CN1793359A - HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof - Google Patents
HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof Download PDFInfo
- Publication number
- CN1793359A CN1793359A CNA2005100963471A CN200510096347A CN1793359A CN 1793359 A CN1793359 A CN 1793359A CN A2005100963471 A CNA2005100963471 A CN A2005100963471A CN 200510096347 A CN200510096347 A CN 200510096347A CN 1793359 A CN1793359 A CN 1793359A
- Authority
- CN
- China
- Prior art keywords
- hbv
- sirna
- cell
- psuper
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention offers hepatitis b virus (HBV) specificity interference target site gene, siRNA, and their application in anti-HBV infection therapeutic drugs manufacturing. The HBV target gene can produce siRNA effector molecule which can identify and degrade HBV by vector expression. No matter whether directly injecting expression siRNA recombination vector to vein, or injecting artificial synthesis siRNA to hepatitis B patient, both of the high effect and special anti-HBV actions can be produced. The formed HBV target siRNA has the following features: high specificity, high efficiency, persistency, and safety. The invention can be used as new means for HBV infection treatment.
Description
Technical field
The present invention relates to the gene therapy of biological technical field, be specifically related to gene engineering method and make up hepatitis B virus (hepatitis B virus, HBV) siRNA (small interfering RNA, little intervening rna) of specificity interference target point gene, said gene generation and described gene and siRNA are used for the application of the medicine of anti HBV infecting in preparation.
Background technology
HBV belongs to hepadnavirus, for containing partially double stranded cyclic DNA virus.The long-chain of viral DNA is a minus strand, and short chain is a normal chain.The HBV genome is fine and close exquisite, the about 3.2kb of size.The persistent infection of HBV is one of global health problem of current serious, also is to cause the modal reason of chronic hepatopathy.The whole world has 3.5 hundred million chronic HBV infection persons approximately at present, dies from HBV every year and infects relevant nearly 1,000,000 people of chronic hepatopathy.China is the district occurred frequently of hepatitis B, life and health by serious harm China people such as the caused viral hepatitis of HBV persistent infection, liver cirrhosis and liver cancer: nearly 10% population is the HBV carrier, existing disease hepatitis B patient more than 3,000 ten thousand people, 300,000 people that have an appointment every year die from hepatitis B and related complication thereof.Therefore, seek effective methods of treatment of hepatitis B, the key subjects that become current medical circle to need to be resolved hurrily.The medicine of at present granted control HBV persistent infection mainly contains interferon-' alpha ' and nucleoside analog such as lamivudine and Adefovir, but antiviral therapy means curative effect so far is satisfied inadequately: the lasting response rate of high dosage recombinant interferon only about about 30%, though nucleoside analog such as lamivudine antiviral activity are stronger, but the appearance of quick knock-on of virus replication level and multidrug resistant disease strain makes the enforcement of clinical antiviral scheme face great challenge after the drug withdrawal.Seek anti-HBV treatment new departure efficient, special, low toxicity is the target of people's unremitting pursue always.
(RNA interference is that double-stranded RNA (dsRNA) is mediation, sequence-specific PTGS phenomenon RNAi), extensively is present in the multiple organism in the RNA interference.The essence of RNAi is a kind of sequence-specific the acquired immune response by the RNA mediation, is the protection mechanism that a kind of primary genome antagonism alien gene is expressed, and is the immunity system of organism on genomic level.The Core Feature of RNAi is the anti-virus infection immunity, keeps the stability of transposon in the genome, removes unusual RNA, participates in the regulation and control of genetic expression simultaneously.Current, RNAi has developed into a kind of novel gene disruption technology, be used for efficiently closing specifically or reducing the expression of specific gene, be widely used in aspects such as new genescreen, gene function evaluation and gene therapy, having obtained positive progress aspect the treatment of tumour, virus infection etc., shown boundless application prospect.
Confirm that now the RNAi mechanism of action that dsRNA brings out is that the dsRNA in the cell degrades under the effect of Dicer-1 enzyme and produces siRNA, the latter discern in the presence of other activating enzymes and siRNA homologous mRNA and with its degraded.In mammalian cell, the introducing of the siRNA of 21nt has then successfully suppressed the target gene expression in the cell, has avoided dsRNA to activate interferon system simultaneously and the nonspecific action that produces.
Compare with nucleoside analog with the anti-HBV medicine Interferon, rabbit of classics, the RNAi technology has many advantages aspect the anti-HBV treatment: thus 1. specificity is duplicated at virus transcription product blocking virus, can not activate the non-specific cell reaction, the untoward reaction minimum; 2. RNAi has high efficiency, and a spot of siRNA just can reach and suppress HBV mRNA, reduces the effect of expressing viral product; 3. there are many potential RNAi target sites in the HBV genome, the target site point of hundreds of RNAi can be provided, select the conservative region site can effectively prevent the appearance of virus variant; 4. the effect of RNAi does not rely on duplicating of virus, siRNA can bring into play it and suppress the effect that protein expression level was transcribed and reduced to virogene under the non-active situation of duplicating of virus, and lamivudine only has restraining effect to the HBV that replication activity is arranged, and therefore can be used as the assisting therapy of antiviral lamivudine.
Summary of the invention
The objective of the invention is to make up the novel molecular that a kind of high specificity, active high energy continue anti HBV infecting, provide siRNA that a kind of HBV specificity interference target point gene, said gene transcribe generation and described gene and siRNA to be used for the application of the medicine of anti HBV infecting in preparation.
Technical solution of the present invention is:
The HBV specificity interference target point gene, it has sequence table＜400〉sequence of one of 1-5.
Transcribe the siRNA of generation by said gene, it has sequence table＜400〉sequence of one of 6-15.
Said gene is used for the application of the medicine of anti HBV infecting in preparation.
Above-mentioned siRNA is used for the application of the medicine of anti HBV infecting in preparation.
The present invention is based on siRNA and can close or reduce the principle of the expression of specific gene efficiently, specifically, adopt pSUPER carrier (grummelkamp TR, et al.Science 2002; 296:550-553) siRNA that produces realizes efficient, special, the lasting restraining effect to HBV.The present invention screens resulting HBV target gene, behind vector expression, produce and to discern specifically and the siRNA effector molecule of the HBV that degrades, no matter be to use expression siRNA recombinant vectors directly to carry out intravenous injection, or the siRNA of synthetic is injected in the hepatitis b patient, all can produce efficient, special anti-HBV effect.
The present invention screens resulting HBV target gene and has following characteristics: 1. Gao Du specificity---RNAi is the gene silencing mechanism of post-transcriptional level, the siRNA of the HBV target mRNA that HBV transcribes that can degrade very specifically, and independent basis is found in the experiment the HBV expression of gene not to be produced obviously influence at the siRNA of EGFP (green fluorescent protein) because of unaffected; 2. high efficiency---relatively very a spot of siRNA molecule just can produce intensive RNAi effect, suppresses the expression of HBV mRNA, reduces the effect of expressing viral product, and its level can reach the degree of deletion mutant phenotype; 3. persistence---HBV specific siRNA can be behind the carrier transfectional cell long-term expression, realize long term inhibition effect to HBV in the body; 4. security---because that use is the siRNA of 21nt, can activate interferon system and produce nonspecific action, untoward reaction minimum.
The present invention is expected to provide a kind of new tool for the treatment that HBV infects.
Description of drawings
Fig. 1 transcribes the synoptic diagram that generates siRNA for the pSUPER carrier.
Fig. 2 is that the RNA of HBV gene and transcript thereof interferes site information figure.
Fig. 3 is the double digestion qualification result figure of siRNA expression vector.
Fig. 4 is the cell cycle analysis figure as a result of the cell strain of stably express siRNA.
Fig. 5 is the growth curve of the cell of stably express siRNA.
Fig. 6 is the degraded figure of siRNA to the HBV gene mRNA.
Fig. 7 is the degraded figure of siRNA to the HBV transcription product.
Fig. 8 is the restraining effect figure of siRNA pair cell secretion HBsAg (A) and HBeAg (B).
Fig. 9 suppresses the immunofluorescence detected result figure (200 *) of the antigenic expression of HBV for siRNA.
Figure 10 is the Western blot analysis chart of cell pyrolysis liquid.
Figure 11 is the restraining effect figure of siRNA to (B) HBV DNA in culture supernatant (A) and the cell.
Figure 12 suppresses the expression figure of HBsAg (A) and HBeAg (B) lastingly for siRNA.
Figure 13 is the restraining effect figure of siRNA to HBsAg in the HBV transgenic mice body.
Figure 14 is HBV transgenic mice (A) and C57BL mouse (B) liver HE colored graph.
Figure 15 suppresses the expression figure of HBsAg in the transgenic mice body liver for siRNA
Figure 16 suppresses the copy pattern of HBV DNA in the transgenic mice body for siRNA
Embodiment
1.HBV the structure of specific siRNA expression vector
(1) transcribes the strategy that generates siRNA by DNA
Every of the oligonucleotide chain of design is 64nt, and 5 ' end and 3 ' end contains BglII and HindIII restriction enzyme site respectively, is convenient to be connected with the pSUPER carrier.Sequence and its reverse complemental of the encoding sequence of 5 ' end 19nt and target gene homology, another section 19nt, the TTCAAGAGA intervening sequence by 9nt forms ring texture therebetween, and end is added with transcription termination signal TTTTT.Form double-stranded DNA, the directed then pSUPER carrier (accompanying drawing 1) that inserts after having the oligonucleotide chain warp annealing, phosphorylation of said structure feature.PSUPER carrier with said structure can be transcribed the RNA (shRNA) that generates the hair clip shape, and the latter becomes siRNA and brings into play the function of inhibition of gene expression after the Dicer enzyme is cut.
(2) at the selection in HBV gene interference site and the design of oligonucleotide
According to the HBV nucleotide sequence of reporting among the GenBank (U95551), in siRNA design website
Http:// wwwl.qiagen.com/Products/GeneSilencing/CustomSiRna/SiRna Design Er.asDx, selecting to start length with AA in the gene coding region is 21 bases, the sequence of G+C content about 50% is as candidate siRNA target site.The siRNA sequence of designing carry out BLAST (
Http:// www.ncbi.nlm.nih.gov/blast/) the homology analysis turns out to be the HBV distinguished sequence.Choose HBV coding region 1683-1701,1580-1598,671-689,413-431,2027-2045 nucleotide sequence, according to can the encode oligonucleotide chain of siRNA of 2 64nt of the requirement of pSUPER carrier design, the oligonucleotide sequence two ends comprise BglII and HindIII restriction enzyme site, can directly be connected with the pSUPER carrier of cutting through same enzyme.Designed in addition with the siRNA expression vector pSUPER-EGFP of the irrelevant enhanced green fluorescence protein (EGFP) of HBV sequence in contrast.RNA at HBV gene and transcript thereof interferes site information as shown in Figure 2.
(3) double chain oligonucleotide is cloned into the pSUPER carrier
1. the annealing of oligonucleotide and phosphorylation
The synthetic single stranded oligonucleotide is dissolved in H
2Among the O, adjusting its concentration is 3 μ g/ μ l.Respectively get the synthetic fragment of the corresponding oligonucleotide of 1 μ l, add 48 μ l annealing buffers, 95 ℃ of insulation 5min were hatched 10 minutes for 70 ℃, slowly cooled to 4 ℃ and obtained the double-stranded DNA of annealing; Get 2 μ l annealed oligonucleotide, add 1 μ l T4 PNK damping fluid, 1 μ l 1mM ATP, 1 μ l T4 PNK, 5 μ l H
2O carries out the 30min phosphorylation 37 ℃ of water-baths, hatches 10 minutes deactivation PNK for 70 ℃.
2. double chain oligonucleotide and carrier is connected
The oligonucleotide of annealing and phosphorylation is connected with the pSUPER carrier through BglII and HindIII double digestion, transform DH5 α competent cell, picking is cloned, is shaken bacterium and cultivates back extraction plasmid, EcoR I and Hind III double digestion are identified, positive plasmid cuts out the band of about 300bp, and the size of empty plasmid is 240bp (accompanying drawing 3).Sequencing confirmation recombinant plasmid sequence and designed sequence are in full accord, respectively called after pSUPER-HBV1, pSUPER-HBV2, pSUPER-HBV3, pSUPER-HBV4, pSUPER-HBV5 and pSUPER-EGFP.
2.siRNA the genetic expression of HBV and duplicating in the inhibition cell
The HepG2 2.2.15 cell of siRNA expression vector that sequence is correct and 10: 1 in molar ratio cotransfection stably express of pTK-Hyg plasmid HBV, obtain stable monoclonal cell strain through the screening of 200 μ g/ml hygromycin resistances, observe the siRNA cell cycle of importing and the influence of the cell speed of growth; On the mRNA level, detect the inhibition situation of HBV mRNA with RT-PCR and Northern blot; With HBsAg and HBeAg content in micropartical enzyme immunoassay (MEIA) the detection by quantitative culture supernatant, immunofluorescence dyeing and Western blot detect the expression of corresponding antigens in the cell on protein level; Quantitative fluorescent PCR (FQ-PCR) detects the situation of duplicating of the inside and outside HBV DNA of cell; And dynamic observe the long term inhibition effect of siRNA to HBV.
(1) the siRNA cell cycle does not have obvious influence
Single cell suspension is made in the monoclonal cell digestion, the washing that filter out, through fixing, dyeing, detects the cell cycle and calculates the cell proliferation index.The flow cytometry result shows (accompanying drawing 4, table 1) stably express siRNA monoclonal cell strain, cell cycle is compared with contrast HBV-pSUPER with proliferation index and there is no significant difference, shows that importing HBV specific siRNA expression vector does not have obvious influence to the growth of HepG2 2.2.15 cell.
The cell cycle of the cell strain of table 1 stably express siRNA and proliferation index (PI)
| Cell | G 1％ | S％ | G 2％ | G 2/G 1 | PI％ |
| HBV1 HBV2 HBV3 HBV4 HBV5 HBV-pSUPER | 51.9 78.3 74.5 79.3 78.5 75.7 | 31.4 16.7 10.5 6.9 17.1 20.2 | 16.7 5.1 15.0 13.7 4.4 4.1 | 1.841 1.841 1.840 1.800 1.799 1.800 | 48.1 21.8 25.5 20.6 21.5 24.5 |
(2) siRNA cell growth curve does not have obvious influence
According to 3 * 10
3The monoclonal cell that the inoculation of/100 μ l/ holes filters out is in 7 96 orifice plates, when cultivating 1,2,3,4,5,6,7 day, respectively get 1 96 orifice plate, nutrient solution is abandoned in suction, every hole adds the MTT of 20 μ l 5mg/ml, sops up nutrient solution after continuing to cultivate 4h, and every hole adds 150 μ l DMSO, 10min is dissolving crystallized in concussion, and enzyme-linked immunosorbent assay instrument is measured the 490nm light absorption value.With the incubation time is X-coordinate, and light absorption value is an ordinate zou, draws each cell growth curve.Found that the cell speed of growth of stably express siRNA is similar to the speed of growth of control cells, do not have significant difference (accompanying drawing 5) between each group
(3) siRNA is to the degraded of HBV mRNA in the HepG2 2.2.15 cell
According to the gene order of HBV, be designed for the RT-PCR primer P1 and the P2 of amplification HBV 356-714 position, the glyceraldehyde 3-phosphate dehydro-genase that is used to increase (glyceraldehyde phosphatedehydrogenase, GAPDH) the primer G1 and the G2 of gene.The total RNA of the monoclonal cell that extraction filters out, reverse transcription generates cDNA, carries out the pcr amplification of HBV mRNA by following parameter with corresponding primer: 94 ℃ of pre-sex change 4min; 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 45sec, totally 25 circulations; 72 ℃ are extended 5min.The RT-PCR product that the result shows interference group cell at the band of 358bp position obviously secretly in the contrast band, the HBV mRNA expression product of transfection pSUPER-EGFP, pSUPER cell is compared no considerable change with HepG2 2.2.15 cell, and the expression of prompting HBV mRNA is obviously suppressed; And internal reference GAPDH mRNA all can produce the 250bp fragment through the RT-PCR amplification at each cell, and the expression no significant difference (accompanying drawing 6) between each group shows that siRNA is efficient, special to the Degradation of HBV mRNA in the HepG2 2.2.15 cell.
P1 5’-CAA CTT GTC CTG GTT ATC GC-3’
P2 5’-AAG CCC TAC GAA CCA CTG AA-3’
G1 5’-CAA CGG ATT TGG TCG TAT TGG G-3’
G2 5’-CCT GGA AGA TGG TGA TGG GAT T-3’
(4) siRNA is to the Degradation of HBV transcription product
The total RNA of the monoclonal cell that extraction filters out, through denaturing gel electrophoresis, change film, with α-
32The probe hybridization of P mark, the radioautograph result shows that the transcription product band of transfection pSUPER, pSUPER-EGFP cell HBV 3.5kb, 2.4kb, 2.1kb is clear, and the corresponding band of interference group cell obviously weakens, suppress the intracellular HBV transcription product of outstanding effect band and can't see (accompanying drawing 7) substantially, show that siRNA is efficient, special to the Degradation of HBV RNA in the HepG22.2.15 cell.
(5) restraining effect of secretion HBsAg and HBeAg in the siRNA pair cell culture supernatant
The cell 3 * 10 that filters out
5The culture supernatant of 48h, 72h detects HBsAg and HBeAg content with MEIA method (MEIA) under two resistance conditions.The result shows that HBsAg in the culture supernatant, HBeAg all are subjected to obvious inhibition, the strongest with the pSUPER-HBV2 restraining effect, it is respectively 97% and 87% to HBsAg and the HBeAg inhibiting rate in the cell conditioned medium of cultivating 48h, and cultivation 72h is 98% and 88% to the inhibiting rate of corresponding antigens; The pSUPER-HBV5 effect is taken second place, and it is respectively 87.4% and 77% to HBsAg and the HBeAg inhibiting rate in the cell conditioned medium of cultivating 48h, and cultivation 72h is 90% and 80.8% to the inhibiting rate of corresponding antigens; Other carrier also has the good restraining effect to the secretion of HBsAg and HBeAg, HBsAg is suppressed efficient be 60.2% (pSUPER-HBV3,72h) (pSUPER-HBV1 72h), suppresses efficient to HBeAg and do not wait by 53.8% to 64.4% to 91.7%.The above results and corresponding pSUPER control group comparing difference highly significant (P＜0.05), pSUPER-EGFP and control group no significant difference (accompanying drawing 8) by contrast.The restraining effect of prompting siRNA is efficient, special.
(6) siRNA suppresses the expression of interior HBsAg of cell and HBcAg
The monoclonal cell that filters out is carried out immunofluorescence dyeing, the virus antigen of red fluorescence mark obviously reduces in the showed cell as a result, pSUPER-HBV2 and pSUPER-HBV5 transfection group cell detect the expression less than HBsAg and HBcAg substantially, and antigenic expression does not have obvious reduction (accompanying drawing 9) in pSUPER-EGFP and the control group, and it is antigenic synthetic to show that siRNA can suppress the interior HBV of cell efficiently, specifically.
(7) the Western blot of HBsAg detects in the cell
The Western blot detected result that the pair cell lysate is carried out shows, the expression of HBsAg is obviously reduced in the cell of expression HBV specific siRNA, and antigenic expression does not have obvious reduction (accompanying drawing 10) in pSUPER-EGFP and the control group, and it is antigenic synthetic to show that siRNA can suppress the interior HBV of cell really efficiently, specifically.
(8) siRNA is to the restraining effect of HBV DNA
Getting the last cleer and peaceful concentration of 3 * 105 cell cultures 72h is that each 5 μ l of 1.0ng/ μ l cell genomic dna add respectively in the PCR reaction tubes that has prepared, set up negative control and the contrast of positive quantitatively gradient simultaneously, mixing is placed on the automatic fluorescence detector of PE7700, increase by following condition: 93 ℃ of pre-sex change 2min, 93 ℃ of 45s, 55 ℃ of 60s do 10 circulations earlier, by 93 ℃ of 30s, 55 ℃ of 45s do 30 circulations again.After reaction finishes, calculate the copy number of HBV by the computer automatic analyser.Quantitative fluorescent PCR (fluorogenicquantitative PCR, FQ-PCR) result shows, siRNA can reduce the copy number of the inside and outside HBV DNA of cell, wherein pSUPER-HBV2, pSUPER-HBV5 all make 2 orders of magnitude of HBV DNA decline in the culture supernatant, inhibiting rate is up to 99.7% and 98.5%, and all the other pSUPER-HBV1, pSUPER-HBV4 and pSUPER-HBV3 are respectively 95.7%, 92.3% and 62.9% (accompanying drawing 11A) to the inhibiting rate of HBV DNA in the culture supernatant.Resulting result is similar in FQ-PCR detected result that the pair cell genomic dna carries out and the culture supernatant, and pSUPER-HBV (1-5) is respectively 81.1%, 82.8%, 63.8%, 74.5% and 82.1% (accompanying drawing 11B) to the inhibiting rate of HBV DNA in the pair cell.Above-mentioned FQ-PCR presentation of results siRNA can suppress duplicating of the interior HBV DNA of cell.
(9) siRNA continues to suppress the antigenic expression of HBV
The monoclonal cell that the filters out cultivation that in the MEM substratum that contains 10%FBS, 200 μ g/ml G418 and 200 μ g/ml Totomycin, continues to go down to posterity, regularly inoculating cell 3 * 10
5In 6 orifice plates, cultivate based on cultivating 72h under the equal conditions with the DMEM that contains same concentrations G418 and Totomycin in totally 3 multiple holes, and the culture supernatant of collecting day part is used for the detection of HBsAg and HBeAg.To the HBV antigen presentation lasting, dynamic observe and found that, the siRNA that carrier is transcribed can continue, suppress efficiently the HBV expression of gene: suppress effect preferably pSUPER-HBV2, pSUPER-HBV5 HBsAg in reaching 10 months culturing process almost remain unchanged, only HBeAg has slight rising; PSUPER-HBV1, pSUPER-HBV4 result be (accompanying drawing 12) similarly, and the results change amplitude of pSUPER-HBV3 is bigger, this may with clone when the picking monoclonal cell impure relevant.
3.siRNA restraining effect to HBV in the transgenic mice body
(1) processing of HBV transgenic mice
A cleaning level C57BL/6J-HBV transgenic mice (6-8 age in week, body weight 15-20g) is bought from the department of the Chinese Academy of Sciences of Department Of Medicine, Peking University laboratory animal section, and every HBV transgenic mice all has the expression of HBV all through strict detection in the body.24 HBV transgenic mices are divided into 3 groups at random: pSUPER-HBV2 group, pSUPER-HBV5 group and pSUPER group, 8 every group.
Hydraulic pressure infection protocol (hydrodynamics-based transfection) administration: prepare normal saline solution (1.5-2.0ml) according to 10% of HBV transgenic mice body weight, the plasmid DNA of getting the different groups of 40 μ g is dissolved in the normal saline solution of respective volume.To be fixed on the outer mouse tail sterilization of mousetrap, with minimum number sword-shaped needle puncture tail vein, quick (＜5 seconds) inject fluid in the mouse body behind the blood back.Injection back the 4th, 7 day, 4 mouse of each component other places reason are collected the detection that blood sample is used for experimental index, get the hepatic tissue film-making, HE or immunohistochemical staining.
(2) siRNA is to the restraining effect of HBsAg in the HBV transgenic mice body
Anti-HBV effect preferably pSUPER-HBV2, pSUPER-HBV5 and control vector pSUPER in the hydraulic pressure infection protocol is injected into the mouse body, the HBsAg in serum measurement result shows, when injecting the 4th, 7 day, pSUPER-HBV2 is respectively 59.3% and 60.3% to the inhibiting rate of HBsAg in the mouse body, and the inhibiting rate of pSUPER-HBV5 is 26%, 40%.Show that pSUPER-HBV2 anti-HBV effect in vivo is better than pSUPER-HBV5, the result of the 7th day result than the 4th day good slightly (accompanying drawing 13).
(3) siRNA suppresses the expression of HBsAg in the transgenic mice body liver
Each histoorgan of C57BL/6J-HBV transgenic mice is not seen the visible pathology of obvious naked eyes.C57BL/6J-HBV transgenic mice liver cell anthorisma under the light microscopic, the liver cell kytoplasm is Yihong levelling (ground-glass-like sex change), local visible macronucleus liver cell, the single liver cell kytoplasm pyknosis engrain companion pyknosis engrain that is dispersed in, visible eosinophilic body in the part of hepatocytes matter, bile duct epithelial cell is arranged not whole, and the acidophilia material increases (accompanying drawing 14) in the kytoplasm.The C57BL mouse hepatic tissue is not seen obvious pathological change.
The HBV transgenic mice liver that imports siRNA is fixed, paraffin embedding, section is carried out immunohistochemical staining after the dewaxing aquation, the result observes in control group (injection pSUPER plasmid) the HBV transgenic mice liver cytoplasm a large amount of brown granulars (HBsAg), and the interior brown granular of HBV transgenic mice liver cell of having injected 40 μ g recombinant plasmid 7d obviously reduces, and stained positive cell proportion reduces.Wherein in the hepatic tissue of pSUPER-HBV2 treatment group HBV transgenic mice the HBsAg expression level near normal C57BL mouse coloration result (Figure 15).
(4) siRNA suppresses duplicating of the interior HBV DNA of transgenic mice body
Get transgenic mice serum and carry out FQ-PCR detection HBV DNA, FQ-PCR result show pSUPER-HBV2 in the time of the 4th, 7 day to the mouse body in the inhibiting rate of HBV DNA be respectively 67.6% and 78.3%, the inhibiting rate of pSUPER-HBV5 is 60.3%, 73% (Figure 16).Illustrate that the s iRNA that carrier is transcribed can suppress duplicating of the interior HBV DNA of transgenic mice body.
(5) siRNA is to the influence of transgenic mice serum alanine aminotransferase (ALT)
(alanine aminotransferase, ALT), ALT can be discharged in the serum during liver damage, causes ALT to give birth to height, so detect the infringement that Serum ALT can reflect liver to be rich in alanine aminotransferase in the liver.
Behind the injection siRNA expression vector, on 7070 automatic biochemistry analyzers, measure ALT content in the mice serum with rate method, the result shows injection pSUPER-HBV2, pSUPER-HBV5 the 4th, 7d, and the ALT level is compared no significant difference (table 2) in the mouse body with control group.Illustrate that siRNA body planted agent's time spent that carrier is transcribed can not cause damage to liver.
Table 2 siRNA to the influence of transgenic mice Serum ALT (x ± s, n=4)
| 4d | 7d | |
| pSUPER-HBV2 pSUPER-HBV5 pSUPER | 35.20±19.06 29.20±9.12 36.33±14.01 | 33.33±12.86 39.20±19.58 32.02±14.42 |
Sequence table
＜110〉Yang Angang
＜120〉HBV specificity interference target point gene and siRNA thereof and its application in anti HBV infecting
<160>15
<210>1
<211>19
<212>DNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>gene
<222>(1)...(19)
<400>1
tgtcaacgac cgaccttga 19
<210>2
<211>19
<212>DNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>gene
<222>(1)...(19)
<400>2
tgtgcactt cgcttcacct 19
<210>3
<211>19
<212>DNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>gene
<222>(1)...(19)
<400>3
ggctcagttt actagtgcc 19
<210>4
<211>19
<212>DNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>gene
<222>(1)...(19)
<400>4
tagagtctc cggaacattg 19
<210>5
<211>19
<212>DNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>gene
<222>(1)...(19)
<400>5
tcctgctgct atgcctcat 19
<210>6
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>6
UGUCAACGACCGACCUUGAdTdT
dTdTACAGUUGCUGGCUGGAACU
<210>7
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>7
UGUCAACGACCGACCUUGAUU
UUACAGUUGCUGGCUGGAACU
<210>8
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>8
UGUGCACUUCGCUUCACCUdTdT
dTdTACACGUGAAGCGAAGUGGA
<210>9
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>9
UGUGCACUUCGCUUCACCUUU
UUACACGUGAAGCGAAGUGGA
<210>10
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>10
GGCUCAGUUUACUAGUGCCdTdT
dTdTCCGAGUCAAAUGAUCACGG
<210>11
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>11
GGCUCAGUUUACUAGUGCCUU
UUCCGAGUCAAAUGAUCACGG
<210>12
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>12
UAGAGUCUCCGGAACAUUGdTdT
dTdTAUCUCAGAGGCCUUGUAAC
<210>13
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>13
UAGAGUCUCCGGAACAUUGUU
UUAUCUCAGAGGCCUUGUAAC
<210>14
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B virus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>14
UCCUGCUGCUAUGCCUCAUdTdT
dTdTAGGACGACGAUACGGAGUA
<210>15
<211>21
<212>RNA
＜213〉people (homo sp.) and hepatitis B virus (hepatitis B vifus, HBV)
<220>
<221>misc_RNA
<222>(1)...(21)
<400>15
UCCUGCUGCUAUGCCUCAUUU
UUAGGACGACGAUACGGAGUA。
Claims (4)
1, HBV specificity interference target point gene, it has sequence table＜400〉sequence of one of 1-5.
2, the siRNA that is produced through synthetic or carrier by the described gene of claim 1, it has sequence table＜400〉sequence of one of 6-15.
3, gene as claimed in claim 1 is used for the application of the medicine of anti HBV infecting in preparation.
4, siRNA as claimed in claim 2 is used for the application of the medicine of anti HBV infecting in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100963471A CN100447243C (en) | 2005-11-15 | 2005-11-15 | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100963471A CN100447243C (en) | 2005-11-15 | 2005-11-15 | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1793359A true CN1793359A (en) | 2006-06-28 |
| CN100447243C CN100447243C (en) | 2008-12-31 |
Family
ID=36805009
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100963471A Active CN100447243C (en) | 2005-11-15 | 2005-11-15 | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100447243C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234275A (en) * | 2018-08-30 | 2019-01-18 | 山东省立医院 | A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously |
| US10513703B2 (en) | 2014-11-10 | 2019-12-24 | Alnylam Pharmaceuticals, Inc. | Hepatitis B virus (HBV) iRNA compositions and methods of use thereof |
| US11324820B2 (en) | 2017-04-18 | 2022-05-10 | Alnylam Pharmaceuticals, Inc. | Methods for the treatment of subjects having a hepatitis b virus (HBV) infection |
| US11492623B2 (en) | 2018-08-13 | 2022-11-08 | Alnylam Pharmaceuticals, Inc. | Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JOP20170161A1 (en) | 2016-08-04 | 2019-01-30 | Arrowhead Pharmaceuticals Inc | RNAi Agents for Hepatitis B Virus Infection |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| CN1322898C (en) * | 2003-06-17 | 2007-06-27 | 杭州新瑞佳生物医药技术开发有限公司 | Small interference RNA molecule SiRNA capable of attacking human hepatitis B virus and application thereof |
-
2005
- 2005-11-15 CN CNB2005100963471A patent/CN100447243C/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10513703B2 (en) | 2014-11-10 | 2019-12-24 | Alnylam Pharmaceuticals, Inc. | Hepatitis B virus (HBV) iRNA compositions and methods of use thereof |
| US11060091B2 (en) | 2014-11-10 | 2021-07-13 | Alnylam Pharmaceuticals, Inc. | Hepatitis B virus (HBV) iRNA compositions and methods of use thereof |
| US11324820B2 (en) | 2017-04-18 | 2022-05-10 | Alnylam Pharmaceuticals, Inc. | Methods for the treatment of subjects having a hepatitis b virus (HBV) infection |
| US11492623B2 (en) | 2018-08-13 | 2022-11-08 | Alnylam Pharmaceuticals, Inc. | Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof |
| CN109234275A (en) * | 2018-08-30 | 2019-01-18 | 山东省立医院 | A kind of GEM 132 that can inhibit hepatitis B virus DNA and hepatitis B surface antigen simultaneously |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100447243C (en) | 2008-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1257284C (en) | Method of blocking expression of hepatitis B virus | |
| CN1836042A (en) | Conserved HBV and HCV sequences useful for gene silencing | |
| CN1177378A (en) | Stabilized external guide sequences | |
| CN1793359A (en) | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof | |
| CN1458973A (en) | Pre-adipose cell lines | |
| CN1718194A (en) | Oligonucleotide medicine for treating myophagism | |
| CN101054577A (en) | A siRNA and expression carrier capable of inhibiting Bax gene expression and application of the same used as virus hepatitis B treatment medicament | |
| CN1812797A (en) | Use of double-stranded ribonucleic acid for inducing cell lysis | |
| CN1800388A (en) | Eight human miRNAs | |
| CN101054591A (en) | Oligonucleotide for targeted activation of chronic granulocyte leukaemia protein kinase PKR and application thereof | |
| CN1908187A (en) | Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia | |
| CN1948483A (en) | SiRNA for inhibiting human Rabj gene expression and its application | |
| CN1940074A (en) | Construction, screen and use for stomach cancer target AFP gene siRNAs expression carrier | |
| CN1847256A (en) | Antiviral prepn containing both CpG single-strand deoxyoligonucleotide and ribavirin | |
| CN1580259A (en) | SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use | |
| CN102018959B (en) | Method and reagent for preventing and treating heart disease | |
| CN1233831C (en) | SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine | |
| Zhou et al. | Establishment of a screening system for selection of siRNA target sites directed against hepatitis B virus surface gene | |
| Ren et al. | Changes in innate and permissive immune responses after HBV transgenic mouse vaccination and llong-term-siRNA treatment | |
| CN1569233A (en) | Method for manufacturing gene medicine for preventing and treating SARS and its medicinal prescription | |
| CN1648249A (en) | Small molecular interference ribonucleic acid for inhibiting SARS virus gene expression | |
| CN103146838B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) method of TAQMAN probe with standard plasmids built by tree shrew IL-6 (interleukin 6) | |
| CN1162547C (en) | Liver cancer targeting hepatitis B antisense RNA expression vector and its construction process and use | |
| CN1837366A (en) | SiRNA sequence directing towards influenza B virus polymerase gene and its application | |
| CN1587406A (en) | SiRNA double chain for inhibiting bc 1-2 gen expression and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: THE FOURTH MILITARY MEDICAL UNIVERSITY OF P.L.A. Free format text: FORMER OWNER: YANG ANGANG Effective date: 20080509 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20080509 Address after: 17, West Changle Road, Shaanxi, Xi'an Province, China: 710032 Applicant after: The Fourth Military Medical University of the Chinese People's Liberation Army Address before: Department of immunology, foundation department, The Fourth Military Medical University, 17 West Changle Road, Shaanxi, Xi'an Province, China: 710032 Applicant before: Yang Angang |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |