CN109234275A - A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously - Google Patents
A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously Download PDFInfo
- Publication number
- CN109234275A CN109234275A CN201811001372.0A CN201811001372A CN109234275A CN 109234275 A CN109234275 A CN 109234275A CN 201811001372 A CN201811001372 A CN 201811001372A CN 109234275 A CN109234275 A CN 109234275A
- Authority
- CN
- China
- Prior art keywords
- gem
- hepatitis
- hbsag
- hbv
- asos
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
Abstract
The present invention provides a kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously, the antisense nucleoside base sequence is included in following base sequence: 5 '-aagaagatgaggcatagcagcaggatg-3 ', wherein a represents adenine, g represents guanine, c represents cytimidine, and t represents thymidine.Additionally provide the purposes of the GEM 132 and the pharmaceutical composition containing the GEM 132.
Description
Technical field
The invention belongs to GEM 132 fields, and in particular to one kind can inhibit hepatitis B virus DNA and hepatitis B table simultaneously
The GEM 132 of face antigen.
Background technique
It is the chronic infection of hepatitis type B virus (HBV) that, which there are about 2.4 hundred million people in the whole world, such as without effective treatment, wherein extremely
Rare about 1/4 crowd will finally develop as hepatitis, cirrhosis even hepatocellular carcinoma.The annual whole world have about 650,000 people die of because
Hepatic failure caused by HBV infection, cirrhosis and hepatocellular carcinoma.There are 93,000,000 Patients with Chronic HBV Infection in China's Mainland.According to Chinese disease
Sick control centre's statistics in 2016 just has about 1,070,000 people when being only newly-increased hepatitis B case load.
The therapeutic agent of hepatitis B only has two classes: interferons and hbv replication enzyme inhibitor-nucleosides (acid) analog medicine at present
Object, comprising: Lamivudine, adefovirdipivoxil, Entecavir, Sebivo, Lamivudine, tenofovir Chinese mugwort draw phenol amine, Bei Xifu
Wei.Interferons drug is nonspecific therapeutic agent, limited to treating chronic hepatitis B effect, and is had apparent clinical secondary
The inconvenience for acting on and using.Nucleosides (acid) analog can effectively inhibit HBV DNA level, but cannot thoroughly remove disease
Poison needs Long-term taking medicine.Once there is drug resistance, the drug resistance to all similar nucleosides (acid) classes may be shown as, without other medications
Selection.Therefore, under the conditions of existing treatment, chronic infection can be controlled by Long-term taking medicine, but can not be cured substantially.Due to
The drug resistance being likely to occur, chronic hepatitis B infections crowd still face higher progression of disease risk.
Although having more mature hepatitis b precaution vaccine.But it since vaccine popularity rate is low, is lost after vaccine injection
It imitates, the reasons such as specific condition infection, the propagation of hepatitis B is not off in global range.Infection population radix is huge, right
The clinical demand of new treatment method is strong.
Hepatitis B viruses (HBV) is a kind of hepadnavirus (Hepadnaviridae), and genome is that partially double stranded DNA is tied
Structure.It cotransports after the infection such as polypeptide (NTCP) enter liver cell by cell surface receptor-sodium ion taurocholate, genome turns
Turn to the closed loop double-stranded DNA structure (cccDNA) of full double-strand.Using cccDNA as template, virus will transcribe out several RNA templates,
And thus translation generates the required various functional proteins and structural protein of host genome integration.Meanwhile there are also a large amount of
Hepatitis B surface antigen (HBsAg) is expressed and is discharged into host circulation system.The level of HBsAg is usual in infected person's blood
Reach 100 times or more of viral particle levels.A large amount of HBsAg can lead to CD8 of the host with antiviral functions+T cell
It exhausts.And studies have reported that confirm that HBsAg can also be by regulation dendritic cells, the function of monocyte and NK cell, directly
Connect the immunological response for inhibiting host HBV specificity.Thus HBV has escaped the clean-up effect of host immune system.
The first aim of the following treating chronic hepatitis B is to realize " functionality is cured ", it may be assumed that while removing HBV DNA,
Also HBsAg is removed, realizes the Virus mutation of HBsAg.Ultimate aim is then the fully erased of the intracellular HBV virus of realization.This
Also it depends on HBsAg to be removed, the recovery that host immune system reacts HBV normal immunological.
The direct antiviral drugs of existing nucleosides (acid) class can only inhibit cccDNA duplication to generate genomic DNA, to HBsAg
Be produced without direct repression.Developing the drug with HBsAg scavenging effect has ten to the clinical treatment of chronic hepatitis B
Divide positive meaning.
In recent years, researcher realizes in the method for RNA interference (RNAi) to HBsAg's in HBV animal pattern body
Efficiently inhibit.And theoretically using more mature thio oligomerization GEM 132 (ASOs) technology of technology, may be implemented and
The identical inhibitory effect of RNAi.ASOs can be lured by base pair complementarity mode, specific combination complementary with target RNA
Lead the RNA degradation process of RNase H dependence.If selecting suitable binding sequence, ASOs may realize simultaneously to HBV DNA and
The inhibiting effect of HBsAg.
Summary of the invention
The technical problem to be solved by the present invention is to utilize Phosphorothioate oligonucleotides drug technique, designs and filter out same
When with inhibit HBV DNA and HBsAg effect antisense oligonucleotide (ASOs).
In order to solve the above technical problems, the technical solution used in the present invention is:
First to known Gene A, the full-length genome of B, C, D, E, F, G, H-type HBV carry out sequence alignment, select different bases
Because of the identical sequence of interval of type more control sequences segment, ASOs sequence design is carried out.Designed sequence should position as far as possible
In the lap for the different RNA segments that HBV virus transcription goes out, and pay attention to the equilibrium of different bases ratio.With Gene A type HBV
For genome, nucleic acid sequence section selected by the present invention is 409-435.Base sequence length is designed in this section is
The full complementary oligonucleotide sequence that 20-27 is not waited, as shown in table 1.
1 antisense oligodeoxynucleotideon sequence table of table
SEQ ID NO | Antisensedigonucleotsequence sequence (5 ' -3 ') | Complementary target-gene sequence position |
SEQ01 | aagaagatgaggcat agcag | 416-435 |
SEQ02 | agaagatgaggcatagcagc | 415-434 |
SEQ03 | gaagatgaggcatagcagca | 414-433 |
SEQ04 | aagatgaggcatagcagcag | 413-432 |
SEQ05 | agatgaggcatagcagcagg | 412-431 |
SEQ06 | gatgaggcatagcagcagga | 411-430 |
SEQ07 | atgaggcatagcagcaggat | 410-429 |
SEQ08 | tgaggcatagcagcaggatg | 409-428 |
SEQ09 | gaagatgaggcatagcagcag | 413-433 |
SEQ10 | aagatgaggcatagcagcagg | 412-432 |
SEQ11 | agaagatgaggcatagcagcag | 413-434 |
SEQ12 | aagatgaggcatagcagcagga | 411-432 |
SEQ13 | aagaagatgaggcatagcagcag | 413-435 |
SEQ14 | aagatgaggcatagcagcaggat | 410-432 |
SEQ15 | aagaagatgaggcatagcagcagg | 412-435 |
SEQ16 | aagaagatgaggcatagcagcagga | 411-435 |
SEQ17 | aagaagatgaggcatagcagcaggat | 410-435 |
SEQ18 | aagaagatgaggcatagcagcaggatg | 409-435 |
SEQ19 | gaggattaggcacagcagag | Mispairing |
It will be using the most for the stability for improving ASOs with the designed oligonucleotide sequence of automatic dna synthesizer synthesis
Common complete thio form.In actual development, the thio ASOs in part also can satisfy stability requirement.
Later, suitable pharmacological techniques is selected to carry out Pharmacodynamics screening and evaluation to the ASOs of design.It will use first
The model of cytology level is screened, and obtaining in designed ASOs has the sequence for significantly inhibiting effect to HBsAg and HBV DNA
Column.Later, using mouse hydrodynamic force injection model as platform, internal pharmacodynamic evaluation is carried out to the ASOs preferably gone out, screening is tied
Fruit is confirmed.
The HepG2.2.15 cell line of expression HBV plasmid is stablized in in-vitro screening selection, will with liposome when cultivating in vitro
Test ASOs is transfected into cell, cultivate it is horizontal using HBsAg in the ELISA kit test supernatant of commercialization after 72h, and it is molten
Matchmaker's control group is compared.Research will be simultaneous with mispairing ASO sequence as negative control, and commercially available hepatitis B medicine Entecavir is made
For positive control (only inhibiting HBV DNA, do not inhibit HBsAg).
On the basis of above-mentioned the selection result, preferably several ASOs carry out HBV DNA still in HepG2.2.15 cell line
The influence of secretion level is tested.The test of HBV DNA will be realized using the method for real-time quantitative PCR.
On the basis of above-mentioned the selection result twice, preferably several ASOs enter animal pharmacodynamics evaluation phase.C57 mouse
HBV plasmid is injected through tail vein hydrodynamic force and makes its infection.Single injection ASOs later, investigate its to mice plasma HBsAg and
The influence of HBV DNA level is still compareed using mispairing ASO and ETV as research.
ASOs designed by the present invention has different degrees of inhibition to HBV DNA and HBsAg in vitro and in vivo, wherein
The inhibitory effect of SEQ04 and SEQ09 is the most significant, is detailed in the embodiment of the present invention.
Main advantages of the present invention are:
(1) the designed ASOs developed can effectively inhibit HBV to be totally different from the mechanism of action of traditional hepatitis B medicine
Self-replacation in host;
(2) the designed ASOs developed can inhibit HBV viral DNA and the generation of HBsAg simultaneously, and traditional hepatitis B medicine
It can only inhibit HBV DNA, there is no depression effect to HBsAg.The removing prompt patient of HBsAg has better outcome, is
Most of patients realizes that functional cure provides possibility;
(3) due to ASO self-characteristic, the ASO single injection inhibitory effect of designed exploitation can at least continue 7 days;
(4) since mechanism of action is different from traditional hepatitis B medicine, ASOs will not theoretically intersect resistance to traditional hepatitis B medicine
Medicine, and be applied in combination and may have concertedness effect.
Below in conjunction with specific embodiment, the present invention is further explained.It should be understood that the following example is merely to illustrate the present invention
Rather than it limits the scope of the invention.The research method of implementation detail is not specified in embodiment, can refer to " pharmacological experiment
Guide-new drug discovery and pharmacological evaluation " (moral H.G. Wo Geer etc. writes, and Du Guanhua etc. is translated) and instrument, the offer of kit manufacturer
Handbook is completed.Unless otherwise defined, all technical terms used in text of the present invention and those skilled in the art be familiar with and
Common technical term meaning is identical.In addition, any method similar to or equal to what is recorded and material all can be applied to
In the present invention.
Detailed description of the invention
Fig. 1 shows different ASOs and ETV to the inhibition percentage (%) of HepG2.2.15 cell secretion HBV DNA;
Fig. 2 indicates single injection ASOs to the blood plasma HBsAg of C57 mouse tail vein hydrodynamic force injection HBV plasmid pharmacodynamics model
Horizontal influence %, of control, Mean ± SD);
Fig. 3 indicates single injection ASOs to the blood plasma HBV of C57 mouse tail vein hydrodynamic force injection HBV plasmid pharmacodynamics model
The influence (%of control, Mean ± SD) of DNA level.
Specific embodiment
The synthesis of the thio oligomerization GEM 132 of embodiment 1
Thio oligonucleotide can be used DNA/RNA automatic synthesizer and realize Fully automated synthesis.Using GE Amersham
Oligonucleotide sequences needed for the AKTA Oligopilot DNA/RNA synthesizer synthesis of company.Purifying and desalination
It is completed using the AKTA ion-exchange purification system of Amersham company.Required reagent can be bought from GE Amersham company, behaviour
It can refer to relevant product description to realize.
The preparation process of oligonucleotide is summarized as follows:
(1) AKTA Oligopilot DNA/RNA synthesizer (GE Amersham) specification is referred to, will be reacted
Solvent (acetonitrile), nucleotide monomer reagent: adenine (A) monomer, guanine (G) monomer, cytimidine (C) monomer and thymidine
(T) monomer), thio reagents, closed reagent and deprotecting regent are broken seal, and are installed at specified tool interface system;
(2) AKTA Oligopilot Unicorn4.0 synthesis control system is opened and connected, synthesis control program is write.
The oligonucleotide sequences of confirmation input and thio-modification site are errorless, and starting is automatically synthesized;
(3) synthesis crude product is collected, strong negative Ag ion exchange column (cylinder: Fineline100, filler: Source is connected
30Q) purified;
(4) it is de- to reconnect reverse-phase chromatographic column (cylinder: Fineline100, filler: Source 15RPC) for product after purification
Salt;
(5) product after purifying and desalination is collected, 50 DEG C of rotary evaporations are concentrated into about the 30% of original volume;
(6) spectrophotometer is used, is tested synthetic product 260nm absorbance (OD260), is roughly calculated using following formula
Oligonucleotides acid concentration: DNA content (μ g/ml)=50 × OD260 × extension rate;
(7) it is sealed after 4 DEG C of preservations or vacuum freeze drying after product sealing.
Synthesizing 19 length of nucleotides altogether is 19 complete thio oligonucleotides that 20-27 is not waited.Its base sequence such as table 1
It is shown.
Inhibition of the thio oligomerization GEM 132 of embodiment 2 to the HepG2.2.15 cell secretion HBsAg of in vitro culture
Experimental method is as follows:
(1) first day, HepG2.2.15 cell (25000/hole) is planted in 96 orifice plates, and to contain 10% cow's serum
The DMEM culture medium culture of albumen;
(2) second days, culture for 24 hours after, using Lipofectamine 2000 (Life technologies,
Carlsbad, CA) ASOs is transfected into cell, two multiple holes of each ASOs;Each ASOs transfection concentrations be respectively 0.5 μM and
5.0μM.Meanwhile 1.0nM Entecavir (ETV) to be added in culture solution as positive control;(experimental concentration of ETV is 0.5nM
And 2.0nM, it is not required to transfect, DMSO solution is directly added into cultivating system.The volume of DMSO is no more than the 5% of cultivating system)
(3) the 5th days, after being further cultured for 72h, the cell and supernatant in orifice plate were collected respectively.
(4) using the HBsAg content in ELISA method detection supernatant, detection method referring to kit (Abazyme LLC,
MA) specification;
(5) with solvent (Lipofectamine 2000) control for reference, inhibition hundred of the ASOs to HBsAg in supernatant is calculated
Divide ratio, and to the suppression percentage of intracellular HBV RNA, formula is as follows:
%HBsAg inhibiting rate=(1- sample HBsAg level/Vehicle controls HBsAg is horizontal) × 100%
(6) another 96 orifice plate cell for making same treatment using ASOs simultaneously uses CellTiter Glo after cultivating 72h
Detect every hole cell viability.
CellTiter Glo reagent is added in every hole, reads values of chemiluminescence.Cell activity percentage is calculated with following formula
Than:
% cell viability=(drug-treated chemiluminescence readings-Vehicle controls sample chemical shines)/Vehicle controls
Sample chemical shines) × 100%
As a result illustrate:
(table 1SEQ01-SEQ19, wherein SEQ19 is base mispairing sequence to 19 GEM 132s, not any with HBV RNA
Base sequence matches completely, the negative control as experiment) HepG2.2.15 is carried out respectively with 5 nanomoles (nM) and 20nM concentration
Cell secretes the inhibitory activity test of HBsAg, and the results are shown in Table 2.
SEQ01-SEQ18 has different degrees of suppression to HepG2.2.15 cell secretion HBsAg under 5nM and 20nM concentration
System.Inhibiting rate is apparently higher than 5nM concentration under 20nM concentration.Wherein, SEQ03, SEQ04, SEQ05, SEQ09, SEQ10 are dense in 20nM
When spending, 70% or more is reached to the inhibiting rate of HBsAg.
The mispairing type SEQ19 of experiment is without obvious depression effect simultaneously.In the treating hepatitis B drug entecavir of clinical use
To HBsAg also unrestraint effect, the mechanism of functioning is consistent Wei (English name: Entecavir, abbreviation: ETV).
In cell viability experiment, all tested oligonucleotides do not make significant difference to HepG2.2.15 cell viability
(cell activity percentage range: 94.6%-107.3%).It is thin to illustrate that oligonucleotide is not due to kill to the inhibition of HBsAg
Born of the same parents cause.
Inhibitory activity statistical form of the thio oligonucleotide of table 2 to HepG2.2.15 cell secretion HBsAg
*: the experimental concentration of ETV is 0.5nM and 2.0nM;
Inhibition of the embodiment 3ASOs to the HepG2.2.15 cell secretion HBV DNA of in vitro culture
Experimental method is as follows:
(1) first day, HepG2.2.15 cell (25000/hole) is planted in 96 orifice plates and cultivated;
(2) second days, culture for 24 hours after, using Lipofectamine 2000 (Life technologies,
Carlsbad, CA) ASOs is transfected into cell, two multiple holes of each ASOs;Each ASOs transfection concentrations be respectively 0.5 μM and
5.0μM.Meanwhile 1.0nM Entecavir (ETV) to be added in culture solution as positive control;(experimental concentration of ETV is 0.5nM
And 2.0nM, it is not required to transfect, DMSO solution is directly added into cultivating system.The volume of DMSO is no more than the 5% of cultivating system)
(3) the 5th days, after being further cultured for 72h, the cell and supernatant in orifice plate were collected respectively.
(4) DNA in supernatant is extracted, with the HBV DNA content in quantitative PCR detection supernatant.PCR primer: 5 '-CCC
GTT TGT CCTCTA ATT CC-3 ' and 5 '-GTC CGA AGG TTT GGT ACA GC-3 ';
(5) using Vehicle controls as reference, it is as follows to the suppression percentage formula of HBV DNA in supernatant to calculate ASOs:
%HBV DNA inhibiting rate=(1- sample HBV DNA copy number/Vehicle controls HBV DNA copy number) × 100%;
Parallel hole data calculates mean value (Mean) and standard deviation (SD)
As a result illustrate:
Secreting HBV DNA inhibiting rate to HepG2.2.15 cell when test concentrations are 20nM only in embodiment 2 is more than
70% ASOs, including SEQ03, SEQ04, SEQ05, SEQ09 and SEQ10, are included into this experiment.SEQ19 is that mispairing feminine gender is right
According to ETV is as positive control.Test result is as shown in Fig. 2.
SEQ03, SEQ04, SEQ09 are in 20nM concentration to the average inhibition of HepG2.2.15 cell secretion HBV DNA
More than 70%, respectively 75.4%, 89.4% and 88.8%.Wherein, SEQ04 and SEQ09 is in 5nM concentration to HepG2.2.15
The average inhibition that cell secretes HBV DNA is more than 30%, respectively 40.0% and 38.9%.Negative control SEQ19 is to HBV
DNA is without obvious inhibiting effect.Known HBV DNA inhibitor ETV is thin to HepG2.2.15 when concentration is 0.5nM and 2.0nM
The average inhibition of intracrine HBV DNA is 67.9% and 96.5%.
Inhibition of the embodiment 3ASOs to HBV in hydrodynamic force injection HBV plasmid mouse model body
Experimental method is as follows:
(1) the 0th day, C57 mouse (every group 8) passed through tail vein injection pAAV2-HBV1.3mer Plasmid DNA;
(2) the 1st days, single intravenous injection tested ASOs, solvent PEG400, volume injected 0.4ml;ETV group is then every
Day sodium carboxymethylcellulose suspension stomach-filling, continuous 7 days, dosage 1mg/kg/day;
(3) the 1st, 3,5,7 days timing acquiring blood plasma, and embodiment 2, embodiment 3 with method test blood plasma HBV DNA and
HBsAg is horizontal.
(4) using blank control as reference, it is public to the suppression percentage of HBsAg and HBV DNA in mice plasma to calculate ASOs
Formula is as follows:
%HBsAg inhibiting rate=(1- sample HBsAg level/Vehicle controls HBsAg is horizontal) × 100%;
%HBV DNA inhibiting rate=(1- sample HBV DNA copy number/Vehicle controls HBV DNA copy number) × 100%;
As a result illustrate: blood plasma of the single injection ASOs to C57 mouse tail vein hydrodynamic force injection HBV plasmid pharmacodynamics model
The influence of HBsAg level is as shown in Figure 2.SEQ04 and SEQ09 significantly inhibits effect to HBsAg level.Inhibiting effect is infused by D1
Start to continue to D7 after penetrating, compared with Vehicle controls, highest inhibiting rate respectively reaches about 77.3% and 68.7%.Test simultaneously
Mismatch controls SEQ19 has no significant effect HBsAg level.ETV is not oral daily significant on HBsAg influence, only surveys in D7
Pilot HBsAg level decreased significantly compared with control group, inhibit in mouse liver cell the possible reason is continuously taking ETV
HBV DNA level inhibits the generation of HBsAg indirectly.
Blood plasma HBV DNA water of the single injection ASOs to C57 mouse tail vein hydrodynamic force injection HBV plasmid pharmacodynamics model
Flat influence is as shown in Fig. 3.SEQ04 and SEQ09 significantly inhibits effect to HBV DNA level.After inhibiting effect is injected by D1
Start to continue to D7, compared with Vehicle controls, highest inhibiting rate respectively reaches about 62.9% and 39.9%.The mispairing of test simultaneously
Control SEQ19 has no significant effect HBV DNA level.ETV takes orally daily can be significantly reduced HBV DNA level, highest in 7 days
Inhibiting rate can reach 76.6%.
These results suggest that SEQ04 and SEQ09 significantly inhibits effect to HBsAg and HBV DNA level in mice plasma
Fruit, inhibitory effect can at least continue 7 days after single injection.In contrast, daily oral hepatitis B therapeutic agent ETV can only then press down
HBV DNA level processed, it is little to the direct repression of HBsAg.The above results difference and the mechanism of action of two kinds of drugs have
It closes.
Claims (10)
1. a kind of GEM 132, which is characterized in that the antisense nucleoside base sequence is included in following base sequence:
5’-aagaagatgaggcatagcagcaggatg-3’
Wherein a represents adenine, and g represents guanine, and c represents cytimidine, and t represents thymidine.
2. GEM 132 as described in claim 1, which is characterized in that antisense base sequences are repaired by completely or partially thio
Decorations.
3. GEM 132 as described in claim 1, which is characterized in that antisense nucleoside base sequence length is 10-27.
4. GEM 132 as described in claim 1, which is characterized in that the nucleotide sequence containing SEQ04.
5. GEM 132 as described in claim 1, which is characterized in that the nucleotide sequence containing SEQ09.
6. the purposes of GEM 132 as described in claim 1, which is characterized in that for hepatitis b virus infected relevant
The prevention and treatment of human diseases.
7. the purposes of GEM 132 as described in claim 1, which is characterized in that the GEM 132 can inhibit simultaneously
Hepatitis B virus DNA and hepatitis B surface antigen.
8. GEM 132 purposes as claimed in claim 6, which is characterized in that human diseases include it is various types of it is acute,
Chronic hepatitis B.
9. a kind of pharmaceutical composition, which is characterized in that the pharmaceutical composition contains the described in claim 1 of effective dose
GEM 132 and pharmaceutically acceptable carrier.
10. pharmaceutical composition as claimed in claim 9, which is characterized in that the pharmaceutical composition also contains: plain interferon,
Long-acting interferon, Lamivudine, adefovirdipivoxil, Entecavir, Sebivo, Lamivudine, tenofovir Chinese mugwort draw phenol amine or shellfish
Xi Fuwei.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811001372.0A CN109234275A (en) | 2018-08-30 | 2018-08-30 | A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811001372.0A CN109234275A (en) | 2018-08-30 | 2018-08-30 | A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109234275A true CN109234275A (en) | 2019-01-18 |
Family
ID=65069837
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811001372.0A Pending CN109234275A (en) | 2018-08-30 | 2018-08-30 | A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109234275A (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1218056A (en) * | 1997-08-27 | 1999-06-02 | 中国科学院上海生物化学研究所 | Transdeoxyoilnucleotide for inhibiting replication of hepatitis B virus |
CN1793359A (en) * | 2005-11-15 | 2006-06-28 | 杨安钢 | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof |
CN103582648A (en) * | 2011-04-21 | 2014-02-12 | Isis制药公司 | Modulation of hepatitis b virus (HBV) expression |
-
2018
- 2018-08-30 CN CN201811001372.0A patent/CN109234275A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1218056A (en) * | 1997-08-27 | 1999-06-02 | 中国科学院上海生物化学研究所 | Transdeoxyoilnucleotide for inhibiting replication of hepatitis B virus |
CN1793359A (en) * | 2005-11-15 | 2006-06-28 | 杨安钢 | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof |
CN103582648A (en) * | 2011-04-21 | 2014-02-12 | Isis制药公司 | Modulation of hepatitis b virus (HBV) expression |
CN106191060A (en) * | 2011-04-21 | 2016-12-07 | Isis制药公司 | The regulation that hepatitis B virus (HBV) is expressed |
Non-Patent Citations (3)
Title |
---|
ALONSO ET AL.: "Upcoming pharmacological developments in chronic hepatitis B: can we glimpse a cure on the horizon?", 《BMC GASTROENTEROLOGY》 * |
陈玉等: "抗HBV反义寡核苷酸的筛选", 《安徽医学》 * |
韩金祥等: "硫代磷酸反义寡脱氧核苷酸抗HBV 细胞的实验研究", 《中国生物化学与分子生物学报》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11590156B2 (en) | RNAi agents for hepatitis B virus infection | |
CA3129261A1 (en) | Rnai agents for hepatitis b virus infection | |
CN103816174A (en) | Compositions and methods for treating viral infections | |
CN114621954B (en) | RNA inhibitor for inhibiting hepatitis B virus gene expression and application thereof | |
WO2018193902A1 (en) | Antiviral effect of microrna against hepatitis b virus | |
CN102257140A (en) | Treating hepatitis c virus infection with over-expression of microrna-196 | |
CN109234275A (en) | A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously | |
BR112021000538A2 (en) | OLIGONUCLEOTIDS TO MODULATE RTEL1 EXPRESSION | |
CN111773214B (en) | Use of 2,4, 5-trisubstituted 1,2, 4-triazolones in the preparation of antiviral medicaments | |
Meisel et al. | Inhibition of hepatitis B virus DNA polymerase by 3′‐fluorothymidine triphosphate and other modified nucleoside triphosphate analogs | |
CN101979556B (en) | Small interfering ribose nucleic acid (siRNA) targeting molecule and application thereof | |
Yu et al. | Strongylocentrotus nudus egg polysaccharide (SEP) suppresses HBV replication via activation of TLR4-induced immune pathway | |
US20240052350A1 (en) | Oligonucleotide and use thereof against hepatitis b virus and hepatitis d virus | |
CN114106097B (en) | Polypeptide for treating hepatocellular carcinoma and application thereof | |
CN102719436A (en) | Oligonucleotides and usage thereof in preparation of medicine for preventing and curing myocardial hypertrophy and heart failure | |
TWI835116B (en) | An RNA inhibitor that inhibits hepatitis B virus gene expression and its application | |
CN101979553B (en) | siRNA molecule for interfering HBV gene and antiviral application thereof | |
CN117535287A (en) | Small interfering nucleic acid of hepatitis B virus gene and application thereof | |
CN116790590A (en) | Antisense oligonucleotide of targeted hepatitis B virus RNA, corresponding chimeric molecule and application thereof | |
CN101084913A (en) | Application of ophiopognin saponin D in preparing vascular endothelial cells regulating signal transduction gene medicine | |
CN101979555B (en) | Small interference RNA molecule and application thereof | |
NZ790940A (en) | RNAi AGENTS FOR HEPATITIS B VIRUS INFECTION | |
CN116510017A (en) | Application of TRPV4 inhibitor in treatment of chronic hepatitis B, liver fibrosis and liver cancer | |
CN101979554B (en) | A kind of siRNA molecule and application thereof disturbing HBV gene | |
TW202346587A (en) | Antisense oligonucleotide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190118 |