, 1329, 1330, 1331 , 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1340, 1341 , 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, and 1350, 1367, 1368, 1369, 1370, 1372, and 1376.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 80% inhibition of a HBV mRNA, ISIS IDs: 510100, 509931 , 510116,

505317, 505319, 505323, 505326, 505327, 505330, 505339, 505346, 505347, 505358, 509934, 146786,

524414, 524415, 524416, 524418, 524419, 524425, 524426, 524431 , 524432, 524434, 524446, 524447,

524452, 524459, 524460, 524466, 524469, 524475, 524477, 524478, 524479, 524482, 524485, 524490,

524491 , 524492, 524493, 524494, 524495, 524499, 524502, 524503, 524507, 524510, 524511 , 524512,

524520, 524525, 524528, 524532, 524533, 524534, 524535, 524536, 524540, 524541, 524547, 524552,

524553, 524556, 524561, 524564, 524565, 524568, 524570, 524571 , 524572, 524573, 524578, 524580,

524586, 524590, 524591, 524594, 524595, 524602, 524604, 524606, 524607, 524610, 524611, 524614,

524616, 524617, 524618, 524619, 524620, 524621, 524633, 524634, 524635, 524636, 524637, 524641 ,

524643, 524644, 524646, 524649, 524650, 524651 , 524657, 524662, 524664, 524667, 524670, 524678,

524679, 524680, 524686, 524688, 524690, 524691 , 524692, 524695, 524698, 524699, 524701 , 524702,

524704, 524705, 524706, 524707, 524708, 524709, 524713, 524715, 524716, 524717, 524718, 524721 ,

524726, 524727, 524728, 524729, 524730, 524731 , 524733, 524734, 524735, 524737, 524739, 524741 ,

524742, 524743, 524747, 524748, 524749, 524751 , 524752, 524754, 524758, 524760, 524762, 524763,

524764, 524767, 524768, 524769, 524771, 524773, 524777, 524778, 524779, 524780, 524781 , 524783,

524784, 524788, 524789, 524791 , 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524801,

524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 524811 , 524813, 524816, 524819,

524822, 524823, 524824, 524827, 524828, 524829, 524833, 524842, 524844, 524880, 524881 , 524882,

524884, 524886, 524887, 524888, 524889, 524890, 524891 , 524893, 524907, 524908, 524980, 524986,

524987, 551921 , 551924, 551925, 551953, 551956, 551957, 551984, 551986, 551987, 551989, 551990,

551993, 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552005, 552006, 552018, 552019,

552020, 552021 , 552022, 552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030, 552031 ,

552032, 552033, 552034, 552039, 552044, 552046, 552050, 552051 , 552052, 552053, 552054, 552055,

552056, 552057, 552058, 552059, 552060, 552061 , 552062, 552063, 552064, 552065, 552073, 552077,

552078, 552079, 552080, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090,

552091 , 552092, 552093, 552094, 552095, 552096, 552097, 552098, 552138, 552139, 552145, 552146,

552147, 552149, 552192, 552193, 552199, 552200, 552201 , 552207, 552246, 552247, 552253, 552301 ,

552307, 552308, 552310, 552317, 52347, 552348, 552354, 552355, 552360, 552361 , 552362, 552363, 552364, 552365, 552366, 552367, 552371 , 552375, 552464, 552465, 552521 , 552808, 552816, 552817, 552818, 552819, 552820, 552822, 552824, 552834, 552844, 552849, 552850, 552851 , 552852, 552853, 552854, 552916, 552922, 552923, 552925, 552930, 552931 , 552932, 552933, 552936, 552937, 552938, 552939, 552942, 552943, 552944, 552980, 552988, 552989, 552996, 552998, 553002, 553003, 566828, 566829, 566830, 566831 , 566832, 577120, 577121 , 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577130, 577131 , 577132, 577133, 577134, 577135, 577136, and 582666.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 80% inhibition of a HBV mRNA, SEQ ID NOs: 17, 20, 22, 24, 26, 28, 39, 40, 50, 51 , 83, 89, 103, 123, 126, 127, 136, 137, 143, 147, 149, 168, 176, 177, 178, 179, 187, 188, 210, 21 1 , 212, 224, 225, 226, 227, 232, 325, 326, 327, 329, 330, 336, 337, 342, 343, 345, 357, 358, 363, 370, 371, 376, 379, 387, 388, 389, 392, 395, 400, 401 , 402, 403, 404, 405, 409, 412, 413, 417, 420 421, 422, 430, 435, 438, 442, 443, 444, 445, 446, 450, 451 , 457, 462, 463, 466, 474, 475, 478, 480, 481 , 482, 483, 488, 490, 496, 500, 501 , 504, 505, 512, 514, 516, 517, 520, 521, 524, 526, 527, 528, 529, 530, 531 , 543, 544, 545, 546, 547, 551 , 553, 554, 555, 559, 560, 561, 567, 572, 574, 577, 580, 588, 589, 590, 596, 598, 600, 601, 602, 605, 608, 609, 61 1 , 612, 614, 615, 616, 617, 618, 619, 623, 625, 626, 627, 628, 631 , 636, 637, 638, 639, 640, 641 , 643, 644, 645, 646, 648, 650, 652, 653, 654, 658, 659, 660, 662, 663, 665, 669, 671 , 673, 674, 675, 678, 679, 680, 682, 684, 688, 689, 690, 691 , 692, 694, 695, 699, 700, 702, 703, 704, 705, 706, 707, 708, 709, 712, 714, 715, 716, 717, 718, 719, 720, 721 , 722, 723, 725, 728, 731, 734, 735, 736, 740, 741 , 745, 756, 791 , 792, 793, 795, 797, 798, 799, 800, 801 , 802, 804, 805, 806, 807, 819, 820, 892, 898, 899, 1292, 1293, 1295, 1296, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1310, 1312, 1316, 1322, 1324, 1325, 1326, 1327, 1330, 1331 , 1332, 1333, 1334, 1335, 1338, 1339, 1340, 1341, 1344, 1345, 1349, 1350, 1368, 1372, and 1376.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 90% inhibition of a HBV mRNA, ISIS IDs: 524414, 524415, 524432, 524460, 524466, 524469, 524475, 524477, 524493, 524512, 524535, 524540, 524552, 524561 , 524572, 524617, 524619, 524634, 524641 , 524644, 524657, 524667, 524691 , 524698, 524699, 524701 , 524706, 524707, 524709, 524713, 524715, 524716, 524718, 524721 , 524726, 524729, 524730, 524731 , 524733, 524734, 524735, 524739, 524743, 524754, 524763, 524764, 524767, 524771 , 524780, 524781 , 524784, 524788, 524789, 524791 , 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524801 , 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 52481 1 , 524822, 524827, 524842, 551986, 551987, 551989, 552005, 552018, 552019, 552020, 552021 , 552022, 552023, 552025, 552046, 552050, 552051 , 552052, 552053, 552054, 552055, 552057, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552092, 552093, 552096, 552097, 552307, 552317, 552355, 552361 , 552362, 552363, 552817, 552851 , 552922, 552923, 566828, 566829, 566830, 566831 , 566832, 577120, 577121 , 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577130, 577131 , 577132, 577134, 577135, 577136, and 582666.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 90% inhibition of a HBV mRNA, SEQ ID NOs: 17, 24, 50, 51 , 137, 143, 147, 176, 21 1 , 212, 224, 226, 227, 325, 326, 343, 371 , 376, 379, 403, 422, 445, 450, 462, 482, 527, 529, 544, 551, 554, 567, 577, 601 , 608, 609, 61 1 , 616, 617, 619, 623, 625, 626, 628, 631 , 636, 639, 640, 641 , 643, 644, 645, 646, 650, 654, 665, 674, 675, 678, 682, 691 , 692, 695, 699, 700, 702, 703, 704, 705, 706, 707, 708, 709, 712, 714, 715, 716, 717, 718, 719, 720, 721 , 722, 723, 735, 801 , 804, 805, 807, 1296, 1302, 1303, 1304, 1312, 1325, 1326, 1332, 1334, 1340, 1345, 1349, and 1376.

HBV nucleic acid and effect at least a 95% inhibition of a HBV mRNA, ISIS IDs: 524619, 524634, 524641 , 505339, 524698, 524709, 524718, 524731 , 524734, 524789, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524801 , 524803, 524804, 524805, 524806, 505346, 146785, 524807, 505347, 524808, 524809, 524810, 52481 1 , 146786, 525101 , 525102, 525103, 525107, 525108, 525109, 5251 10, 525111, 525112, 525113, 525114, 5251 15, 5251 16, 5251 17, 525118, 5251 19, 525120, 552018, 552050, 552019, 552051 , 552020, 552052, 551987, 552021 , 552053, 552005, 552022, 552054, 551989, 552023, 552055, 552084, 552085, 552086, 552087, 552088, 552361 , 552317, 566831 , 577123, 577124, 566830, 566828, 566829, 577127, 577135, 577132, 577136, 566832, and 577122.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a HBV nucleic acid and effect at least a 95% inhibition of a HBV mRNA, SEQ ID NOs: 17, 50, 137, 143, 187, 210, 212, 224, 529, 544, 551 , 608, 619, 628, 641 , 645, 700, 702, 703, 704, 705, 706, 707, 708, 709, 712, 715, 716, 717, 718, 719, 720, 721 , 722,723, 1014, 1015, 1016, 1020, 1021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031 , 1032, 1033, 1236, 1302, 1312, 1334, 1340, 1345, 1349.

Certain embodiments provide methods of treating HBV related disease, disorder, or condition in an animal, comprising administering to an animal in need thereof a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5-310, 321 -802, 804-1272, 1288-1350 , 1364-1372, 1375, 1376, and 1379. Certain embodiments provide methods of treating HBV related disease, disorder, or condition in an animal, comprising administering to an animal in need thereof a compound or composition described herein.

In certain embodiments, the compound or composition comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17, 51 , 86, 93, 95, 98, 100, 102, 104, 106, 109, 1 12, 1 15, 1 17, 137, 140, 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 167, 168, 176, 177- 179, 181 , 188, 190- 192, 194, 199, 201 , 208, 209, 21 1 , 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271 , 1318-1347, 1364- 1372, 1375, 1376, and 1379, wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar and/or constrained ethyl (cEt) sugar. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, or 4 sugar modified nucleosides.

Certain embodiments provide a method of reducing HBV expression in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5-310, 321 -802, 804-1272, 1288-1350 , 1364-1372, 1375, 1376, and 1379. Certain embodiments provide a method of reducing HBV expression in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ED NOs: 17, 51 , 86, 93, 95, 98, 100, 102, 104, 106, 109, 1 12, 1 15, 1 17, 137, 140, 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 167, 168, 176, 177- 179, 181 , 188, 190- 192, 194, 199, 201 , 208, 209, 21 1 , 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271 , 1318- 1347, 1364- 1372, 1375, andl 376, wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar and/or constrained ethyl (cEt) sugar. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5 ' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides.

Certain embodiments provide a method of preventing, ameliorating or treating an HBV-related disease, disorder or condition in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17, 51 ,

86, 93, 95, 98, 100, 102, 104, 106, 109, 1 12, 1 15, 1 17, 137, 140, 143, 145, 147, 149, 151 , 153, 155, 157, 159,

161 , 167, 168, 176, 177- 179, 181 , 188, 190- 192, 194, 199, 201 , 208, 209, 21 1 , 226, 230-237, 244, 245, 247,

252, 254, 256, 258, 260, 262, 264, 266, 271 , 1318- 1347, 1364- 1372, 1375, and l 376, wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar and/or constrained ethyl (cEt) sugar. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides.

Certain embodiments provide methods of treating HBV related disease, disorder, or condition in an animal, comprising administering to an animal in need thereof a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321-406, 413-455, 461-802, or 804-1272.

Certain embodiments provide methods of treating HBV related disease, disorder, or condition in an animal, comprising administering to an animal in need thereof a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ED NOs: 6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538 wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'- O-methoxyethyl sugar.

In certain embodiments, the modified oligonucleotide is 14 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -3 or 2 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1-5, 2-4 or 3 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, 2-4 or 3-4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, 5, or 6 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 18 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, 3-5, or 4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, or 5 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, 5, 6, 7, or 8 sugar modified nucleosides. Certain embodiments provide a method of reducing HBV expression in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5-310, 321 -802, 804-1272, or 1288-1350. Certain embodiments provide a method of reducing HBV expression in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321 -406, 413- 455, 461 -802, or 804-1272.

Certain embodiments provide a method of reducing HBV expression in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538 wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0- methoxyethyl sugar.

In certain embodiments, the modified oligonucleotide is 14 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -3 or 2 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5 ' end and 3' end of the gap each independently having 1 -5, 2-4 or 3 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 2, 3, 4, 5, or 6 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 1 -5, 2-4 or 3-4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 18 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 1 -5, 3-5, or 4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 2, 3, 4, 5, 6, 7, or 8 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, or 5 sugar modified nucleosides.

Certain embodiments provide a method of preventing, ameliorating or treating an HBV-related disease, disorder or condition in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ED NOs: 5-310, 321 -802, 804-1272, or 1288-1350, wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5-310, 321 -802, or 804-1272. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321 -406, 413-455, 461 -802, or 804-1272. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538 wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar. In certain embodiments, the modified oligonucleotide is 14 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5 ' end and 3' end of the gap each independently having 1 -3 or 2 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5 ' end and 3' end of the gap each independently having 2, 3, 4, or 5 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, 2-4 or 3 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 9 or 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 2, 3, 4, 5, or 6 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 1 -5, 2-4 or 3-4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 18 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3 ' end of the gap each independently having 1 -5, 3-5, or 4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 2, 3, 4, 5, 6, 7, or 8 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, or 5 sugar modified nucleosides.

Examples of HBV-related diseases, disorders or conditions include, but are not limited to chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, and conditions having symptoms which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen.

Certain embodiments provide a method of reducing HBV mRNA expression in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, reduction of HBV mRNA expression in an animal prevents, ameliorates or treats an HBV-related disease, disorder or condition. In certain embodiments, reduction of HBV mRNA expression in an animal prevents, ameliorates or treats liver disease. In certain embodiments, the HBV mRNA expression is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. Certain embodiments provide a method of reducing HBV protein levels in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, reduction of HBV protein levels in an animal prevents, ameliorates or treats an HBV-related disease, disorder or condition. In certain embodiments, reduction of HBV protein levels in an animal prevents, ameliorates or treats liver disease. In certain embodiments, the HBV protein level is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

Certain embodiments provide a method of reducing HBV DNA levels in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, reduction of HBV DNA levels in an animal prevents, ameliorates or treats an HBV-related disease, disorder or condition. In certain embodiments, the mammal may be human, and the hepatitis B virus may be a human hepatitis B virus. More particularly, the human hepatitis B virus may be any of the human geographical genotypes: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America), in certain embodiments, reduction of HBV DNA levels in an animal prevents, ameliorates or treats liver disease. In certain embodiments, the HBV DNA level is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

Certain embodiments provide a method of reducing HBV antigen levels in an animal comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, the antigen is HBsAG or HBeAG. In certain embodiments, reduction of HBV antigen levels in an animal prevents, ameliorates or treats an HBV-related disease, disorder or condition. In certain embodiments, reduction of HBV antigen levels in an animal prevents, ameliorates or treats liver disease. In certain embodiments, the HBV antigen levels are reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

Certain embodiments provide a method of reducing HBV DNA and HBV antigen in a animal infected with a hepatitis B virus, comprising administering to the animal a compound or composition described herein. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, the antigen is

HBsAG or HBeAG. In certain embodiments, the amount of HBV antigen may be sufficiently reduced to result in seroconversion, defined as serum HBeAg absence plus serum HBeAb presence if monitoring HBeAg as the determinant for seroconversion, or defined as serum HBsAg absence if monitoring HBsAg as the determinant for seroconversion, as determined by currently available detection limits of commercial ELISA systems.

Certain embodiments provide a method for treating an animal with a HBV related disease, disorder or condition comprising: a) identifying said animal with the HBV related disease, disorder or condition, and b) administering to said animal a therapeutically effective amount of a compound or composition comprising a modified oligonucleotide consisting of 14 to 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363, as measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound or composition administered to the animal treats or reduces the HBV related disease, disorder or condition, or a symptom thereof, in the animal. In certain embodiments, the HBV related disease, disorder or condition is a liver disease. In certain embodiments, the related disease, disorder or condition is chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related to transplantation.

Certain embodiments provide a method for treating an animal with a HBV related disease, disorder or condition comprising: a) identifying said animal with the HBV related disease, disorder or condition, and b) administering to said animal a therapeutically effective amount of a compound or composition comprising a modified oligonucleotide consisting of 14 to 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to SEQ ID NO: 1 , as measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound or composition administered to the animal treats or reduces the HBV related disease, disorder or condition, or a symptom thereof, in the animal. In certain embodiments, the HBV related disease, disorder or condition is a liver disease. In certain embodiments, the related disease, disorder or condition is chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related to transplantation.

In certain embodiments, HBV has the sequence as set forth in GenBank Accession Numbers U95551.1 (incorporated herein as SEQ ID NO: 1) or any variant or fragment thereof. In certain embodiments, HBV has truncated portions of the human sequence as set forth in SEQ ID NOs: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363.

In certain embodiments, the animal is a human. In certain embodiments, the compounds or compositions are designated as a first agent. In certain embodiments, the methods comprise administering a first agent and one or more second agents. In certain embodiments, the methods comprise administering a first agent and one or more second agents. In certain embodiments, the first agent and one or more second agents are co-administered. In certain embodiments the first agent and one or more second agents are co-administered sequentially or concomitantly.

In certain embodiments, the one or more second agents are also a compound or composition described herein. In certain embodiments, the one or more second agents are different from a compound or composition described herein. Examples of one or more second agents include, but are not limited to, an antiinflammatory agent, chemotherapeutic agent or anti-infection agent. In other related embodiments, the additional therapeutic agent may be an HBV agent, an HCV agent, a chemotherapeutic agent, an antibiotic, an analgesic, a non-steroidal anti-inflammatory (NSAID) agent, an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant agent.

In certain embodiments, the one or more second agents are an HBV agent. In certain embodiments the HBV agent can include, but is not limited to, interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal). In certain embodiments, the one or more second agents are an HCV agent. In certain embodiments the HBV agent can include, but is not limited to interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; or an HCV monoclonal or polyclonal antibody therapy. In certain embodiments, the one or more second agents are an anti-inflammatory agent (i.e., an inflammation lowering therapy). In certain embodiments the inflammation lowering therapy can include, but is not limited to, a therapeutic lifestyle change, a steroid, a NSAID or a DMARD. The steroid can be a corticosteroid. The NSAID can be an aspirin, acetaminophen, ibuprofen, naproxen, COX inhibitors, indomethacin and the like. The DMARD can be a TNF inhibitor, purine synthesis inhibitor, calcineurin inhibitor, pyrimidine synthesis inhibitor, a sulfasalazine, methotrexate and the like. In certain embodiments, the one or more second agents are a chemotherapeutic agent (i.e., a cancer treating agent). Chemotherapeutic agents can include, but are not limited to, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5- fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide, trimetrexate, teniposide, cisplatin, gemcitabine and diethylstilbestrol (DES).

In certain embodiments, the one or more second agents are an anti-infection agent. Examples of anti- infection agents include, but are not limited to, antibiotics, antifungal drugs and antiviral drugs.

In certain embodiments, administration comprises parenteral administration.

Certain embodiment provides a method for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment. In some embodiments, the mammal may be human, and the hepatitis B virus may be a human hepatitis B virus. More particularly, the human hepatitis B virus may be any of the human geographical genotypes: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America).

In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 70% compared to the amount before administration of the modified antisense oligonucleotide. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 75% compared to the amount before administration of the modified antisense oligonucleotide. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 80% compared to the amount before administration of the modified antisense oligonucleotide. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 85% compared to the amount before administration of the modified antisense oligonucleotide. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 90% compared to the amount before administration of the modified antisense oligonucleotide. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 95% compared to the amount before administration of the modified antisense oligonucleotide. In related methods, the HBV antigen may be HBsAg or may be HBeAg, and more particularly, the amount of HBV antigen may be sufficiently reduced to result in seroconversion, defined as serum HBeAg absence plus serum HBeAb presence if monitoring HBeAg as the determinant for seroconversion, or defined as serum HBsAg absence if monitoring HBsAg as the determinant for seroconversion, as determined by currently available detection limits of commercial ELISA systems. Certain embodiment provides a method for promoting seroconversion of a hepatitis B virus in a mammal infected with HBV, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal infected with hepatitis B; monitoring for presence of HBeAg plus HBeAb in a serum sample of the mammal, or monitoring for presence of HBsAg in a serum sample of the mammal, such that the absence of HBeAg plus the presence of HBeAb in the serum sample if monitoring HBeAg as the determinant for seroconversion, or the absence of HBsAg in the serum sample if monitoring HBsAg as the determinant for seroconversion, as determined by current detection limits of commercial ELISA systems, is indication of seroconversion in the mammal.

Certain embodiments provide the use of a compound or composition as described herein for preventing, ameliorating or treating liver disease, or symptom thereof, in an animal. In certain embodiments, the compound or composition comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ DD NOs: 17, 51, 86, 93, 95, 98, 100, 102, 104, 106, 109, 1 12, 1 15, 1 17, 137, 140, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 167, 168, 176, 177- 179, 181 , 188, 190- 192, 194, 199, 201 , 208, 209, 211 , 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271 , 1318-1347, 1364- 1372, 1375, 1376, and 1379.

In certain embodiments, the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC₅₀ of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 49 nM, less than 47 nM, less than 46 nM, when delivered to HepG2.2.1 cells. In certain embodiments inhibition is measured with primer probe set RTS3370, as described herein.

In certain embodiments, the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC₅o of less than 250 nM, less than 200 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 60 nM, less than 50 nM, less than 40 nM, less than 35 nM, less than 34 nM, less than 33 nM, less than 32 nM, less than 31 nM, when delivered to HepG2.2.1 cells. In certain embodiments inhibition is measured with primer probe set RTS3371 , as described herein.

In certain embodiments, the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC₅₀ of less than 20 μΜ, less than 10 μΜ, less than 9.5 μΜ, less than 9.0 μΜ, less than 8.5 μΜ, less than 8.0 μΜ, less than 7.5 μΜ, less than 7.0 μΜ, less than 6.5 μΜ, less than 6.0 μΜ, less than 5.5 μΜ, less than 5.0 μΜ, less than 4.5 μΜ, less than 4.0 μΜ, less than 3.5 μΜ, less than 3.0 μΜ, less than 2.5 μΜ, when delivered to HepG2.2.1 cells as described herein.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%), 10%, 5%, or 2%. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over saline treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over saline treated animals. In certain embodiments, these compounds or compositions include ISIS 146779, ISIS 146786, ISIS 505317, ISIS 505329, ISIS 505332, ISIS 505346, ISIS 505347, ISIS 505358, ISIS 509926, ISIS 509927, ISIS 509932, ISIS 509934, ISIS 509960, ISIS 509974, ISIS 510038, ISIS 510039, ISIS 510040, ISIS 510041 , ISIS 510050ISIS 509975, ISIS 510100, ISIS 510106, and ISIS 510116. In certain embodiments, such compounds or compositions include compounds comprising the nucleobase sequence of any one of SEQ ID NOs: 5-310, 321 -802, or 804-1272. In certain embodiments, such compounds or compositions include compounds comprising the nucleobase sequence of any one of SEQ ID NOs: 5, 15, 16, 33, 39-95, 123-135, 163-175, 180- 310, 321 -406, 413-455, 461-802, or 804-1272. In certain embodiments, such compounds or compositions include compounds comprising the nucleobase sequence of any one of SEQ ID NOs: 6-14, 17-32, 34-38, 96- 122, 136-162, 176-179, 407-412, 456-462, 523-538 (update SEQ ID NOs) wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar.Jn certain embodiments, the modified oligonucleotide is 14 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -3 or 2 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 16 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1-5, 2-4 or 3 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 17 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1-5, 2-4 or 3-4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 18 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, 3-5, or 4 sugar modified nucleosides. In certain embodiments, the modified oligonucleotide is 20 nucleosides in length and has a gap segment of 10 linked nucleosides. In certain embodiments, the modified oligonucleotide has a wing segment on the 5' end and 3' end of the gap each independently having 1 -5, or 5 sugar modified nucleosides.

Certain embodiments provide the use of a compound or composition as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing an HBV-related disease, disorder or condition in an animal. Certain embodiments provide the use of a compound or composition as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing liver disease in an animal.

Certain embodiments provide a kit for treating, preventing, or ameliorating an HBV -related disease, disorder or condition, or a symptom thereof, as described herein wherein the kit comprises: a) a compound or compositions as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate the HBV-related disease, disorder or condition.

Antisense compounds Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 10-30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 12 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 12 to 22 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 14 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 14 to 20 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 15 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 15 to 20 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 16 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 16 to 20 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 17 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 17 to 20 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 18 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 1 8 to 21 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 18 to 20 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 20 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subumts, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 14 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 16 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 17 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 18 subunits in length. In certain embodiments, an antisense compound targeted to a HBV nucleic acid is 20 subunits in length. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the antisense compounds are 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.

In certain embodiments antisense oligonucleotides targeted to a HBV nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a HBV nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end. When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al.

(Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al. (J. Natl. Cancer Inst. 93:463-471 , March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense Compound Motifs

In certain embodiments, antisense compounds targeted to a HBV nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'- modified nucleosides (such 2'-modified nucleosides may include 2'-MOE and 2'-0-CH₃, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl). In certain embodiments, nucleosides in the wings may include several modified sugar moieties, including, for example 2'-MOE and bicyclic sugar moieties such as constrained ethyl or LNA. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides.

Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5'- wing, "Y" represents the length of the gap, and "Z" represents the length of the 3 '-wing. "X" and "Z" may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, "X" and "Y" may include one or more 2'-deoxynucleosides."Y" may comprise 2'-deoxynucleosides. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap is positioned immediately adjacent to each of the 5 '-wing and the 3 ' wing. Thus, no intervening nucleotides exist between the 5 '-wing and gap, or the gap and the 3'-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, "X" and "Z" are the same; in other embodiments they are different. In certain embodiments, "Y" is between 8 and 15 nucleosides. X, Y, or Z can be any of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.

In certain embodiments, gapmers provided herein include, for example, 1 1 -mers having a motif of

1 -9-1.

In certain embodiments, gapmers provided herein include, for example, 12-mers having a motif of 1 -9-2, 2-9-1 , or 1 -10-1.

In certain embodiments, gapmers provided herein include, for example, 13-mers having a motif of 1 -9-3, 2-9-2, 3-9-1 , 1 -10-2, or 2-10-1.

In certain embodiments, gapmers provided herein include, for example, 14-mers having a motif of 1 -9-4, 2-9-3, 3-9-2, 4-9-1 , 1 -10-3, 2-10-2, or 3-10-1. In certain embodiments, gapmers provided herein include, for example, 15-mers having a motif of

1 -9-5, 2-9-4, 3-9-3, 4-9-2, 5-9-1 , 1 -10-4, 2-10-3, 3-10-2, or 4-10-1. In certain embodiments, gapmers provided herein include, for example, 16-mers having a motif of 4-8-4, 2-9-5, 3-9-4, 4-9-3, 5-9-2, 1 -10-5, 2-10-4, 3-10-3, 4-10-2, 3-8-5, or 5-10-1.

In certain embodiments, gapmers provided herein include, for example, 17-mers having a motif of

3- 9-5, 3-10-4, 4-9-4, 5-9-3, 2-10-5, 3-10-4, 4-10-3, 5-10-2, 2-9-6, 5-8-4, 5-7-5, 6-7-4, or 6-9-2. In certain embodiments, gapmers provided herein include, for example, 18-mers having a motif of

4- 9-5, 5-9-4, 3-10-5, 4-10-4, or 5-10-3.

In certain embodiments, gapmers provided herein include, for example, 19-mers having a motif of

5- 9-5, 4-10-5, or 5-10-4.

In certain embodiments, gapmers provided herein include, for example, 20-mers having a motif of 5-10-5, 2-10-8, 8-10-2, 3-10-7, 7-10-3, 4-10-6, or 6-10-4.

In certain embodiments, the antisense compound has a "wingmer" motif, having a wing-gap or gap- wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations provided herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1 -10, 8-2, 2-13, 5-13, 5-8, or 6-8. In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 2-10-2 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 3-10-3 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 4-10-4 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 5-10-5 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 3-10-4 gapmer motif. In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 2-10-4 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 2-10-8 gapmer motif. In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 8-10-2 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 3-10-7 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 7-10-3 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 4-10-6 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 6-10-4 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 2-9-6 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 6-9-2 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 4-9-4 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 5-9-3 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 3-9-5 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 5-9-2 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 2-9-5 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 4-9-3 gapmer motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a 3-9-4 gapmer motif. In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a gap-widened motif.

In certain embodiments, the antisense compound targeted to a HBV nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or 16 linked nucleosides.

In certain embodiments, the antisense compounds targeted to a HBV nucleic acid has any of the following sugar motifs: k-d(10)-k e-d(10)-k k-d(10)-e k-k-d(10)-k-k k-k-d(10)-e-e e-e-d(10)-k-k k-k-k-d(10)-k-k-k e-e-e-d(10)-k-k-k k-k-k-d(10)-e-e-e k-k-k-d(10)-k-k-k e-k-k-d(10)-k-k-e e-e-k-d(10)-k-k-e e-d-k-d(10)-k-k-e e-k-d(10)-k-e-k-e k-d(10)-k-e-k-e-e e-e-k-d(10)-k-e-k-e e-d-d-k-d(9)-k-k-e e-e-e-e-d(9)-k-k-e e-e-e-e-e-d(l 0)-e-e-e-e-e k-d-k-d-k-d(9)-e-e e-e-k-k-d(9)-e-k-e-e k-d-k-d-k-d( 10)-e-e-e-e-e k-e-k-d(10)-k-e-k e-e-e-k-k-d(8)-e-e-e-e e-e-e-k-k-d(7) -k-k-e-e-e e-e-e-k-d(9)-k-e-e-e e-e-e-k-k-d(7)-k-k-e-e-e e-e-e-e-k-k-d(7)-e-e-e-e e-k-e-k-d(9)-e-e-e-e e-k-e-k-d-k-d(7)-e-e-e-e e-e-e-k-k-d(7)-k-k-e-e-e k-d-k-d-k-d(8)-e-e-e-e-e wherein, k is a constrained ethyl nucleoside, e is a 2'-MOE substituted nucleoside, and d is a 2'- deoxynucleoside.

In certain embodiments, the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J)_m-(B)_n-(J)p-(B)_r-(A)_r(D)_g-(A)_v-(B)_w-(J)x-(B)_y-(J)z wherein: each A is independently a 2' -substituted nucleoside; each B is independently a bicyclic nucleoside; each J is independently either a 2'-substituted nucleoside or a 2'-deoxynucleoside; each D is a 2'-deoxynucleoside; m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that: at least one of m, n, and r is other than 0; at least one of w and y is other than 0; the sum of m, n, p, r, and t is from 2 to 5; and the sum of v, w, x, y, and z is from 2 to 5.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode HBV include, without limitation, the following: GENBANK Accession U95551.1 (incorporated herein as SEQ ID NO: 1). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif. In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3 ' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for HBV can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.

Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in HBV mRNA levels are indicative of inhibition of HBV expression. Reductions in levels of a HBV protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes are indicative of inhibition of HBV expression. In certain embodiments, reduced fatigue, reduced flu-like symptoms, increase in appetite, reduced nausea, reduced joint pain, reduced jaundice, reduced pain in the abdomen, reduced weakness, reduced weight loss, reduction in breast enlargement in men, reduced rash on the palms, reduced difficulty with blood clotting, reduced cirrhosis, reduced spider-like blood vessels on the skin, increased Vitamins A and D absorption, reduced tumor growth, reduced tumor volume, reduced headache, reduced fever, reduced diarrhea, reduced pain over the liver area of the body, reduced clay- or grey-colored stool, reduced itching, reduced dark-colored urine, and reduced nausea and vomiting can be indicative of inhibition of HBV expression, In certain embodiments, amelioration of symptoms associated with HBV- related conditions, disease, and disorders can be indicative of inhibition of HBV expression. In certain embodiments, reduction of cirrhosis is indicative of inhibition of HBV expression. In certain embodiments, reduction of liver cancer markers can be indicative of inhibition of HBV expression. Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a HBV nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a HBV nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a HBV nucleic acid).

Non-complementary nucleobases between an antisense compound and a HBV nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a HBV nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a HBV nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et ai, J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981 , 2, 482 489). In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a HBV nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a HBV nucleic acid, or specified portion thereof. In certain embodiments, antisense compounds that are, or are up to 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a HBV nucleic acid, or specified portion thereof. The antisense compounds provided also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i:e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least an 1 1 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared. In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a HBV nucleic acid comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.

Modified Sugar Moieties

Antisense compounds provided herein can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, without limitation, addition of substitutent groups (including 5' and 2' substituent groups); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA); replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R)2 (R = H,

alkyl or a protecting group); and combinations thereof. Examples of chemically modified sugars include, 2'-F-5'-methyl substituted nucleoside (see, PCT International Application WO 2008/101 157, published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides), replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see, published U.S. Patent Application US2005/0130923, published on June 16, 2005), or, alternatively, 5'-substitution of a BNA (see, PCT International Application WO 2007/134181 , published on 1 1/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

Examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH₃, and 2'-0(CH₂)20CH₃ substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, OCFj, 0(CH₂)2SCH₃, 0(CH₂)2-0-N(Rm)(Rn), and 0-CH₂-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C]-C;₀ alkyl. As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4' to 2' bicyclic nucleoside. Examples of such 4' to 2' bicyclic nucleosides, include, but are not limited to, one of the formulae: 4'-(CH₂)- 0-2' (LNA); 4'-(CH₂)-S-2'; 4'-(CH₂)₂-0-2' (ENA); 4'-CH(CH₃)-0-2' (cEt) and 4'-CH(CH₂OCH₃)-0-2', and analogs thereof (see, U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH₃)(CH₃)-0-2', and analogs thereof (see, published PCT International Application WO2009/006478, published January 8, 2009); 4'-CH₂- N(OCH₃)-2', and analogs thereof (see, published PCT International Application WO2008/150729, published December 1 1 , 2008); 4'-CH₂-0-N(CH₃)-2' (see, published U.S. Patent Application US2004/0171570, published September 2, 2004); 4'-CH₂-N(R)-0-2', wherein R is H, C_rC₎₂ alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH₂-C(H)(CH₃)-2' (see, Chattopadhyaya, et al, J. Org. Chem.,2009, 74, 118-134); and 4'-CH₂-C(=CH₂)-2', and analogs thereof (see, published PCT International Application WO 2008/154401, published on December 8, 2008). Also see, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al, Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al, Curr. Opinion Invens. Drags, 2001 , 2, 558-561 ; Braasch et al, Chem. Biol, 2001 , 8, 1-7; Orum et al, Curr. Opinion Mol. Ther., 2001 , 3, 239-243; U.S. Patent Nos U.S. 6,670,461 , 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191 , 7,399,845; published PCT International applications WO 2004/106356, WO 94/14226, WO 2005/021570, and WO 2007/134181 ; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; and U.S. Patent Serial Nos. 12/129, 154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Application Nos. PCT/US2008/064591 , PCT/US2008/066154, and PCT US2008/068922. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from - [C(R_a)(R_b)]_n-, -C(R_a)=C(R_b)-, -C(R_a)=N-, -C(=NR_a)-, -C(=0)-, -C(=S)-, -0-, -Si(R_a)₂-, -S(=0)_x-, and -N(R_a)-; wherein:

x is 0, 1 , or 2;

n is 1 , 2, 3, or 4; each R_a and R_b is, independently, H, a protecting group, hydroxyl, C Ci₂ alkyl, substituted C_rC|₂ alkyl, C₂-C|₂ alkenyl, substituted C₂-Ci₂ alkenyl, C₂-C₎₂ alkynyl, substituted C₂-Q₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ|, NJ 2, SJj , N₃, COOJ,, acyl (C(=0)- H), substituted acyl, CN, sulfonyl (S(=0)₂-J,), or sulfoxyl (S(=0)-J,); and

each Ji and J₂ is, independently, H, C Ci₂ alkyl, substituted Ci-Ci₂ alkyl, C₂-Ci₂ alkenyl, substituted C₂-C|₂ alkenyl, C₂-C|₂ alkynyl, substituted C₂-Ci₂ alkynyl, C₅-C₂o aryl, substituted C₅-C₂o aryl, acyl (C(=0)- H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C]-Ci₂ aminoalkyl, substituted C]-Ci₂ aminoalkyl, or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is, -[C(R_a)(R_b)]n-, -[C(R_a)(R_b)]n-0-,

-C(R_aR_b)-N(R)-0- or, -C(R_aR_b)-0-N(R)-. In certain embodiments, the bridge is 4'-CH₂-2', 4'-(CH₂)₂-2', 4'- (CH₂)₃-2', 4'-CH₂-0-2', 4'-(CH₂)₂-0-2', 4'-CH₂-0-N(R)-2', and 4'-CH₂-N(R)-0-2'-, wherein each R is, independently, H, a protecting group, or

alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4 '-2' methyl ene-oxy bridge, may be in the a-L configuration or in the β- D configuration. Previously, a-L-methyleneoxy (4'-CH₂-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et ai, Nucleic Acids Research, 2003, 21, 6365- 6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L-Methyleneoxy (4'-CH₂-0-2') BNA , (B) β-D-Methyleneoxy (4'-CH₂-0-2') BNA , (C) Ethyleneoxy (4'-(CH₂)₂-0-2') BNA , (D) Aminooxy (4'-CH₂-0-N(R)-2') BNA, (E) Oxyamino (4'-CH₂-N(R)-0-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH₃)-0-2') BNA, (G) methylene-thio (4'-CH₂-S-2') BNA, (H) methylene- amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH₂-CH(CH₃)-2') BNA, and (J) propylene carbocyclic (4'-(CH₂)₃-2') BNA as depicted below.

wherein:

Bx is a heterocyclic base moiety;

-Qa-Qb-Qc- is -CHz-NCR^-CH,-, -C(=0)-N(R_c)-CH , -CH₂-0-N(R_c)-, -CH₂-N(R_c)-0-, or -N(R_<;)-0-

CH₂; R_c is C₁-C₁₂ alkyl or an amino protecting group; and

T_a and T_b are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleoside having Formula II:

wherein:

Bx is a heterocyclic base moiety;

T_a and T_b are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

Z_a is C]-C₆ alkyl, C₂-C₆ alkenyl, C₂-C₆ alkynyl, substituted C C6 alkyl, substituted C₂-C₆ alkenyl, substituted C₂-C₆ alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ_c, NJ_cJ_d, SJ_C, N₃, OC(=X)J_c, and NJ_eC(=X)NJ_cJ_d, wherein each J_c, J_d, and J_e is, independently, H, Ci-C₆ alkyl, or substituted Ci-C₆ alkyl and X is O or NJ_C.

In certain embodiments, bicyclic nucleoside having Formula III:

wherein:

Bx is a heterocyclic base moiety;

Z_b is C| -C₆ alkyl, C -C₆ alkenyl, C₂-C₆ alkynyl, substituted C_rC₆ alkyl, substituted C₂-C₆ alkenyl, substituted C2-C6 alkynyl, or substituted acyl (C(=0)-).

In certai eoside having Formula IV:

wherein:

Bx is a heterocyclic base moiety;

T_a and T_b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

¾ is C_rC₆ alkyl, substituted C C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, or substituted C₂-C6 alkynyl;

each q_a, q_b, q_c and q_d is, independently, H, halogen, C C6 alkyl, substituted Q-C6 alkyl, C₂-C6 alkenyl, substituted C₂-C₆ alkenyl, C₂-C6 alkynyl, or substituted C₂-C₆ alkynyl, Ci-C₆ alkoxyl, substituted C Ce alkoxyl, acyl, substituted acyl, Q-Ce aminoalkyl, or substituted C C6 aminoalkyl;

In certain embodiments, bicyclic nucleoside having Formula V:

wherein:

Bx is a heterocyclic base moiety;

T_a and T_b are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; q_a, q_bi q_e and q_f are each, independently, hydrogen, halogen, C_rCi2 alkyl, substituted Q-Ci₂ alkyl, C₂- C12 alkenyl, substituted C₂-C_]2 alkenyl, C₂-Ci₂ alkynyl, substituted C₂-Ci2 alkynyl, C1-C12 alkoxy, substituted C,-C,2 alkoxy, OJ_j, SJ_j, SOJ_j; S0₂J_j, NJ_jJ_k, N₃, CN, C(=0)OJ_j, C(=0)NJ_jJ_k, C(=0)J_j, 0-C(=0)NJ_jJ_k, N(H)C(=NH)NJ_jJ_k, N(H)C(=0)NJ_jJ_k or N(H)C(=S)NJ_jJ_k;

or q_e and q_f together are =C(q_g)(q ); q_g and q are each, independently, H, halogen, C_rC₁₂ alkyl, or substituted Ci-C]₂ alkyl.

The synthesis and preparation of the methyleneoxy (4'-CH₂-0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along with their oligomerization, and nucleic acid recognition properties have been described {see, e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

Analogs of methyleneoxy (4'-CH₂-0-2') BNA, methyleneoxy (4'-CH₂-0-2') BNA, and 2'-thio- BNAs, have also been prepared {see, e.g., Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described {see, e.g., Wengel et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog, has been described in the art {see, e.g., Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'- amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleoside having Formula VI:

wherein:

Bx is a heterocyclic base moiety;

each q_i; q_j, q_k and qi is, independently, H, halogen, Ci-C₁₂ alkyl, substituted Q-Cn alkyl, C₂-Ci₂ alkenyl, substituted C₂-Ci₂ alkenyl, C₂-Ci₂ alkynyl, substituted C₂-Ci₂ alkynyl, C_rCi₂ alkoxyl, substituted C_r C, 2 alkoxyl, OJ_j; SJ_j, SOJ_j, S0₂J_j, NJ_jJ_k, N₃, CN, C(=0)OJ_j, C(=0)NJ_jJ_k, C(=0)J_j, 0-C(=0)NJ_jJ_k, N(H)C(=NH)NJ_jJ_k, N(H)C(=0)NJ_jJ_k, orN(H)C(=S)NJ_jJ_k; and

qi and q_j or qi and q_k together are =C(q_g)(q_h), wherein q_g and q_h are each, independently, H, halogen, C|-C|₂ alkyl, or substituted C_rC_l2 alkyl.

One carbocyclic bicyclic nucleoside having a 4'-(CH₂)r2' bridge and the alkenyl analog, bridge 4'- CH=CH-CH₂-2', have been described {see, e.g., Freier et al., Nucleic Acids Research, 1997, 25{22), 4429- 4443 and Albaek et al, J. Org. Chem., 2006, 71, 7731 -7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described {see, e.g., Srivastava et a!., J. Am. Chem. Soc. 2007, 129(26), 8362-8379). As used herein, "bicyclic nucleoside" refers to a nucleoside comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic sugar moiety. In certain embodiments, the bridge connects the 2' carbon and another carbon of the sugar ring.

As used herein, "4 '-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting the 2' carbon atom and the 4' carbon atom.

As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted fhioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH₂)„0]_mCH₃, 0(CH₂)_nNH₂, 0(CH₂)„CH₃, 0(CH₂)_nONH₂, OCH₂C(=0)N(H)CH₃, and 0(CH₂)_nON[(CH₂)_nCH₃]₂, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: C_rCi₂ alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; aralkyl; O-alkaryl or O-aralkyl; SH; SCH₃; OCN; CI; Br; CN; CF₃; OCF₃; SOCH₃; S0₂CH₃; ON0₂; N0₂; N₃; NH₂; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving pharmacokinetic properties; and a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'-MOE side chain {see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O- methyl, 0-propyl, and (9-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use {see, e.g., Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) {see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841 -854), fiuoro HNA (F-HNA), or those compounds having Fonnula X: Formula

X

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula X:

Bx is a heterocyclic base moiety;

T₃ and T₄ are each, independently, an intemucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T₃ and T₄ is an intemucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T₃ and T₄ is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;

¾i_> ¾2> ¾, φ_> <is, ¾6 and q₇ are each, independently, H, C C₆ alkyl, substituted C C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C(, alkynyl, or substituted C2-C6 alkynyl; and

one of Ri and R₂ is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ,J₂, SJ,, N₃, OC(=X)J,, OC(=X)NJ,J₂, NJ₃C(=X)NJ,J₂, and CN, wherein X is O, S, or NJ,, and each J] , J₂, and J₃ is, independently, H or Ci-C₆ alkyl.

In certain embodiments, the modified THP nucleosides of Formula X are provided wherein q_m, q_n, q_p, q_r, q_s, q_l; and q_u are each H. In certain embodiments, at least one of q_m, q,„ q_P, q_r, q_s, ¾t, and q_u is other than H. In certain embodiments, at least one of q_m, q_n, q_p, q_r, q_s, q_t and q_u is methyl. In certain embodiments, THP nucleosides of Formula X are provided wherein one of Ri and R₂ is F. In certain embodiments, Ri is fluoro and R₂ is H, R] is methoxy and R₂ is H, and Ri is methoxyethoxy and R₂ is H.

As used herein, "2'-modified nucleoside" or "2 '-substituted nucleoside" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position of a furanose ring other than H or OH. 2'- modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring and nucleosides with non-bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-Ci-C]₀ alkyl, -OCF₃, 0-(CH₂)₂- 0-CH₃, 2'-0(CH₂)₂SCH₃, 0-(CH₂)₂-0-N(R_m)(R_n), or 0-CH₂-C(=0)-N(R_m)(R_n), where each R_m and R_n is, independently, H or substituted or unsubstituted C_rC|₀ alkyl. 2'-modifed nucleosides may further comprise other modifications, for example, at other positions of the sugar and/or at the nucleobase.

As used herein, "2'-F" refers to a sugar comprising a fluoro group at the 2' position.

As used herein, "2'-OMe" or "2'-OCH₃" or "2'-0-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH₃ group at the 2' position of the sugar ring. As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds {see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841 -854). Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art.

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a cEt. In certain embodiments, the cEt modified nucleotides are arranged throughout the wings of a gapmer motif.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions arc dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

An antisense compound targeted to a HBV nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a HBV nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense compounds

Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'- cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.

Cell culture and antisense compounds treatment

The effects of antisense compounds on the level, activity or expression of HBV nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors {e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HuVEC cells, b.END cells, HepG2 cells, Hep3B cells, and primary hepatocytes.

In vitro testing of antisense oligonucleotides Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTrN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

Cells are treated with antisense oligonucleotides by routine methods. Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments. The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation. RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.

Analysis of inhibition of target levels or expression

Inhibition of levels or expression of a HBV nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence. Probes and primers are designed to hybridize to a HBV nucleic acid. Methods for designing realtime PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

Quantitative Real-Time PCR Analysis of Target DNA Levels

Quantitation of target DNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Gene (or DNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total DNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total DNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of DNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

Probes and primers are designed to hybridize to a HBV nucleic acid. Methods for designing realtime PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

Analysis of Protein Levels

Antisense inhibition of HBV nucleic acids can be assessed by measuring HBV protein levels. Protein levels of HBV can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. In vivo testing of antisense compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of HBV and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, subcutaneous, intrathecal, and intracerebroventricular. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue and changes in HBV nucleic acid expression are measured. Changes in HBV DNA levels are also measured. Changes in HBV protein levels are also measured. Changes in HBV HBeAg levels are also measured. Changes in HBV HBsAg levels are also measured.

Certain Indications In certain embodiments, provided herein are methods, compounds, and compositions of treating an individual comprising administering one or more pharmaceutical compositions provided herein. In certain embodiments, the individual has an HBV-related condition. In certain embodiments, chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, and HBV viremia. In certain embodiments, the HBV-related condition may have which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, jaundice, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen. In certain embodiments, the individual is at risk for an HBV-related condition. This includes individuals having one or more risk factors for developing an HBV-related condition, including sexual exposure to an individual infected with Hepatitis B virus, living in the same house as an individual with a lifelong hepatitis B virus infection, exposure to human blood infected with the hepatitis B virus, injection of illicit drugs, being a person who has hemophilia, and visiting an area where hepatitis B is common. In certain embodiments, the individual has been identified as in need of treatment for an HBV-related condition. In certain embodiments provided herein are methods for prophylactically reducing HBV expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to an HBV nucleic acid. Due to overlapping transmission routes, many people have been exposed to both hepatitis B virus (HBV) and hepatitis C virus (HCV), and a smaller proportion are chronically infected with both viruses, especially in regions such as Asia where HBV is endemic. Estimates suggest that up to 10% of people with HCV may also have HBV, while perhaps 20% of people with HBV are co-infected with HCV. However, treatment of hepatitis B or hepatitis B in HBV-HCV co-infected individuals has not been well studied. Treatment is complicated by the fact that HCV and HBV appear to inhibit each other's replication (though not all studied have observed this interaction). Therefore, treatment that fully suppresses HBV could potentially allow HCV to re-emerge, or vice versa. Therefore, the compounds and compositions described herein may advantageously be used for treating patients infected with both HBV and HCV. Exemplary treatment options for hepatitis C (HCV) include interferons, e.g., interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1. Less frequent interferon dosing can be achieved using pegylated interferon (interferon attached to a polyethylene glycol moiety which improves its pharmacokinetic profile). Combination therapy with interferon alpha-2b (pegylated and unpegylated) and ribavirin has also been shown to be efficacious for some patient populations. Other agents currently being developed include HCV RNA replication inhibitors (e.g., ViroPharma's VP50406 series), HCV antisense agents, HCV therapeutic vaccines, HCV protease inhibitors, HCV helicase inhibitors and HCV antibody therapy (monoclonal or polyclonal).

In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing an HBV-related condition associated with the presence of the hepatitis B virus. In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing an HBV-related condition.

In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV mRNA levels in the serum of an individual to determine an individual's response to administration of the antisense compound. In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV DNA levels in the serum of an individual to determine an individual's response to administration of the antisense compound. In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV protein levels in the serum of an individual to determine an individual's response to administration of the antisense compound. In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV S antigen (HBsAg) levels in the serum of an individual to determine an individual's response to administration of the antisense compound. In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV E antigen (HBeAg) levels in the serum of an individual to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.

In certain embodiments, administration of an antisense compound targeted to an HBV nucleic acid results in reduction of HBV expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to an HBV nucleic acid results in reduced symptoms associated with the HBV- related condition and reduced HBV -related markers in the blood. In certain embodiments, administration of an HBV antisense compound decreases HBV RNA levels, HBV DNA levels, HBV protein levels, HBsAg levels, or HBeAg levels by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to HBV are used for the preparation of a medicament for treating a patient suffering or susceptible to an HBV- related condition.

Certain Combination Therapies

In certain embodiments, one or more pharmaceutical compositions provided herein are coadministered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions provided herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions provided herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions provided herein. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to produce a synergistic effect.

In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are prepared separately. In certain embodiments the antisense oligonucleotides disclosed is administered in combination with an HCV agent. In further embodiments, the HCV compound is administered simultaneously as the antisense compound; in other embodiments, the HCV compound is administered separately; so that a dose of each of the HCV agent and the antisense compound overlap, in time, within the patient's body. In related embodiments, the HCV agent may be selected from interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; and an HCV antibody therapy (monoclonal or polyclonal).

In other embodiments, an HBV antisense compound of the present invention may be administered to a patient infected with HBV, in combination with one or more HBV therapeutic agents, wherein the one or more HBV therapeutic agents may be administered in the same drug formulation as the HBV ASO compound, or may be administered in a separate formulation. The one or more HBV therapeutic agents may be administered simultaneously with the ASO HBV compound, or may be administered separately, so that a dose of each of the HBV ASO compound and the HBV therapeutic agent overlap, in time, within the patient's body. In related embodiments, the one or more HBV therapeutic agent may be selected from interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second HBV antisense compound; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir; tenofovir; telbivudine (LdT); adefovir; and an HBV antibody therapy (monoclonal or polyclonal).

EXAMPLES Non-limiting disclosure and incorporation by reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1 : Antisense inhibition of HBV viral mRNA in HepG2.2.15 cells by MOE gapmers

Antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. Cultured HepG2.2.15 cells at a density of 25,000 cells per well were transfected using electroporation with 15,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 2; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 3; probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID NO: 4) was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Table 1 were designed as either 5-10-5 MOE gapmers or 3-10-4 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleosides each. The 3-10-4 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising three and 4 nucleosides respectively. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has an MOE sugar modification. Each nucleoside in the central gap segment has a deoxy sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

"Viral Target start site" indicates the 5'-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. The 'Motif column indicates the gap and wing structure of each gapmer. Each gapmer listed in Table 1 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1).

Table 1

Inhibition of viral HBV mRNA levels by MOE gapmers targeted to SEQ ID NO: 1

Viral Viral

% SEQ ID Start Stop ISIS No Sequence Motif

inhibition NO Site Site

245 261 510088 CCACGAGTCTAGACTCT 3-10-4 55 5

250 266 510089 GTCCACCACGAGTCTAG 3-10-4 59 6

251 267 510090 AGTCCACCACGAGTCTA 3-10-4 60 7

252 268 510091 AAGTCCACCACGAGTCT 3-10-4 47 8

253 269 510092 GAAGTCCACCACGAGTC 3-10-4 59 9

254 270 510093 AGAAGTCCACCACGAGT 3-10-4 32 10

255 271 510094 GAGAAGTCCACCACGAG 3-10-4 41 1 1

256 272 510095 AGAGAAGTCCACCACGA 3-10-4 44 12

257 273 510096 GAGAGAAGTCCACCACG 3-10-4 54 13 258 274 510097 TGAGAGAAGTCCACCAC 3-10-4 57 14

384 400 510098 TGATAAAACGCCGCAGA 3-10-4 55 15

385 401 510099 ATGATAAAACGCCGCAG 3-10-4 59 16

411 427 510100 GGCATAGCAGCAGGATG 3-10-4 85 17

412 428 510101 AGGCATAGCAGCAGGAT 3-10-4 51 18

413 429 510102 GAGGCATAGCAGCAGGA 3-10-4 69 19

414 433 505330 AGATGAGGCATAGCAGCAGG 5-10-5 74 20

414 430 510103 TGAGGCATAGCAGCAGG 3-10-4 12 21

415 434 509928 AAGATGAGGCATAGCAGCAG 5-10-5 71 22

415 431 510104 ATGAGGCATAGCAGCAG 3-10-4 69 23

416 435 509929 GAAGATGAGGCATAGCAGCA 5-10-5 78 24

416 432 510105 GATGAGGCATAGCAGCA 3-10-4 69 25

417 436 509930 AGAAGATGAGGCATAGCAGC 5-10-5 72 26

417 433 510106 AGATGAGGCATAGCAGC 3-10-4 77 27

418 437 146783 AAGAAGATGAGGCATAGCAG 5-10-5 15 28

418 434 510107 AAGATGAGGCATAGCAG 3-10-4 69 29

419 435 510108 GAAGATGAGGCATAGCA 3-10-4 59 30

420 436 510109 AGAAGATGAGGCATAGC 3-10-4 0 31

421 437 510110 AAGAAGATGAGGCATAG 3-10-4 38 32

457 473 5101 11 ACGGGCAACATACCTTG 3-10-4 62 33

639 658 146784 CTGAGGCCCACTCCCATAGG 5-10-5 5 34

639 655 5101 12 AGGCCCACTCCCATAGG 3-10-4 44 35

640 656 510113 GAGGCCCACTCCCATAG 3-10-4 27 36

641 657 510114 TGAGGCCCACTCCCATA 3-10-4 44 37

642 658 510115 CTGAGGCCCACTCCCAT 3-10-4 52 38

687 706 509931 CGAACCACTGAACAAATGGC 5-10-5 89 39

687 703 510116 ACCACTGAACAAATGGC 3-10-4 89 40

688 704 5101 17 AACCACTGAACAAATGG 3-10-4 69 41

689 705 510118 GAACCACTGAACAAATG 3-10-4 63 42

690 706 510119 CGAACCACTGAACAAAT 3-10-4 74 43

738 754 510120 ACCACATCATCCATATA 3-10-4 71 44

1176 1192 510121 TCAGCAAACACTTGGCA 3-10-4 73 45

1778 1797 509932 AATTTATGCCTACAGCCTCC 5-10-5 76 46

1778 1794 510122 TTATGCCTACAGCCTCC 3-10-4 76 47

1779 1798 509933 CAATTTATGCCTACAGCCTC 5-10-5 72 48

1779 1795 510123 TTTATGCCTACAGCCTC 3-10-4 75 49

1780 1799 509934 CCAATTTATGCCTACAGCCT 5-10-5 75 50

1780 1796 510124 ATTTATGCCTACAGCCT 3-10-4 73 51

1781 1800 509935 ACCAATTTATGCCTACAGCC 5-10-5 72 52

1781 1797 510125 AATTTATGCCTACAGCC 3-10-4 69 53

1782 1798 510126 CAATTTATGCCTACAGC 3-10-4 59 54

1783 1799 510127 CCAATTTATGCCTACAG 3-10-4 58 55

1784 1800 510128 ACCAATTTATGCCTACA 3-10-4 60 56 1822 1838 510129 AGGCAGAGGTGAAAAAG 3-10-4 47 57

1823 1839 510130 TAGGCAGAGGTGAAAAA 3-10-4 30 58

1865 1884 509936 GCACAGCTTGGAGGCTTGAA 5-10-5 39 59

1865 1881 510131 CAGCTTGGAGGCTTGAA 3-10-4 4 60

1866 1885 509937 GGCACAGCTTGGAGGCTTGA 5-10-5 35 61

1866 1882 510132 ACAGCTTGGAGGCTTGA 3-10-4 0 62

1867 1886 505370 AGGCACAGCTTGGAGGCTTG 5-10-5 36 63

1867 1883 510133 CACAGCTTGGAGGCTTG 3-10-4 12 64

1868 1887 509938 AAGGCACAGCTTGGAGGCTT 5-10-5 7 65

1868 1884 510134 GCACAGCTTGGAGGCTT 3-10-4 20 66

1869 1888 509939 CAAGGCACAGCTTGGAGGCT 5-10-5 36 67

1869 1885 510135 GGCACAGCTTGGAGGCT 3-10-4 22 68

1870 1889 505371 CCAAGGCACAGCTTGGAGGC 5-10-5 35 69

1870 1886 510136 AGGCACAGCTTGGAGGC 3-10-4 14 70

1871 1887 510137 AAGGCACAGCTTGGAGG 3-10-4 0 71

1872 1888 510138 CAAGGCACAGCTTGGAG 3-10-4 6 72

1873 1889 510139 CCAAGGCACAGCTTGGA 3-10-4 17 73

1918 1934 510140 GCTCCAAATTCTTTATA 3-10-4 59 74

2378 2397 509940 TCTGCGAGGCGAGGGAGTTC 3-10-4 10 75

2378 2394 510141 GCGAGGCGAGGGAGTTC 3-10-4 5 76

2379 2395 510142 TGCGAGGCGAGGGAGTT 3-10-4 0 77

2380 2396 510143 CTGCGAGGCGAGGGAGT 3-10-4 8 78

2381 2397 510144 TCTGCGAGGCGAGGGAG 3-10-4 17 79

2820 2836 510145 TTCCCAAGAATATGGTG 3-10-4 22 80

2821 2837 510146 GTTCCCAAGAATATGGT 3-10-4 1 1 81

2822 2838 510147 TGTTCCCAAGAATATGG 3-10-4 21 82

Example 2: Antisense inhibition of HBV viral mRNA in HepG2.2.15 cells by MOE gapmers

Additional antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. Cultured HepG2.2.15 cells at a density of 25,000 cells per well were transfected using electroporation with 15,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels.

RTS3370 detects the full length mRNA and the second portions of the pre-Sl , pre-S2 and pre-C mRNA transcripts. The gapmers were also probed with additional primer probe sets. Viral primer probe set RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 31 1 ; reverse sequence

TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 312; probe sequence

CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO: 313) was used also to measure mRNA levels. RTS3371 detects the full length mRNA and the second portions of the pre-Sl , pre-S2 and pre-

C mRNA transcripts, similar to RTS3370, but at different regions. Viral primer probe set RTS3372 (forward sequence ATCCTATCAACACTTCCGGAAACT, designated herein as SEQ ID NO: 314; reverse sequence CGACGCGGCGATTGAG, designated herein as SEQ ID NO: 315; probe sequence

AAGAACTCCCTCGCCTCGCAGACG, designated herein as SEQ Π) NO: 316) was used to measure mRNA levels. RTS3372 detects the full length genomic sequence. Viral primer probe set RTS3373MGB (forward sequence CCGACCTTGAGGCATACTTCA, designated herein as SEQ ID NO: 317; reverse sequence AATTTATGCCTACAGCCTCCTAGTACA, designated herein as SEQ ID NO: 318; probe sequence TTAAAGACTGGGAGGAGTTG, designated herein as SEQ ID NO: 319) was used to measure mRNA levels. RTS3373MGB detects the full length mRNA and the second portions of the pre-Sl, pre-S2, pre-C, and pre-X mRNA transcripts.

HBV mRNA levels were adjusted according to total RNA content, as measured by RDBOGREEN®.

Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Table 2 were designed as either 5-10-5 MOE gapmers, 3-10-3 MOE gapmers, or 2-10-2 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleosides each. The 3-10-3 MOE gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising three nucleosides each. The 2- 10-2 MOE gapmers are 14 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising two nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has an MOE sugar modification. Each nucleoside in the central gap segment has a deoxy sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5'-methylcytosines.

"Start site" indicates the 5 '-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. The 'Motif column indicates the gap and wing structure of each gapmer. Each gapmer listed in Table 2 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1). Table 2

Inhibition of viral HBV mRNA levels by MOE gapmers targeted to SEQ ID NO: 1 (detected by RTS3370,

RTS3371, RTS3372, and RTS3373MGB)

GTCCACCA

251 266 509945 34 35 64 51 3-10-3 100

CGAGTCTA

GAGAAGTC

252 271 509923 CACCACGA 39 38 39 33 5-10-5 101

GTCT

AGTCCACC

252 267 509946 47 51 50 45 3-10-3 102

ACGAGTCT

AGAGAAGT

253 272 505319 CCACCACG 88 83 80 78 5-10-5 103

AGTC

AAGTCCAC

253 268 509947 46 50 56 46 3-10-3 104

CACGAGTC

GAGAGAAG

254 273 509924 TCCACCAC 43 40 49 44 5-10-5 105

GAGT

GAAGTCCA

254 269 509948 41 46 51 44 3-10-3 106

CCACGAGT

AGTCCACC

254 267 510023 41 32 47 48 2-10-2 107

ACGAGT

TGAGAGAA

255 274 509925 GTCCACCA 50 57 55 55 5-10-5 108

CGAG

AGAAGTCC

255 270 509949 40 41 52 34 3-10-3 109

ACCACGAG

AAGTCCAC

255 268 510024 26 29 19 23 2-10-2 110

CACGAG

TTGAGAGA

256 275 505320 AGTCCACC 51 57 55 66 5-10-5 1 1 1

ACGA

GAGAAGTC

256 271 509950 30 31 43 33 3-10-3 1 12

CACCACGA

GAAGTCCA

256 269 510025 44 38 53 54 2-10-2 113

CCACGA

AGAAGTCC

257 270 510026 39 42 32 25 2-10-2 1 14

ACCACG

GAGAGAAG

258 273 509952 54 52 60 48 3-10-3 1 15

TCCACCAC

GAGAAGTC

258 271 510027 29 30 25 19 2-10-2 1 16

CACCAC

TGAGAGAA

259 274 509953 39 44 47 38 3-10-3 117

GTCCACCA

AGAGAAGT

259 272 510028 31 29 3 15 2-10-2 1 18

CCACCA

GAGAGAAG

260 273 510029 21 19 23 18 2-10-2 1 19

TCCACC

TGAGAGAA

261 274 510030 16 22 21 20 2-10-2 120

GTCCAC

AGAAAATT

262 281 505321 GAGAGAAG 53 58 52 56 5-10-5 121

TCCA CCTAGAAA

265 284 505322 ATTGAGAG 62 65 69 67 5-10-5 122

AAGT

ATTTTGGCC

293 312 505323 AAGACACA 86 84 81 85 5-10-5 123

CGG

CGAATTTTG

296 315 505324 GCCAAGAC 67 67 69 64 5-10-5 124

ACA

GGACTGCG

302 321 505325 AATTTTGGC 77 75 73 76 5-10-5 125

CAA

TCCAGCGA

360 379 505326 TAACCAGG 89 90 77 91 5-10-5 126

ACAA

GACACATC

366 385 505327 CAGCGATA 83 85 75 86 5-10-5 127

ACCA

GCAGACAC

369 388 505328 ATCCAGCG 65 68 49 57 5-10-5 128

ATAA

GATAAAAC

384 399 509954 37 46 53 35 3-10-3 129

GCCGCAGA

TAAAACGC

384 397 510031 36 36 33 33 2-10-2 130

CGCAGA

ATAAAACG

385 398 510032 12 7 19 15 2-10-2 131

CCGCAG

ATGATAAA

386 401 509955 49 55 57 53 3-10-3 132

ACGCCGCA

GATAAAAC

386 399 510033 39 39 45 37 2-10-2 133

GCCGCA

TGATAAAA

387 400 510034 40 37 29 39 2-10-2 134

CGCCGC

ATGATAAA

388 401 510035 22 24 9 22 2-10-2 135

ACGCCG

TGAGGCAT

41 1 430 505329 AGCAGCAG 60 64 47 55 5-10-5 136

GATG

GCATAGCA

41 1 426 509956 62 64 71 60 3-10-3 137

GCAGGATG

ATAGCAGC

41 1 424 510036 44 34 30 48 2-10-2 138

AGGATG

ATGAGGCA

412 431 509926 TAGCAGCA 45 54 71 62 5-10-5 139

GGAT

GGCATAGC

412 427 509957 72 75 80 71 3-10-3 140

AGCAGGAT

CATAGCAG

412 425 510037 29 24 24 20 2-10-2 141

CAGGAT

GATGAGGC

413 432 509927 ATAGCAGC 54 58 54 49 5-10-5 142

AGGA AGGCATAG

413 428 509958 63 66 68 64 3-10-3 143

CAGCAGGA

GCATAGCA

413 426 510038 55 54 37 46 2-10-2 144

GCAGGA

AGATGAGG

414 433 505330 CATAGCAG 85 87 74 82 5-10-5 20

CAGG

GAGGCATA

414 429 509959 64 64 80 68 3-10-3 145

GCAGCAGG

GGCATAGC

414 427 510039 58 54 41 45 2-10-2 146

AGCAGG

TGAGGCAT

415 430 509960 59 59 66 64 3-10-3 147

AGCAGCAG

AGGCATAG

415 428 510040 58 55 38 41 2-10-2 148

CAGCAG

ATGAGGCA

416 431 509961 56 54 65 56 3-10-3 149

TAGCAGCA

GAGGCATA

416 429 510041 64 62 64 57 2-10-2 150

GCAGCA

GATGAGGC

417 432 509962 57 52 58 49 3-10-3 151

ATAGCAGC

TGAGGCAT

417 430 510042 48 50 55 48 2-10-2 152

AGCAGC

AGATGAGG

418 433 509963 50 52 64 51 3-10-3 153

CATAGCAG

ATGAGGCA

418 431 510043 36 31 36 26 2-10-2 154

TAGCAG

AAGATGAG

419 434 509964 48 47 72 65 3-10-3 155

GCATAGCA

GATGAGGC

419 432 510044 44 28 0 14 2-10-2 156

ATAGCA

GAAGATGA

420 435 509965 45 41 65 62 3-10-3 157

GGCATAGC

AGATGAGG

420 433 510045 41 43 37 29 2-10-2 158

CATAGC

AGAAGATG

421 436 509966 32 29 64 51 3-10-3 159

AGGCATAG

AAGATGAG

421 434 510046 21 18 26 27 2-10-2 160

GCATAG

AAGAAGAT

422 437 509967 21 17 55 46 3-10-3 161

GAGGCATA

GAAGATGA

422 435 510047 25 24 23 25 2-10-2 162

GGCATA

AGAAGATG

423 436 510048 21 17 25 19 2-10-2 163

AGGCAT

AAGAAGAT

424 437 510049 17 1 1 38 27 2-10-2 164

GAGGCA

ACGGGCAA

454 473 505331 CATACCTTG 55 57 65 60 5-10-5 165

ATA CAAACGGG

457 476 505332 CAACATAC 73 77 77 74 5-10-5 166

CTTG

CGGGCAAC

457 472 509968 60 61 73 70 3-10-3 167

ATACCTTG

ACGGGCAA

458 473 509969 58 63 64 58 3-10-3 168

CATACCTT

GGGCAACA

458 471 510050 58 56 57 46 2-10-2 169

TACCTT

CGGGCAAC

459 472 510051 49 43 47 37 2-10-2 170

ATACCT

ACGGGCAA

460 473 510052 50 50 54 51 2-10-2 171

CATACC

AGAGGACA

463 482 505333 AACGGGCA 64 68 64 71 5-10-5 172

ACAT

ATTAGAGG

466 485 505334 ACAAACGG 59 62 42 69 5-10-5 173

GCAA

CCTGGAATT

472 491 505335 AGAGGACA 78 81 73 86 5-10-5 174

AAC

GATCCTGG

475 494 505336 AATTAGAG 56 65 61 72 5-10-5 175

GACA

GGCCCACT

639 654 509970 38 55 74 48 3-10-3 176

CCCATAGG

GAGGCCCA

641 656 509971 30 46 77 54 3-10-3 177

CTCCCATA

TGAGGCCC

642 657 509972 58 57 84 66 3-10-3 178

ACTCCCAT

CTGAGGCC

643 658 509973 38 53 70 66 3-10-3 179

CACTCCCA

GGCACTAG

670 689 146823 TAAACTGA 61 64 63 63 5-10-5 180

GCCA

CTAGTAAA

670 685 509974 71 71 78 80 3-10-3 181

CTGAGCCA

AGTAAACT

670 683 510053 49 48 52 53 2-10-2 182

GAGCCA

TAGTAAAC

671 684 510054 41 38 19 30 2-10-2 183

TGAGCC

CTAGTAAA

672 685 510055 25 27 42 47 2-10-2 184

CTGAGC

AATGGCAC

673 692 505337 TAGTAAAC 34 46 49 52 5-10-5 185

TGAG

TGAACAAA

679 698 505338 TGGCACTA 74 77 71 80 5-10-5 186

GTAA CACTGAAC

682 701 505339 AAATGGCA 82 83 71 82 5-10-5 187

CTAG

CCACTGAA

687 702 509975 72 73 76 80 3-10-3 188

CAAATGGC

ACGAACCA

688 707 505340 CTGAACAA 69 69 78 76 5-10-5 189

ATGG

ACCACTGA

688 703 509976 47 48 67 65 3-10-3 190

ACAAATGG

AACCACTG

689 704 509977 33 33 39 41 3-10-3 191

AACAAATG

GAACCACT

690 705 509978 50 49 63 48 3-10-3 192

GAACAAAT

CCTACGAA

691 710 505341 CCACTGAA 64 70 70 72 5-10-5 193

CAAA

CGAACCAC

691 706 509979 67 66 78 77 3-10-3 194

TGAACAAA

AACCACTG

691 704 510056 36 36 23 32 2-10-2 195

AACAAA

GAACCACT

692 705 510057 45 44 51 43 2-10-2 196

GAACAA

CGAACCAC

693 706 510058 59 52 48 49 2-10-2 197

TGAACA

GAAAGCCC

697 716 505342 TACGAACC 76 80 73 83 5-10-5 198

ACTG

CCACATCAT

738 753 509980 40 33 62 54 3-10-3 199

CCATATA

ACATCATCC

738 751 510059 19 9 30 27 2-10-2 200

ATATA

ACCACATC

739 754 509981 76 78 93 85 3-10-3 201

ATCCATAT

CACATCATC

739 752 510060 45 35 24 17 2-10-2 202

CATAT

CCACATCAT

740 753 510061 52 49 43 40 2-10-2 203

CCATA

ACCACATC

741 754 510062 44 45 48 47 2-10-2 204

ATCCAT

TGTACAGA

756 775 505343 CTTGGCCCC 47 56 55 68 5-10-5 205

CAA

AGGGTTTA

823 842 505344 AATGTATA 66 71 64 72 5-10-5 206

CCCA

GCAAACAC

1 170 1 189 505345 TTGGCACA 76 80 35 70 5-10-5 207

GACC

CAGCAAAC

1 176 1 191 509982 42 44 56 54 3-10-3 208

ACTTGGCA TCAGCAAA

1 177 1 192 509983 60 54 74 70 3-10-3 209

CACTTGGC

CCGCAGTA

1259 1278 505346 TGGATCGG 88 82 57 80 5-10-5 210

CAGA

GCAGTATG

1261 1276 509984 61 58 65 72 3-10-3 211

GATCGGCA

GTTCCGCA

1262 1281 505347 GTATGGAT 84 81 71 83 5-10-5 212

CGGC

CTAGGAGT

1268 1287 505348 TCCGCAGT 78 68 70 79 5-10-5 213

ATGG

CGGCTAGG

1271 1290 505349 AGTTCCGC 47 54 59 61 5-10-5 214

AGTA

AACAAGCG

1277 1296 505350 GCTAGGAG 55 62 69 69 5-10-5 215

TTCC

CAAAACAA

1280 1299 505351 GCGGCTAG 20 49 49 54 5-10-5 216

GAGT

GAGCAAAA

1283 1302 505352 CAAGCGGC 53 83 73 87 5-10-5 217

TAGG

TGCGAGCA

1286 1305 505353 AAACAAGC 64 73 68 78 5-10-5 218

GGCT

ACAAAGGA

1413 1426 510063 14 8 0 0 2-10-2 219

CGTCCC

GAGGTGCG

1515 1534 505354 CCCCGTGGT 68 81 61 80 5-10-5 220

CGG

AGAGAGGT

1518 1537 505355 GCGCCCCG 59 75 75 84 5-10-5 221

TGGT

TAAAGAGA

1521 1540 505356 GGTGCGCC 63 76 83 78 5-10-5 222

CCGT

AAGGCACA

1550 1563 510064 35 38 25 32 2-10-2 223

GACGGG

GTGAAGCG

1577 1596 146786 AAGTGCAC 88 91 84 93 5-10-5 224

ACGG

GAGGTGAA

1580 1599 505357 GCGAAGTG 70 75 71 82 5-10-5 225

CACA

GCAGAGGT

1583 1602 505358 GAAGCGAA 77 82 72 84 5-10-5 226

GTGC CGTGCAGA

1586 1605 505359 GGTGAAGC 72 73 67 80 5-10-5 227

GAAG

AGTCCAAG

1655 1674 505360 AGTCCTCTT 66 68 54 68 5-10-5 228

ATG

CAGTCTTTG

1706 1719 510065 19 19 26 17 2-10-2 229

AAGTA

TATGCCTAC

1778 1793 509985 64 60 64 63 3-10-3 230

AGCCTCC

TTATGCCTA

1779 1794 509986 66 66 77 73 3-10-3 231

CAGCCTC

TTTATGCCT

1780 1795 509987 56 55 68 67 3-10-3 232

ACAGCCT

ATTTATGCC

1781 1796 509988 52 52 68 63 3-10-3 233

TACAGCC

AATTTATGC

1782 1797 509989 48 44 70 59 3-10-3 234

CTACAGC

CAATTTATG

1783 1798 509990 24 18 39 40 3-10-3 235

CCTACAG

CCAATTTAT

1784 1799 509991 37 37 55 55 3-10-3 236

GCCTACA

ACCAATTTA

1785 1800 509992 35 36 60 55 3-10-3 237

TGCCTAC

AAAGTTGC

1806 1825 505361 ATGGTGCT 42 55 75 61 5-10-5 238

GGTG

GAAAAAGT

1809 1828 505362 TGCATGGT 45 56 64 53 5-10-5 239

GCTG

GGTGAAAA

1812 1831 505363 AGTTGCAT 71 70 80 72 5-10-5 240

GGTG

AGAGGTGA

1815 1834 505364 AAAAGTTG 51 57 77 82 5-10-5 241

CATG

GGCAGAGG

1818 1837 505365 TGAAAAAG 54 63 76 78 5-10-5 242

TTGC

TTAGGCAG

1821 1840 505366 AGGTGAAA 61 65 80 66 5-10-5 243

AAGT

GGCAGAGG

1822 1837 509993 47 51 74 54 3-10-3 244

TGAAAAAG

AGGCAGAG

1823 1838 509994 47 40 76 54 3-10-3 245

GTGAAAAA

TGATTAGG

1824 1843 505367 CAGAGGTG 41 39 62 29 5-10-5 246

AAAA

TAGGCAGA

1824 1839 509995 46 42 79 59 3-10-3 247

GGTGAAAA TAGGCAGA

1826 1839 510066 40 33 44 31 2-10-2 248

GGTGAA

AGATGATT

1827 1846 505368 AGGCAGAG 27 46 62 51 5-10-5 249

GTGA

AGCTTGGA

1861 1880 146787 GGCTTGAA 59 61 65 72 5-10-5 250

CAGT

CACAGCTT

1864 1883 505369 GGAGGCTT 11 21 48 31 5-10-5 251

GAAC

AGCTTGGA

1865 1880 509996 13 1 45 40 3-10-3 252

GGCTTGAA

CTTGGAGG

1865 1878 510067 22 17 20 14 2-10-2 253

CTTGAA

CAGCTTGG

1866 1881 509997 29 19 51 45 3-10-3 254

AGGCTTGA

GCTTGGAG

1866 1879 510068 24 25 37 32 2-10-2 255

GCTTGA

AGGCACAG

1867 1886 505370 CTTGGAGG 32 36 58 33 5-10-5 63

CTTG

ACAGCTTG

1867 1882 509998 1 4 23 12 3-10-3 256

GAGGCTTG

AGCTTGGA

1867 1880 510069 23 24 17 23 2-10-2 257

GGCTTG

CACAGCTT

1868 1883 509999 5 1 48 41 3-10-3 258

GGAGGCTT

CAGCTTGG

1868 1881 510070 21 20 0 18 2-10-2 259

AGGCTT

GCACAGCT

1869 1884 510000 14 10 50 37 3-10-3 260

TGGAGGCT

ACAGCTTG

1869 1882 510071 19 22 24 27 2-10-2 261

GAGGCT

CCAAGGCA

1870 1889 505371 CAGCTTGG 27 40 68 38 5-10-5 69

AGGC

GGCACAGC

1870 1885 510001 10 12 43 16 3-10-3 262

TTGGAGGC

CACAGCTT

1870 1883 510072 28 31 33 30 2-10-2 263

GGAGGC

AGGCACAG

1871 1886 510002 24 20 46 25 3-10-3 264

CTTGGAGG

GCACAGCT

1871 1884 510073 20 18 22 15 2-10-2 265

TGGAGG

AAGGCACA

1872 1887 510003 6 0 45 24 3-10-3 266

GCTTGGAG

GGCACAGC

1872 1885 510074 18 18 32 23 2-10-2 267

TTGGAG CACCCAAG

1873 1892 505372 GCACAGCT 18 8 55 16 5-10-5 268

TGGA

CAAGGCAC

1873 1888 510004 9 0 31 15 3-10-3 269

AGCTTGGA

AGGCACAG

1873 1886 510075 23 9 27 10 2-10-2 270

CTTGGA

CCAAGGCA

1874 1889 510005 0 0 39 25 3-10-3 271

CAGCTTGG

AGCCACCC

1876 1895 505373 AAGGCACA 47 50 69 56 5-10-5 272

GCTT

CAAAGCCA

1879 1898 505374 CCCAAGGC 27 27 55 30 5-10-5 273

ACAG

CCCCAAAG

1882 1901 505375 CCACCCAA 34 40 54 39 5-10-5 274

GGCA

ATGCCCCA

1885 1904 505376 AAGCCACC 41 43 54 52 5-10-5 275

CAAG

TCCATGCCC

1888 1907 505377 CAAAGCCA 40 42 72 40 5-10-5 276

CCC

ATGTCCATG

1891 1910 505378 CCCCAAAG 35 33 70 40 5-10-5 277

CCA

CTCCAAATT

1918 1933 510006 9 2 53 41 3-10-3 278

CTTTATA

CCAAATTCT

1918 1931 510076 28 22 7 22 2-10-2 279

TTATA

GCTCCAAA

1919 1934 510007 43 39 72 57 3-10-3 280

TTCTTTAT

TCCAAATTC

1919 1932 510077 19 11 0 2 2-10-2 281

TTTAT

CTCCAAATT

1920 1933 510078 19 11 0 0 2-10-2 282

CTTTA

GCTCCAAA

1921 1934 510079 50 48 61 55 2-10-2 283

TTCTTT

GGAAAGAA

1957 1976 505379 GTCAGAAG 17 14 81 39 5-10-5 284

GCAA

GTGCGAAT

2270 2285 510008 21 4 36 1 1 3-10-3 285

CCACACTC

GCGAATCC

2270 2283 510080 32 29 41 33 2-10-2 286

ACACTC

TGCGAATC

2271 2284 510081 28 20 25 1 1 2-10-2 287

CACACT

GTGCGAAT

2272 2285 510082 28 20 32 22 2-10-2 288

CCACAC GAGGGAGT

2368 2387 505380 TCTTCTTCT 24 22 90 48 5-10-5 289

AGG

CGAGGCGA

2378 2393 510009 12 1 65 10 3-10-3 290

GGGAGTTC

AGGCGAGG

2378 2391 510083 17 18 29 25 2-10-2 291

GAGTTC

GCGAGGCG

2379 2394 510010 18 13 82 37 3-10-3 292

AGGGAGTT

GAGGCGAG

2379 2392 510084 29 22 54 30 2-10-2 293

GGAGTT

TGCGAGGC

2380 2395 51001 1 13 1 1 69 44 3-10-3 294

GAGGGAGT

CGAGGCGA

2380 2393 510085 25 20 53 42 2-10-2 295

GGGAGT

CTGCGAGG

2381 2396 510012 17 14 79 53 3-10-3 296

CGAGGGAG

GCGAGGCG

2381 2394 510086 33 29 66 48 2-10-2 297

AGGGAG

TCTGCGAG

2382 2397 510013 18 4 77 47 3-10-3 298

GCGAGGGA

CCGAGATT

2420 2439 505381 GAGATCTTC 12 18 83 28 5-10-5 299

TGC

CCCACCTTA

2459 2478 505382 TGAGTCCA 14 19 80 36 5-10-5 300

AGG

TGTTCCCAA

2819 2838 505383 GAATATGG 29 32 78 44 5-10-5 301

TGA

TCCCAAGA

2820 2835 510014 10 10 68 40 3-10-3 302

ATATGGTG

TTCCCAAG

2821 2836 510015 5 0 62 24 3-10-3 303

AATATGGT

GTTCCCAA

2822 2837 510016 6 2 42 16 3-10-3 304

GAATATGG

TGTTCCCAA

2823 2838 510017 18 18 47 18 3-10-3 305

GAATATG

TTGTTCCCA

2824 2839 510018 7 5 57 19 3-10-3 306

AGAATAT

TGTTCCCAA

2825 2838 510087 25 20 44 25 2-10-2 307

GAATA

GAAAGAAT

2873 2892 505384 CCCAGAGG 8 4 61 22 5-10-5 308

ATTG

ACTGCATG

3161 3180 146833 GCCTGAGG 47 46 82 54 5-10-5 309

ATGA

CCACTGCAT

3163 3182 505385 GGCCTGAG 25 34 69 19 5-10-5 310

GAT Example 3: Antisense inhibition of HBV viral mRNA in HepAD38 (Tet-HBV) cells by MOE gapmers

Certain antisense oligonucleotides selected from the study described in Example 2 were tested for their effects on HBV mRNA in another cell line, human hepatoma HepAD38 cells, in which HBV production is under the control of a tetracycline-regulated promoter. Cultured HepAD38 (Tet-HBV) cells at a density of 45,000 cells per well were transfected using electroporation with 15,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe sets RTS3372 and RTS3373MGB were used individually to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by REBOGREEN®. Results are presented in Table 3 as percent inhibition of HBV, relative to untreated control cells.

Table 3

Inhibition of viral HBV mRNA levels by MOE gapmersin HepAD38 (Tet-HBV) cells (detected by RTS3372 and RTS3373MGB)

261 274 510030 2-10-2 0 0 120

262 281 505321 5-10-5 53 54 121

265 284 505322 5-10-5 59 60 122

293 312 505323 5-10-5 65 77 123

296 315 505324 5-10-5 78 83 124

302 321 505325 5-10-5 71 80 125

360 379 505326 5-10-5 76 84 126

366 385 505327 5-10-5 77 83 127

369 388 505328 5-10-5 65 78 128

384 397 510031 2-10-2 0 16 130

385 398 510032 2-10-2 0 0 131

386 399 510033 2-10-2 1 21 133

387 400 510034 2-10-2 8 28 134

388 401 510035 2-10-2 0 0 135

411 430 505329 5-10-5 58 72 136

411 424 510036 2-10-2 6 11 138

412 431 509926 5-10-5 20 54 139

412 425 510037 2-10-2 0 10 141

413 432 509927 5-10-5 56 76 142

413 426 510038 2-10-2 54 68 144

414 433 505330 5-10-5 66 81 20

414 427 510039 2-10-2 60 74 146

415 428 510040 2-10-2 33 39 148

416 429 510041 2-10-2 30 58 150

417 430 510042 2-10-2 34 57 152

418 431 510043 2-10-2 0 2 154

419 432 510044 2-10-2 0 29 156

420 433 510045 2-10-2 3 31 158

421 434 510046 2-10-2 0 0 160

422 435 510047 2-10-2 0 0 162

423 436 510048 2-10-2 0 0 163

424 437 510049 2-10-2 0 0 164

454 473 505331 5-10-5 60 77 165

457 476 505332 5-10-5 55 74 166

458 471 510050 2-10-2 47 47 169

459 472 510051 2-10-2 35 55 170

460 473 510052 2-10-2 27 41 171

463 482 505333 5-10-5 66 78 172

466 485 505334 5-10-5 53 63 173

472 491 505335 . 5-10-5 70 76 174

475 494 505336 5-10-5 64 77 175

670 689 146823 5-10-5 74 79 180

670 683 510053 2-10-2 18 20 182 671 684 510054 2-10-2 13 21 183

672 685 510055 2-10-2 4 2 184

673 692 505337 5-10-5 60 72 185

679 698 505338 5-10-5 62 75 186

682 701 505339 5-10-5 81 90 187

688 707 505340 5-10-5 67 81 189

691 710 505341 5-10-5 68 80 193

691 704 510056 2-10-2 0 0 195

692 705 510057 2-10-2 37 48 196

693 706 510058 2-10-2 44 59 197

697 716 505342 5-10-5 80 87 198

738 751 510059 2-10-2 0 0 200

739 752 510060 2-10-2 0 0 202

740 753 510061 2-10-2 23 19 203

741 754 510062 2-10-2 25 30 204

756 775 505343 5-10-5 62 71 205

823 842 505344 5-10-5 52 66 206

1170 1189 505345 5-10-5 83 81 207

1259 1278 505346 5-10-5 84 81 210

1262 1281 505347 5-10-5 89 84 212

1268 1287 505348 5-10-5 78 78 213

1271 1290 505349 5-10-5 74 77 214

1277 1296 505350 5-10-5 75 77 215

1280 1299 505351 5-10-5 49 62 216

1283 1302 505352 5-10-5 70 66 217

1286 1305 505353 5-10-5 62 60 218

1413 1426 510063 2-10-2 0 0 219

1515 1534 505354 5-10-5 85 75 220

1518 1537 505355 5-10-5 81 74 221

1521 1540 505356 5-10-5 57 52 222

1550 1563 510064 2-10-2 0 0 223

1577 1596 146786 5-10-5 94 85 224

1580 1599 505357 5-10-5 86 79 225

1583 1602 505358 5-10-5 89 79 226

1586 1605 505359 5-10-5 82 68 227

1655 1674 505360 5-10-5 84 74 228

1706 1719 510065 2-10-2 0 0 229

1806 1825 505361 5-10-5 66 66 238

1809 1828 505362 5-10-5 52 59 239

1812 1831 505363 5-10-5 72 75 240

1815 1834 505364 5-10-5 73 80 241

1818 1837 505365 5-10-5 68 82 242

1821 1840 505366 5-10-5 50 76 243 1824 1843 505367 5-10-5 58 76 246

1826 1839 510066 2-10-2 0 31 248

1827 1846 505368 5-10-5 71 84 249

1861 1880 146787 5-10-5 25 35 250

1864 1883 505369 5-10-5 29 65 251

1865 1878 510067 2-10-2 0 0 253

1866 1879 510068 2-10-2 0 20 255

1867 1886 505370 5-10-5 45 70 63

1867 1880 510069 2-10-2 0 0 257

1868 1881 510070 2-10-2 0 0 259

1869 1882 510071 2-10-2 0 0 261

1870 1889 505371 5-10-5 48 66 69

1870 1883 510072 2-10-2 0 0 263

1871 1884 510073 2-10-2 0 0 265

1872 1885 510074 2-10-2 0 2 267

1873 1892 505372 5-10-5 48 67 268

1873 1886 510075 2-10-2 0 0 270

1876 1895 505373 5-10-5 23 48 272

1879 1898 505374 5-10-5 0 34 273

1882 1901 505375 5-10-5 39 66 274

1885 1904 505376 5-10-5 0 40 275

1888 1907 505377 5-10-5 4 47 276

1891 1910 505378 5-10-5 65 77 277

1918 1931 510076 2-10-2 0 0 279

1919 1932 510077 2-10-2 0 0 281

1920 1933 510078 2-10-2 0 0 282

1921 1934 510079 2-10-2 18 50 283

1957 1976 505379 5-10-5 42 84 284

2270 2283 510080 2-10-2 0 0 286

2271 2284 510081 2-10-2 0 0 287

2272 2285 510082 2-10-2 0 10 288

2368 2387 505380 5-10-5 29 79 289

2378 2391 510083 2-10-2 0 0 291

2379 2392 510084 2-10-2 31 17 293

2380 2393 510085 2-10-2 0 8 295

2381 2394 510086 2-10-2 10 2 297

2420 2439 505381 5-10-5 30 86 299

2459 2478 505382 5-10-5 16 87 300

2819 2838 505383 5-10-5 26 81 301

2825 2838 510087 2-10-2 0 0 307

2873 2892 505384 5-10-5 31 59 308

3161 3180 146833 5-10-5 55 76 309

3163 3182 505385 5-10-5 58 83 310 Example 4: Antisense inhibition of HBV viral mRNA in HepAD38 (Tet-HBV) cells by MOE gapmers

Certain antisense oligonucleotides from the study described in Examples 1 and 2 were tested for their effects on HBV mRNA in vitro. Cultured HepAD38 (Tet-HBV) cells at a density of 45,000 cells per well were transfected using electroporation with 15,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3372 was used to measure mRNA levels. The mRNA levels were also measured using the RTS3373MGB primer probe set. HBV mRNA levels were adjusted according to total RNA content, as measured by RBBOGREEN®. Results are presented in Table 4 as percent inhibition of HBV, relative to untreated control cells.

Table 4

Inhibition of viral HBV mRNA levels by MOE gapmers (RTS3372 and RTS3373MGB)

426 509956 3-10-3 67 53 137

427 510100 3-10-4 88 69 17

427 509957 3-10-3 86 76 140

428 510101 3-10-4 71 46 18

428 509958 3-10-3 78 74 143

429 510102 3-10-4 77 52 19

433 505330 5-10-5 81 60 20

429 509959 3-10-3 62 49 145

430 510103 3-10-4 9 5 21

434 509928 5-10-5 81 66 22

430 509960 3-10-3 67 57 147

431 510104 3-10-4 71 57 23

435 509929 5-10-5 82 69 24

431 509961 3-10-3 62 43 149

432 510105 3-10-4 81 64 25

436 509930 5-10-5 74 45 26

432 509962 3-10-3 59 48 151

433 510106 3-10-4 86 70 27

437 146783 5-10-5 19 3 28

433 509963 3-10-3 48 28 153

434 510107 3-10-4 74 51 29

434 509964 3-10-3 50 39 155

435 510108 3-10-4 67 50 30

435 509965 3-10-3 49 38 157

436 510109 3-10-4 12 13 31

436 509966 3-10-3 23 22 159

437 5101 10 3-10-4 34 16 32

437 509967 3-10-3 3 12 161

472 509968 3-10-3 56 38 167

473 51011 1 3-10-4 68 51 33

473 509969 3-10-3 53 39 168

658 146784 5-10-5 0 0 34

654 509970 3-10-3 51 15 176

655 5101 12 3-10-4 66 32 35

656 5101 13 3-10-4 70 31 36

656 509971 3-10-3 54 31 177

657 5101 14 3-10-4 67 45 37

657 509972 3-10-3 51 25 178

658 5101 15 3-10-4 73 50 38

658 509973 3-10-3 49 32 179

685 509974 3-10-3 74 67 181

706 509931 5-10-5 92 83 39

702 509975 3-10-3 72 71 188 687 703 5101 16 3-10-4 83 74 40

688 703 509976 3-10-3 46 52 190

688 704 510117 3-10-4 71 57 41

689 704 509977 3-10-3 18 22 191

689 705 5101 18 3-10-4 71 50 42

690 705 509978 3-10-3 57 37 192

690 706 5101 19 3-10-4 80 64 43

691 706 509979 3-10-3 65 55 194

738 753 509980 3-10-3 48 44 199

738 754 510120 3-10-4 70 54 44

739 754 509981 3-10-3 54 45 201

1 176 1 191 509982 3-10-3 44 36 208

1 176 1192 510121 3-10-4 74 69 45

1 177 1 192 509983 3-10-3 57 53 209

1261 1276 509984 3-10-3 57 50 21 1

1778 1797 509932 5-10-5 30 76 46

1778 1793 509985 3-10-3 0 46 230

1778 1794 510122 3-10-4 0 60 47

1779 1798 509933 5-10-5 54 78 48

1779 1794 509986 3-10-3 56 81 231

1779 1795 510123 3-10-4 74 85 49

1780 1799 509934 5-10-5 69 84 50

1780 1795 509987 3-10-3 52 78 232

1780 1796 510124 3-10-4 75 84 51

1781 1800 509935 5-10-5 72 85 52

1781 1796 509988 3-10-3 57 68 232

1781 1797 510125 3-10-4 68 72 53

1782 1797 509989 3-10-3 46 41 234

1782 1798 510126 3-10-4 56 51 54

1783 1798 509990 3-10-3 16 25 234

1783 1799 510127 3-10-4 61 69 55

1784 1799 509991 3-10-3 41 41 236

1784 1800 510128 3-10-4 61 68 56

1785 1800 509992 3-10-3 43 43 237

1822 1837 509993 3-10-3 72 44 244

1822 1838 510129 3-10-4 66 33 57

1823 1838 509994 3-10-3 79 32 245

1823 1839 510130 3-10-4 49 31 58

1824 1839 509995 3-10-3 63 30 247

1865 1884 509936 5-10-5 74 59 59

1865 1880 509996 3-10-3 36 0 252

1865 1881 510131 3-10-4 26 0 60

1866 1885 509937 5-10-5 78 63 61 1866 1881 509997 3-10-3 5 0 254

1866 1882 510132 3-10-4 37 4 62

1867 1886 505370 5-10-5 54 17 63

1867 1882 509998 3-10-3 13 0 256

1867 1883 510133 3-10-4 42 25 64

1868 1887 509938 5-10-5 9 6 65

1868 1883 509999 3-10-3 47 6 258

1868 1884 510134 3-10-4 56 27 66

1869 1888 509939 5-10-5 64 29 67

1869 1884 510000 3-10-3 24 1 260

1869 1885 510135 3-10-4 70 43 68

1870 1889 505371 5-10-5 63 46 69

1870 1885 510001 3-10-3 39 12 262

1870 1886 510136 3-10-4 52 23 70

1871 1886 510002 3-10-3 10 0 264

1871 1887 510137 3-10-4 28 0 71

1872 1887 510003 3-10-3 21 0 266

1872 1888 510138 3-10-4 25 7 72

1873 1888 510004 3-10-3 21 38 269

1873 1889 510139 3-10-4 18 0 73

1874 1889 510005 3-10-3 8 0 271

1918 1933 510006 3-10-3 0 0 278

1918 1934 510140 3-10-4 81 67 74

1919 1934 510007 3-10-3 69 66 280

2270 2285 510008 3-10-3 23 0 285

2378 2397 509940 3-10-4 66 7 75

2378 2393 510009 3-10-3 23 0 290

2378 2394 510141 3-10-4 10 11 76

2379 2394 510010 3-10-3 39 6 292

2379 2395 510142 3-10-4 46 24 77

2380 2395 51001 1 3-10-3 33 23 294

2380 2396 510143 3-10-4 59 36 78

2381 2396 510012 3-10-3 38 22 296

2381 2397 510144 3-10-4 54 20 79

2382 2397 510013 3-10-3 42 0 298

2820 2835 510014 3-10-3 51 9 302

2820 2836 510145 3-10-4 68 19 80

2821 2836 510015 3-10-3 35 2 303

2821 2837 510146 3-10-4 65 15 81

2822 2837 510016 3-10-3 9 0 304

2822 2838 510147 3-10-4 30 0 85

2823 2838 510017 3-10-3 18 0 305

2824 2839 510018 3-10-3 24 5 306 Example 5: Dose-dependent inhibition of viral HBV RNA in HepG2.2.15 cells by MOE gapmers

Certain gapmers from the study described in Examples 3 and 4 were tested at various doses in human HepG2.2.15 cells. Cells were plated at a density of 25,000 cells per well and transfected using electroporation with 2.5 μΜ, 5.0 μΜ, 10.0 μΜ, and 20.0 μΜ concentrations of antisense oligonucleotide, as specified in Table 5. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RBBOGREEN^®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The half maximal mhibitory concentration (IC₅o) of each oligonucleotide is also presented in Table 5. As illustrated in Table 5, HBV mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 5

Dose-dependent antisense inhibition of HBV RNA in HepG2.2.15 cells using RTS3370

Example 6: Dose-dependent inhibition of viral HBV RNA in HepG2.2.15 cells by MOE gapmers

Additional gapmers from the study described in Examples 3 and 4 were further tested at various doses in human HepG2.2.15 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE 2000® reagent with 15.625 nM, 31.25 nM, 62.5 nM, 125.0 nM, and 250.0 nM concentrations of antisense oligonucleotide, as specified in Table 6. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN'⁹. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The half maximal inhibitory concentration (IC₅o) of each oligonucleotide is also presented in Table 6. As illustrated in Table 6, HBV mRNA levels were significantly reduced in a dose-dependent manner in some antisense oligonucleotide treated cells.

Table 6

509981 0 15 1 1 35 60 224.4

510007 0 0 15 31 45 >250.0

510038 12 19 48 73 84 68.9

510039 17 25 44 69 72 77.3

510040 17 20 23 59 72 108.6

510041 1 1 21 43 64 79 80.5

510050 3 21 16 51 70 132.4

510058 7 9 16 22 46 >250.0

510079 0 6 1 1 29 32 >250.0

510100 18 34 50 79 83 56.1

510106 23 25 35 69 74 78.4

5101 16 20 44 65 79 91 42.6

510140 7 28 30 55 58 136.5

The mRNA levels were also measured with primer probe set RTS3371 . The results are presented

Table 7.

Table 7

Dose-dependent antisense inhibition of HBV RNA in HepG2.2.15 cells using RTS3371

509959 2 9 31 52 65 132.3

509960 16 28 22 57 75 101.8

509972 3 5 1 39 60 236.3

509974 38 46 65 83 94 31.2

509975 30 7 24 49 67 148.2

509981 22 22 23 46 58 194.7

510007 3 0 15 33 39 >250.0

510038 16 22 50 76 84 62.9

510039 23 36 32 70 68 79.7

510040 18 15 41 59 67 101 .9

510041 0 27 38 62 81 84.5

510050 1 16 17 52 63 149

510058 20 19 40 44 51 214.1

510079 0 2 5 41 49 >250.0

510100 35 52 61 86 90 30.7

510106 27 23 5 75 81 87.9

5101 16 1 1 44 70 72 94 46.5

510140 0 18 26 45 41 >250.0

Example 7: Tolerability of MOE gapmers targeting HBV in BALB/c mice

B ALB/c mice (Charles River, MA) are a multipurpose model of mice, frequently utilized for safety and efficacy testing. The mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for changes in the levels of various metabolic markers.

Study 1

Groups of four BALB/c mice each were injected subcutaneously twice a week for 3 weeks with 50 mg/kg of ISIS 146779, ISIS 146786, ISIS 505317, ISIS 505319, ISIS 505330, ISIS 505332, ISIS 505339, ISIS 505346, ISIS 505347, ISIS 505358, ISIS 509929, ISIS 509931 , ISIS 509932, ISIS 509934, ISIS 509957, ISIS 510100, ISIS 510106, ISIS 5101 16, and ISIS 510140. A group of four BALB/c mice were injected subcutaneously twice a week for 3 weeks with 50 mg/kg of ISIS 141923 (CCTTCCCTGAAGGTTCCTCC (SEQ ID NO: 320)), a 5-10-5 MOE gapmer with no known homology to any human or mouse gene sequence. Another group of 4 BALB/c mice was injected subcutaneously twice a week for 3 weeks with PBS. This group of mice served as the control group. Three days after the last dose at each time point, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.

Body and organ weights

The body weights of the mice were measured pre-dose and at the end of each treatment period. The body weights are presented in Table 8, and are expressed as percent change from the weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 9 as a percentage difference from the respective organ weights of the PBS control. The results indicate that most of the ISIS oligonucleotides did not cause any adverse effects on body or organ weights.

Table 8

Change in body weights of BALB/c mice after antisense oligonucleotide treatment (%)

Table 9

Change in organ weights of BALB/c mice after antisense oligonucleotide treatment (%)

ISIS 505332 7 -2 14

ISIS 505339 5 -6 7

ISIS 505346 7 -6 0

ISIS 505347 12 -7 5

ISIS 505358 8 0 3

ISIS 509929 17 14 200

ISIS 509931 -4 -9 3

ISIS 509932 18 -9 79

ISIS 509934 6 -6 2

ISIS 509957 0 -2 15

ISIS 510100 2 1 8

ISIS 510106 5 -2 58

ISIS 5101 16 12 -8 7

ISIS 510140 20 -8 49

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 10 expressed in IU/L. Plasma levels of cholesterol and triglycerides were also measured using the same clinical chemistry analyzer and the results are also presented in Table 10.

Table 10

Effect of antisense oligonucleotide treatment on metabolic markers in the liver of BALB/c

ISIS 509929 11 1 166 61 175

ISIS 509931 635 508 110 179

ISIS 509932 92 113 118 131

ISIS 509934 38 89 97 176

ISIS 509957 159 229 85 173

ISIS 510100 90 87 86 222

ISIS 510106 61 88 79 239

ISIS 5101 16 70 95 124 214

ISIS 510140 1247 996 161 167

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Table 11 , expressed in mg/dL.

Table 11

Effect of antisense oligonucleotide treatment on kidney markers of BALB/c

Study 2

Groups of four BALB/c mice each were injected subcutaneously twice a week for 3 weeks with 50 mg/kg of ISIS 505329, ISIS 509926, ISIS 509927, ISIS 509958, ISIS 509959, ISIS 509960, ISIS 509974, ISIS 509975, ISIS 510038, ISIS 510039, ISIS 510040, ISIS 510041 , and ISIS 510050. A group of 4 BALB/c mice was injected subcutaneously twice a week for 3 weeks with PBS. This group of mice served as the control group. Three days after the last dose at each time point, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.

Organ weights

Liver, spleen and kidney weights were measured at the end of the study, and are also presented in

Table 12 as a percentage change over the respective organ weights of the PBS control.

Table 12

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 13 expressed in IU/L. Table 13

Effect of antisense oligonucleotide treatment on transaminases (IU/L) in the liver of BALB/c

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Table 14, expressed in mg/dL.

Table 14

Effect of antisense oligonucleotide treatment on kidney markers of BALB/c mice

BUN

PBS 21

ISIS 505329 22

ISIS 509926 20

ISIS 509927 20

ISIS 509958 22

ISIS 509959 21

ISIS 509960 20

ISIS 509974 19

ISIS 509975 19

ISIS 510038 19

ISIS 510039 19

ISIS 510040 22

ISIS 510041 18 ISIS 510050 22

Example 8: Dose response confirmation of MOE gapmers targeting HBV in HepG2.2.15 cells

Gapmers were chosen based on sequence conservation, activity and tolerability, as measured in the study described in Examples 7 and 8, and tested at various doses in HepG2.2.15 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE 2000 reagent with 15.625 nM, 31.25 nM, 62.5 nM, 125.0 nM and 250.0 nM concentrations of antisense oligonucleotide. Two days post- transfection, the media was replaced with fresh media. Samples were collected 4 days post-transfection. DNA, RNA, HBsAg and HBeAg levels were measured in the supernatant.

HBV rnRNA levels were measured by quantitative real-time PCR. HBV primer probe set RTS3370 was used to measure rnRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^® Results are presented as percent inhibition of HBV, relative to untreated control cells. As illustrated in Table 15, HBV rnRNA levels were reduced in a dose-dependent manner in most of the antisense oligonucleotide treated cells.

HBV antigens in the supematants were detected with the ELISA technique. HBs antigen (HBsAg) levels were detected by ELISA from Abazyme LLC, MA. As presented in Table 16, treatment with ISIS oligonucleotides 146779, 146786, 505329, 505330, 505339, 505347, 505358, 509927, 509934, 509958, 509959, 509960, 509974, 5100038, 510039, 510040, 510041 , 510100, 510106, and 5101 16 caused significant reduction in HBsAg levels. HBe antigen (HBeAg) levels were detected by ELISA from

International Immuno-diagnostics, CA. As presented in Table 17, treatment with ISIS oligonucleotides 146779, 146786, 505329, 505330, 505339, 505347, 505358, 509927, 509934, 509958, 509959, 509960, 509974, 5100038, 510039, 510040, 510041 , 510100, 510106, and 5101 16 caused significant reduction in HBeAg levels. HBV DNA levels were measured using primer probe set RTS3370. As presented in Table 18, treatment with ISIS oligonucleotides 146779, 146786, 505329, 505330, 505339, 505347, 505358, 509927, 509934, 509958, 509959, 509960, 509974, 5100038, 510039, 510040, 510041 , 510100, 510106, and 5101 16 caused significant reduction in HBV DNA levels. The total protein in the supematants was measured by a DC protein assay (BioRad), as presented in Table 19.

Table 15

Dose-dependent antisense inhibition of HBV RNA in HepG2.2.15cells

ISIS No 15.625nM 31.25nM 62.5nM 125nM 250nM

146779 10 25 42 64 95

146786 23 59 78 84 90

505329 45 49 57 69 83

505330 31 61 65 80 93 505339 31 56 78 89 97

505347 30 50 72 87 96

505358 28 52 75 86 95

509927 41 61 67 61 76

509934 38 61 64 82 58

509958 50 67 72 79 89

509959 50 63 73 80 86

509960 63 61 72 82 74

509974 29 44 75 91 96

510038 29 40 85 89 93

510039 32 34 63 84 84

510040 18 0 51 71 77

510041 34 53 67 76 71

510100 29 64 70 89 93

510106 28 65 64 81 85

510116 13 34 78 89 95

Table 16

Dose-dependent reduction of S antigen in HepG2.2.15 cell supernatant

Table 17

Dose-dependent reduction of E antigen in HepG2.2.15 cell supernatant

Table 18

Dose-dependent antisense inhibition of HBV DNA in HepG2.2.15 cells

510038 69 76 90 87

510039 70 79 81 86

510040 40 67 68 68

510041 53 71 62 68

510100 76 81 87 87

510106 46 74 73 76

510116 79 84 89 86

Table 19

Total protein levels in HepG2.2.15 cell supernatant

Example 9: In vivo inhibition of HBV mRNA by MOE gapmers in HBV-transgenic mice

ISIS 146786, a 5-10-5 MOE gapmer, and ISIS 510100, a 3-10-4 MOE gapmer, both demonstrating significant inhibition of HBV mRNA, were tested in transgenic mice containing the HBV gene (Chisari 1.3.32 line) (Guidotti, L. G. et al., J. Virol. 1995, 69, 6158-6169) and the efficacy of the gapmers was evaluated.

Treatment Two groups of ten-eleven HBV-transgenic male and female mice each were administered subcutaneously twice a week for four weeks with 25 mg/kg of ISIS 146786 or ISIS 510100. Another group of 14 male and female HBV-transgenic mice was administered Entecavir, an oral antiviral drug used to treat Hepatitis B infection, at 1 mg/kg daily for two weeks. Another group of 10 male and female HBV-transgenic female mice were injected subcutaneously with PBS twice a week for four weeks. The mice injected with PBS served as a control group. Liver HBV mRNA and DNA levels, plasma ALT, and body and organ weights were measured.

RNA analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV using primer probe sets RTS3370, RTS3371 , and RTS3372. Results are presented as percent inhibition of HBV mRNA, relative to PBS control. As shown in Table 20, treatment with ISIS antisense oligonucleotides resulted in significant reduction of HBV mRNA in comparison to the PBS control, irrespective of the primer probe set used for measurement. Entecavir did not decrease HBV mRNA expression.

Table 20

Inhibition of HBV mRNA in HBV-transgenic mice liver relative to the PBS control

DNA analysis

DNA was extracted from liver tissue for real-time PCR analysis of HBV using primer probe sets RTS3370 and RTS3371. The levels were normalized to RIBOGREEN®. Results are presented as percent inhibition of HBV DNA, relative to PBS control. As shown in Table 21 , treatment with ISIS antisense oligonucleotides resulted in significant reduction of HBV DNA in comparison to the PBS control, irrespective of the primer probe set used for measurement. Treatment with Entecavir also reduced DNA levels, as expected.

Table 21

Inhibition of HBV DNA in HBV-transgenic mice liver relative to the PBS control

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminase was measured using a manual clinical chemistry analyzer (Teco Diagnostics, Anaheim, CA )Plasma concentrations of ALT (alanine transaminase) were measured and the results are presented in Table 22, expressed in IU/L. The results indicate that antisense inhibition of HBV had no adverse effects on the liver function of the mice.

Table 22

Effect of antisense oligonucleotide treatment on liver ALT of transgenic mice

The data from the study indicates that both ISIS 146786 and ISIS 510100 caused robust reductions in liver HBV RNA and DNA and treatment with these oligonucleotides were well tolerated in the transgenic mice.

Example 10: Antisense inhibition of HBV viral mRNA in HepG2.2.15 cells by MOE gapmers

Additional antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. Several of the antisense oligonucleotides from the studies described above were also included in the assay. Cultured HepG2.2.15 cells at a density of 28,000 cells per well were transfected using LipofectAMINE 2000® reagent with 100 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Table 23 were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has an MOE sugar modification. Each nucleoside in the central gap segment has a deoxy sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Viral Target start site" indicates the 5 '-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. Each gapmer listed in Table 23 is targeted to the viral genomic sequence, designated herein as SEQ ED NO: 1 (GENBANK Accession No. U95551.1).

Table 23

Inhibition of viral HBV mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ED NO: 1

(RTS3370)

77 96 524439 AAC AGGGTTTACTG CTCCTG 69 350

80 99 524440 CGGAACAGGGTTTACTGCTC 67 351

83 102 524441 AGTCGGAACAGGGTTTACTG 47 352

86 105 524442 AGTAGTCGGAACAGGGTTTA 59 353

89 108 524443 GGCAGTAGTCGGAACAGGGT 47 354

92 1 1 1 524444 AGAGGCAGTAGTCGGAACAG 54 355

95 1 14 524445 GGGAGAGGCAGTAGTCGGAA 49 356

98 117 524446 TAAGGGAGAGGCAGTAGTCG 81 357

101 120 524447 CGATAAGGGAGAGGCAGTAG 86 358

104 123 524448 TGACGATAAGGGAGAGGCAG 79 359

107 126 524449 GATTGACGATAAGGGAGAGG 27 360

1 10 129 524450 GAAGATTGACGATAAGGGAG 53 361

113 132 524451 CGAGAAGATTGACGATAAGG 67 362

1 16 135 524452 CCTCGAGAAGATTGACGATA 84 363

1 19 138 524453 AATCCTCGAGAAGATTGACG 79 364

122 141 524454 CCCAATCCTCGAGAAGATTG 65 365

125 144 524455 GTCCCCAATCCTCGAGAAGA 66 366

128 147 524456 AGGGTCCCCAATCCTCGAGA 67 367

131 150 524457 CGCAGGGTCCCCAATCCTCG 76 368

134 153 524458 CAGCGCAGGGTCCCCAATCC 59 369

137 156 524459 GTTCAGCGCAGGGTCCCCAA 80 370

140 159 524460 CATGTTCAGCGCAGGGTCCC 90 371

143 162 524461 CTCCATGTTCAGCGCAGGGT 75 372

146 165 524462 GTTCTCCATGTTCAGCGCAG 54 373

149 168 524463 GATGTTCTCCATGTTCAGCG 27 374

152 171 524464 TGTGATGTTCTCCATGTTCA 72 375

158 177 524466 TCCTGATGTGATGTTCTCCA 91 376

161 180 524467 GAATCCTGATGTGATGTTCT 77 377

164 183 524468 TAGGAATCCTGATGTGATGT 77 378

167 186 524469 TCCTAGGAATCCTGATGTGA 94 379

170 189 524470 GGGTCCTAGGAATCCTGATG 56 380

188 207 524471 CGCCTGTAACACGAGAAGGG 65 381

191 210 524472 CCCCGCCTGTAACACGAGAA 71 382

194 213 524473 AAACCCCGCCTGTAACACGA 74 383

195 214 524474 AAAACCCCGCCTGTAACACG 72 384

196 215 505315 AAAAACCCCGCCTGTAACAC 52 87

197 216 524475 GAAAAACCCCGCCTGTAACA 38 385

198 217 524476 AGAAAAACCCCGCCTGTAAC 18 386

200 219 524477 CAAGAAAAACCCCGCCTGTA 86 387

203 222 524478 CAACAAGAAAAACCCCGCCT 84 388

204 223 524479 TCAACAAGAAAAACCCCGCC 80 389

205 224 505317 GTCAACAAGAAAAACCCCGC 84 89

206 225 524480 TGTCAACAAGAAAAACCCCG 79 390 207 226 524481 TTGTCAACAAGAAAAACCCC 76 391

209 228 524482 TCTTGTCAACAAGAAAAACC 86 392

212 231 524483 GATTCTTGTCAACAAGAAAA 57 393

215 234 524484 GAGGATTCTTGTCAACAAGA 51 394

218 237 524485 TGTGAGGATTCTTGTCAACA 83 395

221 240 524486 TATTGTGAGGATTCTTGTCA 61 396

224 243 524487 CGGTATTGTGAGGATTCTTG 74 397

227 246 524488 CTGCGGTATTGTGAGGATTC 49 398

230 249 524489 ACTCTGCGGTATTGTGAGGA 67 399

233 252 524490 TAGACTCTGCGGTATTGTGA 88 400

236 255 524491 GTCTAGACTCTGCGGTATTG 84 401

239 258 524492 CGAGTCTAGACTCTGCGGTA 82 402

242 261 524493 CCACGAGTCTAGACTCTGCG 94 403

243 262 524494 ACCACGAGTCTAGACTCTGC 87 404

244 263 146821 CACCACGAGTCTAGACTCTG 87 92

245 264 524495 CCACCACGAGTCTAGACTCT 80 405

246 265 524496 TCCACCACGAGTCTAGACTC 65 406

247 266 505318 GTCCACCACGAGTCTAGACT 65 96

248 267 524497 AGTCCACCACGAGTCTAGAC 46 407

249 268 524498 AAGTCCACCACGAGTCTAGA 54 408

250 269 509921 GAAGTCCACCACGAGTCTAG 35 97

251 270 509922 AGAAGTCCACCACGAGTCTA 51 99

252 271 509923 GAGAAGTCCACCACGAGTCT 49 101

253 272 505319 AGAGAAGTCCACCACGAGTC 60 103

254 273 509924 GAGAGAAGTCCACCACGAGT 46 105

255 274 509925 TGAGAGAAGTCCACCACGAG 79 108

256 275 505320 TTGAGAGAAGTCCACCACGA 84 1 1 1

257 276 524499 ATTGAGAGAAGTCCACCACG 83 409

260 279 524500 AAAATTGAGAGAAGTCCACC 71 410

263 282 524501 TAGAAAATTGAGAGAAGTCC 67 41 1

266 285 524502 CCCTAGAAAATTGAGAGAAG 88 412

269 288 524503 TCCCCCTAGAAAATTGAGAG 82 413

272 291 524504 AGTTCCCCCTAGAAAATTGA 66 414

275 294 524505 GGTAGTTCCCCCTAGAAAAT 0 415

278 297 524506 CACGGTAGTTCCCCCTAGAA 65 416

281 300 524507 ACACACGGTAGTTCCCCCTA 87 417

284 303 524508 AAGACACACGGTAGTTCCCC 76 418

287 306 524509 GCCAAGACACACGGTAGTTC 61 419

290 309 524510 TTGGCCAAGACACACGGTAG 87 420

291 310 52451 1 TTTGGCCAAGACACACGGTA 87 421

292 31 1 524512 TTTTGGCCAAGACACACGGT 93 422

293 312 505323 ATTTTGGCCAAGACACACGG 83 123

294 313 524513 AATTTTGGCCAAGACACACG 79 423 295 314 524514 GAATTTTGGCCAAGACACAC 74 424

298 317 524515 TGCGAATTTTGGCCAAGACA 78 425

300 319 524516 ACTGCGAATTTTGGCCAAGA 71 426

301 320 524517 GACTGCGAATTTTGGCCAAG 71 427

302 321 505325 GGACTGCGAATTTTGGCCAA 50 125

303 322 524518 GGGACTGCGAATTTTGGCCA 55 428

321 340 524519 GTGAGTGATTGGAGGTTGGG 68 429

324 343 524520 TTGGTGAGTGATTGGAGGTT 84 430

327 346 524521 AGGTTGGTGAGTGATTGGAG 64 431

330 349 524522 AGGAGGTTGGTGAGTGATTG 58 432

333 352 524523 GACAGGAGGTTGGTGAGTGA 62 433

336 355 524524 GAGGACAGGAGGTTGGTGAG 56 434

339 358 524525 TTGGAGGACAGGAGGTTGGT 81 435

342 361 524526 AAGTTGGAGGACAGGAGGTT 77 436

345 364 524527 GACAAGTTGGAGGACAGGAG 69 437

348 367 524528 CAGGACAAGTTGGAGGACAG 82 438

351 370 524529 AACCAGGACAAGTTGGAGGA 67 439

354 373 524530 GATAACCAGGACAAGTTGGA 53 440

357 376 524531 AGCGATAACCAGGACAAGTT 55 441

358 377 524532 CAGCGATAACCAGGACAAGT 84 442

359 378 524533 CCAGCGATAACCAGGACAAG 86 443

360 379 505326 TCCAGCGATAACCAGGACAA 79 126

361 380 524534 ATCCAGCGATAACCAGGACA 85 444

362 381 524535 CATCCAGCGATAACCAGGAC 90 445

364 383 524536 CACATCCAGCGATAACCAGG 82 446

365 384 524537 ACACATCCAGCGATAACCAG 72 447

366 385 505327 GACACATCCAGCGATAACCA 61 127

367 386 524538 AGACACATCCAGCGATAACC 79 448

368 387 524539 CAGACACATCCAGCGATAAC 73 449

370 389 524540 CGCAGACACATCCAGCGATA 94 450

373 392 524541 CGCCGCAGACACATCCAGCG 84 451

390 409 524542 AGAGGAAGATGATAAAACGC 45 452

393 412 524543 TGAAGAGGAAGATGATAAAA 62 453

396 415 524544 GGATGAAGAGGAAGATGATA 58 454

399 418 524545 GCAGGATGAAGAGGAAGATG 48 455

402 421 524546 GCAGCAGGATGAAGAGGAAG 60 456

405 424 524547 ATAGCAGCAGGATGAAGAGG 84 457

408 427 524548 GGCATAGCAGCAGGATGAAG 56 458

409 428 524549 AGGCATAGCAGCAGGATGAA 78 459

410 429 524550 GAGGCATAGCAGCAGGATGA 67 460

41 1 430 505329 TGAGGCATAGCAGCAGGATG 85 136

412 431 509926 ATGAGGCATAGCAGCAGGAT 84 139

413 432 509927 GATGAGGCATAGCAGCAGGA 68 142 414 433 505330 AGATGAGGCATAGCAGCAGG 82 20

415 434 509928 AAGATGAGGCATAGCAGCAG 83 22

416 435 509929 GAAGATGAGGCATAGCAGCA 80 24

417 436 509930 AGAAGATGAGGCATAGCAGC 78 26

418 437 146783 AAGAAGATGAGGCATAGCAG 80 28

419 438 524551 CAAGAAGATGAGGCATAGCA 55 461

422 441 524552 CAACAAGAAGATGAGGCATA 90 462

425 444 524553 AACCAACAAGAAGATGAGGC 82 463

428 447 524554 AAGAACCAACAAGAAGATGA 79 464

431 450 524555 CAGAAGAACCAACAAGAAGA 72 465

434 453 524556 GTCCAGAAGAACCAACAAGA 87 466

437 456 524557 ATAGTCCAGAAGAACCAACA 72 467

440 459 524558 TTGATAGTCCAGAAGAACCA 76 468

443 462 524559 ACCTTGATAGTCCAGAAGAA 78 469

446 465 524560 CATACCTTGATAGTCCAGAA 77 470

449 468 524561 CAACATACCTTGATAGTCCA 69 471

452 471 524562 GGGCAACATACCTTGATAGT 39 472

455 474 524563 AACGGGCAACATACCTTGAT 72 473

456 475 524564 AAACGGGCAACATACCTTGA 86 474

457 476 505332 CAAACGGGCAACATACCTTG 85 166

458 477 524565 ACAAACGGGCAACATACCTT 80 475

459 478 524566 GACAAACGGGCAACATACCT 42 476

461 480 524567 AG GAC AA ACGGGC AAC AT AC 47 477

464 483 524568 TAGAGGACAAACGGGCAACA 81 478

467 486 524569 AATTAGAGGACAAACGGGCA 72 479

470 489 524570 TGGAATTAGAGGACAAACGG 84 480

471 490 524571 CTGGAATTAGAGGACAAACG 86 481

472 491 505335 CCTGGAATTAGAGGACAAAC 89 174

473 492 524572 TCCTGGAATTAGAGGACAAA 92 482

474 493 524573 ATCCTGGAATTAGAGGACAA 86 483

476 495 524574 GGATCCTGGAATTAGAGGAC 76 484

479 498 524575 TGAGGATCCTGGAATTAGAG 77 485

482 501 524576 GGTTGAGGATCCTGGAATTA 62 486

485 504 524577 GGTGGTTGAGGATCCTGGAA 73 487

488 507 524578 GCTGGTGGTTGAGGATCCTG 84 488

491 510 524579 CGTGCTGGTGGTTGAGGATC 79 489

494 513 524580 TCCCGTGCTGGTGGTTGAGG 83 490

497 516 524581 TGGTCCCGTGCTGGTGGTTG 66 491

500 519 524582 GCATGGTCCCGTGCTGGTGG 77 492

503 522 524583 TCGGCATGGTCCCGTGCTGG 0 493

506 525 524584 GGTTCGGCATGGTCCCGTGC 56 494

509 528 524585 GCAGGTTCGGCATGGTCCCG 61 495

512 531 524586 CATGCAGGTTCGGCATGGTC 87 496 515 534 524587 AGTCATGCAGGTTCGGCATG 77 497

518 537 524588 AGTAGTCATGCAGGTTCGGC 64 498

521 540 524589 AGCAGTAGTCATGCAGGTTC 61 499

524 543 524590 TTGAGCAGTAGTCATGCAGG 86 500

527 546 524591 TCCTTGAGCAGTAGTCATGC 80 501

530 549 524592 GGTTCCTTGAGCAGTAGTCA 50 502

533 552 524593 AGAGGTTCCTTGAGCAGTAG 61 503

536 555 524594 CATAGAGGTTCCTTGAGCAG 89 504

539 558 524595 ATACATAGAGGTTCCTTGAG 87 505

542 561 524596 GGGATACATAGAGGTTCCTT 0 506

545 564 524597 GGAGGGATACATAGAGGTTC 38 507

548 567 524598 ACAGGAGGGATACATAGAGG 73 508

551 570 524599 GCAACAGGAGGGATACATAG 67 509

554 573 524600 ACAGCAACAGGAGGGATACA 72 510

557 576 524601 GGTACAGCAACAGGAGGGAT 59 511

560 579 524602 TTTGGTACAGCAACAGGAGG 81 512

563 582 524603 AGGTTTGGTACAGCAACAGG 74 513

566 585 524604 CGAAGGTTTGGTACAGCAAC 85 514

569 588 524605 GTCCGAAGGTTTGGTACAGC 76 515

572 591 524606 TCCGTCCGAAGGTTTGGTAC 80 516

575 594 524607 ATTTCCGTCCGAAGGTTTGG 88 517

578 597 524608 GCAATTTCCGTCCGAAGGTT 50 518

581 600 524609 GGTGCAATTTCCGTCCGAAG 55 519

584 603 524610 ACAGGTGCAATTTCCGTCCG 81 520

587 606 52461 1 AATACAGGTGCAATTTCCGT 88 521

590 609 524612 GGGAATACAGGTGCAATTTC 32 522

593 612 524613 GATGGGAATACAGGTGCAAT 49 523

608 627 524614 AGCCCAGGATGATGGGATGG 89 524

611 630 524615 GAAAGCCCAGGATGATGGGA 71 525

614 633 524616 TCCGAAAGCCCAGGATGATG 86 526

617 636 524617 TTTTCCGAAAGCCCAGGATG 97 527

620 639 524618 GAATTTTCCGAAAGCCCAGG 80 528

623 642 524619 TAGGAATTTTCCGAAAGCCC 95 529

626 645 524620 CCATAGGAATTTTCCGAAAG 88 530

629 648 524621 CTCCCATAGGAATTTTCCGA 83 531

632 651 524622 CCACTCCCATAGGAATTTTC 68 532

635 654 524623 GGCCCACTCCCATAGGAATT 60 533

638 657 524624 TGAGGCCCACTCCCATAGGA 57 534

641 660 524625 GGCTGAGGCCCACTCCCATA 62 535

644 663 524626 ACGGGCTGAGGCCCACTCCC 57 536

647 666 524627 GAAACGGGCTGAGGCCCACT 62 537

650 669 524628 GGAGAAACGGGCTGAGGCCC 31 538

653 672 524629 CCAGGAGAAACGGGCTGAGG 77 539 656 675 524630 GAGCCAGGAGAAACGGGCTG 48 540

659 678 524631 ACTGAGCCAGGAGAAACGGG 43 541

662 681 524632 TAAACTGAGCCAGGAGAAAC 67 542

665 684 524633 TAGTAAACTGAGCCAGGAGA 86 543

668 687 524634 CACTAGTAAACTGAGCCAGG 96 544

669 688 524635 GCACTAGTAAACTGAGCCAG 83 545

671 690 524636 TGGCACTAGTAAACTGAGCC 84 546

672 691 524637 ATGGCACTAGTAAACTGAGC 82 547

674 693 524638 AAATGGCACTAGTAAACTGA 74 548

677 696 524639 AACAAATGGCACTAGTAAAC 63 549

678 697 524640 GAACAAATGGCACTAGTAAA 67 550

679 698 505338 TGAACAAATGGCACTAGTAA 84 186

680 699 524641 CTGAACAAATGGCACTAGTA 95 551

681 700 524642 ACTGAACAAATGGCACTAGT 77 552

682 701 505339 CACTGAACAAATGGCACTAG 95 187

683 702 524643 CCACTGAACAAATGGCACTA 89 553

684 703 524644 ACCACTGAACAAATGGCACT 90 554

686 705 524646 GAACCACTGAACAAATGGCA 82 555

687 706 509931 CGAACCACTGAACAAATGGC 90 39

689 708 524647 TACGAACCACTGAACAAATG 79 556

690 709 146824 CTACGAACCACTGAACAAAT 72 557

692 711 524648 CCCTACGAACCACTGAACAA 73 558

693 712 524649 GCCCTACGAACCACTGAACA 83 559

695 714 524650 AAGCCCTACGAACCACTGAA 82 560

696 715 524651 AAAGCCCTACGAACCACTGA 81 561

697 716 505342 GAAAGCCCTACGAACCACTG 66 198

698 717 524652 GGAAAGCCCTACGAACCACT 59 562

699 718 524653 GGGAAAGCCCTACGAACCAC 46 563

718 737 524654 ACTGAAAGCCAAACAGTGGG 64 564

721 740 524655 ATAACTGAAAGCCAAACAGT 0 565

724 743 524656 CATATAACTGAAAGCCAAAC 70 566

727 746 524657 ATCCATATAACTGAAAGCCA 91 567

730 749 524658 ATCATCCATATAACTGAAAG 69 568

733 752 524659 CACATCATCCATATAACTGA 70 569

736 755 524660 TACCACATCATCCATATAAC 57 570

739 758 524661 CAATACCACATCATCCATAT 70 571

742 761 524662 CCCCAATACCACATCATCCA 85 572

745 764 524663 GGCCCCCAATACCACATCAT 70 573

748 767 524664 CTTGGCCCCCAATACCACAT 82 574

751 770 524665 AGACTTGGCCCCCAATACCA 77 575

754 773 524666 TACAGACTTGGCCCCCAATA 77 576

757 776 524667 CTGTACAGACTTGGCCCCCA 90 577

760 779 524668 ATGCTGTACAGACTTGGCCC 79 578 763 782 524669 AAGATGCTGTACAGACTTGG 79 579

766 785 524670 CTCAAGATGCTGTACAGACT 84 580

769 788 524671 GGACTCAAGATGCTGTACAG 24 581

772 791 524672 AAGGGACTCAAGATGCTGTA 57 582

775 794 524673 AAAAAGGGACTCAAGATGCT 66 583

778 797 524674 GGTAAAAAGGGACTCAAGAT 30 584

781 800 524675 AGCGGTAAAAAGGGACTCAA 68 585

784 803 524676 AACAGCGGTAAAAAGGGACT 67 586

787 806 524677 GGTAACAGCGGTAAAAAGGG 48 587

790 809 524678 ATTGGTAACAGCGGTAAAAA 81 588

793 812 524679 AAAATTGGTAACAGCGGTAA 89 589

796 815 524680 AAGAAAATTGGTAACAGCGG 84 590

799 818 524681 CAAAAGAAAATTGGTAACAG 41 591

802 821 524682 AGACAAAAGAAAATTGGTAA 51 592

805 824 524683 CAAAGACAAAAGAAAATTGG 66 593

808 827 524684 ACCCAAAGACAAAAGAAAAT 61 594

81 1 830 524685 TATACCCAAAGACAAAAGAA 79 595

814 833 524686 ATGTATACCCAAAGACAAAA 84 596

817 836 524687 TAAATGTATACCCAAAGACA 77 597

820 839 524688 GTTTAAATGTATACCCAAAG 80 598

821 840 524689 GGTTTAAATGTATACCCAAA 71 599

822 841 524690 GGGTTTAAATGTATACCCAA 85 600

823 842 505344 AGGGTTTAAATGTATACCCA 85 206

824 843 524691 TAGGGTTTAAATGTATACCC 90 601

825 844 524692 TTAGGGTTTAAATGTATACC 83 602

827 846 524693 TGTTAGGGTTTAAATGTATA 53 603

830 849 524694 TTTTGTTAGGGTTTAAATGT 67 604

845 864 524695 AACCCCATCTCTTTGTTTTG 81 605

848 867 524696 AGTAACCCCATCTCTTTGTT 71 606

851 870 524697 GAGAGTAACCCCATCTCTTT 65 607

854 873 524698 TCAGAGAGTAACCCCATCTC 96 608

857 876 524699 AATTCAGAGAGTAACCCCAT 94 609

860 879 524700 TAAAATTCAGAGAGTAACCC 71 610

863 882 524701 CCATAAAATTCAGAGAGTAA 90 61 1

866 885 524702 AACCCATAAAATTCAGAGAG 86 612

869 888 524703 CATAACCCATAAAATTCAGA 72 613

872 891 524704 TGACATAACCCATAAAATTC 81 614

875 894 524705 CAATGACATAACCCATAAAA 81 615

878 897 524706 TTCCAATGACATAACCCATA 95 616

881 900 524707 AACTTCCAATGACATAACCC 91 617

884 903 524708 CATAACTTCCAATGACATAA 83 618

887 906 524709 ACCCATAACTTCCAATGACA 95 619

890 909 524710 AGGACCCATAACTTCCAATG 66 620 893 912 52471 1 GCAAGGACCCATAACTTCCA 41 621

896 915 524712 GTGGCAAGGACCCATAACTT 53 622

899 918 524713 CTTGTGGCAAGGACCCATAA 91 623

902 921 524714 GTTCTTGTGGCAAGGACCCA 77 624

905 924 524715 TGTGTTCTTGTGGCAAGGAC 90 625

908 927 524716 TGATGTGTTCTTGTGGCAAG 90 626

91 1 930 524717 GTATGATGTGTTCTTGTGGC 82 627

914 933 524718 TTTGTATGATGTGTTCTTGT 95 628

930 949 524719 AAACATTCTTTGATTTTTTG 61 629

933 952 524720 CTAAAACATTCTTTGATTTT 43 630

936 955 524721 TTTCTAAAACATTCTTTGAT 90 631

939 958 524722 AGTTTTCTAAAACATTCTTT 75 632

942 961 524723 GGAAGTTTTCTAAAACATTC 52 633

945 964 524724 ATAGGAAGTTTTCTAAAACA 74 634

948 967 524725 TTAATAGGAAGTTTTCTAAA 40 635

951 970 524726 CTGTTAATAGGAAGTTTTCT 93 636

954 973 524727 GGCCTGTTAATAGGAAGTTT 87 637

957 976 524728 ATAGGCCTGTTAATAGGAAG 85 638

960 979 524729 TCAATAGGCCTGTTAATAGG 92 639

963 982 524730 CAATCAATAGGCCTGTTAAT 90 640

966 985 524731 TTCCAATCAATAGGCCTGTT 96 641

969 988 524732 ACTTTCCAATCAATAGGCCT 77 642

972 991 146826 CATACTTTCCAATCAATAGG 92 643

975 994 524733 TGACATACTTTCCAATCAAT 91 644

978 997 524734 CGTTGACATACTTTCCAATC 95 645

996 1015 524735 CCCAAAAGACCCACAATTCG 92 646

999 1018 524736 AAACCCAAAAGACCCACAAT 74 647

1002 1021 524737 GCAAAACCCAAAAGACCCAC 85 648

1005 1024 524738 GCAGCAAAACCCAAAAGACC 70 649

1025 1044 524739 AACCACATTGTGTAAATGGG 90 650

1028 1047 524740 GATAACCACATTGTGTAAAT 58 651

1031 1050 524741 CAGGATAACCACATTGTGTA 83 652

1034 1053 524742 ACGCAGGATAACCACATTGT 84 653

1037 1056 524743 TTAACGCAGGATAACCACAT 93 654

1040 1059 524744 GCATTAACGCAGGATAACCA 60 655

1043 1062 524745 AGGGCATTAACGCAGGATAA 58 656

1046 1065 524746 ACAAGGGCATTAACGCAGGA 75 657

1049 1068 524747 CATACAAGGGCATTAACGCA 89 658

1052 1071 524748 ATGCATACAAGGGCATTAAC 87 659

1055 1074 524749 TACATGCATACAAGGGCATT 86 660

1058 1077 524750 GAATACATGCATACAAGGGC 75 661

1061 1080 524751 ATTGAATACATGCATACAAG 81 662

1064 1083 524752 TAGATTGAATACATGCATAC 85 · 663 1067 1086 524753 GCTTAGATTGAATACATGCA 69 664

1070 1089 524754 CCTGCTTAGATTGAATACAT 90 665

1073 1092 524755 AAGCCTGCTTAGATTGAATA 76 666

1076 1095 524756 TGAAAGCCTGCTTAGATTGA 76 667

1079 1098 524757 AAGTGAAAGCCTGCTTAGAT 68 668

1082 1101 524758 AGAAAGTGAAAGCCTGCTTA 81 669

1085 1104 524759 GCGAGAAAGTGAAAGCCTGC 61 670

1088 1107 524760 TTGGCGAGAAAGTGAAAGCC 89 671

1091 1110 524761 AAGTTGGCGAGAAAGTGAAA 74 672

1094 1113 524762 TGTAAGTTGGCGAGAAAGTG 85 673

1097 11 16 524763 CCTTGTAAGTTGGCGAGAAA 90 674

1100 1 1 19 524764 AGGCCTTGTAAGTTGGCGAG 93 675

1 103 1122 524765 GAAAGGCCTTGTAAGTTGGC 78 676

1 106 1125 524766 ACAGAAAGGCCTTGTAAGTT 76 677

1109 1128 524767 TACACAGAAAGGCCTTGTAA 94 678

1 1 12 1131 524768 GTTTACACAGAAAGGCCTTG 80 679

1115 1134 524769 ATTGTTTACACAGAAAGGCC 83 680

1118 1 137 524770 GGTATTGTTTACACAGAAAG 63 681

1 121 1 140 524771 TCAGGTATTGTTTACACAGA 93 682

1 124 1 143 524772 GGTTCAGGTATTGTTTACAC 68 683

1 127 1146 524773 AAAGGTTCAGGTATTGTTTA 82 684

1130 1149 524774 GGTAAAGGTTCAGGTATTGT 68 685

1 150 1169 524775 TGGCCGTTGCCGGGCAACGG 74 686

1153 1172 524776 ACCTGGCCGTTGCCGGGCAA 77 687

1156 1175 524777 CAGACCTGGCCGTTGCCGGG 88 688

1 159 1178 524778 GCACAGACCTGGCCGTTGCC 80 689

1162 1181 524779 TTGGCACAGACCTGGCCGTT 85 690

1 165 1 184 524780 CACTTGGCACAGACCTGGCC 93 691

1 168 1 187 524781 AAACACTTGGCACAGACCTG 90 692

1 169 1188 524782 CAAACACTTGGCACAGACCT 75 693

1 170 1189 505345 GCAAACACTTGGCACAGACC 78 207

1171 1 190 524783 AGCAAACACTTGGCACAGAC 84 694

1 172 1 191 524784 CAGCAAACACTTGGCACAGA 90 695

1 174 1193 524785 GTCAGCAAACACTTGGCACA 79 696

1200 1219 524786 ACCAAGCCCCAGCCAGTGGG 57 697

1203 1222 524787 ATGACCAAGCCCCAGCCAGT 74 698

1206 1225 524788 CCCATGACCAAGCCCCAGCC 90 699

1209 1228 524789 TGGCCCATGACCAAGCCCCA 96 700

1212 1231 524790 TGATGGCCCATGACCAAGCC 79 701

1215 1234 524791 CGCTGATGGCCCATGACCAA 97 702

1218 1237 524792 ACGCGCTGATGGCCCATGAC 98 703

1221 1240 524793 CGCACGCGCTGATGGCCCAT 98 704

1224 1243 524794 CCACGCACGCGCTGATGGCC 98 705 1227 1246 524795 GTTCCACGCACGCGCTGATG 98 706

1230 1249 524796 AAGGTTCCACGCACGCGCTG 99 707

1233 1252 524797 GAAAAGGTTCCACGCACGCG 97 708

1236 1255 524798 GCCGAAAAGGTTCCACGCAC 98 709

1239 1258 524799 GGAGCCGAAAAGGTTCCACG 75 710

1242 1261 524800 AGAGGAGCCGAAAAGGTTCC 79 71 1

1245 1264 524801 GGCAGAGGAGCCGAAAAGGT 98 712

1248 1267 524802 ATCGGCAGAGGAGCCGAAAA 73 713

1251 1270 524803 TGGATCGGCAGAGGAGCCGA 91 714

1254 1273 524804 GTATGGATCGGCAGAGGAGC 98 715

1257 1276 524805 GCAGTATGGATCGGCAGAGG 98 716

1258 1277 524806 CGCAGTATGGATCGGCAGAG 98 717

1259 1278 505346 CCGCAGTATGGATCGGCAGA 98 210

1260 1279 146785 TCCGCAGTATGGATCGGCAG 98 718

1261 1280 524807 TTCCGCAGTATGGATCGGCA 98 719

1262 1281 505347 GTTCCGCAGTATGGATCGGC 98 212

1263 1282 524808 AGTTCCGCAGTATGGATCGG 96 720

1264 1283 524809 GAGTTCCGCAGTATGGATCG 97 721

1266 1285 524810 AGGAGTTCCGCAGTATGGAT 96 722

1269 1288 524811 GCTAGGAGTTCCGCAGTATG 96 723

1272 1291 524812 GCGGCTAGGAGTTCCGCAGT 75 724

1275 1294 524813 CAAGCGGCTAGGAGTTCCGC 86 725

1278 1297 524814 AAACAAGCGGCTAGGAGTTC 73 726

1281 1300 524815 GCAAAACAAGCGGCTAGGAG 71 727

1282 1301 524816 AGCAAAACAAGCGGCTAGGA 89 728

1283 1302 505352 GAGCAAAACAAGCGGCTAGG 76 217

1284 1303 524817 CGAGCAAAACAAGCGGCTAG 78 729

1285 1304 524818 GCGAGCAAAACAAGCGGCTA 71 730

1286 1305 505353 TGCGAGCAAAACAAGCGGCT 82 218

1287 1306 524819 CTGCGAGCAAAACAAGCGGC 82 731

1288 1307 524820 GCTGCGAGCAAAACAAGCGG 67 732

1290 1309 524821 CTGCTGCGAGCAAAACAAGC 79 733

1293 1312 524822 GACCTGCTGCGAGCAAAACA 87 734

1296 1315 524823 CCAGACCTGCTGCGAGCAAA 94 735

1299 1318 524824 GCTCCAGACCTGCTGCGAGC 80 736

1302 1321 524825 TTTGCTCCAGACCTGCTGCG 70 737

1305 1324 524826 ATGTTTGCTCCAGACCTGCT 75 738

1308 1327 524827 ATAATGTTTGCTCCAGACCT 55 739

131 1 1330 524828 CCGATAATGTTTGCTCCAGA 87 740

1314 1333 524829 GTCCCGATAATGTTTGCTCC 80 741

1317 1336 524830 TCAGTCCCGATAATGTTTGC 76 742

1320 1339 524831 TTATCAGTCCCGATAATGTT 53 743

1577 1596 146786 GTGAAGCGAAGTGCACACGG 96 224 Example 11: Antisense inhibition of HBV viral mRNA in HepG2.2.15 cells by MOE gapmers

Additional antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. Several of the antisense oligonucleotides from the studies described above were also included in the assay. Cultured HepG2.2.15 cells at a density of 28,000 cells per well were transfected using LipofectAMINE 2000® reagent with 70 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels. The mRNA levels of some of the gapmers were also measured using RTS3372. HBV mRNA levels were adjusted according to total RNA content, as measured by REBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Tables 24 and 25 were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has an MOE sugar modification. Each nucleoside in the central gap segment has a deoxy sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

"Viral Target start site" indicates the 5'-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. Each gapmer listed in Table 24 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1). Each gapmer listed in Table 25 is targeted to the viral genomic sequence, designated herein as SEQ ED NO: 1286 (a permuted version of GENBANK Accession No. U95551.1). 'n/a' indicates that the inhibition data for that particular gapmer was not measured with that particular primer probe set.

Table 24

Inhibition of viral HBV mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1

(RTS3370 and RTS3372)

RTS3370 RTS3372 SEQ

Start Stop

ISIS No Sequence % % ID Site Site

inhibition inhibition NO

1323 1342 524832 GAGTTATCAGTCCCGATAAT 63 n/a 744

1326 1345 524833 ACAGAGTTATCAGTCCCGAT 82 n a 745

1329 1348 524834 ACAACAGAGTTATCAGTCCC 52 n/a 746

1332 1351 524835 AGGACAACAGAGTTATCAGT 57 n/a 747

1335 1354 524836 GAGAGGACAACAGAGTTATC 49 n/a 748 1338 1357 524837 CGGGAGAGGACAACAGAGTT 0 n/a 749

1341 1360 524838 TTGCGGGAGAGGACAACAGA 17 n/a 750

1344 1363 524839 TATTTGCGGGAGAGGACAAC 30 n/a 751

1347 1366 524840 GTATATTTGCGGGAGAGGAC 22 n/a 752

1350 1369 524841 GATGTATATTTGCGGGAGAG 32 n a 753

1353 1372 524842 TACGATGTATATTTGCGGGA 76 n/a 754

1356 1375 524843 GGATACGATGTATATTTGCG 76 n/a 755

1359 1378 524844 CATGGATACGATGTATATTT 87 n/a 756

1362 1381 524845 AGCCATGGATACGATGTATA 70 n/a 757

1365 1384 524846 AGCAGCCATGGATACGATGT 22 n/a 758

1368 1387 524847 CCTAGCAGCCATGGATACGA 67 n/a 759

1371 1390 524848 CAGCCTAGCAGCCATGGATA 56 n/a 760

1374 1393 524849 GCACAGCCTAGCAGCCATGG 38 n/a 761

1377 1396 524850 GCAGCACAGCCTAGCAGCCA 11 n/a 762

1380 1399 524851 TTGGCAGCACAGCCTAGCAG 34 n/a 763

1383 1402 524852 CAGTTGGCAGCACAGCCTAG 47 n/a 764

1386 1405 524853 ATCCAGTTGGCAGCACAGCC 45 n/a 765

1389 1408 524854 AGGATCCAGTTGGCAGCACA 36 n/a 766

1392 141 1 524855 CGCAGGATCCAGTTGGCAGC 41 n/a 767

1395 1414 524856 CCGCGCAGGATCCAGTTGGC 72 n/a 768

1398 1417 524857 GTCCCGCGCAGGATCCAGTT 55 n/a 769

1457 1476 524858 AGCGACCCCGAGAAGGGTCG 17 n/a 770

1460 1479 524859 CCAAGCGACCCCGAGAAGGG 45 n/a 771

1463 1482 524860 GTCCCAAGCGACCCCGAGAA 8 n/a 772

1466 1485 524861 AGAGTCCCAAGCGACCCCGA 51 n/a 773

1469 1488 524862 GAGAGAGTCCCAAGCGACCC 28 n/a 774

1472 1491 524863 GACGAGAGAGTCCCAAGCGA 37 n a 775

1492 151 1 524864 GAACGGCAGACGGAGAAGGG 27 n a 776

1498 1517 524866 CGGTCGGAACGGCAGACGGA 78 n/a 777

1501 1520 524867 GGTCGGTCGGAACGGCAGAC 78 n/a 778

1504 1523 524868 CGTGGTCGGTCGGAACGGCA 79 n/a 779

1507 1526 524869 CCCCGTGGTCGGTCGGAACG 70 n/a 780

1510 1529 524870 GCGCCCCGTGGTCGGTCGGA 78 n a 781

1513 1532 524871 GGTGCGCCCCGTGGTCGGTC 74 n/a 782

1514 1533 524872 AGGTGCGCCCCGTGGTCGGT 63 n a 783

1515 1534 505354 GAGGTGCGCCCCGTGGTCGG 70 n/a 220

1516 1535 524873 AGAGGTGCGCCCCGTGGTCG 72 n/a 784

1517 1536 524874 GAGAGGTGCGCCCCGTGGTC 49 n/a 785

1518 1537 505355 AGAGAGGTGCGCCCCGTGGT 64 n/a 221

1519 1538 524875 AAGAGAGGTGCGCCCCGTGG 57 n/a 786

1520 1539 524876 AAAGAGAGGTGCGCCCCGTG 63 n/a 787

1521 1540 505356 TAAAGAGAGGTGCGCCCCGT 68 n/a 222

1522 1541 524877 GTAAAGAGAGGTGCGCCCCG 50 n/a 788 1523 1542 524878 CGTAAAGAGAGGTGCGCCCC 64 n/a 789

1550 1569 524879 GATGAGAAGGCACAGACGGG 70 n/a 790

1553 1572 524880 GCAGATGAGAAGGCACAGAC 81 n/a 791

1556 1575 524881 CCGGCAGATGAGAAGGCACA 80 n/a 792

1559 1578 524882 GGTCCGGCAGATGAGAAGGC 84 n/a 793

1562 1581 524883 CACGGTCCGGCAGATGAGAA 79 n/a 794

1565 1584 524884 GCACACGGTCCGGCAGATGA 83 n/a 795

1568 1587 524885 AGTGCACACGGTCCGGCAGA 77 n/a 796

1571 1590 524886 CGAAGTGCACACGGTCCGGC 89 n/a 797

1574 1593 524887 AAGCGAAGTGCACACGGTCC 85 n/a 798

1575 1594 524888 GAAGCGAAGTGCACACGGTC 83 n/a 799

1576 1595 524889 TGAAGCGAAGTGCACACGGT 83 n/a 800

1577 1596 146786 GTGAAGCGAAGTGCACACGG 88 85 224

1578 1597 524890 GGTGAAGCGAAGTGCACACG 83 n a 801

1579 1598 524891 AGGTGAAGCGAAGTGCACAC 82 n/a 802

1580 1599 505357 GAGGTGAAGCGAAGTGCACA 79 n/a 803

1581 1600 524892 AGAGGTGAAGCGAAGTGCAC 73 n/a 804

1582 1601 524893 CAGAGGTGAAGCGAAGTGCA 80 n/a 805

1583 1602 505358 GCAGAGGTGAAGCGAAGTGC 84 n/a 226

1584 1603 524894 TGCAGAGGTGAAGCGAAGTG 74 n/a 806

1585 1604 524895 GTGCAGAGGTGAAGCGAAGT 72 n/a 807

1586 1605 505359 CGTGCAGAGGTGAAGCGAAG 78 n/a 227

1604 1623 524896 ACGGTGGTCTCCATGCGACG 79 n/a 808

1607 1626 524897 TTCACGGTGGTCTCCATGCG 75 n/a 809

1630 1649 524898 CCTTGGGCAACATTCGGTGG 77 n/a 810

1633 1652 524899 AGACCTTGGGCAACATTCGG 76 n/a 81 1

1636 1655 524900 GTAAGACCTTGGGCAACATT 73 n a 812

1639 1658 524901 TATGTAAGACCTTGGGCAAC 60 n/a 813

1642 1661 524902 TCTTATGTAAGACCTTGGGC 72 n/a 814

1645 1664 524903 TCCTCTTATGTAAGACCTTG 75 n/a 815

1648 1667 524904 GAGTCCTCTTATGTAAGACC 65 n/a 816

1651 1670 524905 CAAGAGTCCTCTTATGTAAG 76 n/a 817

1654 1673 524906 GTCCAAGAGTCCTCTTATGT 78 n/a 818

1657 1676 524907 AGAGTCCAAGAGTCCTCTTA 82 n/a 819

1660 1679 524908 CAGAGAGTCCAAGAGTCCTC 82 n/a 820

1663 1682 524909 TTGCAGAGAGTCCAAGAGTC 76 n/a 821

1666 1685 524910 ACATTGCAGAGAGTCCAAGA 76 n/a 822

1669 1688 52491 1 TTGACATTGCAGAGAGTCCA 74 n a 823

1689 1708 524912 GTATGCCTCAAGGTCGGTCG 76 n/a 824

1692 1711 524913 GAAGTATGCCTCAAGGTCGG 73 n a 825

1695 1714 524914 TTTGAAGTATGCCTCAAGGT 76 n/a 826

1698 1717 524915 GTCTTTGAAGTATGCCTCAA 75 n/a 827

1701 1720 524916 ACAGTCTTTGAAGTATGCCT 77 n/a 828 1704 1723 524917 CAAACAGTCTTTGAAGTATG 55 n/a 829

1707 1726 524918 AAACAAACAGTCTTTGAAGT 59 n/a 830

1710 1729 524919 TTTAAACAAACAGTCTTTGA 53 n/a 831

1713 1732 524920 GTCTTTAAACAAACAGTCTT 3 n/a 832

1716 1735 524921 CCAGTCTTTAAACAAACAGT 75 n/a 833

1719 1738 524922 CTCCCAGTCTTTAAACAAAC 70 n/a 834

1722 1741 524923 CTCCTCCCAGTCTTTAAACA 68 n/a 835

1725 1744 524924 CAACTCCTCCCAGTCTTTAA 62 n/a 836

1728 1747 524925 CCCCAACTCCTCCCAGTCTT 63 n/a 837

1731 1750 524926 CTCCCCCAACTCCTCCCAGT 62 n/a 838

1734 1753 524927 CTCCTCCCCCAACTCCTCCC 55 n/a 839

1737 1756 524928 AATCTCCTCCCCCAACTCCT 61 n/a 840

1740 1759 524929 TCTAATCTCCTCCCCCAACT 61 n/a 841

1743 1762 524930 TAATCTAATCTCCTCCCCCA 70 n/a 842

1746 1765 524931 CTTTAATCTAATCTCCTCCC 74 n/a 843

1749 1768 524932 GACCTTTAATCTAATCTCCT 74 n/a 844

1752 1771 524933 AAAGACCTTTAATCTAATCT 60 n/a 845

1755 1774 524934 TACAAAGACCTTTAATCTAA 55 n/a 846

1758 1777 ^' 524935 TAGTACAAAGACCTTTAATC 54 n/a 847

1761 1780 524936 TCCTAGTACAAAGACCTTTA 69 n/a 848

1764 1783 524937 GCCTCCTAGTACAAAGACCT 72 n/a 849

1767 1786 524938 ACAGCCTCCTAGTACAAAGA 60 n/a 850

1770 1789 524939 CCTACAGCCTCCTAGTACAA 66 n/a 851

1773 1792 524940 ATGCCTACAGCCTCCTAGTA 70 n/a 852

1776 1795 524941 TTTATGCCTACAGCCTCCTA 63 n/a 853

1777 1796 524942 ATTTATGCCTACAGCCTCCT 70 n/a 854

1778 1797 509932 AATTTATGCCTACAGCCTCC 68 n/a 46

1779 1798 509933 CAATTTATGCCTACAGCCTC 68 n/a 48

1780 1799 509934 CCAATTTATGCCTACAGCCT 65 n/a 50

1781 1800 509935 ACCAATTTATGCCTACAGCC 64 n/a 52

1782 1801 524943 GACCAATTTATGCCTACAGC 57 n/a 855

1783 1802 524944 AGACCAATTTATGCCTACAG 60 n/a 856

1785 1804 524945 GCAGACCAATTTATGCCTAC 54 n a 857

1788 1807 524946 TGCGCAGACCAATTTATGCC 68 n/a 858

1791 1810 524947 TGGTGCGCAGACCAATTTAT 64 n/a 859

1794 1813 524948 TGCTGGTGCGCAGACCAATT 75 n/a 860

1797 1816 524949 TGGTGCTGGTGCGCAGACCA 68 n/a 861

1800 1819 524950 GCATGGTGCTGGTGCGCAGA 69 n/a 862

1803 1822 524951 GTTGCATGGTGCTGGTGCGC 59 n/a 863

1807 1826 524952 AAAAGTTGCATGGTGCTGGT 61 n a 864

1810 1829 524953 TGAAAAAGTTGCATGGTGCT 60 n/a 865

1813 1832 524954 AGGTGAAAAAGTTGCATGGT 61 n/a 866

1816 1835 524955 CAGAGGTGAAAAAGTTGCAT 63 n/a 867 1819 1838 524956 AGGCAGAGGTGAAAAAGTTG 57 n/a 868

1822 1841 524957 ATTAGGCAGAGGTGAAAAAG 50 n/a 869

1823 1842 524958 GATTAGGCAGAGGTGAAAAA 57 n/a 870

1825 1844 524959 ATGATTAGGCAGAGGTGAAA 54 n/a 871

1828 1847 524960 GAGATGATTAGGCAGAGGTG 59 n/a 872

1831 1850 524961 CAAGAGATGATTAGGCAGAG 61 n/a 873

1834 1853 524962 GAACAAGAGATGATTAGGCA 56 n/a 874

1837 1856 524963 CATGAACAAGAGATGATTAG 24 n a 875

1840 1859 524964 GGACATGAACAAGAGATGAT 54 n/a 876

1843 1862 524965 GTAGGACATGAACAAGAGAT 52 n/a 877

1846 1865 524966 ACAGTAGGACATGAACAAGA 47 n/a 878

1849 1868 524967 TGAACAGTAGGACATGAACA 33 n/a 879

1852 1871 524968 GCTTGAACAGTAGGACATGA 44 n/a 880

1855 1874 524969 GAGGCTTGAACAGTAGGACA 43 n/a 881

1858 1877 524970 TTGGAGGCTTGAACAGTAGG 28 n/a 882

1862 1881 524971 CAGCTTGGAGGCTTGAACAG 30 n/a 883

1871 1890 524972 CCCAAGGCACAGCTTGGAGG 38 n/a 884

1874 1893 524973 CCACCCAAGGCACAGCTTGG 47 n/a 885

1877 1896 524974 AAGCCACCCAAGGCACAGCT 49 n/a 886

1880 1899 524975 CCAAAGCCACCCAAGGCACA 32 n/a 887

1883 1902 524976 GCCCCAAAGCCACCCAAGGC 56 n/a 888

1886 1905 524977 CATGCCCCAAAGCCACCCAA 63 n/a 889

1889 1908 524978 GTCCATGCCCCAAAGCCACC 64 n/a 890

1892 1911 524979 GATGTCCATGCCCCAAAGCC 65 n/a 891

1895 1914 524980 GTCGATGTCCATGCCCCAAA 80 n/a 892

1898 1917 524981 AGGGTCGATGTCCATGCCCC 79 n/a 893

1901 1920 524982 ATAAGGGTCGATGTCCATGC 79 n/a 894

1904 1923 524983 TTTATAAGGGTCGATGTCCA 71 n/a 895

1907 1926 524984 TTCTTTATAAGGGTCGATGT 77 n/a 896

1910 1929 524985 AAATTCTTTATAAGGGTCGA 79 n/a 897

1913 1932 524986 TCCAAATTCTTTATAAGGGT 80 n/a 898

1916 1935 524987 AGCTCCAAATTCTTTATAAG 80 n/a 899

1919 1938 524988 AGTAGCTCCAAATTCTTTAT 76 n/a 900

1922 1941 524989 CACAGTAGCTCCAAATTCTT 59 n/a 901

1925 1944 524990 CTCCACAGTAGCTCCAAATT 46 n/a 902

1928 1947 524991 TAACTCCACAGTAGCTCCAA 63 n/a 903

1931 1950 524992 GAGTAACTCCACAGTAGCTC 65 n/a 904

1934 1953 524993 CGAGAGTAACTCCACAGTAG 69 n/a 905

1937 1956 524994 AAACGAGAGTAACTCCACAG 61 n/a 906

1940 1959 524995 CAAAAACGAGAGTAACTCCA 46 n/a 907

1943 1962 524996 AGGCAAAAACGAGAGTAACT 39 n/a 908

1946 1965 524997 AGAAGGCAAAAACGAGAGTA 53 n/a 909

1949 1968 524998 GTCAGAAGGCAAAAACGAGA 56 n/a 910 1952 1971 524999 GAAGTCAGAAGGCAAAAACG 49 n/a 91 1

1955 1974 525000 AAAGAAGTCAGAAGGCAAAA 29 n a 912

1958 1977 525001 AGGAAAGAAGTCAGAAGGCA 41 n/a 913

1961 1980 525002 TGAAGGAAAGAAGTCAGAAG 34 n/a 914

1964 1983 525003 TACTGAAGGAAAGAAGTCAG 26 n/a 915

1984 2003 525004 GCGGTATCTAGAAGATCTCG 24 n a 916

1987 2006 525005 GAGGCGGTATCTAGAAGATC 29 n/a 917

1990 2009 525006 GCTGAGGCGGTATCTAGAAG 29 n/a 918

1993 2012 525007 AGAGCTGAGGCGGTATCTAG 13 n/a 919

1996 2015 525008 TACAGAGCTGAGGCGGTATC 6 n a 920

1999 2018 525009 CGATACAGAGCTGAGGCGGT 3 n/a 921

2002 2021 525010 TCCCGATACAGAGCTGAGGC 27 n/a 922

2005 2024 525011 GCTTCCCGATACAGAGCTGA 43 n/a 923

2008 2027 525012 AAGGCTTCCCGATACAGAGC 33 n/a 924

2011 2030 525013 TCTAAGGCTTCCCGATACAG 34 n/a 925

2014 2033 525014 GACTCTAAGGCTTCCCGATA 38 n/a 926

2017 2036 525015 GGAGACTCTAAGGCTTCCCG 16 n/a 927

2020 2039 525016 TCAGGAGACTCTAAGGCTTC 16 n/a 928

2023 2042 525017 TGCTCAGGAGACTCTAAGGC 14 n/a 929

2026 2045 525018 CAATGCTCAGGAGACTCTAA 34 n/a 930

2029 2048 525019 GAACAATGCTCAGGAGACTC 32 n/a 931

2032 2051 525020 GGTGAACAATGCTCAGGAGA 9 n/a 932

2035 2054 525021 TGAGGTGAACAATGCTCAGG 50 n/a 933

2038 2057 525022 TGGTGAGGTGAACAATGCTC 54 n/a 934

2041 2060 525023 GTATGGTGAGGTGAACAATG 47 n/a 935

2044 2063 525024 GCAGTATGGTGAGGTGAACA 40 n/a 936

2047 2066 525025 AGTGCAGTATGGTGAGGTGA 35 n/a 937

2050 2069 525026 CTGAGTGCAGTATGGTGAGG 43 n a 938

2053 2072 525027 TGCCTGAGTGCAGTATGGTG 45 n/a 939

2056 2075 525028 GCTTGCCTGAGTGCAGTATG 42 n a 940

2059 2078 525029 ATTGCTTGCCTGAGTGCAGT 39 n/a 941

2062 2081 525030 AGAATTGCTTGCCTGAGTGC 27 n/a 942

2065 2084 525031 CAAAGAATTGCTTGCCTGAG 42 n/a 943

2068 2087 525032 CAGCAAAGAATTGCTTGCCT 49 n/a 944

2071 2090 525033 CCCCAGCAAAGAATTGCTTG 41 n/a 945

2074 2093 525034 TCCCCCCAGCAAAGAATTGC 39 n/a 946

2077 2096 525035 AGTTCCCCCCAGCAAAGAAT 39 n/a 947

2080 2099 525036 ATTAGTTCCCCCCAGCAAAG 43 n/a 948

2083 2102 525037 GTCATTAGTTCCCCCCAGCA 64 n/a 949

2086 2105 525038 AGAGTCATTAGTTCCCCCCA 45 n/a 950

2089 2108 525039 GCTAGAGTCATTAGTTCCCC 58 n/a 951

2092 21 1 1 525040 GT AG CTAG AGTC ATT AGTTC 45 n/a 952

2095 21 14 525041 CAGGTAGCTAGAGTCATTAG 44 n/a 953 2098 21 17 525042 ACCCAGGTAGCTAGAGTCAT 39 n/a 954

2101 2120 525043 CCCACCCAGGTAGCTAGAGT 51 n/a 955

2104 2123 525044 ACACCCACCCAGGTAGCTAG 27 n/a 956

2107 2126 525045 TTAACACCCACCCAGGTAGC 41 n/a 957

21 10 2129 525046 AAATTAACACCCACCCAGGT 44 n a 958

21 13 2132 525047 TCCAAATTAACACCCACCCA 29 n/a 959

2116 2135 525048 TCTTCCAAATTAACACCCAC 31 n/a 960

21 19 2138 525049 GGATCTTCCAAATTAACACC 42 n/a 961

2122 2141 525050 GCTGGATCTTCCAAATTAAC 53 n/a 962

2125 2144 525051 GATGCTGGATCTTCCAAATT 41 n/a 963

2128 2147 525052 CTAGATGCTGGATCTTCCAA 62 n/a 964

2131 2150 525053 TCTCTAGATGCTGGATCTTC 41 83 965

2134 2153 525054 AGGTCTCTAGATGCTGGATC 26 73 966

2137 2156 525055 ACTAGGTCTCTAGATGCTGG 36 74 967

2140 2159 525056 ACTACTAGGTCTCTAGATGC 22 63 968

2143 2162 525057 CTGACTACTAGGTCTCTAGA 28 80 969

2146 2165 525058 TAACTGACTACTAGGTCTCT 47 83 970

2149 2168 525059 ACATAACTGACTACTAGGTC 31 77 971

2152 2171 525060 TTGACATAACTGACTACTAG 34 75 972

2155 2174 525061 GTGTTGACATAACTGACTAC 42 75 973

2158 2177 525062 TTAGTGTTGACATAACTGAC 48 81 974

2161 2180 525063 ATATTAGTGTTGACATAACT 33 73 975

2164 2183 525064 CCCATATTAGTGTTGACATA 41 82 976

2167 2186 525065 AGGCCCATATTAGTGTTGAC 39 77 977

2170 2189 525066 TTTAGGCCCATATTAGTGTT 46 83 978

2173 2192 525067 AACTTTAGGCCCATATTAGT 38 69 979

2176 2195 525068 CTGAACTTTAGGCCCATATT 41 85 980

2179 2198 525069 TGCCTGAACTTTAGGCCCAT 38 81 981

2182 2201 525070 AGTTGCCTGAACTTTAGGCC 17 67 982

2185 2204 525071 AAGAGTTGCCTGAACTTTAG 27 62 983

2188 2207 525072 CACAAGAGTTGCCTGAACTT 27 64 984

2191 2210 525073 AACCACAAGAGTTGCCTGAA 41 80 985

2194 2213 525074 TGAAACCACAAGAGTTGCCT 32 75 986

2197 2216 525075 ATGTGAAACCACAAGAGTTG 43 67 987

2200 2219 525076 GAAATGTGAAACCACAAGAG 34 74 988

2203 2222 525077 CAAGAAATGTGAAACCACAA 22 65 989

2206 2225 525078 AGACAAGAAATGTGAAACCA 39 70 990

2209 2228 525079 GTGAGACAAGAAATGTGAAA 32 74 991

2212 2231 525080 AAAGTGAGACAAGAAATGTG 30 63 992

2215 2234 525081 CCAAAAGTGAGACAAGAAAT 25 58 993

2218 2237 525082 CTTCCAAAAGTGAGACAAGA 36 74 994

2221 2240 525083 TCTCTTCCAAAAGTGAGACA 42 84 995

2224 2243 525084 GTTTCTCTTCCAAAAGTGAG 33 75 996 2227 2246 525085 ACGGTTTCTCTTCCAAAAGT 32 68 997

2230 2249 525086 ATAACGGTTTCTCTTCCAAA 51 80 998

2233 2252 525087 TCTATAACGGTTTCTCTTCC 36 77 999

2236 2255 525088 TACTCTATAACGGTTTCTCT 23 69 1000

2239 2258 525089 AAATACTCTATAACGGTTTC 45 77 1001

2242 2261 525090 ACCAAATACTCTATAACGGT 57 82 1002

2245 2264 525091 GACACCAAATACTCTATAAC 36 77 1003

2248 2267 525092 AAAGACACCAAATACTCTAT 42 80 1004

2251 2270 525093 CCGAAAGACACCAAATACTC 41 89 1005

2254 2273 525094 ACTCCGAAAGACACCAAATA 29 73 1006

2257 2276 525095 CACACTCCGAAAGACACCAA 33 92 1007

2260 2279 525096 ATCCACACTCCGAAAGACAC 18 74 1008

2263 2282 525097 CGAATCCACACTCCGAAAGA 30 57 1009

2266 2285 525098 GTGCGAATCCACACTCCGAA 28 67 1010

2269 2288 146789 GGAGTGCGAATCCACACTCC 37 72 101 1

2272 2291 525099 GGAGGAGTGCGAATCCACAC 36 64 1012

2275 2294 525100 GCTGGAGGAGTGCGAATCCA 52 90 1013

2278 2297 525101 TAAGCTGGAGGAGTGCGAAT 49 96 1014

2281 2300 525102 CTATAAGCTGGAGGAGTGCG 37 96 1015

2284 2303 525103 GGTCTATAAGCTGGAGGAGT 30 97 1016

2287 2306 525104 GGTGGTCTATAAGCTGGAGG 22 77 1017

2290 2309 525105 TTTGGTGGTCTATAAGCTGG 41 76 1018

2293 2312 525106 GCATTTGGTGGTCTATAAGC 39 76 1019

2313 2332 525107 GAAGTGTTGATAGGATAGGG 27 97 1020

2316 2335 525108 CCGGAAGTGTTGATAGGATA 42 97 1021

2319 2338 525109 TTTCCGGAAGTGTTGATAGG 48 99 1022

2322 2341 5251 10 TAGTTTCCGGAAGTGTTGAT 18 98 1023

2325 2344 5251 1 1 CAGTAGTTTCCGGAAGTGTT 19 98 1024

2328 2347 5251 12 CAACAGTAGTTTCCGGAAGT 29 96 1025

2331 2350 5251 13 TAACAACAGTAGTTTCCGGA 39 95 1026

2334 2353 5251 14 GTCTAACAACAGTAGTTTCC 40 99 1027

2369 2388 5251 15 CGAGGGAGTTCTTCTTCTAG 42 98 1028

2372 2391 5251 16 AGGCGAGGGAGTTCTTCTTC 31 97 1029

2375 2394 5251 17 GCGAGGCGAGGGAGTTCTTC 22 98 1030

2379 2398 5251 18 GTCTGCGAGGCGAGGGAGTT 20 99 1031

2398 2417 5251 19 CGCGGCGATTGAGACCTTCG 26 97 1032

2401 2420 525120 CGACGCGGCGATTGAGACCT 23 97 1033

2404 2423 525121 CTGCGACGCGGCGATTGAGA 47 92 1034

2407 2426 525122 CTTCTGCGACGCGGCGATTG 27 74 1035

2410 2429 525123 GATCTTCTGCGACGCGGCGA 36 87 1036

2413 2432 146790 TGAGATCTTCTGCGACGCGG 25 85 1037

2416 2435 525124 GATTGAGATCTTCTGCGACG 17 84 1038

2419 2438 525125 CGAGATTGAGATCTTCTGCG 24 82 1039 2422 2441 525126 TCCCGAGATTGAGATCTTCT 29 74 1040

2425 2444 525127 GGTTCCCGAGATTGAGATCT 14 79 1041

2428 2447 525128 TGAGGTTCCCGAGATTGAGA 41 76 1042

2431 2450 525129 CATTGAGGTTCCCGAGATTG 39 72 1043

2434 2453 525130 TAACATTGAGGTTCCCGAGA 37 71 1044

2437 2456 525131 TACTAACATTGAGGTTCCCG 42 76 1045

2440 2459 525132 GAATACTAACATTGAGGTTC 21 75 1046

2443 2462 525133 AAGGAATACTAACATTGAGG 36 75 1047

2446 2465 525134 TCCAAGGAATACTAACATTG 29 77 1048

2449 2468 525135 GAGTCCAAGGAATACTAACA 32 76 1049

2452 2471 525136 TATGAGTCCAAGGAATACTA 23 62 1050

2455 2474 525137 CCTTATGAGTCCAAGGAATA 27 57 1051

2458 2477 525138 CCACCTTATGAGTCCAAGGA 52 82 1052

2461 2480 525139 TCCCCACCTTATGAGTCCAA 46 80 1053

2464 2483 525140 AGTTCCCCACCTTATGAGTC 14 59 1054

2467 2486 525141 TAAAGTTCCCCACCTTATGA 20 45 1055

2470 2489 525142 CAGTAAAGTTCCCCACCTTA 14 72 1056

2473 2492 525143 GACCAGTAAAGTTCCCCACC 30 77 1057

2476 2495 525144 AAAGACCAGTAAAGTTCCCC 19 72 1058

2479 2498 525145 AATAAAGACCAGTAAAGTTC 18 55 1059

2482 2501 525146 AAGAATAAAGACCAGTAAAG 16 51 1060

2485 2504 525147 TAGAAGAATAAAGACCAGTA 22 68 1061

2488 2507 525148 CAGTAGAAGAATAAAGACCA 13 59 1062

2491 2510 525149 GTACAGTAGAAGAATAAAGA 0 45 1063

2494 2513 525150 CAGGTACAGTAGAAGAATAA 31 62 1064

2497 2516 525151 AGACAGGTACAGTAGAAGAA 8 62 1065

2500 2519 525152 TAAAGACAGGTACAGTAGAA 29 61 1066

2503 2522 525153 GATTAAAGACAGGTACAGTA 28 67 1067

2506 2525 525154 GAGGATTAAAGACAGGTACA 38 76 1068

2509 2528 525155 AATGAGGATTAAAGACAGGT 30 72 1069

2512 2531 525156 TCCAATGAGGATTAAAGACA 24 67 1070

2515 2534 525157 TTTTCCAATGAGGATTAAAG 0 44 1071

2518 2537 525158 GTGTTTTCCAATGAGGATTA 20 74 1072

2521 2540 525159 ATGGTGTTTTCCAATGAGGA 30 71 1073

2524 2543 525160 AAGATGGTGTTTTCCAATGA 22 68 1074

2527 2546 525161 GAAAAGATGGTGTTTTCCAA 19 61 1075

2530 2549 525162 TAGGAAAAGATGGTGTTTTC 14 52 1076

2533 2552 525163 TATTAGGAAAAGATGGTGTT 1 47 1077

2536 2555 525164 GTATATTAGGAAAAGATGGT 0 60 1078

2539 2558 525165 AATGTATATTAGGAAAAGAT 0 30 1079

2542 2561 525166 GTAAATGTATATTAGGAAAA 1 18 1080

2545 2564 525167 GGTGTAAATGTATATTAGGA 23 72 1081

2548 2567 525168 CTTGGTGTAAATGTATATTA 32 75 1082 2551 2570 525169 TGTCTTGGTGTAAATGTATA 12 65 1083

2554 2573 525170 TAATGTCTTGGTGTAAATGT 3 51 1084

2557 2576 525171 TGATAATGTCTTGGTGTAAA 24 62 1085

2560 2579 525172 TTTTGATAATGTCTTGGTGT 18 66 1086

2563 2582 525173 ATTTTTTGATAATGTCTTGG 1 1 63 1087

2566 2585 525174 CACATTTTTTGATAATGTCT 20 68 1088

2569 2588 525175 GTTCACATTTTTTGATAATG 38 68 1089

2572 2591 525176 ACTGTTCACATTTTTTGATA 12 61 1090

2575 2594 525177 CAAACTGTTCACATTTTTTG 25 56 1091

2578 2597 525178 CTACAAACTGTTCACATTTT 21 47 1092

2581 2600 525179 GGCCTACAAACTGTTCACAT 28 83 1093

2584 2603 525180 GTGGGCCTACAAACTGTTCA 7 72 1094

2587 2606 525181 TAAGTGGGCCTACAAACTGT 26 75 1095

2590 2609 525182 CTGTAAGTGGGCCTACAAAC 35 78 1096

2593 2612 525183 TAACTGTAAGTGGGCCTACA 29 69 1097

2596 2615 525184 CATTAACTGTAAGTGGGCCT 22 73 1098

2599 2618 525185 TCTCATTAACTGTAAGTGGG 31 81 1099

2602 2621 525186 TTTTCTCATTAACTGTAAGT 15 58 1100

2605 2624 525187 TTCTTTTCTCATTAACTGTA 14 71 1 101

2608 2627 525188 ATCTTCTTTTCTCATTAACT 19 71 1 102

261 1 2630 525189 GCAATCTTCTTTTCTCATTA 36 79 1 103

2614 2633 525190 ATTGCAATCTTCTTTTCTCA 38 82 1 104

2617 2636 525191 TCAATTGCAATCTTCTTTTC 23 61 1 105

2620 2639 525192 TAATCAATTGCAATCTTCTT 10 67 1 106

2623 2642 525193 GCATAATCAATTGCAATCTT 27 71 1 107

2626 2645 525194 CAGGCATAATCAATTGCAAT 23 71 1 108

2629 2648 525195 TAGCAGGCATAATCAATTGC 30 77 1 109

2632 2651 525196 ACCTAGCAGGCATAATCAAT 7 70 1 110

2635 2654 525197 AAAACCTAGCAGGCATAATC 47 70 1 111

2638 2657 525198 GATAAAACCTAGCAGGCATA 41 81 1 112

2641 2660 525199 TTGGATAAAACCTAGCAGGC 30 78 1 1 13

2644 2663 525200 CCTTTGGATAAAACCTAGCA 31 76 1 1 14

2647 2666 525201 TAACCTTTGGATAAAACCTA 25 63 1 1 15

2650 2669 525202 TGGTAACCTTTGGATAAAAC 24 76 1 116

2653 2672 525203 ATTTGGTAACCTTTGGATAA 20 64 1 117

2656 2675 525204 AATATTTGGTAACCTTTGGA 16 77 1 1 18

2659 2678 525205 GTAAATATTTGGTAACCTTT 39 80 1 1 19

2662 2681 525206 ATGGTAAATATTTGGTAACC 40 75 1 120

2665 2684 525207 CCAATGGTAAATATTTGGTA 38 75 1 121

2668 2687 525208 TATCCAATGGTAAATATTTG 0 0 1 122

2671 2690 525209 CCTTATCCAATGGTAAATAT 28 57 1 123

2674 2693 525210 TACCCTTATCCAATGGTAAA 18 71 1 124

2677 2696 52521 1 TAATACCCTTATCCAATGGT 35 76 1 125 2680 2699 525212 GTTTAATACCCTTATCCAAT 41 77 1 126

2683 2702 525213 AAGGTTTAATACCCTTATCC 11 79 1127

2686 2705 525214 AATAAGGTTTAATACCCTTA 35 75 1128

2689 2708 525215 GATAATAAGGTTTAATACCC 22 54 1129

2692 271 1 525216 CTGGATAATAAGGTTTAATA 19 35 1130

2695 2714 525217 GTTCTGGATAATAAGGTTTA 24 58 1131

2698 2717 525218 GATGTTCTGGATAATAAGGT 20 73 1132

2701 2720 525219 CTAGATGTTCTGGATAATAA 26 66 1 133

2704 2723 525220 TAACTAGATGTTCTGGATAA 21 66 1 134

2707 2726 525221 GATTAACTAGATGTTCTGGA 30 78 1 135

2710 2729 525222 AATGATTAACTAGATGTTCT 30 61 1 136

2713 2732 525223 AGTAATGATTAACTAGATGT 9 57 1137

2716 2735 525224 GGAAGTAATGATTAACTAGA 18 72 1138

2719 2738 525225 TTTGGAAGTAATGATTAACT 7 67 1 139

2722 2741 525226 TAGTTTGGAAGTAATGATTA 2 30 1140

2725 2744 525227 GTCTAGTTTGGAAGTAATGA 27 78 1141

2728 2747 525228 AGTGTCTAGTTTGGAAGTAA 27 75 1142

2731 2750 525229 AATAGTGTCTAGTTTGGAAG 34 73 1143

2734 2753 525230 GTAAATAGTGTCTAGTTTGG 28 68 1144

2737 2756 525231 TGTGTAAATAGTGTCTAGTT 27 79 1145

2740 2759 525232 GAGTGTGTAAATAGTGTCTA 27 71 1146

2743 2762 525233 ATAGAGTGTGTAAATAGTGT 17 75 1 147

2746 2765 525234 TCCATAGAGTGTGTAAATAG 18 75 1 148

2749 2768 525235 CCTTCCATAGAGTGTGTAAA 23 80 1149

2752 2771 525236 CCGCCTTCCATAGAGTGTGT 26 82 1 150

2755 2774 525237 TACCCGCCTTCCATAGAGTG 19 80 1 151

2758 2777 525238 ATATACCCGCCTTCCATAGA 0 67 1 152

2761 2780 525239 ATAATATACCCGCCTTCCAT 19 70 1153

2764 2783 525240 TATATAATATACCCGCCTTC 9 73 1 154

2767 2786 525241 TCTTATATAATATACCCGCC 20 80 1 155

2770 2789 525242 CTCTCTTATATAATATACCC 29 76 1 156

2773 2792 525243 TTTCTCTCTTATATAATATA 16 58 1 157

2776 2795 525244 TTGTTTCTCTCTTATATAAT 26 57 1158

2779 2798 525245 GTGTTGTTTCTCTCTTATAT 35 85 1 159

2782 2801 525246 TATGTGTTGTTTCTCTCTTA 34 82 1160

2785 2804 525247 CGCTATGTGTTGTTTCTCTC 34 86 1 161

2802 2821 525248 TGACCCACAAAATGAGGCGC 17 71 1 162

2805 2824 525249 TGGTGACCCACAAAATGAGG 31 67 1 163

2808 2827 525250 ATATGGTGACCCACAAAATG 38 69 1 164

281 1 2830 525251 AGAATATGGTGACCCACAAA 37 77 1 165

2814 2833 525252 CCAAGAATATGGTGACCCAC 35 79 1 166

2817 2836 146831 TTCCCAAGAATATGGTGACC 27 75 1 167

2820 2839 525253 TTGTTCCCAAGAATATGGTG 33 69 1 168 2823 2842 525254 ATCTTGTTCCCAAGAATATG 27 65 1 169

2826 2845 525255 TAGATCTTGTTCCCAAGAAT 31 70 1 170

2829 2848 525256 CTGTAGATCTTGTTCCCAAG 42 81 1 171

2832 2851 525257 ATGCTGTAGATCTTGTTCCC 34 80 1 172

2835 2854 525258 CCCATGCTGTAGATCTTGTT 38 80 1 173

2838 2857 525259 TGCCCCATGCTGTAGATCTT 36 80 1174

2841 2860 525260 TTCTGCCCCATGCTGTAGAT 32 74 1 175

2844 2863 525261 AGATTCTGCCCCATGCTGTA 27 75 1 176

2847 2866 525262 GAAAGATTCTGCCCCATGCT 34 70 1 177

2850 2869 525263 GTGGAAAGATTCTGCCCCAT 22 76 1 178

2853 2872 525264 CTGGTGGAAAGATTCTGCCC 36 72 1 179

2856 2875 525265 TTGCTGGTGGAAAGATTCTG 32 71 1 180

2859 2878 525266 GGATTGCTGGTGGAAAGATT 20 74 1181

2862 2881 525267 AGAGGATTGCTGGTGGAAAG 25 73 1182

2865 2884 525268 CCCAGAGGATTGCTGGTGGA 40 82 1183

2868 2887 525269 AATCCCAGAGGATTGCTGGT 32 79 1 184

2871 2890 525270 AAGAATCCCAGAGGATTGCT 23 69 1185

2874 2893 525271 GG AAAGAATCCCAGAGGATT 10 66 1186

2877 2896 525272 TCGGGAAAGAATCCCAGAGG 29 73 1 187

2880 2899 525273 TGGTCGGGAAAGAATCCCAG 31 77 1 188

2883 2902 525274 TGGTGGTCGGGAAAGAATCC 38 71 1189

2886 2905 525275 AACTGGTGGTCGGGAAAGAA 33 78 1 190

2889 2908 525276 TCCAACTGGTGGTCGGGAAA 29 76 1191

2892 291 1 525277 GGATCCAACTGGTGGTCGGG 19 81 1192

2895 2914 525278 GCTGGATCCAACTGGTGGTC 24 74 1193

2898 2917 525279 AAGGCTGGATCCAACTGGTG 33 83 1 194

2901 2920 525280 CTGAAGGCTGGATCCAACTG 18 81 1 195

2904 2923 525286 GCTCTGAAGGCTGGATCCAA 40 79 1196

2907 2926 525287 TTTGCTCTGAAGGCTGGATC 34 69 1197

2910 2929 525288 GTGTTTGCTCTGAAGGCTGG 38 72 1 198

2913 2932 525289 GCTGTGTTTGCTCTGAAGGC 40 82 1 199

2916 2935 525290 TTTGCTGTGTTTGCTCTGAA 44 78 1200

2919 2938 525291 GGATTTGCTGTGTTTGCTCT 38 76 1201

2922 2941 525292 TCTGGATTTGCTGTGTTTGC 28 79 1202

2925 2944 525293 CAATCTGGATTTGCTGTGTT 26 61 1203

2928 2947 525294 TCCCAATCTGGATTTGCTGT 32 68 1204

2931 2950 525295 AAGTCCCAATCTGGATTTGC 33 59 1205

2934 2953 146832 TTGAAGTCCCAATCTGGATT 17 35 1206

2937 2956 525296 GGATTGAAGTCCCAATCTGG 35 62 1207

2940 2959 525297 TTGGG ATTG AAGTCCC AATC 10 36 1208

2943 2962 525298 TTGTTGGGATTGAAGTCCCA 24 49 1209

2946 2965 525299 TCCTTGTTGGGATTGAAGTC 16 52 1210

2949 2968 525300 GTGTCCTTGTTGGGATTGAA 18 71 121 1 2952 2971 525301 CAGGTGTCCTTGTTGGGATT 25 73 1212

2955 2974 525302 GGCCAGGTGTCCTTGTTGGG 31 70 1 21 3

2958 2977 525303 TCTGGCCAGGTGTCCTTGTT 29 75 1214

2978 2997 525304 CAGCTCCTACCTTGTTGGCG 29 71 1215

2981 3000 525305 CTCCAGCTCCTACCTTGTTG 19 63 1216

2984 3003 525306 ATGCTCCAGCTCCTACCTTG 35 75 1217

2987 3006 525307 CGAATGCTCCAGCTCCTACC 13 77 1218

2990 3009 525308 GCCCGAATGCTCCAGCTCCT 28 72 1219

2993 3012 525309 CCAGCCCGAATGCTCCAGCT 32 77 1220

2996 3015 525310 AACCCAGCCCGAATGCTCCA 34 72 1221

2999 3018 52531 1 TGAAACCCAGCCCGAATGCT 28 69 1222

3002 3021 525312 GGGTGAAACCCAGCCCGAAT 18 68 1223

3020 3039 525313 AAAGGCCTCCGTGCGGTGGG 36 77 1224

3023 3042 525314 CCAAAAGGCCTCCGTGCGGT 34 83 1225

3026 3045 525315 ACCCCAAAAGGCCTCCGTGC 28 70 1226

3029 3048 525316 TCCACCCCAAAAGGCCTCCG 26 65 1227

3032 3051 525317 GGCTCCACCCCAAAAGGCCT 19 36 1228

3035 3054 525318 GAGGGCTCCACCCCAAAAGG 14 36 1229

3038 3057 525319 CCTGAGGGCTCCACCCCAAA 32 71 1230

3041 3060 525320 GAGCCTGAGGGCTCCACCCC 37 61 1231

3044 3063 525321 CCTGAGCCTGAGGGCTCCAC 42 70 1232

3047 3066 525322 TGCCCTGAGCCTGAGGGCTC 24 56 1233

3050 3069 525323 GTATGCCCTGAGCCTGAGGG 14 75 1234

3053 3072 525324 GTAGTATGCCCTGAGCCTGA 29 83 1235

3056 3075 525325 TTTGTAGTATGCCCTGAGCC 32 61 1236

3059 3078 525326 AAGTTTGTAGTATGCCCTGA 35 70 1237

3062 3081 525327 GCAAAGTTTGTAGTATGCCC 37 61 1238

3065 3084 525328 CTGGCAAAGTTTGTAGTATG 26 63 1239

3068 3087 525329 TTGCTGGCAAAGTTTGTAGT 37 74 1240

3071 3090 525330 GATTTGCTGGCAAAGTTTGT 20 56 1241

3074 3093 525331 GCGGATTTGCTGGCAAAGTT 28 80 1242

3077 3096 525332 GAGGCGGATTTGCTGGCAAA 38 74 1243

3080 3099 525333 CAGGAGGCGGATTTGCTGGC 41 66 1244

3083 3102 525334 AGGCAGGAGGCGGATTTGCT 27 55 1245

3086 3105 525335 TGGAGGCAGGAGGCGGATTT 13 17 1246

3089 3108 525336 TGGTGGAGGCAGGAGGCGGA 7 21 1247

3092 31 1 1 525337 GATTGGTGGAGGCAGGAGGC 21 44 1248

3095 31 14 525338 GGCGATTGGTGGAGGCAGGA 31 65 1249

3098 31 17 525339 TCTGGCGATTGGTGGAGGCA 15 76 1250

3101 3120 525340 CTGTCTGGCGATTGGTGGAG 35 73 1251

3104 3123 525341 TTCCTGTCTGGCGATTGGTG 32 72 1252

3107 3126 525342 GCCTTCCTGTCTGGCGATTG 28 64 1253

31 10 3129 525343 GCTGCCTTCCTGTCTGGCGA 25 69 1254 31 13 3132 525344 TAGGCTGCCTTCCTGTCTGG 32 79 1255

31 16 3135 525345 GGGTAGGCTGCCTTCCTGTC 35 80 1256

3134 3153 525346 TCAAAGGTGGAGACAGCGGG 4 57 1257

3137 3156 525347 TTCTCAAAGGTGGAGACAGC 32 72 1258

3140 3159 525348 TGTTTCTCAAAGGTGGAGAC 32 66 1259

3143 3162 525349 GAGTGTTTCTCAAAGGTGGA 34 63 1260

3146 3165 525350 GATGAGTGTTTCTCAAAGGT 35 68 1261

3149 3168 525351 GAGGATGAGTGTTTCTCAAA 36 84 1262

3152 3171 525352 CCTGAGGATGAGTGTTTCTC 44 77 1263

3155 3174 525353 TGGCCTGAGGATGAGTGTTT 32 72 1264

3158 3177 525354 GCATGGCCTGAGGATGAGTG 27 73 1265

3162 3181 525355 CACTGCATGGCCTGAGGATG 40 69 1266

Table 25

Inhibition of viral HBV mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1286

(RTS3370 and RTS3372)

Example 12: Dose-dependent inhibition of viral HBV RNA in HepG2.2.15 cells by MOE gapmers

Certain gapmers from the study described in Examples 11 and 12 were tested at various doses in human HepG2.2.15 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE 2000® reagent with 5.56 nM, 16.67 nM, 50.0 nM, and 150.0 nM concentrations of antisense oligonucleotide, as specified in Table 26. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide is also presented in Table

26. As illustrated in Table 26, HBV mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells. Table 26

524991 0 7 19 20 >150.0

524997 17 0 1 9 >150.0

524998 1 5 8 34 >150.0

525095 5 0 0 18 >150.0

525100 14 5 14 26 >150.0

525101 0 0 15 19 >150.0

525102 0 0 18 23 >150.0

525103 0 0 3 15 >150.0

525179 18 7 9 18 >150.0

525245 0 0 8 8 >150.0

525247 12 15 16 23 >150.0

525289 1 1 15 30 >150.0

525314 17 0 18 25 >150.0

525324 0 6 13 16 >150.0

525351 28 13 22 30 >150.0

Some of the ISIS-oligonucleotides were also tested using primer probe set RTS3372. The results presented in Table 27.

Table 27

Dose-dependent antisense inhibition of HBV RNA in HepG2.2.15 cells using RTS3372

524984 20 30 38 75 51.7

524985 30 33 40 60 83.6

524986 25 51 51 66 33.8

524987 19 0 24 65 157.6

524988 12 41 45 62 59.2

524991 0 0 4 8 >150.0

524997 19 0 0 15 >150.0

524998 0 0 1 42 >150.0

525095 0 0 0 17 >150.0

525100 10 0 4 19 >150.0

525101 10 0 21 25 >150.0

525102 0 0 10 15 >150.0

525247 1 1 12 15 28 >150.0

525289 0 9 11 33 >150.0

525314 1 0 18 24 >150.0

525324 9 8 15 10 >150.0

Example 13: Dose-dependent inhibition of viral HBV RNA in HepG2.2.15 cells by MOE gapmers

Certain gapmers from the studies described above were tested at various doses in human HepG2.2.15 cells. Cells were plated at a density of 30,000 cells per well and transfected using LipofectAMINE 2000® reagent with 7.8125 nM, 15.625 nM, 31.25 nM, 62.5 nM, 125.0 nM and 250.0 nM concentrations of antisense oligonucleotide, as specified in Table 28. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide is also presented in Table 28. As illustrated in Table 28, HBV mRNA levels were reduced in a dose-dependent manner in several antisense oligonucleotide treated cells.

Table 28

7.8125 15.625 31.25 62.5 125.0 250.0

ISIS No IC₅₀

nM nM nM nM nM nM (nM)

146786 0 0 14 49 33 50 161.2

510100 0 17 30 28 44 53 177.8

510106 0 4 0 0 29 0 >250.0

509934 0 0 0 7 16 0 >250.0 5101 16 0 0 8 21 27 25 >250.0

505347 31 3 30 63 80 81 48.7

Example 14: Antisense inhibition of HBV viral mRNA in HepG2 cells by MOE gapmers

Antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables. ISIS 146786, 509934, ISIS 509959, and ISIS 510100, from the studies described above, were also included. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000® with 70 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 2; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 3; probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID NO: 4) was used to measure mRNA levels. Levels were also measured using primer probe set RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 31 1 ; reverse sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 312; probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO: 313). HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells. In some of the assays shown in Tables 32, 35, 42, 45, and 46, the potency of ISIS 146786 was measured in two wells in a single plate. In those cases, the values of inhibition levels in both wells have been presented.

The newly designed chimeric antisense oligonucleotides in Tables below were designed as either 2-9- 5 MOE gapmers, 2-9-6 MOE gapmers, 2-10-8 MOE gapmers, 3-9-4 MOE gapmers, 3-9-5 MOE gapmers, 3- 10-3 MOE gapmers, 3-10-4 MOE gapmers, 3-10-7 MOE gapmers, 4-9-3 MOE gapmers, 4-9-4 MOE gapmers, 4-10-6 MOE gapmers, 5-9-2 MOE gapmers, 5-9-3 MOE gapmers, 5-10-5 MOE gapmers, 6-9-2 MOE gapmers, 6-10-4 MOE gapmers, 7-10-3 MOE gapmers, or 8-10-2 MOE gapmers. The 2-9-5 MOE gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising two and five nucleosides respectively. The 2-9-6 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of nine 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising two and six nucleosides respectively. The 2-10-8 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising two and eight nucleosides respectively. The 3-9-4 MOE gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising three and four nucleosides respectively. The 3-9-5 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of nine 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising three and five nucleosides respectively. The 3-10-3 MOE gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising three nucleosides each. The 3-10-4 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of ten 2' -deoxynucleosides and is flanked on both sides (in the 5 ' and 3 ' directions) by wings comprising three and four nucleosides respectively. The 3-10-7 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising three and seven nucleosides respectively. The 4-9-3 MOE gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising four and three nucleosides respectively. The 4-9-4 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of nine 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising four nucleosides each. The 4-10-6 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising four and six nucleosides respectively. The 5-

9- 2 MOE gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five and two nucleosides respectively. The 5-9-3 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of nine 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five and three nucleosides respectively. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleosides each. The 6-9-2 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of nine 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising six and two nucleosides respectively. The 6-

10- 4 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising six and four nucleosides respectively. The 7-10-3 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising seven and three nucleosides respectively. The 8-10-2 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2 '-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising eight and two nucleosides respectively. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has an MOE sugar modification. The 'Motif column indicates the motifs with the number of nucleosides in the wings and the gap segment of each of the oligonucleotides. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.

"Viral Target start site" indicates the 5 '-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. The 'Motif column indicates the gap and wing structure of each gapmer. Each gapmer listed in the Tables is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1). The potency of the newly designed oligonucleotides was compared with ISIS 146786, 509934, ISIS 509959, and ISIS 510100, the information of which have been placed at the top of each table.

Table 29

Inhibition of viral HBV mRNA levels by chimeric antisense oligonucleotides measured with RTS3370

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 50 224

41 1 427 GGCATAGCAGCAGGATG 510100 3-10-4 62 17

58 74 CTGGAGCCACCAGCAGG 552276 5-9-3 42 1288

59 75 ACTGGAGCCACCAGCAG 552277 5-9-3 46 1289

60 76 AACTGGAGCCACCAGCA 552278 5-9-3 31 1290

61 77 GAACTGGAGCCACCAGC 552279 5-9-3 41 1291

253 269 GAAGTCCACCACGAGTC 552280 5-9-3 5 9

254 270 AGAAGTCCACCACGAGT 552281 5-9-3 1 1 10

255 271 GAGAAGTCCACCACGAG 552282 5-9-3 20 11

256 272 AGAGAAGTCCACCACGA 552283 5-9-3 28 12

411 427 GGCATAGCAGCAGGATG 552230 4-9-4 57 17

411 427 GGCATAGCAGCAGGATG 552284 5-9-3 0 17

412 428 AGGCATAGCAGCAGGAT 552231 4-9-4 29 18

412 428 AGGCATAGCAGCAGGAT 552285 5-9-3 61 18

413 429 GAGGCATAGCAGCAGGA 552232 4-9-4 35 19

413 429 GAGGCATAGCAGCAGGA 552286 5-9-3 47 19

414 430 TGAGGCATAGCAGCAGG 552233 4-9-4 38 21

414 430 TGAGGCATAGCAGCAGG 552287 5-9-3 45 21

415 431 ATGAGGCATAGCAGCAG 552234 4-9-4 0 23

415 431 ATGAGGCATAGCAGCAG 552288 5-9-3 50 23

416 432 GATGAGGCATAGCAGCA 552235 4-9-4 0 25

416 432 GATGAGGCATAGCAGCA 552289 5-9-3 46 25

417 433 AGATGAGGCATAGCAGC 552236 4-9-4 45 27

417 433 AGATGAGGCATAGCAGC 552290 5-9-3 41 27

418 434 AAGATGAGGCATAGCAG 552237 4-9-4 44 29 418 434 AAGATGAGGCATAGCAG 552291 5-9-3 26 29

670 686 ACTAGTAAACTGAGCCA 552239 4-9-4 62 1292

670 686 ACTAGTAAACTGAGCCA 552293 5-9-3 67 1292

671 687 CACTAGTAAACTGAGCC 552240 4-9-4 61 1293

671 687 CACTAGTAAACTGAGCC 552294 5-9-3 71 1293

672 688 GCACTAGTAAACTGAGC 552241 4-9-4 55 1294

672 688 GCACTAGTAAACTGAGC 552295 5-9-3 58 1294

687 703 ACCACTGAACAAATGGC 552242 4-9-4 60 40

687 703 ACCACTGAACAAATGGC 552296 5-9-3 59 40

688 704 AACCACTGAACAAATGG 552243 4-9-4 57 41

688 704 AACCACTGAACAAATGG 552297 5-9-3 55 41

689 705 GAACCACTGAACAAATG 552244 4-9-4 33 42

689 705 GAACCACTGAACAAATG 552298 5-9-3 48 42

690 706 CGAACCACTGAACAAAT 552245 4-9-4 48 43

690 706 CGAACCACTGAACAAAT 552299 5-9-3 34 43

1261 1277 CGCAGTATGGATCGGCA 552246 4-9-4 81 1295

1261 1277 CGCAGTATGGATCGGCA 552300 5-9-3 56 1295

1262 1278 CCGCAGTATGGATCGGC 552247 4-9-4 87 1296

1262 1278 CCGCAGTATGGATCGGC 552301 5-9-3 86 1296

1263 1279 TCCGCAGTATGGATCGG 552248 4-9-4 72 1297

1263 1279 TCCGCAGTATGGATCGG 552302 5-9-3 77 1297

1264 1280 TTCCGCAGTATGGATCG 552249 4-9-4 56 1298

1264 1280 TTCCGCAGTATGGATCG 552303 5-9-3 65 1298

1265 1281 GTTCCGCAGTATGGATC 552250 4-9-4 52 1299

1265 1281 GTTCCGCAGTATGGATC 552304 5-9-3 57 1299

1266 1282 AGTTCCGCAGTATGGAT 552251 4-9-4 43 1300

1266 1282 AGTTCCGCAGTATGGAT 552305 5-9-3 56 1300

1267 1283 GAGTTCCGCAGTATGGA 552252 4-9-4 62 1301

1267 1283 GAGTTCCGCAGTATGGA 552306 5-9-3 75 1301

1268 1284 GGAGTTCCGCAGTATGG 552253 4-9-4 82 1302

1268 1284 GGAGTTCCGCAGTATGG 552307 5-9-3 90 1302

1269 1285 AGGAGTTCCGCAGTATG 552254 4-9-4 74 1303

1577 1593 AAGCGAAGTGCACACGG 552255 4-9-4 78 1304

1578 1594 GAAGCGAAGTGCACACG 552256 4-9-4 65 1305

1579 1595 TGAAGCGAAGTGCACAC 552257 4-9-4 62 1306

1580 1596 GTGAAGCGAAGTGCACA 552258 4-9-4 72 1307

1581 1597 GGTGAAGCGAAGTGCAC 552259 4-9-4 63 1308

1582 1598 AGGTGAAGCGAAGTGCA 552260 4-9-4 58 1309

1583 1599 GAGGTGAAGCGAAGTGC 552261 4-9-4 63 1310

1584 1600 AGAGGTGAAGCGAAGTG 552262 4-9-4 50 131 1

1585 1601 CAGAGGTGAAGCGAAGT 552263 4-9-4 60 1312

1586 1602 GCAGAGGTGAAGCGAAG 552264 4-9-4 52 1313

1587 1603 TGCAGAGGTGAAGCGAA 552265 4-9-4 68 1314 1588 1604 GTGCAGAGGTGAAGCGA 552266 4-9-4 62 1315

1589 1605 CGTGCAGAGGTGAAGCG 552267 4-9-4 58 1316

1590 1606 ACGTGCAGAGGTGAAGC 552268 4-9-4 62 1317

1778 1794 TTATGCCTACAGCCTCC 552269 4-9-4 52 47

1779 1795 TTTATGCCTACAGCCTC 552270 4-9-4 54 49

1780 1796 ATTTATGCCTACAGCCT 552271 4-9-4 58 51

1781 1797 AATTTATGCCTACAGCC 552272 4-9-4 40 53

1782 1798 CAATTTATGCCTACAGC 552273 4-9-4 34 54

1783 1799 CCAATTTATGCCTACAG 552274 4-9-4 34 55

1784 1800 ACCAATTTATGCCTACA 552275 4-9-4 39 56

Table 30

417 432 GATGAGGCATAGCAGC 552451 3-9-4 39 151

418 433 AGATGAGGCATAGCAG 552396 2-9-5 62 153

418 433 AGATGAGGCATAGCAG 552452 3-9-4 57 153

457 473 ACGGGCAACATACCTTG 552238 4-9-4 38 33

457 473 ACGGGCAACATACCTTG 552292 5-9-3 48 33

457 473 ACGGGCAACATACCTTG 552346 6-9-2 0 33

457 472 CGGGCAACATACCTTG 552397 2-9-5 63 167

457 472 CGGGCAACATACCTTG 552453 3-9-4 56 167

458 473 ACGGGCAACATACCTT 552398 2-9-5 61 168

458 473 ACGGGCAACATACCTT 552454 3-9-4 48 168

670 685 CTAGTAAACTGAGCCA 552399 2-9-5 52 181

671 686 ACTAGTAAACTGAGCC 552400 2-9-5 57 1322

672 687 CACTAGTAAACTGAGC 552401 2-9-5 52 1323

673 688 GCACTAGTAAACTGAG 552402 2-9-5 54 1324

687 702 CCACTGAACAAATGGC 552403 2-9-5 74 188

688 703 ACCACTGAACAAATGG 552404 2-9-5 43 190

689 704 AACCACTGAACAAATG 552405 2-9-5 15 191

690 705 GAACCACTGAACAAAT 552406 2-9-5 37 192

691 706 CGAACCACTGAACAAA 552407 2-9-5 37 194

1261 1276 GCAGTATGGATCGGCA 552408 2-9-5 76 21 1

1262 1277 CGCAGTATGGATCGGC 552409 2-9-5 76 1325

1263 1278 CCGCAGTATGGATCGG 552410 2-9-5 63 1326

1264 1279 TCCGCAGTATGGATCG 55241 1 2-9-5 70 1327

1265 1280 TTCCGCAGTATGGATC 552412 2-9-5 62 1328

1266 1281 GTTCCGCAGTATGGAT 552413 2-9-5 56 1329

1267 1282 AGTTCCGCAGTATGGA 552414 2-9-5 63 1330

1268 1283 GAGTTCCGCAGTATGG 552415 2-9-5 52 1331

1269 1284 GGAGTTCCGCAGTATG 552416 2-9-5 67 1332

1270 1285 AGGAGTTCCGCAGTAT 552417 2-9-5 50 1333

1577 1592 AGCGAAGTGCACACGG 552418 2-9-5 79 1334

1578 1593 AAGCGAAGTGCACACG 552419 2-9-5 70 1335

1579 1594 GAAGCGAAGTGCACAC 552420 2-9-5 71 1336

1580 1595 TGAAGCGAAGTGCACA 552421 2-9-5 69 1337

1581 1596 GTGAAGCGAAGTGCAC 552422 2-9-5 68 1338

1582 1597 GGTGAAGCGAAGTGCA 552423 2-9-5 65 1339

1583 1598 AGGTGAAGCGAAGTGC 552424 2-9-5 70 1340

1584 1599 GAGGTGAAGCGAAGTG 552425 2-9-5 51 1341

1585 1600 AGAGGTGAAGCGAAGT 552426 2-9-5 40 1342

1586 1601 CAGAGGTGAAGCGAAG 552427 2-9-5 35 1343

1587 1602 GCAGAGGTGAAGCGAA 552428 2-9-5 58 1344

1588 1603 TGCAGAGGTGAAGCGA 552429 2-9-5 46 1345

1589 1604 GTGCAGAGGTGAAGCG 552430 2-9-5 53 1346

1590 1605 CGTGCAGAGGTGAAGC 552431 2-9-5 51 1347 1591 1606 ACGTGCAGAGGTGAAG 552432 2-9-5 57 1348

1778 1793 TATGCCTACAGCCTCC 552433 2-9-5 54 230

1779 1794 TTATGCCTACAGCCTC 552434 2-9-5 44 231

1780 1795 TTTATGCCTACAGCCT 552435 2-9-5 46 232

1781 1796 ATTTATGCCTACAGCC 552436 2-9-5 36 233

1782 1797 AATTTATGCCTACAGC 552437 2-9-5 27 234

1783 1798 CAATTTATGCCTACAG 552438 2-9-5 27 235

1784 1799 CCAATTTATGCCTACA 552439 2-9-5 13 236

Table 31

688 703 ACCACTGAACAAATGG 552516 4-9-3 54 190

689 704 AACCACTGAACAAATG 552461 3-9-4 20 191

689 704 AACCACTGAACAAATG 552517 4-9-3 52 191

690 705 GAACCACTGAACAAAT 552462 3-9-4 46 192

690 705 GAACCACTGAACAAAT 552518 4-9-3 34 192

691 706 CGAACCACTGAACAAA 552463 3-9-4 48 194

691 706 CGAACCACTGAACAAA 552519 4-9-3 44 194

1261 1276 GCAGTATGGATCGGCA 552464 3-9-4 81 21 1

1261 1276 GCAGTATGGATCGGCA 552520 4-9-3 69 211

1262 1277 CGCAGTATGGATCGGC 552465 3-9-4 84 1325

1262 1277 CGCAGTATGGATCGGC 552521 4-9-3 80 1325

1263 1278 CCGCAGTATGGATCGG 552466 3-9-4 75 1326

1263 1278 CCGCAGTATGGATCGG 552522 4-9-3 76 1326

1264 1279 TCCGCAGTATGGATCG 552467 3-9-4 65 1327

1264 1279 TCCGCAGTATGGATCG 552523 4-9-3 71 1327

1265 1280 TTCCGCAGTATGGATC 552468 3-9-4 53 1328

1265 1280 TTCCGCAGTATGGATC 552524 4-9-3 43 1328

1266 1281 GTTCCGCAGTATGGAT 552469 3-9-4 51 1329

1266 1281 GTTCCGCAGTATGGAT 552525 4-9-3 57 1329

1267 1282 AGTTCCGCAGTATGGA 552470 3-9-4 46 1330

1267 1282 AGTTCCGCAGTATGGA 552526 4-9-3 60 1330

1268 1283 GAGTTCCGCAGTATGG 552471 3-9-4 54 1331

1268 1283 GAGTTCCGCAGTATGG 552527 4-9-3 72 1331

1269 1284 GGAGTTCCGCAGTATG 552472 3-9-4 78 1332

1269 1284 GGAGTTCCGCAGTATG 552528 4-9-3 78 1332

1270 1285 AGGAGTTCCGCAGTAT 552473 3-9-4 67 1333

1270 1285 AGGAGTTCCGCAGTAT 552529 4-9-3 77 1333

1577 1592 AGCGAAGTGCACACGG 552474 3-9-4 79 1334

1577 1592 AGCGAAGTGCACACGG 552530 4-9-3 78 1334

1578 1593 AAGCGAAGTGCACACG 552475 3-9-4 74 1335

1578 1593 AAGCGAAGTGCACACG 552531 4-9-3 68 1335

1579 1594 GAAGCGAAGTGCACAC 552476 3-9-4 52 1336

1580 1595 TGAAGCGAAGTGCACA 552477 3-9-4 76 1337

1581 1596 GTGAAGCGAAGTGCAC 552478 3-9-4 70 1338

1582 1597 GGTGAAGCGAAGTGCA 552479 3-9-4 67 1339

1583 1598 AGGTGAAGCGAAGTGC 552480 3-9-4 68 1340

1584 1599 GAGGTGAAGCGAAGTG 552481 3-9-4 57 1341

1585 1600 AGAGGTGAAGCGAAGT 552482 3-9-4 51 1342

1586 1601 CAGAGGTGAAGCGAAG 552483 3-9-4 48 1343

1587 1602 GCAGAGGTGAAGCGAA 552484 3-9-4 58 1344

1588 1603 TGCAGAGGTGAAGCGA 552485 3-9-4 51 1345

1589 1604 GTGCAGAGGTGAAGCG 552486 3-9-4 55 1346

1590 1605 CGTGCAGAGGTGAAGC 552487 3-9-4 62 1347 1591 1606 ACGTGCAGAGGTGAAG 552488 3-9-4 51 1348

1778 1793 TATGCCTACAGCCTCC 552489 3-9-4 49 230

1779 1794 TTATGCCTACAGCCTC 552490 3-9-4 51 231

1780 1795 TTTATGCCTACAGCCT 552491 3-9-4 51 232

1781 1796 ATTTATGCCTACAGCC 552492 3-9-4 38 233

1782 1797 AATTTATGCCTACAGC 552493 3-9-4 52 234

1783 1798 CAATTTATGCCTACAG 552494 3-9-4 17 235

1784 1799 CCAATTTATGCCTACA 552495 3-9-4 49 236

Table 32

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

43

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 224

52

414 429 GAGGCATAGCAGCAGG 509959 3-10-3 38 145

58 73 TGGAGCCACCAGCAGG 552552 5-9-2 33 1318

59 74 CTGGAGCCACCAGCAG 552553 5-9-2 46 1319

60 75 ACTGGAGCCACCAGCA 552554 5-9-2 54 1320

61 76 AACTGGAGCCACCAGC 552555 5-9-2 50 1321

62 77 GAACTGGAGCCACCAG 552556 5-9-2 46 86

41 1 426 GCATAGCAGCAGGATG 552557 5-9-2 57 137

412 427 GGCATAGCAGCAGGAT 552558 5-9-2 55 140

413 428 AGGCATAGCAGCAGGA 552559 5-9-2 66 143

414 429 GAGGCATAGCAGCAGG 552560 5-9-2 44 145

415 430 TGAGGCATAGCAGCAG 552561 5-9-2 48 147

416 431 ATGAGGCATAGCAGCA 552562 5-9-2 52 149

417 432 GATGAGGCATAGCAGC 552563 5-9-2 45 151

418 433 AGATGAGGCATAGCAG 552564 5-9-2 41 153

457 472 CGGGCAACATACCTTG 552565 5-9-2 54 167

458 473 ACGGGCAACATACCTT 552566 5-9-2 56 168

670 685 CTAGTAAACTGAGCCA 552567 5-9-2 71 181

671 686 ACTAGTAAACTGAGCC 552568 5-9-2 64 1322

672 687 CACTAGTAAACTGAGC 552569 5-9-2 59 1323

673 688 GCACTAGTAAACTGAG 552570 5-9-2 60 1324

687 702 CCACTGAACAAATGGC 552571 5-9-2 55 188

688 703 ACCACTGAACAAATGG 552572 5-9-2 60 190

689 704 AACCACTGAACAAATG 552573 5-9-2 24 191

690 705 GAACCACTGAACAAAT 552574 5-9-2 34 192

691 706 CGAACCACTGAACAAA 552575 5-9-2 36 194

1261 1276 GCAGTATGGATCGGCA 552576 5-9-2 67 21 1 1262 1277 CGCAGTATGGATCGGC 552577 5-9-2 64 1325

1263 1278 CCGCAGTATGGATCGG 552578 5-9-2 75 1326

1264 1279 TCCGCAGTATGGATCG 552579 5-9-2 75 1327

1265 1280 TTCCGCAGTATGGATC 552580 5-9-2 59 1328

1266 1281 GTTCCGCAGTATGGAT 552581 5-9-2 54 1329

1267 1282 AGTTCCGCAGTATGGA 552582 5-9-2 61 1330

1268 1283 GAGTTCCGCAGTATGG 552583 5-9-2 69 1331

1269 1284 GGAGTTCCGCAGTATG 552584 5-9-2 74 1332

1270 1285 AGGAGTTCCGCAGTAT 552585 5-9-2 62 1333

1577 1592 AGCGAAGTGCACACGG 552586 5-9-2 79 1334

1578 1593 AAGCGAAGTGCACACG 552587 5-9-2 71 1335

1579 1594 GAAGCGAAGTGCACAC 552532 4-9-3 48 1336

1579 1594 GAAGCGAAGTGCACAC 552588 5-9-2 70 1336

1580 1595 TGAAGCGAAGTGCACA 552533 4-9-3 43 1337

1580 1595 TGAAGCGAAGTGCACA 552589 5-9-2 59 1337

1581 1596 GTGAAGCGAAGTGCAC 552534 4-9-3 62 1338

1581 1596 GTGAAGCGAAGTGCAC 552590 5-9-2 70 1338

1582 1597 GGTGAAGCGAAGTGCA 552535 4-9-3 55 1339

1582 1597 GGTGAAGCGAAGTGCA 552591 5-9-2 51 1339

1583 1598 AGGTGAAGCGAAGTGC 552536 4-9-3 3 1340

1583 1598 AGGTGAAGCGAAGTGC 552592 5-9-2 50 1340

1584 1599 GAGGTGAAGCGAAGTG 552537 4-9-3 14 1341

1584 1599 GAGGTGAAGCGAAGTG 552593 5-9-2 46 1341

1585 1600 AGAGGTGAAGCGAAGT 552538 4-9-3 52 1342

1585 1600 AGAGGTGAAGCGAAGT 552594 5-9-2 55 1342

1586 1601 CAGAGGTGAAGCGAAG 552539 4-9-3 47 1343

1586 1601 CAGAGGTGAAGCGAAG 552595 5-9-2 60 1343

1587 1602 GCAGAGGTGAAGCGAA 552540 4-9-3 60 1344

1587 1602 GCAGAGGTGAAGCGAA 552596 5-9-2 63 1344

1588 1603 TGCAGAGGTGAAGCGA 552541 4-9-3 60 1345

1588 1603 TGCAGAGGTGAAGCGA 552597 5-9-2 61 1345

1589 1604 GTGCAGAGGTGAAGCG 552542 4-9-3 64 1346

1589 1604 GTGCAGAGGTGAAGCG 552598 5-9-2 57 1346

1590 1605 CGTGCAGAGGTGAAGC 552543 4-9-3 46 1347

1590 1605 CGTGCAGAGGTGAAGC 552600 5-9-2 59 1347

1591 1606 ACGTGCAGAGGTGAAG 552544 4-9-3 53 1348

1591 1606 ACGTGCAGAGGTGAAG 552602 5-9-2 6 1348

1778 1793 TATGCCTACAGCCTCC 552545 4-9-3 33 230

1778 1793 TATGCCTACAGCCTCC 552604 5-9-2 47 230

1779 1794 TTATGCCTACAGCCTC 552546 4-9-3 42 231

1779 1794 TTATGCCTACAGCCTC 552606 5-9-2 53 231

1780 1795 TTTATGCCTACAGCCT 552547 4-9-3 51 232

1780 1795 TTTATGCCTACAGCCT 552608 5-9-2 53 232 1781 1796 ATTTATGCCTACAGCC 552548 4-9-3 52 233

1781 1796 ATTTATGCCTACAGCC 552610 5-9-2 47 233

1782 1797 AATTTATGCCTACAGC 552549 4-9-3 38 234

1782 1797 AATTTATGCCTACAGC 552612 5-9-2 39 234

1783 1798 CAATTTATGCCTACAG 552550 4-9-3 19 235

1783 1798 CAATTTATGCCTACAG 552614 5-9-2 24 235

1784 1799 CCAATTTATGCCTACA 552551 4-9-3 24 236

1784 1799 CCAATTTATGCCTACA 552616 5-9-2 15 236

Table 33

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 51 224

1780 1799 CCAATTTATGCCTACAGCCT 509934 5-10-5 76 50

58 77 GAACTGGAGCCACCAGCAGG 552007 6-10-4 61 83

58 77 GAACTGGAGCCACCAGCAGG 552039 7-10-3 84 83

253 272 AGAGAAGTCCACCACGAGTC 552008 6-10-4 48 103

253 272 AGAGAAGTCCACCACGAGTC 552040 7-10-3 48 103

411 430 TGAGGCATAGCAGCAGGATG 552009 6-10-4 77 136

41 1 430 TGAGGCATAGCAGCAGGATG 552041 7-10-3 73 136

412 431 ATGAGGCATAGCAGCAGGAT 552010 6-10-4 63 139

412 431 ATGAGGCATAGCAGCAGGAT 552042 7-10-3 66 139

413 432 GATGAGGCATAGCAGCAGGA 55201 1 6-10-4 52 142

413 432 GATGAGGCATAGCAGCAGGA 552043 7-10-3 54 142

414 433 AGATGAGGCATAGCAGCAGG 552012 6-10-4 73 20

414 433 AGATGAGGCATAGCAGCAGG 552044 7-10-3 86 20

415 434 AAGATGAGGCATAGCAGCAG 552013 6-10-4 73 22

415 434 AAGATGAGGCATAGCAGCAG 552045 7-10-3 65 22

416 435 GAAGATGAGGCATAGCAGCA 552014 6-10-4 76 24

416 435 GAAGATGAGGCATAGCAGCA 552046 7-10-3 93 24

417 436 AGAAGATGAGGCATAGCAGC 552015 6-10-4 70 26

417 436 AGAAGATGAGGCATAGCAGC 552047 7-10-3 77 26

418 437 AAGAAGATGAGGCATAGCAG 552016 6-10-4 61 28

418 437 AAGAAGATGAGGCATAGCAG 552048 7-10-3 66 28

687 706 CGAACCACTGAACAAATGGC 552017 6-10-4 73 39

687 706 CGAACCACTGAACAAATGGC 552049 7-10-3 73 39

1261 1280 TTCCGCAGTATGGATCGGCA 552018 6-10-4 98 719

1261 1280 TTCCGCAGTATGGATCGGCA 552050 7-10-3 98 719

1262 1281 GTTCCGCAGTATGGATCGGC 552019 6-10-4 98 212

1262 1281 GTTCCGCAGTATGGATCGGC 552051 7-10-3 99 212 1263 1282 AGTTCCGCAGTATGGATCGG 551986 4-10-6 92 720

1263 1282 AGTTCCGCAGTATGGATCGG 552020 6-10-4 97 720

1263 1282 AGTTCCGCAGTATGGATCGG 552052 7-10-3 98 720

1264 1283 GAGTTCCGCAGTATGGATCG 551987 4-10-6 95 721

1264 1283 GAGTTCCGCAGTATGGATCG 552021 6-10-4 97 721

1264 1283 GAGTTCCGCAGTATGGATCG 552053 7-10-3 98 721

1265 1284 GGAGTTCCGCAGTATGGATC 551988 4-10-6 50 1349

1265 1284 GGAGTTCCGCAGTATGGATC 552005 5-10-5 99 1349

1265 1284 GGAGTTCCGCAGTATGGATC 552022 6-10-4 99 1349

1265 1284 GGAGTTCCGCAGTATGGATC 552054 7-10-3 99 1349

1266 1285 AGGAGTTCCGCAGTATGGAT 551989 4-10-6 96 722

1266 1285 AGGAGTTCCGCAGTATGGAT 552023 6-10-4 99 722

1266 1285 AGGAGTTCCGCAGTATGGAT 552055 7-10-3 98 722

1577 1596 GTGAAGCGAAGTGCACACGG 551990 4-10-6 86 224

1577 1596 GTGAAGCGAAGTGCACACGG 552024 6-10-4 89 224

1577 1596 GTGAAGCGAAGTGCACACGG 552056 7-10-3 88 224

1578 1597 GGTGAAGCGAAGTGCACACG 551991 4-10-6 0 801

1578 1597 GGTGAAGCGAAGTGCACACG 552025 6-10-4 90 801

1578 1597 GGTGAAGCGAAGTGCACACG 552057 7-10-3 92 801

1579 1598 AGGTGAAGCGAAGTGCACAC 551992 4-10-6 72 802

1579 1598 AGGTGAAGCGAAGTGCACAC 552026 6-10-4 88 802

1579 1598 AGGTGAAGCGAAGTGCACAC 552058 7-10-3 86 802

1580 1599 GAGGTGAAGCGAAGTGCACA 551993 4-10-6 82 225

1580 1599 GAGGTGAAGCGAAGTGCACA 552027 6-10-4 87 225

1580 1599 GAGGTGAAGCGAAGTGCACA 552059 7-10-3 88 225

1581 1600 AGAGGTGAAGCGAAGTGCAC 551994 4-10-6 85 804

1581 1600 AGAGGTGAAGCGAAGTGCAC 552028 6-10-4 83 804

1581 1600 AGAGGTGAAGCGAAGTGCAC 552060 7-10-3 82 804

1582 1601 CAGAGGTGAAGCGAAGTGCA 551995 4-10-6 84 805

1582 1601 CAGAGGTGAAGCGAAGTGCA 552029 6-10-4 88 805

1582 1601 CAGAGGTGAAGCGAAGTGCA 552061 7-10-3 85 805

1583 1602 GCAGAGGTGAAGCGAAGTGC 551996 4-10-6 87 226

1583 1602 GCAGAGGTGAAGCGAAGTGC 552030 6-10-4 88 226

1583 1602 GCAGAGGTGAAGCGAAGTGC 552062 7-10-3 85 226

1584 1603 TGCAGAGGTGAAGCGAAGTG 551997 4-10-6 83 806

1584 1603 TGCAGAGGTGAAGCGAAGTG 552031 6-10-4 82 806

1585 1604 GTGCAGAGGTGAAGCGAAGT 551998 4-10-6 85 807

1585 1604 GTGCAGAGGTGAAGCGAAGT 552032 6-10-4 87 807

1586 1605 CGTGCAGAGGTGAAGCGAAG 551999 4-10-6 82 227

1586 1605 CGTGCAGAGGTGAAGCGAAG 552033 6-10-4 87 227

1587 1606 ACGTGCAGAGGTGAAGCGAA 552000 4-10-6 83 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 552006 5-10-5 88 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 552034 6-10-4 89 1350 1778 1797 AATTTATGCCTACAGCCTCC 552001 4-10-6 65 46

1778 1797 AATTTATGCCTACAGCCTCC 552035 6-10-4 60 46

1779 1798 CAATTTATGCCTACAGCCTC 552002 4-10-6 63 48

1779 1798 CAATTTATGCCTACAGCCTC 552036 6-10-4 65 48

1780 1799 CCAATTTATGCCTACAGCCT 552003 4-10-6 65 50

1780 1799 CCAATTTATGCCTACAGCCT 552037 6-10-4 58 50

1781 1800 ACCAATTTATGCCTACAGCC 552004 4-10-6 58 52

1781 1800 ACCAATTTATGCCTACAGCC 552038 6-10-4 70 52

Table 34

672 688 GCACTAGTAAACTGAGC 552187 3-9-5 74 1294

687 703 ACCACTGAACAAATGGC 552188 3-9-5 78 40

688 704 AACCACTGAACAAATGG 552189 3-9-5 57 41

689 705 GAACCACTGAACAAATG 552190 3-9-5 39 42

690 706 CGAACCACTGAACAAAT 552191 3-9-5 60 43

1261 1277 CGCAGTATGGATCGGCA 552192 3-9-5 85 1295

1262 1278 CCGCAGTATGGATCGGC 552193 3-9-5 86 1296

1263 1279 TCCGCAGTATGGATCGG 552194 3-9-5 68 1297

1264 1280 TTCCGCAGTATGGATCG 552195 3-9-5 73 1298

1265 1281 GTTCCGCAGTATGGATC 552196 3-9-5 60 1299

1266 1282 AGTTCCGCAGTATGGAT 552197 3-9-5 60 1300

1267 1283 GAGTTCCGCAGTATGGA 552198 3-9-5 61 1301

1268 1284 GGAGTTCCGCAGTATGG 552199 3-9-5 89 1302

1269 1285 AGGAGTTCCGCAGTATG 552200 3-9-5 85 1303

1577 1593 AAGCGAAGTGCACACGG 552201 3-9-5 81 1304

1578 1594 GAAGCGAAGTGCACACG 552202 3-9-5 76 1305

1579 1595 TGAAGCGAAGTGCACAC 552203 3-9-5 74 1306

1580 1596 GTGAAGCGAAGTGCACA 552204 3-9-5 71 1307

1581 1597 GGTGAAGCGAAGTGCAC 552151 2-9-6 77 1308

1581 1597 GGTGAAGCGAAGTGCAC 552205 3-9-5 78 1308

1582 1598 AGGTGAAGCGAAGTGCA 552152 2-9-6 72 1309

1582 1598 AGGTGAAGCGAAGTGCA 552206 3-9-5 77 1309

1583 1599 GAGGTGAAGCGAAGTGC 552153 2-9-6 67 1310

1583 1599 GAGGTGAAGCGAAGTGC 552207 3-9-5 81 1310

1584 1600 AGAGGTGAAGCGAAGTG 552154 2-9-6 56 131 1

1584 1600 AGAGGTGAAGCGAAGTG 552208 3-9-5 70 1311

1585 1601 CAGAGGTGAAGCGAAGT 552155 2-9-6 61 1312

1585 1601 CAGAGGTGAAGCGAAGT 552209 3-9-5 63 1312

1586 1602 GCAGAGGTGAAGCGAAG 552156 2-9-6 20 1313

1586 1602 GCAGAGGTGAAGCGAAG 552210 3-9-5 75 1313

1587 1603 TGCAGAGGTGAAGCGAA 552157 2-9-6 39 1314

1587 1603 TGCAGAGGTGAAGCGAA 55221 1 3-9-5 75 1314

1588 1604 GTGCAGAGGTGAAGCGA 552158 2-9-6 70 1315

1588 1604 GTGCAGAGGTGAAGCGA 552212 3-9-5 67 1315

1589 1605 CGTGCAGAGGTGAAGCG 552159 2-9-6 74 1316

1589 1605 CGTGCAGAGGTGAAGCG 552213 3-9-5 70 1316

1590 1606 ACGTGCAGAGGTGAAGC 552160 2-9-6 78 1317

1590 1606 ACGTGCAGAGGTGAAGC 552214 3-9-5 79 1317

1778 1794 TTATGCCTACAGCCTCC 552161 2-9-6 56 47

1778 1794 TTATGCCTACAGCCTCC 552215 3-9-5 61 47

1779 1795 TTTATGCCTACAGCCTC 552162 2-9-6 64 49

1779 1795 TTTATGCCTACAGCCTC 552216 3-9-5 62 49

1780 1796 ATTTATGCCTACAGCCT 552163 2-9-6 71 51 1780 1796 ATTTATGCCTACAGCCT 552217 3-9-5 58 51

1781 1797 AATTTATGCCTACAGCC 552164 2-9-6 52 53

1781 1797 AATTTATGCCTACAGCC 552218 3-9-5 56 53

1782 1798 CAATTTATGCCTACAGC 552165 2-9-6 53 54

1782 1798 CAATTTATGCCTACAGC 552219 3-9-5 33 54

1783 1799 CCAATTTATGCCTACAG 552166 2-9-6 41 55

1783 1799 CCAATTTATGCCTACAG 552220 3-9-5 53 55

1784 1800 ACCAATTTATGCCTACA 552167 2-9-6 54 56

1784 1800 ACCAATTTATGCCTACA 552221 3-9-5 31 56

Table 35

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

60

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 224

85

1780 1799 CCAATTTATGCCTACAGCCT 509934 5-10-5 76 50

41 1 427 GGCATAGCAGCAGGATG 510100 3-10-4 73 17

58 77 GAACTGGAGCCACCAGCAGG 552071 8-10-2 79 83

58 74 CTGGAGCCACCAGCAGG 552114 2-9-6 66 1288

59 75 ACTGGAGCCACCAGCAG 5521 15 2-9-6 70 1289

60 76 AACTGGAGCCACCAGCA 552116 2-9-6 68 1290

61 77 GAACTGGAGCCACCAGC 552117 2-9-6 70 1291

253 272 AGAGAAGTCCACCACGAGTC 552072 8-10-2 50 103

253 269 GAAGTCCACCACGAGTC 5521 18 2-9-6 66 9

254 270 AGAAGTCCACCACGAGT 552119 2-9-6 62 10

255 271 GAGAAGTCCACCACGAG 552120 2-9-6 35 1 1

256 272 AGAGAAGTCCACCACGA 552121 2-9-6 39 12

41 1 430 TGAGGCATAGCAGCAGGATG 552073 8-10-2 80 136

41 1 427 GGCATAGCAGCAGGATG 552122 2-9-6 55 17

412 431 ATGAGGCATAGCAGCAGGAT 552074 8-10-2 73 139

412 428 AGGCATAGCAGCAGGAT 552123 2-9-6 75 18

413 432 GATGAGGCATAGCAGCAGGA 552075 8-10-2 78 142

413 429 GAGGCATAGCAGCAGGA 552124 2-9-6 64 19

414 433 AGATGAGGCATAGCAGCAGG 552076 8-10-2 70 20

414 430 TGAGGCATAGCAGCAGG 552125 2-9-6 73 21

415 434 AAGATGAGGCATAGCAGCAG 552077 8-10-2 83 22

415 431 ATGAGGCATAGCAGCAG 552126 2-9-6 64 23

416 435 GAAGATGAGGCATAGCAGCA 552078 8-10-2 80 24

416 432 GATGAGGCATAGCAGCA 552127 2-9-6 72 25

417 436 AGAAGATGAGGCATAGCAGC 552079 8-10-2 86 26 417 433 AGATGAGGCATAGCAGC 552128 2-9-6 76 27

418 437 AAGAAGATGAGGCATAGCAG 552080 8-10-2 83 28

418 434 AAGATGAGGCATAGCAG 552129 2-9-6 72 29

670 686 ACTAGTAAACTGAGCCA 552131 2-9-6 61 1292

671 687 CACTAGTAAACTGAGCC 552132 2-9-6 73 1293

672 688 GCACTAGTAAACTGAGC 552133 2-9-6 75 1294

687 706 CGAACCACTGAACAAATGGC 552081 8-10-2 76 39

687 703 ACCACTGAACAAATGGC 552134 2-9-6 58 40

688 704 AACCACTGAACAAATGG 552135 2-9-6 67 41

689 705 GAACCACTGAACAAATG 552136 2-9-6 65 42

690 706 CGAACCACTGAACAAAT 552137 2-9-6 55 43

1261 1280 TTCCGCAGTATGGATCGGCA 552082 8-10-2 98 719

1261 1277 CGCAGTATGGATCGGCA 552138 2-9-6 82 1295

1262 1281 GTTCCGCAGTATGGATCGGC 552083 8-10-2 99 212

1262 1278 CCGCAGTATGGATCGGC 552139 2-9-6 86 1296

1263 1282 AGTTCCGCAGTATGGATCGG 552084 8-10-2 99 720

1263 1279 TCCGCAGTATGGATCGG 552140 2-9-6 74 1297

1264 1283 GAGTTCCGCAGTATGGATCG 552085 8-10-2 100 721

1264 1280 TTCCGCAGTATGGATCG 552141 2-9-6 67 1298

1265 1284 GGAGTTCCGCAGTATGGATC 552086 8-10-2 100 1349

1265 1281 GTTCCGCAGTATGGATC 552142 2-9-6 45 1299

1266 1285 AGGAGTTCCGCAGTATGGAT 552087 8-10-2 100 722

1266 1282 AGTTCCGCAGTATGGAT 552143 2-9-6 68 1300

1267 1283 GAGTTCCGCAGTATGGA 552144 2-9-6 78 1301

1268 1284 GGAGTTCCGCAGTATGG 552145 2-9-6 88 1302

1269 1285 AGGAGTTCCGCAGTATG 552146 2-9-6 81 1303

1577 1596 GTGAAGCGAAGTGCACACGG 552088 8-10-2 95 224

1577 1593 AAGCGAAGTGCACACGG 552147 2-9-6 88 1304

1578 1597 GGTGAAGCGAAGTGCACACG 552089 8-10-2 93 801

1578 1594 GAAGCGAAGTGCACACG 552148 2-9-6 79 1305

1579 1598 AGGTGAAGCGAAGTGCACAC 552090 8-10-2 87 802

1579 1595 TGAAGCGAAGTGCACAC 552149 2-9-6 81 . 1306

1580 1599 GAGGTGAAGCGAAGTGCACA 552091 8-10-2 88 225

1581 1600 AGAGGTGAAGCGAAGTGCAC 552092 8-10-2 90 804

1582 1601 CAGAGGTGAAGCGAAGTGCA 552093 8-10-2 91 805

1583 1602 GCAGAGGTGAAGCGAAGTGC 552094 8-10-2 88 226

1584 1603 TGCAGAGGTGAAGCGAAGTG 552063 7-10-3 81 806

1584 1603 TGCAGAGGTGAAGCGAAGTG 552095 8-10-2 89 806

1585 1604 GTGCAGAGGTGAAGCGAAGT 552064 7-10-3 85 807

1585 1604 GTGCAGAGGTGAAGCGAAGT 552096 8-10-2 92 807

1586 1605 CGTGCAGAGGTGAAGCGAAG 552065 7-10-3 86 227

1586 1605 CGTGCAGAGGTGAAGCGAAG 552097 8-10-2 93 227

1587 1606 ACGTGCAGAGGTGAAGCGAA 552066 7-10-3 33 1350 1587 1606 ACGTGCAGAGGTGAAGCGAA 552098 8-10-2 88 1350

1778 1797 AATTTATGCCTACAGCCTCC 552067 7-10-3 50 46

1778 1797 AATTTATGCCTACAGCCTCC 552099 8-10-2 70 46

1779 1798 CAATTTATGCCTACAGCCTC 552068 7-10-3 73 48

1779 1798 CAATTTATGCCTACAGCCTC 552100 8-10-2 70 48

1780 1799 CCAATTTATGCCTACAGCCT 552069 7-10-3 73 50

1780 1799 CCAATTTATGCCTACAGCCT 552101 8-10-2 76 50

1781 1800 ACCAATTTATGCCTACAGCC 552070 7-10-3 71 52

1781 1800 ACCAATTTATGCCTACAGCC 552102 8-10-2 64 52

Table 36

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 84 224

41 1 427 GGCATAGCAGCAGGATG 510100 3-10-4 76 17

58 74 CTGGAGCCACCAGCAGG 552330 6-9-2 54 1288

59 75 ACTGGAGCCACCAGCAG 552331 6-9-2 66 1289

60 76 AACTGGAGCCACCAGCA 552332 6-9-2 70 1290

61 77 GAACTGGAGCCACCAGC 552333 6-9-2 55 1291

253 269 GAAGTCCACCACGAGTC 552334 6-9-2 42 9

254 270 AGAAGTCCACCACGAGT 552335 6-9-2 39 10

255 271 GAGAAGTCCACCACGAG 552336 6-9-2 27 1 1

256 272 AGAGAAGTCCACCACGA 552337 6-9-2 74 12

41 1 427 GGCATAGCAGCAGGATG 552338 6-9-2 68 17

412 428 AGGCATAGCAGCAGGAT 552339 6-9-2 71 18

413 429 GAGGCATAGCAGCAGGA 552340 6-9-2 61 19

414 430 TGAGGCATAGCAGCAGG 552341 6-9-2 58 21

415 431 ATGAGGCATAGCAGCAG 552342 6-9-2 55 23

416 432 GATGAGGCATAGCAGCA 552343 6-9-2 63 25

417 433 AGATGAGGCATAGCAGC 552344 6-9-2 51 27

418 434 AAGATGAGGCATAGCAG 552345 6-9-2 65 29

457 473 ACGGGCAACATACCTTG 552346 6-9-2 0 33

670 686 ACTAGTAAACTGAGCCA 552347 6-9-2 84 1292

671 687 CACTAGTAAACTGAGCC 552348 6-9-2 87 1293

672 688 GCACTAGTAAACTGAGC 552349 6-9-2 74 1294

687 703 ACCACTGAACAAATGGC 552350 6-9-2 59 40

688 704 AACCACTGAACAAATGG 552351 6-9-2 60 41

689 705 GAACCACTGAACAAATG 552352 6-9-2 53 42

690 706 CGAACCACTGAACAAAT 552353 6-9-2 0 43

1261 1277 CGCAGTATGGATCGGCA 552354 6-9-2 83 1295 1262 1278 CCGCAGTATGGATCGGC 552355 6-9-2 90 1296

1263 1279 TCCGCAGTATGGATCGG 552356 6-9-2 0 1297

1264 1280 TTCCGCAGTATGGATCG 552357 6-9-2 45 1298

1265 1281 GTTCCGCAGTATGGATC 552358 6-9-2 74 1299

1266 1282 AGTTCCGCAGTATGGAT 552359 6-9-2 72 1300

1267 1283 GAGTTCCGCAGTATGGA 552360 6-9-2 87 1301

1268 1284 GGAGTTCCGCAGTATGG 552361 6-9-2 96 1302

1269 1285 AGGAGTTCCGCAGTATG 552308 5-9-3 81 1303

1269 1285 AGGAGTTCCGCAGTATG 552362 6-9-2 92 1303

1577 1593 AAGCGAAGTGCACACGG 552309 5-9-3 77 1304

1577 1593 AAGCGAAGTGCACACGG 552363 6-9-2 92 1304

1578 1594 GAAGCGAAGTGCACACG 552310 5-9-3 80 1305

1578 1594 GAAGCGAAGTGCACACG 552364 6-9-2 87 1305

1579 1595 TGAAGCGAAGTGCACAC 552311 5-9-3 13 1306

1579 1595 TGAAGCGAAGTGCACAC 552365 6-9-2 84 1306

1580 1596 GTGAAGCGAAGTGCACA 552150 2-9-6 73 1307

1580 1596 GTGAAGCGAAGTGCACA 552312 5-9-3 77 1307

1580 1596 GTGAAGCGAAGTGCACA 552366 6-9-2 87 1307

1581 1597 GGTGAAGCGAAGTGCAC 552313 5-9-3 64 1308

1581 1597 GGTGAAGCGAAGTGCAC 552367 6-9-2 85 1308

1582 1598 AGGTGAAGCGAAGTGCA 552314 5-9-3 73 1309

1582 1598 AGGTGAAGCGAAGTGCA 552368 6-9-2 77 1309

1583 1599 GAGGTGAAGCGAAGTGC 552315 5-9-3 75 1310

1583 1599 GAGGTGAAGCGAAGTGC 552369 6-9-2 75 1310

1584 1600 AGAGGTGAAGCGAAGTG 552316 5-9-3 64 1311

1584 1600 AGAGGTGAAGCGAAGTG 552370 6-9-2 63 1311

1585 1601 CAGAGGTGAAGCGAAGT 552317 5-9-3 99 1312

1585 1601 CAGAGGTGAAGCGAAGT 552371 6-9-2 81 1312

1586 1602 GCAGAGGTGAAGCGAAG 552318 5-9-3 76 1313

1586 1602 GCAGAGGTGAAGCGAAG 552372 6-9-2 65 1313

1587 1603 TGCAGAGGTGAAGCGAA 552319 5-9-3 55 1314

1587 1603 TGCAGAGGTGAAGCGAA 552373 6-9-2 74 1314

1588 1604 GTGCAGAGGTGAAGCGA 552320 5-9-3 68 1315

1588 1604 GTGCAGAGGTGAAGCGA 552374 6-9-2 78 1315

1589 1605 CGTGCAGAGGTGAAGCG 552321 5-9-3 74 1316

1589 1605 CGTGCAGAGGTGAAGCG 552375 6-9-2 81 1316

1590 1606 ACGTGCAGAGGTGAAGC 552322 5-9-3 73 1317

1590 1606 ACGTGCAGAGGTGAAGC 552376 6-9-2 78 1317

1778 1794 TTATGCCTACAGCCTCC 552323 5-9-3 75 47

1778 1794 TTATGCCTACAGCCTCC 552377 6-9-2 70 47

1779 1795 TTTATGCCTACAGCCTC 552324 5-9-3 0 49

1779 1795 TTTATGCCTACAGCCTC 552378 6-9-2 72 49

1780 1796 ATTTATGCCTACAGCCT 552325 5-9-3 70 51 1780 1796 ATTTATGCCTACAGCCT 552379 6-9-2 74 51

1781 1797 AATTTATGCCTACAGCC 552326 5-9-3 63 53

1781 1797 AATTTATGCCTACAGCC 552380 6-9-2 53 53

1782 1798 CAATTTATGCCTACAGC 552327 5-9-3 30 54

1782 1798 CAATTTATGCCTACAGC 552381 6-9-2 26 54

1783 1799 CCAATTTATGCCTACAG 552328 5-9-3 25 55

1783 1799 CCAATTTATGCCTACAG 552382 6-9-2 13 55

1784 1800 ACCAATTTATGCCTACA 552329 5-9-3 33 56

1784 1800 ACCAATTTATGCCTACA 552383 6-9-2 5 56

Table 37

417 436 AGAAGATGAGGCATAGCAGC 551981 4-10-6 63 26

418 437 AAGAAGATGAGGCATAGCAG 551918 2-10-8 59 28

418 437 AAGAAGATGAGGCATAGCAG 551950 3-10-7 71 28

418 437 AAGAAGATGAGGCATAGCAG 551982 4-10-6 63 28

687 706 CGAACCACTGAACAAATGGC 551919 2-10-8 76 39

687 706 CGAACCACTGAACAAATGGC 551951 3-10-7 71 39

687 706 CGAACCACTGAACAAATGGC 551983 4-10-6 73 39

1261 1280 TTCCGCAGTATGGATCGGCA 551920 2-10-8 68 719

1261 1280 TTCCGCAGTATGGATCGGCA 551952 3-10-7 76 719

1261 1280 TTCCGCAGTATGGATCGGCA 551984 4-10-6 81 719

1262 1281 GTTCCGCAGTATGGATCGGC 551921 2-10-8 83 212

1262 1281 GTTCCGCAGTATGGATCGGC 551953 3-10-7 82 212

1262 1281 GTTCCGCAGTATGGATCGGC 551985 4-10-6 76 212

1263 1282 AGTTCCGCAGTATGGATCGG 551922 2-10-8 73 720

1263 1282 AGTTCCGCAGTATGGATCGG 551954 3-10-7 68 720

1264 1283 GAGTTCCGCAGTATGGATCG 551923 2-10-8 59 721

1264 1283 GAGTTCCGCAGTATGGATCG 551955 3-10-7 71 721

1265 1284 GGAGTTCCGCAGTATGGATC 551924 2-10-8 80 1349

1265 1284 GGAGTTCCGCAGTATGGATC 551956 3-10-7 80 1349

1266 1285 AGGAGTTCCGCAGTATGGAT 551925 2-10-8 82 722

1266 1285 AGGAGTTCCGCAGTATGGAT 551957 3-10-7 88 722

1577 1596 GTGAAGCGAAGTGCACACGG 551926 2-10-8 71 224

1577 1596 GTGAAGCGAAGTGCACACGG 551958 3-10-7 74 224

1578 1597 GGTGAAGCGAAGTGCACACG 551927 2-10-8 68 801

1578 1597 GGTGAAGCGAAGTGCACACG 551959 3-10-7 69 801

1579 1598 AGGTGAAGCGAAGTGCACAC 551928 2-10-8 69 802

1579 1598 AGGTGAAGCGAAGTGCACAC 551960 3-10-7 62 802

1580 1599 GAGGTGAAGCGAAGTGCACA 551929 2-10-8 54 225

1580 1599 GAGGTGAAGCGAAGTGCACA 551961 3-10-7 20 225

1581 1600 AGAGGTGAAGCGAAGTGCAC 551930 2-10-8 53 804

1581 1600 AGAGGTGAAGCGAAGTGCAC 551962 3-10-7 60 804

1582 1601 CAGAGGTGAAGCGAAGTGCA 551931 2-10-8 47 805

1582 1601 CAGAGGTGAAGCGAAGTGCA 551963 3-10-7 63 805

1583 1602 GCAGAGGTGAAGCGAAGTGC 551932 2-10-8 68 226

1583 1602 GCAGAGGTGAAGCGAAGTGC 551964 3-10-7 56 226

1584 1603 TGCAGAGGTGAAGCGAAGTG 551933 2-10-8 72 806

1584 1603 TGCAGAGGTGAAGCGAAGTG 551965 3-10-7 67 806

1585 1604 GTGCAGAGGTGAAGCGAAGT 551934 2-10-8 64 807

1585 1604 GTGCAGAGGTGAAGCGAAGT 551966 3-10-7 73 807

1586 1605 CGTGCAGAGGTGAAGCGAAG 551935 2-10-8 68 227

1586 1605 CGTGCAGAGGTGAAGCGAAG 551967 3-10-7 60 227

1587 1606 ACGTGCAGAGGTGAAGCGAA 551936 2-10-8 67 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 551968 3-10-7 63 1350 1778 1797 AATTTATGCCTACAGCCTCC 551937 2-10-8 47 46

1778 1797 AATTTATGCCTACAGCCTCC 551969 3-10-7 36 46

1779 1798 CAATTTATGCCTACAGCCTC 551938 2-10-8 41 48

1779 1798 CAATTTATGCCTACAGCCTC 551970 3-10-7 43 48

1780 1799 CCAATTTATGCCTACAGCCT 551939 2-10-8 53 50

1780 1799 CCAATTTATGCCTACAGCCT 551971 3-10-7 55 50

1781 1800 ACCAATTTATGCCTACAGCC 551940 2-10-8 50 52

1781 1800 ACCAATTTATGCCTACAGCC 551972 3-10-7 58 52

Table 38

Inhibition of viral HBV mRNA levels by chimeric antisense oligonucleotides measured with RTS3371

418 437 AAGAAGATGAGGCATAGCAG 551918 2-10-8 53 28

418 437 AAGAAGATGAGGCATAGCAG 551950 3-10-7 57 28

418 437 AAGAAGATGAGGCATAGCAG 551982 4-10-6 57 28

687 706 CGAACCACTGAACAAATGGC 551919 2-10-8 65 39

687 706 CGAACCACTGAACAAATGGC 551951 3-10-7 57 39

687 706 CGAACCACTGAACAAATGGC 551983 4-10-6 53 39

1261 1280 TTCCGCAGTATGGATCGGCA 551920 2-10-8 57 719

1261 1280 TTCCGCAGTATGGATCGGCA 551952 3-10-7 67 719

1261 1280 TTCCGCAGTATGGATCGGCA 551984 4-10-6 62 719

1262 1281 GTTCCGCAGTATGGATCGGC 551921 2-10-8 60 212

1262 1281 GTTCCGCAGTATGGATCGGC 551953 3-10-7 57 212

1262 1281 GTTCCGCAGTATGGATCGGC 551985 4-10-6 58 212

1263 1282 AGTTCCGCAGTATGGATCGG 551922 2-10-8 63 720

1263 1282 AGTTCCGCAGTATGGATCGG 551954 3-10-7 61 720

1264 1283 GAGTTCCGCAGTATGGATCG 551923 2-10-8 50 721

1264 1283 GAGTTCCGCAGTATGGATCG 551955 3-10-7 44 721

1265 1284 GGAGTTCCGCAGTATGGATC 551924 2-10-8 52 1349

1265 1284 GGAGTTCCGCAGTATGGATC 551956 3-10-7 46 1349

1266 1285 AGGAGTTCCGCAGTATGGAT 551925 2-10-8 54 722

1266 1285 AGGAGTTCCGCAGTATGGAT 551957 3-10-7 51 722

1577 1596 GTGAAGCGAAGTGCACACGG 551926 2-10-8 70 224

1577 1596 GTGAAGCGAAGTGCACACGG 551958 3-10-7 72 224

1578 1597 GGTGAAGCGAAGTGCACACG 551927 2-10-8 60 801

1578 1597 GGTGAAGCGAAGTGCACACG 551959 3-10-7 61 801

1579 1598 AGGTGAAGCGAAGTGCACAC 551928 2-10-8 57 802

1579 1598 AGGTGAAGCGAAGTGCACAC 551960 3-10-7 58 802

1580 1599 GAGGTGAAGCGAAGTGCACA 551929 2-10-8 49 225

1580 1599 GAGGTGAAGCGAAGTGCACA 551961 3-10-7 26 225

1581 1600 AGAGGTGAAGCGAAGTGCAC 551930 2-10-8 54 804

1581 1600 AGAGGTGAAGCGAAGTGCAC 551962 3-10-7 57 804

1582 1601 CAGAGGTGAAGCGAAGTGCA 551931 2-10-8 46 805

1582 1601 CAGAGGTGAAGCGAAGTGCA 551963 3-10-7 56 805

1583 1602 GCAGAGGTGAAGCGAAGTGC 551932 2-10-8 57 226

1583 1602 GCAGAGGTGAAGCGAAGTGC 551964 3-10-7 53 226

1584 1603 TGCAGAGGTGAAGCGAAGTG 551933 2-10-8 65 806

1584 1603 TGCAGAGGTGAAGCGAAGTG 551965 3-10-7 54 806

1585 1604 GTGCAGAGGTGAAGCGAAGT 551934 2-10-8 58 807

1585 1604 GTGCAGAGGTGAAGCGAAGT 551966 3-10-7 69 807

1586 1605 CGTGCAGAGGTGAAGCGAAG 551935 2-10-8 63 227

1586 1605 CGTGCAGAGGTGAAGCGAAG 551967 3-10-7 53 227

1587 1606 ACGTGCAGAGGTGAAGCGAA 551936 2-10-8 67 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 551968 3-10-7 60 1350

1778 1797 AATTTATGCCTACAGCCTCC 551937 2-10-8 51 46 1778 1797 AATTTATGCCTACAGCCTCC 551969 3-10-7 42 46

1779 1798 CAATTTATGCCTACAGCCTC 551938 2-10-8 40 48

1779 1798 CAATTTATGCCTACAGCCTC 551970 3-10-7 38 48

1780 1799 CCAATTTATGCCTACAGCCT 551939 2-10-8 32 50

1780 1799 CCAATTTATGCCTACAGCCT 551971 3-10-7 46 50

1781 1800 ACCAATTTATGCCTACAGCC 551940 2-10-8 39 52

1781 1800 ACCAATTTATGCCTACAGCC 551972 3-10-7 51 52

Table 39

671 687 CACTAGTAAACTGAGCC 552240 4-9-4 54 1293

671 687 CACTAGTAAACTGAGCC 552294 5-9-3 62 1293

672 688 GCACTAGTAAACTGAGC 552241 4-9-4 47 1294

672 688 GCACTAGTAAACTGAGC 552295 5-9-3 63 1294

687 703 ACCACTGAACAAATGGC 552242 4-9-4 61 40

687 703 ACCACTGAACAAATGGC 552296 5-9-3 61 40

688 704 AACCACTGAACAAATGG 552243 4-9-4 55 41

688 704 AACCACTGAACAAATGG 552297 5-9-3 52 41

689 705 GAACCACTGAACAAATG 552244 4-9-4 45 42

689 705 GAACCACTGAACAAATG 552298 5-9-3 27 42

690 706 CGAACCACTGAACAAAT 552245 4-9-4 41 43

690 706 CGAACCACTGAACAAAT 552299 5-9-3 32 43

1261 1277 CGCAGTATGGATCGGCA 552246 4-9-4 67 1295

1261 1277 CGCAGTATGGATCGGCA 552300 5-9-3 57 1295

1262 1278 CCGCAGTATGGATCGGC 552247 4-9-4 74 1296

1262 1278 CCGCAGTATGGATCGGC 552301 5-9-3 76 1296

1263 1279 TCCGCAGTATGGATCGG 552248 4-9-4 65 1297

1263 1279 TCCGCAGTATGGATCGG 552302 5-9-3 68 1297

1264 1280 TTCCGCAGTATGGATCG 552249 4-9-4 38 1298

1264 1280 TTCCGCAGTATGGATCG 552303 5-9-3 59 1298

1265 1281 GTTCCGCAGTATGGATC 552250 4-9-4 43 1299

1265 1281 GTTCCGCAGTATGGATC 552304 5-9-3 30 1299

1266 1282 AGTTCCGCAGTATGGAT 552251 4-9-4 52 1300

1266 1282 AGTTCCGCAGTATGGAT 552305 5-9-3 49 1300

1267 1283 GAGTTCCGCAGTATGGA 552252 4-9-4 51 1301

1267 1283 GAGTTCCGCAGTATGGA 552306 5-9-3 56 1301

1268 1284 GGAGTTCCGCAGTATGG 552253 4-9-4 47 1302

1268 1284 GGAGTTCCGCAGTATGG 552307 5-9-3 49 1302

1269 1285 AGGAGTTCCGCAGTATG 552254 4-9-4 50 1303

1577 1593 AAGCGAAGTGCACACGG 552255 4-9-4 64 1304

1578 1594 GAAGCGAAGTGCACACG 552256 4-9-4 57 1305

1579 1595 TGAAGCGAAGTGCACAC 552257 4-9-4 51 1306

1580 1596 GTGAAGCGAAGTGCACA 552258 4-9-4 62 1307

1581 1597 GGTGAAGCGAAGTGCAC 552259 4-9-4 59 1308

1582 1598 AGGTGAAGCGAAGTGCA 552260 4-9-4 56 1309

1583 1599 GAGGTGAAGCGAAGTGC 552261 4-9-4 54 1310

1584 1600 AGAGGTGAAGCGAAGTG 552262 4-9-4 47 131 1

1585 1601 CAGAGGTGAAGCGAAGT 552263 4-9-4 45 1312

1586 1602 GCAGAGGTGAAGCGAAG 552264 4-9-4 52 1313

1587 1603 TGCAGAGGTGAAGCGAA 552265 4-9-4 58 1314

1588 1604 GTGCAGAGGTGAAGCGA 552266 4-9-4 54 1315

1589 1605 CGTGCAGAGGTGAAGCG 552267 4-9-4 43 1316

1590 1606 ACGTGCAGAGGTGAAGC 552268 4-9-4 57 1317 1778 1794 TTATGCCTACAGCCTCC 552269 4-9-4 34 47

1779 1795 TTTATGCCTACAGCCTC 552270 4-9-4 37 49

1780 1796 ATTTATGCCTACAGCCT 552271 4-9-4 42 51

1781 1797 AATTTATGCCTACAGCC 552272 4-9-4 36 53

1782 1798 CAATTTATGCCTACAGC 552273 4-9-4 25 54

1783 1799 CCAATTTATGCCTACAG 552274 4-9-4 1 1 55

1784 1800 ACCAATTTATGCCTACA 552275 4-9-4 38 56

Table 40

457 473 ACGGGCAACATACCTTG 552130 2-9-6 46 33

457 473 ACGGGCAACATACCTTG 552184 3-9-5 34 33

457 473 ACGGGCAACATACCTTG 552238 4-9-4 41 33

457 473 ACGGGCAACATACCTTG 552292 5-9-3 45 33

457 473 ACGGGCAACATACCTTG 552346 6-9-2 0 33

457 472 CGGGCAACATACCTTG 552397 2-9-5 37 167

457 472 CGGGCAACATACCTTG 552453 3-9-4 45 167

458 473 ACGGGCAACATACCTT 552398 2-9-5 42 168

458 473 ACGGGCAACATACCTT 552454 3-9-4 39 168

670 685 CTAGTAAACTGAGCCA 552399 2-9-5 34 181

671 686 ACTAGTAAACTGAGCC 552400 2-9-5 47 1322

672 687 CACTAGTAAACTGAGC 552401 2-9-5 53 1323

673 688 GCACTAGTAAACTGAG 552402 2-9-5 47 1324

687 702 CCACTGAACAAATGGC 552403 2-9-5 70 188

688 703 ACCACTGAACAAATGG 552404 2-9-5 44 190

689 ^• 704 AACCACTGAACAAATG 552405 2-9-5 0 191

690 705 GAACCACTGAACAAAT 552406 2-9-5 25 192

691 706 CGAACCACTGAACAAA 552407 2-9-5 23 194

1261 1276 GCAGTATGGATCGGCA 552408 2-9-5 73 21 1

1262 1277 CGCAGTATGGATCGGC 552409 2-9-5 71 1325

1263 1278 CCGCAGTATGGATCGG 552410 2-9-5 52 1326

1264 1279 TCCGCAGTATGGATCG 552411 2-9-5 62 1327

1265 1280 TTCCGCAGTATGGATC 552412 2-9-5 50 1328

1266 1281 GTTCCGCAGTATGGAT 552413 2-9-5 55 1329

1267 1282 AGTTCCGCAGTATGGA 552414 2-9-5 64 1330

1268 1283 GAGTTCCGCAGTATGG 552415 2-9-5 45 1331

1269 1284 GGAGTTCCGCAGTATG 552416 2-9-5 45 1332

1270 1285 AGGAGTTCCGCAGTAT 552417 2-9-5 37 1333

1577 1592 AGCGAAGTGCACACGG 552418 2-9-5 73 1334

1578 1593 AAGCGAAGTGCACACG 552419 2-9-5 68 1335

1579 1594 GAAGCGAAGTGCACAC 552420 2-9-5 64 1336

1580 1595 TGAAGCGAAGTGCACA 552421 2-9-5 54 1337

1581 1596 GTGAAGCGAAGTGCAC 552422 2-9-5 60 1338

1582 1597 GGTGAAGCGAAGTGCA 552423 2-9-5 62 1339

1583 1598 AGGTGAAGCGAAGTGC 552424 2-9-5 60 1340

1584 1599 GAGGTGAAGCGAAGTG 552425 2-9-5 46 1341

1585 1600 AGAGGTGAAGCGAAGT 552426 2-9-5 48 1342

1586 1601 CAGAGGTGAAGCGAAG 552427 2-9-5 36 1343

1587 1602 GCAGAGGTGAAGCGAA 552428 2-9-5 57 1344

1588 1603 TGCAGAGGTGAAGCGA 552429 2-9-5 36 1345

1589 1604 GTGCAGAGGTGAAGCG 552430 2-9-5 42 1346

1590 1605 CGTGCAGAGGTGAAGC 552431 2-9-5 60 1347

1591 1606 ACGTGCAGAGGTGAAG 552432 2-9-5 44 1348 1778 1793 TATGCCTACAGCCTCC 552433 2-9-5 55 230

1779 1794 TTATGCCTACAGCCTC 552434 2-9-5 46 231

1780 1795 TTTATGCCTACAGCCT 552435 2-9-5 47 232

1781 1796 ATTTATGCCTACAGCC 552436 2-9-5 25 233

1782 1797 AATTTATGCCTACAGC 552437 2-9-5 19 234

1783 1798 CAATTTATGCCTACAG 552438 2-9-5 25 235

1784 1799 CCAATTTATGCCTACA 552439 2-9-5 22 236

Table 41

689 704 AACCACTGAACAAATG 552517 4-9-3 54 191

690 705 GAACCACTGAACAAAT 552462 3-9-4 42 192

690 705 GAACCACTGAACAAAT 552518 4-9-3 23 192

691 706 CGAACCACTGAACAAA 552463 3-9-4 28 194

691 706 CGAACCACTGAACAAA 552519 4-9-3 32 194

1261 1276 GCAGTATGGATCGGCA 552464 3-9-4 72 211

1261 1276 GCAGTATGGATCGGCA 552520 4-9-3 61 21 1

1262 1277 CGCAGTATGGATCGGC 552465 3-9-4 68 1325

1262 1277 CGCAGTATGGATCGGC 552521 4-9-3 68 1325

1263 1278 CCGCAGTATGGATCGG 552466 3-9-4 76 1326

1263 1278 CCGCAGTATGGATCGG 552522 4-9-3 71 1326

1264 1279 TCCGCAGTATGGATCG 552467 3-9-4 72 1327

1264 1279 TCCGCAGTATGGATCG 552523 4-9-3 73 1327

1265 1280 TTCCGCAGTATGGATC 552468 3-9-4 50 1328

1265 1280 TTCCGCAGTATGGATC 552524 4-9-3 49 1328

1266 1281 GTTCCGCAGTATGGAT 552469 3-9-4 65 1329

1266 1281 GTTCCGCAGTATGGAT 552525 4-9-3 45 1329

1267 1282 AGTTCCGCAGTATGGA 552470 3-9-4 58 1330

1267 1282 AGTTCCGCAGTATGGA 552526 4-9-3 39 1330

1268 1283 GAGTTCCGCAGTATGG 552471 3-9-4 30 1331

1268 1283 GAGTTCCGCAGTATGG 552527 4-9-3 39 1331

1269 1284 GGAGTTCCGCAGTATG 552472 3-9-4 43 1332

1269 1284 GGAGTTCCGCAGTATG 552528 4-9-3 43 1332

1270 1285 AGGAGTTCCGCAGTAT 552473 3-9-4 25 1333

1270 1285 AGGAGTTCCGCAGTAT 552529 4-9-3 50 1333

1577 1592 AGCGAAGTGCACACGG 552474 3-9-4 70 1334

1577 1592 AGCGAAGTGCACACGG 552530 4-9-3 73 1334

1578 1593 AAGCGAAGTGCACACG 552475 3-9-4 64 1335

1578 1593 AAGCGAAGTGCACACG 552531 4-9-3 62 1335

1579 1594 GAAGCGAAGTGCACAC 552476 3-9-4 50 1336

1580 1595 TGAAGCGAAGTGCACA 552477 3-9-4 66 1337

1581 1596 GTGAAGCGAAGTGCAC 552478 3-9-4 68 1338

1582 1597 GGTGAAGCGAAGTGCA 552479 3-9-4 60 1339

1583 1598 AGGTGAAGCGAAGTGC 552480 3-9-4 58 1340

1584 1599 GAGGTGAAGCGAAGTG 552481 3-9-4 54 1341

1585 1600 AGAGGTGAAGCGAAGT 552482 3-9-4 44 1342

1586 1601 CAGAGGTGAAGCGAAG 552483 3-9-4 17 1343

1587 1602 GCAGAGGTGAAGCGAA 552484 3-9-4 64 1344

1588 1603 TGCAGAGGTGAAGCGA 552485 3-9-4 56 1345

1589 1604 GTGCAGAGGTGAAGCG 552486 3-9-4 26 1346

1590 1605 CGTGCAGAGGTGAAGC 552487 3-9-4 42 1347

1591 1606 ACGTGCAGAGGTGAAG 552488 3-9-4 35 1348

1778 1793 TATGCCTACAGCCTCC 552489 3-9-4 46 230 1779 1794 TTATGCCTACAGCCTC 552490 3-9-4 41 231

1780 1795 TTTATGCCTACAGCCT 552491 3-9-4 38 232

1781 1796 ATTTATGCCTACAGCC 552492 3-9-4 47 233

1782 1797 AATTTATGCCTACAGC 552493 3-9-4 49 234

1783 1798 CAATTTATGCCTACAG 552494 3-9-4 22 235

1784 1799 CCAATTTATGCCTACA 552495 3-9-4 0 236

Table 42

1264 1279 TCCGCAGTATGGATCG 552579 5-9-2 59 1327

1265 1280 TTCCGCAGTATGGATC 552580 5-9-2 58 1328

1266 1281 GTTCCGCAGTATGGAT 552581 5-9-2 51 1329

1267 1282 AGTTCCGCAGTATGGA 552582 5-9-2 40 1330

1268 1283 GAGTTCCGCAGTATGG 552583 5-9-2 35 1331

1269 1284 GGAGTTCCGCAGTATG 552584 5-9-2 50 1332

1270 1285 AGGAGTTCCGCAGTAT 552585 5-9-2 48 1333

1577 1592 AGCGAAGTGCACACGG 552586 5-9-2 74 1334

1578 1593 AAGCGAAGTGCACACG 552587 5-9-2 68 1335

1579 1594 GAAGCGAAGTGCACAC 552532 4-9-3 59 1336

1579 1594 GAAGCGAAGTGCACAC 552588 5-9-2 ■ 67 1336

1580 1595 TGAAGCGAAGTGCACA 552533 4-9-3 52 1337

1580 1595 TGAAGCGAAGTGCACA 552589 5-9-2 47 1337

1581 1596 GTGAAGCGAAGTGCAC 552534 4-9-3 71 1338

1581 1596 GTGAAGCGAAGTGCAC 552590 5-9-2 58 1338

1582 1597 GGTGAAGCGAAGTGCA 552535 4-9-3 59 1339

1582 1597 GGTGAAGCGAAGTGCA 552591 5-9-2 46 1339

1583 1598 AGGTGAAGCGAAGTGC 552536 4-9-3 19 1340

1583 1598 AGGTGAAGCGAAGTGC 552592 5-9-2 44 1340

1584 1599 GAGGTGAAGCGAAGTG 552537 4-9-3 26 1341

1584 1599 GAGGTGAAGCGAAGTG 552593 5-9-2 39 1341

1585 1600 AGAGGTGAAGCGAAGT 552538 4-9-3 54 1342

1585 1600 AGAGGTGAAGCGAAGT 552594 5-9-2 52 1342

1586 1601 CAGAGGTGAAGCGAAG 552539 4-9-3 50 1343

1586 1601 CAGAGGTGAAGCGAAG 552595 5-9-2 57 1343

1587 1602 GCAGAGGTGAAGCGAA 552540 4-9-3 60 1344

1587 1602 GCAGAGGTGAAGCGAA 552596 5-9-2 58 1344

1588 1603 TGCAGAGGTGAAGCGA 552541 4-9-3 68 1345

1588 1603 TGCAGAGGTGAAGCGA 552597 5-9-2 52 1345

1589 1604 GTGCAGAGGTGAAGCG 552542 4-9-3 63 1346

1589 1604 GTGCAGAGGTGAAGCG 552598 5-9-2 51 1346 1590 1605 CGTGCAGAGGTGAAGC 552543 4-9-3 44 1347

1590 1605 CGTGCAGAGGTGAAGC 552600 5-9-2 51 1347

1591 1606 ACGTGCAGAGGTGAAG 552544 4-9-3 45 1348

1591 1606 ACGTGCAGAGGTGAAG 552602 5-9-2 13 1348

1778 1793 TATGCCTACAGCCTCC 552545 4-9-3 42 230

1778 1793 TATGCCTACAGCCTCC 552604 5-9-2 42 230

1779 1794 TTATGCCTACAGCCTC 552546 4-9-3 46 231

1779 1794 TTATGCCTACAGCCTC 552606 5-9-2 42 231

1780 1795 TTTATGCCTACAGCCT 552547 4-9-3 38 232

1780 1795 TTTATGCCTACAGCCT 552608 5-9-2 37 232

1781 1796 ATTTATGCCTACAGCC 552548 4-9-3 49 233

1781 1796 ATTTATGCCTACAGCC 552610 5-9-2 41 233 1782 1797 AATTTATGCCTACAGC 552549 4-9-3 34 234

1782 1797 AATTTATGCCTACAGC 552612 5-9-2 23 234

1783 1798 CAATTTATGCCTACAG 552550 4-9-3 13 235

1783 1798 CAATTTATGCCTACAG 552614 5-9-2 1 1 235

1784 1799 CCAATTTATGCCTACA 552551 4-9-3 8 236

1784 1799 CCAATTTATGCCTACA 552616 5-9-2 6 236

Table 43

1263 1282 AGTTCCGCAGTATGGATCGG 552052 7-10-3 87 720

1264 1283 GAGTTCCGCAGTATGGATCG 551987 4-10-6 76 721

1264 1283 GAGTTCCGCAGTATGGATCG 552021 6-10-4 84 721

1264 1283 GAGTTCCGCAGTATGGATCG 552053 7-10-3 75 721

1265 1284 GGAGTTCCGCAGTATGGATC 551988 4-10-6 5 1349

1265 1284 GGAGTTCCGCAGTATGGATC 552005 5-10-5 72 1349

1265 1284 GGAGTTCCGCAGTATGGATC 552022 6-10-4 80 1349

1265 1284 GGAGTTCCGCAGTATGGATC 552054 7-10-3 83 1349

1266 1285 AGGAGTTCCGCAGTATGGAT 551989 4-10-6 64 722

1266 1285 AGGAGTTCCGCAGTATGGAT 552023 6-10-4 78 722

1266 1285 AGGAGTTCCGCAGTATGGAT 552055 7-10-3 57 722

1577 1596 GTGAAGCGAAGTGCACACGG 551990 4-10-6 83 224

1577 1596 GTGAAGCGAAGTGCACACGG 552024 6-10-4 89 224

1577 1596 GTGAAGCGAAGTGCACACGG 552056 7-10-3 82 224

1578 1597 GGTGAAGCGAAGTGCACACG 551991 4-10-6 0 801

1578 1597 GGTGAAGCGAAGTGCACACG 552025 6-10-4 89 801

1578 1597 GGTGAAGCGAAGTGCACACG 552057 7-10-3 89 801

1579 1598 AGGTGAAGCGAAGTGCACAC 551992 4-10-6 67 802

1579 1598 AGGTGAAGCGAAGTGCACAC 552026 6-10-4 84 802

1579 1598 AGGTGAAGCGAAGTGCACAC 552058 7-10-3 82 802

1580 1599 GAGGTGAAGCGAAGTGCACA 551993 4-10-6 78 225

1580 1599 GAGGTGAAGCGAAGTGCACA 552027 6-10-4 85 225

1580 1599 GAGGTGAAGCGAAGTGCACA 552059 7-10-3 85 225

1581 1600 AGAGGTGAAGCGAAGTGCAC 551994 4-10-6 82 804

1581 1600 AGAGGTGAAGCGAAGTGCAC 552028 6-10-4 82 804

1581 1600 AGAGGTGAAGCGAAGTGCAC 552060 7-10-3 74 804

1582 1601 CAGAGGTGAAGCGAAGTGCA 551995 4-10-6 81 805

1582 1601 CAGAGGTGAAGCGAAGTGCA 552029 6-10-4 81 805

1582 1601 CAGAGGTGAAGCGAAGTGCA 552061 7-10-3 81 805

1583 1602 GCAGAGGTGAAGCGAAGTGC 551996 4-10-6 79 226

1583 1602 GCAGAGGTGAAGCGAAGTGC 552030 6-10-4 86 226

1583 1602 GCAGAGGTGAAGCGAAGTGC 552062 7-10-3 85 226

1584 1603 TGCAGAGGTGAAGCGAAGTG 551997 4-10-6 80 806

1584 1603 TGCAGAGGTGAAGCGAAGTG 552031 6-10-4 86 806

1585 1604 GTGCAGAGGTGAAGCGAAGT 551998 4-10-6 74 807

1585 1604 GTGCAGAGGTGAAGCGAAGT 552032 6-10-4 78 807

1586 1605 CGTGCAGAGGTGAAGCGAAG 551999 4-10-6 79 227

1586 1605 CGTGCAGAGGTGAAGCGAAG 552033 6-10-4 80 227

1587 1606 ACGTGCAGAGGTGAAGCGAA 552000 4-10-6 84 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 552006 5-10-5 86 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 552034 6-10-4 81 1350

1778 1797 AATTTATGCCTACAGCCTCC 552001 4-10-6 66 46

1778 1797 AATTTATGCCTACAGCCTCC 552035 6-10-4 55 46 1779 1798 CAATTTATGCCTACAGCCTC 552002 4-10-6 54 48

1779 1798 CAATTTATGCCTACAGCCTC 552036 6-10-4 58 48

1780 1799 CCAATTTATGCCTACAGCCT 552003 4-10-6 50 50

1780 1799 CCAATTTATGCCTACAGCCT 552037 6-10-4 43 50

1781 1800 ACCAATTTATGCCTACAGCC 552004 4-10-6 56 52

1781 1800 ACCAATTTATGCCTACAGCC 552038 6-10-4 66 52

Table 44

689 705 GAACCACTGAACAAATG 552190 3-9-5 47 42

690 706 CGAACCACTGAACAAAT 552191 3-9-5 50 43

1261 1277 CGCAGTATGGATCGGCA 552192 3-9-5 80 1295

1262 1278 CCGCAGTATGGATCGGC 552193 3-9-5 73 1296

1263 1279 TCCGCAGTATGGATCGG 552194 3-9-5 58 1297

1264 1280 TTCCGCAGTATGGATCG 552195 3-9-5 60 1298

1265 1281 GTTCCGCAGTATGGATC 552196 3-9-5 54 1299

1266 1282 AGTTCCGCAGTATGGAT 552197 3-9-5 64 1300

1267 1283 GAGTTCCGCAGTATGGA 552198 3-9-5 62 1301

1268 1284 GGAGTTCCGCAGTATGG 552199 3-9-5 57 1302

1269 1285 AGGAGTTCCGCAGTATG 552200 3-9-5 52 1303

1577 1593 AAGCGAAGTGCACACGG 552201 3-9-5 73 1304

1578 1594 GAAGCGAAGTGCACACG 552202 3-9-5 60 1305

1579 1595 TGAAGCGAAGTGCACAC 552203 3-9-5 60 1306

1580 1596 GTGAAGCGAAGTGCACA 552204 3-9-5 63 1307

1581 1597 GGTGAAGCGAAGTGCAC 552151 2-9-6 71 1308

1581 1597 GGTGAAGCGAAGTGCAC 552205 3-9-5 64 1308

1582 1598 AGGTGAAGCGAAGTGCA 552152 2-9-6 69 1309

1582 1598 AGGTGAAGCGAAGTGCA 552206 3-9-5 71 1309

1583 1599 GAGGTGAAGCGAAGTGC 552153 2-9-6 63 1310

1583 1599 GAGGTGAAGCGAAGTGC 552207 3-9-5 71 1310

1584 1600 AGAGGTGAAGCGAAGTG 552154 2-9-6 56 131 1

1584 1600 AGAGGTGAAGCGAAGTG 552208 3-9-5 52 131 1

1585 1601 CAGAGGTGAAGCGAAGT 552155 2-9-6 61 1312

1585 1601 CAGAGGTGAAGCGAAGT 552209 3-9-5 50 1312

1586 1602 GCAGAGGTGAAGCGAAG 552156 2-9-6 40 1313

1586 1602 GCAGAGGTGAAGCGAAG 552210 3-9-5 66 1313

1587 1603 TGCAGAGGTGAAGCGAA 552157 2-9-6 45 1314

1587 1603 TGCAGAGGTGAAGCGAA 55221 1 3-9-5 63 1314

1588 1604 GTGCAGAGGTGAAGCGA 552158 2-9-6 66 1315

1588 1604 GTGCAGAGGTGAAGCGA 552212 3-9-5 62 1315

1589 1605 CGTGCAGAGGTGAAGCG 552159 2-9-6 68 1316

1589 1605 CGTGCAGAGGTGAAGCG 552213 3-9-5 64 1316

1590 1606 ACGTGCAGAGGTGAAGC 552160 2-9-6 78 1317

1590 1606 ACGTGCAGAGGTGAAGC 552214 3-9-5 72 1317

1778 1794 TTATGCCTACAGCCTCC 552161 2-9-6 57 47

1778 1794 TTATGCCTACAGCCTCC 552215 3-9-5 54 47

1779 1795 TTTATGCCTACAGCCTC 552162 2-9-6 54 49

1779 1795 TTTATGCCTACAGCCTC 552216 3-9-5 49 49

1780 1796 ATTTATGCCTACAGCCT 552163 2-9-6 65 51

1780 1796 ATTTATGCCTACAGCCT 552217 3-9-5 50 51

1781 1797 AATTTATGCCTACAGCC 552164 2-9-6 48 53

1781 1797 AATTTATGCCTACAGCC 552218 3-9-5 39 53 1782 1798 CAATTTATGCCTACAGC 552165 2-9-6 46 54

1782 1798 CAATTTATGCCTACAGC 552219 3-9-5 41 54

1783 1799 CCAATTTATGCCTACAG 552166 2-9-6 42 55

1783 1799 CCAATTTATGCCTACAG 552220 3-9-5 32 55

1784 1800 ACCAATTTATGCCTACA 552167 2-9-6 47 56

1784 1800 ACCAATTTATGCCTACA 552221 3-9-5 33 56

Table 45

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

87

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 224

56

1780 1799 CCAATTTATGCCTACAGCCT 509934 5-10-5 56 50

41 1 427 GGCATAGCAGCAGGATG 510100 3-10-4 69 17

58 77 GAACTGGAGCCACCAGCAGG 552071 8-10-2 73 83

58 74 CTGGAGCCACCAGCAGG 5521 14 2-9-6 64 1288

59 75 ACTGGAGCCACCAGCAG 5521 15 2-9-6 61 1289

60 76 AACTGGAGCCACCAGCA 5521 16 2-9-6 53 1290

61 77 GAACTGGAGCCACCAGC 5521 17 2-9-6 69 1291

253 272 AGAGAAGTCCACCACGAGTC 552072 8-10-2 39 103

253 269 GAAGTCCACCACGAGTC 5521 18 2-9-6 49 9

254 270 AGAAGTCCACCACGAGT 552119 2-9-6 49 10

255 271 GAGAAGTCCACCACGAG 552120 2-9-6 21 1 1

256 272 AGAGAAGTCCACCACGA 552121 2-9-6 27 12

41 1 430 TGAGGCATAGCAGCAGGATG 552073 8-10-2 73 136

41 1 427 GGCATAGCAGCAGGATG 552122 2-9-6 48 17

412 431 ATGAGGCATAGCAGCAGGAT 552074 8-10-2 69 139

412 428 AGGCATAGCAGCAGGAT 552123 2-9-6 68 18

413 432 GATGAGGCATAGCAGCAGGA 552075 8-10-2 78 142

413 429 GAGGCATAGCAGCAGGA 552124 2-9-6 47 19

414 433 AGATGAGGCATAGCAGCAGG 552076 8-10-2 63 20

414 430 TGAGGCATAGCAGCAGG 552125 2-9-6 72 21

415 434 AAGATGAGGCATAGCAGCAG 552077 8-10-2 62 22

415 431 ATGAGGCATAGCAGCAG 552126 2-9-6 64 23

416 435 GAAGATGAGGCATAGCAGCA 552078 8-10-2 59 24

416 432 GATGAGGCATAGCAGCA 552127 2-9-6 65 25

417 436 AGAAGATGAGGCATAGCAGC 552079 8-10-2 80 26

417 433 AGATGAGGCATAGCAGC 552128 2-9-6 78 27

418 437 AAGAAGATGAGGCATAGCAG 552080 8-10-2 74 28

418 434 AAGATGAGGCATAGCAG 552129 2-9-6 68 29 457 473 ACGGGCAACATACCTTG 552130 2-9-6 46 33

670 686 ACTAGTAAACTGAGCCA 552131 2-9-6 61 1292

671 687 CACTAGTAAACTGAGCC 552132 2-9-6 66 1293

672 688 GCACTAGTAAACTGAGC 552133 2-9-6 78 1294

687 706 CGAACCACTGAACAAATGGC 552081 8-10-2 69 39

687 703 ACCACTGAACAAATGGC 552134 2-9-6 68 40

688 704 AACCACTGAACAAATGG 552135 2-9-6 59 41

689 705 GAACCACTGAACAAATG 552136 2-9-6 39 42

690 706 CGAACCACTGAACAAAT 552137 2-9-6 36 43

1261 1280 TTCCGCAGTATGGATCGGCA 552082 8-10-2 86 719

1261 1277 CGCAGTATGGATCGGCA 552138 2-9-6 80 1295

1262 1281 GTTCCGCAGTATGGATCGGC 552083 8-10-2 85 212

1262 1278 CCGCAGTATGGATCGGC 552139 2-9-6 80 1296

1263 1282 AGTTCCGCAGTATGGATCGG 552084 8-10-2 86 720

1263 1279 TCCGCAGTATGGATCGG 552140 2-9-6 70 1297

1264 1283 GAGTTCCGCAGTATGGATCG 552085 8-10-2 83 721

1264 1280 TTCCGCAGTATGGATCG 552141 2-9-6 72 1298

1265 1284 GGAGTTCCGCAGTATGGATC 552086 8-10-2 83 1349

1265 1281 GTTCCGCAGTATGGATC 552142 2-9-6 58 1299

1266 1285 AGGAGTTCCGCAGTATGGAT 552087 8-10-2 77 722

1266 1282 AGTTCCGCAGTATGGAT 552143 2-9-6 70 1300

1267 1283 GAGTTCCGCAGTATGGA 552144 2-9-6 66 . 1301

1268 1284 GGAGTTCCGCAGTATGG 552145 2-9-6 78 1302

1269 1285 AGGAGTTCCGCAGTATG 552146 2-9-6 63 1303

1577 1596 GTGAAGCGAAGTGCACACGG 552088 8-10-2 90 224

1577 1593 AAGCGAAGTGCACACGG 552147 2-9-6 80 1304

1578 1597 GGTGAAGCGAAGTGCACACG 552089 8-10-2 87 801

1578 1594 GAAGCGAAGTGCACACG 552148 2-9-6 74 1305

1579 1598 AGGTGAAGCGAAGTGCACAC 552090 8-10-2 85 802

1579 1595 TGAAGCGAAGTGCACAC 552149 2-9-6 79 1306

1580 1599 GAGGTGAAGCGAAGTGCACA 552091 8-10-2 84 225

1581 1600 AGAGGTGAAGCGAAGTGCAC 552092 8-10-2 86 804

1582 1601 CAGAGGTGAAGCGAAGTGCA 552093 8-10-2 82 805

1583 1602 GCAGAGGTGAAGCGAAGTGC 552094 8-10-2 84 226

1584 1603 TGCAGAGGTGAAGCGAAGTG 552063 7-10-3 79 806

1584 1603 TGCAGAGGTGAAGCGAAGTG 552095 8-10-2 85 806

1585 1604 GTGCAGAGGTGAAGCGAAGT 552064 7-10-3 83 807

1585 1604 GTGCAGAGGTGAAGCGAAGT 552096 8-10-2 88 807

1586 1605 CGTGCAGAGGTGAAGCGAAG 552065 7-10-3 86 227

1586 1605 CGTGCAGAGGTGAAGCGAAG 552097 8-10-2 90 227

1587 1606 ACGTGCAGAGGTGAAGCGAA 552066 7-10-3 35 1350

1587 1606 ACGTGCAGAGGTGAAGCGAA 552098 8-10-2 86 1350

1778 1797 AATTTATGCCTACAGCCTCC 552067 7-10-3 53 46 1778 1797 AATTTATGCCTACAGCCTCC 552099 8-10-2 66 46

1779 1798 CAATTTATGCCTACAGCCTC 552068 7-10-3 70 48

1779 1798 CAATTTATGCCTACAGCCTC 552100 8-10-2 67 48

1780 1799 CCAATTTATGCCTACAGCCT 552069 7-10-3 68 50

1780 1799 CCAATTTATGCCTACAGCCT 552101 8-10-2 65 50

1781 1800 ACCAATTTATGCCTACAGCC 552070 7-10-3 64 52

1781 1800 ACCAATTTATGCCTACAGCC 552102 8-10-2 54 52

Table 46

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

69

1577 1596 GTGAAGCGAAGTGCACACGG 146786 5-10-5 224

57

411 427 GGCATAGCAGCAGGATG 510100 3-10-4 59 17

58 74 CTGGAGCCACCAGCAGG 552330 6-9-2 50 1288

59 75 ACTGGAGCCACCAGCAG 552331 6-9-2 46 1289

60 76 AACTGGAGCCACCAGCA 552332 6-9-2 50 1290

61 77 GAACTGGAGCCACCAGC 552333 6-9-2 48 1291

253 269 GAAGTCCACCACGAGTC 552334 6-9-2 42 9

254 270 AGAAGTCCACCACGAGT 552335 6-9-2 30 10

255 271 GAGAAGTCCACCACGAG 552336 6-9-2 23 1 1

256 272 AGAGAAGTCCACCACGA 552337 6-9-2 42 12

411 427 GGCATAGCAGCAGGATG 552338 6-9-2 40 17

412 428 AGGCATAGCAGCAGGAT 552339 6-9-2 50 18

413 429 GAGGCATAGCAGCAGGA 552340 6-9-2 45 19

414 430 TGAGGCATAGCAGCAGG 552341 6-9-2 44 21

415 431 ATGAGGCATAGCAGCAG 552342 6-9-2 51 23

416 432 GATGAGGCATAGCAGCA 552343 6-9-2 44 25

417 433 AGATGAGGCATAGCAGC 552344 6-9-2 24 27

418 434 AAGATGAGGCATAGCAG 552345 6-9-2 41 29

457 473 ACGGGCAACATACCTTG 552346 6-9-2 0 33

670 686 ACTAGTAAACTGAGCCA 552347 6-9-2 75 1292

671 687 CACTAGTAAACTGAGCC 552348 6-9-2 72 1293

672 688 GCACTAGTAAACTGAGC 552349 6-9-2 65 1294

687 703 ACCACTGAACAAATGGC 552350 6-9-2 42 40

688 704 AACCACTGAACAAATGG 552351 6-9-2 45 41

689 705 GAACCACTGAACAAATG 552352 6-9-2 43 42

690 706 CGAACCACTGAACAAAT 552353 6-9-2 20 43

1261 1277 CGCAGTATGGATCGGCA 552354 6-9-2 70 1295

1262 1278 CCGCAGTATGGATCGGC 552355 6-9-2 66 1296 1263 1279 TCCGCAGTATGGATCGG 552356 6-9-2 62 1297

1264 1280 TTCCGCAGTATGGATCG 552357 6-9-2 53 1298

1265 1281 GTTCCGCAGTATGGATC 552358 6-9-2 57 1299

1266 1282 AGTTCCGCAGTATGGAT 552359 6-9-2 46 1300

1267 1283 GAGTTCCGCAGTATGGA 552360 6-9-2 45 1301

1268 1284 GGAGTTCCGCAGTATGG 552361 6-9-2 44 1302

1269 1285 AGGAGTTCCGCAGTATG 552308 5-9-3 38 1303

1269 1285 AGGAGTTCCGCAGTATG 552362 6-9-2 51 1303

1577 1593 AAGCGAAGTGCACACGG 552309 5-9-3 76 1304

1577 1593 AAGCGAAGTGCACACGG 552363 6-9-2 73 1304

1578 1594 GAAGCGAAGTGCACACG 552310 5-9-3 58 1305

1578 1594 GAAGCGAAGTGCACACG 552364 6-9-2 66 1305

1579 1595 TGAAGCGAAGTGCACAC 55231 1 5-9-3 38 1306

1579 1595 TGAAGCGAAGTGCACAC 552365 6-9-2 64 1306

1580 1596 GTGAAGCGAAGTGCACA 552150 2-9-6 68 1307

1580 1596 GTGAAGCGAAGTGCACA 552312 5-9-3 75 1307

1580 1596 GTGAAGCGAAGTGCACA 552366 6-9-2 55 1307

1581 1597 GGTGAAGCGAAGTGCAC 552313 5-9-3 66 1308

1581 1597 GGTGAAGCGAAGTGCAC 552367 6-9-2 67 1308

1582 1598 AGGTGAAGCGAAGTGCA 552314 5-9-3 56 1309

1582 1598 AGGTGAAGCGAAGTGCA 552368 6-9-2 41 1309

1583 1599 GAGGTGAAGCGAAGTGC 552315 5-9-3 46 1310

1583 1599 GAGGTGAAGCGAAGTGC 552369 6-9-2 52 1310

1584 1600 AGAGGTGAAGCGAAGTG 552316 5-9-3 55 131 1

1584 1600 AGAGGTGAAGCGAAGTG 552370 6-9-2 35 1311

1585 1601 CAGAGGTGAAGCGAAGT 552317 5-9-3 53 1312

1585 1601 CAGAGGTGAAGCGAAGT 552371 6-9-2 58 1312

1586 1602 GCAGAGGTGAAGCGAAG 552318 5-9-3 59 1313

1586 1602 GCAGAGGTGAAGCGAAG 552372 6-9-2 68 1313

1587 1603 TGCAGAGGTGAAGCGAA 552319 5-9-3 56 1314

1587 1603 TGCAGAGGTGAAGCGAA 552373 6-9-2 63 1314

1588 1604 GTGCAGAGGTGAAGCGA 552320 5-9-3 62 1315

1588 1604 GTGCAGAGGTGAAGCGA 552374 6-9-2 70 1315

1589 1605 CGTGCAGAGGTGAAGCG 552321 5-9-3 63 1316

1589 1605 CGTGCAGAGGTGAAGCG 552375 6-9-2 64 1316

1590 1606 ACGTGCAGAGGTGAAGC 552322 5-9-3 52 1317

1590 1606 ACGTGCAGAGGTGAAGC 552376 6-9-2 58 1317

1778 1794 TTATGCCTACAGCCTCC 552323 5-9-3 45 47

1778 1794 TTATGCCTACAGCCTCC 552377 6-9-2 42 47

1779 1795 TTTATGCCTACAGCCTC 552324 5-9-3 49 49

1779 1 95 TTTATGCCTACAGCCTC 552378 6-9-2 37 49

1780 1796 ATTTATGCCTACAGCCT 552325 5-9-3 48 51

1780 1796 ATTTATGCCTACAGCCT 552379 6-9-2 57 51 1781 1797 AATTTATGCCTACAGCC 552326 5-9-3 50 53

1781 1797 AATTTATGCCTACAGCC 552380 6-9-2 48 53

1782 1798 CAATTTATGCCTACAGC 552327 5-9-3 13 54

1782 1798 CAATTTATGCCTACAGC 552381 6-9-2 22 54

1783 1799 CCAATTTATGCCTACAG 552328 5-9-3 9 55

1783 1799 CCAATTTATGCCTACAG 552382 6-9-2 20 55

1784 1800 ACCAATTTATGCCTACA 552329 5-9-3 18 56

1784 1800 ACCAATTTATGCCTACA 552383 6-9-2 18 56

Example 15: Antisense inhibition of HBV viral mRNA in HepG2 cells by deoxy, MOE and (S)-cEt gapmers

Antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. ISIS 146786 and ISIS 509934, which were described in an earlier application (U.S. Provisional Application No. 61/478,040 filed on April 21 , 201 1), were also included in these studies for comparison. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000® with 70 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 1 ; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 2; probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID NO: 3) was used to measure mRNA levels. Levels were also measured using primer probe set RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ED NO: 31 1 ; reverse sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 312; probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO: 313). HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Tables below were designed as deoxy, MOE and (S)-cEt gapmers. The gapmers are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; and 'e' indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. "Viral Target start site" indicates the 5 '-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. Each gapmer listed in the Tables is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1). The potency of the newly designed oligonucleotides was compared with ISIS 146786, 509934, ISIS 509959, and ISIS 510100.

Table 47

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

1780 1799 CCAATTTATGCCTACAGCCT 509934 eeeee-10-eeeee 30 50

58 73 TGGAGCCACCAGCAGG 552787 ekk-10-kke 57 1318

59 74 CTGGAGCCACCAGCAG 552788 ekk-10-kke 60 1319

60 75 ACTGGAGCCACCAGCA 552789 ekk-10-kke 67 1320

61 76 AACTGGAGCCACCAGC 552790 ekk-10-kke 67 1321

62 77 GAACTGGAGCCACCAG 552791 ekk-10-kke 65 86

245 260 CACGAGTCTAGACTCT 552792 ekk-10-kke 44 93

246 261 CCACGAGTCTAGACTC 552793 ekk-10-kke 0 95

250 265 TCCACCACGAGTCTAG 552794 ekk-10-kke 54 98

251 266 GTCCACCACGAGTCTA 552795 ekk-10-kke 55 100

252 267 AGTCCACCACGAGTCT 552796 ekk-10-kke 62 102

253 268 AAGTCCACCACGAGTC 552797 ekk-10-kke 59 104

254 269 GAAGTCCACCACGAGT 552798 ekk-10-kke 59 106

255 270 AGAAGTCCACCACGAG 552799 ekk-10-kke 58 109

256 271 GAGAAGTCCACCACGA 552800 ekk-10-kke 62 1 12

258 273 GAGAGAAGTCCACCAC 552801 ekk-10-kke 65 1 15

259 274 TGAGAGAAGTCCACCA 552802 ekk-10-kke 53 117

411 426 GCATAGCAGCAGGATG 552803 ekk-10-kke 67 137

412 427 GGCATAGCAGCAGGAT 552804 ekk-10-kke 75 140

413 428 AGGCATAGCAGCAGGA 552805 ekk-10-kke 72 143

414 429 GAGGCATAGCAGCAGG 552806 ekk-10-kke 64 145

415 430 TGAGGCATAGCAGCAG 552807 ekk-10-kke 68 147

416 431 ATGAGGCATAGCAGCA 552808 ekk-10-kke 65 149

417 432 GATGAGGCATAGCAGC 552809 ekk-10-kke 60 151

418 433 AGATGAGGCATAGCAG 552810 ekk-10-kke 59 153

419 434 AAGATGAGGCATAGCA 552811 ekk-10-kke 64 155

420 435 G AAG ATGAGGC AT AG C 552812 ekk-10-kke 69 157

421 436 AGAAGATGAGGCATAG 552813 ekk-10-kke 64 159

422 437 AAGAAGATGAGGCATA 552814 ekk-10-kke 62 161

457 472 CGGGCAACATACCTTG 552815 ekk-10-kke 61 167

458 473 ACGGGCAACATACCTT 552816 ekk-10-kke 63 168 639 654 GGCCCACTCCCATAGG 552817 ekk-10-kke 42 176

641 656 GAGGCCCACTCCCATA 552818 ekk-10-kke 44 177

642 657 TGAGGCCCACTCCCAT 552819 ekk-10-kke 56 178

643 658 CTGAGGCCCACTCCCA 552820 ekk-10-kke 59 179

670 685 CTAGTAAACTGAGCCA 552821 ekk-10-kke 76 181

671 686 ACTAGTAAACTGAGCC 552822 ekk-10-kke 77 1322

672 687 CACTAGTAAACTGAGC 552823 ekk-10-kke 73 1323

673 688 GCACTAGTAAACTGAG 552824 ekk-10-kke 73 1324

678 693 AAATGGCACTAGTAAA 552825 ekk-10-kke 51 1364

679 694 CAAATGGCACTAGTAA 552826 ekk-10-kke 55 1365

680 695 ACAAATGGCACTAGTA 552827 ekk-10-kke 67 1366

681 696 AACAAATGGCACTAGT 552828 ekk-10-kke 78 1367

682 697 GAACAAATGGCACTAG 552829 ekk-10-kke 72 1368

683 698 TGAACAAATGGCACTA 552830 ekk-10-kke 71 1369

684 699 CTGAACAAATGGCACT 552831 ekk-10-kke 69 1370

685 700 ACTGAACAAATGGCAC 552832 ekk-10-kke 67 1371

686 701 CACTGAACAAATGGCA 552833 ekk-10-kke 65 1372

687 702 CCACTGAACAAATGGC 552834 ekk-10-kke 78 188

688 703 ACCACTGAACAAATGG 552835 ekk-10-kke 70 190

689 704 AACCACTGAACAAATG 552836 ekk-10-kke 64 191

690 705 GAACCACTGAACAAAT 552837 ekk-10-kke 65 192

691 706 CGAACCACTGAACAAA 552838 ekk-10-kke 64 194

738 753 CCACATCATCCATATA 552839 ekk-10-kke 60 199

739 754 ACCACATCATCCATAT 552840 ekk-10-kke 35 201

1176 1191 CAGCAAACACTTGGCA 552841 ekk-10-kke 62 208

1 177 1 192 TCAGCAAACACTTGGC 552842 ekk-10-kke 67 209

1261 1276 GCAGTATGGATCGGCA 552843 ekk-10-kke 77 21 1

1262 1277 CGCAGTATGGATCGGC 552844 ekk-10-kke 81 1325

1263 1278 CCGCAGTATGGATCGG 552845 ekk-10-kke 63 1326

1264 1279 TCCGCAGTATGGATCG 552846 ekk-10-kke 79 1327

1265 1280 TTCCGCAGTATGGATC 552847 ekk-10-kke 47 1328

1266 1281 GTTCCGCAGTATGGAT 552848 ekk-10-kke 69 1329

1267 1282 AGTTCCGCAGTATGGA 552849 ekk-10-kke 59 1330

1268 1283 GAGTTCCGCAGTATGG 552850 ekk-10-kke 83 1331

1269 1284 GGAGTTCCGCAGTATG 552851 ekk-10-kke 90 1332

1270 1285 AGGAGTTCCGCAGTAT 552852 ekk-10-kke 89 1333

1577 1592 AGCGAAGTGCACACGG 552853 ekk-10-kke 83 1334

1578 1593 AAGCGAAGTGCACACG 552854 ekk-10-kke 80 1335

1579 1594 GAAGCGAAGTGCACAC 552855 ekk-10-kke 75 1336

1580 1595 TGAAGCGAAGTGCACA 552856 ekk-10-kke 69 1337

1581 1596 GTGAAGCGAAGTGCAC 552857 ekk-10-kke 68 1338

1582 1597 GGTGAAGCGAAGTGCA 552858 ekk-10-kke 79 1339

1583 1598 AGGTGAAGCGAAGTGC 552859 ekk-10-kke 79 1340 1584 1599 GAGGTGAAGCGAAGTG 552860 ekk-10-kke 71 1341

1585 1600 AGAGGTGAAGCGAAGT 552861 ekk-10-kke 68 1342

1586 1601 CAGAGGTGAAGCGAAG 552862 ekk-10-kke 65 1343

1587 1602 GCAGAGGTGAAGCGAA 552863 ekk-10-kke 70 1344

1588 1603 TGCAGAGGTGAAGCGA 552864 ekk-10-kke 71 1345

Table 48

Viral Viral

Target Target % SEQ ED

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

58 73 TGGAGCCACCAGCAGG 552787 ekk-10-kke 53 1318

59 74 CTGGAGCCACCAGCAG 552788 ekk-10-kke 45 1319

60 75 ACTGGAGCCACCAGCA 552789 ekk-10-kke 75 1320

61 76 AACTGGAGCCACCAGC 552790 ekk-10-kke 68 1321

62 77 GAACTGGAGCCACCAG 552791 ekk-10-kke 51 86

245 260 CACGAGTCTAGACTCT 552792 ekk-10-kke 38 93

246 261 CCACGAGTCTAGACTC 552793 ekk-10-kke 0 95

250 265 TCCACCACGAGTCTAG 552794 ekk-10-kke 44 98

251 266 GTCCACCACGAGTCTA 552795 ekk-10-kke 56 100

252 267 AGTCCACCACGAGTCT 552796 ekk-10-kke 45 102

253 268 AAGTCCACCACGAGTC 552797 ekk-10-kke 46 104

254 269 GAAGTCCACCACGAGT 552798 ekk-10-kke 53 106

255 270 AGAAGTCCACCACGAG 552799 ekk-10-kke 48 109

256 271 GAGAAGTCCACCACGA 552800 ekk-10-kke 54 1 12

258 273 GAGAGAAGTCCACCAC 552801 ekk-10-kke 63 1 15

259 274 TGAGAGAAGTCCACCA 552802 ekk-10-kke 49 1 17

411 426 GCATAGCAGCAGGATG 552803 ekk-10-kke 71 137

412 427 GGCATAGCAGCAGGAT 552804 ekk-10-kke 64 140

413 428 AGGCATAGCAGCAGGA 552805 ekk-10-kke 70 143

414 429 GAGGCATAGCAGCAGG 552806 ekk-10-kke 67 145

415 430 TGAGGCATAGCAGCAG 552807 ekk-10-kke 61 147

416 431 ATGAGGCATAGCAGCA 552808 ekk-10-kke 83 149

417 432 GATGAGGCATAGCAGC 552809 ekk-10-kke 59 151

418 433 AGATGAGGCATAGCAG 552810 ekk-10-kke 56 153

419 434 AAGATGAGGCATAGCA 552811 ekk-10-kke 62 155

420 435 GAAGATGAGGCATAGC 552812 ekk-10-kke 66 157

421 436 AGAAGATGAGGCATAG 552813 ekk-10-kke 63 159

422 437 AAGAAGATGAGGCATA 552814 ekk-10-kke 65 161

457 472 CGGGCAACATACCTTG 552815 ekk-10-kke 63 167

458 473 ACGGGCAACATACCTT 552816 ekk-10-kke 88 168

639 654 GGCCCACTCCCATAGG 552817 ekk-10-kke 94 176 641 656 GAGGCCCACTCCCATA 552818 ekk-10-kke 82 177

642 657 TGAGGCCCACTCCCAT 552819 ekk-10-kke 80 178

643 658 CTGAGGCCCACTCCCA 552820 ekk-10-kke 84 179

670 685 CTAGTAAACTGAGCCA 552821 ekk-10-kke 71 181

671 686 ACTAGTAAACTGAGCC 552822 ekk-10-kke 85 1322

672 687 CACTAGTAAACTGAGC 552823 ekk-10-kke 71 1323

673 688 GCACTAGTAAACTGAG 552824 ekk-10-kke 81 1324

678 693 AAATGGCACTAGTAAA 552825 ekk-10-kke 51 1364

679 694 CAAATGGCACTAGTAA 552826 ekk-10-kke 64 1365

680 695 ACAAATGGCACTAGTA 552827 ekk-10-kke 61 1366

681 696 AACAAATGGCACTAGT 552828 ekk-10-kke 76 1367

682 697 GAACAAATGGCACTAG 552829 ekk-10-kke 61 1368

683 698 TGAACAAATGGCACTA 552830 ekk-10-kke 59 1369

684 699 CTGAACAAATGGCACT 552831 ekk-10-kke 58 1370

685 700 ACTGAACAAATGGCAC 552832 ekk-10-kke 64 1371

686 701 CACTGAACAAATGGCA 552833 ekk-10-kke 75 1372

687 702 CCACTGAACAAATGGC 552834 ekk-10-kke 84 188

688 703 ACCACTGAACAAATGG 552835 ekk-10-kke 57 190

689 704 AACCACTGAACAAATG 552836 ekk-10-kke 51 191

690 705 GAACCACTGAACAAAT 552837 ekk-10-kke 53 192

691 706 CGAACCACTGAACAAA 552838 ekk-10-kke 48 194

738 753 CCACATCATCCATATA 552839 ekk-10-kke 50 199

739 754 ACCACATCATCCATAT 552840 ekk-10-kke 54 201

1176 1191 CAGCAAACACTTGGCA 552841 ekk-10-kke 61 208

1 177 1192 TCAGCAAACACTTGGC 552842 ekk-10-kke 71 209

1261 1276 GCAGTATGGATCGGCA 552843 ekk-10-kke 75 21 1

1262 1277 CGCAGTATGGATCGGC 552844 ekk-10-kke 78 1325

1263 1278 CCGCAGTATGGATCGG 552845 ekk-10-kke 52 1326

1264 1279 TCCGCAGTATGGATCG 552846 ekk-10-kke 76 1327

1265 1280 TTCCGCAGTATGGATC 552847 ekk-10-kke 61 1328

1266 1281 GTTCCGCAGTATGGAT 552848 ekk-10-kke 72 1329

1267 1282 AGTTCCGCAGTATGGA 552849 ekk-10-kke 87 1330

1268 1283 GAGTTCCGCAGTATGG 552850 ekk-10-kke 76 1331

1269 1284 GGAGTTCCGCAGTATG 552851 ekk-10-kke 76 1332

1270 1285 AGGAGTTCCGCAGTAT 552852 ekk-10-kke 79 1333

1577 1592 AGCGAAGTGCACACGG 552853 ekk-10-kke 82 1334

1578 1593 AAGCGAAGTGCACACG 552854 ekk-10-kke 85 1335

1579 1594 GAAGCGAAGTGCACAC 552855 ekk-10-kke 78 1336

1580 1595 TGAAGCGAAGTGCACA 552856 ekk-10-kke 77 1337

1581 1596 GTGAAGCGAAGTGCAC 552857 ekk-10-kke 75 1338

1582 1597 GGTGAAGCGAAGTGCA 552858 ekk-10-kke 75 1339

1583 1598 AGGTGAAGCGAAGTGC 552859 ekk-10-kke 79 1340

1584 1599 GAGGTGAAGCGAAGTG 552860 ekk-10-kke 71 1341 1585 1600 AGAGGTGAAGCGAAGT 552861 ekk-10-kke 74 1342

1586 1601 CAGAGGTGAAGCGAAG 552862 ekk-10-kke 66 1343

1587 1602 GCAGAGGTGAAGCGAA 552863 ekk-10-kke 70 1344

1588 1603 TGCAGAGGTGAAGCGA 552864 ekk-10-kke 73 1345

Table 49

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

1577 1596 GTGAAGCGAAGTGCACACGG 146786 eeeee-10-eeeee 60 224

58 73 TGGAGCCACCAGCAGG 552889 ek-10-keke 59 1318

59 74 CTGGAGCCACCAGCAG 552890 ek-10-keke 56 1319

60 75 ACTGGAGCCACCAGCA 552891 ek-10-keke 67 1320

61 76 AACTGGAGCCACCAGC 552892 ek-10-keke 65 1321

62 77 GAACTGGAGCCACCAG 552893 ek-10-keke 68 86

250 265 TCCACCACGAGTCTAG 552894 ek-10-keke 71 98

251 266 GTCCACCACGAGTCTA 552895 ek-10-keke 51 100

252 267 AGTCCACCACGAGTCT 552896 ek-10-keke 51 102

253 268 AAGTCCACCACGAGTC 552897 ek-10-keke 43 104

254 269 GAAGTCCACCACGAGT 552898 ek-10-keke 43 106

255 270 AGAAGTCCACCACGAG 552899 ek-10-keke 55 109

256 271 GAGAAGTCCACCACGA 552900 ek-10-keke 34 112

258 273 GAGAGAAGTCCACCAC 552901 ek-10-keke 42 1 15

259 274 TGAGAGAAGTCCACCA 552902 ek-10-keke 60 1 17

41 1 426 GCATAGCAGCAGGATG 552903 ek-10-keke 76 137

412 427 GGCATAGCAGCAGGAT 552904 ek-10-keke 74 140

413 428 AGGCATAGCAGCAGGA 552905 ek-10-keke 66 143

415 430 TGAGGCATAGCAGCAG 552907 ek-10-keke 69 147

416 431 ATGAGGCATAGCAGCA 552908 ek-10-keke 63 149

417 432 GATGAGGCATAGCAGC 552909 ek-10-keke 70 151

418 433 AGATGAGGCATAGCAG 552910 ek-10-keke 72 153

457 472 CGGGCAACATACCTTG 55291 1 ek-10-keke 72 167

458 473 ACGGGCAACATACCTT 552912 ek-10-keke 67 168

670 685 CTAGTAAACTGAGCCA 552913 ek-10-keke 74 181

682 697 GAACAAATGGCACTAG 552914 ek-10-keke 75 1368

684 699 CTGAACAAATGGCACT 552915 ek-10-keke 58 1370

686 701 CACTGAACAAATGGCA 552916 ek-10-keke 74 1372

687 702 CCACTGAACAAATGGC 552917 ek-10-keke 76 188

688 703 ACCACTGAACAAATGG 552918 ek-10-keke 75 190

689 704 AACCACTGAACAAATG 552919 ek-10-keke 55 191

690 705 GAACCACTGAACAAAT 552920 ek-10-keke 49 192 691 706 CGAACCACTGAACAAA 552921 ek-10-keke 45 194

1261 1276 GCAGTATGGATCGGCA 552922 ek-10-keke 83 21 1

1262 1277 CGCAGTATGGATCGGC 552923 ek-10-keke 83 1325

1263 1278 CCGCAGTATGGATCGG 552924 ek-10-keke 0 1326

1264 1279 TCCGCAGTATGGATCG 552925 ek-10-keke 85 1327

1265 1280 TTCCGCAGTATGGATC 552926 ek-10-keke 50 1328

1266 1281 GTTCCGCAGTATGGAT 552927 ek-10-keke 76 1329

1267 1282 AGTTCCGCAGTATGGA 552928 ek-10-keke 78 1330

1268 1283 GAGTTCCGCAGTATGG 552929 ek-10-keke 75 1331

1269 1284 GGAGTTCCGCAGTATG 552930 ek-10-keke 78 1332

1270 1285 AGGAGTTCCGCAGTAT 552931 ek-10-keke 74 1333

1577 1592 AGCGAAGTGCACACGG 552932 ek-10-keke 86 1334

1578 1593 AAGCGAAGTGCACACG 552933 ek-10-keke 82 1335

1579 1594 GAAGCGAAGTGCACAC 552934 ek-10-keke 74 1336

1580 1595 TGAAGCGAAGTGCACA 552935 ek-10-keke 76 1337

1581 1596 GTGAAGCGAAGTGCAC 552936 ek-10-keke 81 1338

1582 1597 GGTGAAGCGAAGTGCA 552937 ek-10-keke 80 1339

1583 1598 AGGTGAAGCGAAGTGC 552938 ek-10-keke 78 1340

1584 1599 GAGGTGAAGCGAAGTG 552939 ek-10-keke 75 1341

1585 1600 AGAGGTGAAGCGAAGT 552940 ek-10-keke 63 1342

1586 1601 CAGAGGTGAAGCGAAG 552941 ekk-10-kke 78 1343

1587 1602 GCAGAGGTGAAGCGAA 552942 ek-10-keke 80 1344

1589 1604 GTGCAGAGGTGAAGCG 552865 ekk-10-kke 67 1346

1590 1605 CGTGCAGAGGTGAAGC 552866 ekk-10-kke 68 1347

1778 1793 TATGCCTACAGCCTCC 552868 ekk-10-kke 55 230

1779 1794 TTATGCCTACAGCCTC 552869 ekk-10-kke 48 231

1780 1795 TTTATGCCTACAGCCT 552870 ekk-10-kke 55 232

1781 1796 ATTTATGCCTACAGCC 552871 ekk-10-kke 57 233

1782 1797 AATTTATGCCTACAGC 552872 ekk-10-kke 70 234

1783 1798 CAATTTATGCCTACAG 552873 ekk-10-kke 49 235

1784 1799 CCAATTTATGCCTACA 552874 ekk-10-kke 42 236

1785 1800 ACCAATTTATGCCTAC 552875 ekk-10-kke 41 237

1822 1837 GGCAGAGGTGAAAAAG 552876 ekk-10-kke 50 244

1823 1838 AGGCAGAGGTGAAAAA 552877 ek-10-keke 39 245

1824 1839 TAGGCAGAGGTGAAAA 552878 ekk-10-kke 31 247

1865 1880 AGCTTGGAGGCTTGAA 552879 ekk-10-kke 5 252

1866 1881 CAGCTTGGAGGCTTGA 552880 ekk-10-kke 5 254

1867 1882 ACAGCTTGGAGGCTTG 552881 ekk-10-kke 10 256

1868 1883 CACAGCTTGGAGGCTT 552882 ekk-10-kke 1 1 258

1869 1884 GCACAGCTTGGAGGCT 552883 ekk-10-kke 27 260

1870 1885 GGCACAGCTTGGAGGC 552884 ekk-10-kke 36 262

1871 1886 AGGCACAGCTTGGAGG 552885 ekk-10-kke 12 264

1872 1887 AAGGCACAGCTTGGAG 552886 ekk-10-kke 32 266 1874 1889 CCAAGGCACAGCTTGG 552888 ekk-10-kke 1 271

Table 50

Viral Viral

Target Target SEQ ID

Sequence ISIS No Motif % inhibition

Start Stop NO Site Site

1577 1596 GTGAAGCGAAGTGCACACGG 146786 eeeee-10-eeeee 59 224

58 73 TGGAGCCACCAGCAGG 552955 eee-10-kkk 60 1318

59 74 CTGGAGCCACCAGCAG 552956 eee-10-kkk 60 1319

60 75 ACTGGAGCCACCAGCA 552957 eee-10-kkk 64 1320

61 76 AACTGGAGCCACCAGC 552958 eee-10-kkk 56 1321

62 77 GAACTGGAGCCACCAG 552959 eee-10-kkk 59 86

250 265 TCCACCACGAGTCTAG 552960 eee-10-kkk 42 98

251 266 GTCCACCACGAGTCTA 552961 eee-10-kkk 41 100

252 267 AGTCCACCACGAGTCT 552962 eee-10-kkk 35 102

253 268 AAGTCCACCACGAGTC 552963 eee-10-kkk 19 104

254 269 GAAGTCCACCACGAGT 552964 eee-10-kkk 34 106

255 270 AGAAGTCCACCACGAG 552965 eee-10-kkk 42 109

256 271 GAGAAGTCCACCACGA 552966 eee-10-kkk 60 112

258 273 GAGAGAAGTCCACCAC 552967 eee-10-kkk 38 1 15

259 274 TGAGAGAAGTCCACCA 552968 eee-10-kkk 35 117

41 1 426 GCATAGCAGCAGGATG 552969 eee-10-kkk 67 137

412 427 GGCATAGCAGCAGGAT 552970 eee-10-kkk 56 140

413 428 AGGCATAGCAGCAGGA 552971 eee-10-kkk 69 143

414 429 GAGGCATAGCAGCAGG 552972 eee-10-kkk 75 145

415 430 TGAGGCATAGCAGCAG 552973 eee-10-kkk 59 145

416 431 ATGAGGCATAGCAGCA 552974 eee-10-kkk 71 149

417 432 GATGAGGCATAGCAGC 552975 eee-10-kkk 56 151

418 433 AGATGAGGCATAGCAG 552976 eee-10-kkk 50 153

457 472 CGGGCAACATACCTTG 552977 eee-10-kkk 56 167

458 473 ACGGGCAACATACCTT 552978 eee-10-kkk 43 168

670 685 CTAGTAAACTGAGCCA 552979 eee-10-kkk 71 181

682 697 GAACAAATGGCACTAG 552980 eee-10-kkk 80 1368

684 699 CTGAACAAATGGCACT 552981 eee-10-kkk 64 1370

686 701 CACTGAACAAATGGCA 552982 ek-10-keke 61 1372

687 702 CCACTGAACAAATGGC 552983 eee-10-kkk 77 188

688 703 ACCACTGAACAAATGG 552984 eee-10-kkk 65 190

689 704 AACCACTGAACAAATG 552985 eee-10-kkk 41 191

690 705 GAACCACTGAACAAAT 552986 eee-10-kkk 30 192

691 706 CGAACCACTGAACAAA 552987 eee-10-kkk 41 194

1261 1276 GCAGTATGGATCGGCA 552988 eee-10-kkk 74 21 1 1262 1277 CGCAGTATGGATCGGC 552989 eee-10-kkk 85 1325

1263 1278 CCGCAGTATGGATCGG 552990 eee-10-kkk 72 1326

1264 1279 TCCGCAGTATGGATCG 552991 eee-10-kkk 73 1327

1265 1280 TTCCGCAGTATGGATC 552992 eee-10-kkk 60 1328

1266 1281 GTTCCGCAGTATGGAT 552993 eee-10-kkk 52 1329

1267 1282 AGTTCCGCAGTATGGA 552994 eee-10-kkk 58 1330

1268 1283 GAGTTCCGCAGTATGG 552995 eee-10-kkk 70 1331

1269 1284 GGAGTTCCGCAGTATG 552996 eee-10-kkk 74 1332

1270 1285 AGGAGTTCCGCAGTAT 552997 eee-10-kkk 59 1333

1577 1592 AGCGAAGTGCACACGG 552998 eee-10-kkk 82 1334

1578 1593 AAGCGAAGTGCACACG 552999 eee-10-kkk 70 1335

1579 1594 GAAGCGAAGTGCACAC 553000 eee-10-kkk 67 1336

1580 1595 TGAAGCGAAGTGCACA 553001 eee-10-kkk 67 1337

1581 1596 GTGAAGCGAAGTGCAC 553002 eee-10-kkk 74 1338

1582 1597 GGTGAAGCGAAGTGCA 553003 eee-10-kkk 72 1339

1583 1598 AGGTGAAGCGAAGTGC 553004 eee-10-kkk 73 1340

1584 1599 GAGGTGAAGCGAAGTG 553005 eee-10-kkk 67 1341

1585 1600 AGAGGTGAAGCGAAGT 553006 eee-10-kkk 69 1342

1586 1601 CAGAGGTGAAGCGAAG 553007 eee-10-kkk 60 1343

1587 1602 GCAGAGGTGAAGCGAA 553008 eee-10-kkk 71 1344

1588 1603 TGCAGAGGTGAAGCGA 552943 ek-10-keke 77 1345

1588 1603 TGCAGAGGTGAAGCGA 553009 eee-10-kkk 78 1345

1589 1604 GTGCAGAGGTGAAGCG 552944 ek-10-keke 74 1346

1589 1604 GTGCAGAGGTGAAGCG 553010 eee-10-kkk 78 1346

1590 1605 CGTGCAGAGGTGAAGC 552945 ek-10-keke 76 1347

1590 1605 CGTGCAGAGGTGAAGC 553011 eee-10-kkk 72 1347

1591 1606 ACGTGCAGAGGTGAAG 552946 ek-10-keke 71 1348

1591 1606 ACGTGCAGAGGTGAAG 553012 eee-10-kkk 74 1348

1778 1793 TATGCCTACAGCCTCC 552947 ek-10-keke 54 230

1778 1793 TATGCCTACAGCCTCC 553013 eee-10-kkk 39 230

1779 1794 TTATGCCTACAGCCTC 552948 ek-10-keke 50 231

1779 1794 TTATGCCTACAGCCTC 553014 eee-10-kkk 37 231

1780 1795 TTTATGCCTACAGCCT 552949 ek-10-keke 8 232

1780 1795 TTTATGCCTACAGCCT 553015 eee-10-kkk 45 232

1781 1796 ATTTATGCCTACAGCC 552950 ek-10-keke 44 233

1781 1796 ATTTATGCCTACAGCC 553016 eee-10-kkk 47 233

1782 1797 AATTTATGCCTACAGC 552951 ek-10-keke 60 234

1782 1797 AATTTATGCCTACAGC 553017 eee-10-kkk 47 234

1783 1798 CAATTTATGCCTACAG 552952 ek-10-keke 35 235

1783 1798 CAATTTATGCCTACAG 553018 eee-10-kkk 30 235

1784 1799 CCAATTTATGCCTACA 552953 ek-10-keke 37 236

1784 1799 CCAATTTATGCCTACA 553019 eee-10-kkk 37 236

1785 1800 ACCAATTTATGCCTAC 552954 ek-10-keke 40 237 1800 ACCAATTTATGCCTAC 553020 eee-10-kkk 24 237

Table 51

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

58 73 TGGAGCCACCAGCAGG 552889 ek-10-keke 42 1318

59 74 CTGGAGCCACCAGCAG 552890 ek-10-keke 56 1319

60 75 ACTGGAGCCACCAGCA 552891 ek-10-keke 55 1320

61 76 AACTGGAGCCACCAGC 552892 ek-10-keke 53 1321

62 77 GAACTGGAGCCACCAG 552893 ek-10-keke 56 86

250 265 TCCACCACGAGTCTAG 552894 ek-10-keke 53 98

251 266 GTCCACCACGAGTCTA 552895 ek-10-keke 38 100

252 267 AGTCCACCACGAGTCT 552896 ek-10-keke 43 102

253 268 AAGTCCACCACGAGTC 552897 ek-10-keke 40 104

254 269 GAAGTCCACCACGAGT 552898 ek-10-keke 50 106

255 270 AGAAGTCCACCACGAG 552899 ek-10-keke 37 109

256 271 GAGAAGTCCACCACGA 552900 ek-10-keke 43 112

258 273 GAGAGAAGTCCACCAC 552901 ek-10-keke 56 115

259 274 TGAGAGAAGTCCACCA 552902 ek-10-keke 43 117

411 426 GCATAGCAGCAGGATG 552903 ek-10-keke 78 137

412 427 GGCATAGCAGCAGGAT 552904 ek-10-keke 75 140

413 428 AGGCATAGCAGCAGGA 552905 ek-10-keke 52 143

415 430 TGAGGCATAGCAGCAG 552907 ek-10-keke 75 147

416 431 ATGAGGCATAGCAGCA 552908 ek-10-keke 57 149

417 432 GATGAGGCATAGCAGC 552909 ek-10-keke 66 151

418 433 AGATGAGGCATAGCAG 552910 ek-10-keke 60 153

457 472 CGGGCAACATACCTTG 552911 ek-10-keke 65 167

458 473 ACGGGCAACATACCTT 552912 ek-10-keke 37 168

670 685 CTAGTAAACTGAGCCA 552913 ek-10-keke 76 181

682 697 GAACAAATGGCACTAG 552914 ek-10-keke 79 1368

684 699 CTGAACAAATGGCACT 552915 ek-10-keke 71 1370

686 701 CACTGAACAAATGGCA 552916 ek-10-keke 82 1372

687 702 CCACTGAACAAATGGC 552917 ek-10-keke 78 188

688 703 ACCACTGAACAAATGG 552918 ek-10-keke 64 190

689 704 AACCACTGAACAAATG 552919 ek-10-keke 38 191

690 705 GAACCACTGAACAAAT 552920 ek-10-keke 43 192

691 706 CGAACCACTGAACAAA 552921 ek-10-keke 49 194

1261 1276 GCAGTATGGATCGGCA 552922 ek-10-keke 90 21 1

1262 1277 CGCAGTATGGATCGGC 552923 ek-10-keke 92 1325

1263 1278 CCGCAGTATGGATCGG 552924 ek-10-keke 30 1326 1264 1279 TCCGCAGTATGGATCG 552925 ek-10-keke 81 1327

1265 1280 TTCCGCAGTATGGATC 552926 ek-10-keke 39 1328

1266 1281 GTTCCGCAGTATGGAT 552927 ek-10-keke 53 1329

1267 1282 AGTTCCGCAGTATGGA 552928 ek-10-keke 48 1330

1268 1283 GAGTTCCGCAGTATGG 552929 ek-10-keke 68 133J-

1269 1284 GGAGTTCCGCAGTATG 552930 ek-10-keke 87 1332

1270 1285 AGGAGTTCCGCAGTAT 552931 ek-10-keke 87 1333

1577 1592 AGCGAAGTGCACACGG 552932 ek-10-keke 88 1334

1578 1593 AAGCGAAGTGCACACG 552933 ek-10-keke 75 1335

1579 1594 GAAGCGAAGTGCACAC 552934 ek-10-keke 76 1336

1580 1595 TGAAGCGAAGTGCACA 552935 ek-10-keke 71 1337

1581 1596 GTGAAGCGAAGTGCAC 552936 ek-10-keke 80 1338

1582 1597 GGTGAAGCGAAGTGCA 552937 ek-10-keke 81 1339

1583 1598 AGGTGAAGCGAAGTGC 552938 ek-10-keke 85 1340

1584 1599 GAGGTGAAGCGAAGTG 552939 ek-10-keke 82 1341

1585 1600 AGAGGTGAAGCGAAGT 552940 ek-10-keke 76 1342

1586 1601 CAGAGGTGAAGCGAAG 552941 ekk-10-kke 72 1343

1587 1602 GCAGAGGTGAAGCGAA 552942 ek-10-keke 85 1344

1589 1604 GTGCAGAGGTGAAGCG 552865 ekk-10-kke 70 1346

1590 1605 CGTGCAGAGGTGAAGC 552866 ekk-10-kke 65 1347

1778 1793 TATGCCTACAGCCTCC 552868 ekk-10-kke 36 230

1779 1794 TTATGCCTACAGCCTC 552869 ekk-10-kke 23 231

1780 1795 TTTATGCCTACAGCCT 552870 ekk-10-kke 49 232

1781 1796 ATTTATGCCTACAGCC 552871 ekk-10-kke 46 233

1782 1797 AATTTATGCCTACAGC 552872 ekk-10-kke 73 234

1783 1798 CAATTTATGCCTACAG 552873 ekk-10-kke 41 235

1784 1799 CCAATTTATGCCTACA 552874 ekk-10-kke 18 236

1785 1800 ACCAATTTATGCCTAC 552875 ekk-10-kke 0 237

1822 1837 GGCAGAGGTGAAAAAG 552876 ekk-10-kke 49 244

1823 1838 AGGCAGAGGTGAAAAA 552877 ek-10-keke 37 245

1824 1839 TAGGCAGAGGTGAAAA 552878 ekk-10-kke 28 247

1865 1880 AGCTTGGAGGCTTGAA 552879 ekk-10-kke 0 252

1866 1881 CAGCTTGGAGGCTTGA 552880 ekk-10-kke 12 254

1867 1882 ACAGCTTGGAGGCTTG 552881 ekk-10-kke 0 256

1868 1883 CACAGCTTGGAGGCTT 552882 ekk-10-kke 0 258

1869 1884 GCACAGCTTGGAGGCT 552883 ekk-10-kke 12 260

1870 1885 GGCACAGCTTGGAGGC 552884 ekk-10-kke 39 262

1871 1886 AGGCACAGCTTGGAGG 552885 ekk-10-kke 37 264

1872 1887 AAGGCACAGCTTGGAG 552886 ekk-10-kke 15 266

1874 1889 CCAAGGCACAGCTTGG 552888 ekk-10-kke 0 271 Table 52

Viral Viral

Target Target % SEQ ID

Sequence ISIS No Motif

Start Stop inhibition NO Site Site

58 73 TGGAGCCACCAGCAGG 552955 eee-10-kkk 67 1318

59 74 CTGGAGCCACCAGCAG 552956 eee-10-kkk 60 1319

60 75 ACTGGAGCCACCAGCA 552957 eee-10-kkk 73 1320

61 76 AACTGGAGCCACCAGC 552958 eee-10-kkk 63 1321

62 77 GAACTGGAGCCACCAG 552959 eee-10-kkk 58 86

250 265 TCCACCACGAGTCTAG 552960 eee-10-kkk 67 98

251 266 GTCCACCACGAGTCTA 552961 eee-10-kkk 78 100

252 267 AGTCCACCACGAGTCT 552962 eee-10-kkk 29 102

253 268 AAGTCCACCACGAGTC 552963 eee-10-kkk 25 104

254 269 GAAGTCCACCACGAGT 552964 eee-10-kkk 33 106

255 270 AGAAGTCCACCACGAG 552965 eee-10-kkk 55 109

256 271 GAGAAGTCCACCACGA 552966 eee-10-kkk 71 1 12

258 273 GAGAGAAGTCCACCAC 552967 eee-10-kkk 23 1 15

259 274 TGAGAGAAGTCCACCA 552968 eee-10-kkk 41 1 17

41 1 426 GCATAGCAGCAGGATG 552969 eee-10-kkk 76 137

412 427 GGCATAGCAGCAGGAT 552970 eee-10-kkk 44 140

413 428 AGGCATAGCAGCAGGA 552971 eee-10-kkk 77 143

414 429 GAGGCATAGCAGCAGG 552972 eee-10-kkk 74 145

415 430 TGAGGCATAGCAGCAG 552973 eee-10-kkk 61 145

416 431 ATGAGGCATAGCAGCA 552974 eee-10-kkk 73 149

417 432 GATGAGGCATAGCAGC 552975 eee-10-kkk 66 151

418 433 AGATGAGGCATAGCAG 552976 eee-10-kkk 70 153

457 472 CGGGCAACATACCTTG 552977 eee-10-kkk 65 167

458 473 ACGGGCAACATACCTT 552978 eee-10-kkk 40 168

670 685 CTAGTAAACTGAGCCA 552979 eee-10-kkk 79 181

682 697 GAACAAATGGCACTAG 552980 eee-10-kkk 81 64

684 699 CTGAACAAATGGCACT 552981 eee-10-kkk 74 66

686 701 CACTGAACAAATGGCA 552982 ek-10-keke 52 68

687 702 CCACTGAACAAATGGC 552983 eee-10-kkk 78 188

688 703 ACCACTGAACAAATGG 552984 eee-10-kkk 71 190

689 704 AACCACTGAACAAATG 552985 eee-10-kkk 38 191

690 705 GAACCACTGAACAAAT 552986 eee-10-kkk 48 192

691 706 CGAACCACTGAACAAA 552987 eee-10-kkk 54 194

1261 1276 GCAGTATGGATCGGCA 552988 eee-10-kkk 85 211

1262 1277 CGCAGTATGGATCGGC 552989 eee-10-kkk 84 1325

1263 1278 CCGCAGTATGGATCGG 552990 eee-10-kkk 79 1326

1264 1279 TCCGCAGTATGGATCG 552991 eee-10-kkk 53 1327 1265 1280 TTCCGCAGTATGGATC 552992 eee-10-kkk 68 1328

1266 1281 GTTCCGCAGTATGGAT 552993 eee-10-kkk 67 1329

1267 1282 AGTTCCGCAGTATGGA 552994 eee-10-kkk 69 1330

1268 1283 GAGTTCCGCAGTATGG 552995 eee-10-kkk 62 1331

1269 1284 GGAGTTCCGCAGTATG 552996 eee-10-kkk 82 1332

1270 1285 AGGAGTTCCGCAGTAT 552997 eee-10-kkk 58 1333

1577 1592 AGCGAAGTGCACACGG 552998 eee-10-kkk 86 1334

1578 1593 AAGCGAAGTGCACACG 552999 eee-10-kkk 63 1335

1579 1594 GAAGCGAAGTGCACAC 553000 eee-10-kkk 67 1336

1580 1595 TGAAGCGAAGTGCACA 553001 eee-10-kkk 70 1337

1581 1596 GTGAAGCGAAGTGCAC 553002 eee-10-kkk 84 1338

1582 1597 GGTGAAGCGAAGTGCA 553003 eee-10-kkk 83 1339

1583 1598 AGGTGAAGCGAAGTGC 553004 eee-10-kkk 68 1340

1584 1599 GAGGTGAAGCGAAGTG 553005 eee-10-kkk 57 1341

1585 1600 AGAGGTGAAGCGAAGT 553006 eee-10-kkk 74 1342

1586 1601 CAGAGGTGAAGCGAAG 553007 eee-10-kkk 62 1343

1587 1602 GCAGAGGTGAAGCGAA 553008 eee-10-kkk 50 1344

1588 1603 TGCAGAGGTGAAGCGA 552943 ek-10-keke 86 1345

1588 1603 TGCAGAGGTGAAGCGA 553009 eee-10-kkk 79 1345

1589 1604 GTGCAGAGGTGAAGCG 552944 ek-10-keke 83 1346

1589 1604 GTGCAGAGGTGAAGCG 553010 eee-10-kkk 74 1346

1590 1605 CGTGCAGAGGTGAAGC 552945 ek-10-keke 79 1347

1590 1605 CGTGCAGAGGTGAAGC 55301 1 eee-10-kkk 60 1347

1591 1606 ACGTGCAGAGGTGAAG 552946 ek-10-keke 68 1348

1591 1606 ACGTGCAGAGGTGAAG 553012 eee-10-kkk 78 1348

1778 1793 TATGCCTACAGCCTCC 552947 ek-10-keke 51 230

1778 1793 TATGCCTACAGCCTCC 553013 eee-10-kkk 45 230

1779 1794 TTATGCCTACAGCCTC 552948 ek-10-keke 56 231

1779 1794 TTATGCCTACAGCCTC 553014 eee-10-kkk 53 231

1780 1795 TTTATGCCTACAGCCT 552949 ek-10-keke 1 232

1780 1795 TTTATGCCTACAGCCT 553015 eee-10-kkk 55 232

1781 1796 ATTTATGCCTACAGCC 552950 ek-10-keke 52 233

1781 1796 ATTTATGCCTACAGCC 553016 eee-10-kkk 65 233

1782 1797 AATTTATGCCTACAGC 552951 ek-10-keke 59 234

1782 1797 AATTTATGCCTACAGC 553017 eee-10-kkk 36 234

1783 1798 CAATTTATGCCTACAG 552952 ek-10-keke 34 235

1783 1798 CAATTTATGCCTACAG 553018 eee-10-kkk 20 235

1784 1799 CCAATTTATGCCTACA 552953 ek-10-keke 55 236

1784 1799 CCAATTTATGCCTACA 553019 eee-10-kkk 34 236

1785 1800 ACCAATTTATGCCTAC 552954 ek-10-keke 51 237

1785 1800 ACCAATTTATGCCTAC 553020 eee-10-kkk 28 237 Example 16: Dose-dependent antisense inhibition of HBV mRNA in HepG2 cells by MOE gapmers

Antisense oligonucleotides from the study described in Example 14 exhibiting in vitro inhibition of HBV mRNA were selected and tested at various doses in HepG2 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE2000® with 9.26 nM, 27.78 nM, 83.33 nM, and 250.00 nM concentrations of antisense oligonucleotide, as specified in Table 53. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. HBV primer probe set RTS3371 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

As illustrated in Table 53, HBV mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells, 'n/a' indicates that the data for that dosage is not available.

Table 53

Dose-dependent antisense inhibition of human HBV in HepG2 cells

552020 2 35 65 91

552021 4 1 1 53 82

552022 6 35 57 79

552023 1 1 33 59 81

552024 15 43 69 91

552025 17 35 69 87

552026 14 26 66 86

552027 3 46 62 88

552028 9 43 58 78

552029 8 40 72 89

552030 18 48 77 92

552031 0 38 66 89

552032 42 48 80 88

552033 2 40 64 84

552034 6 40 70 81

552039 2 33 56 83

552044 19 30 63 84

552046 4 21 47 77

552050 15 44 70 92

552051 8 33 69 90

552052 17 38 71 91

552053 0 40 59 86

552054 7 15 58 75

552056 19 62 86 92

552057 11 33 69 86

552058 30 55 79 90

552059 1 1 25 69 90

552060 9 32 61 86

552061 6 40 69 88

552062 22 48 75 89

552064 23 49 69 90

552065 10 8 69 86

552069 1 1 4 28 60

552073 9 31 62 78

552075 21 18 33 65

552077 0 17 40 72

552079 1 12 44 70

552080 3 12 34 69

552082 13 29 66 87

552083 24 54 69 88

552084 10 25 48 82

552085 28 35 64 85

552086 0 24 65 84 552088 33 53 77 93

552089 0 41 69 92

552090 17 35 70 87

552091 13 31 69 89

552092 6 23 66 89

552093 0 17 61 89

552094 12 38 65 88

552095 20 42 73 88

552096 n/a 39 66 91

552097 24 43 67 88

552098 0 24 56 85

552101 3 13 28 61

552147 11 27 58 80

552160 20 25 69 89

552163 0 21 22 53

552176 16 1 1 40 66

552192 7 38 78 89

552222 0 24 65 79

552247 0 38 69 86

552255 5 27 69 81

552301 5 38 65 86

552309 8 26 62 85

552312 0 4 32 62

552347 2 15 38 75

552348 12 40 42 65

552354 10 35 44 76

552361 2 25 55 74

552363 20 36 54 76

552374 7 4 38 76

552379 0 12 24 46

552403 8 27 54 76

552408 2 25 44 77

552409 6 31 56 80

552418 0 30 72 84

552420 9 34 53 81

552442 4 23 46 56

552466 0 23 56 79

552474 1 1 34 66 87

552477 1 1 22 44 64

552530 25 37 73 87

552559 9 13 29 51 Example 17: Dose-dependent antisense inhibition of HBV mRNA in HepG2 cells by deoxy, MOE and (S)-cEt gapmers

Antisense oligonucleotides from the study described in Example 15 exhibiting in vitro inhibition of HBV mRNA were selected and tested at various doses in HepG2 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE2000® with 9.26 nM, 27.78 nM, 83.33 nM, and 250.00 nM concentrations of antisense oligonucleotide, as specified in Table 54. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. HBV primer probe set RTS3371 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN^® Results are presented as percent inhibition of HBV, relative to untreated control cells.

As illustrated in Table 54, HBV mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 54

Dose-dependent antisense inhibition of human HBV in HepG2 cells

TC TO fsjn 9.2593 27.7778 83.3333 250.0

lol 1NO

nM nM nM nM

146786 10 43 74 89

552808 13 14 55 70

552816 38 73 87 92

552818 29 63 87 85

552820 58 83 90 90

552821 33 49 71 88

552822 24 55 74 88

552824 8 24 65 87

552834 1 1 28 68 89

552849 12 25 73 84

552851 13 42 74 89

552852 4 35 70 87

552853 19 52 86 93

552854 28 57 80 89

552916 5 26 64 82

552922 25 44 77 89

552923 22 49 82 91

552925 33 56 80 92

552930 12 49 79 89

552931 12 40 62 82

552932 24 62 84 91

552933 20 40 75 89 552936 18 36 75 88

552937 22 51 82 88

552938 12 36 67 80

552939 17 40 65 79

552942 21 48 74 88

552943 5 39 70 85

552944 14 33 70 77

552980 15 40 69 86

552988 4 36 58 84

552989 0 50 74 81

552996 0 25 53 72

552998 17 49 79 90

553002 0 32 68 86

553003 15 42 67 88

Example 18: Antisense inhibition of HBV viral mRNA in HepG2 cells by deoxy, MOE and (S)-cEt gapmers

Additional antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. ISIS 5808 and ISIS 9591 , disclosed in US5985662, as well as ISIS 146781 , ISIS 146786, 524518, ISIS 552859, and ISIS 552870 were also included in these studies for comparison and are distinguished with an asterisk. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000® with 100 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe sets RTS3370 and RTS3371 and were used to separately measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Table below were designed as MOE gapmers or deoxy, MOE and (S)-cEt gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3 ' directions) by wings comprising five nucleosides each. The deoxy, MOE and (S)-cEt gapmers are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, 'd' indicates a deoxynucleoside; and 'e' indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines. "Viral Target start site" indicates the 5 '-most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted viral gene sequence. Each gapmer listed in Table 55 is targeted to the viral genomic sequence, designated herein as SEQ E) NO: 1 (GENBANK Accession No. U95551.1 ).

Table 55

Inhibition of viral HBV mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 or

RTS3371

Viral Viral

% % SEQ Target Target

ISIS No Motif inhibition inhibition Sequence ID Start Stop

(RTS3370) (RTS3371 ) NO Site Site

156 176 5808* Uniform deoxy 57 64 CCTGATGTGATGTTCTCCATG 1373

303 322 524518* eeeee-10-eeeee 62 72 GGGACTGCGAATTTTGGCCA 428

376 395 146781 * eeeee-10-eeeee 72 93 AAACGCCGCAGACACATCCA 1374

380 399 582665 eeeee-10-eeeee 57 59 GATAAAACGCCGCAGACACA 1375

382 401 582666 eeeee-10-eeeee 49 92 ATGATAAAACGCCGCAGACA 1376

411 426 566831 kdkdk-9-ee 96 73 GCATAGCAGCAGGATG 137

41 1 427 577123 eekk-9-ekee 84 96 GGCATAGCAGCAGGATG 17

41 1 427 577124 kdkdk-8-eeee 92 96 GGCATAGCAGCAGGATG 17

41 1 426 577126 kkk-8-eeeee 87 90 GCATAGCAGCAGGATG 137

413 428 566830 kdkdk-9-ee 93 95 AGGCATAGCAGCAGGA 143

415 430 577130 eek-10-kke 87 94 TGAGGCATAGCAGCAG 147

415 430 577131 kdkdk-9-ee 83 93 TGAGGCATAGCAGCAG 147

1263 1278 566828 kdkdk-9-ee 97 90 CCGCAGTATGGATCGG 1236

1577 1596 146786* eeeee-10-eeeee 93 71 GTGAAGCGAAGTGCACACGG 224

1577 1592 566829 kdkdk-9-ee 98 84 AGCGAAGTGCACACGG 1334

1577 1596 577120 kdkdk-10-eeeee 94 93 GTGAAGCGAAGTGCACACGG 224

1577 1592 577127 kkk-8-eeeee 95 70 AGCGAAGTGCACACGG 1334

1577 1592 577134 kek-8-eeeee 94 89 AGCGAAGTGCACACGG 1334

1577 1592 577135 kek-10-kek 96 94 AGCGAAGTGCACACGG 1334

1583 1598 552859* ekk-10-kke 92 91 AGGTGAAGCGAAGTGC 1340

1583 1602 577121 kdkdk-10-eeeee 91 74 GCAGAGGTGAAGCGAAGTGC 226

1583 1598 577128 kkk-8-eeeee 92 85 AGGTGAAGCGAAGTGC 1340

1583 1598 577132 kdkdk-9-ee 97 81 AGGTGAAGCGAAGTGC 1340

1583 1598 577136 kek-10-kek 95 95 AGGTGAAGCGAAGTGC 1340

1588 1603 566832 kdkdk-9-ee 95 78 TGCAGAGGTGAAGCGA 1345

1780 1795 552870* ekk- 10-kke 71 93 TTTATGCCTACAGCCT 232

1780 1799 577122 kdkdk-10-eeeee 70 96 CCAATTTATGCCTACAGCCT 50

1780 1796 577125 kdkdk-8-eeee 70 94 ATTTATGCCTACAGCCT 51

1780 1795 577129 kkk-8-eeeee 76 51 TTTATGCCTACAGCCT 232

1780 1795 577133 kdkdk-9-ee 80 52 TTTATGCCTACAGCCT 232

1873 1892 9591 * Uniform deoxy 30 14 CACCCAAGGCACAGCTTGG 1377 Example 19: Efficacy of gapmers targeting HBV in transgenic mice

Transgenic mice were treated with ISIS antisense oligonucleotides in a number of studies to evaluate the efficacy of the gapmers. HBV DNA and RNA levels were assessed.

Study 1 _

Groups of 12 mice each were injected subcutaneously twice a week for 4 weeks with 50 mg/kg of ISIS 510106, ISIS 5101 16, ISIS 505347, or ISIS 509934. A control group of 12 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and livers were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe sets RTS3370, RTS3371 , and RTS3372. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe sets RTS3370 and RTS3371 after RT-PCR analysis. The mRNA levels were nonnalized to RIBOGREEN®. The data is presented in Table 56, expressed as percent inhibition compared to the control group. As shown in Table 56, most of the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column indicates the gap-wing motif of each gapmer.

Table 56

Percent inhibition of HBV RNA and DNA in the liver of transgenic mice

Study 2

Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 50 mg/kg of ISIS 146779, ISIS 505358, ISIS 146786, ISIS 509974, ISIS 509958, or ISIS 509959. A control group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and livers were harvested for further analysis. DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe sets RTS3370. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe sets RTS3370 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. The data is presented in Table 57, expressed as percent inhibition compared to the control group. As shown in Table 57, most of the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column indicates the gap-wing motif of each gapmer.

Table 57

Percent inhibition of HBV RNA and DNA in the liver of transgenic mice

Study 3

Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 50 mg/kg of ISIS 509960, ISIS 505329, ISIS 146786, ISIS 505339, or ISIS 509927. Another group of 6 mice was administered Entecavir, an oral antiviral drug used to treate Hepatitis B infection, at 1 mg/kg daily for two weeks. A control group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and livers were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe sets RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe sets RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. The data is presented in Table 58, expressed as percent inhibition compared to the control group. As shown in Table 58, most of the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column indicates the gap-wing motif of each gapmer. Table 58

Percent inhibition of HBV RNA and DNA in the liver of transgenic mice

Study 4

Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786, ISIS 552176, and ISIS 552073. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RBBOGREEN®. The data is presented in Table 59. As shown in Table 59, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column indicates the gap-wing motif of each gapmer.

Table 59

Percent inhibition of HBV RNA and DNA in transgenic mice

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of ALT were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz NW (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). The results are presented in Table 60 expressed in IU/L. Both the ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.

Table 60

ALT levels (IU/L) of transgenic mice

Study 5

Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 25 g/kg of ISIS 146786, ISIS 552056, ISIS 552088, and ISIS 552309. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. As shown in Table 61 , the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column indicates the gap-wing motif of each gapmer.

Table 61

Percent inhibition of HBV DNA and RNA in transgenic mice

Study 6

Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786, ISIS 505330, ISIS 509932, ISIS 552032, ISIS 552057, ISIS 552075, ISIS 552092, and ISIS 552255. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. As shown in Table 62, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column indicates the gap-wing motif of each gapmer.

Table 62

Percent inhibition of HBV DNA and RNA in transgenic mice

Study 7

Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 20 mg/kg of ISIS 552859, ISIS 577121 , ISIS 577122, ISTS 577123, TSTS 577Π2, TSTS 5771 33, and ISIS 577134. These gapmers have deoxy, MOE and (S)-cEt chemistry. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. As shown in Table 63, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, 'd' indicates a deoxynucleoside; and 'e' indicates a MOE modification.

Table 63

Percent inhibition of HBV DNA and RNA in transgenic mice

Study 8

A group of 6 mice was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786, the 5-10-5 MOE gapmer. Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 10 mg/kg of ISIS 552803, ISIS 552903, ISIS 552817, ISIS 552822, and ISIS 552907. These gapmers all had deoxy, MOE, and (S)-cEt chemistry. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. The data is presented in Table 64. As shown in Table 64, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, 'd' indicates a deoxynucleoside; and 'e' indicates a MOE modification; in case of the MOE gapmers, the Chemistry column defines the gap-wing structure.

Table 64

Percent inhibition of HBV RNA and DNA in transgenic mice

Study 9

A group of 6 mice was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 10 mg/kg of ISIS 552853, ISIS 552854, ISIS 552932, and ISIS 552938. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. As shown in Table 65, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, 'd' indicates a deoxynucleoside; and 'e' indicates a MOE modification; in case of the MOE gapmers, the Chemistry column defines the gap-wing structure. Table 65

Percent inhibition of HBV DNA and RNA in transgenic mice

Study 10

A group of 6 mice was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 10 mg/kg of ISIS 552922, ISIS 552923, ISIS 552942, ISIS 552872, ISIS 552925, ISIS 552937, and ISIS 552939. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. As shown in Table 66, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, 'd' indicates a deoxynucleoside; and 'e' indicates a MOE modification; in case of the MOE gapmers, the Chemistry column defines the gap-wing structure.

Table 66

Percent inhibition of HBV DNA and RNA in transgenic mice

552872 ek- 10-keke 20 77 46

552925 ek-10-keke 20 89 65

552937 ek-10-keke 20 59 35

552939 ek-10-keke 20 57 19

Example 20: Efficacy of gapmers targeting HBV in transgenic mice

Mice harboring a HBV gene fragment (Guidotti, L. G. et al., J. Virol. 1995, 69, 6158-6169) were used. The mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model. HBV DNA, RNA, and antigen levels were assessed.

Groups of 10 mice each were injected subcutaneously twice a week for the first with 50 mg/kg and, subsequently, twice a week for the next 3 weeks with 25 mg/kg of ISIS 146786 or ISIS 510100. Control groups of 10 mice each were treated in a similar manner with ISIS 141923 (CCTTCCCTGAAGGTTCCTCC, SEQ ID NO: 320; 5-10-5 MOE gapmer with no known murine target) or ISIS 459024 (CGGTCCTTGGAGGATGC, SEQ ID NO: 1351 ; 3-10-4 MOE gapmer with no known murine target). Mice were euthanized 48 hours after the last dose, and organs and serum were harvested for further analysis.

DNA and RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of HBV DNA, using primer probe sets RTS3370, RTS3371 , or RTS3372 (forward sequence ATCCTATCAACACTTCCGGAAACT, designated SEQ ID NO: 314; reverse sequence CGACGCGGCGATTGAG, designated SEQ ID NO: 315; probe sequence AAGAACTCCCTCGCCTCGCAGACG, designated SEQ ID NO: 316). The DNA levels were normalized to picogreen. HBV RNA samples were also assayed with primer probe sets RTS3370 and RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN®. The data is presented in Table 67. Serum DNA samples were analyzed after the study period. The data is presented in Table 68, expressed relative to the levels measured in the control group. As shown in Tables 67 and 68, the antisense oligonucleotides achieved reduction of HBV DNA and RNA over the PBS control. Results are presented as percent inhibition of HBV mRNA or DNA, relative to control. The Chemistry column defines the gap-wing structure of each gapmer.

Table 67

Percent inhibition of HBV RNA and DNA in the liver of transgenic mice

141923 5-10-5 MOE 2 0 13 0 7 31

459024 3-10-4 MOE 19 0 8 0 0 0

Table 68

Percent inhibition of HBV DNA in the serum of transgenic mice

HBV antigen Analysis

HBV antigens in the supernatants were detected with the ELISA technique. HBs antigen (HBsAg) levels were detected by ELISA from Abazyme LLC, MA. As presented in Table 57, treatment with ISIS oligonucleotides 146786 or 510100 caused reduction in HBsAg levels. HBe antigen (HBeAg) levels were detected by ELISA from International Immuno-diagnostics, CA. As presented in Table 69, treatment with ISIS oligonucleotides 146786 or 510100 also caused reduction in HBeAg levels.

Table 69

HBV antigen levels (PEI U/mL) in transgenic mice

Example 21: Antisense inhibition of HBV viral mR A in HepG2 cells by deoxy, MOE and (S)-cEt gapmers

Additional antisense oligonucleotides were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. ISIS 146786, ISIS 505358, ISIS 509932, and ISIS 510100, disclosed in U.S. Provisional Application No. 61/478,040 filed on April 21 , 2011 ; ISIS 552859 disclosed in U.S. Provisional Application No. 61/596692 filed on February 8, 2012; ISIS 577121 , ISIS 577122, ISIS 577123, ISIS 577132, ISIS 577133, and ISIS 577134, disclosed in the study described above, were also included in the assay. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using Cytofectin with 9.375 nM, 18.75 nM, 37.50 nM, 75.00 nM, 150.00 nM, or 300.00 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3371 was used to measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in Tables below were designed as deoxy, MOE and (S)-cEt gapmers. The deoxy, MOE and (S)-cEt gapmers are 16, 17, or 18 nucleosides in length wherein the nucleosides have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, 'd' indicates a deoxynucleoside; and 'e' indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.

"Viral Target start site" indicates the 5' -most nucleotide to which the gapmer is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3' -most nucleotide to which the gapmer is targeted viral gene sequence. Each gapmer listed in Table 70 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1).

Table 70

Chimeric antisense oligonucleotides targeting SEQ ID NO: 1

Table 71

Dose dependent inhibition of HBV mRNA levels by chimeric antisense oligonucleotides

Table 72

Example 22: Analysis of the potency of uniform deoxyoligonucleotides in inhibition of HBV mRNA in HepG2 cells

Additional antisense oligonucleotides were tested for their effects on HBV mRNA in vitro. ISIS

5808 and ISIS 9591 , disclosed in US5985662 were also included in the assay. ISIS 146786 was included in the assay as the benchmark. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000® with 18.75 nM, 37.50 nM, 75.00 nM, 150.00 nM, or 300.00 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3371 was used to measure mRNA and DNA levels. HBV mRNA levels were adjusled according to total RNA content, as measured by RIBOGREEN®. S antigen and E antigen levels were also measured by ELISA. Results are presented as percent inhibition, relative to untreated control cells.

The antisense oligonucleotides tested, ISIS 582699, ISIS 582700, and ISIS 582701 , were designed according to the sequences and chemistries disclosed in Korba and Gerin, Antiviral Research, 1995, Vol. 28, 225-242; the corresponding names for the oligonucleotides in the reference are SI , CI , and L2c, respectively. The antisense oligonucleotides in Tables below were designed as uniform deoxy oligonucleotides, 16 or 21 nucleosides in length wherein the nucleosides have deoxy modifications. "Viral Target start site" indicates the 5 '-most nucleotide to which the oligonucleotide is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3'-most nucleotide to which the oligonucleotide is targeted viral gene sequence. Each oligonucleotide listed in Table 73 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1). The results indicate that the deoxy oligonucleotides had negligible effect on HBV mRNA expression levels DNA levels and HBV antigen levels.

Table 73

Uniform deoxy oligonucleotides targeting SEQ ID NO: 1

Table 74

Dose dependent inhibition of HBV mRNA levels after treatment with oligonucleotides

Table 75 Dose dependent inhibition of HBV DNA levels in HepG2 cells after treatment with oligonucleotides

Table 76

HBV S antigen levels after treatment with oligonucleotides (arbitrary units)

Table 77

HBV E antigen levels after treatment with oligonucleotides (arbitrary units)

Claims

What is claimed is:

1. A compound, comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5-310, 321 -802, 804-1272, or 1288-1350, 1364-1372, 1375, 1376, and 1379.

2. A compound, comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein said modified oligonucleotide is complementary to SEQ ID NO: 1

3. The compound of claim 1 or 2, wherein said modified oligonucleotide is at least 96% complementary to SEQ ID NO: 1.

4. The compound of claim 1 or 2, wherein said modified oligonucleotide is at least 97% complementary to SEQ ID NO: 1.

5. The compound of claim 1 or 2, wherein said modified oligonucleotide is at least 98% complementary to SEQ ID NO: 1.

6. The compound of claim 1 or 2, wherein said modified oligonucleotide is at least 99% complementary to SEQ ID NO: 1.

7. The compound of claim 1 or 2, wherein said modified oligonucleotide is 100% complementary to SEQ ID NO: 1.

8. The compound of claim 1 or 2, consisting of a single-stranded modified oligonucleotide.

9. The compound of claim 1 or 2, wherein at least one intemucleoside linkage is a modified intemucleoside linkage.

10. The compound of claim 9, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.

1 1. The compound of claim 1 or 2, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

12. The compound of claim 1 1 , wherein the at least one modified sugar is a bicyclic sugar.

13. The compound of claim 1 1 , wherein at least one modified sugar comprises a 2'-0-methoxyethyl group.

14. The compound of claim 1 1 , wherein the modified sugar comprises a 2'-0(CH₂)2-OCH₃ group.

15. The compound of claim 1 1 , wherein the modified sugar comprises a 4'-CH(CH₃)-0-2' group.

16. The compound of claim 1 or 2, wherein at least one nucleoside comprises a modified nucleobase.

17. The compound of claim 16, wherein the modified nucleobase is a 5-methylcytosine.

18. The compound of claim 1 or 2, wherein the modified oligonucleotide comprises: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3 ' wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3 ' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

19. The compound of claim 18, wherein the gap segment consists of 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15 or 16 linked nucleosides.

20. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5 ' wing segment consisting of 2-3 linked nucleosides; and a 3 ' wing segment consisting of 3-4 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar or a constrained ethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.

21. The compound of claim 20, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of 3 linked nucleosides; and a 3' wing segment consisting of 3 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar or a constrained ethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.

22. The compound of claim 21 , wherein each of the 3 linked nucleosides of the 5' wing segment comprises a 2'-0-methoxyethyl sugar and each of the 3 linked nucleosides of the 3' wing segment comprises a constrained ethyl sugar.

23. The compound of claim 21, wherein the 3 linked nucleosides of the 5' wing segment comprise a 2'-0- methoxyethyl sugar, a constrained ethyl sugar, and a constrained ethyl sugar in the 5' to 3' direction, and the 3 linked nucleosides of the 3' wing segment comprise a constrained ethyl sugar, a constrained ethyl sugar, and a 2'-0-methoxyethyl sugar in the 5' to 3' direction.

24. The compound of claim 20, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of 2 linked nucleosides; and a 3' wing segment consisting of 4 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar or a constrained ethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.

25. The compound of claim 24, wherein the 2 linked nucleosides of the 5' wing segment comprise a 2'-0- methoxyethyl sugar and a constrained ethyl sugar in the 5' to 3' direction, and the 4 linked nucleosides of the 3' wing segment comprise a constrained ethyl sugar, a 2'-0-methoxyethyl sugar, a constrained ethyl sugar, and a 2'-0-methoxyethyl sugar in the 5' to 3 ' direction.

26. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5 ' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

27. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of four linked nucleosides; and a 3' wing segment consisting of four linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

28. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and a 3' wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

29. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of two linked nucleosides; and a 3' wing segment consisting of two linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

30. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and a 3' wing segment consisting of four linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

31. The compound of claim 18, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of 1-5 linked nucleosides; and a 3' wing segment consisting of 1-5 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein each intemucleoside linkage is a phosphorothioate linkage.

32. The compound of claim 1 or 2, wherein the modified oligonucleotide consists of 20 linked nucleosides.

33. The compound of claim 1 or 2, wherein the modified oligonucleotide consists of 16 linked nucleosides.

34. The compound of claim 1 or 2, wherein said modified oligonucleotide consists of 15 to 30 linked nucleosides.

35. The compound of claim 1 or 2, wherein said modified oligonucleotide consists of 18 to 22 linked nucleosides.

36. The compound of claim 1 or 2, wherein said modified oligonucleotide consists of 20 to 30 linked nucleosides. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleotides 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61 -76, 61 -77, 61 -80, 62-77, 63-84, 68-1 14, 101 -123, 98-123, 113-138, 1 16-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191 -215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224,

206-228 218-237_: 224-243, 233-264, 242-263, 243-262, 244-263 245-274; 245-260, 245-264, 246-266, 247-266 247-269 247-270, 245-267, 251-267, 245-266, 250-269 251 -266, 251 - 268, 251-269, 245-269, 245-266 245-261 _; 250-265, 250-266, 250-267, 250-268, 250-269 251 -270, 252- 267, 253-268, 253-269, 253-272 253-274_; 254- 269, 254-270, 254-274, 255-270, 255-271 255- 274, 255-401 , 255- 400, 255-274, 255-273 255-272_; 255- 271 , 256-271 , 256-275, 255-276, 256-272 256- 276, 253- 275, 256- 279, 257-276, 258-273 259-274_; 260-279, 262-281, 262-321, 262-315, 262-312 265-312, 266-288, 266-291 , 266-285, 281-321 281 -303 290-321 , 290-312, 292-31 1 , 290-312, 293-312 293-315, 293-321 , 296-321 , 302-321 , 324-343 339-361 339-367, 348-367, 342-367, 358-392, 358-378 360-392, 360-383, 360-388, 360-385, 362-381 366-388 369-388, 366-385, 366-392, 370-389, 370-392 380-399, 382-401 , 384-433, 384-400, 384-401 385-401 405-424, 409-428, 405-428, 411 -426, 41 1 -427 41 1 -430, 411 -431 , 41 1-437, 412- 431 , 41 1 -426 41 1 -427_: 412-428, 412-431 , 412-427, 413-433, 413-432_: 413-428, 413-429, 413-432, 413- 433, 414-427 415- 427_: 414-429, 414-430, 414-433, 415-428, 415-429 415-430, 415-431 , 415-434, 416-431 , 416-432 416- 429_: 416-435, 417-432, 417-433, 417-436, 418-433 418-435, 418-434, 418-437, 419-435, 419-434 420-435_: 419-432, 419-434, 421 -436, 422-437, 422-441 423-436, 425-465, 454-473, 454-472, 457-476 457-472_: 457.473, 454-476, 455-472, 457-485, 458-485 458- 483, 458-477, 458-473, 459-485, 460-485 463-498_: 463-485, 466-485, 463-482, 457-491 , 458-491 459- 491 , 460-491 , 463-491 , 466-491 , 472-491 472-493_: 473-492, 475-491 , 459-494, 460-494, 463-494 466-494, 467-498, 472-494, 475-494, 457-473 457-472 458-494, 454-494, 457-494, 457-473, 485-513 470-493, 476-519, 485-519, 500-519, 512-534 512-550 524-546, 536-559, 548-567, 548-570, 550-570 548-594, 554-573, 548-576, 560-594, 584-606 611 -645 617-363, 623-642, 617-645, 639-754, 639-658 639-654, 641 -656, 642-657, 643-658, 642-754 653-672 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689, 671 -690 671 -691 671 -686, 671 -687, 672-693, 672-697, 672-707 672-687, 672-688, 673-688, 674-693, 678-693 679-694 679-707, 679-698, 679-701 , 679-702, 679-707 680-695, 680-699, 679-699, 681 -706, 681-696 682-697 682-706, 682-707, 682-702, 682-701 , 683-698 684-699, 685-700, 686-701 , 687-754, 688-704 689- 709 689- 710, 690-705, 679-705, 679-710, 679-706 690-710, 691 -710, 690-754, 690-706, 684-703 687-705 687-702, 687-703, 687-706, 688-703, 688-704_: 688-705, 689-704, 689-705, 689- 708, 690-705 690- 706 690- 709, 691 -706, 692-71 1 , 693-716, 693-712, 695-715, 697-716, 697-716_: 690- 716, 724-746, 724-752 724-754, 724-758, 733-752, 738-754, 738-753 739-758, 739-754, 739-775, 739-754, 740-754. 742-785 742-773, 757-776, 757-785, 790-815, 793-812 81 1 -833, 81 1 -844, 814-833. 81 1 -906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951 -1024, 951-1056, 951 -997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081 -1 143, 1082-1101 , 1088-1 107, 1088-1 134, 1094-1119, 1097-1119, 11 12- 1134, 1 118-1143, 1118-1146, 1088-1146, 1 121-1 140, 1 127-1 146, 1127-1 193, 1150-1193, 1156-1 187, 1165-1187, 1170-1192, 1171 -1191 , 1 172-1 191 , 1 176-1 192, 1176-1285, 1177-1 192, 1 176-1191 , 1203- 1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261 -1296, 1261-1285, 1261 -1276, 1261-1277, 1261-1280, 1262- 1296, 1262-1277, 1262-1278, 1262-1281 , 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281 , 1265-1284, 1266-1281 , 1266-1282, 1266-1285, 1267- 1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259- 1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281 -1324, 1281-1336, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 131 1 -1336, 1311 -1333, 1326-1345, 1353- 1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521- 1563, 1521 -1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571 -1595, 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578- 1597, 1578-1598, 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601 , 1582-

1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-1604, 1586-1601 , 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-

1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651-1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773- 1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1797, 1781 -1796, 1781- 1796, 1781 -1800, 1781 -1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1889, 1778-1794, 1779-1795, 1780-1799, 1785-1800, 1794-1813, 1806- 1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831 , 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821 -1840, 1821 -1844, 1821 -1837, 1822-1843, 1822-1839, 1822- 1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1866-1881 , 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884, 1870-1885, 1871 -1886, 1872-1887, 1874- 1889, 1876-1895, 1888-1914, 1888-1908, 1891 -1910, 1891 -1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921 -1934, 1928-1956, 1957- 1976, 2035-2057, 2083-2141 , 2230-2261 , 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381 -2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892, or 3161- 3182 of SEQ ID NO: 1 , wherein said modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1.

38. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 1 -20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43- 68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61 -76, 61 -77, 61 -80, 62-77, 63-84, 68-1 14, 101-123, 98-123, 113-138, 1 16-138, 131 -150, 137-162, 152- 186, 158-177, 167-186, 191 -215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205- 224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-274; 245-260, 245-264, 246- 266, 247-266, 247-269, 247-270, 245-267, 251 -267, 245-266, 250-269, 251-266, 251 -268, 251 -269, 245-269, 245-266, 245-261 , 250-265, 250-266, 250-267, 250-268, 250-269, 251 -270, 252-267, 253-268,

253-269 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255-271 , 255-274, 255-401 , 255-400, 255-274 255-273, 255-272, 255-271, 256-271 , 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276 258-273, 259-274, 260-279, 262-281 , 262-321 , 262-315, 262-312, 265-312, 266-288, 266-291 , 266-285 281 -321 , 281 -303, 290-321 , 290-312, 292-311 , 290-312, 293-312, 293-315, 293-321 , 296-321 , 302-321 324-343, 339-361 , 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385 362-381 , 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400 384-401 , 385-401 , 405-424, 409-428, 405-428, 41 1-426, 411 -427, 41 1 -430, 411-431 , 41 1 -437,

412- 431 41 1 -426, 41 1 -427, 412-428, 412-431 , 412-427, 413-433, 413-432, 413-428, 413-429, 413-432,

413- 433 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431 , 415-434, 416-431 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435 419-434, 420-435, 419-432, 419-434, 421-436, 422-437, 422-441 , 423-436, 425-465, 454-473, 454-472_: 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485 460-485, 463-498, 463-485, 466-485, 463-482, 457-491 , 458-491 , 459-491 , 460-491 , 463-491 , 466-491 472-491 , 472-493, 473-492, 475-491 , 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494 457.473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594 584-606, 61 1 -645, 617-363, 623-642, 617-645, 639-754, 639-658, 639-654, 641 -656, 642-657, 643-658_: 642-754, 653-672, 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689_; 671 -690, 671 -691 , 671 -686, 671 -687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693_; 678-693, 679-694, 679-707, 679-698, 679-701 , 679-702, 679-707, 680-695, 680-699, 679-699, 681 -706 681 -696, 682-697, 682-706, 682-707, 682-702, 682-701 , 683-698, 684-699, 685-700, 686-701 , 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705,

689- 708, 690-705, 690-706, 690-709, 691-706, 692-711 , 693-716, 693-712, 695-715, 697-716, 697-716,

690- 716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 738-753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811 -833, 81 1-844, 814-833, 811 -906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951 -970, 951 -985, 951 -1044, 951-1024, 951 -1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101 , 1081 -1134, 1081-1 143, 1082-1101 , 1088-1107, 1088-1134, 1094-11 19, 1097- 1119, 1112-1134, 1 118-1143, 1 1 18-1 146, 1088-1146, 1121-1 140, 1127-1146, 1127-1193, 1150-1 193, 1156-1187, 1165-1187, 1170-1192, 1171-1191 , 1172-1191 , 1 176-1 192, 1176-1285, 1177-1 192, 1176- 1191 , 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261 -1296, 1261-1285, 1261 -1276, 1261 -1277, 1261 - 1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281 , 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281 , 1265-1284, 1266-1281 , 1266-1282, 1266- 1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271 -1290, 1271 -1296, 1277-1296, 1261 -1290, 1262-1290, 1268-1290, 1263-1305, 1259- 1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281 -1324, 1281-1336, 1282-1301 , 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 131 1-1336, 131 1-1333, 1326- 1345, 1353-1381 , 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518- 1537, 1521-1563, 1521 -1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571 -1595, 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578- 1594, 1578-1597, 1578-1598, 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581 -1596, 1581 -1597, 1581 -1600, 1582-1597, 1582-1598, 1582- 1601 , 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601 , 1585-1604, 1586-1601 , 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587- 1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651 -1720, 1651 -1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764- 1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781 -1797, 1781 - 1796, 1781-1796, 1781 -1800, 1781 -1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1889, 1778-1794, 1779-1795, 1780-1799, 1785-1800, 1794- 1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1 837, 1812-1831 , 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821 -1840, 1821 -1844, 1821 -1837, 1822-1843, 1822- 1839, 1822-1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846, 1861 -1884, 1861-1880, 1865-1885, 1866-1881 , 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884, 1870-1885, 1871-1886, 1872- 1887, 1874-1889, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891 -1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921 -1934, 1928- 1956, 1957-1976, 2035-2057, 2083-2141 , 2230-2261 , 2368-2393, 2381 -2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873- 2892, or 3161-3182, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 1.

39. The compound of claim 36, wherein at least one nucleoside of the modified oligonucleotide comprises at least one 2'-0-methoxyethyl sugar or constrained ethyl sugar.

40. A compound, comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1 , 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281 , 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361 , 1362, and 1363.

41. A composition comprising the compound of any of claims 1 -40 or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.

42. A method comprising administering to an animal the compound or composition of any of claims 1-41.

43. The method of claim 42, wherein the animal is a human.

44. The method of claim 43, wherein administering the compound prevents, treats, ameliorates, or slows progression of a HBV -related disease, disorder or condition.

45. The method of claim 44, wherein the disease, disorder or condition is liver disease.

46. The method of claim 44, wherein the disease, disorder or condition is jaundice, liver inflammation, liver fibrosis, inflammation, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related transplantation.

47. The method of claim 44, wherein the disease or condition is a hyperproliferative condition.

48. The method of claim 47, wherein the hyperproliferative condition is liver cancer.

49. A method of reducing antigen levels in an animal comprising administering to said animal the compound or composition of any of claims 1-41.

50. The method of claim 49, wherein HBsAG levels are reduced.

51. The method of claim 49, wherein HBeAG levels are reduced.

52. The method of claim 49, wherein the animal is human.

53. The method of claim 49, comprising co-administering the compound or composition and a second agent.

54. The method of claim 53, wherein the compound or composition and the second agent are administered concomitantly.