RU2780021C2 - Methods for treatment of hepatitis b infection - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: present invention relates to the field of biotechnology, in particular to new antisense oligonucleotides; it can be used in medicine. The invention discloses highly efficient modified oligonucleotide, which is capable of inhibiting the expression of mRNA of a hepatitis B virus surface antigen (HBsAg).

EFFECT: invention can be used in medical practice for the treatment of infections caused by hepatitis B virus (HBV).

25 cl, 19 dwg, 4 tbl, 7 ex

Description

FIELD OF TECHNOLOGY TO WHICH THE INVENTION RELATES

[0001] This application relates to oligonucleotides and their use, in particular to use in the treatment of hepatitis B infection.

BACKGROUND TO THE INVENTION

[0002] Chronic hepatitis B virus (HBV) infection is a major cause of morbidity and mortality worldwide. Current treatments for hepatitis B, such as treatment with nucleoside analogues, require lifelong therapy to reduce plasma viremia and are generally ineffective in the long term. Functional cure of chronic HBV is generally considered to be the best treatment outcome. RNA interference (RNAi) technology has the potential to be applied in pharmacology.

[0003] The outer envelope proteins of the virus are collectively known as hepatitis B surface antigens (HBsAg). HBsAg consists of three related polypeptides called S, M and L, which are encoded by overlapping open reading frames (ORFs). The shortest coat protein is the 226 amino acid S protein called S-ORF. M and L are synthesized using previous translation initiation sites and add 55 and 108 amino acids to the length of the S protein, respectively. HBV S, M, and L glycoproteins are found in the viral envelope of intact, infectious HBV virions, called Dane particles, and all three of these are produced and secreted in huge excess, from which non-infectious subviral spherical and filamentous particles (both called bait particles) are formed. found in the blood of patients with chronic HBV. An excess of HBsAg on the surface of the bait particles is believed to inhibit both humoral immunity and spontaneous clearance in patients with chronic HBV (referred to as CHB) infection.

SUMMARY OF THE INVENTION

[0004] Aspects of the disclosure relate to improved oligonucleotide compositions and related methods for treating HBV infection in a subject. In some embodiments, the invention relates to the development of highly effective oligonucleotides that cause long-term knockdown of HBV surface antigen (HBsAg) expression. The oligonucleotide induces mediated RNA interference (RNAi) recognition and destruction of mRNA encoding all forms of HBsAg in hepatocytes. These include proteins translated from viral RNAs transcribed from both cccDNA (circular covalently closed DNA) and HBV DNA integrated into the host genome. Presented here are oligonucleotides designed to target HBsAg transcripts encoded by HBV genomes for all known genotypes. In some embodiments, it has been found that the oligonucleotides described herein, which target HBsAg transcripts in hepatocytes, can cause a stable, highly specific reduction in HBsAg expression, and such reduction in expression persists for an extended period of time (e.g., more than 7 weeks to several months) after administration. those of the subject (see, for example, Examples 1 and 3). In some embodiments, the use of oligonucleotides disclosed herein that target HBsAg expression has been found to result in a reduction in pregenomic RNA (pgRNA) and other viral life cycle intermediates. It has also been found that certain RNAi oligonucleotides disclosed in the present invention can knock down HBsAg mRNA transcripts read either from cccDNA or from an integrated virus. In additional aspects, it was found that the use of oligonucleotides disclosed in the present invention, targeting the expression of HBsAg, reduces the expression of all HBV proteins (with the exception of HBx), namely HBcAg, HBeAg and HBV polymerase, which leads to the retention of the basic HBV core protein in cytosol. In addition, in some embodiments, the clearance of circulating HBsAg resulting from mRNA knockdown using the methods of the present invention is clinically beneficial as it allows for the elimination of HBV immune tolerance induced by high levels of circulating HBsAg in patients with CHB. It is believed that restarting the activity of the immune system against HBV infection is the cornerstone of achieving a functional cure, defined as the permanent (or prolonged) absence of HBsAg in plasma (clearance).

[0005] Previous studies have shown that the use of a combination of RNAi agents that target many different HBV genes (namely, the S, C, P, and X genes), or, in some cases, target X gene transcripts alone, provides effective inhibition of replication. and HBV gene expression. However, the results presented in the present invention demonstrate that the use of RNAi oligonucleotides targeting only HBsAg transcripts also provides effective inhibition of HBV replication and gene expression, which represents a new therapeutic approach for the treatment of HBV infections. In addition to a direct viral RNA silencing effect, HSB(s)-219 precursors prevent nuclear localization of the HBV core antigen (HBcAg). It is important to note that targeting HBV-X or both genes simultaneously does not prevent the nuclear localization of HBcAg. Preclinical data strongly suggest that the inhibition of nuclear localization induced by S-targeted RNAi therapy leads to a significant increase in the duration of HBsAg suppression. Notably, the absence of nuclear localization of HBcAg in patients has been shown to correlate with favorable outcomes of antiviral therapy.

[0006] Some aspects of the present disclosure relate to oligonucleotides for reducing hepatitis B surface antigen (HBsAg) mRNA expression, comprising an antisense strand of 19 to 30 nucleotides in length, wherein the antisense strand contains a region of complementarity of the HBsAg mRNA sequence indicated as ACAANAAUCCUCACAAUA (SEQ ID NO : one).

[0007] In some embodiments, the oligonucleotide further comprises a sense strand between 19 and 50 nucleotides in length, wherein the sense strand forms a duplex region with the antisense strand. In some embodiments, the implementation of the sense strand contains a region of complementarity to the sequence indicated as UUNUUGUGAGGAUUN (SEQ ID NO: 2). In some embodiments, the sense strand contains a region of complementarity to the sequence indicated as 5'-UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 3).

[0008] In some embodiments, the antisense strand contains a sequence such as UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 4). In some embodiments, the antisense strand consists of a sequence such as UUAUUGUGAGGAUUCUUGUCGG (SEQ ID NO: 5). In some embodiments, the antisense strand consists of a sequence such as UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1).

[0009] In some embodiments, the implementation of the sense strand contains a sequence such as ACAANAAUCCUCACAAUAA (SEQ ID NO: 6). In some embodiments, the sense strand contains a sequence such as GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 7). In some embodiments, the sense strand consists of a sequence such as GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8). In some embodiments, the sense strand consists of a sequence such as GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8.1).

[00010] Other aspects of the present invention relate to oligonucleotides for reducing hepatitis B surface antigen (HBsAg) mRNA expression, wherein the oligonucleotide comprises a sense strand forming a duplex region with an antisense strand, wherein the sense strand contains a sequence such as GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8), and where the antisense strand contains a sequence such as UUAUUGUGAGGAUUUUUUGUCGG (SEQ ID NO: 5.1), where each of the antisense and sense strands contain one or more 2'-fluoro- and 2'-O-methyl-modified nucleotides and, by at least one phosphorothioate bond, and wherein the 4' sugar carbon of the 5'-nucleotide of the antisense strand contains a phosphate analog, and wherein the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties.

[00011] Further, the present invention relates to oligonucleotides for reducing the expression of hepatitis B surface antigen (HBsAg) mRNA, comprising a sense strand forming a duplex region with an antisense strand, wherein: the sense strand contains a sequence such as GACAAAAAUCCCACAAAGAGAGA (SEQ ID NO: 8) , including 2'-fluoro-modified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methyl-modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18- 26 and 31-36 and at least one phosphorothioate internucleotide bond, and wherein the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties; the antisense strand contains a sequence such as UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1) comprising 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methyl - modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22 and at least three phosphorothioate internucleotide bonds, and where the 4' is the sugar carbon of the 5' nucleotide of the antisense strand contains a phosphate analog, and the sense strand contains a phosphorothioate bond between nucleotides at positions 1 and 2.

[00012] In some embodiments, the antisense strand contains five phosphorothioate bonds between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22.

[00013] In some embodiments, the 5' nucleotide of the antisense strand has the following structure:

[00014] In some embodiments, one or more nucleotides of the -GAAA- sequence of the sense strand are conjugated to a monovalent GalNac fragment.

[00015] In some embodiments, each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac fragment. In some embodiments, the -GAAA- motif contains the structure:

wherein:

L is a bond, click-latch or linker, from 1 to 20 in length inclusive, of successively covalently bonded atoms selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene , substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; a

X is O, S or N.

[00016] In some embodiments, L is an acetal linker. In some embodiments, X is O.

[00017] In some embodiments, the -GAAA- sequence contains the structure:

.

.

[00018] In some embodiments, the sense strand contains at its 3' end a stem loop designated as: S1-L-S2, where S1 is complementary to S2, and where L forms a loop between S1 and S2 up to 6 nucleotides in length. In some embodiments, L is a tetra loop. In some embodiments, L forms a 4 nucleotide loop between S1 and S2. In some embodiments, L contains the sequence designated as GAAA. In some embodiments, up to 4 stem loop L nucleotides are present, each conjugated to a separate GalNAc.

[00019] In some embodiments, the implementation of the oligonucleotide contains at least one modified nucleotide. In some embodiments, the modified nucleotide contains a 2' modification. In some embodiments, the 2'-modification is a modification selected from: 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β -d-arabinonucleic acid. In some embodiments, all oligonucleotide nucleotides are modified nucleotides. In some embodiments, the oligonucleotide contains at least one modified internucleotide bond. In some embodiments, at least one modified internucleotide bond is a phosphorothioate bond, wherein the 4' sugar carbon of the 5' nucleotide of the antisense strand contains a phosphate analog.

[00020] In some embodiments, at least one nucleotide of the oligonucleotide is conjugated to a targeting ligand. In some embodiments, the targeting ligand is an N-acetylgalactosamine (GalNAc) moiety.

[00021] Further, the present invention relates to compositions containing an oligonucleotide according to any of the previous claims and a counter-ion, and compositions containing an oligonucleotide according to any of the previous claims and a pharmaceutically acceptable carrier.

[00022] Other aspects of the present invention relate to methods for reducing hepatitis B virus (HBV) surface antigen expression in a cell, comprising delivering an oligonucleotide described in the present invention to the cell. In some embodiments, the cell is a hepatocyte. In some embodiments, the implementation of the cell is in vivo. In some embodiments, the implementation of the cell is in vitro.

[00023] Other aspects of the present disclosure relate to methods for treating hepatitis B virus (HBV) infection in a subject, comprising administering to the subject an oligonucleotide or composition described in the present invention.

[00024] The invention also provides methods for treating an HBV infection in a subject, comprising administering to the subject an RNAi oligonucleotide selectively targeted to HBsAg mRNA, such RNAi oligonucleotide being administered in the absence of treatment with an RNAi oligonucleotide targeting an HBV mRNA transcript encoding a non-surface antigen. The invention also relates to methods for treating an HBV infection in a subject, comprising administering to the subject an RNAi oligonucleotide selectively targeting HBsAg mRNA, while not administering to the subject an RNAi oligonucleotide selectively targeting an HBxAg mRNA transcript. In some embodiments, the method further comprises administering to the subject an effective amount of entecavir.

[00025] Other aspects of the present invention relate to oligonucleotides for reducing hepatitis B surface antigen (HBsAg) mRNA expression, comprising a sense strand forming a duplex region with an antisense strand, wherein:

the sense strand contains a sequence as specified in GACAAAAACCCCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8) and containing 2'-fluoro-modified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methyl-modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36 and one phosphorothioate internucleotide bond between nucleotides at positions 1 and 2, where each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent fragment GalNac, and where the sequence -GAAA- contains the structure:

; и

; and

where the antisense strand contains a sequence such as UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1) and containing 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O- methyl-modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22 and five phosphorothioate internucleotide bonds between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21 and 21 and 22, and wherein the 4' sugar carbon of the 5' nucleotide of the antisense strand has the following structure:

[00026] The invention also relates to a composition containing an oligonucleotide. In some embodiments, the composition further comprises Na ⁺ counter ions.

[00027] The invention also relates to methods for reducing hepatitis B virus (HBV) surface antigen expression in a cell, including delivery of an oligonucleotide or composition. In some embodiments, the cell is a hepatocyte. In some embodiments, the implementation of the cell is in vivo. In some embodiments, the implementation of the cell is in vitro.

[00028] The invention relates to methods for treating hepatitis B virus (HBV) infection in a subject, comprising administering an oligonucleotide or composition to the subject. In some embodiments, the method includes administering to the subject an effective amount of Entecavir.

BRIEF DESCRIPTION OF THE DRAWINGS

[00029] The accompanying drawings, which are included in and constitute a part of this specification, illustrate certain embodiments and, along with the written description, serve to provide non-limiting examples of certain aspects of the compositions and methods disclosed in the present invention.

[00030] FIG. 1 shows an example of an RNAi target site in a schematic diagram of the organization of the HBV genome.

[00031] FIG. 2 shows the evaluation of a single dose of an oligonucleotide to reduce HBsAg expression in mice in an HDI model.

[00032] FIG. 3 is a graphical representation of plasma levels of HBsAg over time using a specific dosing regimen using an HBsAg-targeted oligonucleotide. As shown in this example, the oligonucleotide has shown potential in preclinical studies and maintained reduced levels for a significant time after the dosing period.

[00033] FIG. 4 provides graphs depicting the results of HBsAg mapping in HeLa cells using reporter analysis. Unmodified siRNA targeting position 254 of the HBV genome was used as a positive control at the indicated concentrations. Commercially available Silencer siRNA (Thermo Fisher) served as a negative control for these experiments. Scatter bars represent SEM.

[00034] FIG. 5 shows a comparison of genotype conservation rates showing that the engineered mismatch in the HBs Ag-targeted oligonucleotide, HBV-219, increases the coverage of HBV genotypes.

[00035] FIG. 6 illustrates a vector designed for psiCHECK2 reporter assays where HBV Genotype A is used as the prototype sequence.

[00036] FIG. 7 shows several examples of oligonucleotides designed to evaluate the effect of introducing mismatches. Oligonucleotide sequences for parental and mismatched strands are shown aligned and mismatch positions are boxed. Appropriate reporter sequences used in psiCHECK2 reporter assays are provided in addition.

[00037] FIG. 8 shows a single dose titration plot of the oligonucleotide used in mismatch evaluation studies, which demonstrates that mismatch in the target strand is tolerated in vivo.

[00038] FIG. 9 shows an in vivo dose titration plot demonstrating that incorporation of a mismatch into an HBsAg-targeted oligonucleotide does not adversely affect its in vivo activity.

[00039] FIG. 10 shows an example of an HBsAg-targeted oligonucleotide (HBV(s)-219) with chemical modifications and in duplex form. Darker shade indicates 2'-O-methyl ribonucleotide. A lighter shade indicates 2'-fluoro-deoxyribonucleotide.

[00040] FIG. 11A shows immunohistochemical staining results showing the intracellular distribution of HBV major antigen (core core protein) (HBcAg) in hepatocytes.

[00041] FIG. 11B provides RNA sequencing results mapping the detected RNA transcript sequences compared to HBV pgRNA.

[00042] FIG. 12A shows the time course of HBsAg mRNA expression after treatment with HBV(s)-219P2 oligonucleotide, a precursor of HBV(s)-219 oligonucleotide targeting HBsAg mRNA, compared to a vehicle control and a control RNAi oligonucleotide targeting HbxAg mRNA in hydrodynamic analysis. models of injection (HDI) of HBV.

[00043] FIG. 12B shows the time course of HBsAg mRNA expression after treatment with HBV(s)-219P2 oligonucleotide, a precursor of the HBV(s)-219 oligonucleotide, targeting HBsAg mRNA, compared to a vehicle control and control RNAi oligonucleotide targeting HbxAg mRNA in the model. AAV-HBV.

[00044] FIG. 13 shows immunohistochemical staining results showing the intracellular distribution of HBcAg in hepatocytes derived from the AAV-HBV model and the HDI HBV model after treatment with HBV(s)-219 oligonucleotide targeting HBsAg mRNA compared to vehicle control and control RNAi oligonucleotide, targeting HBxAg mRNA (GalXC-HBVX).

[00045] FIG. 14A-14D show the antiviral activity of HBV(s)-219 oligonucleotide precursor 1 (designated HBV(s)-219 P1) in the PXB-HBV model. Cohorts of 9 mice were injected subcutaneously with 3 weekly doses of either 0 mg/kg or 3 mg/kg HBV(s)-219P1 in PBS. Six mice from each cohort were analyzed for non-lethal mandibular bleeding at each of the indicated time points (FIGS. 14A and 14B) to determine serum HBsAg and HBV DNA. On day 28 (counting from the day of the first dose of HBV(s)-219P1), all remaining mice were sacrificed and liver biopsies were collected to obtain the content of HBV DNA in the liver (FIG. 14C) and cccDNA (circular covalently closed DNA) in the liver (FIG. . 14D) using RT-qPCR (quantitative real-time PCR).

[00046] FIG. 15A-15C show that HBV(s)-219 precursor 2 (designated HBV(s)-219P2) enhances the antiviral activity of entecavir. In the HBV mouse hydrodynamic injection (HDI) model, a single dose of HBV(s)-219P2 was administered to mice subcutaneously on day 1 followed by daily oral administration of entecavir 500 ng/kg (ETV) for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (FIG. 15A). Plasma HBsAg levels were measured using an ELISA test (FIG. 15B). Hepatic mRNA and pgRNA (pgRNA) levels of HBV were measured by qPCR (FIG. 15C). The results show clear cumulative effects with combination therapy. ETV therapy alone is not effective against circulating HBsAg or viral RNA in the liver. The antiviral activity of HBV(s)-219P2, as measured by HBsAb or HBV RNA, is not altered when co-administered with ETV. "BLOD" means "below the limit of detection".

[00047] FIG. 16A-16B show a comparison of HBsAg suppression by a GalNac-conjugated oligonucleotide targeting the S antigen (HBV(s)-219P2) or X antigen (designated GalXC-HBVX). The result shows that HBVS-219P2 suppresses HBsAg for a longer period of time than GalXC-HBVX or an equimolar combination of both RNAi agents. FIG. 16A shows that the location of the HBV target site targeted by RNAi affects the kinetics of HBsAg recovery in HBV expressing mice. FIG. 16B shows plasma HBsAg levels 2 weeks post-dose (left panel) and 9 weeks post-dose (right panel), indicating targeting the HBVX coding region, alone or in combination with HBV(s)-219P2 , leads to a shorter duration of suppression. Data from individual animals are shown. At several points, the data (light gray circles) were below the limit of detection.

[00048] FIG. 17A-17C show intracellular localization of HBV major antigen (HBcAg) in HBV expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination thereof. FIG. 17A shows representative hepatocytes of liver sections obtained at 1, 2, 6, 9 and 13 weeks after injection and stained for HBcAg. FIG. 17B shows the percentage of HBcAg positive cells with nuclear staining for each animal (n=3/group, 50 cells per animal, 2 weeks post-dose). Alternative sequences within the X and S open reading frames were designed and tested. FIG. 17C shows the intracellular distribution of HBcAg in hepatocytes obtained at 2, 3 and 9 weeks after administration of an alternative RNAi oligonucleotide targeting either the S antigen or the X antigen.

[00049] FIG. 18 provides dose information by cohort for conducting a study of the safety and tolerability of HBV(s)-219 in healthy patients and the therapeutic efficacy of HBV(s)-219 in patients with HBV.

[00050] FIG. 19A-19B show the chemical structure of HBV(s)-219 and HBV(s)-219P2. (FIG. 19A) Chemical structure of HBV(s)-219. (FIG. 19B) Chemical structure of HBV(s)-219P2.

DETAILED DESCRIPTION OF THE INVENTION

[00051] In accordance with some aspects, the present invention relates to highly effective oligonucleotides that reduce the expression of HBsAg in cells, in particular in liver cells (eg, hepatocytes), for the treatment of HBV infections. In some embodiments, HBsAg-targeting oligonucleotides provided herein are designed to be delivered to selected target tissue cells (eg, liver hepatocytes) to treat HBV infection in those tissues. Accordingly, in related aspects, the present invention relates to methods for treating HBV infection, comprising selectively reducing HBV surface antigen gene expression in cells (eg, liver cells).

[00052] Additional aspects of the disclosure, including a description of certain terms, are provided below.

I. Definitions

[00053] Approximately: The term "approximately" or "about/about", as used in the present description, in relation to one or more discussed values, refers to a value similar to the specified specific value. In some embodiments, the term "about" or "about" refers to a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12% , 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in any direction (greater than or less than) the specified specified value, unless otherwise indicated or does not follow from the context (except when this number exceeds 100% of the possible value).

[00054] Introduction. The term "administration" or "administration" as used herein means providing a substance (eg, an oligonucleotide) to a subject in a pharmacologically acceptable manner (eg, to treat a condition in the subject).

[00055] Asialoglycoprotein receptor (ASGPR). As used herein, the term "asialoglycoprotein receptor" or "ASGPR" refers to a two-piece C-type lectin formed by a 48 kD major subunit (ASGPR-1) and a 40 kD minor subunit (ASGPR-). 2). ASGPR is predominantly expressed on the sinusoidal surface of hepatocyte cells and plays a major role in the binding, internalization and subsequent clearance of circulating glycoproteins containing terminal residues of galactose or N-acetylgalactosamine (asialoglycoproteins).

[00056] Complementary: As used herein, the term "complementary" refers to a structural relationship between two nucleotides (e.g., on two opposite nucleic acids or on opposite sites on the same nucleic acid strand) or between two nucleotide sequences that allows two nucleotides or two nucleotide sequences to form base pairs with each other. For example, a purine nucleotide of one nucleic acid that is complementary to a pyrimidine nucleotide of the opposite nucleic acid can interact with it to form a base pair by forming hydrogen bonds with each other. In some embodiments, complementary nucleotides may form a Watson-Crick base pair or interact in any other manner that provides for the formation of stable duplexes. In some embodiments, two nucleic acids may have regions of several nucleotides that are complementary to each other to form regions of complementarity, as described herein.

[00057] Deoxyribonucleotide: As used herein, the term "deoxyribonucleotide" refers to a nucleotide having a hydrogen instead of a hydroxyl at the 2' position of the pentose sugar compared to a ribonucleotide. A modified deoxyribonucleotide is a deoxyribonucleotide having one or more modifications or substitutions of atoms at positions other than the 2' position, including modifications or substitutions in the sugar, phosphate group, or base.

[00058] Double stranded oligonucleotide: As used herein, the term "double stranded oligonucleotide" refers to an oligonucleotide that is substantially in duplex form. In some embodiments, a complementary base pairing of the duplex region(s) of a double stranded oligonucleotide is formed between the antiparallel nucleotide sequences of the individual nucleic acid strands. In some embodiments, a complementary base pairing of the duplex region(s) of a double stranded oligonucleotide is formed between antiparallel nucleotide sequences of nucleic acid strands that are covalently linked. In some embodiments, complementary base-pairing of the duplex region(s) to form a double-stranded oligonucleotide is formed on a single strand of nucleic acid that is folded (e.g., via a hairpin) to allow complementary interaction of anti-parallel nucleotide sequences to form base pairs. In some embodiments, the double-stranded oligonucleotide contains two separate covalent nucleic acid strands that are fully duplexed with each other. However, in some embodiments, the double-stranded oligonucleotide contains two separate covalent nucleic acid strands that are partially duplexed, eg, have overhangs at one or both ends. In some embodiments, the double-stranded oligonucleotide contains anti-parallel nucleotide sequences that are partially complementary and thus may have one or more mismatches (mismatches/non-complementaries), and these mismatches may include internal mismatches or terminal mismatches (non-complementaries).

[00059] Duplex: As used herein, the term "duplex" in relation to nucleic acids (eg, oligonucleotides) refers to a structure formed by complementary base pairing of two antiparallel nucleotide sequences.

[00060] Excipient: As used herein, the term "excipient" refers to a non-therapeutic agent that may be included in the composition, for example, to provide or contribute a desired consistency or stabilizing effect.

[00061] Hepatocyte: As used herein, the term "hepatocyte" or "hepatocytes" refers to cells in the parenchymal tissues of the liver. These cells make up approximately 70-85% of the mass of the liver and produce serum albumin, fibrinogen, and the prothrombin group of blood clotting factors (with the exception of factors 3 and 4). Hepatocyte cell line markers may include, but are not limited to: transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). Markers for mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose-6-phosphate (G6p), albumin (Alb), and OC2-2F8. See, for example, Huch et al., (2013), Nature, 494 (7436): 247-250, the content of which discloses hepatocyte markers and is incorporated herein by reference.

[00062] Hepatitis B virus: As used herein, the term "hepatitis B virus" or "HBV" refers to a small DNA virus belonging to the family Hepadnaviridae and classified as a typical species of the genus Orthohepadnavirus. The HBV virus particles (virions) contain an outer lipid envelope and an icosahedral nucleocapsid core composed of protein. The nucleocapsid typically includes viral DNA and DNA polymerase, which has reverse transcriptase activity similar to that of retroviruses. The outer envelope of HBV contains built-in proteins involved in the binding of the virus to the cell and in its entry into susceptible cells. HBV affecting the liver is classified based on sequence and has at least ten genotypes (A-J). Generally, there are four genes encoded by the genome, whose genes are designated C, P, S and X. The main protein of the virus (called the main core protein) is encoded by gene C (HBcAg), and its start codon is preceded by the upstream start codon AUG , located in the reading frame, from which the precursor of the main protein is synthesized. HBeAg is produced by proteolytic processing of a precursor protein. DNA polymerase is encoded by the P gene. The S gene encodes the surface antigen (HBsAg). The HBsAg gene is one long open reading frame, but contains three "start" (ATG) codons in the reading frame, which divide the gene into three sections: pre-S1, pre-S2 and S. Due to multiple start codons, polypeptides of three various sizes, called large, medium and small (pre-S1+pre-S2+S, pre-S2+S or S). They may have a 1:1:4 ratio (Heermann et al, 1984).

[00063] Hepatitis B virus (HBV) proteins can be organized into several categories and have several functions. Polymerases function as reverse transcriptases (RT), synthesizing viral DNA from pregenomic RNA (pgRNA), and as DNA-dependent polymerases to form covalently closed circular DNA (cccDNA) from viral DNA. They are covalently attached to the 5' end of the negative strand. The main proteins form the viral capsid and the secreted E-antigen. Surface antigens are ligands for internalization by hepatocytes, as well as the main component of spherical and filamentous particles. Aviral particles (virus-like particles that carry no genetic material) are produced 1,000 times more frequently than Dane particles (infectious virions) and can act as immune baits.

[00064] Hepatitis B surface antigen: As used herein, the term "hepatitis B surface antigen" or "HBsAg" refers to an S-domain containing protein encoded by the S gene (eg, with the S ORF) of the HBV genome. The hepatitis B virus particles carry a viral nucleic acid at the core of the particles, surrounded by three proteins encoded by the S gene, which are surface proteins: large, medium and basic. Among these proteins, the predominant surface protein usually contains about 226 amino acids and contains only the S domain.

[00065] Infection: As used herein, the term "infection" refers to pathogenic invasion and/or proliferation of microorganisms, such as viruses, in a subject. The infection can be lysogenic, for example, when the viral DNA is dormant inside the cell. Alternatively, the infection may be lytic, eg, in which the virus actively replicates and causes destruction of the infected cells. The infection may or may not cause clinically significant symptoms. The infection may remain localized or spread, for example, through the patient's blood or lymphatic system. An individual having, for example, an HBV infection can be identified by detecting one or more viral load markers, surface antigen (HBsAg), e-antigen (HBeAg); and there are various other methods for detecting HBV infection known in the art. Methods for detecting HBV infection may include testing serum or blood samples for the presence of HBsAg and/or HBeAg and optionally additional screening for the presence of one or more viral antibodies (eg, IgM and/or IgG) during times when HBV antigen may be present. below the detection threshold.

[00067] Inflammation of the liver: As used herein, the term "inflammation of the liver" or "hepatitis" refers to a physical condition in which the liver becomes swollen, dysfunctional, and/or painful, especially as a result of injury or infection, which may be caused by exposure to a hepatotoxic agent. Symptoms may include jaundice (yellowing of the skin or eyes), fatigue, weakness, nausea, vomiting, decreased appetite, and weight loss. Inflammation of the liver, if left untreated, can progress to fibrosis, cirrhosis, liver failure, or liver cancer.

[00068] Liver fibrosis: As used herein, the term "liver fibrosis" refers to excessive accumulation in the liver of extracellular matrix proteins, which may include collagens (I, III, and IV), fibronectin, andulin, elastin, laminin, hyaluronan, and proteoglycans resulting from inflammation and death of liver cells. Liver fibrosis, if left untreated, can develop into cirrhosis, liver failure, or liver cancer.

[00069] Loop/hairpin: As used herein, the term "loop" or "hairpin" refers to an unpaired region of a nucleic acid (e.g., an oligonucleotide) that is flanked by two antiparallel regions of a nucleic acid sufficiently complementary to each other that, under suitable hybridization conditions (e.g., in phosphate buffered cells) two anti-parallel regions flanking the unpaired region hybridized to form a duplex (called a "trunk").

[00070] Modified internucleotide bond: As used herein, the term "modified internucleotide bond" refers to an internucleotide bond having one or more chemical modifications compared to a standard internucleotide bond containing a phosphodiester bond. In some embodiments, the modified nucleotide contains a non-naturally occurring bond. Generally, the modified internucleotide linkage imparts one or more desirable properties to the nucleic acid having the modified internucleotide linkage. For example, a modified nucleotide can improve thermal stability, degradation resistance, nuclease resistance, modified solubility, bioavailability, bioactivity, reduced immunogenicity, and the like.

[00071] Modified nucleotide: As used herein, the term "modified nucleotide" refers to a nucleotide having one or more chemical modifications compared to the corresponding standard nucleotide selected from the list: adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, deoxyribonucleotide guanine, cytosine deoxyribonucleotide and thymidine deoxyribonucleotide. In some embodiments, the modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, the modified nucleotide has one or more chemical modifications in its sugar, nucleic and/or phosphate group. In some embodiments, the modified nucleotide has one or more chemical groups conjugated to the corresponding standard nucleotide. Typically, the modified nucleotide imparts one or more desirable properties to the nucleic acid in which the modified nucleotide is present. For example, the modified nucleotide can improve thermal stability, degradation resistance, nuclease resistance, bioavailability, bioactivity, solubility modification, reduced immunogenicity, and so on.

[00072] Nicked Tetraloop Structure: The "Nicked Tetraloop Structure" is an RNAi oligonucleotide structure characterized by having separate sense (delivered) and antisense (guide) strands in which the sense strand has a region of complementarity with the antisense strand, and in which at least one of the strands, typically the sense strand, has a tetra-loop configured to stabilize an adjacent region of the stem (duplex) formed within at least one of the strands.

[00073] Oligonucleotide: As used herein, the term "oligonucleotide" refers to a short nucleic acid, eg, less than 100 nucleotides in length. The oligonucleotide may be single stranded or double stranded. The oligonucleotide may or may not have duplex regions. As a non-limiting example, the oligonucleotide can be a small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), dicer substrate interfering RNA (dsiRNA), antisense oligonucleotide, short siRNA, or single-stranded siRNA, but not limited to those. In some embodiments, the double stranded oligonucleotide is an RNAi oligonucleotide.

[00074] Overhang: As used herein, the term "overhang" refers to the terminal mismatch nucleotide(s) resulting from one strand or region protruding beyond the end of the complementary strand with which that strand or region forms a duplex. In some embodiments, the overhang contains one or more unpaired nucleotides protruding from the duplex region at the 5' or 3' end of the double stranded oligonucleotide. In some embodiments, the overhang is the 3' or 5' overhang of the antisense or sense strand of the double stranded oligonucleotide.

[00075] Phosphate analog: As used herein, the term "phosphate analog" refers to a chemical moiety that mimics the electrostatic and/or steric properties of a phosphate group. In some embodiments, the phosphate analog is located at the 5' nucleotide position of the oligonucleotide instead of the 5' phosphate, often subject to enzymatic removal. In some embodiments, the 5'-phosphate analog has a phosphatase-resistant bond. Examples of phosphate analogs include 5'-phosphonates such as 5'-methylenephosphonate (5'-MP) and 5'-(E)-vinylphosphonate (5'-VP). In some embodiments, the oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar (referred to as a "4'-phosphate analog") at the 5'-terminal nucleotide. An example of a 4'-phosphate analog is hydroxymethylphosphonate, in which the oxygen atom of the hydroxymethyl group is bonded to a sugar moiety (eg, on its 4'-carbon) or an analog thereof. See, for example, U.S. Provisional Applications 62/383,207, filed September 2, 2016, and 62/393,401, filed September 12, 2016, the contents of each of which disclose phosphate analogs and are incorporated herein by reference. Other modifications have been developed for the 5' end of oligonucleotides (see, for example, WO 2011/133871; US Pat. No. 8,927,513; and Prakash et al. (2015) Nucleic Acids Res., 43 (6): 2993-3011, the content of each of which, related to phosphate analogs, and is included in the present description by reference).

[00076] Reduced expression: As used herein, the term "reduced expression" of a gene refers to a decrease in the amount of RNA transcript or protein encoded by a gene and/or a decrease in gene activity in a cell or subject compared to a corresponding control cell or subject. For example, treatment of a cell with a double-stranded oligonucleotide (e.g., having an antisense strand complementary to the HBsAg mRNA sequence) may result in a decrease in the amount of RNA transcript, protein, and/or enzymatic activity (e.g., products encoded by the S gene of the HBV genome) compared to the cell. , not treated with a double-stranded oligonucleotide. Similarly, "down/down-expression" as used herein refers to an action that results in reduced expression of a gene (eg, the S gene of the HBV genome).

[00076] Region of complementarity: As used herein, the term "region of complementarity" refers to a nucleic acid nucleotide sequence (e.g., a double-stranded oligonucleotide) that is sufficiently complementary to an antiparallel nucleotide sequence to allow hybridization between the two nucleotide sequences under appropriate hybridization conditions, for example, in phosphate buffer, in a cage, etc.

[00077] Ribonucleotide: As used herein, the term "ribonucleotide" refers to a nucleotide having a ribose instead of a pentose sugar containing a hydroxyl group at the 2' position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms at positions other than the 2' position, including modifications or substitutions and/or in the ribose and/or phosphate group and/or base.

[00078] RNAi oligonucleotide: As used herein, the term "RNAi oligonucleotide" refers to (a) a double-stranded oligonucleotide having a sense strand (delivered) and an antisense strand (guide/targeter) in which the antisense strand or part of the antisense strand is used by the Argonaute 2 endonuclease ( Ago2) to cleave the target mRNA, or (b) a single stranded oligonucleotide having a single antisense strand, where that antisense strand (or a portion of that antisense strand) is used by the Ago2 endonuclease to cleave the target mRNA.

[00079] Chain: As used herein, the term "chain" refers to a single continuous sequence of nucleotides linked together by internucleotide bonds (eg, phosphodiester bonds, phosphorothioate bonds). In some embodiments, the chain has two free ends, such as a 5' end and a 3' end.

[00080] Subject: As used herein, the term "subject" means any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or non-human primate. The terms "individual" or "patient" may be used interchangeably with the term "subject".

[00081] Synthetic: As used herein, the term "synthetic" refers to a nucleic acid or other molecule that has been artificially synthesized (e.g., using an apparatus (e.g., a solid phase nucleic acid synthesizer)) or a molecule that does not normally originate from a natural source (such as a cell or organism) that naturally produces a molecule.

[00082] Targeting ligand: As used herein, the term "targeting ligand" refers to a molecule (eg, carbohydrate, amino sugar, cholesterol, polypeptide, or lipid) that selectively binds to a cognate molecule (eg, receptor) in the tissue or cell of interest, and which can be conjugated to another substance in order to target the other substance to the tissue or cell of interest. For example, in some embodiments, a targeting ligand may be conjugated to an oligonucleotide to target the oligonucleotide to a particular tissue or cell of interest. In some embodiments, the targeting ligand selectively binds to a cell surface receptor. Accordingly, in some embodiments, the targeting ligand, when conjugated to an oligonucleotide, facilitates delivery of the oligonucleotide to a particular cell by selectively binding to a receptor expressed on the cell surface and endosomal internalization by the cell of a complex containing the oligonucleotide, targeting ligand and receptor. In some embodiments, the targeting ligand is conjugated to the oligonucleotide via a linker that is cleaved after or during cellular internalization such that the oligonucleotide is released from the targeting ligand within the cell itself.

[00083] Tetra-loop: As used herein, the term "tetra-loop" refers to a loop that enhances the stability of an adjacent duplex formed by hybridization of flanking nucleotide sequences. An increase in stability is defined as an increase in the melting temperature (Tm) of the adjacent duplex stem that is higher than the expected Tm of the adjacent duplex stem when there are loops of comparable length, consisting of randomly selected nucleotide sequences. For example, a tetra loop can provide a melting point of at least 50°C, at least 55°C, at least 56°C, at least 58°C, at least 60°C, at least 65°C or at least 75° C. in 10 mM NaHPO ₄ for a hairpin containing a duplex of at least 2 bp in length. In some embodiments, the tetra-loop can stabilize a base pair in the adjacent duplex stem via stacking interactions (non-covalent aromatic interactions). In addition, interactions between nucleotides in the tetra-loop include, but are not limited to, Watson-Crick base pairing, stacking interactions, hydrogen bonds, and contact interactions (Cheong et al., Nature 1990 Aug. 16; 346 (6285) : 680 -2; Heus and Pardi, Science 1991 Jul. 12; 253 (5016): 191-4). In some embodiments, the implementation of the tetra-loop contains from 4 to 5 nucleotides. In some embodiments, the tetra-loop contains or consists of three, four, five, or six nucleotides, which may or may not be modified (eg, which may or may not be conjugated to a targeting moiety). In one embodiment, the tetra-loop consists of four nucleotides. Any nucleotide can be used in the tetra-loop, and standard IUPAC-IUB symbols for such nucleotides are chosen as described in Cornish-Bowden (1985) Nucl. Acids Res. 13:3021-3030. For example, the letter "N" can be used to indicate that any base can be in this position, the letter "R" can be used to indicate that A (adenine) or G (guanine) can be in this position, and "B" can be used to indicate that C (cytosine), G (guanine) or T (thymine) can be in this position. Examples of tetra loops include tetra loops of the UNCG family (eg UUCG), tetra loops of the GNRA family (eg GAAA), and tetra loops of the CUUG family (Woese et al., Proc Natl Acad Sci USA. 1990 November; 87(21 ):8467-71; Antao et al., Nucleic Acids Res. 1991 Nov. 11; 19(21):5901-5). Examples of DNA tetra-loops include the d(GNNA) tetra-loop family (e.g., d (GTTA)), the d tetra-loop family (GNRA), the d(GNAB) tetra-loop family, the d(CNNG) tetra-loop family, and the family of tetra-loops d(TNCG) (for example, d(TTCG)). See, for example, Nakano et al. Biochemistry, 41 (48), 14281-14292, 2002. SHINJI et al. Nippon Kagakkai Koen Yokoshu. Vol. ^78th ; NO. 2; PAGE. 731 (2000), which are incorporated here by reference for their respective disclosures. In some embodiments, the tetra loop is contained in a "nicked tetraloop structure" structure.

[00084] Treatment: As used herein, the term "treat" refers to the act of providing assistance to a subject in need, for example, by administering a therapeutic agent (e.g., an oligonucleotide) to a subject in order to improve the subject's health and/or quality of life in relation to an existing condition ( for example, with an existing HBV infection) or to prevent or reduce the likelihood of an undesirable condition (for example, to prevent liver fibrosis, hepatitis, liver cancer, or other condition associated with HBV infection). In some embodiments, treatment includes reducing the frequency or severity of at least one sign, symptom, or concomitant condition (eg, HBV infection or related condition) experienced by the subject. During HBV infection, the subject may experience symptoms such as yellowing of the skin and eyes (jaundice), dark urine, extreme fatigue, nausea, vomiting, and abdominal pain. Accordingly, in some embodiments, the implementation of the treatment disclosed in the present invention may lead to a reduction in the frequency or severity of one or more of these symptoms. However, an HBV infection can develop into one or more liver diseases such as cirrhosis, liver fibrosis, inflammation of the liver, or liver cancer. Accordingly, in some embodiments, the implementation of the treatment disclosed in the present invention may lead to a reduction in the frequency or severity or prevention or amelioration of one or more of these conditions.

II. Oligonucleotide Inhibitors

i. HBV surface antigen targeting

[00085] In some embodiments, the present invention provides oligonucleotide-based HBV surface antigen expression inhibitors that can be used to achieve a therapeutic effect. As a result of studying HBV surface antigen mRNA and testing various oligonucleotides, highly effective oligonucleotides have been developed to reduce the expression of HBV surface antigen (HBsAg) for the treatment of HBV infection. The oligonucleotides provided herein, in some embodiments, are designed to target HBsAg mRNA sequences present in >95% of known HBV genomes across all known genotypes. In some embodiments, such oligonucleotides result in a decrease in HBV pregenomic RNA (pgRNA) and HBsAg mRNA in the liver of greater than 90%. In some embodiments, the reduction in HBsAg expression persists for an extended period of time after a single dose or completion of a treatment regimen.

[00086] Accordingly, in some embodiments, the oligonucleotides provided herein are designed to have regions of complementarity with HBsAg mRNA to target HBsAg transcripts in cells and inhibit their expression. The region of complementarity is usually of a suitable length and base selection such that the oligonucleotide (or chain thereof) is annealed to the HBsAg mRNA to inhibit its expression. In some embodiments, the complementarity region is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least at least 20 nucleotides in length. In some embodiments, the oligonucleotide provided herein has an HBsAg mRNA complementarity region ranging from 12 to 30 (e.g., 12 to 30, 12 to 22, 15 to 25, 17 to 21, 18 to 27, 19 up to 27 or 15-30) nucleotides in length. In some embodiments, the oligonucleotide provided herein has an HBsAg mRNA complementarity region that has 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[00087] In some embodiments, the oligonucleotides provided herein are designed to target mRNA sequences encoding HBsAg. For example, in some embodiments, an oligonucleotide is provided having an antisense strand containing a sequence complementarity region such as: ACAANAAUCCUCACAAUA (SEQ ID NO: 1), where N refers to any nucleotide (A, G, T, or C). In some embodiments, the oligonucleotide further comprises a sense strand that forms a duplex region with the antisense strand. In some embodiments, the implementation of the sense strand contains a region of complementarity of the sequence, designated as: UUNUUGUGAGGAUUN (SEQ ID NO: 2). In some embodiments, the sense strand contains a region of sequence complementarity such as (shown 5' to 3'): UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 3).

[00088] In some embodiments, the implementation of the antisense strand contains or consists of a sequence such as: UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 4). In some embodiments, the antisense strand contains or consists of the sequence designated as: UUAUUGUGAGGAUUCUUGUCGG (SEQ ID NO: 5). In some embodiments, the antisense strand contains or consists of a sequence such as: UUAUUGUGAGGAUUUUUGUGU CGG (SEQ ID NO: 5.1). In some embodiments, the implementation of the sense strand includes or consists of the sequence indicated as: ACAANAAUCCUCACAAUAA (SEQ ID NO: 6). In some embodiments, the sense strand contains or consists of the sequence represented as: GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 7). In some embodiments, the sense strand contains or consists of a sequence such as: GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8). In some embodiments, the sense strand contains or consists of a sequence such as: GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8.1).

[00089] In some embodiments, the implementation of the oligonucleotide to reduce the expression of HBsAg mRNA contains a sense strand forming a duplex region with an antisense strand, where the sense strand contains the sequence specified in any of SEQ ID NO: 6-8.1, and the antisense strand contains the sequence specified in any of SEQ ID NO: 4-5.1. In some embodiments, the sense strand contains 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate internucleotide bond. In some embodiments, the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) group. In some embodiments, the antisense strand contains 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate internucleotide bond. In some embodiments, the 4' sugar carbon of the 5' nucleotide of the antisense strand contains a phosphate analog. In some embodiments, each of the antisense and sense strands contains 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate internucleotide bond, wherein the 4'-sugar carbon of the 5'-nucleotide of the antisense strand contains a phosphate analog , and the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) group.

[00090] In some embodiments, the sense strand containing the sequence set forth in any of SEQ ID NOs: 7-8.1 contains 2'-fluoro-modified nucleotides at positions 3, 8-10, 12, 13, and 17. In some embodiments, the sense strand the chain contains 2'-O-methyl-modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36. In some embodiments, the sense strand contains a single phosphorothioate internucleotide bond. In some embodiments, the sense strand contains a phosphorothioate internucleotide bond between the nucleotides at positions 1 and 2. In some embodiments, the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) group.

[00091] In some embodiments, the implementation of the antisense strand containing the sequence specified in any of SEQ ID NO: 4-5.1 contains 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19. In some embodiments, the antisense strand contains 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22. In some embodiments, the antisense strand contains three phosphorothioate internucleotide bonds. In some embodiments, the antisense strand contains phosphorothioate internucleotide bonds between nucleotides at positions 1 and 2, between nucleotides at positions 2 and 3, between nucleotides at positions 3 and 4, between nucleotides at positions 20 and 21, and between nucleotides at positions 21 and 22. In some embodiments, the 4' sugar carbon of the 5' nucleotide of the antisense strand contains a phosphate analog.

II. Double-stranded oligonucleotides

[00092] There are many oligonucleotide structures that are advantageous for targeting HBsAg mRNA expression in the methods of the present invention, including RNAi, antisense, miRNA, etc. Any of the structures described in the present invention or elsewhere can be used as a basis for incorporating or targeting the sequences described in the present invention. Double-stranded oligonucleotides for targeting HBV antigen expression (eg, by RNAi methods) typically have the sense strand and antisense strand duplexed with each other. In some embodiments, the sense and antisense strands are not covalently linked. However, in some embodiments, the sense and antisense strands are covalently linked.

[00093] In some embodiments, the implementation of double-stranded oligonucleotides to reduce the expression of HBsAg mRNA are involved in the process of RNA interference (RNAi). For example, RNAi oligonucleotides have been designed such that each strand is 19-25 nucleotides in size and has at least one 3' overhang of 1 to 5 nucleotides (see, for example, US Pat. No. 8,372,998). Longer oligonucleotides have also been developed that are processed by the Dicer enzyme to produce active RNAi products (see, for example, US Pat. No. 8,883,996). Further work has yielded extended double-stranded oligonucleotides in which at least one end of at least one strand extends beyond the duplex of the targeting region, including structures in which one of the strands contains a thermodynamically stabilizing tetra-loop structure (see, for example, US Pat. elongation.

[00094] In some embodiments, the implementation of the oligonucleotides presented in the present invention, are cleaved by Dicer enzymes. Such oligonucleotides may have an overhang (eg, 1, 2, or 3 nucleotides in length) at the 3' end of the sense strand. Such oligonucleotides (eg, siRNAs) may contain a 21 nucleotide guide strand that is antisense to the target RNA and a complementary strand (deliverable strand) where both strands anneal to form a 19 bp duplex. and overhangs 2 nucleotides long at one or both of the 3' ends. Longer oligonucleotide constructs are also available, including oligonucleotides having a guide strand of 23 nucleotides and a deliverable strand of 21 nucleotides, where there is a blunt end on the right side of the molecule (3'-end of the delivered strand/5'-end of the guide strand) and 3'- a two nucleotide overhang on the left side of the molecule (5'-end of the delivered strand/3'-end of the guide strand). These molecules have a duplex region of 21 base pairs. See, for example, US 9012138, US 9012621 and US 9193753, each of which is incorporated herein by reference to the subject matter of their respective disclosures.

[00095] In some embodiments, the implementation of the oligonucleotides disclosed in the present invention may contain sense and antisense strands, the length of which is in the range from 17 to 26 (for example, from 17 to 26, from 20 to 25, from 19 to 21 or 21- 23) nucleotides. In some embodiments, the sense and antisense strands are the same length. In some embodiments, oligonucleotides having sense and antisense strands that are 21-23 nucleotides in length have a 3' overhang on the sense, antisense, or both sense and antisense strands of 1 or 2 nucleotides in length. In some embodiments, the oligonucleotide has a guide strand of 23 nucleotides and a deliverable strand of 21 nucleotides, and has a blunt end on the right side of the molecule (3'-end of the delivered strand/5' end of the guide strand) and a two-nucleotide 3'-end of the guide strand on left side of the molecule (5'-end of the delivered strand/3'-end of the guide strand). These molecules have a duplex region consisting of 21 base pairs. In some embodiments, the oligonucleotide contains a 25 nucleotide sense strand and a 27 nucleotide antisense strand which, when acted upon by the Deitzer enzyme, results in the incorporation of the antisense strand into a mature RISC.

[00096] Other oligonucleotide constructs for use in the compositions and methods disclosed in the present invention include: 16-mer siRNAs (see, for example, Nucleic Acids in Chemistry and Biology. Blackburn (ed.), Royal Society of Chemistry, 2006) , shRNAs (e.g. having 19 bp or shorter stems, see e.g. Moore et al. Methods Mol. Biol. 2010; 629: 141-158), "blunt" siRNAs (e.g. 19 bp long) n.; see: e.g., Kraynack and Baker, RNA Vol. 12, p163-176 (2006)), asymmetric siRNAs (aiRNA; see, e.g., Sun et al., Nat. Biotechnol. 26, 1379-1382 ( 2008)), asymmetric short-duplex siRNAs (see e.g. Chang et al., Mol Ther. 2009 Apr; 17 (4): 725-32), forked siRNAs (e.g. Hohjoh, FEBS Letters, Vol 557, issues 1-3; Jan 2004, p 193-198), single-stranded siRNAs (Elsner; Nature Biotechnology 30, 1063 (2012)), dumbbell-shaped circular siRNAs (see e.g. Abe et al. J Am Chem Soc.129:15108-15109 (2007)) and small internally segmented int surfer RNA (sisiRNA; see, for example, Bramsen et al., Nucleic Acids Res. 2007 Sep; 35 (17): 5 886-5897). Each of the aforementioned publications is incorporated herein in its entirety by reference to the subject matter of their respective disclosures. Other non-limiting examples of oligonucleotide structures that can be used in some embodiments of the invention to reduce or inhibit HBsAg expression are microRNA (miRNA), short hairpin RNA (shRNA), and short siRNA (see, for example, Hamilton et al., Embo J., 2002, 21 (17): 4671-4679, see also US Patent Application No. 20090099115).

a. Antisense strands

[00097] In some embodiments, the antisense strand of an oligonucleotide may be referred to as a "guide or target strand". For example, if an antisense strand is capable of interacting with an RNA-induced silencing complex (RISC) and binding to the Argonaut protein, or involving or binding to one or more similar factors and causing silencing of the target gene, then it can be defined as guide chain. In some embodiments, the sense strand complementary to the guide strand may be referred to as the "passenger" or delivered strand.

[00098] In some embodiments, the implementation of the oligonucleotide provided in the present invention contains an antisense strand up to 50 nucleotides in length (for example, up to 30, up to 27, up to 25, up to 21, or up to 19 nucleotides in length). In some embodiments, an oligonucleotide provided by the present invention contains an antisense strand that is at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25 or at least 27 nucleotides in length). In some embodiments, the antisense strand of an oligonucleotide disclosed in the present invention is in the range of 12 to 50 or 12 to 30 (e.g., 12 to 30, 11 to 27, 11-25, 15-21, 15-27, 17-21, 17-25, 19-27 or 19-30) nucleotides in length. In some embodiments, the antisense strand of any of the oligonucleotides disclosed in the present invention is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length.

[00099] In some embodiments, the antisense strand contains a region of sequence complementarity such as (5'-3' shown): AATCCTCACA (SEQ ID NO: 9). In some embodiments, the antisense strand contains a sequence such as (shown 5' to 3'): UGUGAGGAUU (SEQ ID NO: 10). In some embodiments, the antisense strand contains a sequence such as (shown 5' to 3'): TGTGAGGATT (SEQ ID NO: 11).

[000100] In some embodiments, an oligonucleotide for reducing HBsAg mRNA expression may comprise an antisense strand having a region of sequence complementarity such as indicated in SEQ ID NO: 9 and one or two non-complementary nucleotides at its 3' end. In some embodiments, the implementation of the antisense strand contains the nucleotide sequence represented by any of SEQ ID NO: 4-5.1.

[000101] In some embodiments, the implementation of the oligonucleotide to reduce the expression of HBsAg mRNA may contain an antisense strand having a region of complementarity of the sequence indicated in SEQ ID NO: 9, where the antisense strand does not have the sequence indicated in any of the following paragraphs (shown from 5' to 3'): TATTGTGAGGATTCTTGTCA (SEQ ID NO: 12); CGGTATTGTGAGGATTCTTG (SEQ ID NO: 13); TGTGAGGATTCTTGTCAACA (SEQ ID NO: 14); UAUUGUGAGGAUUUUUGUCAA (SEQ ID NO: 15); UGCGGUAUUGUGAGGAUUCTT (SEQ ID NO: 16); ACAGCATTGTGAGGATTCTTGTC (SEQ ID NO: 17); UAUUGUGAGGAUUUUUGUCAACA (SEQ ID NO: 18); AUUGUGAGGAUUUUUGUCAACAA (SEQ ID NO: 19); and UUGUGAGGAUUUUUGUCAACAAG (SEQ ID NO: 20). In some embodiments, the antisense strand differs from the nucleotide sequence shown in SEQ ID NO: 4, 5, or 5.1 by no more than three nucleotides.

b. Semantic chains

[000102] In some embodiments, a double-stranded oligonucleotide can have a sense strand up to 40 nucleotides in length (e.g., up to 40, up to 35, up to 30, up to 27, up to 25, up to 21 to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, the oligonucleotide may have a sense strand of at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length). In some embodiments, the oligonucleotide may have a sense strand in the range of 12 to 50 nucleotides in length (e.g., 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 21, 17 to 25, 19 to 27, 19 to 30, to 20 to 40, 22 to 40, 25 to 40, or 32 to 40) . In some embodiments, the oligonucleotide may have a sense strand of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 , 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length. In some embodiments, the sense strand of the oligonucleotide is longer than 27 nucleotides (eg, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides). In some embodiments, the sense strand of the oligonucleotide is longer than 25 nucleotides (eg, 26, 27, 28, 29, or 30 nucleotides).

[000103] In some embodiments, the sense strand contains a stem loop at its 3' end. In some embodiments, the sense strand contains a stem loop at its 5' end. In some embodiments, the length of the chain containing the stem loop is 2 to 66 nucleotides in length (e.g., 2 to 66, 10 to 52, 14 to 40, 2 to 30, 4 to 26, 8 to 22, 12 to 18, 10 to 22, 14 to 26, or 14 to 30 nucleotides long). In some embodiments, the chain containing the stem loop is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29 or 30 nucleotides in length. In some embodiments, the implementation of the stem contains a duplex length of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 nucleotides. In some embodiments, the stem loop provides the molecule with increased protection from degradation (eg, enzymatic degradation) and improves targeting capabilities upon delivery to the target cell. For example, in some embodiments, the loop carries added nucleotides that can be modified without significantly affecting the activity of the oligonucleotide to inhibit gene expression. In some embodiments, the present invention provides an oligonucleotide wherein the sense strand includes (e.g., at its 3' end) a stem loop designated as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a loop between S1 and S2 up to 10 nucleotides long (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides long).

[000104] In some embodiments, the hinge (L) of the stem hinge itself is a tetra-loop (eg, in a split tetra-loop structure). The tetra loop may contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Typically, a tetra loop has 4 to 5 nucleotides.

With. duplex length

[000105] In some embodiments, the duplex formed by the sense and antisense strands is at least 12 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 or at least 21) nucleotides in length. In some embodiments, the duplex formed by the sense and antisense strands is 12 to 30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length). In some embodiments, the duplex formed by the sense and antisense strands is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the duplex formed by the sense and antisense strands does not span the entire length of the sense strand and/or antisense strand. In some embodiments, the sense and antisense strand duplex spans the entire length of either the sense or antisense strands. In some embodiments, the duplex between the sense and antisense strands spans the entire length of both the sense strand and the antisense strand.

d. Oligonucleotide ends

[000106] In some embodiments, the oligonucleotide contains sense and antisense strands such that there is a 3' overhang with respect to either the sense strand or the antisense strand, or both the sense and antisense strands. In some embodiments, the implementation of the oligonucleotides provided in the present invention, have one 5'-end, which is thermodynamically less stable compared to the other 5'-end. In some embodiments, an asymmetric oligonucleotide is provided that contains a blunt end at the 3' end of the sense strand and a ridge at the 3' end of the antisense strand. In some embodiments, the 3' overhang of the antisense strand is 1-8 nucleotides in length (eg, 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length).

[000107] Typically, an RNAi oligonucleotide has a two-nucleotide overhang at the 3' end of the antisense (guide) strand. However, other projections are also possible. In some embodiments, the overhang is a 3' overhang of one to six nucleotides in length, optionally one to five, one to four, one to three, one to two, two to six, two to five, two up to four, two to three, three to six, three to five, three to four, four to six, four to five, five to six nucleotides, or one, two, three, four, five, or six nucleotides. However, in some embodiments, the overhang is a 5' overhang, one to six nucleotides in length, optionally one to five, one to four, one to three, one to two, two to six, two up to five, two to four, two to three, three to six, three to five, three to four, four to six, four to five, five to six nucleotides or is one, two, three , four, five or six nucleotides in length.

[000108] In some embodiments, one or more (eg, 2, 3, 4) terminal nucleotides of the 3' end or 5' end of the sense and/or antisense strand are modified. For example, in some embodiments, one or two terminal nucleotides of the 3' end of the antisense strand are modified. In some embodiments, the last nucleotide at the 3' end of the antisense strand is modified, eg, contains a 2' modification, eg, 2'-O-methoxyethyl. In some embodiments, the last one or two terminal nucleotides at the 3' end of the antisense strand are complementary to the target. In some embodiments, the last one or two nucleotides at the 3' end of the antisense strand are not complementary to the target.

[000109] In some embodiments, a double-stranded oligonucleotide is provided that contains a tetra-loop structure with a break at the 3' end of the sense strand and two terminal overhangs at the 3' end of the antisense strand thereof. In some embodiments, the two terminal overhangs are GG. Typically, one or both of the two terminal GG nucleotides of the antisense strand are not complementary to the target.

[000110] In some embodiments, the 5' end and/or 3' end of the sense or antisense strand has an inverted "cap" nucleotide.

[000111] In some embodiments, one or more (e.g., 2, 3, 4, 5, 6) modified internucleotide bonds are provided between the terminal nucleotides of the 3' or 5' end of the sense and/or antisense strand. In some embodiments, modified internucleotide bonds are provided between overhang nucleotides at the 3' end or 5' end of the sense and/or antisense strand.

e. Mismatches (or unpaired nucleotides)

[000112] In some embodiments, the oligonucleotide may have one or more (eg, 1, 2, 3, 4, 5) mismatches between sense and antisense strands. If there is more than one mismatch between the sense and antisense strands, then they may be sequential (eg 2, 3 or more in a row) or scattered throughout the complementarity region. In some embodiments, the 3' end of the sense strand contains one or more mismatches. In one embodiment, two mismatches are included at the 3' end of the sense strand. In some embodiments, base mismatch or destabilization of segments at the 3' end of the sense strand of the oligonucleotide increased the potential of synthetic duplexes at RNAi, possibly by facilitating processing with the Dicer enzyme.

[000113] In some embodiments, the antisense strand may have an HBsAg transcript complementary region that contains one or more mismatches compared to the corresponding transcript sequence. The complementarity region of an oligonucleotide can be up to 1, up to 2, up to 3, up to 4, up to 5, and so on. mismatches provided that it retains the ability to form complementary base pairs with the transcript under appropriate hybridization conditions. Alternatively, an oligonucleotide complementarity region may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches, provided that it retains the ability to form complementary base pairs with HBsAg mRNA under appropriate hybridization conditions. In some embodiments, if there is more than one mismatch in a complementarity region, then they may be arranged sequentially (e.g., 2, 3, 4, or more in a row) or scattered throughout the complementarity region, provided that the oligonucleotide retains the ability to form complementary base pairs. with HBsAg mRNA under appropriate hybridization conditions.

III. Single strand oligonucleotides

[000114] In some embodiments, the implementation of the oligonucleotide to reduce the expression of HBsAg, as described here, is a single-stranded oligonucleotide complementary to HBsAg mRNA. Such structures may include, but are not limited to, single stranded RNAi oligonucleotides. Recent studies have demonstrated the activity of single-stranded RNAi oligonucleotides (see, for example, Matsui et al. (May 2016), Molecular Therapy, Vol. 24 (5), 946-955). However, in some embodiments, the oligonucleotides provided herein are antisense oligonucleotides (ASOs). An antisense oligonucleotide is a single-stranded oligonucleotide having a nucleobase sequence that, when written in the 5' to 3' direction, contains the reverse complement of the target segment of the particular nucleic acid and is suitably modified (e.g., as a gapmer) to induce RNase H-mediated RNA cleavage. -targets in cells or is modified (eg, as a mixer) to inhibit translation of the target mRNA in cells. Antisense oligonucleotides for use herein may be modified by any suitable method known in the art, including, for example, as described in US Pat. length, sugar fragments of nucleic bases (pyrimidine, purine) and modifications of the heterocyclic part of nucleotide bases). In addition, it is known that antisense molecules have been used for decades to reduce the expression of specific target genes (see, e.g., Bennett et al., Pharmacology of Antisense Drugs, Annual Review of Pharmacology and Toxicology, Vol. 57: 81-105) .

iv. Oligonucleotide Modifications

[000115] Oligonucleotides can be modified in various ways to improve or control specificity, stability, delivery, bioavailability, resistance to nuclease degradation, immunogenicity, base pairing, RNA distribution and cellular uptake, and other properties of relevance to therapeutic or research applications. See, for example, Bramsen et al., Nucleic Acids Res., 2009, 37, 2867-2881; Bramsen and Kjems (Frontiers in Genetics, 3 (2012): 1-22). Accordingly, in some embodiments, the implementation of the oligonucleotides of the present invention may include one or more suitable modifications. In some embodiments, the modified nucleotide carries a modification at its base (nucleotide base), sugar (eg, ribose, deoxyribose), or phosphate group.

[000116] The number of modifications to an oligonucleotide and the positions of those nucleotide modifications can affect the properties of the oligonucleotide itself. For example, oligonucleotides can be delivered in vivo by conjugation or incorporation into a lipid nanoparticle (LNP) or similar carrier. However, if the oligonucleotide is protected by an LNP or similar carrier, it may be advantageous for at least some of its nucleotides to be modified. Accordingly, in some embodiments of any of the oligonucleotides provided herein, all or substantially all of the nucleotides of the oligonucleotide are modified. In some embodiments, more than half of the nucleotides are modified. In some embodiments, less than half of the nucleotides are modified. As a rule, when delivered in the "naked" way, each sugar is modified in the 2'-position. These modifications may be reversible or irreversible. In some embodiments, the oligonucleotide disclosed in the present invention has the number and type of nucleotide modifications that are sufficient to provide the desired characteristic (e.g., protection from enzymatic degradation, ability to target the desired cell after in vivo administration, and/or thermodynamic stability).

a. Sugar modifications

[000117] In some embodiments, the modified sugar (also referred to herein as a sugar analog) includes a modified deoxyribose or ribose moiety, for example, in which one or more modifications occur at the 2', 3', 4', and/or 5' carbon positions Sahara. In some embodiments, the modified sugar may also include non-natural alternative carbon structures, such as those present in "locked" nucleic acids ("LNAs") (see, for example, Koshkin et al. (1998), Tetrahedron 54, 3607-3630), in unblocked nucleic acids ("UNA") (see e.g. Snead et al. (2013), Molecular Therapy - Nucleic Acids, 2, e103) and in bridged nucleic acids ("BNA")) (Imanishi and Obika (2002 ), The Royal Society of Chemistry, Chem. Commun., 1653-1659). Koshkin et al., Snead et al.). These publications are incorporated herein by reference with respect to disclosures regarding sugar modifications.

[000118] In some embodiments, the nucleotide modification of the sugar includes a 2' modification. The 2' modification may be 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. Typically, the modification is 2'-fluoro, 2'-O-methyl, or 2'-O-methoxyethyl. In some embodiments, the sugar modification includes a sugar ring modification, which may include a modification of one or more carbon atoms of the sugar ring. For example, the sugar modification of a nucleotide can be the 2'-oxygen of the sugar directly bonded to the 1'-carbon or 4'-carbon of the sugar, or the 2'-oxygen bonded to the 1'-carbon or 4'-carbon through an ethylene or methylene bridge. . In some embodiments, the modified nucleotide has an acyclic sugar that lacks a 2'-carbon-3'-carbon bond. In some embodiments, the modified nucleotide contains a thiol group, for example, at the 4' position of the sugar.

[000119] In some embodiments, the terminal 3' end group (e.g., 3'-hydroxyl) is a phosphate group or other group that can be used, for example, to attach linkers, adapters, or tags, or to directly ligate an oligonucleotide to another nucleic acid. acid.

b. 5'-terminal phosphates

[000120] In some embodiments, the 5' phosphate groups of the oligonucleotides enhance interaction with Argonaut 2. However, oligonucleotides containing a 5' phosphate group may be susceptible to degradation by phosphatases or other enzymes that can limit their bioavailability in vivo. In some embodiments, the implementation of the oligonucleotides include analogues of 5'-phosphates that are resistant to such degradation. In some embodiments, the phosphate analog may be hydroxymethyl phosphonate, vinyl phosphonate, or malonyl phosphonate. In some embodiments, the 5' end of the oligonucleotide strand is attached to a chemical moiety capable of mimicking the electrostatic and steric properties of the natural 5'-phosphate group ("phosphate mimic") (see, for example, Prakash et al. (2015) ), Nucleic Acids Res., Nucleic Acids Res. 2015 Mar 31; 43 (6): 2993-3011, the content of which describes phosphate analogs, and which is incorporated herein by reference). A variety of phosphate mimics have been developed that can be attached to the 5' end (see, for example, US Patent No. 8,927,513, contents describe phosphate analogs, the publication is incorporated herein by reference). Other modifications have been developed for the 5'-end of the oligonucleotides (see, for example, WO 2011/133871, the content of which describes phosphate analogues, the publication is incorporated herein by reference). In some embodiments, a hydroxyl group is attached to the 5' end of the oligonucleotide.

[000121] In some embodiments, the implementation of the oligonucleotide contains a phosphate analog at the 4'-carbon position of the sugar (referred to as "4'-phosphate analog"). See, for example, U.S. Provisional Application No. 62/383,207 entitled "4'-Phosphate Analogs and Oligonucleotides Containing The Same", filed September 2, 2016, and No. 62/393,401 filed September 12, 2016, "4' -phosphate analogs and oligonucleotides containing the same", the content of each of which, relating to phosphate analogs, is incorporated herein by reference. In some embodiments, the implementation of the oligonucleotide provided in the present invention contains a 4'-phosphate analogue at the 5'-terminal nucleotide. In some embodiments, the phosphate analog is a hydroxymethylphosphonate in which the oxygen atom of the hydroxymethyl group is bonded to a sugar moiety (eg, its 4' carbon) or an analog thereof. In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or aminomethylphosphonate in which the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is bonded to the 4'-carbon of the sugar moiety or an analog thereof. In some embodiments, the 4'-phosphate analog is hydroxymethylphosphonate. In some embodiments, the hydroxymethyl phosphonate is represented by the formula -O-CH ₂ -PO(OH) ₂ or -O-CH ₂ -PO(OR) ₂ wherein R is independently selected from H, CH ₃ , alkyl, CH ₂ CH ₂ CN , CH ₂ OCOC(CH ₃ ) ₃ , CH ₂ OCH ₂ CH ₂ Si(CH ₃ ) ₃ , or a protective group. In some embodiments, the alkyl group is CH ₂ CH ₃ . In most cases, R is independently selected from H, CH ₃ , or CH ₂ CH ₃ .

[000122] In some embodiments, the phosphate analog attached to the oligonucleotide is methoxyphosphonate (MOP). In specific embodiments, the phosphate analog attached to the oligonucleotide is a 5'-mono-methyl-protected MOP. In some embodiments, the following uridine nucleotide containing a phosphate analog may be used, for example, in the first position of the guide (antisense) strand:

where the modified nucleotide is either [MePhosphonate-4O-mU] or 5'-methoxy, phosphonate-4'oxy-2'-O-methyluridine.

With. Modified internucleoside bonds

[000123] In some embodiments, phosphate modifications or substitutions can result in an oligonucleotide that contains at least one (e.g., at least 1, at least 2, at least 3, or at least 5) modified internucleotide linkage. In some embodiments, any of the oligonucleotides disclosed herein may contain 1 to 10 (e.g., 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3 or 1 to 2) modified internucleotide bonds. In some embodiments, any of the oligonucleotides disclosed in the present invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide bonds.

[000124] The modified internucleotide bond may be a phosphorothioate bond, a phosphotriester bond, a thionoalkylphosphonate bond, a thionoalkylphosphotriester bond, a phosphoramidite bond, a phosphonate bond, or a boranophosphate bond. In some embodiments, at least one modified internucleotide bond of any of the oligonucleotides described herein is a phosphorothioate bond.

d. Base modifications

[000125] In some embodiments, the implementation of the oligonucleotides provided in the present invention, have one or more modified nucleic bases. In some embodiments, modified nucleobases (also referred to herein as base analogs) are linked at the 1' position of the nucleotide sugar. In some embodiments, the modified nucleobase is a nitrogenous base. In some embodiments, the modified nucleobase does not contain a nitrogen atom. See, for example, US Patent Application Publication No. 20080274462. In some embodiments, the modified nucleotide contains a universal base. In addition, in some embodiments, the implementation of the modified nucleotide does not contain a nitrogenous base (is abasic).

[000126] In some embodiments, the universal base is a heterocyclic moiety located at the 1' position of the nucleotide sugar moiety in the modified nucleotide, or occupies an equivalent position in the substituted sugar moiety of the nucleotide, which, if present in a duplex, may be located opposite more than one base type without a significant change in the structure of the duplex. In some embodiments, when compared to a standard single-stranded nucleic acid (e.g., an oligonucleotide) that is fully complementary to the target nucleic acid, the single-stranded nucleic acid containing the universal base forms a duplex with the target nucleic acid, and the duplex has a lower Tm than the duplex formed by a complementary nucleic acid. However, in some embodiments, compared to a standard single-stranded nucleic acid in which the universal base has been substituted with a base to generate a single mismatch, the single-stranded nucleic acid containing the universal base forms a duplex with the target nucleic acid having a higher Tm than the duplex formed by the nucleic acid. an acid containing a mismatch base.

[000127] Non-limiting examples of universally binding nucleotides include inosine, 1-β-D-ribofuranosyl-5-nitroindole, and/or 1-β-D-ribofuranosyl-3-nitropyrrole (U.S. Patent Appl. Publ. No. 20070254362, Quay et Loakes et al., 3-Nitropyrrole and 5-nitroindole as Loakes and Brown, 5-Nitroindole as an universal base analogue Nucleic Acids Res. 1994 Oct 11;22( 20):4039-43 Each of the above publications is incorporated herein by reference with respect to the disclosure relating to base modifications).

e. Reversible modifications

[000128] While certain modifications may be made to protect the oligonucleotide from in vivo exposure to allow delivery to target cells, they may reduce the efficacy or activity of the oligonucleotide once it enters the cytosol of the target cell. Reversible modifications can be made such that the molecule retains desirable properties outside the cell, but these modifications are removed when the molecule enters the cytosol of the cell. A reversible modification can be removed, for example, under the action of an intracellular enzyme or under appropriate chemical conditions inside the cell (for example, by reduction with intracellular glutathione).

[000129] In some embodiments, the reversibly modified nucleotide contains a glutathione sensitive group. Typically, nucleic acid molecules are chemically modified with cyclic disulfide moieties to mask the negative charge created by internucleotide diphosphate bonds to improve cellular uptake and enhance nuclease resistance. See U.S. Patent Application Publication No. 2011/0294869, originally filed by Traversa Therapeutics, Inc. (“Traversa”), PCT Publication No. WO 2015/188197 Solstice Biologics, Ltd. (“Solstice”), Meade et al., Nature Biotechnology, 2014,32:1256-1263 (“Meade”), PCT Publication No. WO 2014/088920 Merck Sharp & Dohme Corp, each of which is incorporated herein by reference in scope of such modifications. Such a reversible modification of internucleotide diphosphate bonds is intended for intracellular cleavage by the cytosol reducing medium (for example, glutathione). Previously known examples include the neutralization of phosphotriester modifications that have been reported to be cleaved within cells (Dellinger et al. J. Am. Chem. Soc. 2003, 125: 940-950).

[000130] In some embodiments, such a reversible modification provides protection during in vivo administration (e.g., while passing through the blood and/or lysosomal/endosomal cell compartments) where the oligonucleotide is exposed to nucleases and other adverse environmental conditions (e.g., pH) . When released into the cytosol of a cell that has a higher level of glutathione compared to the extracellular space, the modification is removed (exposed), resulting in a cleaved oligonucleotide. By applying reversible modifications using glutathione sensitive moieties, sterically bulkier chemical groups can be introduced into the oligonucleotide of interest than can be introduced using irreversible chemical modifications. This is possible because these large chemical groups will be removed in the cytosol and therefore will not interfere with the biological activity of the oligonucleotides within the cytosol of the cell. As a result, these larger chemical groups can be designed to confer various advantages to the nucleotide or oligonucleotide, such as nuclease resistance, lipophilicity, charge, thermal stability, specificity, and reduced immunogenicity. In some embodiments, the structure of the glutathione responsive moiety can be engineered to alter its release kinetics.

[000131] In some embodiments, a glutathione sensitive moiety is attached to a sugar of a nucleotide. In some embodiments, the glutathione sensitive moiety is attached to the 2' sugar carbon of the modified nucleotide. In some embodiments, the glutathione sensitive moiety is located on the 5' carbon of the sugar, especially when the modified nucleotide is the 5' nucleotide of the oligonucleotide. In some embodiments, the glutathione sensitive moiety is located on the 3' carbon of the sugar, especially when the modified nucleotide is the 3' nucleotide of the oligonucleotide. In some embodiments, the glutathione sensitive moiety contains a sulfonyl group. See, for example, U.S. Provisional Application No. 62/378,635 "Compositions Comprising Reversibly Modified Oligonucleotides and Uses Thereof", filed August 23, 2016, the contents of which are incorporated herein by reference in the relevant disclosure.

V. Targeting ligands

[000132] In some embodiments, it is desirable to target the oligonucleotides of the invention to one or more cells or one or more organs. Such a strategy may help to avoid undesirable effects in other organs or prevent excessive loss of the oligonucleotide in those cells, tissues or organs where the oligonucleotide would not be of benefit. Accordingly, in some embodiments, the oligonucleotides disclosed herein may be modified to improve targeting to a particular tissue, cell, or organ, for example, to facilitate delivery of the oligonucleotide to the liver. In some embodiments, the implementation of the oligonucleotides disclosed in the present invention can be modified to facilitate delivery of the oligonucleotide to liver hepatocytes. In some embodiments, the oligonucleotide contains a nucleotide conjugated to one or more targeting ligands.

[000133] The targeting ligand may comprise a carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein, or portion of a protein (eg, an antibody or antibody fragment) or lipid. In some embodiments, the targeting ligand is an aptamer. For example, the targeting ligand can be an RGD peptide used to target tumor vasculature or glioma cells, a CREKA peptide to target tumor vasculature or stoma, transferrin, lactoferrin, or an aptamer to target transferrin receptors expressed on CNS vasculature, or anti-EGFR antibody for targeting EGFR of glioma cells. In some embodiments, the targeting ligand is one or more GalNAc fragments.

[000134] In some embodiments, 1 or more (eg, 1, 2, 3, 4, 5, or 6) oligonucleotide nucleotides are present, each conjugated to a separate targeting ligand. In some embodiments, 2 to 4 nucleotides of the oligonucleotide are present, where each is conjugated to a separate targeting ligand. In some embodiments, the targeting ligands are conjugated to 2-4 nucleotides at either end of the sense or antisense strand (e.g., the ligands are conjugated to 2-4 nucleotides of an overhang or extension at the 5' or 3' end of the sense or antisense strand) such that the targeting ligands look like toothbrush bristles, and the oligonucleotide looks like a toothbrush. For example, an oligonucleotide may contain a stem loop at the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop may be individually conjugated to targeting ligands.

[000135] In some embodiments, it is desirable to target an oligonucleotide that reduces HBV antigen expression in liver hepatocytes of a subject to hepatocytes. For this purpose, any suitable fragment targeting hepatocytes can be used.

[000136] GalNAc is a high affinity ligand for the asialoglycoprotein receptor (ASGPR), which is primarily expressed on the sinusoidal surface of hepatocyte cells and plays a major role in the binding, internalization and subsequent clearance of circulating glycoproteins containing terminal galactose or acetylgalactosamine N-residues (asialoglycoproteins) . Conjugation (both indirect and direct) of GalNAc fragments to the oligonucleotides of the present invention can be used to target such oligonucleotides to ASGPRs expressed on the surface of hepatocyte cells.

[000137] In some embodiments, an oligonucleotide of the present invention is conjugated directly or indirectly to a monovalent GalNAc. In some embodiments, the oligonucleotide is directly or indirectly conjugated to more than one monovalent GalNAc (ie, conjugated to 2, 3, or 4 monovalent GalNAc fragments, and typically conjugated to 3 or 4 monovalent GalNAc fragments). In some embodiments, an oligonucleotide of the present invention is conjugated to one or more divalent GalNAc, trivalent GalNAc, or tetravalent GalNAc fragments.

[000138] In some embodiments, 1 or more (eg, 1, 2, 3, 4, 5, or 6) oligonucleotide nucleotides are each conjugated to a GalNAc fragment. In some embodiments, 2 to 4 nucleotides of the stem loop (L) are present, where each nucleotide is conjugated to a separate GalNAc. In some embodiments, the targeting ligands are conjugated to 2-4 nucleotides at both ends of the sense or antisense strand (e.g., the ligands are conjugated to a 2-4 nucleotide overhang or extension at the 5' or 3' end of the sense or antisense strand) such that the GalNAc fragments resemble the bristles of a toothbrush, and the oligonucleotide itself resembles a toothbrush. For example, the oligonucleotide may contain a stem loop at the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop may be individually conjugated to GalNAc fragments. In some embodiments, GalNAc fragments are conjugated to a sense strand nucleotide. For example, four GalNAc fragments can be conjugated to nucleotides in the tetra-loop of the sense strand, where each GalNAc fragment is conjugated to one nucleotide.

[000139] In some embodiments, the oligonucleotide disclosed in the present invention contains a monovalent GalNac attached to a guanidine nucleotide and is called [ademG-GalNAc] or 2'-aminodiethoxymethanol-guanidine-GalNAc, as shown below:

[000140] In some embodiments, the implementation of the oligonucleotide in the present invention contains a monovalent GalNac attached to an adenine nucleotide, and is called [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc, as shown below.

является точкой присоединения к цепи олигонуклеотида.[000141] An example of such conjugation is shown below for a loop containing in the 5' to 3' direction the nucleotide sequence of GAAA (L=linker, X=heteroatom), where stem attachment points are shown. Such a loop may be present, for example, at positions 27-30 of the molecule shown in FIG. 1A. In the chemical formula, the symbol

is the point of attachment to the oligonucleotide chain.

[000142] Suitable methods or chemical methods (eg, click chemistry methods) can be used to link a targeting ligand to a nucleotide. In some embodiments, the targeting ligand is conjugated to a nucleotide using a click linker. In some embodiments, an acetal linker is used to conjugate a targeting ligand to a nucleotide of any of the oligonucleotides described herein. Acetal-based linkers are disclosed, for example, in International Patent Application WO 2016100401 A1 published June 23, 2016, the contents of which relating to such linkers are incorporated herein by reference. In some embodiments, the implementation of the linker is a labile linker. However, in other embodiments, the implementation of the linker is quite stable.

является точкой присоединения к цепи олигонуклеотида.[000143] An example is shown below for a loop containing GAAA nucleotides in the 5' to 3' direction, where GalNac fragments are attached to loop nucleotides using an acetal linker. Such a loop may be present, for example, at positions 27-30 of the molecule shown in FIG. 10. In the chemical formula, the designation

is the point of attachment to the oligonucleotide chain.

III. Recipes

[000144] Various formulations have been developed for ease of use of oligonucleotides. For example, oligonucleotides can be delivered to a subject or to a cellular environment using a formulation that minimizes degradation, facilitates delivery and/or uptake, or provides another beneficial property of the oligonucleotide in the composition. In some embodiments, the present invention provides compositions containing oligonucleotides (eg, single-stranded or double-stranded oligonucleotides) to reduce the expression of an HBV antigen (eg, HBsAg). Such compositions can be suitably formulated such that when administered to a subject, either in the immediate environment of the target cell or systemically, an amount of the oligonucleotide sufficient to reduce the expression of the HBV antigen enters the cell. Any of a variety of suitable oligonucleotide formulations as described herein can be used to deliver oligonucleotides that reduce HBV antigen expression. In some embodiments, the oligonucleotide is included in buffer solutions such as phosphate buffered saline solutions, liposomes, micellar structures, and capsids.

[000145] Oligonucleotide formulations with cationic lipids can be used to facilitate transfection of oligonucleotides into cells. For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (eg, polylysine) can be used. Suitable lipids include oligofectamine, lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.) and FuGene 6 (Roche), each of which can be used according to the manufacturer's instructions.

[000146] Accordingly, in some embodiments, the composition comprises a lipid nanoparticle. In some embodiments, the excipient comprises liposomes, lipids, a lipid complex, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to the cells, tissues, organs, or body of a subject in need thereof (see, for example, Remington: The Science and Practice of Pharmacy, ^22nd edition, Pharmaceutical Press, 2013).

[000147] In some embodiments, the compositions disclosed in the present invention contain a filler. In some embodiments, the excipient provides the composition with improved stability, improved absorption, improved solubility, and/or improves the therapeutic properties of the active ingredient. In some embodiments, the excipient is a buffering agent (eg, sodium citrate, sodium phosphate, tris base, or sodium hydroxide) or a carrier (eg, a buffer solution, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotide is lyophilized to extend its shelf life and then put into solution prior to use (eg, administration to a subject). Accordingly, the excipient in a composition containing any of the oligonucleotides described herein may be a lyoprotectant (eg, mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone) or a clotting temperature modifier (eg, dextran, ficoll, or gelatin).

[000148] In some embodiments, the pharmaceutical composition is formulated to be compatible with the intended route of administration. Examples of routes of administration include parenteral, eg, intravenous, intradermal, subcutaneous, oral (eg, inhalation), transdermal (topical), transmucosal, and rectal administration.

[000149] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if the compositions are water-soluble) or dispersions, and sterile powders for rapid preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg glycerol, propylene glycol and liquid polyethylene glycol and the like), and suitable mixtures thereof. In many cases, it is preferable to include isotonic agents such as sugars, polyalcohols such as mannitol, sorbitol and sodium chloride in the composition. Sterile injectable solutions can be prepared by incorporating the required amount of oligonucleotides in a chosen solvent with one or a combination of the ingredients listed above, as needed, followed by filtered sterilization.

[000150] In some embodiments, the composition may contain at least about 0.1% therapeutic agent (e.g., an oligonucleotide to reduce HBV antigen expression) or more, although the percentage of active ingredient(s) may range from about 1 % to about 80% or more by weight or volume of the entire composition. Factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, as well as other pharmacological characteristics should be considered by one skilled in the art of preparing such pharmaceutical formulations for various dosages and desired treatment regimens.

[000151] Although a number of embodiments are directed to liver delivery of any of the oligonucleotides disclosed in the present invention, oligonucleotides are expected to be targeted to other tissues.

IV. Usage Methods

i. Decreased expression of HBsAg

[000152] In some embodiments, methods are provided for delivering an effective amount of any of the oligonucleotides disclosed herein to a cell to reduce HBsAg expression. The methods provided in the present invention can be carried out on any suitable cell type. In some embodiments, the cell is any cell expressing the HBV antigen (e.g., hepatocytes, macrophages, monocyte-derived cells, prostate cancer cells, brain cells, endocrine tissue, bone marrow, lymph nodes, lungs, gallbladder, liver , duodenum, small intestine, pancreas, kidney, gastrointestinal tract, bladder, adipose and soft tissue, and skin). In some embodiments, the implementation of the cell is a primary cell obtained from the subject and passed a limited number of passages (subcultures), so that the cell essentially retains its natural phenotypic properties. In some embodiments, the cell to which the oligonucleotide is delivered is ex vivo or in vitro (ie, the oligonucleotide can be delivered to a cell in a cell culture or to the organism in which the cell is located). In specific embodiments, methods are provided for delivering an effective amount of any of the oligonucleotides disclosed herein to a cell to reduce HBsAg expression exclusively in hepatocytes.

[000153] In some embodiments, the oligonucleotides disclosed herein can be administered using suitable nucleic acid delivery methods, including injection of a solution containing the oligonucleotides, bombardment with oligonucleotide-coated particles, treatment of a cell or organism with a solution containing the oligonucleotides, or electroporation of cell membranes in the presence of oligonucleotides. Other suitable methods for delivering oligonucleotides to cells can be used, such as lipid-mediated transport, chemical-mediated transport, and transfection with cationic liposomes using calcium phosphate, and others.

[000154] That inhibition has occurred can be confirmed by appropriate analysis of one or more properties of the cell or subject, or by biochemical methods to detect HBV antigen expression indicator molecules (eg, RNA or protein). In some embodiments, the extent to which an oligonucleotide of the present invention reduces HBV antigen expression levels is assessed by comparing expression levels (e.g., mRNA or protein levels) of the HBV antigen with an appropriate control (e.g., level of HBV antigen expression in a cell or population cells to which no oligonucleotide was delivered or to which a negative control was delivered). In some embodiments, a suitable reference level of HBV antigen expression may be represented by a predetermined level or value so that the expression level of the control does not need to be measured each time. The predefined level or value can take many forms. In some embodiments, the implementation of the given level or value may be a single threshold value, such as the average value (median) or average (mean) value.

[000155] In some embodiments, the implementation of the implementation of the oligonucleotide, as described here, leads to a decrease in the level of expression of the HBV antigen (eg, HBsAg) in the cell. In some embodiments, the decrease in HBV antigen expression may be a decrease in expression to 1% or less, 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less, 55% or less, 60% or less, 70% or less, 80% or less, or 90% or less compared to the corresponding control expression level of the HBV antigen. A suitable control level may be the expression level of the HBV antigen in a cell or cell population that has not been treated with an oligonucleotide as described here. In some embodiments, the effect of delivering an oligonucleotide into a cell in accordance with the method disclosed in the present invention is characterized over time. For example, HBV antigen levels can be analyzed in a cell at least 8 hours, 12 hours, 18 hours, 24 hours; or at least one, two, three, four, five, six, seven, fourteen, twenty one, twenty eight, thirty five, forty two, forty nine, fifty six, sixty three, seventy, seventy through seven, eighty four , ninety-one, ninety-eight, 105, 112, 119, 126, 133, 140 or 147 days after the introduction of the oligonucleotide into the cell.

[000156] In some embodiments, the reduction in the expression level of the HBV antigen (eg, HBsAg) is maintained for an extended period of time after administration. In some embodiments, a detectable decrease in HBs Ag expression persists for a period of 7 to 70 days following administration of the oligonucleotide described herein. For example, in some embodiments, a detectable decrease persists for a period of 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, or 10 to 20 days after administration of the oligonucleotide. In some embodiments, the detectable reduction persists for a period of 20 to 70, 20 to 60, 20 to 50, 20 to 40, or 20 to 30 days after administration of the oligonucleotide. In some embodiments, the detectable reduction persists for a period of 30 to 70, 30 to 60, 30 to 50, or 30 to 40 days after administration of the oligonucleotide. In some embodiments, a detectable decrease in expression persists for a period of 40 to 70, 40 to 60, 40 to 50, 50 to 70, 50 to 60, or 60 to 70 days after administration of the oligonucleotide.

[000157] In some embodiments, a detectable decrease in HBsAg expression persists for a period of 2 to 21 weeks after administration of the oligonucleotide described here. For example, in some embodiments, a detectable decrease in expression persists for a period of 2 to 20, 4 to 20, 6 to 20, 8 to 20, 10 to 20, 12 to 20, 14 to 20, 16 up to 20 or 18 to 20 weeks after administration of the oligonucleotide. In some embodiments, a detectable decrease in expression persists for a period of 2 to 16, 4 to 16, 6 to 16, 8 to 16, 10 to 16, 12 to 16, or 14 to 16 weeks after administration of the oligonucleotide. In some embodiments, the detectable reduction persists for a period of 2 to 12, 4 to 12, 6 to 12, 8 to 12, or 10 to 12 weeks after administration of the oligonucleotide. In some embodiments, the detectable reduction persists for a period of 2 to 10, 4 to 10, 6 to 10, or 8 to 10 weeks after administration of the oligonucleotide.

[000158] In some embodiments, the oligonucleotide is delivered in the form of a transgene designed to effect the expression of the oligonucleotides (eg, their sense and antisense strands) in a cell. In some embodiments, an oligonucleotide is delivered using a transgene engineered to express any of the oligonucleotides disclosed herein. Transgenes can be delivered using viral vectors (eg, adenovirus, retrovirus, vaccinia, poxvirus, adeno-associated virus, or herpes simplex virus) or non-viral vectors (eg, plasmids or synthetic mRNAs). In some embodiments, the implementation of the transgenes can be injected directly into the subject.

II. Treatment Methods

[000159] Aspects of the disclosure relate to methods for reducing HBsAg expression (eg, methods for reducing HBsAg expression) to treat an HBV infection in a subject. In some embodiments, methods may include administering to a subject in need thereof an effective amount of any of the oligonucleotides disclosed herein. The present disclosure provides for both prophylactic and therapeutic methods of treating a subject at risk for (or susceptible to) HBV infection and/or a disease or disorder associated with HBV infection.

[000160] In certain aspects, the present invention provides a method for preventing a disease or disorder in a subject, as described herein, by administering a therapeutic agent (eg, an oligonucleotide or vector, or a transgene encoding thereof) to the subject. In some embodiments, the subject to be treated is a subject who is therapeutically beneficial in reducing the amount of HBsAg protein, for example, in the liver. Subjects at risk for a disease or disorder can be identified, for example, using a specific assay or a combination of diagnostic or prognostic assays known in the art (eg, identification of liver cirrhosis and/or inflammation of the liver). Administration of a prophylactic may occur prior to the detection or manifestation of symptoms characteristic of the disease or disorder, in order to prevent the disease or disorder or, conversely, to delay the progression thereof.

[000161] The methods described in the present invention generally include administering to the subject an effective amount of the oligonucleotide, that is, an amount capable of providing the desired therapeutic result. A therapeutically acceptable amount may be an amount that is capable of treating a disease or disorder. The appropriate dosage for any individual subject will depend on certain factors, including the height and proportions of the subject, body surface area, age, the specific formulation of the drug being administered, the active ingredient(s) in the formulation, the time and route of administration, the general health of the patient, and consideration of other drugs administered at the same time. For example, the dosage may range from 0.1 to 12 mg/kg. The dosage may also be in the range of 0.5 to 10 mg/kg. Alternatively, the dosage may range from 1.0 to 6.0 mg/kg. The dosage may also be in the range of 3.0 to 5.0 mg/kg.

[000162] In some embodiments, any of the compositions disclosed herein may be administered to a subject, enterally (e.g., orally, through a stomach feeding tube, through a duodenal feeding tube, through a gastrostomy tube, or rectally), parenterally (e.g., by subcutaneous injection, intravenous injection or infusion, intra-arterial injection or infusion, intraosseous infusion, intramuscular injection, intracerebral injection, intracerebroventricular injection, intrathecal therapy), topical (eg, subcutaneous, inhalation, eye drops, or mucosal injection), or direct injection into a target organ (eg, the subject's liver). Typically, the oligonucleotides disclosed herein are administered intravenously or subcutaneously.

[000163] As a non-limiting set of examples, the oligonucleotides of the present invention are typically administered quarterly (once every three months), every two months (once every two months), monthly, or weekly. For example, oligonucleotides can be administered after one, two or three weeks. Oligonucleotides can be administered daily.

[000164] In some embodiments, the subject to be treated is a human, non-human primate, or other mammal. Examples of other subjects include pets such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats and chickens; and other animals such as mice, rats, guinea pigs and hamsters.

EXAMPLES

Example 1 Development of Effective Oligonucleotide Inhibitors of HBsAg Expression

[000165] The HBV surface antigen has been identified as a target for RNAi-based therapy for the treatment of HBV infection. As shown in the HBV genome organization diagram shown in FIG. 1, HBsAg is encoded by three RNA molecules transcribed from one ORF. Oligonucleotides were designed to provide silencing of one or more RNA transcripts from which the HBsAg group of proteins is synthesized (example of an RNAi target site labeled "X" in FIG. 1). An HBsAg-targeting oligonucleotide, HBV-254, was constructed and evaluated for in vitro and in vivo utility. HBV-254 was selected and engineered to be able to directly target mRNA transcripts for four HBV RNAs. The HBV-254 duplex oligonucleotide used in the experiments included a sense strand sequence such as (shown 5' to 3'): GUGGUGGACUUCUCUCAAUAGCAGCCGAAAGGCUGC (SEQ ID NO: 21); and an antisense strand sequence such as (5'-3' shown): UAUUGAGAGAAGUCCACCACGG (SEQ ID NO: 22).

[000166] A single dose of HBV-254 oligonucleotide was evaluated in HDI mice demonstrating the ability of the subcutaneous polynucleotide to target the HBsAg viral transcript (FIG. 2). As shown, HBV-254 systematically reduced HBsAg levels in mice with increasing dose. Activity shown in preclinical studies was further evaluated in mice with a QW x 3 dosing regimen in which HBV-254 was administered subcutaneously at a dose of 3 mg/kg (FIG. 3). The time of administration is indicated by the arrows in the diagram. HBsAg levels were monitored in both oligonucleotide treated and untreated control mice over a period spanning 147 days. Decreased levels of HBs Ag were maintained in treated mice throughout the study, with expression levels (relative to controls) appearing to stabilize in a reduced expression line about two months after the first injection.

[000167] Additional highly effective HBsAg-targeted oligonucleotides have been identified by in vitro screening using psiCHECK reporter analysis with unmodified tetraloop oligonucleotides. The results of three different plates are shown in FIG. 4. Each oligonucleotide, including HBV-254, was evaluated at three concentrations (1, 10, and 100 pM) in HeLa cells using a fluorescent reporter assay. The results presented for each plate are further shown in comparison to the positive control (8, 40 and 200 pM), negative control (1 nM) and mock transfection control. Oligonucleotides shown in highlighted boxes were selected for in vivo testing, which found that HBV-219 and HBV-258 were the most potent oligonucleotides compared to HBV-254 and others identified by screening. HBV-219 showed a multiple improvement in efficacy over HBV-254 and was selected for additional testing and evaluation.

Example 2 Sequence Conservation Analysis and Mismatch Design to Increase Overall Therapeutic Efficacy

[000168] Some of the most highly effective oligonucleotides characterized in Example 1 were compared to the genome sequences of various HBV genotypes A-I. The results of the initial conservation analysis are shown in Table 1. As shown, HBV-219 has a relatively low percentage of conservation (match) across all these genomes. However, the conservation percentage increases significantly (from 66% to 96%) if a mismatch (MM) is introduced in position 15 of the guide chain. Hepatitis B virus (HBV) genotyped sequence data from the publicly available GenBank database, incorporated herein by reference, were used to select and align sequences using bioinformatics techniques.

Table 1 Initial HBV Key Sequence Conservation Analysis

Oligonucleotide Guide chain, mismatches (MM) highlighted % conservation among genomes % conservation if MM is acceptable HBV-0217 UUUGUGAGGAUUUUUGUCAAGG 66 97 HBV-0219 UUAUUGUGAGGAUUUUUGUCGG 66 96 HBV-0254 UCUGAGAGAAGUCCACCACGGG 94 98 HBV-0255 UACUGAGAGAAGUCCACCACGG 95 99 HBV-0258 UAAAACUGAGAGAAGUCCACGG 94 98

[000169] A subsequent conservation analysis was made focusing on a few oligonucleotides from Table 1 and including broader search parameters. For example, while the initial analysis included only full length genome sequences, the focused analysis included full length and partial length sequences (>80% identity with the target site). In addition, the number of genomes examined increased from 5628 in the original analysis to more than 17000 genomes in the focused analysis. The results of the focused analysis generally revealed the same trends that were observed in the original analysis (Table 2). As shown - (and further illustrated in FIG. 5) - HBV-219 was predicted to be inactive against HBV genotypes B, E, F, H, and I unless a mismatch was introduced at position 15 of the guide strand.

Table 2. Focused conservation analysis

HBV-219 HBV-254 HBV-258 ORF Purpose S S S Semantic 19-mer GACAAGAATCCTCACAATA CGTGGTGGACTTCTCTCAA GTGGACTTCTCTCAATTTT Semantic 19-mer with indefinite base GACAANAATCCTCACATAATA CGTGGTGGACTTCTCTCAN GTGGACTTCTCTCANTTTTT Mismatch position on chain guide fifteen 2 6 Genotype conservation* Genotype A 97/99 [3278] 94/97 [4002] 94/97 [4005] Genotype B 03/95 [2563] 81/97 [2700] 82/99 [2700] Genotype C 92/97 [4783] 95/97 [4938] 96/98 [4938] Genotype D 95/97 [4311] 96/99 [4395] 96/98 [4398] Genotype E 01/98 [1039] 93/95 [1234] 93/95 [1232] Genotype F 01/90 [425] 94/96 [501] 95/96 [501] Genotype G 92/99 [83] 98/98 [85] 99/99 [85] Genotype H 03/92 [71] 86/97 [78] 87/99 [78] Genotype I 00/100 [18] 95/100 [22] 95/100 [22] TOTAL
(focused analysis) 72/97 [17021] 93/97 [17995] 93/98 [17959] TOTAL
(initial analysis) 66/96 [5628] 94/98 [5628] 94/98 [5628] Percent preservation calculated as (total/MM), values <90% in bold [Total N #]

[000170] The psiCHECK-2 reporter system with two luciferase genes was used to assess the effect of mismatches introduced at a specific position in each of HBV-217, HBV-219, HBV-254, HBV-255, and HBV-258. The psiCHECK vector allows for the tracking of changes in the expression of a target gene fused to a reporter gene in which active RNAi degrade the fusion construct, causing a corresponding decrease in the reporter signal. The diagram in FIG. 6 generally shows the vector used in these assays. The parent fragment of the reporter sequence contained a fragment of 120 bp genotype A (GenBank: AM282986.1) spanning the target sites of interest in the S ORF. Duplex sequences of the parental oligonucleotides having 100% homology to the reporter plasmid at the respective sites are shown in FIG. 6, while oligonucleotide duplex sequences with mismatches carry a single mismatch with the reporter plasmid. The parental and mismatch sequences of the tested oligonucleotides are shown in FIG. 7 are aligned to their respective parent reporter sequence fragments.

[000171] In the mismatch assay examples, the oligonucleotides tested have the same modification patterns. According to the numbering scheme shown for each oligonucleotide in FIG. 7, the modifications were as follows: 5'-methoxy, phosphonate-4'-oxy-2'-O-methyluridine at position 1; 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19; 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22; and phosphorothioate internucleotide bonds between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. Mismatch positions differed in each sample of parental and mismatch sequences, and are shown in boxes in FIG. 7.

[000172] psiCHECK2 reporter assays for each oligonucleotide were performed over a three day period using a 6-point 5-fold serial dilution starting at 1 nM, transfected into HeLa cells. On Day 1, 10,000 HeLa cells/well (96-well plate) were seeded in a black-walled clear-bottom well (cells 80-90% confluent). On day 2, vector DNA and RNAi molecules were diluted in an appropriate amount of Opti-MEM® I medium without serum and gently mixed. After gentle mixing, Lipofectamine® 2000 0.2 µl was diluted into 25 µl Opti-MEM® I medium without serum for each reaction. This dilution was gently mixed and incubated for 5 minutes at room temperature. After a 5 minute incubation, equal volumes of dilutions of DNA and RNAi molecules were combined with diluted Lipofectamine® 2000. The combined mixture was gently mixed and incubated for 20 minutes at room temperature to form a complex. Thereafter, DNA-RNAi-molecule Lipofectamine® 2000 complexes were added to each well containing cells and media and mixed gently by rocking the plate back and forth. The cells were then incubated at 37° C. in a CO ₂ incubator until the cells were ready for collection and analysis of the target gene. On day 3, 100 μl of Dual-Glo reagent was added to each well, mixed and incubated for 10 minutes before measuring luminescence. An additional 100 µl of Dual-Glo Stop&Glo was added to each well, mixed and incubated for 10 minutes before measuring luminescence. Dose-response curves were constructed for each parental genotype and mismatched oligonucleotides to evaluate the effect of mismatches on activity. The EC50 values determined for each oligonucleotide are shown in Table 3 with additional characteristics.

Table 3. Estimation of the effectiveness of mismatches of HBsAg-targeted oligonucleotides

HBV-217 HBV-219 HBV-254 HBV-255 HBV-258 ORF Purpose S S S S S Semantic 19-mer TGTTGAC AAGAATC CTCACAAT GACAAGA ATCCTCACAATA CGTGGTGG ACTTCTCTCAA TCGTGGTG GACTTCTCTCAAT GTGGACTT CTCTCAATTTT Sense 19-mer with indefinite base TGTTGAC AANAATC CTCACAAT GACAANA ATCCTCACAATA CGTGGTGG ACTTCTCTCAN TCGTGGTG GACTTCTCTCANT GTGGACTT CTCTCANTTTTT The position of the mismatch in the target chain 13 fifteen 2 3 6 Parent EC ₅₀ s (pM) twenty 5 37 35 ten MM EC ₅₀ s (pM) 25 eight 96 366 >1000

[000173] As indicated by relative EC ₅₀ s values, in vitro dose-response curves for HBV-219 duplexes show no loss of activity with a single mismatch at position 15 of the guide strand. A subsequent in vivo assay comparing parental HBV-219 (here designated HBV(s)-219P1) and a mismatch oligonucleotide (here designated HBV(s)-219P2) confirmed that mismatch administration did not induce loss of activity (FIG. 8). As shown in the single dose titration plot shown in FIG. 9, the mismatch duplex oligonucleotide HBV-219 (HBV(s)-219P2) was well tolerated in vivo over a 70 day period after administration.

[000174] FIG. 10 illustrates an example of a modified duplex structure for HBV-219 with an embedded mismatch (here referred to as HBV(s)-219). According to the numbering scheme shown for each oligonucleotide in FIG. 7, the sense strand spans nucleotides 1 to 36 and the antisense strand spans oligonucleotides 1 to 22, the latter numbered from right to left. The duplex form is shown with a gap between nucleotides at position 36 on the sense strand and position 1 on the antisense strand. The modifications in the sense strand were as follows: 2'-fluoro-modified nucleotides at positions 3, 8-10, 12, 13 and 17; 2'-O-methyl-modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36; phosphorothioate internucleotide bond between nucleotides in positions 1 and 2; 2'-OH nucleotides at positions 27-30; 2'-aminodiethoxymethanol-guanidine-GalNAc at position 27; and 2'-aminodiethoxymethanol-adenine-GalNAc at each of positions 28, 29 and 30. Modifications in the antisense strand were as follows: 5'-methoxy, phosphonate-4'-oxy-2'-O-methyluridine phosphorothioate at position 1; 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19; 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22; and phosphorothioate internucleotide bonds between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The antisense strand included a mismatch at position 15. Also, as shown, the duplex antisense strand has an included "GG" protrusion at positions 21-22.

[000175] Details of HBV(s)-219 and the two precursors mentioned above (HBV(s)-219P1 and HBV(s)-219P2) are shown in Table 4.

Table 4. HBV(s)-219 and precursors

RNAi oligonucleotides Length
(sense/antisense) Consistency/Chemical Modifications HBV(s)-219 36/22mer Contains a mismatch at position 15 of the antisense strand. An acetal-based GalNAc linker is used. Methoxy, phosphonate-4'-oxy-2'-O-methyluridine (MeMOP) is introduced at position 1 of the antisense strand. See FIG. 10 and FIG. 19A HBV(s)-219P2 36/22mer Contains a mismatch at position 15 of the antisense strand. Click chemistry based conjugation, includes a triazole-based GalNAc linker. A fully unprotected 5'-phosphonate-4'oxy-2'-O-methyluridine (MOP) is used at position 1 of the antisense strand. See FIG. 19B HBV(s)-219P1 36/22mer Does not contain a mismatch at position 15 of the antisense strand. Has the same chemical modifications as HBV(s)-219P2.

Example 3 Antiviral activity of HBV(s)-219 precursors.

[000176] The effect of treatment with HBV(s)-219 precursors on the intracellular localization of the HBV core antigen (HBcAg) was evaluated. NOD _{scid mice} were hydrodynamically injected (HDI) with the tail-head dimer of the HBV genome. Oligonucleotide treatment was started 2 weeks after HDI injection. Immunohistochemical staining of hepatocytes isolated from mice after treatment showed a sharp decrease in the expression of the main antigen (basic core protein) of HBV (HBcAg).

[000177] RNA sequencing was performed to study the effect of HBsAg knockdown on overall expression of HBV viral transcripts. Hepatocytes were isolated from HDI-treated mice four days after administration of three once-weekly doses of 3 mg/kg each. Total RNA was isolated from hepatocytes and sequenced using the Illumina HiSeq platform. FIG. 11B shows the results of RNA sequencing where the detected RNA transcript sequences were matched to HBV RNA. The target sites of HBV(s)-219 and its precursors are also shown to demonstrate that the oligonucleotide targets the pgRNA (3.5kb), S1 (2.4kb) and S2 (2.1kb) transcripts. The results show that compared to controls, treatment with HBV(s)-219P1 resulted in over 90% silencing (inhibition) of all HBV transcripts.

[000178] The long-term effects of administration of the HBV(s)-219P1 oligonucleotide were studied in two different HBV mouse models, a cccDNA-dependent HDI model and a cccDNA-independent AAV model. Temporal (over 12 weeks) analysis of HBsAg mRNA expression was performed in the context of a treatment involving three single doses of 3 mg/kg once a week of HBV(s)-219P1 oligonucleotide targeting HBsAg mRNA, where vehicle and oligonucleotide RNAi controls were used. targeting HBxAg mRNA in an HDI model of HBV (FIG. 12A). Oligonucleotide HBV(s)-219P1 caused a decrease of ≥3.9 log, while maintaining a relatively long duration of decline in activity over 7 weeks; while the HBV(x)-targeted oligonucleotide used for comparison resulted in a 3.0 log reduction that was maintained for a shorter period of time.

[000179] A further temporal (12 weeks) analysis of HBsAg mRNA expression was performed in the context of a treatment comprising three single doses of 3 mg/kg once a week of HBV(s)-219P2 oligonucleotide targeting HBsAg mRNA, where vehicle and RNAi oligonucleotide targeting HBxAg mRNA in the AAV-HBV model (FIG. 12B). In this model, the HBV(s)-219P2 oligonucleotide produced a comparable log reduction in activity and a similar duration as the HGV(x)-targeted oligonucleotide. An RNAi oligonucleotide targeting HBxAg mRNA and shown in FIG. 12A and 12B has the sense strand sequence UGCACUUCGCGUCACCUCUAGCAGCCGAAAGGCUGC and the antisense strand sequence UAGAGGUGACGCGAAGUGCAGG. This HBxAg-targeting RNAi oligonucleotide is referred to herein as GalXC-HBVX.

[000180] Immunohistochemical staining was performed to examine the intracellular distribution of HbcAg in hepatocytes derived from the AAV-HBV model and the HDI-HBV model after treatment with HBV(s)-219 precursor oligonucleotide as described above, targeting HBsAg mRNA compared to vehicle control and an RNAi control oligonucleotide targeting HBxAg mRNA as described above. (FIG. 13) Residual basic protein (core protein) HBcAg after treatment showed marked differences in subcellular localization between treatments with two RNAi oligonucleotides in the HDI model but not in the AAV model.

Example 4 Evaluation of HBV(s)-219P1 in PXB-HBV genotype C human chimeric liver model

[000181] The antiviral activity of HBV(s)-219P1 was evaluated in the PXB-HBV model, also known in the HBV-related literature as the chimeric human liver model. This technology is based on the transplantation of human hepatocytes into severely immunocompromised mice, followed by the use of a genetic mechanism to damage the host mouse hepatocytes (Tateno et al., 2015). This process results in mice with livers derived from >70% human tissue, which, unlike the livers of wild-type mice, can be infected with HBV (Li et al., 2014). The PXB-HBV model serves several purposes in the context of the pharmacology of HBV(s)-219, it is used: (1) to confirm that an oligonucleotide can engage human RNAi mechanisms (RISC) in vivo, (2) to confirm that the targeting The GalNAc ligand configuration can be taken up by hepatocytes involving human ASGR in vivo and (3) to confirm treatment efficacy in a true HBV infection model (as opposed to a designed HBV expression model). Despite the limitation that grafted human hepatocytes lead to irregular chimeric liver physiology (Tateno et al., 2015), it is in this model that significant antiviral efficacy can be observed/tested.

[000182] Approximately 8 weeks after the mice were initially challenged with the HBV genotype, plasma samples from each mouse were taken for baseline HBsAg measurements. Then, cohorts of 9 mice each (n=3 for PK, n=6 for PD) were given 3 weekly SC injections of 0 mg/kg (PBS) or 3 mg/kg HBV(s)-219P1. The first day of dosing is considered day 0. To determine the level of HBsAg and circulating HBV DNA in serum, non-lethal blood samples were collected from each mouse weekly (FIGS. 14A-14D). Mice were euthanized on day 28 for analysis of tissue samples at the final stage (end point). Liver samples on day 28 were analyzed for intrahepatic HBV DNA and cccDNA. Significant antiviral activity was observed in all endpoints belonging to mice treated with HBV(s)-219P1 and included a decrease in HBsAg by > 80%, as well as a significant decrease in circulating HBV DNA, intrahepatic HBV DNA and cccDNA (FIGS. 14A-14D) . These data demonstrate that treatment with HBV(s)-219 results in antiviral activity in infected human hepatocytes following systemic administration.

Example 5 HBV(s)-219P2 Improves Antiviral Activity of Entecavir

[000183] Nucleotide/nucleoside analogs (eg, entecavir) are the standard of care, and although they are effective in reducing circulating HBV genomic DNA, they do not reduce circulating HBsAg. Although this results in controlled viremia during such treatment, lifelong treatment is required and a functional cure is rarely achieved. RNAi oligonucleotides targeting the S antigen affect both the viral polymerase and the HBsAg protein. In this study, the cumulative effect of the antiviral activity of HBV(s)-219P2, used both in monotherapy and in combination with entecavir, was studied in an HBV-expressing mouse (HDI model).

[000184] Mice were administered a daily oral dose of 500 ng/kg Entecavir (ETV) for 14 days. One subcutaneous injection of HBV(s)-219P2 was used. Circulating viral load (HBV DNA) was measured by quantitative PCR (qPCR) (FIG. 15A); Plasma HBsAg levels were measured by ELISA test (FIG. 15B) and HBV mRNA and pgRNA levels in liver were measured by qPCR. Clear additive effects have been observed with combination therapy with HBV(s)-219P2 and ETV. The results show that ETV therapy alone is not effective against circulating HBsAg or liver viral RNA. In addition, the antiviral activity of HBV(s)-219P2, as measured by HBsAg or HBV RNA, does not change when co-dosed with ETV (FIGS. 15B-15C).

[000185] As shown in FIG. 15A-15C, Entecavir monotherapy at 500 ng/kg PO daily for 14 days resulted in a mean ~1.6 log reduction in HBV DNA detected in plasma compared to mice treated with PBS (n=6). At the same time, there was no significant decrease in either circulating HBsAg or viral RNA in the liver. Monotherapy with a single 1mg/kg or 3mg/kg SC dose of HBV(s)-219P2 on day 0 resulted in a mean ~0.8 log or ~1.8 log reduction in HBV DNA detectable in plasma compared to PBS control , respectively (n=7). Monotherapy with a single 6 mg/kg SC dose of HBV(s)-219P2 on day 0 resulted in a mean ~2.5 log reduction in plasma HBV DNA, and two mice were below the detection limit (n=7). Monotherapy with a single SC dose of HBV(s)-219P2 on day 0 resulted in a dose-dependent decrease in both circulating HBsAg and viral RNA in the liver. Combination therapy with entecavir at a dose of 500 ng/kg PO daily for 14 days and a single dose of 1 mg/kg HBV(s)-219P2 SC on day 0 resulted in an additive reduction in HBV DNA detected in plasma, on average ~2.3 log . A similar reduction in plasma HBsAg levels and hepatic viral transcripts was observed with single-dose 1 mg/kg SC monotherapy of HBV(s)-219P2, suggesting additive effects in reducing plasma HBV DNA but not circulating HBsAg or hepatic viral transcripts.

Example 6 Comparison of antiviral activity of HBV(s)-219P2 and GalXC-HBVX

[000186] In this study, mice expressing HBV (HDI model) were injected with HBV(s)-219P2, GalXC-HBVX (same sequence as GalXC-HBVX shown in FIGS. 12A and 12B), or a combination of both RNAi oligonucleotides and determined the level of HBsAg in plasma two or nine weeks after dosing. As shown in FIG. 16B, similar levels of HBsAg suppression were observed 2 weeks after treatment with a single loading dose of 9 mg/kg SC with either HBV(s)-219P2 or GalXC-HBVX, or a combination thereof. Long-term HBsAg suppression was observed in mice treated with S-targeted HBV(s)-219P2, while mice treated with GalXC-HBVX or a combination thereof showed significant HBsAg recovery at 9 weeks post-treatment (n=3).

[000187] Subcellular localization of the HBV major antigen (HBcAg) in HBV expressing mice was also assessed in mice treated with HBV(s)-219P2, GalXC-HBVX, or a combination of both RNAi oligonucleotides. Mice expressing HBV (HDI model) were treated with a single loading dose (9 mg/kg, ss) of either HBV (s)-219P2 or GalXC-HBVX, or a 1:1 combination of the two. At the times indicated in FIG. 17A liver sections were stained for HBcAg; representative hepatocytes are shown. Cohorts treated with HBV(s)-219P2 alone or in combination with GalXC-HBVX showed nuclear localization of HBcAg. Cohorts treated with GalXC-HBVS alone showed only cytosolic localization of HBcAg, which is regarded as a favorable prognostic indicator of treatment response (Huang et al. J. Cell. Mol. Med. 2018). The percentage of HBcAg positive cells with nuclear staining for each animal is shown in FIG. 17B (n=3/group, 50 cells per animal, 2 weeks post-dose). To confirm that the effect on HBcAg subcellular localization is due to the HBV transcriptome region and not to an unknown property of the RNAi sequence, alternative sequences targeting the X and S open reading frames were designed and tested (see FIG. 17C). HBV-254 is shown in FIG. 17C. The sequence of HBV-254 is described in Example 1. An alternative oligonucleotide targeting HBxAg shown in FIG. 17C has the sense strand sequence GCACCUCUCUUUACGCGGAAGCAGCCGAAAGGCUGC and the antisense sequence UUCCGCGUAAAGAGAGGUGCGG. The two alternative RNAi oligonucleotides have different target sequences in the S or X antigen than the RNAi oligonucleotides shown in FIG. 16V. However, they show the same (similar) effect on plasma HBcAg levels, indicating that this effect is specific to the effect on the S antigen per se, but not specific to the oligonucleotide used.

Example 7. Evaluation of the safety of use, tolerability in healthy people and the effectiveness of HBV(s)-219 in patients with HBV.

[000188] This study is designed to evaluate the safety and tolerability of HBV(s)-219 in healthy subjects (Arm A) and the efficacy of HBV(s)-219 in patients with HBV (Arm B). Dose information by cohort is presented in FIG. 18. The molecular structure of HBV(s)-219 is shown in FIG. 10 FIG. 19A, and is also illustrated in the figure below (the caption to the figure follows):

Sense chain: Hybridized with: Antisense strand: Designations:
mX: 2'-O-methyl ribonucleotide
fX: 2'-fluoro-deoxyribonucleotide
[ademA-GalNAc}: 2'-modified-GalNAc-adenosine
[ademG-GalNAc}: 2'-modified-GalNAc-guanosine
[MePhoshponate-4O-mU]: 4'-O-monomethylphosphonate-2'-O-methyluridine Connections:
"-" denotes a phosphodiester bond
"-S-" denotes a phosphothioate bond

[000189] Patient selection criteria are shown below.

[000190] Group A - Healthy Subjects

[000191] Selection Criteria:

[000192] 1. Age: 18 (or age of majority, whichever is higher) up to and including 65 years of age at the time of signing the informed consent.

[000193] 2. Clearly healthy at the time of screening, as determined by the medical examiner's assessment, including medical history, physical examination, and laboratory tests

[000194] a. No symptoms of ongoing illness

[000195] b. Absence of clinically significant deviations in body temperature, pulse rate, respiratory rate, blood pressure

[000196] s. No clinically significant cardiovascular or pulmonary disease, no cardiovascular or pulmonary disease requiring pharmacological intervention.

[000197] 3. 12-lead electrocardiogram (ECG) within normal limits or without clinically significant abnormalities at screening and day-1 as judged by the investigator.

[000198] 4. Negative alcohol or drug test at examination, first visit (1) and admission (Day-1)

[000199] 5. Non-smokers for at least 5 years prior to first visit (1) with negative urinary cotinine concentration at first visit (1)

[000200] 6. Body mass index (BMI) in the range of 18.0-32.0 kg/m ² (inclusive).

[000201] 7. Man or Woman:

[000202] a. Male members:

[000203] The male participant must agree to use contraception during the treatment period and for at least two weeks after the study dose, and to abstain from sperm donation during this period.

[000204] b. Female participants:

[000205] Female patients are eligible to participate in the absence of pregnancy, breastfeeding, and meet at least one of the following conditions: not be a woman of childbearing age (WOCBP), or, depending on the region; Be a WOCBP if you agree to follow contraceptive instructions from the time of registration after a medical examination, throughout the treatment period and for at least 12 weeks after the study dose.

[000206] 8. Is in a position to sign informed consent 1, which includes compliance with requirements and restrictions.

[000207] Exclusion Criteria, Group A

[000208] 1. History of any medical condition that may interfere with absorption, distribution, or elimination of study drug, or clinical and laboratory assessments in this study, including (but not limited to); chronic or recurrent kidney disease, functional bowel disorders (eg, frequent diarrhea or constipation), gastrointestinal disease, pancreatitis, seizure disorder, mucosal or musculoskeletal disorders, history of suicide attempts or suicidal ideation, or clinically significant depression, or other neuropsychiatric disorders disorder requiring pharmacological intervention

[000209] 2. Poorly controlled or unstable hypertension; or sustained systolic BP >150 mmHg. or diastolic BP >95 mm Hg. at screening

[000210] 3. History of diabetes mellitus, using insulin or hypoglycemic agents for treatment

[000211] 4. History of asthma requiring hospitalization within the previous 12 months

[000212] 5. Proven deficiency of G-6-PD as determined by the central research laboratory

[000213] 6. Currently poorly controlled endocrine conditions, with the exception of thyroid conditions (hyper/hypothyroidism, etc.), with the exception of thyroid conditions requiring any pharmacological interventions

[000214] 7. A history of malignancy is allowed if the participant's cancer is in complete remission after chemotherapy and has not required additional medical or surgical intervention in the previous three years

[000215] 8. Presence of multiple drug allergy or history of allergic reaction to oligonucleotide or GalNAc

[000216] 9. The presence of intolerance to SC injections or the presence of significant scarring in the abdominal cavity, which may potentially interfere with the study or assessment of local tolerance

[000217] 10. Clinically significant surgical history

[000218] 11. History of persistent ethanol abuse (>40 g ethanol/day) or illicit drug use within the previous 3 years.

[000219] 12. Clinically Significant Illness Within 7 Days Prior to Starting Study Substance Administration

[000220] 13. Donation of more than 500 ml of blood within 2 months prior to study entry or plasma donation within 7 days prior to screening

[000221] 14. Significant infection or known inflammatory process ongoing at screening (by investigator)

[000222] 15. History of chronic or recurrent urinary tract infection (UTI) or UTI within one month prior to screening

[000223] 16. Planned Elective Surgery During This Study

[000224] 17. Use of prescription drugs within 4 weeks prior to study entry

[000225] 18. Use of over-the-counter (OTC) drugs or herbal supplements, excluding conventional vitamins, within 7 days of the first dose, unless agreed with the clinically relevant investigator and sponsor.

[000226] 19. Receiving/administering an investigational agent within 3 months prior to dosing or participating in another clinical study prior to the start of this study.

[000227] 20. HBV, HIV, HCV, or HDV seropositive antibodies detected at screening (pre-screening testing may be considered if performed within 3 months prior to screening)

[000228] 21. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), total bilirubin, alkaline phosphatase (ALP), or albumin out of control range at screening visit (1) or on the day of admission (Day-1)

[000229] 22. Blood test abnormalities that the investigator considers clinically significant and unacceptable; hemoglobin <12.0 g/dl (equivalent to 120 g/l); platelets outside the normal range.

[000230] 23. Hemoglobin A1C (HbA1C) >7%

[000231] 24. Any other laboratory test result determined by the Investigator to be clinically significant and unacceptable

[000232] 25. The patient has made or plans to make a significant change in the level of physical activity, from 48 hours prior to admission to the clinical research center and until the end of the study.

[000233] 26. Any condition that, in the opinion of the investigator, makes the participant unfit to participate in research or may prevent participation or completion of the study.

[000234] Group B - adult subjects with hepatitis B

[000235] Inclusion Criteria Group B

[000236] 1. Age 18 (or age of majority, whichever is higher) up to and including 65 years of age at the time of signing the informed consent.

[000237] 2. Chronic hepatitis B documented:

[000238] a. medical history consistent with chronic hepatitis B based on compatible clinical information and previous seropositivity for HBsAg and possibly other HBV serological markers (HBeAg, HBV DNA)

[000239] b. Serum HBsAg >1000 IU/mL at screening for HBeAg-positive patients or >500 IU/mL for HBeAg-negative patients

[000240] s. HBV DNA >20,000 IU/ml in serum at screening for untreated patients as determined by the TaqMan™ HBV DNA v2.0 assay at the central research laboratory

[000241] e. Serum anti-HBc IgM assay is negative.

[000242] 3. Clinical history consistent with compensated liver disease, without evidence of cirrhosis:

[000243] a. No history of bleeding from esophageal or gastrointestinal varices

[000244] b. No history of ascites

[000245] s. No history of jaundice attributed to chronic liver disease

[000246] e. No history of hepatic encephalopathy

[000247] i. No physical scarring of portal hypertension - angiomatic spiders, etc.

[000248] f. No previous liver biopsies, liver imaging studies, or elastography findings indicative of liver cirrhosis

[000249] 4. Hepatitis B treatment: no previous antiviral treatment for hepatitis B (no previous HBV nucleoside/nucleotide or interferon treatment) OR the patient has not received ongoing nucleotide/nucleoside therapy (Entecavir or Tenofovir) for at least 12 weeks prior to screening visit (1), with satisfactory tolerance and compliance

[000250] 5. Serum ALT > 60 U/L (men) or > 38 U/L (women) (2x ULN according to American Association for the Study of Liver Diseases (AASLD) guidelines, HBV Guidelines and Criteria, Terrault et al ., 2016)

[000251] 6. 12-lead ECG without clinically significant abnormalities at Screening and Day-1 (by Investigator)

[000252] 7. Absence of other prerequisites for liver disease

[000253] 8. No other medical condition requiring ongoing medical treatment or ongoing or intermittent pharmacological intervention other than well-controlled hypertension and treatment of hypercholesterolemia with statins.

[000254] 9. BMI in the range of 18.0 to 32.0 kg/m ² (inclusive)

[000255] 10. Man or Woman:

[000256] a. Male members:

[000257] The male participant must agree to use contraception during the treatment period and for at least two weeks after the study dose and abstain from sperm donation during this period.

[000258] b. Female participants:

[000259] Female patients are eligible to participate in the absence of pregnancy, breastfeeding, and meet at least one of the following conditions: not be a woman of childbearing age (WOCBP), or, depending on the region; be a WOCBP by agreeing to follow contraceptive instructions from the time of registration after a medical examination, throughout the treatment period and for at least 12 weeks after the study dose.

[000260] 11. Is in a position to sign informed consent 1, which includes compliance with requirements and restrictions.

[000261] Exclusion Criteria, Group B

[000262] 1. History of any medical condition that may interfere with absorption, distribution, or elimination of study drug, or clinical and laboratory assessments in this study, including (but not limited to); chronic or recurrent kidney disease, functional bowel disorders (eg, frequent diarrhea or constipation), gastrointestinal disease, pancreatitis, seizure disorder, mucosal or musculoskeletal disorders, history of suicide attempts or suicidal ideation, or clinically significant depression, or other neuropsychiatric disorders disorders requiring pharmacological intervention.

[000263] 2. Poorly controlled or unstable hypertension.

[000264] 3. History of diabetes mellitus, using insulin or hypoglycemic agents for treatment.

[000265] 4. History of asthma requiring hospitalization within the previous 12 months.

[000266] 5. Proven G-6-PD deficiency as determined by a central research laboratory.

[000267] 6. Currently poorly controlled endocrine conditions, with the exception of thyroid conditions (hyper/hypothyroidism, etc.), with the exception of thyroid conditions requiring any pharmacological interventions.

[000268] 7. History of chronic or recurrent urinary tract inflammation (UTI) or UTI disease within one month prior to screening

[000269] 8. History of hepatocellular carcinoma (HCC)

[000270] 9. A history of malignancy other than HCC is allowed if the patient's malignancy is in complete remission after chemotherapy and has not required additional medical or surgical intervention in the previous three years.

[000271] 10. History of persistent ethanol abuse (>40 g ethanol/day) or illicit drug use within the previous 3 years.

[000272] 11. A history of intolerance to SC injections or the presence of significant abdominal scarring that could potentially interfere with the study or assessment of local tolerability.

[000273] 12. Receipt of donated blood (transfusion) in the last 6 weeks prior to the start of therapy or planned transfusion during the observed period after the end of the study.

[000274] 13. Donation or loss of >500 ml of blood within 2 months prior to screening or donation of plasma within 7 days prior to screening.

[000275] 14. Antiviral therapy (other than Entecavir or Tenofovir) within 3 months prior to screening or treatment with interferon within the previous 3 years.

[000276] 15. Use within the last 6 months (or expected need for use) of anticoagulants, systemically administered corticosteroids, systemically administered immunomodulators, or systemically administered immunosuppressants.

[000277] 16. Use of a prescription drug within 14 days prior to the study that the investigator or sponsor believes would interfere with the study. Topical drugs without systemic absorption, statins (except rosuvastatin), hypertensive drugs, over-the-counter drugs, as well as over-the-counter pain medications, and hormonal contraceptives (females) are acceptable.

[000278] 17. Depot injections or implantation of any drug within 3 months prior to study entry, excluding injectable depot/pregnancy prevention implant.

[000279] 18. Chronic use of herbal supplements or systemic over-the-counter drugs; participants must be prepared to stop using them for the duration of the study.

[000280] 19. Administered/received an investigational agent within 3 months prior to the study dose or participation in another clinical study prior to the commencement of this study.

[000281] 20. Liver elastography (i.e. FibroScan®), kPa > 10.5 at screening.

[000282] 21. Systolic blood pressure > 150 mm Hg. and diastolic blood pressure > 95 mmHg. after 10 minutes of rest lying down at screening.

[000283] 22. Liver transaminases (ALT or AST) confirmed value > 7xULN at screening.

[000284] 23. The presence of persistent or recurrent hyperbilirubinemia that is not Gilbert's disease or Dubin-Johnson syndrome.

[000285] 24. Seropositivity of antibodies to human immunodeficiency virus (HIV) or hepatitis C virus (HCV) or hepatitis delta virus (HDV).

[000286] 25. Hgb <12 g/dl (men) or Hgb <11 g/dl (women).

[000287] 26. Serum albumin <3.5 g/dl at screening.

[000288] 27. Total leukocyte count <4000 cells/µl or absolute neutrophil count (ANC) <1800 cells/µl at screening.

[000289] 28. Platelet count ≤100,000 per µl at screening.

[000290] 29. The international normalized ratio (INR) or prothrombin time (PT) is above the upper limit of the normal reference range (according to the laboratory's reference range) at screening.

[000291] 30. Serum urea (BUN) or creatinine > ULN.

[000292] 31. Serum amylase or lipase > 1.25 x ULN.

[000293] 32. Serum HbA1c > 7.0%.

[000294] 33. Serum alpha-fetoprotein (AFP) value >100 ng/mL. If AFP at screening is >ULN but <100 ng/mL, the patient is eligible for study if liver examination shows no lesions suggestive of HCC.

[000295] 34. Any other laboratory test result, performed for patient safety reasons, that is determined by the investigator to be clinically significant and unacceptable.

[000296] 35. The patient has made or plans to make a significant change in the level of physical activity, from 48 hours prior to admission to the clinical research center and until the end of the study.

[000297] 36. Any condition that, in the opinion of the investigator, makes the participant unfit to participate in research or may prevent participation or completion of the study.

[000298] The disclosure described herein for purposes of illustration may be practiced in the absence of any element or elements, limitation or limitations not disclosed in the present invention. Thus, for example, in each case described in the present invention, any of the terms "comprising", "consisting essentially of" and "consisting of" can be replaced by any of the other two terms. The terms and expressions used are used as terms of description, not limitation, and the use of such terms and expressions is not intended to exclude any equivalents of the features or parts thereof shown and described, however, it is recognized that various modifications are possible within the scope of the claimed invention. . Thus, it should be understood that while the present invention has been disclosed in detail in the preferred embodiments, those skilled in the art may make use of additional features, modifications, and variations of the concepts disclosed herein, and such modifications and variations are considered to be within the scope of the present invention. defined by the description and the appended claims.

[000299] The use of the terms "a" and "an" and "the" and the like in the context of the description of the invention (especially in the context of the following claims) should be construed as covering both the singular and the plural, unless otherwise specified in this invention or is not clearly contrary to the context. The terms "comprising", "having", "including", and "consisting of" are to be construed as open terms (i.e., meaning "including but not limited to"), unless otherwise indicated. The listing of ranges of values in the present invention is simply intended to serve as a shorthand way of individually referring to each individual value falling within that range, unless otherwise noted in the present invention, and thus each individual value is included in the description as if it has been specifically indicated in the present invention. All methods described in the present invention may be performed in any suitable order, unless otherwise indicated in the present invention or otherwise clearly contrary to the context. The use of any or all of the examples or exemplary language (eg, "such as") provided herein is intended primarily to better illuminate the invention and is not intended to limit the scope of the invention unless otherwise stated. No expression in the specification is to be construed as indicating any unclaimed element as essential to the practice of the invention.

[000300] Embodiments of this invention are described herein, including the best methods known to the inventors for carrying out the invention. Variations to these embodiments may be apparent to those skilled in the art upon reading the foregoing description.

[000301] The inventors expect those skilled in the art to use such variations as the case may be, and expect the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of those discussed in the appended claims, in accordance with the provisions of applicable law. Moreover, any combination of the above elements in all possible variations is covered by the invention, unless otherwise indicated in the present invention or otherwise clearly contrary to the context. Those skilled in the art will recognize, or be able to ascertain, without going beyond standard experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be embraced by the following claims.

--->

SEQUENCE LIST

<110> Dicerna Pharmaceuticals, Inc.

<120> PCT/US2018/056801

<130> D0800.70003WO00

<140> PCT/US2018/056801

<141> 2018-10-19

<150> US 62/575,358

<151> 2017-10-20

<160> 59

<170> PatentIn Version 3.5

<210> 1

<211> 18

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (5)..(5)

<223> n is a, c, g, or u

<400> 1

acaanaaucc ucacaaua 18

<210> 2

<211> 15

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (3)..(3)

<223> n is a, c, g, or u

<220>

<221> distinguishing characteristic

<222> (15)..(15)

<223> n is a, c, g, or u

<400> 2

uunuugugag gauun 15

<210> 3

<211> 20

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (15)..(15)

<223> n is a, c, g, or u

<400> 3

uuauugugag gauunuuguc 20

<210> 4

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (15)..(15)

<223> n is a, c, g, or u

<400> 4

uuauugugag gauunuuguc gg 22

<210> 5

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 5

uuauugugag gauucuuguc gg 22

<210> 6

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 6

uuuugugag gauuuuuguc gg 22

<210> 7

<211> 19

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (5)..(5)

<223> n is a, c, g, or u

<400> 7

acaanaaucc ucacaauaa 19

<210> 8

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222>(6)..(6)

<223> n is a, c, g, or u

<400> 8

gacaanaauc cucacaauaa gcagccgaaa ggcugc 36

<210> 9

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 9

gacaaaaauc cucacaauaa gcagccgaaa ggcugc 36

<210> 10

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 10

gacaagaauc cucacaauaa gcagccgaaa ggcugc 36

<210> 11

<211> 10

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 11

aatcctcaca 10

<210> 12

<211> 10

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 12

ugugaggauu 10

<210> 13

<211> 10

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 13

tgtgaggatt 10

<210> 14

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 14

tattgtgagg attcttgtca 20

<210> 15

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 15

cggtattgtg aggattcttg 20

<210> 16

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 16

tgtgaggatt cttgtcaaca 20

<210> 17

<211> 21

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 17

uauugugagg auuuuuguca a 21

<210> 18

<211> 21

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 18

ugcgguauug ugaggauuct t 21

<210> 19

<211> 23

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 19

acagcattgt gaggattctt gtc 23

<210> 20

<211> 23

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 20

uauugugagg auuuuuguca aca 23

<210> 21

<211> 23

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 21

auugugagga uuuuugucaa caa 23

<210> 22

<211> 23

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 22

uugugaggau uuuugucaac aag 23

<210> 23

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 23

gugguggacu ucucucaaua gcagccgaaa ggcugc 36

<210> 24

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 24

uauugagaga aguccaccac gg 22

<210> 25

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 25

uuuugagga uuuuugucaa gg 22

<210> 26

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 26

ucugagagaa guccacacg gg 22

<210> 27

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 27

uacugaga aguccaccac gg 22

<210> 28

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 28

uaaaacugag agaaguccac gg 22

<210> 29

<211> 19

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 29

gacaagaatc ctcacaata 19

<210> 30

<211> 19

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 30

cgtggtggac ttctctcaa 19

<210> 31

<211> 19

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 31

gtggacttct ctcaatttt 19

<210> 32

<211> 19

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222>(6)..(6)

<223> n is a, c, g, or t

<400> 32

gacaanaatc ctcacaata 19

<210> 33

<211> 19

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (19)..(19)

<223> n is a, c, g, or t

<400> 33

cgtggtggac ttctctcan 19

<210> 34

<211> 19

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (15)..(15)

<223> n is a, c, g, or t

<400> 34

gtggacttct ctcantttt 19

<210> 35

<211> 22

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 35

tgttgacaag aatcctcaca at 22

<210> 36

<211> 21

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 36

tcgtggtgga cttctctcaa t 21

<210> 37

<211> 22

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (10)..(10)

<223> n is a, c, g, or t

<400> 37

tgttgacaan aatcctcaca at 22

<210> 38

<211> 21

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (20)..(20)

<223> n is a, c, g, or t

<400> 38

tcgtggtgga cttctctcan t 21

<210> 39

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 39

ugcacuucgc gucaccucua gcagccgaaa ggcugc 36

<210> 40

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 40

uagaggugac gcgaagugca gg 22

<210> 41

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 41

gcaccucucu uuacgcggaa gcagccgaaa ggcugc 36

<210> 42

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 42

uuccgcguaa agagaggugc gg 22

<210> 43

<211> 36

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (1)..(1)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (1)..(2)

<223> can be modified with phosphorothioate

<220>

<221> distinguishing characteristic

<222> (2)..(2)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (3)..(3)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (4)..(7)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (8)..(10)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (11)..(11)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (12)..(13)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (14)..(16)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (17)..(17)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (18)..(26)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (27)..(27)

<223> can be modified with 2'-modified -GalNAc-guanosine

<220>

<221> distinguishing characteristic

<222> (28)..(30)

<223> can be modified with 2'-modified -GalNAc-adenosine

<220>

<221> distinguishing characteristic

<222> (31)..(36)

<223> can be modified with 2'-O-methyl ribonucleotide

<400> 43

gacaaaaauc cucacaauaa gcagccgaaa ggcugc 36

<210> 44

<211> 23

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<220>

<221> distinguishing characteristic

<222> (1)..(1)

<223> can be modified with 4'-O-monomethylphosphonate-2'-O-methyluridine

<220>

<221> distinguishing characteristic

<222> (1)..(4)

<223> can be modified with phosphorothioate

<220>

<221> distinguishing characteristic

<222> (2)..(3)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (4)..(4)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (5)..(5)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222>(6)..(6)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (7)..(8)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222>(9)..(9)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (10)..(10)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (11)..(11)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (12)..(12)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (13)..(13)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (14)..(14)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (15)..(15)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (16)..(16)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (17)..(18)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (19)..(19)

<223> can be modified with 2'-fluoro-deoxyribonucleotide

<220>

<221> distinguishing characteristic

<222> (20)..(22)

<223> can be modified with 2'-O-methyl ribonucleotide

<220>

<221> distinguishing characteristic

<222> (20)..(22)

<223> can be modified with phosphorothioate

<400> 44

uuauugugag gauuuuuugu cgg 23

<210> 45

<211> 50

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 45

tgttgacaag aatcctcaca atacctcgtg gtggacttct ctcaattttc 50

<210> 46

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 46

ggaacuguuu uuaggagugu uu 22

<210> 47

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 47

ggaacuguuc uuaggagugu uu 22

<210> 48

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 48

ggcuguuuuu aggaguguua uu 22

<210> 49

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 49

ggcuguucuu aggaguguua uu 22

<210> 50

<211> 22

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 50

ttgacaagaa tcctcacaat ac 22

<210> 51

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 51

gggcaccacc ugaagagagu cu 22

<210> 52

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 52

gggcaccacc ugaagagagu uu 22

<210> 53

<211> 22

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 53

ctcgtggtgg acttctctca at 22

<210> 54

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 54

ggcaccaccu gaagagaguc au 22

<210> 55

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 55

ggcaccaccu gaagagaguu au 22

<210> 56

<211> 22

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 56

tcgtggtgga cttctctcaa tt 22

<210> 57

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 57

ggcaccugaa gagagucaaa au 22

<210> 58

<211> 22

<212> RNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 58

ggcaccugaa gagaguuaaa au 22

<210> 59

<211> 22

<212> DNA

<213> Synthetic sequence

<220>

<223> Synthetic polynucleotide

<400> 59

tggtggactt ctctcaattt tc 22

<---

Claims (78)

1. Oligonucleotide to reduce the expression of hepatitis B surface antigen (HBsAg) mRNA, containing a sense strand forming a duplex region with an antisense strand, where: the sense strand consists of a sequence such as GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8) and containing 2'-fluoro-modified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and phosphorothioate bond between nucleotides in positions 1 and 2, where each of the nucleotides of the -GAAA- sequence of the sense chain is conjugated to a monovalent GalNac fragment; a the antisense strand consists of a sequence such as UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1) and containing 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and phosphorothioate bonds between nucleotides at positions 1 and 2, between nucleotides at positions 2 and 3, between nucleotides at positions 3 and 4, between nucleotides at positions 20 and 21, and between nucleotides at positions 21 and 22, and where the 4'-sugar carbon of the 5'-nucleotide of the antisense strand comprises methoxyphosphonate (MOP). 2. An oligonucleotide according to claim 1, wherein the 5'-nucleotide of the antisense strand has the following structure:  

3. Oligonucleotide according to claim 1 or 2, where the sequence -GAAA- contains the structure:

where: L is a bond, click-latch or linker from 1 to 20 consecutive covalently bonded atoms in length, inclusive, selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; as well as X is O or S. 4. Oligonucleotide according to claim 3, where L is an acetal linker. 5. Oligonucleotide according to claim 3 or 4, where X is O. 6. Oligonucleotide according to any one of claims 1 to 5, where the sequence -GAAA- contains the structure:

. 7. Oligonucleotide to reduce the expression of hepatitis B surface antigen (HBsAg) mRNA, containing a sense strand forming a duplex region with an antisense strand, where: the meaning chain consists of a sequence such as GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8) and containing 2'-fluoro-modified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate internucleotide bond between nucleotides in positions 1 and 2, where each of the nucleotides of the -GAAA- sequence of the sense strand is conjugated to a monovalent GalNac fragment, and where the -GAAA- sequence contains the structure:

; and the antisense strand consists of a sequence such as UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1) and containing 2'-fluoro-modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and five phosphorothioate internucleotide bonds between nucleotides at positions 1 and 2, between nucleotides at positions 2 and 3, between nucleotides at positions 3 and 4, between nucleotides at positions 20 and 21, and between nucleotides at positions 21 and 22, where the 5'-nucleotide of the antisense strand has the following structure:

. 8. Double-stranded oligonucleotide to reduce the expression of hepatitis B surface antigen (HBsAg) mRNA containing the sense strand: 5' mG–S–mA–fC–mA–mA–mA–mA–fA–fU–fC–mC–fU–fC–mA– mC–mA–fA–mU–mA–mA–mG–mC–mA– mG–mC–mC–[ademG–GalNAc]–[ademA–GalNAc]–[ademA–GalNAc]–[ademA–GalNAc]–mG–mG–mC–mU–mG–mC 3', and antisense strand: 5' [MePhosphonate–4 O– mU]–S–fU–S–fA–S–mU–fU–mG–fU– fG–mA–fG–mG–fA–mU–fU–mU–fU–mU–mG –fU–mC–S–mG–S–mG 3', wherein: "—" between nucleosides represents a phosphodiester internucleoside bond; "–S–" between nucleosides represents a phosphorothioate internucleoside bond; mA is 2'-O-methyladenosine ribonucleoside; mG is 2'-O-methylguanosine ribonucleoside; mC is 2'-O-methylcytidineribonucleoside; mU is 2'-O-methyluridine ribonucleoside; fA is 2'-fluoroadenosine deoxyribonucleoside; fG is 2'-fluoroguanosine deoxyribonucleoside; fC is 2'-fluorocytidine deoxyribonucleoside; fU is 2'-fluorouridine deoxyribonucleoside; [ademG-GalNAc] is

; [ademA-GalNAc] represents

; and [MePhosphonate-4O-mU] represents yourself

. 9. Double-stranded oligonucleotide according to claim 8, having the following formula:

10. A composition for reducing hepatitis B surface antigen (HBsAg) mRNA expression, comprising an effective amount of an oligonucleotide according to any one of claims 1 to 9. 11. Composition according to claim 10 containing a counterion. 12. Composition according to claim 10 or 11, containing a pharmaceutically acceptable carrier. 13. Composition according to any one of claims 10-12 containing an excipient. 14. Composition according to any one of claims 10-13, containing a phosphate-buffered saline solution. 15. A method for reducing in vitro expression of hepatitis B virus (HBV) surface antigen (HBsAg) in a cell, comprising delivering an oligonucleotide according to any one of claims 1 to 9 into the cell. 16. The method of claim 15, wherein the cell is a hepatocyte. 17. The use of an oligonucleotide according to any one of claims 1-9 or a composition according to any one of claims 10-14 for the treatment of an HBV infection in a subject. 18. The use of claim 17 wherein the oligonucleotide or composition is administered subcutaneously to the subject. 19. The use of claim 17 wherein the oligonucleotide or composition is administered intravenously to a subject. 20. Use according to claim 17, wherein the composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a solvent or dispersion medium containing water. 21. Use according to any one of claims 17-20, wherein the subject is a positive HBV e-antigen (HbeAg) patient. 22. Use according to claim 21, wherein the HbeAg positive patient has a serum HBV surface antigen (HbsAg) >1000 IU/mL. 23. Use according to any one of claims 17-20, wherein the subject is an HbeAg negative patient. 24. Use according to claim 23, wherein the HbeAg negative patient has a serum HBsAg >500 IU/mL. 25. Application according to any one of paragraphs. 17-20, where the subject has serum HBV DNA >20,000 IU/mL.

Images