CN1580260A - SiRNA and expression carrier for inhibiting human telomerase reversed transcriptive enzyme gene expression and their pharmaceutical use - Google Patents

Abstract

The present invention discloses SiRNA and expression carrier thereof for specifically inhibiting human telomerase enzyme reversed transcriptive enzyme gene expression and their pharmaceutical use for preparing human telomere enzyme activation related neoplastic medicines. The present invention obtains a group of human telomere enzyme inverse transcriptase gene sequences from the GenBank by using bio-computer information technology, based on the RNA disturbance technology, works out a group of siRNA which probably induce RNA disturbance, and expresses a certain amount of siRNA though chemical method synthesis or plasmid carrier, and then specifically restrains the expression of human telomere enzyme inverse transcriptase genes. Said siRNA and expression plasmid thereof can prepare highly effective and rapid antineoplastic drugs with strong specificity and low side-effects.

Description

Suppress siRNA and the expression vector and the application in pharmacy thereof of human telomerase reverse transcriptase genetic expression

Technical field

The present invention relates to a kind of siRNA, particularly relate to siRNA and expression vector and the application in pharmacy thereof that a kind of target suppresses human telomerase reverse transcriptase genetic expression.

Background technology

The therapy of tumor method that suppresses the oncogene expression at present mainly is with Antisense OligodeoxynucleotideTechnique Technique (Agraival, Trends in Biotech, 1992,10:152) block detrimental expression, its mechanism of action is clear, it forms three chains by base complementrity pairing and double-stranded DNA, or forms heteroduplex with RNA, thus blocking gene duplicate, transcribe, transcribe post-treatment or translation.It also can excite the RNaseH vigor, the RNA chain in degradation of rna, the DNA heteroduplex or with other the expression of the final blocking gene of mode.People use Antisense OligodeoxynucleotideTechnique Technique to suppress the overexpression of some gene.But because Antisense OligodeoxynucleotideTechnique Technique does not have scale effect, general consumption is all bigger, some use reaches more than the 2 μ mol in cell transfecting research, and the inhibition of gene expression effect about about 50%-90%, only has 10-20% to some acceptors and special proteic restraining effect greatly.At some antisense oligonucleotides of clinic trial, (Webb A, Lancet 1997,349:1137) to 73.6mg/m2 to reach 4.1mg/m2 as the antisense oligonucleotide dosage of Bcl-2 oncogene.The efficient of targeting cancer cells just reduces greatly like this.Also limited the widespread use of Antisense OligodeoxynucleotideTechnique Technique.

The expression level of Telomerase and the generation of malignant tumour, development and prognosis are closely related, have therefore become new tumor markers and oncotherapy target spot.Existing research report is treated kinds of tumors (Teng L et al.J Clin Endocrinol Metab 2003,88:1362 with telomere enzyme antiseuse oligonucleotide; Schindler A et al.IntJ Oncol 2001,19:25; Zhang Suzhen etc., Chinese J of Cancer, 2002,21:493; King's filial piety is foster etc., CHINESE JOURNAL OF INTERNAL MEDICINE, 2002,41:3; Xu Ning etc., Chinese magazine of urology surgery, 2000,21:6), certain result of treatment is arranged.They utilize telomere enzyme antiseuse oligonucleotide to act on thyroid carcinoma, prostate cancer, nasopharyngeal carcinoma, lung cancer, kidney cancer cell respectively, the propagation of the activity of anticancer Telomerase and cancer cells in various degree, shortcoming is that used dosage is bigger, suppresses effect and still can not reach requirement.

(RNA interference, RNAi) The Application of Technology brings new application prospect for the gene therapy of cancer in RNA interference recently.Being in February, 1998 has in the world the earliest used this technology having delivered on " Nature " first by Fire and Mello on a kind of nematode, many subsequently investigators have carried out big quantity research on fruit bat, plant and animal ovum, the result shows that the RNAi phenomenon can both take place in above-mentioned organism.Up to May calendar year 2001 and December calendar year 2001, people such as Germany scientist Elabshir, Harborth and Tuschl have delivered in succession on " Nature " and " J.Cell Sci. " with the RNAi technology and have made 16 gene expression doses reductions or reticent in the cells of mamma animals respectively, thereby proof RNAi also is influential to cells of mamma animals, and this makes this technology be applied to treat some becomes possibility because specific gene is expressed disease of too much causing (cancer that causes as the overexpression of oncogene).Being expected to this technology can become the effective means of new gene therapy for cancer.This technology can make the mRNA of target express at short notice obviously reduction, and has the waterfall type of amplification effect, target gene is expressed in a long time continue to reduce, and used dosage is little, suppresses the effect height.

Summary of the invention

The purpose of this invention is to provide a kind of target and suppress human telomerase reverse transcriptase (human telomerasereverse transcriptase, hTRT) siRNA of gene mRNA expression.

Another object of the present invention provides a kind of plasmid vector that can express above-mentioned siRNA.

A further object of the invention provides above-mentioned siRNA and the application of expression plasmid carrier in the medicine of preparation treatment or prophylaxis of tumours thereof.

Purpose of the present invention can reach by following measure:

Principle of the present invention is by making up a kind of plasmid vector (called after psiRNATE), this plasmid vector can produce the little double-stranded RNA (siRNA) of 19-23 Nucleotide, there are complementary relationship in this siRNA and hTRT mRNA, can discern on the hTRT mRNA and its complementary sequence by target, and combination with it, thereby influence the activity that telomerase gene is expressed.

Design in view of the above, at first in gene pool, seek the mRNA sequence of target gene hTRT, and 75 bases begin to seek AA+N19+UU sequence or AA+N19 sequence (N19 is any 19 mRNA nucleotide sequences) behind the initiation codon, calculate in the selected 19-23 nts mRNA base sequence G+C ratio then between 30% to 70%, again 19-23 nts mRNA sequence is searched the EST gene pool with Blast, the gene of confirming institute's target is unique, design the sense-rna of 19-23 Nucleotide again, and with synthetic two the RNA chains of SiACE-RNAi method, form the little double-stranded RNA that a specific specificity suppresses human telomerase reverse transcriptase genetic expression, it comprises in following four kinds of little double-stranded RNAs any one or a few, and their base sequence sees Table 1.

Little double-stranded RNA sequence of table 1 and targeting human telomerase reverse transcriptase gene locus (sequence number: AF015950)

Numbering	Little double-stranded RNA sequence	Length	Site of action
				NO.1 (SEQ?ID?NO.1)	5’-GAA?CGU?GCU?GGC?CUU?CGG?C-3’ 3’-CUU?GCA?CGA?CCG?GAA?GCC?G-5’	19nts	337-355
NO.2 (SEQ?ID?NO.2)	5’-CGU?GCU?GGC?CUU?CGG?CUU?C-3’ 3’-GCA?CGA?CCG?GAA?GCC?GAA?G-5’	19nts	340-358
				NO.3 (SEQ?ID?NO.3)	5’-CAC?GGU?GAC?CGA?CGC?ACU?G-3’ 3’-GUG?CCA?CUG?GCU?GCG?UGA?C-5’	19nts	430-448
NO.4 (SEQ?ID?NO.4)	5’-GGC?GUC?UGG?GAU?GCG?AAC?G-3’ 3’-CCG?CAG?ACC?C?UA?CGC?UUG?C-5’	19nts	639-657

Purpose of the present invention can also realize by following measures:

A kind of expression plasmid series that can suppress the little double-stranded RNA of human telomerase reverse transcriptase genetic expression, it has following basic structure:

By the circular double stranded DNA molecule that promotor, little double-stranded RNA coding region and dna sequence dna sequentially connect form, wherein promotor is the promotor of any eukaryotic gene, and it is that the little dsdna epitope that starts its downstream is reached little double stranded rna expression element; Little double-stranded RNA coding region is the double-stranded DNA that is made of main body the double-stranded DNA that can express the little double-stranded RNA sequence in the table 1, and forms the little double-stranded RNA of two-way or hairpin structure at cell inner expression; Dna sequence dna is the dna sequence dna of any eucaryon plasmid outside promotor, coding region, contains antibiotics resistance gene, comprises making bacterium obtain at certain antibiotic resistant gene or eukaryotic cell being obtained at certain antibiotic resistant gene.

The application of described little double-stranded RNA in the medicine of preparation treatment and prophylaxis of tumours.

The application of described plasmid in the medicine of preparation treatment and prophylaxis of tumours.

Advantage of the present invention:

3 ' terminal Synthetic 2-5 dT the sequence of extending with the double-stranded RNA in the table 1 (siRNA) two chains, degrade to reduce in the cell, and with the little double-stranded RNA transfectional cell of synthetic, to confirm the genetic expression of the selectively targeted inhibition telomerase reverse transcriptase of these little double-stranded RNAs energy, then these little double-stranded RNAs are cloned in the plasmid vector by two-way or the corresponding double-stranded DNA of hairpin structure, this plasmid can be transcribed in cell form 3 ' the terminal double-stranded RNA that extends 2-5 U with table 1 identical sequence.

The above-mentioned expression plasmid carrier psiRNATE that can form the double-stranded RNA (siRNA) of the identical double-stranded sequence of table 1 is distinguished transfection or by virus vector direct infection Hela cervical cancer cell, SMMC7721 liver cancer cell, MKN-45 stomach cancer cell, sets up the cell strain of stable commentaries on classics psiRNA carrier with liposome.Compare with control group (JEG-3 of untransfected), detect the content of hTRT in the strain of above-mentioned commentaries on classics psiRNATE plasmid cell with the western method, the result shows that (concrete data are seen embodiment) psiRNATE plasmid vector of the present invention can obviously suppress the activity of hTRT in above-mentioned several cancer cells.Further measure the telomerase activation in the transfection JEG-3, the result is starkly lower than untransfected plasmid cancer cells group.Various cells transfected strains are inoculated into respectively in the nude mouse that contains transplanted tumor, observe knurl bulk-growth situation, the result shows that this plasmid can suppress the growth of knurl body effectively.The plasmid vector that can produce little double-stranded RNA that makes up and this little double-stranded RNA, the energy targeting is in hTRT mRNA, the activity of Telomerase in the anticancer, and can in whole animal experiment, suppress the growth of transplanted tumor, its retarding effect is more obvious than the effect of telomere enzyme antiseuse oligonucleotide, and the time length is more of a specified duration.Show that this invention can be applicable to prepare the medicine of treatment and prophylaxis of tumours.

Description of drawings

Fig. 1: empty carrier pcDNA3.1 (+) collection of illustrative plates

Fig. 2: 1.5% agarose gel electrophoresis U6+1+antisense DNA band

Fig. 3: 1.5% agarose gel electrophoresis U6+1+sense DNA band

Fig. 4: 1.5% agarose gel electrophoresis U6+1+antisense and U6+1+sense band

Fig. 5: Hela cell transfecting psiRNATE is to the proteic inhibition of Telomerase genetic expression

Fig. 6: psiRNATE transfection Hela cell, SMMC7721 cell, MKN-45 cell are to the active influence of Telomerase

Fig. 7: 25 days posterior tuberosity bulk-growths of nude inoculation Hela cell volume

Fig. 8: pRK5 empty plasmid carrier collection of illustrative plates

Fig. 9: Hela cell transfecting psiRNA-TRT is to the proteic inhibition of Telomerase genetic expression

Figure 10: psiRNA-TRT transfection Hela cell, SMMC7721 cell, MKN-45 cell are to the active influence of Telomerase

Figure 11: nude inoculation Hela cell 25 posterior tuberosity bulk-growth volumes

Embodiment

The present invention is further elaborated by following embodiment, but do not limit the scope of the invention.

Embodiment 1: make up the two-way little dsrna expression vector that is formed by positive-sense strand (sense chain) and antisense strand (antisense chain) and suppress telomerase reverse transcriptase genetic expression.

1. the structure of little dsrna expression vector

(1) forgives the formation of the double-stranded DNA of goal gene

For the little double-stranded RNA sequence (is example with SEQ ID NO.1) that will design can be expressed in plasmid, at first synthetic 3 primers utilize round pcr to form and forgive the double chain DNA fragment of U6+1 promotor accordingly respectively.The sequence of 3 primers is respectively:

3 ' terminal positive-sense strand (sense) primer sequence is:

5’-ATT?GGG?CCC?GTC?GAC?ATC?GAT?AAA?AAA?GAA?GCC?GAA?GGC?CAG?CACGTT?CGG?TGT?TTC?GTC?CTT?TCC?AC-3’

(SEQ?ID?NO.5)

3 ' terminal antisense strand (antisense) primer sequence is:

5’-CCG?GAA?TCC?TCT?AGA?AAA?AAA?GAA?CGT?GCT?GGC?CTT?CGG?CTT?CGGTGT?TTC?GTC?CTT?TCC?AC-3’

(SEQ?ID?NO.6)

5 ' terminal primer sequence is:

5’-ATA?AGA?ATG?CGG?CCG?CCC?CGG?GGA?TCC?AAG?GTC?GGG-3’

(SEQ?ID?NO.7)

Respectively with 3 ' terminal normal chain and minus strand primer and 5 ' terminal primer by pcr amplification formation two dna double chains (sense chain, antisense chain), pcr template is pTZU6+1, the process of PCR: 94 ℃ 1 minute, 57 ℃ 1 minute, 72 ℃ 1 minute, after 35 circulations, 72 ℃ 10 minutes, 4 ℃ of preservations.

(2) enzyme is cut double-stranded DNA and the plasmid vector pcDNA3.1 (5.428kb) that forgives goal gene U6+1+antisense

The PCR product has a very dark very bright band through 1.5% agarose gel electrophoresis about 350bp under the UV-light, be U6+1+antisense DNA band, reclaims test kit with the Qiagen gel and reclaims.That gets that 17 μ l reclaim contains U6+1+antisense DNA, adds 10 * restriction enzyme XbaI damping fluid, 2 μ l, adds restriction enzyme XbaI1 μ l again, mixing, 37 ℃ of enzymes are cut and are spent the night, and add restriction enzyme BamHI 1 μ l again in reaction system, and 37 ℃ of enzymes are cut 3h.Same method is cut empty plasmid carrier pcDNA3.1 (5.428kb) with XbaI and BamHI enzyme.Electrophoresis also reclaims, and obtains containing U6+1+antisense small pieces segment DNA (restriction enzyme site is XbaI and BamHI) and big fragment plasmid vector pcDNA3.1 (restriction enzyme site is XbaI and BamHI).-20 ℃ of preservations are standby.

(3) enzyme is cut double-stranded DNA and the empty plasmid carrier pcDNA3.1 that forgives goal gene U6+1+sense

The PCR product has a very dark very bright band through 1.5% agarose gel electrophoresis about 350bp under the UV-light, be U6+1+sense DNA band, reclaims test kit with the Qiagen gel and reclaims.Get the U6+1+senseDNA that contains of 17 μ l recovery, add 10 * restriction enzyme NotI damping fluid, 2 μ l, add restriction enzyme NotI 1 μ l again, mixing, 37 ℃ of enzymes are cut and are spent the night, and add 16 μ l 4M Spirit of Mindererus then in the reaction system, 84 μ l dehydrated alcohols, mix ,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme A paI, enzyme is cut 3h.Same method is cut empty plasmid carrier pcDNA3.1 (5.428kb, collection of illustrative plates is seen Fig. 1) with NotI and ApaI enzyme.Obtain containing U6+1+sense small pieces segment DNA (restriction enzyme site be NotI and ApaI and) and big fragment plasmid vector pcDNA3.1 (restriction enzyme site is NotI and ApaI).-20 ℃ of preservations are standby.

(4) goal gene U6+1+antisense is connected among the plasmid vector pcDNA3.1

Get enzyme and cut big fragment plasmid vector pcDNA3.1 (restriction enzyme site is XbaI and BamHI) 1 μ l, get U6+1+antisense small pieces segment DNA (restriction enzyme site is XbaI and BamHI) 7 μ l again, the sterilized water that adds 10 μ l, the T4 dna ligase of the 10 * T4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.The competence bacillus coli DH 5 alpha that in Incubating Solution, adds 100 μ l, transformed into escherichia coli, be coated on then on the LB solid medium that contains 100 μ g/ml penbritins, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, cut evaluation with restriction enzyme XbaI and BamHI enzyme respectively, reaction solution separates at 1.5% agarose gel electrophoresis, the results are shown in Figure 2,2,3,4,5,6,7 for containing the pulsating positive colony bacterium of U6+1+antisenseDNA among the figure.Selection 350bp occurs and inserts segmental plasmid, preserves standby.

(5) goal gene U6+1+sense is connected among the plasmid vector pcDNA3.1

Get enzyme and cut big fragment plasmid vector pcDNA3.1 (restriction enzyme site is NotI and ApaI) 1 μ l, get U6+1+sense small pieces segment DNA (restriction enzyme site is NotI and ApaI) 7 μ l again, the sterilized water that adds 10 μ l, the T4 dna ligase of the 10 * T4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.The competence escherichia coli DH5a that in Incubating Solution, adds 100 μ l, transformed into escherichia coli, be coated on then on the LB solid medium that contains 100 μ g/ml penbritins, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, cut evaluation with restriction enzyme NotI and ApaI enzyme respectively, reaction solution separates at 1.5% agarose gel electrophoresis, the results are shown in Figure 3,1,2,3,6 for containing the positive colony bacterium of U6+1+sense dna segment among the figure.350bp occurs and insert segmental plasmid, preserve standby.

(6) after cutting 3h with the positive colony bacterium upgrading grain in the step (4), and with Apa I enzyme, in reaction solution, add 0.5 μ l tack enzyme, hatch 15min for 37 ℃, 75 ℃ of deactivation 10min add 16 μ l 4M Spirit of Mindererus then in the reaction system, 84 μ l dehydrated alcohols, precipitation, centrifugal.Remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme HindIII damping fluid and 1 μ l HindIII, enzyme is cut 3h.1.5% agarose gel electrophoresis separates, and what obtain 350bp contains U6+1+antisense small pieces segment DNA, and its restriction enzyme site is HindIII and Apa I (putting down).Glue reclaims standby.

(7) after cutting 2h with the positive colony bacterium upgrading grain in the step (5), and with EcoR I enzyme, in reaction solution, add 0.5 μ l tack enzyme, hatch 15min for 37 ℃, 75 ℃ of deactivation 10min add 16 μ l 4M Spirit of Mindererus then in the reaction system, 84 μ l dehydrated alcohols, precipitation, centrifugal.Remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme HindIII damping fluid and 1 μ l HindIII, enzyme is cut 3h.1.5% agarose gel electrophoresis separates, and obtains comprising the big fragment of U6+1+sense, and its restriction enzyme site is HindIII and EcoRI (putting down).Glue reclaims standby.

(8) structure of psiRNATE plasmid

Get the big fragment that the comprises U6+1+sense 1 μ l in the step (7), get U6+1+antisense small pieces segment DNA (restriction enzyme site is XbaI and BamHI) the 7 μ l in the step (6) again, the method for attachment in (4) gets involved small segment in the big fragment set by step.Transformed into escherichia coli, be coated on then on the LB solid medium that contains 100 μ g/ml penbritins, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, cut evaluation with restriction enzyme BamHI enzyme respectively, 1.5% agarose gel electrophoresis U6+1+antisense separates with the U6+1+sense band, the segmental positive clone bacterium of 350bp appears, the results are shown in Figure 4, among the figure No. 1 for comprising the pulsating positive colony bacterium of U6+1+antisense and U6+1+sense.To positive colony bacterium order-checking, the result shows in the plasmid vector of new structure and comprises U6+1+antisense and U6+1+sense, its plasmid called after psiRNATE.

The sequencing result of positive colony bacterium:

5′-CTGGCTAGCGTTTAAACTTAAGCAGCTTGGTACCGAGCTCGGATCCAAGGCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAAGCCGAAGGCCAGCACGTTCTTTTTTTCTAGAGATTCTGCAGATATCCAGCACAGTGGCGGCCGCCCCGGGGATCCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGAACGTGCTGGCCTTCGGCTTCTTTTTATCGATGTCNANGGGCCCGTNNAACCCNCTGTNCNNCCTCNACTGGGCCTNCTAANTTGNCCNCANNCGGNGGTNGCCCTCCCCNNN-3′

(SEQ?ID?NO.8)

Wherein comprise two sections U6+1 promoter sequences (41-309) (381-650):

5′-GGATCCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG-3′

(SEQ?ID?NO.9)

With antisense chain-ordering (311-330): 5 '-GCCGAAGGCCAGCACGTTC-3 ' (SEQ ID NO.10)

And sense chain-ordering (651-670): 5 '-GAACGTGCTGGCCTTCGGC-3 ' (SEQ ID NO.11).

2, gene transfection and cell cultures

With s, containing the RPMI1640 nutrient solution of 10% calf serum, 37 ℃, 5%CO ₂, the saturated humidity environment condition under cultured continuously.Transfection the day before yesterday is with 3.0 * 10 ⁵Above-mentioned three kinds of cell inoculations of logarithmic phase growth are in 6 well culture plates, 1.5 * 10 ⁵Individual cells/well, after the incubated overnight, the adherent rate of cell is inhaled and is removed nutrient solution when 40% left and right sides, does not wash 1 time with not containing 1640 of penicillin, Streptomycin sulphate and calf serum.Next get psiRNATE plasmid 4 μ g, add 250 μ l Opti-MEM mixed dilutings, another test tube adds 10 μ l lipofectamin 2000, with 250 μ l Opti-MEM mixed dilutings.Two test tubes were placed 5 minutes under the room temperature aseptic condition, and two test tubes merge to mix under the room temperature aseptic condition of back to be placed 20 minutes, treated to move in 6 orifice plates after the solution retrogradation, and every hole adds 560 μ l developing mediums, 37 ℃ of 5%CO ₂Under cultivated 4 hours, every hole adds the RPMI-1640 1440 μ l that contain 2 times of calf serums and 2 times of penicillin, Streptomycin sulphate, 37 ℃ of 5%CO again ₂Under cultivate behind the 72h again with G418 250 μ g/ml screening.Changed a not good liquor, and finally picked out positive cell clone in every 2-3 days.Amplification cultivation.

3. detect the expression of hTRT in above-mentioned Hela cell with western blot method

The s of above-mentioned commentaries on classics psiRNATE plasmid is cultivated, added the digestion of 1%SDS lysate, collecting cell.The ultrasonication cell.Polyacrylamide gel electrophoresis changes nitrocellulose filter, cuts the target protein band.With 1% skim-milk sealing 30min, adding the anti-hTRT polyclonal antibody one of rabbit by 1: 200 resists, hatch 2h for 37 ℃, 1% skim-milk is washed 3 times, add two anti-(goat anti-rabbit igg-HRP is available from Huamei Bio-Engrg Co.) by 1: 50 again, hatch 2h for 37 ℃, 1% skim-milk is washed 5 times, and 0.05M Tris-HCl pH7.4 washes once.Develop the color by 1: 50 diluent with DAB (dioxy base p-diaminodiphenyl) concentrated solution.The results are shown in Figure 5,1 is normal Hela groups of cells among the figure, and 2 are the blank plasmid group of transfection, and 3 are transfection psiRNATE group.The result shows that the hTRT in the Hela cervical cancer cell of transfection psiRNATE plasmid obviously reduces.

4. telomerase activity

Respectively at the Hela cervical cancer cell, the SMMC7721 liver cancer cell, transfection psiRNATE plasmid in the MKN-45 stomach cancer cell, incubation 3d, PBS solution is washed 1 time, 4 ℃ of centrifugal 1min of 1000r/min, precipitation adds 150 μ l lavation buffer solution (10mmol/L HEPES-KOH, pH7.5,1.5mmol/L MgCl2,10mmol/L KCl, 1mmol/L DTT) washing, centrifugal 1min, abandon washing lotion, add 50 μ l lysis buffer (10mmol/L Tris-HCl pH7.5,1mmol/L MgCl2,1mmol/L EGTA, 0.1mmol/L PMSF, the 5mmol/L mercaptoethanol, 0.5%CHAPS, 10% glycerine.), suspending, mixing is put ice bath 30min, and 4 ℃ of centrifugal 20min of 14000r/min get supernatant 2 μ l and do the TRAP reaction template.Get reaction tubes, each adds 45 μ l reaction mixtures, adds the sample that 2 μ l have handled, and mixing adds 30 μ l whiterusss, to 25 ℃ of water bath heat preservation 30min, and in the cocycle of PCR instrument, 94 ℃ of 120s; 94 ℃ of 30s; 48 ℃ of 30s; 72 ℃ of 92s; 72 ℃ of 300s circulate 35 times.After the loop ends, in each hole of microwell plate, add hybridization reaction solution, add amplified production 20 μ l mixings again, set up blank,, add developer then to 37 ℃ of isothermal reaction 60min, 37 ℃ of lucifuge colour developing 10min, add reaction terminating liquid (200mmol/L EDTA, 20mmol/L Tris-HCl pH7.0), termination reaction.Read the A value at wavelength 570-630nm, the results are shown in Figure 6,1 is Hela cell control group among the figure; 2 is SMMC7721 cell control group; 3 is MKN-45 cell control group; 4 is the Hela-psiRNATE groups of cells; 5 is the SMMC7721-psiRNATE groups of cells; 6 is the MKN-45-psiRNATE groups of cells.The result shows that Hela cervical cancer cell, SMMC7721 liver cancer cell, the MKN-45 telomerase activity of gastric cancer cells of transfection psiRNATE plasmid obviously are suppressed.

5. animal tumorigenicity experiment

BALB/C (nu/nu) nude mouse is divided into control group at random, changes blank plasmid group and changes psiRNATE plasmid group, 6 every group, be female.The Hela cervical cancer cell of taking the logarithm vegetative period, 0.25% trysinization is placed in the serum-free RPMI-1640, adjustment concentration is 5 * 107/ml, the right armpit that is inoculated in BALB/C (nu/nu) nude mouse respectively is subcutaneous, every 0.1ml, after the visible tumour of naked eyes to be formed, the next day with length (L) and wide (W) of vernier caliper measurement tumour, gross tumor volume is by following formula calculating: V=(L * W7) * 0.52.Each group is all being injected tumour cell after 25 days, and nude mice is put to death in the cervical vertebra dislocation, cuts tumour, measures the gross tumor volume size.The results are shown in Figure 7,1 is control group among the figure, and 2 for changeing blank plasmid group, and 3 are transfection psiRNATE group.The result shows: control group just forms the visible tumour of naked eyes in 14 days behind the inoculation nude mice, tumor average volume is 498mm3 in the time of the 25th day, changeing blank plasmid group tumor average volume and be 474mm3 changes psiRNATE plasmid group to form tumour speed in nude mouse obviously slower, and 25 days tumor average volumes are 37.2mm3 behind tumor cell inoculation.Show that the psiRNATE plasmid can obviously suppress growth of tumor, can be used for preparing the medicine for the treatment of tumour.

Embodiment 2. makes up the little dsrna expression vector of hair clip shape and suppresses hTRT genetic expression

The U6 promotor can efficiently express little double-stranded RNA, but does not have this promotor in the general plasmid vector, therefore at first needs to make up this promotor.

1.U6+1 the structure of promotor

(1) process of U6+1 promotor PCR primer design and PCR

Primer:

3 ' end primer

AATCTGCAGAAAAAGCGGACCGAAGTCCGCTCTAGATGCATGCTCGAGGTCGTCCGGTGTTTCGTCCTTTC

CAC

(SEQ?ID?NO.12)

5 ' end primer

CGCGGATCCAAGGTCGGGCAGGAAGAGGGC

(SEQ?ID?NO.13)

Pcr template: pTZU6+1

The process of PCR

94 ℃ 1 minute, 57 ℃ 1 minute, 72 ℃ 1 minute, after 35 circulations, 72 ℃ 10 minutes, 4 ℃ of preservations.

(2) the PCR product is through 1% agarose gel electrophoresis, at 280bp a very dark very bright band is arranged under the UV-light, the band of U6+1 promotor that Here it is, downcut,, get the DNA that 17 μ l reclaim with the double-stranded DNA on the Qiagen gel recovery test kit recovery gel, add 10 * restriction enzyme PstI damping fluid, 2 μ l, add restriction enzyme PstI 1 μ l again, mixing, 37 ℃ are incubated enzymolysis 5 hours, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols mix, 20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme BamHI damping fluid, 2 μ l, add restriction enzyme BamHI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 2 hours.At last, 1% agarose gel electrophoresis has a very dark very bright band at 280bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be A liquid, and-20 ℃ of preservations are standby.

2.pRK5 the enzyme of empty plasmid carrier cut with being connected of U6+1 promotor

(1) gets empty plasmid carrier pRK5 (4716bp, collection of illustrative plates is seen Fig. 8) 0.5 μ g (0.5 μ l), add 10 * restriction enzyme PstI damping fluid, 2 μ l, sterilized water 17 μ l and restriction enzyme PstI 1 μ l, mixing, 37 ℃ are incubated enzymolysis 5 hours, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols mix,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme BamHI damping fluid, 2 μ l, add restriction enzyme BamHI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 2 hours.At last, 1% agarose gel electrophoresis has a band above 4500bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be B liquid, and-20 ℃ of preservations are standby.

(2) get above-mentioned A liquid 7 μ l, B liquid 1 μ l adds the sterilized water of 10 μ l, and the T4 dna ligase of the 10 * T4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.

(3) the competence escherichia coli DH5a of adding 100 μ l in Incubating Solution, transformed into escherichia coli, be coated on then on the LB solid medium of 100 μ g/ml penbritins, 37 ℃ incubated overnight 16-18 hour, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, extracting plasmid, cut with restriction enzyme PstI and BamHI enzyme respectively, reaction solution separates at 1% agarose gel electrophoresis, selects 350bp to occur and inserts segmental plasmid, preserves standby.

3. suppress hTRT genetic expression the little double-stranded RNA of hair clip shape preparation be connected

Hair clip shape double-stranded RNA provided by the present invention (siRNA), (sequence number: partially double stranded sequence AF015950) identical (site is at 340-358), but added the ring of 9 nucleotide sequences in a double-stranded side, the sequence of this ring is: TTCAAGAGA with the hTRT gene.The purpose that increases this ring is to improve the expression amount of little double-stranded RNA.

The action site that siRNA suppresses hTRT mRNA sees Table 1, these RNA sequences must meet following principle: 75 bases begin to seek AA+N19+UU sequence or AA+N19 sequence behind the initiation codon from gene order, wherein any 19 the mRNA nucleotide sequences of N19.Find out therefrom generally that the G+C ratio is about 50% in 21 Nucleotide, be not higher than 70% or be not less than 30% Nucleotide.Satisfactory 21 base sequences are passed through little nucleotide sequence homology of blast search and EST Library in NCBI database, be unique with the goal gene that guarantees institute's target.Modify with 2-4 dT or 2-6 U by the sense RNA of 21 bases that design and the 3 ' end of antisense RNA, can reduce degraded in the cell.

The contriver is according to above principle, and the NO.2 sequence (SEQ ID NO.2) in the table 1 has been synthesized in design, and sequence is:

5’-CGU?GCU?GGC?CUU?CGG?CUU?C-3’

3’-GCA?CGA?CCG?GAA?GCC?GAA?G-5’

Act on the 340-358 site of hTRT mRNA.

Two ends stay the restriction enzyme site of SalI and XbaI, and the gene order of concrete hair clip shape RNA is:

The N end:

5’-GATCCGAACGTGCTGGCCTTCGGCTTCAAGAGAGCCGAAGGCCAGCACGTTC

TTTTTTGGAAA-3’

(SEQ?ID?NO.14)

The C end:

5’-AGCTTTTCCAAAAAAGAACGTGCTGGCCTTCGGCTCTCTTGAAGCCGAAGGC

CAGCACGTTCG-3’

(SEQ?ID?NO.15)

(1) above-mentioned two single stranded DNAs of synthetic respectively is made into two strands

The single stranded DNA that is made into 50 μ M is respectively got 2 μ l, add the annealing Buffer (100mM Potassium ethanoate, 30mM Hepes-KOH pH7.4,2mM magnesium acetate) of 46 μ l, in the PCR instrument, 95 ℃ 4 minutes, 70 ℃ 10 minutes, the shutdown postcooling to room temperature, 4 ℃ deposit after ,-20 ℃ of preservations are standby.

(2) phosphorylation of synthetic dsdna

2 μ l synthetic dsdnas

The buffer A of 1 μ l T4 polynueleotide kinase

1μl?1mM?ATP

1μl?T4?PNK

5 μ l sterilized waters

Is cumulative volume the liquid mixing of 10 μ l, 37 ℃ of 30min, 70 ℃ of 10min are cooled to room temperature then, 4 ℃ deposit after ,-20 ℃ of preservations are standby.

(3) get the pRK5 plasmid 16 μ l (1 μ g) that connect the U6 promotor, add 10 * restriction enzyme SalI damping fluid, 2 μ l, each 1 μ l of restriction enzyme SalI and XbaI, mixing, 37 ℃ of insulation enzymolysis 5h, after the reaction, 1% agarose gel electrophoresis has a band below 5000bp under the UV-light, downcut, double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, and-20 ℃ of preservations are standby.

(4) the plasmid 1 μ l that above-mentioned enzyme is cut and the synthetic double-stranded DNA 7 μ l of above-mentioned phosphorylation add the sterilized water of 10 μ l, and the T4 dna ligase of the 10 * T4 dna ligase damping fluid of 2 μ l and 1 μ l is hatched 1h for 22 ℃.

(5) the competence bacillus coli DH 5 alpha of adding 100 μ l in Incubating Solution, transformed into escherichia coli, be coated on then on the LB solid medium of 100 μ g/ml penbritins, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, use restriction enzyme SalI and XbaI enzyme cutting respectively, reaction solution separates at 2.5% agarose gel electrophoresis, 64bp occurs and insert segmental positive clone bacterium, with its plasmid called after pRTRT.

4. the construction process that contains G418 resistant gene double-stranded RNA plasmid psiRNA-TRT

(1) the pRTRT plasmid that has built, get 17 μ l (about 1 μ g), add 10 * restriction enzyme EcoRI damping fluid, 2 μ l, restriction enzyme EcoRI 1 μ l, mixing, 37 ℃ are incubated enzymolysis 1 hour, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols mix,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme XbaI damping fluid, 2 μ l, add restriction enzyme XbaI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 5 hours.At last, 1% agarose gel electrophoresis has a band at 400bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be A liquid, and-20 ℃ of preservations are standby.

(2) get pcDNA3.1 plasmid 17 μ l (about 1 μ g), add 10 * restriction enzyme EcoRI damping fluid, 2 μ l, restriction enzyme EcoRI 1 μ l, mixing, 37 ℃ are incubated enzymolysis 2 hours, after the reaction, add 16 μ l4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols, mix ,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme XbaI damping fluid, 2 μ l, add restriction enzyme XbaI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 5 hours.At last, 1% agarose gel electrophoresis has a band at 5400bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be B liquid, and-20 ℃ of preservations are standby.

(3) connection of plasmid, conversion and evaluation

Get above-mentioned A liquid 7 μ l, B liquid 1 μ l adds the sterilized water of 10 μ l, and the T4 dna ligase of the 10 * T4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.

The competence bacillus coli DH 5 alpha that in Incubating Solution, adds 100 μ l, transformed into escherichia coli, be coated on then on the LB solid medium of 100 μ g/ml penbritins, 37 ℃ of incubated overnight 18 hours, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, use restriction enzyme EcoRI and XbaI enzyme cutting respectively, reaction solution separates at 1% agarose gel electrophoresis, selection 400bp occurs and inserts the positive clone of segmental plasmid bacterium, its plasmid called after psiRNA-TRT.

5.psiRNA-TRT plasmid is to the restraining effect of Hela cell hTRT genetic expression

(1) cultivation of Hela cell and transfection

The Hela cell is from cell institute of the Shanghai Chinese Academy of Sciences, and 1640 substratum+10% calf serum is cultivated, and the adherent rate of waiting to cultivate cell is spread 6 porocyte culture plates, 1.5 * 10 about 80% ⁵Individual cells/well, after the incubated overnight, the adherent rate of cell is inhaled and is removed nutrient solution when 40% left and right sides, does not wash 1 time with not containing 1640 of penicillin, Streptomycin sulphate and calf serum.Next get p siRNA-TRT plasmid 4 μ g, add 250 μ l Opti-MEM mixed dilutings, another test tube adds 10 μ l lipofectamin2000, with 250 μ l Opti-MEM mixed dilutings.Two test tubes were placed 5 minutes under the room temperature aseptic condition, and two test tubes merge to mix under the room temperature aseptic condition of back to be placed 20 minutes, treated to move in 6 orifice plates after the solution retrogradation, and every hole adds 560 μ l developing mediums, 37 ℃ of 5% CO ₂Under cultivated 4 hours, every hole adds the RPMI-1640 1440 μ l that contain 2 times of calf serums and 2 times of penicillin, Streptomycin sulphate, 37 ℃ of 5%CO again ₂Under cultivated 72 hours.

(2) screening of cell

Developing medium is removed in suction, with the 1640 substratum screenings positive cell that contains 100 μ g/ml G418, middlely constantly changes fresh 1640 substratum that contain 100 μ g/ml G418, treat that cell is adherent fully after, this is the Hela cell that contains p siRNA-TRT plasmid.

(3) evaluation of the recovery of cell and inhibition effect

The Hela cell that contains the psiRNA-TRT plasmid after not containing the 1640 culture medium culturing 72h of G418, is inhaled and removed developing medium, use Hank ' s liquid to wash once, every hole adds 50 μ l 1%SDS, behind the taking-up cell, and slight ultrasonication cell 10 seconds ,-70 ℃ are frozen.Take out 3 μ l simultaneously and survey protein concentration with Bio-Rad DC, OD750 surveys absorption value, finds protein concentration from typical curve.It is that 100 μ g make the 10%SDS-PAGE electrophoresis that the adjusting protein concentration makes the protein content of each sample, and is transferred on the nitrocellulose filter, carries out the western method and detects.Contain the PBS (0.1M of the nitrocellulose filter of sample with the preparation of 2% skim-milk, pH7.0) wash 30min, after diluting by 1: 250 usefulness 2% skim-milk-PBS with mouse monoclonal antibody (mouse-anti hTRT monoclonal antibody, down together), oscillatory reaction 1.5 hours is washed 30min with 2% skim-milk-PBS.Then with the HRP-goat antirabbit two anti-(1: 1,000 2% skim-milk of goat anti-rabbit igg-HRP)-PBS dilution afterreaction 1 hour, PBS washes 30min, DAB test kit color development treatment, the results are shown in Figure 9,1 is normal Hela groups of cells among the figure, and 2 are the blank plasmid group of transfection, and 3 are transfection psiRNA-TRT group.Found that, with control group relatively, transfection has that it suppresses the hTRT expression of gene more than 90% in the cell of psiRNA-TRT plasmid.

6. telomerase activity

Hela cell incubation 3d with transfection psiRNA-TRT plasmid, PBS solution is washed 1 time, 4 ℃ of centrifugal 1min of 1000r/min, and precipitation adds the washing of 150 μ l washing lotions, centrifugal 1min, abandon washing lotion, add 50 μ l lysates, suspend, mixing, put ice bath 30min, 4 ℃ of centrifugal 20min of 14000r/min get supernatant 2 μ l and do the TRAP reaction template.Get reaction tubes, each adds 45 μ l reaction mixtures, adds the sample that 2 μ l have handled, and mixing adds 30 μ l whiterusss, to 25 ℃ of water bath heat preservation 30min, and in the cocycle of PCR instrument, 94 ℃ of 120s; 94 ℃ of 30s; 48 ℃ of 30s; 72 ℃ of 92s; 72 ℃ of 300s circulate 35 times.After the loop ends, add hybridization reaction solution in each hole of microwell plate, adding amplified production 20 μ l mixings, set up blank, to 37 ℃ of isothermal reaction 60min, add developer then, 37 ℃ of lucifuge colour developing 10min add stop buffer, termination reaction.Read the A value at wavelength 570-630nm, the results are shown in Figure 10,1 is Hela cell control group among the figure; 2 is SMMC7721 cell control group; 3 is MKN-45 cell control group; 4 is the Hela-psiRNA-TRT groups of cells; 5 is the SMMC7721-psiRNA-TRT groups of cells; 6 is the MKN-45-psiRNA-TRT groups of cells.The result shows that the telomerase activation of the Hela cell of transfection psiRNA-TRT plasmid obviously is suppressed.

7. animal tumorigenicity experiment

BALB/C (nu/nu) nude mouse is divided into the blank plasmid group of commentaries on classics at random and changes psiRNA-TRT plasmid plasmid group, 6 every group, be female.Blank plasmid Hela cell of taking the logarithm vegetative period and the Hela-psiRNA-TRT that changes the psiRNA-TRT plasmid, 0.25% trysinization is placed in the serum-free RPMI-1640, adjustment concentration is 5 * 107/ml, the right armpit that is inoculated in BALB/C (nu/nu) nude mouse respectively is subcutaneous, every 0.1ml, after the visible tumour of naked eyes to be formed, the next day with length (L) and wide (W) of vernier caliper measurement tumour, gross tumor volume is by following formula calculating: V=(L * W7) * 0.52.Each group is all being injected tumour cell after 22 days, and nude mice is put to death in the cervical vertebra dislocation, cuts tumour, measures the gross tumor volume size, the results are shown in Figure 11, and 1 is control group among the figure, and 2 are the blank plasmid group of commentaries on classics, and 3 for changeing the psiRNA-TRT group.The result shows: control group Hela cervical cancer cell just forms the visible tumour of naked eyes in 14 days behind the inoculation nude mice, tumor average volume is 456mm in the time of the 25th day ³, change the 25th day tumor average volume of blank plasmid group and be 437mm3 and the Hela-psiRNA-TRT cell to form tumour speed in nude mouse obviously slower, 25 days tumor average volumes are 19mm behind tumor cell inoculation ³

Sequence table

＜110〉Xu Genxing

＜120〉siRNA and the expression vector and the application in pharmacy thereof of the genetic expression of inhibition human telomerase reverse transcriptase

<160>15

<210>1

<211>19

<212>RNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the little double-stranded RNA of synthetic

<400>1

gaacgugcug?gccuucggc????????????????????????????????????????????????19

<210>2

<211>19

<212>RNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the little double-stranded RNA of synthetic

<400>2

cgugcuggcc?uucggcuuc????????????????????????????????????????????????19

<210>3

<211>19

<212>RNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the little double-stranded RNA of synthetic

<400>3

cacggugacc?gacgcacug????????????????????????????????????????????????19

<210>4

<211>19

<212>RNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the little double-stranded RNA of synthetic

<400>4

ggcgucuggg?augcgaacg????????????????????????????????????????????????19

<210>5

<211>68

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: beidirectional double-stranded RNA 3 ' is rectified adopted strand primer sequence

<400>5

attgggcccg?tcgacatcga?taaaaaagaa?gccgaaggcc?agcacgttcg?gtgtttcgtc?60

ctttccac??????????????????????????????????????????????????????????68

<210>6

<211>62

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: beidirectional double-stranded RNA 3 ' end antisense strand primer sequence

<400>6

ccggaatcct?ctagaaaaaa?agaacgtgct?ggccttcggc?ttcggtgttt?cgtcctttcc?60

ac????????????????????????????????????????????????????????????????62

<210>7

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: beidirectional double-stranded RNA 5 ' end primer sequence

<400>7

ataagaatgc?ggccgccccg?gggatccaag?gtcggg???????????????????????????36

<210>8

<211>764

<212>DNA

＜213〉contain the intestinal bacteria sequence of psiRNATE plasmid

<220>

<221>misc_signal

<222>(686，688，697，698，704，709，711，712，717，727，732，736，739，742，743，747，751，761，762，763)

＜223〉n=a or g or c or t

<400>8

ctggctagcg?tttaaactta?agcagcttgg?taccgagctc?ggatccaagg?cgggcaggaa?60

gagggcctat?ttcccatgat?tccttcatat?ttgcatatac?gatacaaggc?tgttagagag?120

ataattagaa?ttaatttgac?tgtaaacaca?aagatattag?tacaaaatac?gtgacgtaga?180

aagtaataat?ttcttgggta?gtttgcagtt?ttaaaattat?gttttaaaat?ggactatcat?240

atgcttacgt?aacttgaaag?tatttcgatt?tcttggcttt?atatatcttg?tggaaaggac?300

gaaacaccga?agccgaaggc?cagcacgttc?tttttttcta?gagattctgc?agatatccag?360

cacagtggcg?gccgccccgg?ggatccaagg?tcgggcagga?agagggccta?tttcccatga?420

ttccttcata?tttgcatata?cgatacaagg?ctgttagaga?gataattaga?attaatttga?480

ctgtaaacac?aaagatatta?gtacaaaata?cgtgacgtag?aaagtaataa?tttcttgggt?540

agtttgcagt?tttaaaatta?tgtttaaaat?ggactatcat?atgcttaccg?taacttgaaa?600

gtatttcgat?ttcttggctt?tatatatctt?gtggaaagga?cgaaacaccg?gaacgtgctg?660

gccttcggct?tctttttatc?gatgtcnang?ggcccgtnna?acccnctgtn?cnncctcnac?720

tgggcctnct?aant?tgnccn?canncggngg?tngccctccc?cnnn?????????????????764

<210>9

<211>271

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: U6+1 promoter sequence

<400>9

ggatccaagg?tcgggcagga?agagggccta?tttcccatga?ttccttcata?tttgcatata?60

cgatacaagg?ctgttagaga?gataattaga?attaatttga?ctgtaaacac?aaagatatta?120

gtacaaaata?cgtgacgtag?aaagtaataa?tttcttgggt?agtttgcagt?tttaaaatta?180

tgttttaaaa?tggactatca?tatgcttacc?gtaacttgaa?agtatttcga?tttcttggct?240

ttatatatct?tgtggaaagg?acgaaacacc?g????????????????????????????????271

<210>10

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the antisense chain-ordering of the dna double chain of structure

<400>10

gccgaaggcc?agcacgttc??????????????????????????????????????????????19

<210>11

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the sense chain-ordering of the dna double chain of structure

<400>11

gaacgtgctg?gccttcggc????????????????????????????????????????????????19

<210>12

<211>74

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: U6 promotor PCR 3 ' end primer

<400>12

aatctgcaga?aaaagcggac?cgaagtccgc?tctagatgca?tgctcgaggt?cgtccggtgt???60

ttcgtccttt?ccac?????????????????????????????????????????????????????74

<210>13

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: U6 promotor PCR 5 ' end primer

<400>13

cgcggatcca?aggtcgggca?ggaagagggc????????????????????????????????????30

<210>14

<211>63

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the N end of single stranded DNA

<400>14

gatccgaacg?tgctggcctt?cggcttcaag?agagccgaag?gccagcacgt?tcttttttgg?60

aaa????????????????????????????????????????????????????????????????????????????????????63

<210>15

<211>65

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the C end of single stranded DNA

<400>15

agcttttcca?aaaaagaacg?tgctggcctt?cggctctctt?gaagccgaag?gccagcacgt?60

tcg???????????????????????????????????????????????????????????????63

Claims (4)

1. a specific specificity suppresses the little double-stranded RNA of human telomerase reverse transcriptase genetic expression, it is characterized in that it comprises in following four kinds of little double-stranded RNAs any one or a few, and their base sequence is as follows:

a.5’-GAA?CGU?GCU?GGC?CUU?CGG?C-3’

3’-CUU?GCA?CGA?CCG?GAA?GCC?G-5’

b.5’-CGU?GCU?GGC?CUU?CGG?CUU?C-3’

3’-GCA?CGA?CCG?GAA?GCC?GAA?G-5’

c.5’-CAC?GGU?GAC?CGA?CGC?ACU?G-3’

3’-GUG?CCA?CUG?GCU?GCG?UGA?C-5’

d.5’-GGC?GUC?UGG?GAU?GCG?AAC?G-3’

3’-CCG?CAG?ACC?CUA?CGC?UUG?C-5’

2, a kind of little double stranded rna expression plasmid series that can suppress human telomerase reverse transcriptase genetic expression is characterized in that it has following basic structure:

By the circular double stranded DNA molecule that promotor, little double-stranded RNA coding region and dna sequence dna sequentially connect form, wherein promotor is the promotor of any eukaryotic gene, and it is that the little dsdna epitope that starts its downstream is reached little double stranded rna expression element; Little double-stranded RNA coding region is the double-stranded DNA that is made of main body the double-stranded DNA that can express the described little double-stranded RNA sequence of claim 1, and forms the little double-stranded RNA of two-way or hairpin structure at cell inner expression; Dna sequence dna is the dna sequence dna of any eucaryon plasmid outside promotor, coding region, contains antibiotics resistance gene, comprises making bacterium obtain at certain antibiotic resistant gene or eukaryotic cell being obtained at certain antibiotic resistant gene.

3, the application of the described little double-stranded RNA of claim 1 in the medicine of preparation treatment or prophylaxis of tumours.

4, the application of the described plasmid of claim 2 in the medicine of preparation treatment or prophylaxis of tumours.

Images