WO2011127175A1

WO2011127175A1 - Modulation of cd130 (gp130) expression

Info

Publication number: WO2011127175A1
Application number: PCT/US2011/031424
Authority: WO
Inventors: Adam Mullick; Rosanne M. Crooke; Mark J Graham
Original assignee: Isis Pharmaceuticals, Inc.
Priority date: 2010-04-06
Filing date: 2011-04-06
Publication date: 2011-10-13

Abstract

Provided herein are methods, compounds, and compositions for reducing expression of a gp130 mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for reducing inflammation in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of inflammatory disease, cardiovascular disease or metabolic disease or a symptom thereof.

Description

MODULATION OF CD130 (gp!30) EXPRESSION

Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The

Sequence Listing is provided as a file entitled 20110406_BIOL0128WOSEQ.txt, created on April 6, 2011 which is 189 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field of the Invention

Provided herein are methods, compounds, and compositions for reducing expression of gpl30 mRNA and protein in an animal. Also, provided herein are methods, compounds, and compositions having a gpl30 inhibitor for reducing gpl30 related diseases or conditions in an animal. Such methods, compounds, and compositions are useful, for example, to treat, prevent, delay or ameliorate any one or more of cardiovascular disease or inflammatory syndrome, or a symptom thereof, in an animal.

Background Liver acute phase proteins (APPs) have become powerful predictors of cardiovascular disease

(CVD)(Ridker et al., The NEJM, 2005, 352(l):20-28; Johnson et al., Circulation. 2004, 109(6):726-732). Atherosclerosis, a major contributor to CVD, is a chronic inflammatory disease characterized in part by elevated plasma IL-6 and liver acute phase proteins like serum amyloid P (SAP), serum amyloid A (SAA) and C-reactive protein (CRP)(Gabay C, Kushner I. NEJM, 1999, 340(6):448-454). The links between inflammation, APPs and atherosclerosis remain unclear, however emerging evidence demonstrates a pro- atherosclerotic milieu is created by APPs (O'Brien et al., ATVB, 2005, 25(4):785-790; Bjorkman et al., J Leukocyte Biology, 2008, 83(2):245-253; Cheng et al., J Immunol, 2008, 181(l):22-26; Wilson et al., Am J of Path, 2008, 173(6): 1902-1910; He et al., Blood, 2009, 113(2):429-437; Annema et al., J Lipid

Research, 2010, 51(4):743-754; Feingold and Grunfeld, J Lipid Research, 2010, 51(4):682-684; Lu et al., Biochem andBiophys Res Comm, 2010, 391(4):1737-1741; Sullivan et al., J Biol Chem, 2010,

285(l):565-575). The IL-6 family of cytokines stimulates an acute phase response (APR) via IL-6 receptor binding leading to glycoprotein 130 activation (Ohtani et al., Expert Opin Ther Targets, 2000, 4(4):459- 479). Glycoprotein 130 (also known as gpl30, CD130, oncostatin M receptor or IL6ST) forms a subunit of the IL-6 receptor (EL-6R), and is required for IL-6R signal transduction via all members of the IL-6 cytokine family. EL-6 cytokine family includes: IL-6, IL-12, granulocyte colony-stimulating factor (G- CSF), oncostatin M (OSM), leukemia inhibitory factor (LIF) and cardiotrophin-1 (CT-1). gpl30 has broad tissue expression, including the liver, kidney, adipose, bone marrow and skeletal muscle. However, liver gpl30 expression is principally responsible for elevation of plasma APPs during inflammation (Luchtefeld et al., J Exp Med, 2007, 204(8):1935-1944). Homozygous deficiency of gpl30 is lethal, but liver-specific deficiency results in viable and healthy mice that have >50% reduction in atherosclerosis and are protected against neointima formation (Luchtefeld et al., J Exp Med, 2007, 204(8):1935-1944; Wang et al., Circulation Research, 2007, 100(6):807-816; Salguero et al.,

Hypertension, 2009, 54(5): 1035-1042). Interestingly, a polymorphism in GP130 has been described that results in a reduction in coronary artery disease (CAD) risk (Luchtefeld et al., J Exp Med, 2007,

204(8): 1935-1944).

Although the relationship between inflammation, APPs and atherosclerosis is unclear, the role of gpl30 in elevating APPs makes it an attractive target for therapeutic and investigative strategies aimed at diseases and conditions associated with inflammation and atherosclerosis.

Antisense compounds readily accumulate in the tissues where gpl30 is expressed such as liver and adipose tissue (Antisense Drug Technology 2^nd Edition, ST Crooke, Ed., CRC Press, Boca Raton, FL) making antisense technology uniquely suited to target gpl30 expression and function.

The potential role of gpl30 in inflammation makes it an attractive target for investigation.

Antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of gpl30.

Summary of the Invention

Provided herein are antisense compounds useful for modulating gene expression and associated pathways via antisense mechanisms of action such as RNaseH, RNAi and dsRNA enzymes, as well as other antisense mechanisms based on target degradation or target occupancy.

Provided herein are methods, compounds, and compositions for inhibiting expression of gpl30 and treating, preventing, delaying or ameliorating a gpl30-related disease, condition or a symptom thereof. In certain embodiments, the gpl30-related disease or condition is cardiovascular disease or inflammatory disease.

In certain embodiments, the compounds or compositions of the invention comprise a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30. The gpl30 target can have a sequence selected from any one of SEQ ID NOs: 1-13. The modified oligonucleotide targeting gpl30 can have a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of SEQ ID NOs: 1-13. The modified oligonucleotide can have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases. The contiguous nucleobase portion of the modified oligonucleotide can be complementary to an equal length portion of a gpl30 region selected from any one of SEQ DD NOs: 1-13.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5' wing segment consisting of linked nucleosides; and c) a 3' wing segment consisting of linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2'-0- methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5- methylcytosine.

Certain embodiments provide a method of reducing gpl30 expression in an animal comprising administering to the animal a compound comprising the modified oligonucleotide targeting gpl30 described herein.

Certain embodiments provide a method of reducing inflammation in an animal comprising administering to the animal a compound comprising the modified oligonucleotide targeted to gpl30 described herein, wherein the modified oligonucleotide reduces gpl30 expression in the animal.

Certain embodiments provide a method of reducing glucose levels in an animal comprising administering to the animal a compound comprising the modified oligonucleotide targeted to gpl30 described herein, wherein the modified oligonucleotide reduces gpl30 expression in the animal.

Certain embodiments provide a method of ameliorating cardiovascular disease or metabolic disease in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeted to gpl30 described herein, wherein the modified oligonucleotide reduces gpl30 expression in the animal.

Certain embodiments provide a method for treating an animal with cardiovascular disease or metabolic disease comprising: 1) identifying the animal with cardiovascular disease or metabolic disease, and 2) administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to SEQ ID NO: 1-13 as measured over the entirety of said modified oligonucleotide, thereby treating the animal with cardiovascular disease or metabolic disease. In certain embodiments, the therapeutically effective amount of the compound administered to the animal reduces cardiovascular disease or metabolic disease in the animal.

Certain embodiments provide a method for treating an animal with inflammatory disease comprising: 1) identifying the animal with inflammatory disease, and 2) administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to SEQ ID NO: 1-13 as measured over the entirety of said modified oligonucleotide, thereby treating the animal with

inflammatory disease. In certain embodiments, the therapeutically effective amount of the compound administered to the animal reduces inflammatory disease in the animal.

Detailed Description of the Invention

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety. Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

"2'-0-methoxyethyl" (also 2'-MOE and 2'-0(CH₂)2-OCH₃) refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.

"2'-0-methoxyethyl nucleotide" means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety. "3' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 3'- most nucleotide of a particular antisense compound.

"5' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 5'- most nucleotide of a particular antisense compound.

"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5 ' position. A 5-methylcytosine is a modified nucleobase.

"About" means within ±10% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of gpl30", it is implied that the gp 130 levels are inhibited within a range of 63% and 77%.

"Active pharmaceutical agent" means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to GP130 is an active pharmaceutical agent.

"Active target region" or "target region" means a region to which one or more active antisense compounds is targeted. "Active antisense compounds" means antisense compounds that reduce target nucleic acid levels or protein levels.

"Adipogenesis" means the development of fat cells from preadipocytes. "Lipogenesis" means the production or formation of fat, either fatty degeneration or fatty infiltration.

"Adiposity" or "Obesity" refers to the state of being obese or an excessively high amount of body fat or adipose tissue in relation to lean body mass. The amount of body fat includes concern for both the distribution of fat throughout the body and the size and mass of the adipose tissue deposits. Body fat distribution can be estimated by skin-fold measures, waist-to-hip circumference ratios, or techniques such as ultrasound, computed tomography, or magnetic resonance imaging. According to the Center for Disease Control and Prevention, individuals with a body mass index (BMI) of 30 or more are considered obese. The term "Obesity" as used herein includes conditions where there is an increase in body fat beyond the physical requirement as a result of excess accumulation of adipose tissue in the body. The term "obesity" includes, but is not limited to, the following conditions: adult-onset obesity; alimentary obesity; endogenous or inflammatory obesity; endocrine obesity; familial obesity; hyperinsulinar obesity;

hyperplastic-hypertrophic obesity; hypogonadal obesity; hypothyroid obesity; lifelong obesity; morbid obesity and exogenous obesity.

"Administered concomitantly" refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

"Administering" means providing an agent to an animal, and includes, but is not limited to, administering by a medical professional and self-administering.

"Agent" means an active substance that can provide a therapeutic benefit when administered to an animal. "First Agent" means a therapeutic compound of the invention. For example, a first agent can be an antisense oligonucleotide targeting gpl30. "Second agent" means a second therapeutic compound of the invention (e.g. a second antisense oligonucleotide targeting gpl30) and/or a non-gpl30 therapeutic compound.

"Amelioration" refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.

"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and

chimpanzees.

"Anti-inflammatory drug" refers to compounds used to decrease inflammation locally or systemically. Anti-inflammatory drugs include steroids, NSAIDS (nonsteroidal anti-inflammatory drugs), and therapeutic antibodies against TNFa (e.g., infliximab, etanercept, adalimumab, etc) and against IL-6 (e.g., tocilizumab). NSAIDS include aspirin, acetaminophen, ibuprofen, naproxen, COX inhibitors, indomethacin and the like.

"Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

"Antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. As used herein, the term "antisense compound" encompasses pharmaceutically acceptable derivatives of the compounds described herein.

"Antisense inhibition" means the reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to the target nucleic acid levels or target protein levels in the absence of the antisense compound.

"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid. As used herein, the term "antisense oligonucleotide" encompasses pharmaceutically acceptable derivatives of the compounds described herein. "ApoB-containing lipoprotein" means any lipoprotein that has apolipoprotein B as its protein component, and is understood to include LDL, VLDL, IDL, and lipoprotein(a) and can be generally targeted by lipid lowering agent and therapies. "ApoB-100-containing LDL" means ApoB-100 isoform containing LDL.

"Atherosclerosis" means a hardening of the arteries affecting large and medium-sized arteries and is characterized by the presence of fatty deposits. The fatty deposits are called "atheromas" or "plaques," which consist mainly of cholesterol and other fats, calcium and scar tissue, and damage the lining of arteries.

"Bicyclic sugar" means a furosyl ring modified by the bridging of two non-geminal ring atoms. A bicyclic sugar is a modified sugar.

"Bicyclic nucleic acid" or "BNA" refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.

"Cardiovascular disease" or "cardiovascular disorder" refers to a group of conditions related to the heart, blood vessels, or the circulation. Examples of cardiovascular diseases include, but are not limited to, aneurysm, angina, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), coronary heart disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia.

"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0- methoxyethyl modifications.

"Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions.

"Co-administration" means administration of two or more agents to an individual. The two or more agents can be in a single pharmaceutical composition, or can be in separate pharmaceutical compositions. Each of the two or more agents can be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

"Constrained ethyl" or "cEt" refers to a bicyclic nucleoside having a furanosyl sugar that comprises a methyl(methyleneoxy) (4'-CH(CH₃)-0-2') bridge between the 4' and the 2' carbon atoms.

"Cholesterol" is a sterol molecule found in the cell membranes of all animal tissues. Cholesterol must be transported in an animal's blood plasma by lipoproteins including very low density lipoprotein (VLDL), intermediate density lipoprotein (IDL), low density lipoprotein (LDL), and high density lipoprotein (HDL). "Plasma cholesterol" refers to the sum of all lipoproteins (VDL, IDL, LDL, HDL) esterified and/or non-estrified cholesterol present in the plasma or serum.

"Cholesterol absorption inhibitor" means an agent that inhibits the absorption of exogenous cholesterol obtained from diet.

"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid. In certain embodiments, complementarity between the first and second nucleic acid may be between two DNA strands, between two RNA strands, or between a DNA and an RNA strand. In certain embodiments, some of the nucleobases on one strand are matched to a complementary hydrogen bonding base on the other strand. In certain embodiments, all of the nucleobases on one strand are matched to a complementary hydrogen bonding base on the other strand. In certain embodiments, a first nucleic acid is an antisense compound and a second nucleic acid is a target nucleic acid. In certain such embodiments, an antisense oligonucleotide is a first nucleic acid and a target nucleic acid is a second nucleic acid.

"Contiguous nucleobases" means nucleobases immediately adjacent to each other.

"Cross-reactive" means an oligomeric compound targeting one nucleic acid sequence can hybridize to a different nucleic acid sequence. For example, in some instances an antisense

oligonucleotide targeting human gpl30 can cross-react with a murine gpl30. Whether an oligomeric compound cross-reacts with a nucleic acid sequence other than its designated target depends on the degree of complementarity the compound has with the non-target nucleic acid sequence.

"Cure" means a method that restores health or a prescribed treatment for an illness.

"Coronary heart disease (CHD)" means a narrowing of the small blood vessels that supply blood and oxygen to the heart, which is often a result of atherosclerosis.

"Deoxyribonucleotide" means a nucleotide having a hydrogen atom at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.

"Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

"Dyslipidemia" refers to a disorder of lipid and/or lipoprotein metabolism, including lipid and/or lipoprotein overproduction or deficiency. Dyslipidemias may be manifested by elevation of lipids such as cholesterol and triglycerides as well as lipoproteins such as low-density lipoprotein (LDL) cholesterol.

"Dosage unit" means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art. In certain embodiments, a dosage unit is a vial containing lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted antisense oligonucleotide. "Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose can be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month. Doses can be expressed, for example, as mg/kg.

"Effective amount" or "therapeutically effective amount" means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. "Effective amount" or "therapeutically effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of active ingredient or pharmaceutical agent, such as an antisense compound, to the individual in need of such modulation, such as inhibition, treatment or prophylaxis, either in a single dose or as part of a series of doses, that is effective for modulating that activity, such as inhibition of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

"Fully complementary" or "100% complementary" means each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a second nucleic acid is a target nucleic acid.

"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a "gap segment" and the external regions can be referred to as "wing segments."

"Gap-widened" means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.

"Glucose" is a monosaccharide used by cells as a source of energy and inflammatory

intermediate. "Plasma glucose" refers to glucose present in the plasma.

"Glycoprotein 130" or "gpl30" means any nucleic acid or protein of gpl30. Glycoprotein 130 or gpl30 is also known as CD130, oncostatin M receptor or IL-6 signal transducer (IL6ST). The gpl30 protein forms a subunit of the IL-6 receptor (IL-6R), and is required for IL-6R signal transduction via all members of the IL-6 cytokine family. IL-6 cytokine family includes: IL-6, IL-12, granulocyte colony- stimulating factor (G-CSF), oncostatin M (OSM), leukemia inhibitory factor (LIF) and cardiotrophin-1 (CT-1).

"gpl30 expression" means the level of mRNA transcribed from the gene encoding gpl30 or the level of protein translated from the mRNA. gpl30 expression can be determined by art known methods such as a Northern or Western blot.

"gpl30 nucleic acid" means any nucleic acid encoding gpl30. For example, in certain

embodiments, a gpl30 nucleic acid includes a DNA sequence encoding gpl30, an RNA sequence transcribed from DNA encoding gpl30 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding gpl30. "gpl30 mRNA" means an mRNA encoding a gpl30 protein.

"High density lipoprotein-C (HDL-C)" means cholesterol associated with high density lipoprotein particles. Concentration of HDL-C in serum (or plasma) is typically quantified in mg dL or nmol/L. "HDL- C" and "plasma HDL-C" mean HDL-C in serum and plasma, respectively.

"HMG-CoA reductase inhibitor" means an agent that acts through the inhibition of the enzyme

HMG-CoA reductase, such as atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, and simvastatin.

"Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

"Hypercholesterolemia" means a condition characterized by elevated cholesterol or circulating (plasma) cholesterol, LDL-cholesterol and VLDL-cholesterol, as per the guidelines of the Expert Panel Report of the National Cholesterol Educational Program (NCEP) of Detection, Evaluation of Treatment of high cholesterol in adults (see, Arch. Int. Med. (1988) 148, 36-39).

"Hyperlipidemia" or "hyperlipemia" is a condition characterized by elevated serum lipids or circulating (plasma) lipids. This condition manifests an abnormally high concentration of fats. The lipid fractions in the circulating blood are cholesterol, low density lipoproteins, very low density lipoproteins and triglycerides.

"Hypertriglyceridemia" means a condition characterized by elevated triglyceride levels.

"Identifying" or "selecting an animal with metabolic or cardiovascular disease" means identifying or selecting a subject having been diagnosed with a metabolic disease, a cardiovascular disease, or a metabolic syndrome; or, identifying or selecting a subject having any symptom of a metabolic disease, cardiovascular disease, or metabolic syndrome including, but not limited to, hypercholesterolemia, hyperglycemia, hyperlipidemia, hypertriglyceridemia, hypertension increased insulin resistance, decreased insulin sensitivity, above normal body weight, and/or above normal body fat content or any combination thereof. Such identification may be accomplished by any method, including but not limited to, standard clinical tests or assessments, such as measuring serum or circulating (plasma) cholesterol, measuring serum or circulating (plasma) blood-glucose, measuring serum or circulating (plasma) triglycerides, measuring blood-pressure, measuring body fat content, measuring body weight, and the like.

"Identifying" or "selecting an animal with an inflammatory disease" means identifying or selecting a subject having been identified as having an inflammatory disease or disorder or identifying or selecting a subject having any symptom of an inflammatory disease or disorder.

"Improved cardiovascular outcome" means a reduction in the occurrence of adverse

cardiovascular events, or the risk thereof. Examples of adverse cardiovascular events include, without limitation, death, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia.

"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements, for example, between regions, segments, nucleotides and/or nucleosides.

"Individual" or "subject" or "animal" means a human or non-human animal selected for treatment or therapy.

"Induce", "inhibit", "potentiate", "elevate", "increase", "decrease" or the like, e.g. denote quantitative differences between two states. For example, "an amount effective to inhibit the activity or expression of gpl30" means that the level of activity or expression of gp 130 in a treated sample will differ from the level of gpl30 activity or expression in an untreated sample. Such terms are applied to, for example, levels of expression, and levels of activity.

"Inflammation" refers to a complex biological response of a body to a stimulus (e.g., a pathogen, cellular damage or an irritant). Inflammation, when prolonged, can lead to an inflammatory disease or disorder. Factors elicited during an inflammatory reaction include pro-inflammatory cytokines (e.g., TNF- a, IL-1, INF-γ, MCP-1), cellular migration (e.g., monocytes, macrophages, lymphocytes, plasma cells) and serum proteins (e.g., serum amyloid A (SAA) and serum amyloid P (SAP)). Inflammation can be local (e.g., vascular inflammation) or systemic.

"Inflammatory disorder" or "inflammatory disease" refers to a condition characterized by inflammation in a cell, tissue or body. Inflammatory diseases and disorders include, but are not limited to, hypersensitivities (e.g., allergies), asthma, autoimmune disease (e.g., rheumatoid arthritis, lupus, multiple sclerosis), cancer, diabetes, inflammatory bowel disease (IBD) or cardiovascular disease (e.g., atherosclerosis), NAFLD, NASH, hepatitis, fibrosis, and cirrhosis.

"Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity of a RNA or protein and does not necessarily indicate a total elimination of expression or activity. "Insulin resistance" is defined as the condition in which normal amounts of insulin are inadequate to produce a normal insulin response from fat, muscle and liver cells. Insulin resistance in fat cells results in hydrolysis of stored triglycerides, which elevates free fatty acids in the blood plasma. Insulin resistance in muscle reduces glucose uptake whereas insulin resistance in liver reduces glucose storage, with both effects serving to elevate blood glucose. High plasma levels of insulin and glucose due to insulin resistance often leads to metabolic syndrome and type 2 diabetes.

"Insulin sensitivity" is a measure of how effectively an individual processes glucose. An individual having high insulin sensitivity effectively processes glucose whereas an individual with low insulin sensitivity does not effectively process glucose.

"Internucleoside linkage" refers to the chemical bond between nucleosides.

"Intravenous administration" means administration into a vein.

"Linked nucleosides" means adjacent nucleosides which are bonded together.

"Lipid-lowering" means a reduction in one or more lipids in a subject. Lipid-lowering can occur with one or more doses over time.

"Lipid-lowering therapy" means a therapeutic regimen provided to a subject to reduce one or more lipids in a subject. In certain embodiments, a lipid-lowering therapy is provided to reduce one or more of ApoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small dense LDL particles, and Lp(a) in a subject.

"Lipoprotein", such as VLDL, LDL and HDL, refers to a group of proteins found in the serum, plasma and lymph and are important for lipid transport. The chemical composition of each lipoprotein differs in that the HDL has a higher proportion of protein versus lipid, whereas the VLDL has a lower proportion of protein versus lipid.

"Low density lipoprotein-cholesterol (LDL-C)" means cholesterol carried in low density lipoprotein particles. Concentration of LDL-C in serum (or plasma) is typically quantified in mg/dL or nmol/L. "Serum LDL-C" and "plasma LDL-C" mean LDL-C in the serum and plasma, respectively.

"Major risk factors" refers to factors that contribute to a high risk for a particular disease or condition. In certain embodiments, major risk factors for coronary heart disease include, without limitation, cigarette smoking, hypertension, low HDL-C, family history of coronary heart disease, age, and other factors disclosed herein.

"Metabolic disorder" or "metabolic disease" refers to a condition characterized by an alteration or disturbance in metabolic function. "Metabolic" and "metabolism" are terms well known in the art and generally include the whole range of biochemical processes that occur within a living organism. Metabolic disorders include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type 2), obesity, insulin resistance, metabolic syndrome and dyslipidemia due to type 2 diabetes. "Metabolic syndrome" means a condition characterized by a clustering of lipid and non-lipid cardiovascular risk factors of metabolic origin. In certain embodiments, metabolic syndrome is identified by the presence of any 3 of the following factors: waist circumference of greater than 102 cm in men or greater than 88 cm in women; serum triglyceride of at least 150 mg/dL; HDL-C less than 40 mg/dL in men or less than 50 mg/dL in women; blood pressure of at least 130/85 mmHg; and fasting glucose of at least 110 mg/dL. These determinants can be readily measured in clinical practice (JAMA, 2001, 285: 2486-2497).

"Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

"Mixed dyslipidemia" means a condition characterized by elevated cholesterol and elevated triglycerides.

"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

"Modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

"Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.

"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A "modified nucleoside" means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.

"Modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleotide.

"Modified sugar" refers to a substitution or change from a natural sugar.

"Motif means the pattern of chemically distinct regions in an antisense compound.

"MTP inhibitor" means an agent inhibits the enzyme, microsomal triglyceride transfer protein.

"Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

"Natural sugar moiety" means a sugar found in DNA (2'-H) or RNA (2'-OH).

"Non-alcoholic fatty liver disease" or "NAFLD" means a condition characterized by fatty inflammation of the liver that is not due to excessive alcohol use (for example, alcohol consumption of over 20 g/day). In certain embodiments, NAFLD is related to insulin resistance and the metabolic syndrome. NAFLD encompasses a disease spectrum ranging from simple triglyceride accumulation in hepatocytes (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis. "Nonalcoholic steatohepatitis" (NASH) occurs from progression of NAFLD beyond deposition of triglycerides. A "second hit" capable of inducing necrosis, inflammation, and fibrosis is required for development of NASH. Candidates for the second-hit can be grouped into broad categories: factors causing an increase in oxidative stress and factors promoting expression of proinflammatory cytokines "Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA). A nucleic acid can also comprise a combination of these elements in a single molecule.

"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid. "Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the oligonucleotide and the target nucleic acid are considered to be complementary at that nucleobase pair.

"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

"Nucleoside" means a nucleobase linked to a sugar.

"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base, and not necessarily the linkage at one or more positions of an oligomeric compound such; for example, nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, such as non furanose sugar units.

"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

"Nucleotide mimetic" includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=0)-0- or other non-phosphodiester linkage).

"Oligomeric compound" or "oligomer" refers to a polymeric structure comprising two or more sub-structures and capable of hybridizing to a region of a nucleic acid molecule. In certain embodiments, oligomeric compounds are oligonucleosides. In certain embodiments, oligomeric compounds are oligonucleotides. In certain embodiments, oligomeric compounds are antisense compounds. In certain embodiments, oligomeric compounds are antisense oligonucleotides. In certain embodiments, oligomeric compounds are chimeric oligonucleotides. "Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

"Parenteral administration" means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short or intermittent.

"Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

"Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to GP130 is pharmaceutical agent.

"Pharmaceutical composition" or "composition" means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution.

"Pharmaceutically acceptable carrier" means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain, of such carries enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. Certain of such carriers enable pharmaceutical compositions to be formulated for injection, infusion or topical administration. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution.

"Pharmaceutically acceptable derivative" encompasses derivatives of the compounds described herein such as solvates, hydrates, esters, prodrugs, polymorphs, isomers, isotopically labelled variants, conjugates, pharmaceutically acceptable salts and other derivatives known in the art.

"Pharmaceutically acceptable salts" or "salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto. The term "pharmaceutically acceptable salt" or "salt" includes a salt prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic or organic acids and bases. "Pharmaceutically acceptable salts" of the compounds described herein may be prepared by methods well-known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley- VCH, Weinheim, Germany, 2002). Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. Accordingly, in one embodiment the compounds described herein are in the form of a sodium salt. "Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

"Portion" means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

"Prevent" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.

"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e. a drug) within the body or cells thereof by the action of endogenous or non-endogenous enzymes or other chemicals or conditions.

"Region" or "target region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

"Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.

"Second agent" or "second therapeutic agent" means an agent that can be used in combination with a "first agent". A second therapeutic agent can be any agentthat inhibits or prevents excess collagen production. A second therapeutic agent can include, but is not limited to, an siRNA or antisense oligonucleotide including antisense oligonucleotides targeting gpl30. A second agent can also include anti-gpl30 antibodies, gpl30 peptide inhibitors, cholesterol lowering agents, lipid lowering agents, glucose lowering agents and anti-inflammatory agents.

"Segments" are defined as smaller, sub-portions of regions within a nucleic acid. For example, a "target segment" means the sequence of nucleotides of a target nucleic acid to which one or more antisense compounds is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.

"Shortened" or "truncated" versions of antisense oligonucleotides or target nucleic acids taught herein have one, two or more nucleosides deleted.

"Side effects" means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum can indicate liver toxicity or liver function abnormality. For example, increased bilirubin can indicate liver toxicity or liver function abnormality. "Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a complementary strand.

"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.

"Statin" means an agent that inhibits the activity of HMG-CoA reductase.

"Subcutaneous administration" means administration just below the skin.

"Subject" means a human or non-human animal selected for treatment or therapy.

"Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

"Target nucleic acid," "target RNA," and "target RNA transcript" all refer to a nucleic acid capable of being targeted by antisense compounds.

"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.

"Therapeutic lifestyle change" means dietary and lifestyle changes intended to lower fat /adipose tissue mass and/or cholesterol. Such change can reduce the risk of developing heart disease, and may includes recommendations for dietary intake of total daily calories, total fat, saturated fat, polyunsaturated fat, monounsaturated fat, carbohydrate, protein, cholesterol, insoluble fiber, as well as recommendations for physical activity.

"Triglyceride" means a lipid or neutral fat consisting of glycerol combined with three fatty acid molecules.

"Type 2 diabetes," (also known as "type 2 diabetes mellitus" or "diabetes mellitus, type 2", and formerly called "diabetes mellitus type 2" , "non-insulin-dependent diabetes (NIDDM)", "obesity related diabetes", or "adult-onset diabetes") is a metabolic disorder that is primarily characterized by insulin resistance, relative insulin deficiency, and hyperglycemia.

"Treat" refers to administering a pharmaceutical composition to an animal to effect an alteration or improvement of a disease, disorder, or condition.

"Unmodified nucleotide" means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside). Certain Embodiments In certain embodiments, the compounds or compositions of the invention comprise a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30. The gpl30 target can have a sequence selected from any one of SEQ ED NOs: 1-13.

In certain embodiments, the compounds or compositions of the invention comprise a modified oligonucleotide consisting of 10 to 30 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of SEQ ID NOs: 1-13.

In certain embodiments, the compounds or compositions of the invention comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases complementary to an equal length portion of SEQ ID NOs: 1-13.

In certain embodiments, the compounds or compositions of the invention can consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NO: 61, 62, 69, 70, 76, 90, 92, 93, 96 or 101.

In certain embodiments, the compounds or compositions of the invention ca consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NO: 49-124.

In certain embodiments, the compounds or compositions of the invention comprise a salt of the modified oligonucleotide.

In certain embodiments, the compounds or compositions of the invention further comprise a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%,

80%, 90%, 95% or 100% complementary to any one of SEQ ID NO: 1-13 as measured over the entirety of the modified oligonucleotide.

In certain embodiments, the compound of the invention consists of a single-stranded modified oligonucleotide.

In certain embodiments, the modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

In certain embodiments, at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is a

phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified oligonucleotide comprises at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces a furanose ring. In certain embodiments each of the tetrah dropyran modified nucleoside has the structure:

wherein Bx is an optionally protected heterocyclic base moiety. In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2'-0- methoxyethyl or a 4'- (CH₂)_n-0-2' bridge, wherein n is 1 or 2.

In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, the compounds or compositions of the invention comprise a modified oligonucleotide consists of 20 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NO: 1-13, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

Certain embodiments provide methods, compounds, and compositions for inhibiting gpl30 expression.

Certain embodiments provide a method of reducing gpl30 expression in an animal comprising administering to the animal a compound of the invention described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30.

Certain embodiments provide a method of reducing inflammation in an animal comprising administering to the animal a compound of the invention described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30. In certain embodiments, reducing inflammation ameliorates an inflammatory disease or disorder.

Examples of inflammatory diseases or disorders include, but are not limited to, hypersensitivities (e.g., allergies), asthma, autoimmune disease (e.g., rheumatoid arthritis, lupus, multiple sclerosis), cancer, diabetes, inflammatory bowel disease (IBD) or cardiovascular disease (e.g., atherosclerosis), NAFLD, NASH, hepatitis, fibrosis, and cirrhosis.

Certain embodiments provide a method of reducing glucose levels in an animal comprising administering to the animal a compound of the invention described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30.

Certain embodiments provide a method of an ameliorating metabolic or cardiovascular disease in an animal comprising administering to the animal a compound of the invention described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30. In certain embodiments, the cardiovascular disease is atherosclerosis.

Certain embodiments provide a method for treating an animal with an gpl30 related disease or condition comprising: a) identifying said animal with the gpl30 related disease or condition, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30. In certain embodiments, the therapeutically effective amount of the compound administered to the animal reduces the gp 130 related disease or condition, or a symptom thereof, in the animal.

Certain embodiments provide a method for treating an animal with metabolic or cardiovascular disease comprising: a) identifying said animal with metabolic or cardiovascular disease, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NO: 1-13 as measured over the entirety of said modified

oligonucleotide.

In certain embodiments, a therapeutically effective amount of the compound administered to an animal reduces metabolic or cardiovascular disease in the animal. In certain embodiments, the metabolic or cardiovascular disease is obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, nonalcoholic fatty liver disease (NAFLD), hyperfattyacidemia, metabolic syndrome, or a combination thereof. The dyslipidemia can be hyperlipidemia. The NAFLD can be hepatic steatosis or steatohepatitis. The diabetes can be type 2 diabetes or type 2 diabetes with dyslipidemia.

Certain embodiments provide a method for treating an animal with inflammatory disease comprising: a) identifying said animal with inflammatory disease, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NO: 1-13 as measured over the entirety of said modified oligonucleotide.

In certain embodiments, a therapeutically effective amount of the compound administered to an animal reduces an inflammatory disease in the animal. In certain embodiments, the inflammatory disease is a hypersensitivity (e.g., allergies), asthma, autoimmune disease (e.g., rheumatoid arthritis, lupus, multiple sclerosis), cancer, diabetes, inflammatory bowel disease (IBD) or cardiovascular disease (e.g., atherosclerosis), NAFLD, NASH, hepatitis, fibrosis or cirrhosis.

Certain embodiments provide a method of decreasing one or more of inflammatory cytokine levels by administering to an animal a compound of the invention described herein. In certain

embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30. Inflammatory cytokines include, for example, IL-1 (e.g., IL-lbeta), INF-gamma, TNF- alpha or MCP-1. In certain embodiments, one or more cytokine levels are reduced 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40% or more.

In certain embodiments, administering the compound of the invention can result in improved insulin sensitivity or hepatic insulin sensitivity or a reduction in atherosclerotic plaques, atherosclerotic lesions, obesity, glucose, lipids, glucose resistance, insulin resistance, or any combination thereof.

In certain embodiments, gpl30 has the sequence as set forth in any of the GenBank Accession Numbers listed in Table 1 (incorporated herein as SEQ ID NOs: 1-17). In certain embodiments, gpl30 has the human sequence as set forth in nucleotides 5825000 to 5886000 of GenBank Accession No.

NT 006713.14 (incorporated herein as SEQ ID NO: 13). In certain embodiments, gpl30 has the murine sequence as set forth in GenBank Accession No. NM 010560.2 (incorporated herein as SEQ ID NO: 14) or the murine sequence as set forth in nucleotides 20461000 to 20509000 of GenBank Accession No. NT_039590.7 (incorporated herein as SEQ ID NO: 16).

Table 1

Gene Target Names and Sequences

SEQ ID

Target Name Species Genbank #

NO

gpl30 Human M57230.1 1 gpl30 Human NM_002184.2 2 gpl30 Human NM_175767.1 3 gpl30 Human DA863210.1 4 gpl30 Human BC071555.1 5 gpl30 AL049265.1 6

Human

gpl30 Human AB 102799.1 7 gpl30 Human AB 102800.1 8 gpl30 Human AB102801.1 9 In certain embodiments, the animal is a human.

In certain embodiments, the compounds or compositions of the invention are designated as a first agent. In certain embodiments, the methods of the invention comprise administering a first and second agent. In certain embodiments, the first agent and the second agent are co-administered. In certain embodiments the first agent and the second agent are co-administered sequentially or concomitantly.

In certain embodiments, the second agent is a glucose-lowering agent. The glucose lowering agent can include, but is not limited to, a therapeutic lifestyle change, PPAR agonist, a dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof. The glucose- lowering agent can include, but is not limited to metformin, sulfonylurea, rosiglitazone, meglitinide, thiazolidinedione, alpha-glucosidase inhibitor or a combination thereof. The sulfonylurea can be acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide. The meglitinide can be nateglinide or repaglinide. The thiazolidinedione can be pioglitazone or rosiglitazone. The alpha-glucosidase can be acarbose or miglitol.

In certain embodiments, the second agent is an inflammation lowering therapy. In certain embodiments the inflammation lowering therapy can include, but is not limited to, a therapeutic lifestyle change, a steroid or a NSAID. The steroid can be a corticosteroid. The NSADD can be an aspirin, acetaminophen, ibuprofen, naproxen, COX inhibitors, indomethacin and the like.

In certain embodiments, administration comprises parenteral administration.

Certain embodiments provide the use of a compound as described herein for reducing gpl30 in an animal. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30 as shown in any of SEQ ID NO: 1-13.

Certain embodiments provide the use of a compound as described herein for treating,

ameliorating, delaying or preventing one or more of an inflammatory disease, a metabolic disease, a cardiovascular disease, atherosclerosis, or a symptom thereof, in an animal. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30 as shown in any of SEQ ID NO: 1-13.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing one or more of an inflammatory disease, a metabolic disease, a cardiovascular disease, or a symptom thereof.

Certain embodiments provide a kit for treating, preventing, or ameliorating one or more of a inflammatory disease, metabolic disease, a cardiovascular disease, or a symptom thereof, as described herein wherein the kit comprises: a) a compound as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate one or more of an inflammatory disease, metabolic disease or a cardiovascular disease.

Antisense Compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound can be "antisense" to a target nucleic acid, meaning that it is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to gpl30 nucleic acid is 10 to 30 nucleotides in length. In other words, antisense compounds are from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values. In some embodiments, the antisense compound is an antisense oligonucleotide.

In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5' end, or alternatively can have two or more subunits deleted from the 3' end. In certain embodiments, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one or more nucleosides deleted from the 5' end and one or more nucleosides deleted from the 3' end. In certain embodiments, a shortened antisense compound targeted to a gpl30 nucleic acid can have one or more subunits deleted from the the central portion of the antisense compound.

When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside can be located at the 5' or 3' end or the central portion of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the oligonucleotide or the central portion of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one or more nucleoside added to the 5' end, one or more nucleoside added to the 3' end and/or one or more nucleosides added to the central portion.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a scries of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides. Antisense Compound Motifs In certain embodiments, antisense compounds targeted to a gp 130 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can in some embodiments include β-D-ribonucleosides, β-D- ^■-^■ deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides can include 2'-MOE, and 2'-0-CH₃, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides can include those having a 4'-(CH2)n-0-2' bridge, where n=l or n=2). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing region, "Y" represents the length of the gap region, and "Z" represents the length of the 3' wing region. As used herein, a gapmer described as "X-Y- Z" has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3 ' wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. Thus, gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 1-8-1, 2-6-2, 2- 13-2, 1-8-2, 2-8-3, 3-10-2, 1-18-2 or 2-18-2.

In certain embodiments, the antisense compound as a "wingmer" motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13 or 5-13.

In certain embodiments, antisense compounds targeted to a gpl30 nucleic acid possess a 5-10-5 gapmer motif.

In certain embodiments, an antisense compound targeted to a gp 130 nucleic acid has a gap- widened motif.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode gpl30 include, without limitation, the following: the sequence as set forth in nucleotides 5825000 to 5886000 of GenBank Accession No. NT_006713.14 (incorporated herein as SEQ ID NO: 13), GenBank Accession No. NM 010560.2 (incorporated herein as SEQ ID NO: 14) or the sequence as set forth in nucleotides 20461000 to 20509000 of GenBank Accession No.

NT 039590.7 (incorporated herein as SEQ ID NO: 16). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO can comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region can encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for gpl30 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region can encompass the sequence from a 5' target site of one target segment within the target region to a 3 ' target site of another target segment within the target region.

In certain embodiments, a "target segment" is a smaller, sub-portion of a target region within a nucleic acid. For example, a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compounds are targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region can contain one or more target segments. Multiple target segments within a target region can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous.

Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.

Suitable target segments can be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment can specifically exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments can include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There can be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in gpl30 mRNA levels are indicative of inhibition of gpl30 protein expression. Reductions in levels of a gpl30 protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes, such as a reduction of the level of proinflammatory cytokines or glucose, can be indicative of inhibition of gpl30 mRNA and/or protein expression. Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a gpl30 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art (Sambrooke and Russell, Molecular Cloning: A Laboratory Manual, 3^rd Ed., 2001). In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a gp 130 nucleic acid. Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a gpl30 nucleic acid).

An antisense compound can hybridize over one or more segments of a gpl30 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a gpl30 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound can be fully complementary to a gp 130 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is "fully complementary" to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase can be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases can be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they can be either contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a gpl30 nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18,

19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a gp 130 nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are

complementary to at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values. Identity The antisense compounds provided herein can also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or the sequence of a compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases can be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein. Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.

Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates.

Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a gp 130 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, without limitation, addition of substitutent groups (including 5' and 2' substituent groups; bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA); replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R = H, C_rCi₂ alkyl or a protecting group); and combinations thereof. Examples of chemically modified sugars include, 2 -F-5'- methyl substituted nucleoside {see, PCT International Application WO 2008/101157, published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides), replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see, published U.S. Patent Application

US2005/0130923, published on June 16, 2005), or, alternatively, 5'-substirution of a BNA (see, PCT International Application WO 2007/134181, published on 11/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

Examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH₃, 2'-0CH₂CH₃, 2'-OCH₂CH₂F and 2'-

0(CH₂)20CH₃ substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-CI-CIO alkyl, OCF₃, 0(CH₂)2SCH₃, 0(CH₂)2-0-N(Rm)(Rn), and 0-CH₂- C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted CI -CIO alkyl. As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4' to 2' bicyclic nucleoside. Examples of such 4' to 2' bicyclic nucleosides, include, but are not limited to, one of the formulae: 4'-(CH₂)-0-2' (LNA); 4'-(CH₂)-S-2'; 4'-(CH₂)₂-0-2' (ENA); 4'-CH(CH₃)-0-2* and 4'-C- H(CH₂OCH₃)-0-2',and analogs thereof (see, U.S. Patent 7,399,845, issued on July 15, 2008); 4'- C(CH₃)(CH₃)-0-2'and analogs thereof, (see, published International Application WO2009/006478, published January 8, 2009); 4'-CH₂-N(OCH₃)-2' and analogs thereof (see, published PCT International Application WO2008/150729, published December 11, 2008); 4'-CH₂-0-N(CH₃)-2' (see published U.S. Patent Application US2004/0171570, published September 2, 2004 ); 4'-CH₂-N(R)-0-2', wherein R is H, Ci-Ci₂ alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH₂-C- (H)(CH₃)-2' (see Chattopadhyaya, et al, J. Org. Chem.,2 09, 74, 118-134); and 4'-CH₂-C(=CH₂)-2' and analogs thereof (see, published PCT International Application WO 2008/154401, published on December 8, 2008). Also see, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al.,

Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al, Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035- 10039; Srivastava et al., J. Am. Chem. Soc, 129(26) 8362-8379 (Jul. 4, 2007); Elayadi etal, Curr.

Opinion Invens. Drugs, 2001, , 558-561; Braasch et al., Chem. Biol, 2001, 8, 1-7; Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; International applications WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570 (US Patent 7,696,345), US2007/0287831 (US Patent 7,547,684), and US2008/0039618; U.S. Patent Serial Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and

61/099,844; and PCT International Applications Nos. PCT/US2008/064591(WO 2008/150729),

PCT/US2008/066154 (WO 2008/154401), and PCT/US2008/068922 (WO 2009/006478). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and β-D-ribofuranose (see PCT international application

PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(R_a)(R_b)]_n-, -C(R_a)=C(R_b)-, -C(R_a)=N-, -C(=NR_a)-, -C(=0)-, -C(=S)-, -0-, -Si(R_a)₂-, - S(=0)_x-, and -N(R_a)-;

wherein: x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each R_a and R_b is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted Ci-C_]2 alkyl, C₂-Ci₂ alkenyl, substituted C₂-Q₂ alkenyl, C₂-Ci₂ alkynyl, substituted C₂-Ci₂ alkynyl, C₅-C ₀ aryl, substituted C₅-C₂₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJiJ₂, SJi, N₃, COOJ_!, acyl (C(=0)-H), substituted acyl, CN, sulfonyl

and

each Ji and J₂ is, independently, H, Q-C12 alkyl, substituted C Ci₂ alkyl, C₂-Ci₂ alkenyl, substituted C₂-Ci₂ alkenyl, C₂-Ci₂ alkynyl, substituted C₂-Cj₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C_rCi₂ aminoalkyl, substituted C_rCi₂ aminoalkyl, or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is , -[C(R_a)(R_b)]„-, -[C(R_a)(R_b)]_n-0-, -C(R_aR_b)-N(R)-0- or, -C(R_aR_b)-0-N(R)-. In certain embodiments, the bridge is 4'-CH₂-2', 4'-(CH₂)₂-2', 4'-(CH₂)₃-2', 4'-CH₂-0-2', 4'-(CH₂)₂-0-2', 4'-CH₂-0-N(R)-2', and 4'-CH₂-N(R)-0-2'-, wherein each Ris, independently, H, a protecting group, or Ci-C₁₂ alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4 '-2' methylene-oxy bridge, may be in the a-L configuration or in the β-D configuration. Previously, a-L-methyleneoxy (4'-CH₂-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365-6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L- Methyleneoxy (4'-CH₂-0-2') BNA , (B) β-D-Methyleneoxy (4'-CH₂-0-2') BNA , (C) Ethyleneoxy (4'- (CH₂)₂-0-2') BNA , (D) Aminooxy (4'-CH₂-0-N(R)-2') BNA, (E) Oxyamino (4'-CH₂-N(R)-0-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH₃)-0-2') BNA, (G) methylene-thio (4'-CH₂-S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH₂-CH(CH₃)-2') BNA, and (J) propylene carbocyclic (4'-(CH₂)₃-2') BNA as depicted below.

(A) (B) (C)

wherein Bx is the base moiety and R is, independently, H, a protecting group, or Q-Cn alkyl.

In certain embodiments, bicyclic nucleoside having Formula I:

wherein:

Bx is a heterocyclic base moiety;

-Q_a-Qb-Qc- is -CH₂-N(R_C)-CH₂-,

-CH₂-0-N(R₌)-, -CH₂-N(R_o)-0-, or -N(R_c)-

0-CH₂;

R_c is Q-Q₂ alkyl or an amino protecting group; and

T_a and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleoside having Formula II:

wherein:

Bx is a heterocyclic base moiety;

T_a and T_b are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

Z_a is Ci-C₆ alkyl, C₂-Ce alkenyl, C₂-C₆ alkynyl, substituted Q-C6 alkyl, substituted C₂-Ce alkenyl, substituted C₂-C₆ alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ_c, NJ_cJd, SJ_C, N3,

OC(=X)J_c, and NJ_eC(=X)NJ_cJ_d, wherein each J_c, J_d, and J_e is, independently, H, Ci-Ce alkyl, or substituted Ci-C₆ alkyl and X is O or NJ_C.

In certain embodiments, bicyclic nucleoside having Formula ΙΠ:

wherein:

Bx is a heterocyclic base moiety;

Z_b is Ci-C₆ alkyl, C₂-Ce alkenyl, C₂-C₆ alkynyl, substituted Ci-C₆ alkyl, substituted C₂-C₆ alkenyl, substituted C₂-C₆ alkynyl, or substituted acyl (C(=0)-).

In certain embodiments, bicyclic nucleoside having Formula IV: wherein:

Bx is a heterocyclic base moiety;

T_a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

Rd is Ci-C₆ alkyl, substituted Ci-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, or substituted C₂-C6 alkynyl;

each q_a, qb, q_c and q_d is, independently, H, halogen, Cj-Ce alkyl, substituted Ci-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, or substituted C₂-C₆ alkynyl, Cj-C₆ alkoxyl, substituted Ci-C₆ alkoxyl, acyl, substituted acyl, Ci-C₆ aminoalkyl, or substituted Cj-C₆ aminoalkyl;

In certain embodiments, bicyclic nucleoside having Formula V:

wherein:

Bx is a heterocyclic base moiety;

T_a and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

¾a, b, _e and qf are each, independently, hydrogen, halogen, Ci-C_u alkyl, substituted -Cn alkyl, C2-C12 alkenyl, substituted C₂-Ci₂ alkenyl, C₂-C]₂ alkynyl, substituted C₂-Ci₂ alkynyl, Ci-C₁₂ alkoxy, substituted C Ci₂ alkoxy, OJ_j, SJ_j, SOJ_j, S0₂J_j5 NJ_jJ_k, N₃, CN, C(=0)OJ_j, C(=0)NJ_jJ_k, C(=0)J_j, 0-C(=0)- NJ_jJ_k, N(H)C(=NH)NJ_jJ_k, N(H)C(=0)NJ_jJ_k or N(H)C(=S)NJ_jJ_k;

or q_e and q_f together are =C(q_g)(q_h);

q_g and q_h are each, independently, H, halogen, Cj-Cn alkyl, or substituted Ci-Ci₂ alkyl.

The synthesis and preparation of the methyleneoxy (4'-CH₂-0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (see, e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607- 3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

Analogs of methyleneoxy (4'-CH₂-0-2') BNA, and 2 -thio-BNAs, have also been prepared (see, e.g., Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (see, e.g., Wengel et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog, has been described in the art (see, e.g., Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

lic nucleoside having Formula VI:

wherein:

Bx is a heterocyclic base moiety;

each ¾, ¾, q and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C₂-Ci₂ alkenyl, C₂-Ci₂ alkynyl, substituted C₂-C₁₂ alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJ_j, SJ_js SOJ_j, S0₂J_j, NJ_jJ_k, N₃, CN,

N(H)C(=NH)NJ_jJ_k, N(H)C(=0)NJ_jJ_k, orN(H)C(=S)NJ_jJ_k; and

q, and q_j or ¾ and q_k together are =C(q_g)(q_h), wherein q_g and q_h are each, independently, H, halogen, C_rCi₂ alkyl, or substituted C1- 2 alkyl.

One carbocyclic bicyclic nucleoside having a 4'-(CH₂)3-2' bridge and the alkenyl analog, bridge 4'-CH=CH-CH2-2', have been described (see, e.g., Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al, J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

As used herein, "4 '-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge between the 4' and the 2' position of the furanose ring. As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH₂)_nO]_mCH₃, 0(CH₂)_nNH₂, 0(CH₂)_nCH₃, 0(CH₂)_nONH₂, OCH₂C(=0)N(H)CH₃, and 0(CH₂)_nON[(CH₂)_nCH₃]₂, where n and m are from 1 to about 10. Other 2*- substituent groups can also be selected from: Ci-Ci₂ alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; aralkyl; O-alkaryl or O-aralkyl; SH; SCH₃; OCN; CI; Br; CN; CF₃; OCF₃; SOCH₃; S0₂CH₃; ON0₂; N0₂; N₃; NH₂; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; and a group for improving pharmacokinetic properties, a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'-MOE side chain (see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and Oaminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (see, e.g., Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), or those compounds having Formula X:

Formula X: X

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula X:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;

qi, q₂, q3, *, qs, ₆and q₇ are each, independently, H, Ci-C₆ alkyl, substituted C]-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-Ce alkenyl, C₂-C6 alkynyl, or substituted C₂-C₆ alkynyl; and

one of Ri and R₂ is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJiJ₂, SJj, N₃, OC(=X)J,,

and CN, wherein X is O, S or NJ,, and each Jj, J₂, and J₃ is, independently, H or Q-Ce alkyl.

In certain embodiments, the modified THP nucleosides of Formula X are provided wherein qi, q₂, q₃, q4, q₅, q6 and q₇ are each H. In certain embodiments, at least one of qi, q₂, q3, q4, qs, qe and q₇ is other than H. In certain embodiments, at least one of q_l5 q₂, q₃, q₄, qs, q6 and q₇ is methyl. In certain embodiments, THP nucleosides of Formula X are provided wherein one of Ri and R₂ is F. In certain embodiments, Ri is fluoro and R₂ is H, Ri is methoxy and R₂ is H, and Ri is methoxyethoxy and R₂ is H.

As used herein, "2'-modified" or "2 '-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring and nucleosides with non-bridging

2'substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, -OCF₃, 0-(CH₂)₂-0-CH₃, 2'- 0(CH₂)₂SCH₃, O-CCHz^-O-NiR_mXR,,), or 0-CH₂-C(=0)-N(R_m)(R_n), where each R_m and R_n is, independently, H or substituted or unsubstituted Ci-Qo alkyl. 2'-modifed nucleosides may further comprise other modifications, for example, at other positions of the sugar and/or at the nucleobase.

As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position.

As used herein, "2'-OMe" or "2'-OCH3" or "2'-0-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH₃ group at the 2' position of the sugar ring.

As used herein, "MOE" or "2'-MOE" or "2'-OCH₂CH₂OCH₃" or "2'-0-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH₂CH₂OCH₃ group at the 2' position of the sugar ring.

As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds {see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).

Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art.

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside. In certain embodiments, the bicyclic nucleoside comprises a (4'- CH(CH₃)-0-2') bridge. In certain embodiments, the (4'-CH(CH₃)-0-2') bicyclic nucleotides are arranged throughout the wings of a gapmer motif. In certain embodiments, the bicyclic nucleoside is a cEt. In certain embodiments, the cEt bicyclicnucleotides are arranged throughout the wings of a gapmer motif.

Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase

modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F- adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine.

Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to a gpl30 nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to a gpl30 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations^". Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Antisense compound targeted to a gp 130 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.

In certain embodiments, the "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).

Pharmaceutically acceptable organic or inorganic excipients, which do not deleteriously react with nucleic acids, suitable for parenteral or non-parenteral administration can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a gp 130 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or an oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound. Conjugated Antisense Compounds

Antisense compounds can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'- cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003. Cell culture and antisense compounds treatment

The effects of antisense compounds on the level, activity or expression of GP130 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, Huh7

(hepatocellular carcinoma) cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.

In vitro testing of antisense oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA). Antisense

oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes

LIPOFECTAMINE 2000® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI- MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Oligofectamine™ (Invitrogen Life Technologies, Carlsbad, CA). Antisense oligonucleotide is mixed with Oligofectamine™ in Opti-MEM™-l reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide with an Oligofectamine™ to oligonucleotide ratio of approximately 0.2 to 0.8 μL per 100 nM. Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum-free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 uL of FuGENE 6 per 100 nM.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrooke and Russell, Molecular Cloning: A Laboratory Manual, 3^rd Ed., 2001).

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrooke and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art (Sambrooke and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000® (Invitrogen, Carlsbad, CA), Lipofectin® (Invitrogen, Carlsbad, CA) or Cytofectin™ (Genlantis, San Diego, CA). Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.

Analysis of inhibition of target levels or expression

Inhibition of levels or expression of a gp 130 nucleic acid can be assayed in a variety of ways known in the art (Sambrooke and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels can be accomplished by quantitative real-time PCR using the

ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT and real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR can be normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Inc. Carlsbad, CA). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure

RIBOGREEN® fluorescence.

Probes and primers are designed to hybridize to a gp 130 nucleic acid. Methods for designing realtime PCR probes and primers are well known in the art, and can include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA).

Gene target quantities obtained by RT, real-time PCR were normalized using either the expression level of GAPDH or Cyclophilin A, genes whose expression are constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR). GAPDH or Cyclophilin A expression can be quantified by RT, real-time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA was quantified using RiboGreenTM RNA quantification reagent (Molecular Probes, Inc. Eugene, OR).

Presented in Table 2 are primers and probes used to measure GAPDH or Cyclophilin A expression in the cell types described herein. The PCR probes have JOE or FAM covalently linked to the 5' end and TAMRA or MGB covalently linked to the 3' end, where JOE or FAM is the fluorescent reporter dye and TAMRA or MGB is the quencher dye. In some cell types, primers and probe designed to a sequence from a different species are used to measure expression. For example, a human GAPDH primer and probe set can be used to measure GAPDH expression in monkey-derived cells and cell lines.

Table 2

GAPDH primers and probes for use in real-time PCR

Sequence SEQ ID

Target Name Species Sequence (5' to 3')

Description NO

GAPDH Human Forward Primer CAACGGATTTGGTCGTATTGG 18

GAPDH Human Reverse Primer GGCAACAATATCCACTTTACCAGAGT 19

GAPDH Human Probe CGCCTGGTCACCAGGGCTGCT 20

GAPDH Human Forward Primer GAAGGTGAAGGTCGGAGTC 21

GAPDH Human Reverse Primer GAAGATGGTGATGGGATTTC 22

GAPDH Human Probe CAAGCTTCCCGTTCTCAGCC 23

GAPDH Human Forward Primer GAAGGTGAAGGTCGGAGTC 21

GAPDH Human Reverse Primer GAAGATGGTGATGGGATTTC 22

GAPDH Human Probe TGGAATCATATTGGAACATG 24

GAPDH Mouse Forward Primer GGCAAATTCAACGGCACAGT 25

GAPDH Mouse Reverse Primer GGGTCTCGCTCCTGGAAGAT 26

GAPDH Mouse Probe AAGGCCGAGAATGGGAAGCTTGTCATC 27

GAPDH Rat Forward Primer TGTTCTAGAGACAGCCGCATCTT 28

GAPDH Rat Reverse Primer CACCGACCTTCACCATCTTGT 29

GAPDH Rat Probe TTGTGCAGTGCCAGCCTCGTCTCA 30

Cyclophilin A Human Forward Primer TGCTGGACCCAACACAAATG 31

Cyclophilin A Human Reverse Primer TGCCATCCAACCACTCAGTC 32

Cyclophilin A Human Probe TTCCCAGTTTTTCATCTGCACTGCCA 33

Cyclophilin A Human Forward Primer GACGGCGAGCCCTTGG 34

Cyclophilin A Human Reverse Primer TGCTGTCTTTGGGACCTTGTC 35

Cyclophilin A Human Probe CCGCGTCTCCTTTGAGCTGTTTGC 36

Cyclophilin A Human Forward Primer GCCATGGAGCGCTTTGG 37

Cyclophilin A Human Reverse Primer TCCACAGTCAGCAATGGTGATC 38

Cyclophilin A Human Probe TCCAGGAATGGCAAGACCAGCAAGA 39

Cyclophilin A Mouse Forward Primer TCGCCGCTTGCTGCA 10

Cyclophilin A Mouse Reverse Primer ATCGGCCGTGATGTCGA 41

Cyclophilin A Mouse Probe CCATGGTCAACCCCACCGTGTTC 42

Cyclophilin A Rat Forward Primer CCCACCGTGTTCTTCGACA 43 Probes and primers for use in real-time PCR are designed to hybridize to target-specific sequences. The target-specific PCR probes can have FAM covalently linked to the 5' end and TAMRA or MGB covalently linked to the 3' end, where FAM is the fluorescent dye and TAMRA or MGB is the quencher dye.

Analysis of Protein Levels

Antisense inhibition of gpl30 nucleic acids can be assessed by measuring gpl30 protein levels. Protein levels of gpl30 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.

In vivo testing of antisense compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of gpl30 and produce phenotypic changes. Testing can be performed in normal animals, or in experimental disease models. For administration to animals, antisense

oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration. Calculation of antisense

oligonucleotide dosage and dosing frequency depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from tissue and changes in gpl30 nucleic acid expression are measured. Changes in gpl30 protein levels are also measured.

Certain Indications

In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has inflammatory, metabolic or cardiovascular disease. Accordingly, provided herein are methods for ameliorating a symptom associated with inflammatory, metabolic or cardiovascular disease in a subject in need thereof. In certain embodiments, provided is a method for reducing the rate of onset of a symptom associated with inflammatory, metabolic or cardiovascular disease. In certain embodiments, provided is a method for reducing the severity of a symptom associated with inflammatory, metabolic or cardiovascular disease. In such embodiments, the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeted to a gpl30 nucleic acid.

In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to a gp 130 nucleic acid is accompanied by monitoring of gpl30 levels or markers of inflammatory, metabolic or cardiovascular or other disease process associated with the expression of gpl30, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.

In certain embodiments, administration of an antisense compound targeted to a gp 130 nucleic acid results in reduction of gpl30 expression by at least about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to gpl30 are used for the preparation of a medicament for treating a patient suffering or susceptible to inflammatory, metabolic or cardiovascular disease.

In certain embodiments, the methods described herein include administering a compound comprising a modified oligonucleotide having an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobase portion.

Administration

The compounds or pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), intradermal (for local treatment of skin fibrosis or scarring), pulmonary, (e.g., by local inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral.

In certain embodiments, the compounds and compositions as described herein are administered parenterally. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump.

In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

In certain embodiments, formulations for parenteral, intrathecal or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

In certain embodiments, formulations for topical administration of the compounds or compositions of the invention can include, but is not limited to, pharmaceutical carriers, excipients, sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the compounds or compositions in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.

In certain embodiments, formulations for oral administration of the compounds or compositions of the invention can include, but is not limited to, pharmaceutical carriers, excipients, powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In certain embodiments, oral formulations are those in which compounds of the invention are administered in conjunction with one or more penetration enhancers, surfactants and chelators. Dosing

In certain embodiments, pharmaceutical compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect. The desired effect can be, for example, reduction of gp 130 or the prevention, reduction, amelioration or slowing the progression of a disease or condition associated with gpl30.

In certain embodiments, the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject. "Concentration of pharmaceutical composition" as used with regard to dose regimen can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition. For example, in certain embodiments, dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from 0.01 μg to 100 mg per kg of body weight, or within a range of O.OOlmg - 600mg dosing, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.0 ^g to lOOmg per kg of body weight, once or more daily, to once every 20 years or ranging from O.OOlmg to 600mg dosing.

Certain Combination Therapies

In certain embodiments, a first agent comprising the modified oligonucleotide of the invention is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same inflammatory, metabolic or cardiovascular disease as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.

In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

In certain embodiments, second agents include, but are not limited to, a glucose-lowering agent, a cholesterol or lipid lowering therapy or an anti-inflammatory or inflammation lowering agent. The glucose lowering agent can include, but is not limited to, a therapeutic lifestyle change, PPAR agonist, a dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof. The glucose-lowering agent can include, but is not limited to metformin, sulfonylurea, rosiglitazone, meglitinide, thiazolidinedione, alpha-glucosidase inhibitor or a combination thereof. The sulfonylurea can be acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide. The meglitinide can be nateglinide or repaglinide. The thiazolidinedione can be pioglitazone or rosiglitazone. The alpha-glucosidase can be acarbose or miglitol. The cholesterol or lipid lowering therapy can include, but is not limited to, a therapeutic lifestyle change, statins, bile acids sequestrants, nicotinic acid and fibrates. The statins can be atorvastatin, fluvastatin, lovastatin, pravastatin, rosuvastatin and simvastatin and the like. The bile acid sequestrants can be colesevelam, cholestyramine, colestipol and the like. The fibrates can be gemfibrozil, fenofibrate, clofibrate and the like. The inflammation lowering agent can include, but is not limited to, a therapeutic lifestyle change, a steroid or a NSAID. The steroid can be a corticosteroid. The NSAID can be an aspirin, acetaminophen, ibuprofen, naproxen, COX inhibitors, indomethacin and the like.

EXAMPLES

Non-limiting disclosure and incorporation by reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety. Example 1: Antisense inhibition of murine membrane glycoprotein gpl30 in b.END cells

A series of oligomeric compounds (i.e., antisense oligonucleotide) was designed to target different regions of mouse gpl30, using published sequences cited in Table 1. The compounds are shown in Tables 3 and 4. All compounds in Tables 3 and 4 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of 5-10-5 gapmers, where the gap segment comprises ten 2'- deoxynucleosides and each wing segment comprises five 2'-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. The oligomeric compounds in Tables 3 and 4 specifically hybridize to a target nucleic acid molecule encoding gpl30 and are comprised of regions that increase binding affinity, these regions being the "wings" of the oligomeric compounds. The oligomeric compounds each comprise a region that elicits RNase H activity, this regions being the "gap" region.

The compounds were analyzed for their effect on gene target mRNA levels by quantitative realtime PCR as described herein. Cultured b.END cells at a density of 4,000 cells/ mL were transfected using cytofectin reagent with 70 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and gpl30 RNA transcript levels were measured by quantitative real-time PCR with murine primer probe set RTS2942 (forward sequence GTGGGCAACAGAGAAG, designated herein as SEQ ID NO: 46; reverse sequence GCTGACCATACATGAAGTG, designated herein as SEQ ID NO: 47; probe sequence TTCCTGATTGCCAGTCAAAGCATGG, designated herein as SEQ ID NO: 48). gpl30 RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN^®. Results are presented as percent inhibition of gpl30 relative to untreated control cells.

Shown in Table 3 is the SEQ ID NO of the sequence to which each antisense oligonucleotide is targeted. 'Target start site' indicates the 5 '-most nucleotide to which the antisense oligonucleotide is targeted. 'Target stop site' indicates the 3 '-most nucleotide to which the antisense oligonucleotide is targeted. All the antisense oligonucleotides listed in Table 3 target SEQ ID NO: 14 (GENBANK Accession No. NM O 10560.2). All the antisense oligonucleotides listed in Table 4 target SEQ ID NO: 16 (nucleotides 20461000 to 20509000 of GENBANK Accession No. NT 039590.7).

As shown in Tables 3 and 4, the murine oligonucleotides can also be cross-reactive with human gene sequences. The murine oligonucleotides in Tables 3 and 4 were compared to SEQ ED NO: 2 (GENBANK Accession No. NM 002184.2). "Human Target start site" indicates the 5 '-most nucleotide to which the gapmer is targeted in the human gene sequence; the designation "n/a" indicates that the human target start site was not determined. 'Mismatches' indicate the number of nucleobases by which the murine oligonucleotide is mismatched with a human gene sequence; the designation "n/a" indicates that there was greater than 3 mismatches between the murine oligonucleotide and the human gene sequence. The greater the complementarity between the murine oligonucleotide and the human sequence, the more likely the murine oligonucleotide can cross-react with the human sequence.

Table 3

Inhibition of murine gpl30 RNA transcript in b.END cells by 5-10-5 gapmers targeting SEQ ID NO: 14

Target Target SEQ Human

% MisStart Stop Sequence ISIS No ID Target

inhibition matches Site Site NO Start Site

37 56 GCCCGGATGGCTCGAAGCTC 409157 57 49 n/a n/a

177 196 AATCGGAAACAAGTTCGCTG 409158 67 50 n/a n/a

219 238 GGGATGTTCCCAACATACGA 409159 45 51 n/a n/a

236 255 GGTGCTGACATCTTGCAGGG 409160 61 52 n/a n/a

398 417 TAATGCTGCAGACACGCCTC 409161 42 53 n/a n/a

437 456 TGGTTGGTCTTCCACACGAT 409162 70 54 n/a n/a

538 557 TGTTGCAGGTGAGCTGCACG 409163 27 55 n/a n/a

575 594 CCATACACATTCTGCTCGAT 409164 45 56 n/a n/a

605 624 TCTGGAGGAAAGCCTGAAAG 409165 47 57 616 2

643 662 TCCCCTCATTCACAATGCAA 409166 53 58 654 1

701 720 GTGTAGTTTGTTTCAAGGTA 409167 54 59 n/a n/a

706 725 TCAAAGTGTAGTTTGTTTCA 409168 25 60 n/a n/a

811 830 CCCAGACTTCAATGTTGACA 409169 61 61 828 0

836 855 TTCCCAAGGGCATTCTCTGC 409170 63 62 853 0 884 903 GGTTTCACTTTATCCACGGG 409171 67 63 n/a n/a

926 945 AATTCTTCTGAGTTGGTCAC 409172 67 64 943 3

931 950 TGGATAATTCTTCTGAGTTG 409173 70 65 n/a n/a

941 960 TTTAATATACTGGATAATTC 409174 13 66 n/a n/a

984 1003 TAGATCTAAAAGACCGCCCA 409175 54 67 n/a n a

1010 1029 TTGGTCCTATATTGGATGTC 409176 71 68 1027 2

1020 1039 TGAGGCATCTTTGGTCCTAT 409177 63 69 1037 0

1027 1046 TCCAAGTTGAGGCATCTTTG 409178 41 70 1044 0

1049 1068 GTATCTTCAAGAGGGACCTG 409179 48 71 n/a n/a

1066 1085 AAGTTCGAGGAGACATTGTA 409180 38 72 n/a n/a

1093 1112 AAGGCTTGAGGTCCTGCACA 409181 65 73 n/a n/a

1210 1229 TTGGTGGTCTGGATGGTCTG 409182 65 74 n/a n a

1304 1323 TTCCCATTGGCTTCAGAAAG 409183 53 75 1321 3

1324 1343 TCACTTCATAATCCAAGATT 409184 21 76 1341 0

1524 1543 TTTTGGAAATGCTTTAAGAT 409185 45 77 1541 2

1534 1553 GCAGGTTATCTTTTGGAAAT 409186 67 78 1551 3

1541 1560 ACCCAGAGCAGGTTATCTTT 409187 41 79 1558 2

1602 1621 TGACAACACACACCACTCTA 409188 43 80 1619 2

1767 1786 TTGTTTGAGGTACGCCTTCA 409189 52 81 1784 3

1801 1820 TTGTCCGAACAGTCGGTCCT 409190 45 82 1818 1

1810 1829 CCACTTTCTTTGTCCGAACA 409191 56 83 1827 2

1827 1846 GACAGCTTCATTTTTCCCCA 409192 65 84 1844 2

1886 1905 ATGGAGTAGTTTCTAATGAA 409193 17 85 n/a n/a

1892 1911 TAAGATATGGAGTAGTTTCT 409194 16 86 n/a n/a

1944 1963 CGTGTGAGAAGAATCCACAT 409195 42 87 1961 2

2042 2061 AAAGTGAATTCCGGCCCATC 409196 51 88 2059 2

2050 2069 GTGTTGTAAAAGTGAATTCC 409197 36 89 2067 3

2093 2112 ACAGGCACGACTATGGCTTC 409198 66 90 2110 0

2102 2121 GCTAAGCACACAGGCACGAC 409199 52 91 2119 1

2181 2200 ATTAGGCCAGATGTGTTTTT 409200 27 92 2198 0

2218 2237 ACCACTGGGCAATATGACTC 409201 52 93 2235 0

2254 2273 TGGAGTTAAAATTGTGCCTT 409202 43 94 2271 2

2261 2280 TGATCTTTGGAGTTAAAATT 409203 35 95 2278 2

2294 2313 CTTACATCAGTGAAATTGCC 409204 40 96 2311 0

2342 2361 AGGTCATCTGGACAAGGCTT 409205 52 97 2359 3

2425 2444 AGGACATGCATGAAGAGCCC 409206 60 98 2442 2

2558 2577 GACCTTGAGAACACTTGCAC 409207 31 99 2575 3

2621 2640 CTATCCACCAGCTGCAGGTC 409208 37 100 n/a n/a

2720 2739 GACCTTTCAAAATGTGAAAT 409209 28 101 2737 0

2765 2784 TTCAGTCTGACAAAATCCTC 409210 29 102 2782 3

2791 2810 AAATGTGATCTGAAACCTGC 409211 50 103 2805 2

2965 2984 AGCCACCTTGTCTTACAGTC 409212 52 104 2979 3

2972 2991 GGCATGTAGCCACCTTGTCT 409213 60 105 2986 3

3086 3105 CCTTAGAGGCAATGCCTATC 409214 44 106 n/a n/a Table 4

Inhibition of murine gpl30 RNA transcript in b.END cells by 5-10-5 gapmers targeting SEQ ID NO: 16

Target Target SEQ Human

ISIS % MisStart Stop Sequence ID Target

No inhibition matches Site Site NO Start Site

2003 2022 GCCCGGATGGCTCGAAGCTC 409157 57 49 n/a n/a

10479 10498 AATCGGAAACAAGTTCGCTG 409158 67 50 n/a n/a

12895 12914 GGTGCTGACATCTTGCAGGG 409160 61 52 n/a n/a

15252 15271 ATGCTGGTCAGGTAAGGGAT 409228 47 117 n/a n/a

17932 17951 TAATGCTGCAGACACGCCTC 409161 42 53 n/a n/a

17971 17990 TGGTTGGTCTTCCACACGAT 409162 70 54 n/a n/a

18072 18091 TGTTGCAGGTGAGCTGCACG 409163 27 55 n/a n/a

18109 18128 CCATACACATTCTGCTCGAT 409164 45 56 n a n/a

19272 19291 TCTGGAGGAACTATAAGGAA 409229 23 118 n/a n/a

19310 19329 TCCCCTCATTCACAATGCAA 409166 53 58 654 1

19368 19387 GTGTAGTTTGTTTCAAGGTA 409167 54 59 n/a n/a

19373 19392 TCAAAGTGTAGTTTGTTTCA 409168 25 60 n/a n/a

22937 22956 GACTGATACAATCAATACCA 409230 58 119 n/a n/a

22970 22989 CATGTATACAAACTAGGGTC 409231 58 120 n/a n/a

25642 25661 CCCAGACTTCAATGTTGACA 409169 61 61 828 0

25667 25686 TTCCCAAGGGCATTCTCTGC 409170 63 62 853 0

25718 25737 TTCTAAGTACCTTTATCCAC 409232 6 121 n/a n/a

26391 26410 AATTCTTCTGAGTTGGTCAC 409172 67 64 943 3

26396 26415 TGGATAATTCTTCTGAGTTG 409173 70 65 n/a n/a

26406 26425 TTTAATATACTGGATAATTC 409174 13 66 n/a n/a

26449 26468 TAGATCTAAAAGACCGCCCA 409175 54 67 n/a n/a

26475 26494 TTGGTCCTATATTGGATGTC 409176 71 68 1027 2

26485 26504 TGAGGCATCTTTGGTCCTAT 409177 63 69 1037 0

26492 26511 TCCAAGTTGAGGCATCTTTG 409178 41 70 1044 0

28338 28357 GTATCTTCAAGAGGGACCTG 409179 48 71 n/a n/a

28355 28374 AAGTTCGAGGAGACATTGTA 409180 38 72 n/a n/a

28382 28401 AAGGCTTGAGGTCCTGCACA 409181 65 73 n/a n/a

32446 32465 TTCCCATTGGCTTCAGAAAG 409183 53 75 1321 3

32466 32485 TCACTTCATAATCCAAGATT 409184 21 76 1341 0 33066 33085 TTTTGGAAATGCTTTAAGAT 409185 45 77 1541 2

33076 33095 GCAGGTTATCTTTTGGAAAT 409186 67 78 1551 3

33083 33102 ACCCAGAGCAGGTTATCTTT 409187 41 79 1558 2

33144 33163 TGACAACACACACCACTCTA 409188 43 80 1619 2

33221 _. 33240 GTAGGTGTACCTCTCAAGTG 409233 28 122 n/a n/a

35221 35240 TTGTTTGAGGTACGCCTTCA 409189 52 81 1784 3

35590 35609 TTGTCCGAACAGTCGGTCCT 409190 45 82 1818 1

35599 35618 CCACTTTCTTTGTCCGAACA 409191 56 83 1827 2

35616 35635 GACAGCTTCATTTTTCCCCA 409192 65 84 1844 2

35675 35694 ATGGAGTAGTTTCTAATGAA 409193 17 85 n/a n/a

35681 35700 TAAGATATGGAGTAGTTTCT 409194 16 86 n/a n/a

35911 35930 TTCACAGCAGTAAAACCTAA 409234 8 123 n/a n/a

36613 36632 CGTGTGAGAAGAATCCACAT 409195 42 87 1961 2

36711 36730 AAAGTGAATTCCGGCCCATC 409196 51 88 2059 2

36719 36738 GTGTTGTAAAAGTGAATTCC 409197 36 89 2067 3

38985 39004 ACAGGCACGACTATGGCTTC 409198 66 90 2110 0

38994 39013 GCTAAGCACACAGGCACGAC 409199 52 91 2119 1

40654 40673 ATTAGGCCAGATGTGTTTTT 409200 27 92 2198 0

40691 40710 ACCACTGGGCAATATGACTC 409201 52 93 2235 0

41566 41585 TGATCTTTGGAGTTAAAATT 409203 35 95 2278 2

41599 41618 CTTACATCAGTGAAATTGCC 409204 40 96 2311 0

41647 41666 AGGTCATCTGGACAAGGCTT 409205 52 97 2359 3

41730 41749 AGGACATGCATGAAGAGCCC 409206 60 98 2442 2

41863 41882 GACCTTGAGAACACTTGCAC 409207 31 99 2575 3

41926 41945 CTATCCACCAGCTGCAGGTC 409208 37 100 n a n/a

42025 42044 GACCTTTCAAAATGTGAAAT 409209 28 101 2737 0

42070 42089 TTCAGTCTGACAAAATCCTC 409210 29 102 2782 3

42096 42115 AAATGTGATCTGAAACCTGC 409211 50 103 2805 2

42270 42289 AGCCACCTTGTCTTACAGTC 409212 52 104 2979 3

42277 42296 GGCATGTAGCCACCTTGTCT 409213 60 105 2986 3

42391 42410 CCTTAGAGGCAATGCCTATC 409214 44 106 n/a n/a

42514 42533 GCAGTGCAAACATTCTGAAA 409215 58 107 n/a n/a

42855 42874 TAAGAAAGCGGGTGCTTCTA 409216 52 108 n/a n/a

43069 43088 GTCAACAACTTAAGTCTTTA 409217 38 109 n/a n/a

43218 43237 TTCAACAAACACCCTGCTAT 409218 41 110 n/a n/a

43505 43524 CTGGTTGGGTGTGTGACAGC 409219 43 111 n/a n/a

43536 43555 CTACCTCATAAATGGCAGAT 409220 51 112 n/a n/a

43797 43816 CCGCTATAAATGATCTGGGT 409221 77 113 n/a n/a

43963 43982 TCTCACGAGGATTATACATG 409222 38 114 n/a n/a

44622 44641 TGCTACCTAAGGTACAAGGT 409223 59 115 n/a n/a

44662 44681 TATTAGACGGTTTTACAGAA 409224 17 116 n/a n/a

46066 46085 CTTTAAAAATAGTATGTGAT 409227 37 124 n/a n/a Example 2: Dose-dependent antisense inhibition of murine gpl30 in b.E D cells

Several of the antisense oligonucleotides exhibiting in vitro inhibition of gpl30 in b.END cells (see Example 1) were tested at various doses. Cells were plated at a density of 4,000 cells/mL and transfected using Cytofectin™ reagent with 5 nM, 10 nM, 20 nM, 40 nM, 80 nM and 160 nM

concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and gpl30 transcript levels were measured by quantitative real-time PCR using primer probe set RTS2942. gpl30 transcript levels were normalized to total RNA content, as measured by RDBOGREEN^®. Results are presented in Table 5 as percent inhibition of gpl30, relative to untreated control cells and demonstrate dose-dependent inhibition of gpl30 mRNA levels by ISIS oligonucleotides.

Table 5

Dose-dependent antisense inhibition of murine gpl30 in b.END cells

Example 3: In vivo antisense inhibition of murine gpl30 in C57BL/6 mice

Antisense oligonucleotides that demonstrated statistically significant dose-dependent inhibition in vitro (see Example 2), were evaluated for their potency and tolerability in vivo.

Treatment

C57 BL6 mice were maintained on a 12-hour light/dark cycle and fed ad libitum Teklad lab chow (Harlan Laboratories, Indianapolis, IN). Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

The mice were divided into four treatment groups of 4 mice each. Three groups received subcutaneous injections of ISIS 409171, ISIS 409176, or ISIS 409221 at a dose of 50 mg/kg twice a week for 4 weeks. One group of mice received subcutaneous injections of PBS twice a week for 4 weeks. This PBS group served as the control group. Body weights were taken weekly. Two days following the final dose, the mice were euthanized, organs harvested and analyses done. Inhibition ofgpBO RNA

RNA was isolated from liver for real-time PCR analysis of gpl30 and normalized to

RIBOGREEN^®. As presented in Table 6, treatment with antisense oligonucleotides reduced murine gpl30 RNA transcript expression. The results are expressed as percent inhibition of gpl30 transcript, relative to the PBS control.

Table 6

Percent inhibition of murine gpl30 RNA transcript in C57BL/6 mice

Liver fitnction

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz NW (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) at week 4 were measured and the results are presented in Table 7 expressed in IU L. The ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.

Table 7

Liver transaminase levels (IU/L) of C57BL/6 mice at week 4

Glucose levels

Plasma glucose values were determined using a Beckman Glucose Analyzer II (Beckman Coulter) by a glucose oxidase method (Lott, J.A. et al., Clin. Chem. 21 : 1754-1760, 1975). The results are presented in Table 8 expressed in mg/dL. Table 8

Glucose levels (mg dL) in C57BL/6 mice at week 4

Cholesterol and lipid levels

Plasma and liver triglycerides, and cholesterol were extracted by the method of Bligh and Dyer (Bligh,E.G. and Dyer, W.J. CanJ.Biochem.Physiol. 37: 911-917, 1959) and measured with the use of a commercially available triglyceride kit (DCL Triglyceride Reagent; Diagnostic Chemicals Ltd.). The results are presented in Table 9 and are expressed in mg/dL.

Table 9

Cholesterol and lipid levels (mg/dL) in C57BL/6 mice at week 4

Body and organ weights

The body weights of the mice were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 10, and are expressed in grams. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 11. The ISIS oligonucleotides had no adverse effects on body weight or organ weight.

Table 10

Weekly measurements of body weights of C57BL/6 mice

Table 11

Organ weights of C57BL/6 mice at week 4

Liver Kidney Spleen

(g) (mg) (mg)

PBS 1.0 263 78

ISIS 409171 1.0 246 85 Example 4: Effect of antisense inhibition of gpl30 on atherosclerosis: treatment with ISIS 409176 in LDLr^{" /_} mice

The effect of ISIS 409176 as an anti-atherosclerotic agent was evaluated in LDL receptor knockout (LDLr⁷ ) mice fed on a hypercholesterolemia diet; a model used for studying atherosclerosis (Ishibashi et al, J. Clin. Invest. 1994 May; 93:1885-93).

Treatment

C57B1/6 mice with LDL receptor gene knockout (Jackson Labs, #2207) were fed a Harlan

Tekland diet, TD 88137 or 'Western diet' (21% anhydrous milkfat (butterfat), 34% sucrose, and a total of 0.2% cholesterol). Three weeks after the initiation of the diet, the mice were divided into two groups consisting of 6-8 mice each for treatment. The first group received twice-weekly subcutaneous injections of ISIS 409176 (SEQ ID NO: 68) at doses of 25 mg kg for 10 weeks. The second group received twice- weekly subcutaneous injections of PBS for 10 weeks. This saline-injected group served as the control group to which the oligonucleotide-treated groups were compared. At the end of 8 weeks, the mice were injected intraperitoneally with 1 mg kg of lipopolysaccharide (LPS) to instigate an inflammatory reaction and recruit peritoneal macrophages. The mice were bled 24 hours after the LPS challenge, plasma and peritoneal lavage were collected. After 10 weeks of dosing, mice were sacrificed and livers and aortae were harvested.

Inhibition of gp!30 mRNA

RNA was isolated from the peritoneal macrophages at week 8, and aorta and liver at week 10 for real-time PCR analysis of gpl30 and normalized to cyclophilin using the primer probe set described in Table 2. As presented in Table 12, treatment with ISIS 409176 reduced murine gpl30 RNA transcript expression. The results are expressed as percent inhibition of gpl30 transcript, relative to the PBS control.

Table 12

Percent inhibition of murine gpl30 RNA transcript in LDLr^"A mice

Tissue % inhibition

Peritoneal macrophages 57

Aorta 57

Liver 34 Expression ofTNF-aandMCP-1 RNA

TNF-a is a pro-inflammatory cytokine secreted by macrophages in response to LPS (Mathison, J.C. et al., 1988. J. Clin. Invest. 81 : 1925). MCP-1 is a chemokine secreted by LPS-activated macrophages and is critical for recruitment and activation of leukocytes into the peritoneum in response to inflammation. The mRNA expressions of TNF-a and MCP-1 in peritoneal macrophages were assessed by RT-PCR. The primer probe set for TNF-a was RTS2501 (forward sequence CAGGTTCTGTCCCTTTCACTCACT, designated herein as SEQ ID NO: 125; reverse sequence CTGTGCTCATGGTGTCTTTTCTG, designated herein as SEQ ID NO: 126; probe sequence CCCAAGGCGCCACATCTCCCTX, designated herein as SEQ ID NO: 127). The primer probe set for MCP-1 was mCcl2_LTS_00066 (forward sequence

AGTTGACCCGTAAATCTGAAGCTAA, designated herein as SEQ ID NO: 128; reverse sequence CACACTGGTCACTCCTACAGAAGTG, designated herein as SEQ ID NO: 129; probe sequence CATCCACTACCTTTTCCACAACCACCTCAX, wherein X is the fluorophore, designated herein as SEQ ID NO: 130). The RT-PCR data were analyzed and normalized to RIBOGREEN^® as described above. As presented in Table 13, treatment with ISIS 409176 significantly reduced RNA transcript expressions of these two cytokines. The results are expressed as percent inhibition of mRNA transcript, relative to the PBS control. Therefore, inhibition of gpl30 mRNA expression by ISIS oligonucleotides may have a therapeutic effect on atherosclerosis, as indicated by the lowering of pro-inflammatory cytokine levels.

Table 13

Percent inhibition of cytokine RNA transcript in LDLr^v" mice

Levels of liver acute phase proteins

Liver acute phase proteins, such as serum amyloid P (SAP), are elevated in chronic inflammatory diseases, like atherosclerosis. The IL-6 family of cytokines stimulate an acute phase response (APR) via IL- 6 receptor binding leading to gpl30 activation. Therefore, the plasma level of SAP protein after antisense inhibition of gpl30 was measured using a mouse ELISA kit (ICL, Inc., Oregon), following the

manufacturer's instructions. The level of SAP was decreased by 65% in mice treated with ISIS 409176 compared to the PBS control. Therefore, inhibition of gpl30 mRNA expression by ISIS oligonucleotides may have a therapeutic effect on atherosclerosis, as indicated by the lowering of liver acute phase proteins. Measurement of aortic atherosclerosis

After 10 weeks of treatment, mice were sacrificed, and aortas were harvested, cleaned of adventitial fat and imaged using the fluorescent agent, ProSense750™ (VisEN Medical, Inc., MA).

ProSense™750 is a protease-activatable fluorescent in vivo imaging agent that is activated by key disease associated proteases such as Cathepsin B, L, S and Plasmin (Weissleder, R. et al., Nat. Biotech. 1999. 17: 375-378). Changes in protease activity are seen in a number of pathological states and disease-related events, including rheumatoid arthritis, cancer, atherosclerosis, angiogenesis and cardiovascular disease.

TM

ProSense 750 (3.3 nmol) was administered intravenously to the mice 24 hours before euthanasia, and the thoracic aorta as well as the aortic arch were imaged on the LI-COR Odyssey at 700/800 nm

TM

(excitation/emission). Cathepsin-dependent cleavage of ProSense 750, demonstrated a 54% decrease in protease activity indicating a decrease in aortic atherosclerosis with ISIS 409176 treatment compared to the PBS control.

Liver function

To evaluate the effect of ISIS 409176 on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; TietzNW (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) at week 8 were measured and the results are presented in Table 14 expressed in IU/L. ISIS 409176 was considered tolerable in the mice, as demonstrated by their liver transaminase profile.

Table 14

Liver transaminase levels (IU/L) of LDLr^"

Body and organ weights

The body weights of the mice were measured pre-dose and weekly for 8 weeks. The body weights are presented in Table 15, and are expressed in grams. Liver, spleen and kidney weights were measured at the end of the study (week 10), and are presented in Table 16. Table 15

Body weights of LDLr mice

Table 16

Organ weights of LDLr^"

Glucose levels

Plasma glucose values were determined using a Beckman Glucose Analyzer Π (Beckman Coulter) by a glucose oxidase method (Lott, J.A. et al., Clin. Chem. 21 : 1754-1760, 1975). The results are presented in Table 17 expressed in mg dL.

Table 17

Glucose levels (mg/dL) in LDLr ^_ mice

Example 5: In vivo antisense inhibition of murine gpl30 in C57BL/6 mice

Treatment

C57/BL6 mice were maintained on a 12-hour light/dark cycle and fed ad libitum Teklad lab chow (Harlan Laboratories, Indianapolis, IN). Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

The mice were divided into six treatment groups of 5 mice each. Five groups received subcutaneous injections of ISIS 409158, ISIS 409162, ISIS 409173, ISIS 409181 or ISIS 409198, respectively, at a dose of 50 mg/kg twice a week for 4 weeks. One group of mice received subcutaneous injections of PBS twice a week for 4 weeks. This PBS group served as the control group. Body weights were taken weekly. Two days following the final dose, the mice were euthanized, organs harvested and analyses done. ISIS 409198 has no mismatches between the murine and human sequences as shown in Table 3.

Inhibition ofgpBO RNA

RNA was isolated from liver for real-time PCR analysis of gpl30 and normalized to cyclophilin A. As presented in Table 18, treatment with antisense oligonucleotides reduced murine gpl30 RNA transcript expression. The results are expressed as percent inhibition of gpl30 transcript, relative to the PBS control.

Table 18

Percent inhibition of murine gpl30 RNA transcript in C57BL/6 mice

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz NW (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) at week 4 were measured and the results are presented in Table 19 expressed in R7/L. The ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.

Table 19

Liver transaminase levels (IU L) of C57BL/6 mice at week 4

ALT AST

PBS 27 103

ISIS 409158 38 69

ISIS 409162 71 98

ISIS 409173 69 172

ISIS 409181 39 77

ISIS 409198 46 134 Glucose levels

Plasma glucose values were determined using a Beckman Glucose Analyzer II (Beckman Coulter) by a glucose oxidase method (Lott, J.A. et al., Clin. Chem. 21: 1754-1760, 1975). The results are presented in Table 20 expressed in mg/dL.

Table 20

Glucose levels (mg/dL) of C57BL/6 mice at week 4

Cholesterol and lipid levels

Plasma and liver triglycerides, and cholesterol were extracted by the method of Bligh and Dyer (Bligh,E.G. and Dyer,W.J. Can.J.Biochem.Physiol. 37: 911-917, 1959) and measured with the use of a commercially available triglyceride kit (DCL Triglyceride Reagent; Diagnostic Chemicals Ltd.). The results are presented in Table 21 and are expressed in mg dL.

Table 21

Cholesterol and lipid levels (mg/dL) of C57BL/6 mice at week 4

Body and organ weights

The body weights of the mice were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 22, and are expressed in grams. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 23.

Table 22

Body weights of C57BL/6 mice at week 4

Week O Week l Week 2 Week 3 Week 4

PBS 19 19 20 21 21

ISIS 409158 20 20 21 22 22 Table 23

Organ weights of C57BL/6 mice at week 4

Example 6: Effect of antisense inhibition of gpl30 on atherosclerosis in LDLr mice

The effect of ISIS 409158, ISIS 409162, ISIS 409173 and ISIS 409176 as anti-atherosclerotic agents was evaluated in LDL receptor knockout (LDLr^{" _}) mice fed on a hypercholesterolemic diet.

Treatment

C57BL/6 mice with LDL receptor gene knockout (Jackson Labs, #2207) were fed a Harlan Tekland diet, TD 88137 or 'Western diet' (21% anhydrous milkfat (butterfat), 34% sucrose, and a total of 0.2% cholesterol). One week after the initiation of the diet, the mice were divided into groups consisting of 5 mice each for treatment. Four groups received twice-weekly subcutaneous injections of ISIS 409158, ISIS 409162, ISIS 409173, or ISIS 409176 at doses of 25 mg/kg for 10 weeks. One group received twice- weekly subcutaneous injections for 10 weeks of control oligonucleotide ISIS 141923

(CCTTCCCTGAAGGTTCCTCC, 5-10-5 MOE gapmer, SEQ ID NO: 131) with no known murine target. One group received twice-weekly subcutaneous injections of PBS for 10 weeks. This saline-injected group served as the control group to which the oligonucleotide-treated groups were compared. After 10 weeks of dosing, mice were sacrificed and livers and aortae were harvested.

Inhibition ofgpl30RNA

R A was isolated from the liver for real-time PCR analysis of gpl30 and normalized to

RIBOGPvEEN^®. As presented in Table 24, treatment with ISIS oligonucleotides reduced murine gpl30 RNA transcript expression. The results are expressed as percent inhibition of gpl30 transcript, relative to the PBS control. ISIS 141923 had no effect on gpl30 mRNA expression, as expected.

Table 24

Percent inhibition of murine gpl 30 RNA transcript in LDLr^"Amice

Levels of liver acute phase proteins

Liver acute phase proteins, such as serum amyloid P (SAP) and C-reactive protein (CRP), are elevated in chronic inflammatory diseases, like atherosclerosis. The IL-6 family of cytokines stimulate an acute phase response (APR) via IL-6 receptor binding leading to gpl 30 activation. The RNA expression levels of serum amyloid A (SAA) was evaluated by RT-PCR analysis in the liver. As presented in Table 25, SAA mRNA levels were reduced by most of the ISIS oligonucleotides compared to the control.

The plasma levels of serum amyloid A (SAA) and serum amyloid P (SAP) proteins were also measured using mouse ELISA kits (ICL, Inc., Oregon), following the manufacturer's instructions. As presented in Table 26, SAA and SAP levels were reduced by antisense inhibition of gpl30. Therefore, inhibition of gpl 30 mRNA expression by ISIS oligonucleotides may have a therapeutic effect on atherosclerosis, as indicated by the lowering of liver acute phase proteins.

Table 25

Percent decrease in SAA mRNA expression due to antisense inhibition of gpl 30 in LDLr^'^mice

Table 26

SAA and SAP plasma levels ^g/mL) in LDLr '

SAA SAP

PBS 199 66

ISIS 141923 177 90

ISIS 409158 55 25

ISIS 409162 35 8 Measurement of aortic atherosclerosis

After 10 weeks of treatment, mice were sacrificed, and aortas were harvested, cleaned of adventitial fat and imaged using the fluorescent agents ProSense750™ and Cat B 680 FAST (VisEN

TM

Medical, Inc., MA). ProSense 750 is a protease-activatable fluorescent in vivo imaging agent that is activated by key disease associated proteases such as Cathepsin B, L, S and Plasmin (Weissleder, R. et al., Nat. Biotech. 1999. 17: 375-378). Changes in protease activity are seen in a number of pathological states and disease-related events, including rheumatoid arthritis, cancer, atherosclerosis, angiogenesis and cardiovascular disease.

Cat B 680 FAST is a Cathepsin B activatable agent that is optically silent upon injection and produces fluorescent signal after cleavage by Cathepsin B produced by inflammatory cells. Therefore, Cat B 680 FAST may be used to monitor inflammation.

TM

ProSense 750 (3.3 nmol) and Cat B 680 FAST (2.2 nmol) were administered intravenously to the mice 24 hours before euthanasia, and the thoracic aorta as well as the aortic arch were imaged on the LI-COR Odyssey at 680/700 nm (excitation/emission) for Cat B 680 FAST and at 700/800 nm

(excitation/emission) for ProSense 750. The results are presented in Table 27 as percentage decrease in fluorescence intensity of Cathepsin B and Prosense compared to the PBS control.

Aortic atherosclerosis was also measured by Sudan IV en face lipid staining, as described in previous publications (Daugherty, A. and Whitman, S.C. Methods in Molecular Biology. Human Press. Vol.209, 2008). The results are presented in Table 28 and demonstrate decrease in Sudan IV staining and hence, in aortic lesions after treatment with ISIS oligonucleotides, particularly, ISIS 409162, ISIS 409173 and ISIS 409176.

The results indicate that aortic atherosclerosis, was decreased by antisense inhibition of gpl30. Therefore, inhibition of gpl30 mRNA expression by ISIS oligonucleotides may have a therapeutic effect on atherosclerosis, as indicated by decrease in cathepsin, lipid staining and other protease activity.

Table 27

Percent change in fluorescent intensity due to antisense inhibition of gp 130 in LDLr^'^mice

Cat B 680 ProSense

ISIS No

FAST 750

141923 -11 13

409158 -31 -6

409162 -15 -16

409173 -30 -3 409176 -44 -38

Table 28

Percent change in Sudan IV lipid staining due to antisense inhibition of gp 130 in LDLr ^mice

Liver fimction

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured at weeks 8 and 10 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al. Alcohol & Alcoholism 39: 336-339, 2004; Tietz NW (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). The results are presented in Tables 29 and 30 expressed in IU L. The oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.

Table 29

Liver transaminase levels (IU/L) of LDLr^'^mice at week 8

Table 30

Liver transaminase levels (IU/L) of LDLr ^mice at week 10

ALT AST

PBS 36 193

ISIS 141923 26 85

ISIS 409158 29 75

ISIS 409162 49 101

ISIS 409173 53 127

ISIS 409176 135 204 Body and organ weights

The body weights of the mice were measured pre-dose and bi-weekly for 10 weeks. The body weights are presented in Table 31, and are expressed in grams. Liver, spleen and kidney weights were measured at week 10, and are presented in Table 32.

Table 31

Body weights of LDLr^'^mice

Table 32

Organ weights of LDLr^"

Glucose levels

Plasma glucose values were determined at weeks 8 and 10 using a Beckman Glucose Analyzer II (Beckman Coulter) by a glucose oxidase method (Lott, J.A. et al., Clin. Chem. 21 : 1754-1760, 1975). The results are presented in Table 33 expressed in mg/dL.

Table 33

Glucose levels (mg/dL) in LDLr^v" mice

Week 8 Week 10

PBS 319 260

ISIS 141923 289 245

ISIS 409158 264 260

ISIS 409162 288 219

ISIS 409173 300 216

ISIS 409176 251 204 Effect on plasma cytokine levels

IL-Ιβ, IFN-γ, TNF-a, IL-6 and IL-10 levels were assayed in the mice groups at week 10 by ELISA (Meso Scale Discovery, Maryland) and are shown in Table 34. Treatment with ISIS 409176 significantly decreased the levels of certain pro-inflammatory cytokines, such as IL-Ιβ, IFN-γ and TNF-

Table 34

Plasma cytokine levels (pg/mL) in LDLr ^"mice

IL-Ιβ IFN-γ TNF-a IL-6 IL-10

PBS 20 16 8 226 327

ISIS 141923 22 9 8 208 263

ISIS 409158 18 9 18 215 270

ISIS 409162 17 16 9 192 315

ISIS 409173 17 28 11 237 296

ISIS 409176 8 7 5 256 318

Claims

What is claimed is:

1. A method of reducing gpl30 expression in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30, wherein expression of gpl30 is reduced in the animal.

2. A method of reducing inflammation in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30, wherein inflammation is reduced in the animal.

3. The method of claim 2, wherein reducing inflammation ameliorates an inflammatory disease or disorder.

4. The method of claim 3, wherein the inflammatory disease is metabolic disease or cardiovascular disease.

5. A method of reducing glucose levels in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30, wherein the level of glucose is reduced in the animal.

6. A method of ameliorating metabolic or cardiovascular disease in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30, wherein the metabolic or cardiovascular disease is ameliorated in the animal.

7. The method of claim 4 or 6, wherein the cardiovascular disease is atherosclerosis.

8. The method of any one of claims 1, 2, 5 or 6, wherein the compound consists of a single-stranded modified oligonucleotide.

9. The method of any one of claims 1, 2, 5 or 6, wherein the animal is a human.

10. The method of any one of claims 1, 2, 5 or 6, wherein the compound is a first agent and further comprising administering a second agent.

11. The method of claim 10, wherein the first agent and the second agent are co-administered.

12. The method of any of claim 10, wherein the second agent is a glucose-lowering agent.

13. The method of claim 12, wherein the glucose lowering agent is a therapeutic lifestyle change, PPAR agonist, a dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof.

14. The method of claim 12, wherein the glucose-lowering agent is metformin, sulfonylurea, rosiglitazone, or a combination thereof.

15. The method of claim 12, wherein the glucose-lowering agent is a sulfonylurea selected from acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide.

16. The method of claim 12, wherein the glucose-lowering agent is the biguanide metformin.

17. The method of claim 12, wherein the glucose-lowering agent is a meglitinide selected from nateglinide or repaglinide.

18. The method of claim 12, wherein the glucose-lowering agent is a thiazolidinedione selected from pioglitazone or rosiglitazone.

19. The method of claim 12, wherein the glucose-lowering agent is an alpha-glucosidase inhibitor selected from acarbose or miglitol.

20. The method of claim 10, wherein the second agent is an inflammation lowering therapy.

21. The method of claim 20, wherein the inflammation lowering therapy is a therapeutic lifestyle change, steroid, NSAID, antibody against TNF-cc or antibody against EL-6.

22. The method of claim 20, wherein the steroid is a corticosteroid.

23. The method of claim 20, wherein the NSAID is aspirin, acetaminophen, ibuprofen, naproxen, COX inhibitors, indomethacin and the like.

24. The method of any one of claims 1, 2, 5 or 6, wherein administration comprises parenteral administration.

25. The method of any one of claims 1, 2, 5 or 6, wherein the modified oligonucleotide has a nucleobase sequence at least 90% complementary to any of SEQ ID NO: 1-13 as measured over the entirety of said modified oligonucleotide.

26. The method of any one of claims 1, 2, 5 or 6, wherein the modified oligonucleotide has a nucleobase sequence at least 95% complementary to any of SEQ ID NOs: 1-13 as measured over the entirety of said modified oligonucleotide.

27. The method of any one of claims 1, 2, 5 or 6, wherein the modified oligonucleotide has a nucleobase sequence at least 100% complementary to any of SEQ ID NOs: 1-13 as measured over the entirety of said modified oligonucleotide.

28. The method of any one of claims 1, 2, 5 or 6, wherein at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

29. The method of claim 28, wherein each internucleoside linkage is a phosphorothioate

internucleoside linkage.

30. The method of any one of claims 1, 2, 5 or 6, wherein at least one nucleoside of said modified oligonucleotide comprises a modified sugar.

31. The method of claim 30, comprising at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces a furanose ring.

32. The method of claim 31, wherein each of the at least one tetrahydropyran modified nucleoside has the structure:

wherein Bx is an optionally protected heterocyclic base moiety.

33. The method of claim 30, wherein at least one modified sugar is a bicyclic sugar.

34. The method of claim 30, wherein at least one modified sugar comprises a 2'-0-methoxyethyl or a 4'- (CH₂)_n-0-2' bridge, wherein n is 1 or 2.

35. The method of any one of claims 1, 2, 5 or 6, wherein at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase.

36. The method of claim 35, wherein the modified nucleobase is a 5-methylcytosine.

37. The method of any one of claims 1, 2, 5 or 6, wherein the modified oligonucleotide consists of 20 linked nucleosides.

38. The method of any one of claims 1, 2, 5 or 6, wherein the modified oligonucleotide comprises: a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3 ' wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

39. The method of claim 1, 2, 5 or 6, wherein the modified oligonucleotide consists of 20 linked nucleosides, has a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NO: 1-13 and comprises:

a. a gap segment consisting of ten linked deoxynucleosides;

b. a 5' wing segment consisting of five linked nucleosides;

c. a 3' wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.

40. A method for treating an animal with metabolic or cardiovascular disease comprising

a. identifying said animal with metabolic or cardiovascular disease,

b. administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NO: 1-13 as measured over the entirety of said modified oligonucleotide,

wherein said animal with metabolic or cardiovascular disease is treated.

41. The method of claim 6 or 40, wherein administering the compound to the animal reduces metabolic or cardiovascular disease in the animal.

42. The method of claim 41, wherein the metabolic or cardiovascular disease is obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, non-alcoholic fatty liver disease (NAFLD), hyperfattyacidemia, metabolic syndrome, or a combination thereof.

43. A method for treating an animal with an inflammatory disease comprising

a. identifying said animal with the inflammatory disease,

wherein said animal with the inflammatory disease is treated.

44. The method of claim 3 or 43, wherein administering the compound to the animal reduces the inflammatory disease in the animal.

45. The method of claim 44, wherein the inflammatory disease is atherosclerosis.

46. The method of claim 1, 2, 5 or 6, wherein administering the compound to the animal results in a reduction of inflammatory cytokines levels in the animal.

47. The method of claim 46, wherein the cytokines are IL-1, INF-gamma, TNF-alpha, MCP-1.

48. The method of claim 47, wherein the cytokine levels are independently reduced by 5%, 10%, 20%, 30%, 35%, or 40%.

49. Use of a compound to reduce gpl30 levels in an animal, wherein the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gp 130 as shown in any of SEQ ID NO: 1-13.

50. Use of a compound to treat an inflammatory disease in an animal, wherein the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30 shown in any of SEQ ID NO: 1-13.

51. Use of a compound to treat metabolic or cardiovascular disease in an animal, wherein the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30 shown in any of SEQ ID NO: 1-13.

52. Use of a compound to treat atherosclerosis in an animal, wherein the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to gpl30 shown in any of SEQ ID NO: 1-13.

53. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NO: 1-13.

54. The compound of claim 53, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to any of SEQ ID NO: 1-13.

55. The compound of claim 53, wherein the nucleobase sequence of the modified oligonucleotide is at least 100% complementary to any of SEQ ID NO: 1-13.

56. The compound of claim 53, wherein the modified oligonucleotide is single-stranded.

57. The compound of claim 53, wherein at least one internucleoside linkage is a modified

internucleoside linkage.

58. The compound of claim 57, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

59. The compound of claim 53, wherein at least one nucleoside comprises a modified sugar.

60. The compound of claim 59, wherein at least one modified sugar is a bicyclic sugar.

61. The compound of claim 59, wherein at least one modified sugar comprises a 2'-0-methoxyethyl or a 4'- (CH₂)_n-0-2' bridge, wherein n is 1 or 2.

62. The compound of claim 53, wherein at least one nucleoside comprises a modified nucleobase.

63. The compound of claim 62, wherein the modified nucleobase is a 5-methylcytosine.

64. The compound of claim 53, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked deoxynucleosides;

a 5' wing segment consisting of linked nucleosides;

a 3' wing segment consisting of linked nucleosides;

65. The compound of claim 53, wherein the modified oligonucleotide consists of 20 linked nucleosides and comprises:

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of five linked nucleosides;

a 3' wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5- methylcytosine.

66. The compound of claim 53, wherein the modified oligonucleotide consists of 20 linked nucleosides.

67. A compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ED NO: 1-13, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of five linked nucleosides;

a 3' wing segment consisting of five linked nucleosides;

68. Use of the compound of any of claim 53, 67 or 68, to treat an inflammatory disease in an animal.

69. Use of the compound of claim 68, wherein the inflammatory disease is atherosclerosis.