CN1908187A

CN1908187A - Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia

Info

Publication number: CN1908187A
Application number: CN 200610088827
Authority: CN
Inventors: 鲍时来; 郑胡镛; 周忠卫; 张瑞东
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Beijing Childrens Hospital; Institute of Genetics and Developmental Biology of CAS
Priority date: 2006-07-19
Filing date: 2006-07-19
Publication date: 2007-02-07
Anticipated expiration: 2026-07-19
Also published as: CN100516232C

Abstract

the invention discloses a little interference RNA to inhibit PRMT5 gene, which is characterized by the following: inhibiting PRMT5 from breeding; treating leukemia and tumour drug target through silent PRMT5 gene.

Description

The application of Protein Arginine Methyltransferase 5 in the leukemia cell detects and treats

Technical field

(Protein Arginine Methyltransferase 5, new purposes PRMT5) particularly relate to the application of PRMT5 in the leukemia cell detects and treats to the present invention relates to Protein Arginine Methyltransferase 5.

Background technology

The protein arginine methylated transferase, promptly PRMT family has found 8 members at mammalian cell at present, is respectively PRMT1-8.Specificity according to substrate and reaction product can be divided into two classes with these 8 enzymes.Two zymoid common features are can both catalytic proteins arginine generation monomethylation; Two zymoid differences are: two the methylating of class PRMTs energy catalytic proteins arginine generation asymmetry, and the second class PRMT can two the methylating of catalysis arginine generation symmetry.Remove PRMT5 and PRMT7 and belong to the second class catalysis arginine guanine group generation monomethylation and symmetric two methylating, other 6 enzymes all belong to a class catalysis arginine guanine group generation monomethylation and asymmetric two (Bedford MT that methylates, Richard S.Arginine Methylation:An EmergingRegulator of Protein Function.Molecular Cell, 2005,18:263-272).

PRMT5 claims JBP1, Skb1Hs or Hsl7 again, separate to obtain by yeast two-hybrid the earliest, in eukaryote from the yeast to the Mammals its protein in evolution camber homology and conservative.Homologous protein Skb1 and the phosphokinase Shk1 of fission yeast PRMT5 combine closely, and are the regulon of Shk1.Overexpression Skb1 causes cell enlargement in yeast, and the Skb1 deletion mutant shortens cell, illustrate Skb1 be the cell cycle negative regulatory factor (Gilbreth, M., et al.Proc.Natl.Acad.Sci.U.S.A.1998,95:14781-14786).In mammalian cell, PRMT5 combines with tyrosine protein kinase in the Jak-Stat approach, show PRMT5 (the Pollack BP that may in signal transduction pathways such as cytokinin, somatomedin and sexual hormoue, play an important role, etal.The human homologue of the yeast proteins Skb1 and Hsl7p interacts withJak kinases and contains proteinmethyltransferase activity.J Biol Chem 1999,274:31531-31542).The PRMT5 relevant protein (Sm proteins) of neural flesh disease SMA that methylates, participate in regulation and control snRNP, the montage and the transportation (Friesen that comprise pre-mRNA, WJ, et al.The methylosome, a 20S complex containing JBP1 and pICln, produces dimethylarginine-modifiedSm proteins.Mol.Cell.Biol.2001,21,8289-8300).Discovery PRMT5 such as Kwak and the PRMT1 arginine on can both the conjugated protein SPT5 of catalysis rna plymerase ii methylates, prolongation (the Kwak that transcribes with regulatory gene, YT, et al.Methylation of SPT5 regulates its interaction with RNApolymerase II and transcriptional elongation properties.Mol.Cell, 2003,11,1055-1066.).The up-to-date PRMT5 that discovers not only plays an important role in cell cycle regulating, and can also with histone deacetylase (HDAC), interactions such as Chromatin Remodeling protein B rg1, direct catalysis histone H 3, H4 methylates, show that this enzyme may be by regulation and control Histone Code (Histone code), (Pal S plays a significant role in Chromatin Remodeling and gene transcription regulation and control, et al., Human SWI/SNF-AssociatedPRMT5 Methylates Histone H3 Arginine 8 and Negatively Regulates Expressionof ST7 and NM23 Tumor Suppressor Genes; MOLECULAR AND CELLULAR BIOLOGY; 2004, Vol.24, No.21; 9630-9645.).But whether PRMT5 is directly related with cancer generation and leukemia, at present both at home and abroad without any report.

Leukemia is a modal malignant tumour in children's's period, according to statistics, about 11000 people of leukemia of children of the annual new diagnosis of China, leukemia has become one of main cause of death in children's period.Because chemotherapy regimen is updated, supportive treatment perfect day by day, leukemic treatment is greatly improved, children acute lymphoblastic leukaemia (Acute Lymphoblastic Leukemia, ALL) long-term disease free survival rate reaches (BFM-orientedtreatment for children with acute lymphoblastic leukemia without cranialirradiation and treatment reduction for standard risk patients:results ofDCLSG protocol ALL-8 (1991-1996) .Leukemia.2002,16:1099-1111 more than 80%; Improvedoutcome in Childhood acute lymphoblastic leukemia despite reduced use ofanthracyclines and cranial radiotherapy:results of trial ALL-BFM 90.Blood.2000,95:3310-3322; Long-term results of the Italian Association of PediatricHematology and Oncology (AIEOP) Acute Lymphoblastic Leukemia studies, 1982-1995.Leukemia.2000,14:2196-2204; Children ' s Cancer Group trials inchildren acute lymphoblastic leukemia:1983-1995.Leukemia.2000,14:2196-2204), but leukemic pathogeny is still unclear, also have some infants treatment failures, recurrence, in addition myelogenous leukemia, to mix leukemic result of treatment still undesirable.Therefore, find and the leukemic pathogeny of deep understanding, will help leukemic diagnosis and treatment (Acute Lymphoblastic Leukemia.N Engl J Med 2004,350:1535-1548; Biology and Treatment of Childhood T-Lineage AcuteLymphoblastic Leukemia.Blood, 1998,91:735-746; Treatment of AcuteLymphoblastic Leukemia.N Engl J Med 2006,354:166-78).

RNA perturbation technique (RNA interference, be called for short RNAi) be by small molecules double-stranded RNA (ds RNA) specificity complementary target to gene transcripts, thereby a kind of mode of gene silencing behind the inducible transcription.Double-stranded RNA is degraded into the siRNA fragment (siRNA that length is 19-25nt, small interfering RNA), these small segments are mediation and its homologous single stranded RNA degraded further, its Stability Analysis of Structures, need not as antisense nucleotide, carry out chemically modified widely to improve its transformation period, and can under the concentration that is lower than the antisense nucleotide several magnitude, make target gene reduce to the utmost point low-level even complete " knocking out ", thereby produce the deletion mutantion phenotype.The intervention effect key of siRNA depends on the selection of its target-gene sequence, the mistake of arbitrary nt all can cause the forfeiture of RNAi effect, and it is inserted point mutation, sequence this height sequence-specific and selected gene of disappearance is silent has an important pharmacological action.Confirm, the RNA perturbation technique can be separately or together be used to suddenly change with other existing treatment means due to disease, as virus infection, can also be used for the treatment of tumour etc.

Summary of the invention

The new purposes that the purpose of this invention is to provide Protein Arginine Methyltransferase 5 (PRMT5) promptly detects the application in (comprise the diagnosis of leukemia initial stage, medication effect, prognosis residual etc.) the leukemia cell.

The invention provides the new purposes of a kind of PRMT5, i.e. application in the leukemia cell detects.

Methods such as the protein immuning hybridization of available routine (Western blot), reverse transcriptional PCR (RT-PCR), cellular immunofluorescence dyeing (Immunostaining), immunohistochemical methods, flow cytometer, immune colloid gold detect the expression amount of PRMT5 on genetic transcription and protein level in the testing sample medullary cell, again with normal marrow cell in the expression amount of PRMT5 compare, if expression amount significantly increases, but then preliminary evaluation is the leukemia cell.

Experimental results show that, the expression level of PRMT5 is significantly higher than normal marrow cell in leukaemic's medullary cell, therefore can PRMT5 as the leukemia mark, PRMT5 is made monoclonal antibody or is applied to the detection of clinical leukemia residual cell with other antibody collocation, and have detection method advantage simple, quick, highly sensitive, with low cost.The present invention provides a new approach for the leukemia cell detects, and has broad application prospects at medical field.

Another object of the present invention provides the siRNA that suppresses PRMT5 genetic expression.

The siRNA of inhibition provided by the present invention PRMT5 genetic expression, be following double-stranded RNA sequence it:

1) positive-sense strand is the SEQ ID № in the sequence table: 1, and antisense strand is SEQ ID № in the sequence table: 2;

2) positive-sense strand is the SEQ ID № in the sequence table: 3, and antisense strand is SEQ ID № in the sequence table: 4;

3) positive-sense strand is the SEQ ID № in the sequence table: 5, and antisense strand is SEQ ID № in the sequence table: 6;

4) positive-sense strand is the SEQ ID № in the sequence table: 7, and antisense strand is SEQ ID № in the sequence table: 8.

With above-mentioned double-stranded RNA sequence called after PRMT5 siRNA1-4.The antisense strand of PRMT5 siRNA1 and the complementation of PRMT5mRNA distance P RMT5 cDNA initiator codon ATG 288-308 position sequence, SEQ ID № in the sequence table: 1 by 21 based compositions, the direction of sequence is 5 ' end → 3 ' end from left to right, SEQ ID № in the sequence table: 2 by 21 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; The antisense strand of PRMT5 siRNA2 and the complementation of PRMT5 mRNA distance P RMT5 cDNA initiator codon ATG 626-646 position sequence, SEQ ID № in the sequence table: 3 by 21 based compositions, the direction of sequence is 5 ' end → 3 ' end from left to right, SEQ ID № in the sequence table: 4 by 21 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; The antisense strand of PRMT5 siRNA3 and the complementation of PRMT5 mRNA distance P RMT5 cDNA initiator codon ATG 852-872 position sequence, SEQ ID №: 5 by 21 based compositions, the direction of sequence is 5 ' end → 3 ' end from left to right, SEQ ID № in the sequence table: 6 by 21 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; The antisense strand of PRMT5 siRNA4 and the complementation of PRMT5 mRNA distance P RMT5 cDNA initiator codon ATG 1228-1248 position sequence, SEQ ID № in the sequence table: 7 by 21 based compositions, the direction of sequence is 5 ' end → 3 ' end from left to right, SEQ ID № in the sequence table: 8 by 21 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right.

The encoding gene of the siRNA that above-mentioned inhibition PRMT5 expresses also belongs to protection scope of the present invention.It is one of following double chain nucleotide sequence:

1) positive-sense strand has SEQ ID № in the sequence table: 9 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 9 dna sequence dnas hybridization that limit; Antisense strand has SEQ ID № in the sequence table: 10 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 10 dna sequence dnas hybridization that limit;

2) positive-sense strand has SEQ ID № in the sequence table: 11 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 11 dna sequence dnas hybridization that limit; Antisense strand has SEQ ID № in the sequence table: 12 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 12 dna sequence dnas hybridization that limit;

3) positive-sense strand has SEQ ID № in the sequence table: 13 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 13 dna sequence dnas hybridization that limit; Antisense strand has SEQ ID № in the sequence table: 14 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 14 dna sequence dnas hybridization that limit;

4) positive-sense strand has SEQ ID № in the sequence table: 15 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 15 dna sequence dnas hybridization that limit; Antisense strand has SEQ ID № in the sequence table: 16 nucleotide sequence or under the rigorous condition of height with sequence table in SEQ ID №: the nucleotide sequence of the 16 dna sequence dnas hybridization that limit.

The rigorous condition of described height be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

SEQ ID № in the sequence table: 9 by 58 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; SEQ ID № in the sequence table: 10 by 62 based compositions, and the direction of sequence is 3 ' end → 5 ' end from left to right; SEQ ID № in the sequence table: 11 by 58 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; SEQ ID № in the sequence table: 12 by 62 based compositions, and the direction of sequence is 3 ' end → 5 ' end from left to right; SEQ ID № in the sequence table: 13 by 58 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; SEQ ID № in the sequence table: 14 by 62 based compositions, and the direction of sequence is 3 ' end → 5 ' end from left to right; SEQ ID № in the sequence table: 15 by 58 based compositions, and the direction of sequence is 5 ' end → 3 ' end from left to right; SEQ ID № in the sequence table: 16 by 62 based compositions, and the direction of sequence is 3 ' end → 5 ' end from left to right.

Contain the expression vector, transgenic cell line and the host bacterium that suppress the siRNA encoding gene that PRMT5 expresses and amplification and suppress that arbitrary segmental primer also belongs to protection scope of the present invention in the siRNA encoding gene that PRMT5 expresses.

Another object of the present invention provides a kind of method of the PRMT5 of inhibition genetic expression.

The method of inhibition PRMT5 provided by the present invention genetic expression is the encoding gene importing host with the siRNA of described PRMT5 gene, thereby suppresses PRMT5 genetic expression.

The encoding gene of the siRNA of described inhibition PRMT5 genetic expression can be by containing described inhibition PRMT5 genetic expression the siRNA expression vector of encoding gene of siRNA import the host; The carrier that sets out that is used for making up described siRNA expression vector can be any one can be at the carrier of host's expression alien gene, as pNeoU6+1, pSilence1.0-U6 (U.S. Ambion company) or pSilencer ^TM(3.1-H1 U.S. Ambion company) etc.

Be the carrier that sets out with pNeoU6+1, the siRNA expression vector of the PRMT5 gene of structure is pDs288, pDs626, pDs852 or pDs1228.

RNAi expression vector of the present invention can make up according to a conventional method.

The invention provides the new purposes of PRMT5, promptly detect the application in (comprise the diagnosis of leukemia initial stage, medication effect, prognosis residual etc.) the leukemia cell.Experimental results show that, the expression level of PRMT5 is significantly higher than normal marrow cell in leukaemic's medullary cell, therefore can PRMT5 as the leukemia mark, PRMT5 is made monoclonal antibody or is applied to the detection of clinical leukemia residual cell with other antibody collocation, and have detection method advantage simple, quick, highly sensitive, with low cost.In addition, the present invention also provides the siRNA that suppresses PRMT5 genetic expression.Experimental results show that, siRNA of the present invention has significant inhibitory effect to the PRMT5 gene, in addition, and by reticent PRMT5 gene, the propagation that can suppress PRMT5 genetically deficient cell shows that the PRMT5 gene can be used as the drug targets of treatment leukemia and tumour.Therefore can be prepared into leukemia and tumor therapeutic medicine as activeconstituents with the encoding sequence of the siRNA that suppresses PRMT5 genetic expression.The present invention has bigger practical significance and wide application prospect in medical science and field of biological pharmacy.

Below in conjunction with specific embodiment the present invention is described in further detail.

Description of drawings

Fig. 1 is the Western blot detected result of PRMT5 expression in the leukemia children medullary cell

Fig. 2 is the RT-PCR detected result of PRMT5 expression in the leukemia children medullary cell

Fig. 3 is the flow cytometer detected result of PRMT5 expression in the leukemia children medullary cell

Fig. 4 is the immunostaining detected result of PRMT5 expression in the leukemia children medullary cell

Fig. 5 suppresses the Western Blot detected result of the expression of PRMT5 in cell for siRNA and the clone of inhibition growth of tumour cell forms experimental result

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment.All sequences is synthetic by Beijing Bo Ya biotech company.

Clinical samples:

149 first visit leukemia children of collection hospital care during year March in September, 2003 to 2006,23 alleviation (Complete Remission, CR) infant, 25 drug withdrawal children, 13 Te Fa minimizing thrombocyte purpura (Idiopathic Thrombocytopenic Purpura, ITP) marrow of infant, and 24 orthopedic children's (normal control group) marrow, all infants are all through clinical, morphology, cytochemical staining and immunology are made a definite diagnosis, diagnosis and somatotype standard by whole nation unified standard (referring to acute leukemia of children diagnosis and treatment suggestion " Chinese paediatrics magazine; 1999, Vol137 (5) 305-307).Infant and contrast children's physical resource is as follows:

(1) first visit leukemia children

Select 149 of first visit leukemia children altogether, 88 of men, 61 of woman, M-F 1.44: 1.Age 0.3-16 year, mean 6.87 years old.Wherein, and acute lymphoblastic leukemia (Acute Lymphoblastic Leukemia, ALL) infant is 129, comprises 27 of T-ALL infants, 9 of preceding B-ALL infants, 5 of preceding B-ALL infants, 86 of common B-ALL infants, 2 of ripe B-ALL infants; 17 of non-lymphocytic leukemia infants, comprise acute myelogenous chronic myeloid leukemia (Acute Myeloid Leukemia, AML) 10, chronic myelocytic leukemia (ChronicMyelogenous Leukemia, CML) infant is 7; Two phenotype acute leukemias (Biphenotypic AcuteLeukemia, BAL) 3.

Adopt multiple nido RT-PCR method can detect the gene that 29 kinds of chromosomal structural aberrations form, in all leukemia children, 74 of the leukemia children that detected result is negative, 75 of the leukemia children that detected result is positive, wherein the positive leukemia children of BCR-ABL fusion gene is 13,23 of the positive leukemia children of TEL-AML1 fusion gene, 27 of HOX11 activatory leukemia children, 6 of the positive leukemia children of E2A-PBX1 fusion gene, 3 of the positive leukemia children of AML1-ETO fusion gene, 1 of the positive leukemia children of PML-RAR alpha fusion gene, del (1) (p34; P34) the male leukemia children is 2.

(2) alleviate (CR) infant

Form by two portions, alleviated 3 months infant 15 people through treating in the first visit leukemia children, alleviated about 12 months infant 18 people (wherein 10 people are same crowd with the infant of alleviating 3 months) through treatment in the first visit leukemia children.

(3) drug withdrawal children

25 of drug withdrawal children, 15 of men, 10 of woman.Age 6-17 year, mean 10.94 years old.

(4) control group children

Be made up of two portions, a part is orthopedic children 24 people, all do not have disease in the blood system, in the recent period do not have infect, and other disease (except that deformity itself), wherein the man is 14, women 10, age 3-14 year, mean 7.87 years old; Another part is ITP children 13 people, 8 of men, 5 of woman, age 2.6-10 year, mean 4.62 years old.

The expression of PRMT5 in embodiment 1, the detection leukemia children medullary cell

One, the Western blot of PRMT5 expression detects in the leukemia children medullary cell

1, gathers marrow

Gather above-mentioned 149 first visit leukemia children, 23 marrow of alleviating infant, 25 drug withdrawal children, 13 Te Fa minimizing thrombocyte purpura infants, and 24 children's of BJ Children's Hospital's orthopedic (normal control group) marrow, concrete grammar is as follows:

Different sites (as breastbone, ilium, thoracic vertebrae or shin bone) from first visit leukemia children, alleviation infant, drug withdrawal children and control group children extracts marrow 2mL under aseptic condition, add edetate (EDTA) anti-freezing.The collection of bone marrow prepare requires: EDTA anti-freezing, marrow amount be greater than 2mL, no blood clot, and the sample shelf-time was less than 24 hours.

2, extract mononuclearcell

From the marrow of gathering, extract mononuclearcell, may further comprise the steps:

A, splitting erythrocyte: get the 2mL bone marrow prepare, put into extraction tube, in extraction tube, add 10mL erythrocyte cracked liquid (EDTA sodium salt 20mg, ammonium chloride 4.2g, saleratus 0.5g, adding distil water is settled to 500mL), with the marrow thorough mixing, room temperature was placed 3 minutes, centrifugal 3 minutes of 1000rpm normal temperature.Centrifugal end discards supernatant liquid.

B, observe the mononuclearcell that the extraction tube bottom extracts, as wherein being mixed with more red corpuscle, but repeating step A1-2 time is removed unnecessary red corpuscle.

C, washing lysate: get 10mL physiological saline and put into extraction tube,, make itself and physiological saline thorough mixing with suction pipe piping and druming bottom cell, centrifugal 3 minutes of 1000rpm normal temperature, centrifugal end discards supernatant liquid.

D, add a small amount of physiological saline in extraction tube, with suction pipe piping and druming, make itself and bottom cytomixis, be transferred in the 1.5mL EP memotron, 4000rpm normal temperature centrifugal 5 seconds discard upper strata physiological saline, the mononuclearcell number of extraction should be at 107 orders of magnitude.

E, will extract good mononuclearcell sample and deposit in-76 ℃ of refrigerators, standby.

3, ultrasonic degradation cell extraction protein

A, take out the mononuclearcell of preserving, to each EP test tube numbering, then according to the RIPB lysate that how much the adds 150-400ul (2 * stock solution: 2mL Triton X-100,6mL 5M NaCl, 8mL 0.5M Na of cell concentration from-76 ℃ of refrigerators ₂HPO ₄The pH value to 7.4 of regulator solution, adding distil water is settled to 100mL.Use liquid: 10mL 2 * stock solution adds 10mL PBS liquid and adds 2 tablets of Luo Shi Complete tablets again.)。

B, carry out ultrasonic cell on ice, the amplitude of ultrasonic instrument is set to 40%, how much regulates ultrasonic time according to cell concentration, is traditionally arranged to be 15 seconds.

Behind C, the every ultrasonic sample,, and in frozen water, cool off after 5 minutes ultrasonic more next sample with the distilled water flushing probe.

D, with the sample after ultrasonic with 4 ℃ of supercentrifuges, centrifugal 10 minutes of 12000rpm.

E, get supernatant liquor and be transferred in another corresponding EP test tube, numbering.

4, measure the concentration of the concentration of testing protein sample with BCA test kit (available from U.S. PIETCE company) and reference reagent box specification sheets working sample.

5, SDS-PAGE electrophoresis and commentaries on classics film

Protein sample to be measured is carried out the SDS-PAGE electrophoresis, under voltage 80V electrophoresis 10-30 minute earlier, treat that the dyestuff forward position enters separation gel after, voltage is brought up to 160V continued electrophoresis about 1 hour, arrive the bottom of separation gel until tetrabromophenol sulfonphthalein.After electrophoresis finished, the electricity consumption transfer method was transferred to nitrocellulose filter (NC film) with isolating protein sample, 400mA (100V), 1 hour (or 350mA (95V), 1.5 hours).

6, Western blot detects

Carrying out Western blot with ordinary method detects, wherein the PRMT5 polyclonal antibody is available from U.S. Upstate company, Tubulin monoclonal antibody (confidential reference items) is available from Sigma company, ECL colouring reagents box (available from Sweden Amersham company), (swimming lane 1 is the rectum cancer cell as positive control to detected result as shown in Figure 1, swimming lane 2 is a normal marrow cell, swimming lane 3-7 is a first visit leukemia children sample, swimming lane 8-13 is for alleviating the infant sample), the PRMT5 expressing quantity significantly increases in the medullary cell of 93.95% first visit leukemia children, and alleviates infant, the drug withdrawal infant, do not find all in normal orthopedic children and the ITP infant that the PRMT5 expressing quantity increases.

Two, the RT-PCR of PRMT5 expression detects in the leukemia children medullary cell

Now to 29 first visit leukemia children, 23 marrow of alleviating infant, 25 drug withdrawal children, 13 Te Fa minimizing thrombocyte purpura infants, and the expression of PRMT5 carries out the RT-PCR detection in 24 bone in children myelocytes of BJ Children's Hospital's orthopedic, and concrete grammar may further comprise the steps:

1, design primer

CDNA sequence (BC025979) design pcr amplification product length according to PRMT5 gene among the GeneBank is the primer of 210bp, and primer sequence is as follows:

P1 (upstream primer): 5 '-AGCCAGAACCGTCCTCCACC-3 '

P2 (downstream primer): 5 '-CAGCACCATCAGTACCTGGAC-3 ';

The pcr amplification product that with length is the abl gene of 310bp simultaneously is an internal reference, and primer sequence is as follows:

P3 (upstream primer): 5 '-CCTTCAGCGGCCAGTAGC-3 '

P4 (downstream primer): 5 '-GGACACAGGCCCATGGTAC-3 '

2, the extraction of bone marrow collection and mononuclearcell

Method is identical with step 1.

3, the Trizol method is extracted total RNA of mononuclearcell

Extract total RNA of mononuclearcell with Trizol reagent and with reference to product description, may further comprise the steps:

A, mononuclearcell is taken out from-70 ℃ of refrigerators, add TRIzol reagent 1mL immediately, blow and beat mixing repeatedly, put room temperature and made cytolysis in 5 minutes.

B, every 1mL TRIzol add chloroform 0.2mL, in 15 seconds of violent jolting, put room temperature 3 minutes.Centrifugal 15 minutes of 4 ℃, 12000rpm.

C, carefully draw the upper strata water, be transferred in another EP pipe (no RNase), add the 0.5mL Virahol, put upside down mixing 3-4 time, put room temperature 10 minutes.Centrifugal 10 minutes of 4 ℃, 12000rpm.

D, abandon supernatant, add 75% ethanol 1mL, shake, thorough washing precipitation, centrifugal 5 minutes of 4 ℃, 7500rpm.Thoroughly inhale and remove supernatant, 37 ℃ of dryings are resuspended in precipitation in about 20 μ l DEPC water.

F, by 1: 1000 dilution proportion RNA (1 μ l RNA+1000 μ l DEPC water), by spectrophotometry sample OD ₂₆₀And OD ₂₈₀, OD ₂₆₀/ OD ₂₈₀Ratio should be more than or equal to 1.8, otherwise extract sample again.

RNA concentration (μ g/ μ l)=OD ₂₆₀* 40 * extension rate/1000=OD ₂₆₀* 40

4, cDNA's is synthetic

Total RNA of the mononuclearcell that extracts with step 3 is a template, with RNA reverse transcription test kit (available from Promega company) and with reference to synthetic its cDNA of product description reverse transcription.

5, PCR reaction

CDNA is a template with step 4 reverse transcription synthetic, the cDNA fragment of pcr amplification PRMT5 gene under the guiding of primer P1 and P2,12.5 μ l PCR reaction system is: 5 * ABI damping fluid II (available from u.s.a. applied biosystem company), 2.5 μ l, 1.5mmol/L MgCl ₂, 0.2mmol/L dNTPs, each 800nM of primer P1, P2, cDNA 1 μ l, TaqDNA polysaccharase 1.25U.The PCR reaction conditions is: 95 ℃ of pre-sex change of elder generation 5 minutes; 94 ℃ of sex change are 40 seconds then, 60 ℃ of annealing 30 seconds, and 72 ℃ were extended totally 30 circulations 60 seconds; Last 72 ℃ are continued reaction 15 minutes.After reaction finishes, 4 ℃ of preservations.

Abl gene fragment with wide expression is as internal reference simultaneously, and 12.5 μ l PCR reaction systems are: 5 * ABI damping fluid II2.5 μ l, 2.5mmol/L MgCl ₂, 0.2mmol/L dNTPs, each 400nM of primer P3, P4, cDNA 1 μ l, TaqDNA polysaccharase 1.25U.PCR reaction conditions: 95 ℃ of pre-sex change of elder generation 5 minutes; 94 ℃ of sex change are 30 seconds then, 65 ℃ of annealing 60 seconds, and 72 ℃ were extended totally 35 circulations 60 seconds; Last 72 ℃ are continued reaction 15 minutes.After reaction finishes, 4 ℃ of preservations.

6, polyacrylamide gel electrophoresis and silver dyeing

Pcr amplification product to step 5 carries out the detection of 6% polyacrylamide gel electrophoresis, carries out silver dyeing then, and dyeing process is:

A, polyacrylamide gel is fixed 5 minutes in stationary liquid (10% ethanol, 1% nitric acid).Reclaim stationary liquid, use rinsed with deionized water 2 times.With gel at staining fluid (0.5mL 20%AgNO ₃Distilled water diluting liquid adds 30 μ L formaldehyde (37%), mixing to 50mL) in the effect 10 minutes.The staining fluid that inclines, rinsed with deionized water 2 times.

B, with gel in colour developing liquid effect till show clear band.Liquid (the 3%Na that develops the color inclines ₂CO ₃50mL adds 30 μ L formaldehyde (37%) and 30 μ L Na ₂S ₂O ₃(10mg/mL), mixing), use rinsed with deionized water 2 times.

C, gel is acted on 10-15 minute react in 10% acetate stop buffer with color development stopping.Reclaim stop buffer, with gel rinsed with deionized water 1 time.

D, with the glassine paper sealing, as for dry in 4 ℃ of refrigerators.

(swimming lane 1-2 is the normal marrow cell contrast to the result as shown in Figure 2, swimming lane 3-4 is a first visit leukemia children sample, swimming lane 5 is Marker), 27 manual inspections in 29 first visit leukemia children measure the strong and weak PRMT5 mRNA expression that does not wait, 2 people do not detect PRMT5 mRNA and express, and the Western blot detected result of step 1 shows that this 2 people does not detect the PRMT5 expressing quantity yet and increases, and detected result conforms to; The PRMT5 mRNA expression that compares first visit leukemia children and CR infant simultaneously, the mRNA expression level of finding first visit infant PRMT5 illustrates that apparently higher than the CR infant leukemia cell's PRMT5 all increases at the expression amount of mRNA and protein level.

Three, the flow cytometer of PRMT5 expression detects in the leukemia children medullary cell

Gather the marrow of above-mentioned part first visit leukemia children and alleviation infant, collecting bone marrow is seen step 1, and the expression to PRMT5 in the medullary cell carries out the flow cytometer detection then, and concrete grammar may further comprise the steps:

1) the difference gradient centrifugation extracts mononuclearcell

A, with 1 * PBS or physiological saline dilution marrow 2: 1 (2: 1, PBS: marrow).

B, the marrow after will diluting add slowly along test tube wall on the liquid level of 4mL lymphocyte separatory Ficoll, and is firmly not excessive, in order to avoid cause bone marrow fluid to mix with parting liquid, keeps stratification state clearly.

C, room temperature (18-20 ℃) down 2000rpm after centrifugal 30 minutes visible invisible spectro marrow clearly be divided into 4 layers: the upper strata is a plasma layer, the middle level is by separating liquid layer (mononuclearcell be in plasma layer and separate liquid layer in the middle of), bottom is the red corpuscle layer, and the red corpuscle upper strata is a GCL.

D, the mononuclearcell sucking-off between upper strata and the middle level is collected in another test tube, wash 2 times, all centrifugal 10 minutes at every turn, after the supernatant discarded, obtain highly purified mononuclearcell suspension with 1500rpm with PBS with suction pipe.

2) get two test tubes, add 1 * 10 in each test tube ⁶The mononuclearcell suspension carries out immunostaining.Cell fixation and immunostaining process reference literature (Bao S, et al.Oncogene, 2004,23 (33): 5586-93). wherein the PRMT5 polyclonal antibody is available from Upstate, and the goat-anti rabbit two of Cy3 mark is anti-available from U.S. JacksonImmunoResearch Laboratories Inc.3) cell of immunostaining detects with flow cytometer.

The result as shown in Figure 3, the faint expression of 98.03% cell PRMT5 in the normal marrow cell only has 1.96% cell PRMT5 to express and increases; And the faint expression of 0.93% cell PRMT5 among the leukemia cell, 99.07% cell expressing PRMT5 strengthens.The expression level of PRMT5 significantly increases than the control group children in this proof first visit leukemia children medullary cell, thereby proves that further the expression amount of PRMT5 in the leukemia cell increases.

Four, immunohistochemistry staining method the expression in the leukemia cell detects to PRMT5

Medullary cell to part first visit leukemia children, alleviation infant, normal control children carries out immunohistochemical staining, and concrete grammar may further comprise the steps:

1) gathers medullary cell and difference gradient centrifugation and extract mononuclearcell

Method is identical with embodiment 1.

2) with the PBS fixed cell that contains 4% Paraformaldehyde 96, paraffin embedding, section, thick is 4um.

3) dewaxing of conventional gradient is carried out in section: section was placed dimethylamino benzophenone 20 minutes, arrive dimethylbenzene second again 20 minutes, after put into raw spirit 5 minutes, fall 95% alcohol, 80% alcohol, distilled water respectively 1 minute then successively.

4) PBS flushing section is 3 times, and each 3 minutes, add 3% hydrogen peroxide, hatched 10 minutes hatching 37 ℃ in box, to eliminate the endogenous peroxidase activity.

5) to the section distilled water flushing, PBS flushing 3 times each 3 minutes, with 121 ℃ of heating of pressure kettle 90 seconds, drips normal goats serum (sealing), incubated at room 15 minutes.

6) discard normal goats serum, do not wash, drip PRMT5 (is anti-), 4 ℃ 12-24 hour (negative control is anti-with PBS replacement one) by 1: 200 dilution proportion.

7) PBS flushing, 3 minutes * 3 times, drip SP-9001 biotin labeling goat anti-rabbit antibody (two is anti-, available from Fuzhou Maixin biotechnology Development Co., Ltd), hatched 15 minutes PBS flushing 3 times, each 3 minutes at 37 ℃.

8) drip horseradish enzyme labelling chain enzyme avidin working fluid (available from Fuzhou Maixin biotechnology Development Co., Ltd, three is anti-), hatched 15 minutes at 37 ℃, the PBS flushing is 3 times then, each 3 minutes.

9) add DAB developer (available from Bioisystech Co., Ltd of China fir Golden Bridge in Beijing) colour developing, the colour developing back was washed 5 minutes with tap water, and Hematorylin is redyed, mounting.

(1 is the normal control group to the result as shown in Figure 4,2 are first visit leukemia children group), compare with the normal control group, alleviating the PRMT5 that trace is arranged in the infant medullary cell expresses, PRMT5 great expression in the first visit leukemia children medullary cell, consistent with above-mentioned detected result, prove that further the expression amount of PRMT5 in the leukemia cell increases.

The siRNA of embodiment 2, detection PRMT5 is to the restraining effect of tumour cell

One, the design of PRMT5 siRNA and coding DNA thereof is synthetic

1, the design of PRMT5 siRNA

Wherein four section (288-308 (ggagaagattcgcaggaactc) according to PRMT 5mRNA, 626-646 (gggctgacctcccatctaatc), 852-872 (ggaatacttaagccagaaccg), 1228-1248 (ggaagccaagtgaccgtagtc)) design four couples of siRNA, sequence is as follows:

siRNA1：

Positive-sense strand: 5 '-ggagaagauucgcaggaacuc-3 ' (sequence 1 in the sequence table)

Antisense strand: 5 '-gaguuccugcgaaucuucucc-3 ' (sequence 2 in the sequence table);

siRNA2：

Positive-sense strand: 5 '-gggcugaccucccaucuaauc-3 ' (sequence 3 in the sequence table)

Antisense strand: 5 '-gauuagaugggaggucagccc-3 ' (sequence 4 in the sequence table);

siRNA3：

Positive-sense strand: 5 '-ggaauacuuaagccagaaccg-3 ' (sequence 5 in the sequence table)

Antisense strand: 5 '-cgguucuggcuuaaguauucc-3 ' (sequence 6 in the sequence table);

siRNA4：

Positive-sense strand: 5 '-ggaagccaagugaccguaguc-3 ' (sequence 7 in the sequence table)

Antisense strand: 5 '-gacuacggucacuuggcuucc-3 ' (sequence 8 in the sequence table).

2, state the synthetic of PRMT5 siRNA encoding gene

Suppress the required complementary dna sequence of siRNA expression vector that PRMT5 expresses according to synthetic structure of above-mentioned four pairs of PRMT5 siRNA sequences again, sequence is as follows:

First pair:

PRMT5-dsRNA288-1：

5 '-gagaagattcgcaggaactcTTCAAGAGAgagttcctgcgaatcttctccTTTTTT TA-3 ' (sequence 9 in the sequence table),

PRMT5-dsRNA288-2：

3 '-AGCTTAAAAAAAggagaagattcgcaggaactcTCTCTTGAAgagttcctgcgaat cttctc-5 ' (sequence 10 in the sequence table);

Second pair:

PRMT5-dsRNA626-1：

5 '-ggctgacctcccatctaatcTTCAAGAGAgattagatgggaggtcagcccTTTTTT TA-3 ' (sequence 11 in the sequence table),

PRMT5-dsRNA626-2：

3 '-AGCTTAAAAAAAgggctgacctcccatctaatcTCTCTTGAAgattagatgggagg tcagcc-5 ' (sequence 12 in the sequence table);

The 3rd pair:

PRMT5-dsRNA852-1：

5 '-gaatacttaagccagaaccgTTCAAGAGAcggttctggcttaagtattccTTTTTT TA-3 ' (sequence 13 in the sequence table),

PRMT5-dsRNA852-2：

3 '-AGCTTAAAAAAAggaatacttaagccagaaccgTCTCTTGAAcggttctggcttaa gtattc-5 ' (sequence 14 in the sequence table);

The 4th pair:

PRMT5-dsRNA1228-1：

5 '-gaagccaagtgaccgtagtcTTCAAGAGAgactacggtcacttggcttccTTTTTT TA-3 ' (sequence 15 in the sequence table),

PRMT5-dsRNA1228-2：

3 '-AGCTTAAAAAAAggaagccaagtgaccgtagtcTCTCTTGAAgactacggtcactt ggcttc-5 ' (sequence 16 in the sequence table).

With the sex change 10 minutes in boiling water respectively of four pairs of single stranded DNA sequences of synthetic, slowly be cooled to room temperature then then, make four pairs of single stranded DNAs annealing form four double chain DNA fragments.

Two, the structure of PRMT5 siRNA expression vector

Four double chain DNA fragments of step 1 synthetic are inserted into carrier pNeoU6+1 (pNeoU6+1 carrier and cloning process reference literature: Bao S respectively, et al.Oncogene, 2004,23 (33): 5586-93), obtain the expression plasmid of four kinds of PRMT5 siRNA, respectively called after pDs288, pDs626, pDs852 and pDs1228.Prepare plasmid DNA in a large number with the Qiangen plasmid extraction kit, measure plasmid concentration, be used for eukaryotic cell transfection.

Three, detect the inhibition situation that PRMT5 siRNA expresses PRMT5 in the tumour cell

1, the structure of GFP-PRMT5 fusion protein expression vector

Full-length cDNA (NCBI:BC025979 with people PRMT5, available from U.S. OpenBiosystem company) be template, pcr amplification PRMT5 full length cDNA sequence under the guiding of primer P1 (5 '-cgggatccatggcggcgatggcggtcg-3 ') and P2 (5 '-ccgctcgaggaggccaatggtatatgagc-3 '), again with this sequence clone between the Bgl II and Xho I restriction enzyme digestion sites of carrier pEGFP-C1 (available from Clonetech) multiple clone site, obtain the GFP-PRMT5 fusion protein expression vector, called after pGFP-PRMT5.

2, transfectional cell

1) the transfection cultivation of cell

24h before the transfection, in the 60mm culture dish, cultivate rectum cancer cell and be HCT116 (available from U.S. ATCC, Bao S, et al.Oncogene, 2004,23 (33): 5586-93), density reaches at 70% o'clock and carries out transfection.

2) transfectional cell

Control group: pGFP-PRMT5 (0.3ug)+pDslucif (2.7ug, the contrast siRNA expression plasmid of reticent Luciferase gene, construction process reference literature Bao S, et al.Oncogene, 2004,23 (33): 5586-93).

SiRNA expression plasmid (pDs288, pDs626, pDs852 or the pDs1228) 2.7ug that experimental group: pGFP-PRMT5 (0.3ug)+step 2 makes up.

Lipofectamine2000 (Cat:11668-027) test kit and reference reagent box specification sheets with Invitrogen company make up transient transfection HCT116 cell with above-mentioned plasmid.

3, the Western Blot of PRMT5 expression detects in the transfectional cell

Behind the transfection 36h, detect the expression of PRMT5 in above-mentioned 5 kinds of transfectional cells with Western Blot method, protein extracting method is: inhale and remove substratum, cell is washed twice with cold PBS, add 300ul RIPA damping fluid (50mMTris pH7.5,150mM NaCl, 10mM EDTA, 1%NP-40,0.1%SDS, 1mM PMSF, 10 μ g/mLAprotinin), 4 ℃ of cracking 30min, collecting cell; Ultrasonic 15 seconds of 8V voltage, ice bath 10min; 4 ℃, the centrifugal 10min of 12000rpm.Draw supernatant, utilize the Brandford method to carry out protein quantification, respectively getting the 50ug total protein then detects, with GFP is reference, detected result is seen a figure among Fig. 5, can both reduce or suppress the expression level of PRMT5 in the tumour cell effectively at four couples of siRNA of PRMT5 design, wherein with the inhibition effect of siRNA1 (288-308 (ggagaagattcgcaggaactc)) significantly (seeing the figure b among Fig. 5, is reference with Tubulin).

Four, detect the inhibition situation of PRMT5 siRNA to growth of tumour cell

With siRNA expression vector pDs288 that can effective reticent PRMT5 is example, detect its influence by cell clone survival experiment to growth of cancer cells, concrete grammar is: with pDs288 and pDslucif difference transfection HCT116 cell, counting after 24 hours, 20000 cell/100mm culture dish, parallel three parts of each sample, adding final concentration is the Xin Meisu (G418 of 400ug/mL, available from Gibco company), cultivating and forming diameter to cell in 14-20 days is clone about 2mm, see the figure c among Fig. 5, the growth of the cancer cells of transfection pDs288 is significantly suppressed, and finally be killed, prove that the siRNA that the present invention is directed to the PRMT5 design can suppress or the kill tumor cell effectively.

Sequence table

<160>16

<210>1

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>1

ggagaagauu?cgcaggaacu?c 21

<210>2

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>2

gaguuccugc?gaaucuucuc?c 21

<210>3

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>3

gggcugaccu?cccaucuaau?c 21

<210>4

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>4

gauuagaugg?gaggucagcc?c 21

<210>5

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>5

ggaauacuua?agccagaacc?g 21

<210>6

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>6

cgguucuggc?uuaaguauuc?c 21

<210>7

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>7

ggaagccaag?ugaccguagu?c 21

<210>8

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>8

gacuacgguc?acuuggcuuc?c 21

<210>9

<211>58

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>9

gagaagattc?gcaggaactc?ttcaagagag?agttcctgcg?aatcttctcc?ttttttta 58

<210>10

<211>62

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>10

agcttaaaaa?aaggagaaga?ttcgcaggaa?ctctctcttg?aagagttcct?gcgaatcttc 60

tc 62

<210>11

<211>58

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>11

ggctgacctc?ccatctaatc?ttcaagagag?attagatggg?aggtcagccc?ttttttta 58

<210>12

<211>62

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>12

agcttaaaaa?aagggctgac?ctcccatcta?atctctcttg?aagattagat?gggaggtcag 60

cc 62

<210>13

<211>58

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>13

gaatacttaa?gccagaaccg?ttcaagagac?ggttctggct?taagtattcc?ttttttta 58

<210>14

<211>62

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>14

agcttaaaaa?aaggaatact taagccagaa?ccgtctcttg?aacggttctg?gcttaagtat?60

tc 62

<210>15

<211>58

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>15

gaagccaagt?gaccgtagtc?ttcaagagag?actacggtca?cttggcttcc?ttttttta 58

<210>16

<211>62

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>16

agcttaaaaa?aaggaagcca?agtgaccgta?gtctctcttg?aagactacgg?tcacttggct 60

tc 62

Claims

1, the application of Protein Arginine Methyltransferase 5 in leukemia detects.

2, the siRNA of arrestin matter arginine methyltransferase 5 genetic expressions is one of following double-stranded RNA sequences:

3, the encoding sequence of the siRNA of the described arrestin matter of claim 2 arginine methyltransferase 5 genetic expressions.

4, encoding sequence according to claim 3 is characterized in that: the encoding sequence of the siRNA of described arrestin matter arginine methyltransferase 5 genetic expressions is one of following double chain nucleotide sequences:

1) positive-sense strand has SEQ ID № in the sequence table: 9 nucleotide sequence; Antisense strand has SEQ ID № in the sequence table: 10 nucleotide sequence;

2) positive-sense strand has SEQ ID № in the sequence table: 11 nucleotide sequence; Antisense strand has SEQ ID №: 12 nucleotide sequence;

3) positive-sense strand has SEQ ID № in the sequence table: 13 nucleotide sequence; Antisense strand has SEQ ID №: 14 nucleotide sequence;

4) positive-sense strand has SEQ ID № in the sequence table: 15 nucleotide sequence; Antisense strand has SEQ ID №: 16 nucleotide sequence.

5, the expression vector that contains claim 3 or 4 described encoding sequences.

6, the transgenic cell line that contains the described expression vector of claim 5.

7, the host bacterium that contains the described expression vector of claim 5.

8, the method for a kind of arrestin matter arginine methyltransferase 5 genetic expressions, be that encoding sequence with the siRNA of claim 3 or 5 genetic expressions of 4 described arrestin matter arginine methyltransferases imports among the host, the Protein Arginine Methyltransferase 5 gene is inhibited.

9, method according to claim 8 is characterized in that: the siRNA expression vector of the siRNA encoding sequence of the encoding sequence of the siRNA of described arrestin matter arginine methyltransferase 5 genetic expressions by containing 5 genetic expressions of described arrestin matter arginine methyltransferase imports the host; The described siRNA expression vector that contains the siRNA encoding gene of arrestin matter arginine methyltransferase 5 genetic expressions is pDs288, pDs626, pDs852 or pDs1228.

10, the application of the siRNA of the described arrestin matter of claim 2 arginine methyltransferase 5 genetic expressions in preparation leukemia treating medicine.