EA039127B1 - HEPATITIS B VIRUS (HBV) iRNA COMPOSITIONS AND METHODS OF USE THEREOF - Google Patents

Abstract

The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the hepatitis B virus (HBV) genome, and methods of using such RNAi agents to inhibit expression of one or more HBV genes, and methods of treating subjects having an HBV infection and/or HBV-associated disorder, e.g., chronic hepatitis B infection.

Description

Related Applications

This patent application claims priority of U.S. Provisional Application No. 62/077799 filed November 10, 2014 and U.S. Provisional Application No. 62/137464 filed March 24

2015. The entire contents of each of the above patent applications are incorporated herein by reference.

This application also claims priority of U.S. Provisional Application No. 62/077672, filed Nov. 10, 2014, the entire contents of which are incorporated herein by reference.

This application relates to International Patent Application PCT/US2015/XXXXX titled Anti-Hepatitis D Virus (HDV) iRNA Compositions and Methods of Use, filed November 10, 2015, the entire content of which is incorporated herein by reference.

Sequence listing

The invention includes a sequence listing that has been filed electronically in ASCII format and incorporated herein by reference in its entirety. The specified ASCII copy, created on November 5, 2015, is named 121301-02320_SL.txt and is 385791 bytes in size.

State of the art

Worldwide, more than 400 million people have chronic hepatitis B virus infection and are therefore at increased risk of developing serious liver disease such as chronic hepatitis, cirrhosis, liver failure, and hepatocellular carcinoma (HCC), leading to approximately 100 deaths. 600,000 people a year.

The natural progression of chronic HBV infection includes four successive phases: (1) an early immunotolerant phase, high levels of viral replication, and minimal inflammation in the liver; (2) immunoreactive phase, significant liver inflammation and elevated levels of serum aminotransferases; while in some patients the disease progresses to (3) non-replicative phase, seroconversion of antibodies to HBe; undetectable or low level of viremia (below 2000 IU / ml according to the results of PCR analysis); cessation of inflammation in the liver; and (4) HBeAg-negative chronic hepatitis B caused by specific mutations in the virus that prevent HBeAg production but do not prevent viral replication. This form of chronic hepatitis B (CHB) is characterized by fluctuations in serum levels of HBV DNA and serum aminotransferases (ALT and AST) and progressive liver disease. It is important to note that SNR can be either HBeAg positive or HBeAg negative SNR. The results of longitudinal studies of patients with SNV indicate that the 5-year cumulative incidence of cirrhosis varies in the range of 8-20%. The 5-year cumulative incidence of hepatic decompensation is approximately 20%. The incidence of HCC is on the rise worldwide and it is now the fifth most common type of cancer. The annual incidence of HCC associated with HBV is high, ranging from 2 to 5% when cirrhosis occurs.

The main goal of HBV treatment is to permanently suppress HBV replication and reduce the development of liver disease. Clinically important immediate goals are to achieve HBeAg seroconversion, normalize serum ALT and AST levels, stop the inflammatory process in the liver, and prevent liver decompensation. The ultimate goal of treatment is to achieve a sustainable response to prevent the development of cirrhosis, liver cancer and increase life expectancy. HBV infection cannot be completely eliminated due to the persistence of a separate form of viral covalently closed circular DNA (cccDNA HBV) in the nuclei of infected hepatocytes. However, treatment-induced clearance of serum HBsAg is a marker for cessation of chronic HBV infection and is associated with the best long-term outcome.

Current standard treatments for HBV include the use of immunotherapies based on interferon or thymosin a1 and suppression of virus production by inhibiting HBV polymerase. HBV polymerase inhibitors are effective in reducing viral reproduction but have little or no efficacy in rapidly lowering HBsAg in long-term treatment in a limited number of patients (as with tenofovir disoproxil fumarate). With interferon-based immunotherapy, both a reduction in viral reproduction and an early elimination of HBsAg from the blood can be achieved, but only in a small percentage of treated subjects. The generally recognized function of HBsAg in the blood is to block anti-HBsAg antibodies and allow infectious viral particles to evade detection by the immune system, which appears to be one of the reasons why HBV infection remains a chronic condition. In addition, all HBsAg, HBeAg, and HBcAg have immunoinhibitory properties, and the persistence of these viral proteins in the blood of patients following administration of any of the currently available HBV treatments appears to have a significant impact, interfering with immune control of HBV infection. in patients.

Although all three major HBV proteins (HBsAg, HBeAg, and HBcAg) have immunoinhibitory properties, HBsAg makes up the majority of the HBV protein in the circulation of HBV-infected subjects. Furthermore, although elimination (via seroconversion) of HBeAg or reduction in serum viremia does not correlate with development of sustained control after treatment for HBV infection, clearance of serum HBsAg from the blood (and seroconversion) in HBV infection is a well-established predictor of antiviral response to HBV infection. treatment that will result in control after treatment for HBV infection (although this only occurs in a small proportion of patients on immunotherapy). Thus, while reducing levels of all three major HBV proteins (HBsAg, HBeAg, and HBcAg) may result in optimal reversal of the inhibitory effect, elimination of HBsAg alone appears to be sufficient to reverse the bulk of viral inhibition of immune function. in subjects with HBV infection.

Therefore, in the absence of any current treatment regimen that can restore immunological control of HBV in a significant proportion of patients, there is a need for an effective treatment for HBV infection that can inhibit viral replication as well as restore immunological control in the majority of patients.

Accordingly, there is a need in the art for alternative therapies and combination therapies for subjects infected with HBV and/or having a disease associated with HBV.

Brief description of the invention

The present invention provides iRNA-based compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the hepatitis B virus (HBV) gene. The HBV gene may be in a cell, for example in a cell of a subject such as a human.

The present invention also provides methods and therapies for treating a subject with a disorder that would benefit from inhibition or reduction of HBV gene expression, such as an HBV infection and/or an HBV associated disease, such as chronic hepatitis B virus infection. (SNV), cirrhosis, liver failure, and hepatocellular carcinoma (HCC), by using iRNA-based compositions that act on RNA-induced silencing complex (RISC)-mediated cleavage of HBV RNA transcripts to inhibit HBV gene expression.

The RNAi agents of the present invention were designed to target regions in the HBV genome that are conserved across all 8 HBV serotypes. In addition, the RNAi agents of the present invention have been developed to inhibit all steps of the HBV life cycle, eg, replication, assembly, viral secretion, and secretion of subviral antigens, by inhibiting the expression of several HBV genes. In particular, since transcription of the HBV genome results in the formation of polycistronic overlapping RNAs, the RNAi agent of the present invention, which targets a single HBV gene, results in significant inhibition of the expression of most or all HBV transcripts. For example, since the HBV genome is transcribed into a single mRNA, the RNAi agent of the present invention targeting the S gene will result in inhibition of not only the expression of the S gene, but also the expression of the downstream reverse transcriptase gene. In addition, the RNAi agents of the present invention have been developed to inhibit HBV virus replication by targeting HBV structural genes and the HBV X gene, allowing the subject's immune system to detect and respond to the presence of HBsAg to produce anti-HBV antibodies to eliminate HBV infection. Without being limited by theory, it is believed that a combination or sub-combination of the above properties, and specific target sites and/or specific modifications in such RNAi agents, provides the RNAi agents of the present invention with improved efficacy, stability, safety, potency, and duration of action.

Therefore, in one aspect, the present invention provides double-stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell. Double stranded RNAi agents include a sense strand and an antisense strand forming a double strand, where said sense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1, and said antisense strand contains at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, where substantially all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides, wherein said the sense strand is conjugated to a ligand attached to the 3' end, and wherein said ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one embodiment, one or more 3 nucleotide differences in the nucleotide sequence of the antisense strand is a nucleotide mismatch in the antisense strand.

In another embodiment, one or more 3 nucleotide differences in a nucleotide

- 2 039127 antisense strand sequences consist of a mismatch of nucleotides in the sense strand.

In one embodiment, all nucleotides of said sense strand and all nucleotides of said antisense strand are modified nucleotides.

In one embodiment, the sense strand and the antisense strand contain a complementarity region that contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any of the sequences shown in any of Table. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26.

In one embodiment, at least one of said modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2' -deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl- modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1.5 -anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide, content containing a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In one embodiment, at least one strand contains a 3' overhang consisting of at least 1 nucleotide. In another embodiment, at least one strand has a 3' overhang of at least 2 nucleotides.

In one embodiment, the length of the double-stranded section is 15-30 base pairs. In another embodiment, the length of the double-stranded section is 17-23 base pairs. In yet another embodiment, the length of the double-stranded section is 17-25 base pairs. In one embodiment, the length of the double-stranded section is 23-27 base pairs. In another embodiment, the length of the double-stranded section is 19-21 base pairs. In yet another embodiment, the length of the double-stranded section is 21-23 base pairs.

In one embodiment, each strand contains 15-30 nucleotides. In one embodiment, each strand contains 19-30 nucleotides.

In one embodiment, the ligand is

In one embodiment, the RNAi agent is conjugated to a ligand as shown in the following scheme

where X is O or S.

In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in any of Table 1. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26.

In one aspect, the present invention provides double-stranded RNAi agents for inhibiting

- 3 039127 expression of hepatitis B virus (HBV) in a cell. Double stranded RNAi agents include a sense strand and an antisense strand forming a double strand, wherein said sense strand contains 5'-UCGUGGUGGACUUCUCUCA-3' (SEQ ID NO: 5) and said antisense strand contains

5' UGAGAGAAGUCCACCACGAUU 3' (SEQ ID NO: 6), wherein substantially all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides wherein said sense strand is conjugated to a ligand attached to 3' -terminus, and wherein said ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

The present invention also provides RNAi agents containing sense and antisense nucleotide sequences that are at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout their length to the above sense and antisense nucleotide sequences. by sequences.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell. Double stranded RNAi agents include a sense strand and an antisense strand forming a double strand, where said sense strand contains 5'-gugcacuucgcuucaccucua-3' (seq id no: 7) and said antisense strand contains 5'-UAGAGGUGAAGCGAAGUGCACUU-3' ( SEQ ID NO: 8), wherein substantially all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand attached to the 3' end, and wherein said the ligand is one or more derivatives of GalNAc attached through a divalent or trivalent branched linker. The present invention also provides RNAi agents containing sense and antisense nucleotide sequences that are at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout their length to the above sense and antisense nucleotide sequences. sequences.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell. Double-stranded RNAi agents include a sense strand and an antisense strand forming a double-stranded region where said sense strand contains 5'-CGUGGUGGACUUCUCUCAAUU-3' (SEQ ID NO: 9) and said antisense strand contains 5'-AAUUGAGAGAAGUCCACCAGCAG- ³ ' ( SEQ id NO: 10) wherein substantially all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand attached to the 3' end, and wherein said the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker. The present invention also provides RNAi agents containing sense and antisense nucleotide sequences that are at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout their length to the above sense and antisense nucleotide sequences. sequences.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell. Double-stranded RNAi agents include a sense strand and an antisense strand forming a double-stranded region where the sense strand contains 5'-CGUGGUGGUCUUCUCUAAAUU-3' (SEQ ID NO:37) and the antisense strand contains '-AAUUGAGAGAAGUCCACCAGCUU-3' (SEQ ID NO :38), where essentially all of the nucleotides of the sense strand and essentially all of the nucleotides of the antisense strand are modified nucleotides, where said sense strand is conjugated to a ligand attached to the 3' end, and where said ligand is one or several GalNAc derivatives attached via a divalent or trivalent branched linker. The present invention also provides RNAi agents containing sense and antisense nucleotide sequences that are at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout their length to the above sense and antisense nucleotide sequences. sequences.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell. Double-stranded RNAi agents include a sense strand and an antisense strand forming a double-stranded region where said sense strand contains 5'-GGUGGACUUCUCUCAAUUUUA-3' (SEQ ID NO:11) and said antisense strand contains 5'-UAAAAUUGAGAGAAGUCCACCAC-3' ( SEQ id NO: 12) wherein substantially all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand attached to the 3' end, and wherein said ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

The present invention also provides RNAi agents containing sense and antisense nucleotide sequences that are at least 90, 91, 92, 93, 94, 95, 96, 97, 98

- 4 039127 or 99% identical throughout their length to the above sense and antisense nucleotide sequences.

In another aspect, the present invention provides double-stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell. Double stranded RNAi tools include a sense strand and an antisense strand forming a double strand where said sense strand contains 5' - GGUGGACUUCUCUCAAUUUUA-3'

ID NO: 39), and the specified antisma (SEQ ID NO: 40), where, in fact, all nucleotides of the specified sense strand and, in fact, all nucleotides of the specified antisense strand are modified nucleotides, where the specified sense strand is conjugated to a ligand, attached to the 3'-end, and where the specified ligand is one or more derivatives of GalNAc attached through a divalent or trivalent branched linker. The present invention also provides RNAi agents containing sense and antisense nucleotide sequences that are at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout their length to the above sense and antisense nucleotide sequences. by sequences.

In one embodiment, all nucleotides of said sense strand and all nucleotides of said antisense strand have a modification.

In one embodiment, at least one of said modified nucleotides is selected from the group consisting of a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2 '-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing non-naturally occurring bases, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing phosphorothioate th group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In one embodiment, the 5'-phosphate mimetic is 5'-vinyl phosphate (5'-VP).

In one embodiment, the sense strand 'is uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:13) and the antisense strand contains contains

5'-usGfsagaGfaAfGfuccaCfcAfcgasusu-3' (SEQ ID NO: 14), where A, C, G and U are

A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, 5uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:15) 5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu-3' (SEQ ID, the sense strand contains a and the antisense strand contains No; 1 b), where A, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond; and P is a 5'-phosphate or a 5'-phosphate mimetic.

In one embodiment, the sense strand contains '-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:17) and the antisense strand contains 5'-usAfsgagGfugaagcgAfaGfugcacsusu-3' (SEQ ID _NO :18), where A, C, G, and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, the sense strand contains 5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO: 19) and the antisense strand contains 5'-PusAf sgagGfugaagcgAf aGfugcacsusu-3' (SEQ ID _NO:2 0), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond; and P is a 5'-phosphate or a 5'-phosphate mimetic.

In one embodiment, the sense strand contains 5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO: 21) and the antisense strand contains 5'-asAfsuugAfgAfgAfaguCfcAfccagcsasg-3' (SEQ ID _NO: 22), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is phosphorothio

- 5 039127 atomic bond.

In another embodiment, the sense strand contains 5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:23) and the antisense strand contains 5'-PasAfsuugAfgAfgAfaguCfcAfccagcsasg-3' (SEQ ID NO:24), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In another embodiment, the sense strand contains '-csgsuggudGgucdTucucuaaauu-3' (SEQ ID NO: 35) and the antisense strand contains 5'-asdAsuugagagdAagudCcaccagcsusu-3' (SEQ ID NO: 3-6), where A, C, G and U represent is A, C, G or U containing ribose; a, e, c and and are 2'-O-methyl-(2'-OMe-) A, U, C or G; dA, dC, dG and dT are A, C, G and T containing deoxyribose; and s is a phosphorothioate bond.

In one embodiment, '-gsguggaCfuUfCfUfcucaAfUfuuua-3' (SEQ ID NO:25) is the sense strand and the antisense strand contains contains

5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc-3' (SEQ ID NO:26), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, the sense strand contains 5 gsguggaCfuUfCfUf cucaAfUfuuua-3' (SEQ ID NO:27) and the antisense strand contains 5'-PusAfsaaaUfuGfAfgagaAfgUfccaccsasc-3' (SEQ ID NO:28), where A, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In another embodiment, the sense strand contains 5'-gsusguGfcAfCfUfucgcuucaca-3' (SEQ ID NO: 41) and the antisense strand contains 5'-usGfsugaAfgCfGfaaguGfcAfcacsusu-3' (SEQ ID NO: 42), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In one embodiment, the ligand is

In one embodiment, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

In one embodiment, P is a 5'-phosphate mimetic. In one embodiment, the 5'-phosphate mimetic is 5'-vinyl phosphate (5'-VP).

In another aspect, the present invention provides compositions containing two or more than two

- 6 039127 stranded RNAi agents for inhibiting hepatitis B virus (HBV) expression in a cell, where each double-stranded RNAi agent independently contains a sense strand and an antisense strand forming a double-stranded region, where each of said sense strands independently contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1, and each of these antisense strands independently contains at least 15 adjacent nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, where , essentially all nucleotides of each of said sense strands, and essentially all nucleotides of each of said antisense strands are independently modified nucleotides, wherein each of said sense strands is conjugated to a ligand attached to the 3' end, and wherein said ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one or more embodiments, one or more 3 nucleotide differences in the nucleotide sequence of the antisense strand is a mismatch of nucleotides in the antisense strand. In another embodiment, one or more 3 nucleotide differences in the nucleotide sequence of the antisense strand is a mismatch of nucleotides in the sense strand.

In one embodiment, all nucleotides in said sense strand and all nucleotides in said antisense strand are modified nucleotides.

In one embodiment, the sense strand and said antisense strand contain a complementarity region that contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any of the sequences shown in any of Table. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26.

In one embodiment, at least one of said modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2' -deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl- modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1.5 -anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide, content containing a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In another aspect, the present invention provides compositions for inhibiting hepatitis B virus (HBV) expression in a cell, the composition comprising (a) a first double-stranded RNAi agent comprising a first sense strand and a first antisense strand forming a double-stranded region, where, in essence, all nucleotides of said first sense strand and, in fact, all nucleotides of the first antisense strand are modified nucleotides, where said first sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via divalent or trivalent branched linker; and (b) a second double-stranded RNAi agent comprising a second sense strand and a second antisense strand, forming a double-stranded region, where substantially all nucleotides of said second sense strand and substantially all nucleotides of said second antisense strand are modified nucleotides, where said second sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker; where each of the first and second sense strands independently contains a sequence selected from the group consisting of:

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ IDNO:5),

5'- GUGCACUUCGCUUCACCUCUA -3' (SEQ IDNO:7),

5'- CGUGGUGGACUUCUCUCAAUU-3' (SEQ IDNO:9),

5'- CGUGGUGGUCUUCUCUAAAUU -3' (SEQ IDNO:37),

5'- GGUGGACUUCUCUCAAUUUUA -3' (SEQ IDNO:11), and

5'-GUGUGCACUUCGCUUCACA -3' (SEQ IDNO:39) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequences), and where each of the first and second antisense strands independently contains the sequence selected

- 7 039127 from the group consisting of:

5'-UGAGAGAAGUCCACCACGAUU-3' (SEQ ID NO:6),

5'- UAGAGGUGAAGCGAAGUGCACUU -3' (SEQ ID NO :8) ,

5'- AAUUGAGAGAAGUCCACCAGCAG -3' (SEQ ID NO :10) ,

5'- AAUUGAGAGAAGUCCACCAGCUU -3' (SEQ ID NO :38), 5'- UAAAAUUGAGAGAAGUCCACCAC -3' (SEQ ID NO :12), and

5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO:40) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequences).

In one embodiment, the first and second sense strand and/or the nucleotides of the first and second sense strand and all nucleotides of the antisense strand have a modification.

In one embodiment, at least one of said modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2' -deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl- modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1.5 -anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide, content containing a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In one embodiment, the first and second RNAi agents are selected from the group consisting of:

5'-uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:13)

5'-usGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:14);

5'-uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:15)

5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:16);

5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:17)

5'-usAfsgagGfugaagcgAfaGfugcacsusu - 3' (SEQ ID NO:18);

5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:19)

5'-PusAfsgagGfugaagcgAfaGfugcacsusu - 3' (SEQ ID NO:20);

5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:21)

5'-asAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:22);

5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:23)

5'-PasAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:24);

5'-csgsuggudGgucdTucucuaaauu-3' (SEQ ID NO:35)

5'-asdAsuugagagdAagudCcaccagcsusu-3' (SEQ ID NO:36);

5'-gsguggaCfuUfCfUfcucaAfUfuuua - 3' (SEQ ID NO:25)

5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:26);

5'-gsguggaCfuUfCfUfcucaAfUfuuua - 3' (SEQ ID NO :27)

5'- PusAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:28)

5'-gsusguGfcAfCfUfucgcuucaca -3' (SEQ ID NO:41)

5'-usGfsugaAfgCfGfaaguGfcAfcacsusu-3' (SEQ ID NO:42) where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; dA, dC, dG and dT are A, C, G and T containing deoxyribose; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In one embodiment, the first and second RNAi agents are

5'-uscsguGfgUfGfGfacuucucuca - 3' (SEQ ID NO:15)

5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:16);

5'-csgsugguGfgAfCfUfucucUfCfaauu - 3' (SEQ ID NO:21) '-asAf suugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO: 22)

- 8 039127 where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In another embodiment, the first and second RNAi agents are

5'-gsguggaCfuUfCfUfcucaAfUfuuua - 3' (SEQ ID NO:25)

5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:26); and

5'-gsusguGfcAfCfUfucgcuucaca -3' (SEQ ID NO:41)

5'-usGfsugaAfgCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:42), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In one aspect, the present invention provides a double-stranded RNAi agent comprising the RNAi agents listed in any one of Table 1. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26.

The present invention also provides vectors and cells containing the double stranded RNAi agent of the present invention.

In another aspect, the present invention provides pharmaceutical compositions comprising the double stranded RNAi agents of the present invention, or the compositions of the present invention, or the vectors of the present invention.

In one embodiment, the double stranded RNAi agent is administered in an unbuffered solution. In one embodiment, the unbuffered solution is saline or water.

In another embodiment, the double stranded RNAi agent is administered with a buffer solution. In one embodiment, the buffer solution contains acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof. In another embodiment, the buffer solution is phosphate buffered saline (PBS).

In one aspect, the present invention provides methods for inhibiting hepatitis B virus (HBV) gene expression in a cell. The methods include contacting a cell with a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention; and maintaining the resulting cell for a time sufficient to achieve destruction of the mRNA transcript of the HBV gene, thereby inhibiting the expression of the HBV gene in the cell.

In one embodiment, the HBV gene is selected from the group consisting of C, X, P, S, and combinations thereof.

In one aspect, the present invention provides methods for inhibiting hepatitis B virus (HBV) replication in a cell. The methods include contacting a cell with a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention; and maintaining the resulting cell for a time sufficient to achieve destruction of the mRNA transcript of the HBV gene, thereby providing inhibition of HBV replication in the cell.

In one embodiment, the cell is in the subject. In one embodiment, the subject is a human.

In one embodiment, the subject is suffering from a disease associated with HBV.

In one embodiment, HBV gene expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% , by about 98%, or by about 100%.

In one embodiment, HBV replication in a cell is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%. %, by about 98%, or by about 100%.

In one aspect, the present invention provides methods for reducing the level of hepatitis B virus (HBV) DNA in a subject infected with HBV. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby reducing the HBV cccDNA level in the subject.

In another aspect, the present invention provides methods for reducing the level of hepatitis B virus (HBV) antigen in a subject infected with HBV. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby reducing the HBV antigen level of the subject.

In one embodiment, the HBV antigen is HBsAg. In another variant

- 9 039127 implementation of the HBV antigen is HBeAg.

In another aspect, the present invention provides methods for reducing the hepatitis B virus (HBV) viral load in a subject infected with HBV. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby reducing the HBV viral load in the subject.

In another aspect, the present invention provides methods for reducing the level of alanine aminotransferase (ALT) in a subject infected with HBV. The methods include administering to a subject a therapeutically effective amount of a double stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby reducing the ALT level of the subject.

In another aspect, the present invention provides methods for reducing the level of aspartate aminotransferase (AST) in a subject infected with HBV. The methods include administering to a subject a therapeutically effective amount of a double stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby reducing the subject's AST level.

In another aspect, the present invention provides methods for increasing the level of antibodies to hepatitis B virus (HBV) in a subject infected with HBV. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby increasing the subject's anti-HBV antibody level.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby treating said subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent of the present invention, or a composition of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby treating said subject.

In one embodiment, the HBV associated disorder is selected from the group consisting of hepatitis D virus infection, delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma.

In one embodiment, the HBV associated disorder is chronic hepatitis and the subject is HBeAg positive. In another embodiment, the HBV associated disorder is chronic hepatitis and the subject is HBeAg negative.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5ucgugguggacuucucuca-3' (SEQ id NO: 5) (or a nucleotide sequence, (SEQ ID NO: 6) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides wherein said sense strand is conjugated to a ligand attached to the 3' end , and where the ligand is one or more derivatives of GalNAc attached through a divalent or trivalent branched linker, due to which the subject is treated.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5'-UCGUGGUGGACUUCUCUCA-3' (SEQ ID NO: 5) (or a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical throughout its length to the above nucleotide sequence) and said antisense

- 10 039127 strand contains 5'- ^{ugagagaaguccaccgauu} -z' (seq id no: b) (and _L and a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 % is identical throughout its length to the above nucleotide sequence), where, in fact, all nucleotides of the specified sense strand and, in fact, all nucleotides of the specified antisense strand are modified nucleotides, where the specified sense strand is conjugated to a ligand attached to the 3'-end , and wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker, whereby the subject is treated.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5' - GUGCACUUCGCUUCACCUCUA-3' (SEQ ID NO: 7) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence) and said antisense strand contains 5' - UAGAGGUGAAGCGAAGUGCACUU-3' (SEQ ID NO: 8) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand, attached m to the 3' end, and where the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker, thereby treating the subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5 GUGCACUUCGCUUCACCUCUA-3' (SEQ ID NO: 7) (or a nucleotide a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical throughout its length to the above nucleotide sequence) and said antisense strand contains 5'-UAGAGGUGAAGCGAAGUGCACUU-3' ( SEQ ID NO: 8) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence , all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides wherein said sense strand is conjugated to a ligand attached to 3' -terminus, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker, thereby treating the subject.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains ⁵ ' ^_ CGUGGUGGACUUCUCUCAAUU-3' (SEQ ID NO: 9) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence) and said antisense strand contains 5' - AAUUGAGAGAAGUCCACCAGCAG-3' (seq id NO: 10) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence), where, essentially all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides wherein said sense strand is conjugated to a ligand attached th to the 3' end, and where the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker, thereby treating the subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5'-CGUGGUGGACUUCUCUCAAUU- ³ ' (SEQ ID NO: 9) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), and the specified antisense strand contains 5'- aauugagaaguccaccagcag-3' (seq id no: 10) (or nucleotide sequence

- 11 039127 identity, which is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in fact, all nucleotides of the specified sense strand and, in fact, all nucleotides of the specified antisense strand are modified nucleotides, where the specified sense strand is conjugated to a ligand attached to the 3'end, and where the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker, due to of which the subject is being treated.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent contains a sense strand and an antisense strand forming a double-stranded region, where the sense strand contains 5'-CGUGGUGGUCUUCUCUAAAUU- ³ ' (seq id no: 37) (or nucleotide a sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence) and the antisense strand contains 5' - AAUUGAGAGAAGUCCACCAGCUU-3' (SEQ ID NO: 38) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker, thereby treating the subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand contains 5'-CGUGGUGGUCUUCUCUAAAUU-3' (SEQ ID NO:37) (or the nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence) and the antisense strand contains 5' - AAUUGAGAGAAGUCCACCAGCUU-3' (SEQ ID NO: 38) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all sense strand nucleotides and, in fact, all antisense strand nucleotides are modified nucleotides, where said sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one and or several GalNAc derivatives attached via a divalent or trivalent branched linker, thereby treating the subject.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5' - GGUGGACUUCUCUCAAUUUUA-3' (SEQ ID NO: 11) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), and the specified antisense strand contains 5' - UAAAAUUGAGAGAAGUCCACCAC-3' (SEQ ID NO: 12) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand, attached m to the 3'-end, and where the ligand is one or more derivatives of GalNAc attached through a divalent or trivalent branched linker, thereby treating the subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains GGUGGACUUCUCUCAAUUUUA-3' (SEQ ID NO: 11) (or a nucleotide sequence, (SEQ ID NO: 12) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides, where said sense strand is conjugated to a ligand attached united at the 3' end, and wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker, thereby treating the subject.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5'-GUGUGCACUUCGCUUCACA-3' (SEQ ID NO: 39) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence) and said antisense strand contains 5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO: 40) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence), where, in essence, all nucleotides of said sense strand and, in fact, all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand attached to the 3'- end, and where the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker, thereby treating the subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein said sense strand contains 5'-GUGUGCACUUCGCUUCACA-3' (SEQ ID NO: 39) (or a nucleotide sequence that is at least 90%, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence) and said antisense strand contains 5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO:40)( _M u a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to the above nucleotide sequence), where, essentially all nucleotides of said sense strand and essentially all nucleotides of said antisense strand are modified nucleotides wherein said sense strand is conjugated to a ligand attached to the 3'ko nzu, and where the ligand is one or more derivatives of GalNAc attached through a divalent or trivalent branched linker, due to which the treatment of the subject.

In one embodiment, all nucleotides of said sense strand and all nucleotides of said antisense strand have a modification.

In one embodiment, at least one of said modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2' -deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl- modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1.5 -anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide, content containing a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In one embodiment, the 5'-phosphate mimetic is 5'-vinyl phosphate (5'-VP).

In one embodiment, the sense strand contains 5'-uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO: 13) and the antisense strand contains 5'-usGfsagaGfaAfGfuccaCfcAfcgasusu-3' (SEQ ID NO: 14), where a, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, the semantic thread

5uscsguGfgUfGfGfacuucucuca-3 ’ (SEQ ID NO: 15) and the antisense strand contains contains

5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu-3' (SEQ ID NO: 16), where A, C, G and U represent

- 13 039127 battle A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or

G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond; and P is a 5'-phosphate or a 5'-phosphate mimetic.

In one embodiment, the sense strand contains 5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO: 17) and the antisense strand contains 5'-usAfsgagGfugaagcgAfaGfugcacsusu-3' (SEQ ID NO: 18), _G de a, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, the sense strand contains 5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:19) and the antisense strand contains 5'-PusAf sgagGfugaagcgAfaGfugcacsusu-3' (SEQ ID NO:20), where A, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond; and P is a 5'-phosphate or a 5'-phosphate mimetic.

In one embodiment, the sense strand contains 5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:21) and the antisense strand contains 5'-asAfsuugAfgAfgAfaguCfcAfccagcsasg-3' (SEQ ID NO: 22), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, the sense strand contains '-csgsugguGfgAfCfUfucucUfCf aauu-3' (SEQ ID NO:23) and the antisense strand contains 5'-PasAfsuugAfgAfgAfaguCfcAfccagcsasg-3' (SEQ ID NO:24), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In another embodiment, '-csgsuggudGgucdTucucuaaauu-3' (SEQ ID NO:35) is the sense strand and the antisense strand contains contains

5'-asdAsuugagagdAagudCcaccagcsusu-3 - (SEQ ID no:36) where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; dA, dC, dG and dT are A, C, G and T containing deoxyribose; and s is a phosphorothioate bond.

In one embodiment, the sense strand contains 5'-gsguggaCfuUfCfUf cucaAfUfuuua-3' (SEQ ID NO:25) and the antisense strand contains 5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc-3' (SEQ ID NO: 26), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In another embodiment, the sense strand contains 5'-gsguggaCfuUfCfUf cucaAfUfuuua-3' (SEQ ID NO:27) and the antisense strand contains 5'-PusAfsaaaUfuGfAfgagaAfgUfccaccsasc-3' (SEQ ID NO: 28), where A, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In another embodiment, the sense strand contains 5'-gsusguGfcAfCfUfucgcuucaca-3' (SEQ ID NO:41) and the antisense strand contains 5'-usGfsugaAfgCfGfaaguGfcAfcacsusu-3' (SEQ ID NO:42), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In one embodiment, the ligand is

- 14 039127

In one embodiment, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

In one embodiment, the HBV associated disorder is selected from the group consisting of hepatitis D virus infection, delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma.

In one embodiment, the HBV associated disorder is chronic hepatitis and the subject is HBeAg positive. In another embodiment, the HBV associated disorder is chronic hepatitis and the subject is HBeAg negative.

In one aspect, the present invention provides methods for treating a subject with hepatitis B virus (HBV) infection. The methods include administering to a subject a therapeutically effective amount of a composition to inhibit hepatitis B virus (HBV) expression in a cell. The composition includes: (a) a first double-stranded RNAi agent containing a first sense strand and a first antisense strand, forming a double-stranded region, where essentially all nucleotides of said first sense strand and essentially all nucleotides of said first antisense strand are modified nucleotides, where the specified first sense strand is conjugated to a ligand attached to the 3'-end, and where the ligand is one or more derivatives of GalNAc attached via a bivalent or trivalent branched linker; and (b) a second double-stranded RNAi agent comprising a second sense strand and a second antisense strand, forming a double-stranded region, where substantially all nucleotides of said second sense strand and substantially all nucleotides of said second antisense strand are modified nucleotides, where said second sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker; where each and the first and second semantic strands independently contain a sequence selected from the group consisting of:

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ IDNO:5),

5'- GUGCACUUCGCUUCACCUCUA -3' (SEQ IDNO:7),

5'- CGUGGUGGACUUCUCUCAAUU -3' (SEQ IDNO:9),

5'- CGUGGUGGUCUUCUCUAAAUU -3' (SEQ IDNO:37),

5'- GGUGGACUUCUCUCAAUUUUA -3' (SEQ IDNO:11), and

5'-GUGUGCACUUCGCUUCACA-3' (SEQ IDNO:39) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to any or from the above nucleotide sequences), and where each of the first and second antisense strands independently contains a sequence selected from the group consisting of:

- 15 039127

5'- UGAGAGAAGUCCACCACGAUU-3' (SEQ ID NO:6);

5'- UAGAGGUGAAGCGAAGUGCACUU-3' (SEQ ID NO:8) ;

5'-AAUUGAGAGAAGUCCACCAGCAG-3' (SEQ ID NO:10);

5'-AAUUGAGAGAAGUCCACCAGCUU-3' (SEQ ID NO:38),

5'-UAAAAUUGAGAGAAGUCCACCAC-3' (SEQ ID NO:12), and

5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO:40) (or a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical throughout its length to whichever - any of the above nucleotide sequences), thereby treating the subject.

In another aspect, the present invention provides methods for treating a subject with a disorder associated with hepatitis B virus (HBV). The methods include administering to a subject a therapeutically effective amount of a composition to inhibit hepatitis B virus (HBV) expression in a cell. The composition includes: (a) a first double-stranded RNAi agent containing a first sense strand and a first antisense strand, forming a double-stranded region, where essentially all nucleotides of said first sense strand and essentially all nucleotides of said first antisense strand are modified nucleotides, where the specified first sense strand is conjugated to a ligand attached to the 3'-end, and where the ligand is one or more derivatives of GalNAc attached via a bivalent or trivalent branched linker; and (b) a second double-stranded RNAi agent comprising a second sense strand and a second antisense strand forming a double-stranded region where essentially all nucleotides of said second sense strand and substantially all nucleotides of said second antisense strand are modified nucleotides. where said second sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker; where each of the first and second sense strands independently contains a sequence selected from the group consisting of:

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ IDNO:5),

5'- GUGCACUUCGCUUCACCUCUA -3' (SEQ IDNO:7),

5'- CGUGGUGGACUUCUCUCAAUU -3' (SEQ IDNO:9),

5'- CGUGGUGGUCUUCUCUAAAUU -3' (SEQ IDNO:37),

5'-GGUGGACUUCUCUCAAUUUUA-3' (SEQ IDNO:11), and

5'-GUGUGCACUUCGCUUCACA-3' (SEQ IDNO:39) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to any or from the above nucleotide sequences), and where each of the first and second antisense strands independently contains a sequence selected from the group consisting of:

5'-UGAGAGAAGUCCACCACGAUU-3' (SEQ ID NO:6);

5'- UAGAGGUGAAGCGAAGUGCACUU -3' (SEQ ID NO:8) ;

5'- AAUUGAGAGAAGUCCACCAGCAG-3' (SEQ ID NO:10);

5'- AAUUGAGAGAAGUCCACCAGCUU -3' (SEQ ID NO:38),

5'- UAAAAUUGAGAGAAGUCCACCAC -3' (SEQ ID NO:12), and

5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO: 40) (or a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical throughout its length to whichever - any of the above nucleotide sequences), thereby treating the subject.

In one embodiment, all nucleotides of the first and second sense strands and all nucleotides of the first and second antisense strands have a modification.

In one embodiment, at least one of said modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2' -deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl- modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1.5 -anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide, content holding a phosphorothioate group,

- 16,039,127 nucleotides containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In one embodiment, the first and second RNAi agents are selected from the group consisting of:

5'-uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:13)

5'-usGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:14);

5'-uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:15)

5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:16);

5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:17)

5'-usAfsgagGfugaagcgAfaGfugcacsusu - 3' (SEQ ID NO:18);

5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:19)

5'-PusAfsgagGfugaagcgAfaGfugcacsusu - 3' (SEQ ID NO:20);

5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:21)

5'-asAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:22);

5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:23)

5'-PasAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:24);

5'-csgsuggudGgucdTucucuaaauu-3' (SEQ ID NO:35)

5'-asdAsuugagagdAagudCcaccagcsusu-3' (SEQ ID NO:36);

5'-gsguggaCfuUfCfUfcucaAfUfuuua - 3' (SEQ ID NO:25)

5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:26);

5'-gsguggaCfuUfCfUfcucaAfUfuuua-3' (SEQ ID NO:27)

5'- PusAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:28);m

5'-gsusguGfcAfCfUfucgcuucaca -3' (SEQ ID NO:41)

5'-usGfsugaAfgCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:42), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; dA, dC, dG and dT are A, C, G and T containing deoxyribose; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In one embodiment, the first and second RNAi agents are

5'-uscsguGfgUfGfGfacuucucuca - 3' (SEQ ID NO:15)

5 ¹ -PusGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:16); and

5'-csgsugguGfgAfCfUfucucUfCfaauu - 3' (SEQ ID NO:21)

5 ¹ -asAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:22), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In another embodiment, the first and second RNAi agents are

5'- gsguggaCfuUfCfUfcucaAfUfuuua - 3' (SEQ ID NO:25)

5'- usAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:26);

and

5'-gsusguGfcAfCfUfucgcuucaca -3' (SEQ ID NO:41)

5'- usGfsugaAfgCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:42) where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In one embodiment, the ligand is

- 17 039127

In one embodiment, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

In one embodiment, the subject is a human.

In one embodiment, the HBV associated disorder is selected from the group consisting of hepatitis D virus infection, delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma.

In one embodiment, the HBV associated disorder is chronic hepatitis and the subject is HBeAg positive. In another embodiment, the HBV associated disorder is chronic hepatitis and the subject is HBeAg negative.

In one embodiment, the double-stranded RNAi agent is administered at a dose of about 0.01 mg/kg to about 10 mg/kg, or about 0.5 mg/kg to about 50 mg/kg.

In one embodiment, the double stranded RNAi agent is administered at a dose of about 10 mg/kg to about 30 mg/kg. In another embodiment, the double stranded RNAi agent is administered at a dose of approximately 3 mg/kg. In one embodiment, the double stranded RNAi agent is administered at a dose of approximately 10 mg/kg.

In one embodiment, the double stranded RNAi agent is administered at a dose of approximately 0.5 mg/kg twice a week.

In one embodiment, the double stranded RNAi agent is administered at a fixed dose of about 50 mg to 200 mg.

In one embodiment, the double stranded RNAi agent is administered subcutaneously. In another embodiment, the double stranded RNAi agent is administered intravenously.

In one embodiment, the RNAi agent is administered in two or more doses.

In one embodiment, the RNAi agent is administered at intervals selected from the group consisting of once about every 12 hours, once about every 24 hours, once about every 48 hours, once about every 72 hours, and once about every 96 hours. h.

In one embodiment, the RNAi agent is administered twice a week. In another embodiment, the RNAi agent is administered once every two weeks.

In one embodiment, the methods of the present invention further comprise administering to the subject an additional therapeutic agent.

In one embodiment, the additional therapeutic agent is selected from the group consisting of an antiviral agent, a reverse transcriptase inhibitor, an immunostimulant, a therapeutic vaccine, a viral entry inhibitor, an oligonucleotide that inhibits the secretion or release of HbsAg, a capsid assembly inhibitor, an inhibitor of cccDNA formation, and

- 18 039127 any combination of the above.

In another embodiment, the methods of the present invention further comprise administering a reverse transcriptase inhibitor to the subject. In yet another embodiment, the methods of the present invention further comprise administering to the subject a reverse transcriptase inhibitor and an immunostimulant.

In one embodiment, the reverse transcriptase inhibitor is selected from the group consisting of tenofovir disoproxil fumarate (TDF), tenofovir alafenamide, lamivudine, adefovir dipivoxil, entecavir (ETV), telbivudine, and AGX-1009.

In some embodiments, the methods of the present invention further comprise treating a subject for hepatitis D virus (HDV). Methods of treatment may include any methods of treatment that are known in this field. In certain embodiments, HDV is treated in a subject using one of several iRNA-based agents that target HBV, as described herein.

In some embodiments, the methods of the present invention further include methods for modulating, eg, reducing, PD-L1 expression. Compositions and methods for reducing the expression of PD-L1 are given, for example, in the PCT publication under WO 2011/127180, the entire content of which is incorporated herein by reference.

In one embodiment, the immunostimulant is selected from the group consisting of pegylated interferon alfa-2a (PEG-IFN-a2a), interferon alfa-2b, recombinant human interleukin-7, and a Toll-like receptor 7 (TLR7) agonist.

In a further aspect, the present invention provides a method of treating a subject with a hepatitis B virus (HBV) disorder, comprising administering to the subject a therapeutically effective amount of a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region where the sense the strand contains at least 15 contiguous nucleotides and differs by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 29, and said antisense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: : 30 where substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides where the sense strand is conjugated to a ligand attached to the 3' end and where the ligand is one or more derivatives of GalNAc , connected through a divalent or trivalent branched linker, whereby the subject is treated.

In another aspect, the present invention also provides a method of treating a subject with hepatitis B virus (HBV) infection, comprising administering to the subject a therapeutically effective amount of a composition for inhibiting hepatitis B virus (HBV) expression in a cell, said composition comprising:

(a) a first double-stranded RNAi agent, comprising a first strand and a first antisense strand, forming a double-stranded region, where substantially all nucleotides of the first sense strand and substantially all nucleotides of the first antisense strand are modified nucleotides, wherein said first sense strand the strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker; and (b) a second double-stranded RNAi agent comprising a second sense strand and a second antisense strand forming a double-stranded region, where essentially all nucleotides of the second sense strand and substantially all of the nucleotides of the second antisense strand are modified nucleotides, where the second the sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker;

where the first sense strand contains at least 15 contiguous nucleotides and differs by no more than 3 nucleotides from the nucleotide sequence under SEQ ID NO:1, and the specified first antisense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence under SEQ ID NO: 2, where the second sense strand contains at least 15 contiguous nucleotides and differs by no more than 3 nucleotides from the nucleotide sequence under SEQ ID NO: 29, and the second antisense strand contains at least 15 contiguous nucleotides that differ by no more than than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 30, thereby treating the subject.

In some embodiments, the first sense strand contains a sequence selected from the group consisting of:

- 19 039127

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ IDNO:5)

5'- GUGCACCUUCGCUUCACCUCUA -3' (SEQ IDNO:7), 5'- CGUGGUGGACUUCUCUCAAUU -3' (SEQIDNO:9), 5'- CGUGGUGGUCUUCUCUUAAUU -3' (SEQ IDNO:37) 5'- GGUGGACUUCUCUCAAUUUUA -3' (SEQ IDNO:11), and 5' - GUGUGCACUUCGCUUCACA -3' (SEQ IDNO:39)

(or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequences), and the second antisense strand contains a sequence selected from the group , consisting of:

5'-UGAGAGAAGUCCACCACGAUU-3' (SEQ ID NO:b);

5'- UAGAGGUGAAGCGAAGUGCACUU-3' (SEQ ID NO:8);

5'-AAUUGAGAGAAGUCCACCAGCAG-3' (SEQ ID NO:10);

5'-AAUUGAGAGAAGUCCACCAGCUU-3' (SEQ ID NO:38);

5'-UAAAAUUGAGAGAAGUCCACCAC -3' (SEQ ID NO:12); and

5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO: 40) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to the above nucleotide sequences).

In some aspects, all nucleotides of the sense strand and all nucleotides of the antisense strand have a modification.

In certain embodiments, at least one of the modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'- deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1,5- anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing carrying a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In some embodiments, the ligand is

In a specific embodiment, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

- 20 039127

In certain embodiments, the double-stranded RNAi agents and compositions provided herein are used to treat an HDV infection and/or an HDV-associated disorder.

Accordingly, the present invention provides methods for inhibiting hepatitis D virus (HDV) replication in a cell. The methods include (a) contacting a cell with a double-stranded RNAi agent, composition, vector, or pharmaceutical composition as provided herein; and (b) maintaining the cell obtained in step (a) for a time sufficient to achieve destruction of the HBV mRNA transcript, thereby inhibiting HDV replication in the cell.

In certain embodiments, the implementation of the cell is in the subject. In certain embodiments, the subject is a human.

The present invention further provides methods for reducing the level of hepatitis D virus (HDV) antigen in a subject infected with HDV. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, composition, vector, or pharmaceutical composition as provided herein, whereby the subject's level of anti-HDV, e.g., S-HDAg or L-HDAg, is reduced.

The present invention also provides methods for reducing the hepatitis D virus (HDV) viral load in a subject infected with HDV. The methods include administering to a subject a therapeutically effective amount of a double-stranded RNAi agent, composition, vector, or pharmaceutical composition as provided herein, thereby reducing the viral load generated by HDV in the subject.

The present invention also provides methods for treating a subject with hepatitis D virus (HDV) infection, comprising administering to the subject a therapeutically effective amount of a double-stranded RNAi agent, composition, vector, or pharmaceutical composition as provided herein, thereby treating the subject.

In certain embodiments, the double-stranded RNAi agent comprises a sense strand and an antisense strand, forming a double-stranded region, the Sense strand and the antisense strands.

can be selected from the following means for RNAi, where the semantic thread contains 5'-UCGUGGUGGACUUCUCUCA-3' (SEQ ID NO: 5) and antisense a thread contains 5'-UGAGAGAAGUCCACCAC GAUU-3' (S E Q ID NO: 6); semantic a thread contains 5'-GUGCACUUCGCUUCACCUCUUA -3'(SEQ IE ¹ NO: 7), and antisense a thread contains 5'-UAGAGGUGAAGCGAAGUGCACUU-3' ( SEQ ID NO: 8); semantic a thread contains 5'-CGUGGUGGACUUCUCUCAAUU-3' (SEQ ID NO: 9) and antisense a thread contains 5'-AAUUGAGAGAAGUCCACCAGCAG-3' ( SEQ ID NO: 10); semantic a thread contains 5'-CGUGGUGGUCUUCUCUAAAUU-3' (SEQ ID NO: 3 7), and antisense a thread contains 5' - AAUUGAGAGAAGUCCACCAGCUU-3' (SEQ ID NO: 38) . semantic a thread contains 5'-GGUGGACUUCUCUCAAUUUUA-3' ( SEQ ID NO: 11), and antisense a thread contains 5'-UAAAAUUGAGAGAAGUCCACCAC-3' (SEQ ID NO: 12). or semantic a thread contains 5'-GUGUGCACUUCGCUUCACA-3'(SEQ ID NO: 3 9), and antisense a thread contains 5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO: 40), where, in fact, all nucleotides semantic

strand and, in fact, all nucleotides of the antisense strand are modified nucleotides, where the sense strand is conjugated to a ligand attached to the 3'-end, and where the ligand is one or more derivatives of GalNAc attached via a bivalent or trivalent branched linker, due to of which the subject is being treated.

In certain embodiments, all nucleotides of the sense strand and all nucleotides of the antisense strand have a modification. In certain embodiments, at least one of the modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-deoxy- modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2'hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing non-naturally occurring bases, tetrahydropyran-modified nucleotide, 1,5anhydrohexitol-modified nucleotide , cyclohexenyl-modified nucleotide, nucleotide containing th phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic. In certain embodiments, the 5'-phosphate mimetic is 5'-vinyl phosphate (5'-VP).

In certain embodiments, the implementation of the semantic thread contains

- 21 039127 '-uscsguGfgUfGfGfacuucucuca-3 ' (SEQ ID NO: 13) and the antisense strand contains

5'-usGfsagaGfaAfGfuccaCfcAfcgasusu-3' (SEQ id NO: 14), where a, c, _g and and are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or

G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In certain embodiments, the sense strand contains 5'-uscsguGfgUfGfGfacuuucucuca-3' (SEQ ID NO: 15) and the antisense strand contains 5.-PasGfsagaGfaAfGfuccaCfcAfcgasusu- 3. _{(SEQ ID NO} :16) where a, c, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond; and P is a 5'-phosphate or a 5'-phosphate mimetic.

In certain embodiments, the sense strand contains 5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO: 17) and the antisense strand contains 5'-usAf sgagGfugaagcgAf aGfugcacsusu-3 ι (SEQ _id nO:18), where A, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In certain embodiments, the sense strand contains 5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:19) and the antisense strand contains 5'-PusAfsgagGfugaagcgAfaGfugcacsusu- ₃ (SEQ ID NO:20), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond; and P is a 5'-phosphate or a 5'-phosphate mimetic.

In certain embodiments, the sense strand contains 5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO: 21) and the antisense strand contains 5'-AfsuugAfgAfgAfaguCfcAfccagcsasg-3' (SEQ ID NO:22), where A, C, G, and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In certain embodiments, the sense strand contains 5 ¹ -csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO: 23) and the antisense strand contains 5'-PasAfsuugAfgAfgAfaguCfcAfccagcsasg-3' (SEQ ID NO:24), where A, C, G and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In certain embodiments, the sense strand contains 5'-csgsuggudGgucdTucucuaaauu-3' (SEQ ID NO:35) and the antisense strand contains 5'-asdAsuugagagdAagudCcaccagcsusu-3' (SEQ ID NO: 36), where A, C, G, and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; dA, dC, dG and dT are A, C, G and T containing deoxyribose; and s is a phosphorothioate bond.

In certain embodiments, the sense strand contains 5'-gsguggaCfuUfCfUfcucaAfUfuuua-3' (SEQ ID NO: 25) and the antisense strand contains 5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc-3' (SEQ ID NO: 26), where A, C, G, and U represent is A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

In certain embodiments, the sense strand contains '-gsguggaCfuUfCfUfcucaAfUfuuua-3' (SEQ ID NO:27) and the antisense strand contains 5'-PusAfsaaaUfuGfAfgagaAfgUfccaccsasc-3' (SEQ ID NO: 28), where A, C, G, and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In certain embodiments, the sense strand contains '-gsusguGfcAfCfUfucgcuucaca-3' (SEQ ID NO:41) and the antisense strand contains 5'-usGf sugaAfgCfGfaaguGfcAfcacsusu-3' (SEQ ID NO:42), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; and s is a phosphorothioate bond.

- 22 039127

In certain embodiments, the ligand is

In certain embodiments, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

The present invention provides methods for treating a subject with hepatitis D virus (HDV) infection. The methods include administering to a subject a therapeutically effective amount of a composition for inhibiting hepatitis B virus (HBV) expression in a cell, wherein the composition comprises (a) a first double-stranded RNAi agent comprising a first sense strand and a first antisense strand forming a double-stranded region, wherein essentially , all nucleotides of the first sense strand, and in fact all nucleotides of the first antisense strand, are modified nucleotides, where the first sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or a trivalent branched linker; and (b) a second double-stranded RNAi agent comprising a second sense strand and a second antisense strand forming a double-stranded region, where essentially all nucleotides of the second sense strand and substantially all of the nucleotides of the second antisense strand are modified nucleotides, where the second the sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker; where each of the first and second semantic strands independently contains a sequence selected from the group consisting of:

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ ID NO:5),

5'- GUGCACUUCGCUUCACCUCUA -3' (SEQ ID NO:7) ,

5'- CGUGGUGGACUUCUCUCAAUU -3' (SEQ ID NO:9),

5'- CGUGGUGGUCUUCUCUAAAUU -3' (SEQ ID NO:37), 5'- GGUGGACUUCUCUCAAUUUUA -3' (SEQ ID NO:11), and

5'- GUGUGCACUUCGCUUCACA -3' (SEQ IDNO:39), and where each of the first and second antisense strands independently contains a sequence selected from the group consisting of:

5'-UGAGAGAAGUCCACCACGAUU-3' (SEQ ID NO:6);

5'- UAGAGGUGAAGCGAAGUGCACUU -3' (SEQ ID NO:8) ;

5'- AAUUGAGAGAAGUCCACCAGCAG-3' (SEQ ID NO:10);

5'- AAUUGAGAGAAGUCCACCAGCUU -3' (SEQ ID NO:38),

5'- UAAAAUUGAGAGAAGUCCACCAC -3' (SEQ ID NO:12), and

5'- UGUGAAGCGAAGUGCACACUU -3' (SEQ ID NO: 40) whereby the subject is treated.

In certain embodiments, all nucleotides of the first and second sense strands and all

- 23 039127 nucleotides of the first and second antisense strands have a modification. In certain embodiments, at least one of the modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'- deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing non-naturally occurring bases, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, a nucleotide containing o a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In certain embodiments, the first and second RNAi agents are selected from the group: 5'-uscsguGfgUfGfGfacuucucuca - 3' (SEQ ID NO:13)

5'-usGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:14);

5'-uscsguGfgUfGfGfacuucucuca-3' (SEQ ID NO:15)

5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:16);

5'-gsusgcacUfuCfGfOfuucaccucua-3' (SEQ ID NO:17)

5'-usAfsgagGfugaagcgAfaGfugcacsusu - 3' (SEQ ID NO:18);

5'-gsusgcacUfuCfGfCfuucaccucua-3' (SEQ ID NO:19)

5'-PusAfsgagGfugaagcgAfaGfugcacsusu - 3' (SEQ ID NQ:20);

5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:21)

5'-asAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:22);

5'-csgsugguGfgAfCfUfucucUfOfaauu-3' (SEQ ID NO:23)

5'-PasAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:24);

5'-csgsuggudGgucdTucucuaaauu-3' (SEQ ID NO:35)

5'-asdAsuugagagdAagudCcaccagcsusu-3' (SEQ ID NO:36);

5'-gsguggaCfuUfCfUfcucaAfUfuuua - 3' (SEQ ID NO:25)

5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:26);

5'-gsguggaCfuUfCfUfcucaAfUfuuua-3' (SEQ ID NO:27)

5'- PusAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:28);

and

5'-gsusguGfcAfCfUfucgcuucaca -3' (SEQ ID NO:41)

5'-usGfsugaAfgCfGfaaguGfcAfcacsusu-3' (SEQ ID NO:42), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; dA, dC, dG and dT are A, C, G and T containing deoxyribose; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In certain embodiments, the first and second RNAi agents are

5'-uscsguGfgUfGfGfacuucucuca - 3' (SEQ ID NO:15)

5'-PusGfsagaGfaAfGfuccaCfcAfcgasusu - 3' (SEQ ID NO:16); and

5'-csgsugguGfgAfCfUfucucUfCfaauu-3' (SEQ ID NO:21)

5'-asAfsuugAfgAfgAfaguCfcAfccagcsasg - 3' (SEQ ID NO:22), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In certain embodiments, the first and second RNAi agents are 5'-gsguggaCfuUfCfUfcucaAfUfuuua-3' (SEQ ID NO:25)

5'-usAfsaaaUfuGfAfgagaAfgUfccaccsasc - 3' (SEQ ID NO:26);

and

5'-gsusguGfcAfCfUfucgcuucaca -3' (SEQ ID NO:41)

5'-usGfsugaAfgCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:42), where A, C, G and U are A, C, G or U containing ribose; a, g, c and u are 2'-O-methyl-(2'-OMe-) A, U, C or G; Af, Cf, Gf or Uf are 2'-fluoro-A, G, C or U; s is a phosphorothioate bond and P is a 5'-phosphate or 5'-phosphate mimetic.

In certain embodiments, the ligand is

In certain embodiments, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

In certain embodiments, the subject is a human.

In certain embodiments, the double-stranded RNAi agent is administered at a dose of about 0.01 mg/kg to about 10 mg/kg, or about 0.5 mg/kg to about 50 mg/kg. In certain embodiments, the double-stranded RNAi agent is administered at a dose of about 10 mg/kg to about 30 mg/kg. In certain embodiments, the double-stranded RNAi agent is administered at a dose of about 3 mg/kg. In certain embodiments, the double-stranded RNAi agent is administered at a dose of about 10 mg/kg. In certain embodiments, the double-stranded RNAi agent is administered at a dose of approximately 0.5 mg/kg twice a week. In certain embodiments, the double-stranded RNAi agent is administered at a fixed dose of about 50 mg to 200 mg.

In certain embodiments, the double-stranded RNAi agent is administered subcutaneously.

In certain embodiments, the double-stranded RNAi agent is administered intravenously.

In certain embodiments, the RNAi agent is administered in two or more doses. In certain embodiments, the RNAi agent is administered at intervals selected from the group consisting of once about every 12 hours, once about every 24 hours, once about every 48 hours, once about every 72 hours, and once about every 96 hours. h. In certain embodiments, the RNAi agent is administered twice a week. In certain embodiments, the RNAi agent is administered once every two weeks. In certain embodiments, the RNAi agent is administered once per month. In certain embodiments, the RNAi agent is administered once every two months. In certain embodiments, the RNAi agent is administered once every three months.

In certain embodiments, the RNAi agent is administered to the subject with an additional therapeutic agent. Additional therapeutic agents include, for example, an antiviral agent, a reverse transcriptase inhibitor, an immunostimulant, a therapeutic vaccine, an inhibitor of viral entry, an oligonucleotide that inhibits the secretion or release of HbsAg, a capsid assembly inhibitor, an inhibitor of HBV covalently closed circular (ccDNA) formation, and any combination of of the above.

In certain embodiments, the additional agent is a reverse transcriptase inhibitor. In certain embodiments, the additional agent is a reverse transcriptase inhibitor and an immunostimulant. Exemplary reverse transcriptase inhibitors include tenofovir disoproxil fumarate (TDF), tenofovir alafenamide, lamy-25 039127 vudine, adefovir dipivoxil, entecavir (ETV), telbivudine, and AGX-1009. Exemplary immunostimulants include pegylated interferon alfa-2a (PEG-IFN-a2a), interferon alfa-2b, recombinant human interleukin-7, and a Toll-like receptor 7 (TLR7) agonist.

The present invention further provides methods of treating a subject with hepatitis D virus (HDV) infection, comprising administering to the subject a therapeutically effective amount of a composition for inhibiting hepatitis B virus (HBV) expression in a cell, the composition comprising (a) a first double-stranded RNAi agent, containing the first strand and the first antisense strand, forming a double-stranded section, where, in fact, all nucleotides of the first sense strand and, in fact, all nucleotides of the first antisense strand are modified nucleotides, where the first sense strand is conjugated to a ligand attached to the 3'- the end, and where the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker; and (b) a second double-stranded RNAi agent comprising a second sense strand and a second antisense strand forming a double-stranded region, where essentially all nucleotides of the second sense strand and substantially all of the nucleotides of the second antisense strand are modified nucleotides, where the second the sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker; where the first sense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence under SEQ ID NO: 1, and the first antisense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence under SEQ ID NO: 2, where the second sense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence under SEQ ID NO: 29, and the second antisense strand contains at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 30, thereby treating the subject.

In certain embodiments, the first sense strand contains a sequence selected from the group consisting of:

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ IDNO:5),

5'- GUGCACUUCGCUUCACCUCUA -3' (SEQ ID NO:7) ,

5'- CGUGGUGGACUUCUCUCAAUU -3' (SEQ ID NO:9),

5'- CGUGGUGGUCUUCUCUAAAUU -3' (SEQ ID NO:37), 5'- GGUGGACUUCUCUCAAUUUUA -3' (SEQ ID NO:11), and

5'- GUGUGCACUUCGCUUCCACA -3' (SEQ IDNO:39), and the second antisense strand contains a sequence selected from the group consisting of: 5'-UGAGAGAAGUCCACCACGAUU -3' (SEQ ID NO:6);

5'- UAGAGGUGAAGCGAAGUGCACUU -3' (SEQ ID NO:8) ;

5'- AAUUGAGAGAAGUCCACCAGCAG -3' (SEQ ID NO :10) ;

5'- AAUUGAGAGAAGUCCACCAGCUU -3' (SEQ ID NO :38),

5'- UAAAAUUGAGAGAAGUCCACCAC -3' (SEQ ID NO :12), and

5'-UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO:40).

In certain embodiments, all nucleotides of the sense strand and all nucleotides of the antisense strand have a modification. In certain embodiments, the additional agent is at least one of the modified nucleotides, which is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-fluoro-modified nucleotide , 2'-deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally ethyl-hindered nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C -alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing unnatural bases, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide, cyclohexenium l-modified nucleotide, a nucleotide containing a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In certain embodiments, the ligand is

- 26 039127

In certain embodiments, the RNAi agent is conjugated to a ligand as shown in the following scheme:

where X is O or S.

The present invention is further illustrated by the following detailed description and drawings.

Brief description of graphic materials

In FIG. 1 schematically depicts the structure of the approximately 3.2 kb double-stranded HBV genome. Replication of the HBV genome occurs at the expense of intermediate RNA and results in 4 overlapping viral transcripts (approximately 3.5 kb transcript, approximately 2.4 kb transcript, approximately 2.1 kb transcript). .bp and a transcript of approximately 0.7 kb) encoding seven viral proteins (pre-S1, pre-S2, S, P, X, pre-C and C) that are translated from three reading frames.

In FIG. 2 is a graph showing the log reduction in serum HBsAg levels, normalized to pre-dose serum HBsAg levels, following a single dose of 3 mg/kg of these iRNA-based agents.

In FIG. 3 is a graph showing the log reduction in serum HBsAg levels, normalized to pre-dose serum HBsAg levels, following a single dose of 3 mg/kg of these iRNA-based agents.

In FIG. 4 is a graph showing the percentage of pre-dose HBsAg remaining on days 5 and 10 following a single dose of 3 mg/kg of these iRNA-based agents. In FIG. Figure 4 also depicts the percentage of HBsAG that remains on day 10 post-dose versus the percentage of HBsAG that remains on day 10 post-dose in an animal treated with 3 mg/kg of control dsRNA targeting mouse/rat transthyretin (mrTTR) .

In FIG. 5 is a graph showing the log reduction in serum HBsAg levels, normalized to pre-dose serum HBsAg levels, after administration of a single dose of AD-65403 of 3 mg/kg.

In FIG. 6A is a graph showing the reduction in serum HBsAg levels, normalized for pre-dose serum HBsAg levels, on a standard linear scale following subcutaneous administration of a single dose of AD-66810 of 0.3, 1, 3, or 9 mg/day. kg.

In FIG. 6B is a graph showing the decrease in serum HBsAg levels, normalized for pre-dose serum HBsAg levels, on a log ₁₀ scale after administration of a single subcutaneous dose of AD-66810 of 0.3, 1, 3, or 9 mg. /kg.

In FIG. 7 is a graph showing the decrease in plasma HBsAg levels, normalized to pre-dose plasma HBsAg levels, on a log ₁₀ scale following subcutaneous administration of three weekly doses of 3 mg/kg AD-66810.

- 27 039127

Detailed description of the invention

The present invention provides iRNA-based compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the hepatitis B virus (HBV) gene. The gene may be in a cell, for example in a cell of a subject such as a human. The use of these iRNAs allows for the targeted destruction of the mRNA of the corresponding gene (the HBV gene) in mammals.

The RNAi agents of the present invention were designed to target regions in the HBV genome that are conserved across all 8 HBV serotypes. In addition, the RNAi agents of the present invention have been developed to inhibit HBV at all stages of the life cycle, eg, replication, assembly, viral secretion, and secretion of subviral antigens, by inhibiting the expression of several HBV genes. In particular, since transcription of the HBV genome results in the formation of polycistronic overlapping RNAs, the RNAi agent of the present invention, which targets a single HBV gene, results in significant inhibition of the expression of most or all HBV transcripts. For example, since the HBV genome is transcribed into a single mRNA, the RNAi agent of the present invention that targets the S gene will result in inhibition of not only the expression of the S gene, but also the expression of the downstream polymerase gene. In addition, the RNAi agents of the present invention have been developed to inhibit HBV virus replication by targeting HBV structural genes and the HBV X gene, allowing the subject's immune system to detect and respond to the presence of HBsAg to produce anti-HBV antibodies to eliminate HBV infection. Without being limited by theory, it is believed that a combination or subcombination of the above properties, and specific target sites and/or specific modifications in such RNAi agents, provide the RNAi agents of the present invention with improved efficacy, stability, safety, potency, and duration of action.

Using in vitro and in vivo assays, the present inventors have demonstrated that iRNA molecules that target the HBV gene are able to actively promote RNAi, resulting in significant inhibition of the expression of more than one HBV gene. The present inventors have also demonstrated that the RNAi agents of the present invention are exceptionally stable in the cytoplasm and lysosome. Thus, methods and compositions comprising these iRNAs are useful for treating a subject with an HBV infection and/or an HBV associated disease such as chronic hepatitis B (CHB).

Accordingly, the present invention also provides methods for treating a subject with a disorder that would benefit from inhibition or reduction of HBV gene expression, for example, an HBV associated disease such as chronic hepatitis B virus (CHB) infection, by administering the compositions to based on iRNAs that act on RNA-induced silencing complex (RISC)-mediated cleavage of HBV RNA transcripts.

Very low dosages of the iRNA of the present invention can specifically and effectively promote RNA interference (RNAi), resulting in a significant inhibition of the expression of the corresponding gene (the HBV gene).

The iRNAs of the present invention comprise an RNA strand (antisense strand) with a region that is approximately 30 nucleotides or less in length, e.g. -24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26 , 18-25,

18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20,

20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21- 28, 21-27, 21-26, 21-25,

21-24, 21-23 or 21-22 nucleotides in length, this region being essentially complementary to at least a portion of the HBV mRNA transcript.

The following detailed description discloses how to prepare and use compositions containing iRNA to inhibit HBV gene expression, as well as compositions, routes of administration, and methods of treating subjects with diseases and disorders that would benefit from inhibition and/or reduction of HBV gene expression. .

I. Definitions.

In order to make the present invention easier to understand, some terms are first defined. Furthermore, it should be noted that in all cases where a parameter value or range is listed, it is intended that values and ranges intermediate to the values listed are also intended to be part of the present invention.

The singular form is used herein to refer to one or more (ie, at least one) of the grammatical entities of this application. By way of example, element means one element or multiple elements, such as a plurality of elements.

The term including is used herein to refer to the phrase including without limitation and is used interchangeably with it.

The term or is used herein to mean the term and/or and is used interchangeably with it, unless the context clearly indicates otherwise.

In the context of this document, the expression hepatitis B virus, used interchangeably with the term HBV, refers to a well-known non-cytopathic hepatotropic DNA virus belonging to the Hepadnaviridae family.

The HBV genome is partially double-stranded circular DNA with overlapping reading frames (see, for example, Fig. 1).

There are four known genes encoded in the HBC genome, called C, X, P, and S. The core protein is encoded by the C (HBsAg) gene. The hepatitis B virus antigen (HBeAg) is produced by proteolytic processing of the core (pre-C) protein precursor. DNA polymerase is encoded by the P gene. The S gene is a gene that encodes a surface antigen (HBsAg). The HBsAg gene is a single long open reading frame but contains three in-frame start codons (ATGs) that divide the gene into three parts, pre-S1, pre-S2, and S. Multiple start codons produce polypeptides of three different sizes, which are called large, medium and small (pre-S1+pre-S2+S, pre-S2+S or S). The function of the non-structural protein encoded by gene X is not fully understood, but it is associated with the development of liver cancer and codes for a protein trap that allows HBsAg in the blood to block anti-HBsAg antibodies and allows infectious viral particles to evade detection by the immune system.

The proteins encoded by the HBV genome include the envelope proteins: i) small - hepatitis B surface antigen (HBsAg); ii) medium - preS2 plus HBsAg; iii) large - preS1 plus preS2 plus HBsAg; nucleocapsid protein, hepatitis B capsid antigen (HBsAg). Hepatitis B virus e antigen (HBeAg) is a non-structural protein produced during HBV replication that shares 90% amino acid similarity with the HBsAg nucleocapsid; and protein X is a non-structural protein (HBx), which manifests its function in the cytoplasm, and consists in the activation of various signaling pathways, many of which are controlled by the modulation of cytosolic calcium, and in the nucleus, and consists in the regulation of transcription through direct interaction with various transcription factors , and in some cases enhancing their binding to specific transcriptional elements.

HBV is one of the few DNA viruses that use reverse transcriptase in a replication process that involves several steps, including entry, decapsidation, and transfer of the viral genome to the nucleus. Initially, replication of the HBV genome involves the formation of an intermediate RNA, which is then reverse transcribed to produce the viral genome as DNA.

Upon infection of an HBV cell, viral genomic relaxed cDNA (rcDNA) is transferred to the cell nucleus and converted into episomal covalently closed cDNA (cccDNA), which serves as a transcription template for viral mRNAs. After transcription and export from the nucleus, cytoplasmic viral pregenomic RNA (pgRNA) is assembled with HBV polymerase and capsid proteins to form a nucleocapsid, within which polymerase-catalyzed reverse transcription yields a minus-strand of DNA, which is then copied to a plus-strand of DNA to form progeny rcDNA -genome. Mature nucleocapsids are then either packaged with viral envelope proteins to exit as virion particles, or translocated into the nucleus to amplify the cccDNA pool via the intracellular cccDNA amplification pathway. cccDNA is an important component in the HBV replication cycle and is responsible for the development of infection and persistence of the virus.

HBV infection results in the production of two distinct particles: 1) the HBV virus itself (or Dane particles), which includes an HBsAg-assembled viral capsid and is coated with HBsAg and is capable of re-infecting cells, and 2) subviral particles (or SVP), which are high-density lipoprotein-type particles composed of lipids, cholesterol, cholesterol esters, and small and medium forms of hepatitis B surface antigen HBsAg, which are not infectious. For every viral particle formed, 1000-10000 SVPs are released into the blood. For this reason, SVPs (and the HBsAg protein they carry) represent the vast majority of viral protein in the blood. HBV-infected cells also secrete a soluble proteolysis product of a core protein precursor called HBV e-antigen (HBeAg).

Eight HBV genotypes, designated A-H, have been identified, each with a distinct geographic distribution. The virus is non-cytopathic, with virus-specific cellular immunity being the primary determinant of the outcome of acute HBV infection with cessation of liver disease after 6 months or chronic HBV infection, which is often associated with progressive liver damage.

The term HBV includes any of the eight HBV genotypes (A-H). The amino acid and complete coding sequence of the HBV genome reference sequence can be found, for example, under GenBank accession numbers GI: 21326584 (SEQ ID NO: 1) and GI: 3582357 (SEQ ID NO: 3).

Additional examples of HBV mRNA sequences are readily available from public databases such as GenBank, UniProt and 0MIM.

As used herein, the term HBV also refers to naturally occurring alterations in the DNA sequence of the HBV genome.

In the context of this document, the term hepatitis D virus, used interchangeably with the term HDV, refers to a well-known non-cytopathic hepatotropic DNA virus belonging to the Hepadnaviridae family. See, for example, Ciancio and Rizzetto, Nat. Rev. 11:68-71, 2014; Le Gal et al., Emerg. Infect. Dis. 12:1447-1450, 2006; and Abbas and afzal, World J. Hep., 5:666-675, 2013, all of which are incorporated by reference. Unless otherwise noted, HDV refers to all HDV clades and variants.

HDV produces one protein, namely HDAg. It exists in two forms: the 27 kDa large HDAg (also referred to herein as 1HD, L-HDAg, and HDV large antigen) and the 24 kDa small HDAg (also referred to herein as sHD, S-HDAg, and HDV small antigen). ). The N-termini of both forms are identical, they differ in 19 amino acids at the C-terminus of the large HDAg. Both isoforms are produced from a single reading frame that contains the UAG stop codon at codon 196, which typically results in only a small HDAg. However, editing by the cellular enzyme adenosine deaminase-1 changes the stop codon to UCG, allowing the production of a large HDAg. Although their sequences are 90% identical, the two proteins perform different functions during infection. HDAg-S is produced early in infection and enters the nucleus to support viral replication. On the contrary, HDAg-L is produced in the later stages of infection, acts as an inhibitor of viral replication and is essential for the assembly of viral particles.

Additional examples of HDV mRNA sequences are readily available from public databases such as GenBank, UniProt, and OMIM.

As used herein, the term HDV also refers to naturally occurring changes in the DNA sequence of the HDV genome.

As used herein, the term target sequence refers to the contiguous portion of the nucleotide sequence of an mRNA molecule resulting from transcription of the HBV gene, including mRNA that is the product of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-driven cleavage at or near that portion of the nucleotide sequence of an mRNA molecule resulting from transcription of the HBV gene.

The target sequence may be about 9-36 nucleotides in length, eg, about 15-30 nucleotides. For example, the target sequence may be approximately 15-30 nucleotides long 20, 1519, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18- 21, 18-20, 19-30, 19-29, 1928, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20- 30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,2023, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23 or 21-22 nucleotides. Range and length values intermediate to the range and length values listed above are also considered part of the present invention.

As used herein, the term strand containing a sequence refers to an oligonucleotide containing a strand of nucleotides that is described by a sequence denoted using standard nucleotide nomenclature.

Each of G, C, A, T and U generally denotes a nucleotide which respectively contains guanine, cytosine, adenine, thymidine and uracil as a base. However, it will be understood that the term ribonucleotide or nucleotide can also mean a modified nucleotide, described in more detail below, or mimicking a replacement fragment (see, for example, Table 2). It is well known to one skilled in the art that guanine, cytosine, adenine, and uracil can be substituted with other moieties without substantially altering the base pairing properties of the oligonucleotide containing the nucleotide carrying such a replacement moiety. For example, without limitation, a nucleotide containing inosine as a base can form a base pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine or adenine can be replaced in the dsRNA nucleotide sequences of the present invention with nucleotides containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be respectively replaced by guanine and uracil to form G-U ambiguous base pairs with the target mRNA. Sequences containing such replacement fragments are suitable for the compositions and methods of the present invention.

The terms iRNA, RNAi agent, iRNA based agent, 'RNA interference agent, used interchangeably herein, refer to an agent that contains RNA, as the term is defined herein, and that mediates the targeted destruction of RNA -transcript via the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific destruction of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, eg, inhibits, the expression of an HBV gene (eg, one or more HBV genes) in a cell, eg, a cell in a subject, such as a mammalian subject.

In one embodiment, the RNAi agent of the present invention includes a single-stranded RNA that interacts with a target RNA sequence, such as a target HBV mRNA sequence, to direct cleavage of the target RNA. Without being limited by theory, it is believed that long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a type III ribonuclease-like enzyme, processes dsRNA to short interfering RNAs of 19-23 bp in length with characteristic two-base 3' overhangs (Bernstein, et al. (2001) Nature 409:363). The siRNAs are then inserted into an RNA-inducible silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing a complementary antisense strand to drive target recognition (Nykanen, et al. (2001) Cell 107:309). After binding to the appropriate target mRNA, one or more endonucleases in RISC cleave the target to induce silencing (Elbashir, et al. (2001) Genes Dev. 15:188). Thus, in one aspect, the present invention relates to a single-stranded siRNA (ssRNA) generated within a cell that promotes the formation of a RISC complex to effect silencing of a target gene, i.e. the HBV gene. Accordingly, the term siRNA is also used herein to refer to RNAi as described above.

In another embodiment, the RNAi agent may be a single-stranded siRNA that is introduced into a cell or organism to inhibit the target mRNA. Single-stranded RNAi agents bind to Argonaute 2, which has endonuclease activity in the RISC complex, which then cleaves the target mRNA. Single-stranded siRNAs are typically 15-30 nucleotides long and are chemically modified. Construction and testing of single-stranded siRNAs are described in US Pat. No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the contents of each of which are hereby incorporated by reference in their entirety. Any antisense nucleotide sequences described herein can be used as single-stranded siRNA as described herein or which has been chemically modified by the methods described in Lima et al. (2012) Cell 150:883-894.

In another embodiment, the iRNA for use in the compositions, routes of use, and methods of the present invention is double-stranded RNA, and is referred to herein as double-stranded RNAi agent, double-stranded RNA molecule (dsRNA), dsRNA-based agent, or dsRNA. The term dsRNA refers to a complex of duplex ribonucleic acid molecules containing two antiparallel and essentially complementary nucleic acid strands considered to have sense and antisense orientations with respect to the target RNA, i.e. the HBV gene. In some embodiments of the present invention, double-stranded RNA (dsRNA) triggers the destruction of a target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

Typically, most of the nucleotides in each strand of a dsRNA molecule are ribonucleotides, but as detailed herein, each strand or both strands may also contain one or more non-ribonucleotide nucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. In addition, as used herein, the term RNAi agent may include ribonucleotides with chemical modifications; the RNAi agent may include significant modifications of multiple nucleotides. As used herein, the term modified nucleotide refers to a nucleotide independently having a modified sugar moiety, a modified internucleotide bond, and/or a modified nucleotide base. Thus, the expression modified nucleotide encompasses substitutions, additions or deletions of, for example, a functional group or atom, in internucleoside bonds, sugar moieties, or nucleotide bases. Modifications suitable for use in the compositions of the present invention include all types of modifications disclosed herein or known in the art. Any such modifications that are used in a siRNA-type molecule are encompassed by the term RNAi agent in the context of the specification and claims.

The duplex region may be of any length that allows specific degradation of the desired target RNA via the RISC pathway and may vary in length from about 9 to 36 bp, e.g., it can be about 15-30 bp in length, e.g. approx 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 bp, such as about 1530, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15- 21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 1828, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 1923, 19-22, 19-21, 19- 20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 2128, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Range and length values intermediate to the range and length values listed above are also considered part of the present invention.

The two strands that form the duplex structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules. In cases where two strands are part of one larger molecule and, therefore, are connected by an uninterrupted chain of nucleotides from the 3' end of one strand to the 5' end of the corresponding other strand, forming a duplex structure, then the connecting strand of RNA is called a hairpin loop. The hairpin loop may contain at least one unpaired nucleotide. In some embodiments, the hairpin loop may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least at least 10, at least 20, at least 23 or more unpaired nucleotides.

If two, in fact, complementary dsRNA strands are formed by separate RNA molecules, then these molecules do not have to, but can be connected covalently. When two strands are joined covalently in a manner other than by an unbroken chain of nucleotides from the 3' end of one strand to the 5' end of the corresponding other strand, forming a duplex structure, the connecting structure is called a linker. Strands of RNA may have the same or different number of nucleotides. The maximum base pair is the number of nucleotides in the shortest strand of the dsRNA, minus any overhangs that are present in the duplex. In addition to the duplex structure, the RNAi agent may contain one or more nucleotide overhangs.

In one embodiment, the RNAi agent of the present invention is a dsRNA, each strand containing 24-30 nucleotides, that interacts with a target RNA sequence, such as a target HBV mRNA sequence, to direct cleavage of the target RNA. Without being limited by theory, long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a type III ribonuclease-like enzyme, processes dsRNA to short interfering RNAs of 19-23 bp in length with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then inserted into an RNA-inducible silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing a complementary antisense strand to drive target recognition (Nykanen, et al. (2001) Cell 107:309). After binding to the appropriate target mRNA, one or more endonucleases in RISC cleave the target to induce silencing (Elbashir, et al. (2001) Genes Dev. 15:188).

As used herein, the expression nucleotide overhang refers to at least one unpaired nucleotide that protrudes from an iRNA duplex structure, eg, dsRNA. For example, if the 3' end of one dsRNA strand extends beyond the 5' end of the other strand, or vice versa, a nucleotide overhang is formed. dsRNA may contain an overhang of at least one nucleotide; alternatively, the overhang may comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more. The nucleotide overhang may comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) end(s) may be within the sense strand, the antisense strand, or a combination thereof. In addition, the overhang nucleotide(s) may be present at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA.

In one embodiment, the dsRNA antisense strand contains 1-10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, extending from the 3' end and/or 5' end. In one embodiment, the dsRNA sense strand contains 1-10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides overhanging the 3' end and/or 5' end. In another embodiment, one or more overhang nucleotides are replaced with a nucleoside thiophosphate.

A blunt end or a blunt end means that there are no unpaired nucleotides at the end of the double stranded RNAi agent, i. no nucleotide overhang. The blunt-ended RNAi tool is a dsRNA that is double-stranded throughout its length, i.e. does not have a nucleotide overhang at either end of the molecule.

The RNAi agents of the present invention include RNAi agents with a nucleotide overhang at one end (ie, one overhang and one blunt end) or nucleotide overhangs at both ends.

The term antisense strand or guide strand refers to an iRNA strand, eg dsRNA, that contains a region substantially complementary to a target sequence, eg HBV mRNA. As used herein, the term complementarity site refers to a site on an antisense strand that is substantially complementary to a sequence, eg, a target sequence, eg, an HBV nucleotide sequence, as defined herein. In cases where the complementarity region is not fully complementary to the target sequence, mismatches may be present in the internal or terminal regions of the molecule. Generally, the most tolerable mismatches are at the terminal regions, eg, within 5, 4, 3, 2, or 1 nucleotide of the 5' and/or 3' end of the iRNA. In one embodiment, the double-stranded RNAi agent of the present invention provides for nucleotide mismatch in the antisense strand. In another embodiment, the double-stranded RNAi tool of the present invention provides for mismatching of nucleotides in the sense strand. In one embodiment, nucleotide mismatch occurs, for example, within 5, 4, 3, 2, or 1 nucleotide from the 3' end of the iRNA. In another embodiment, nucleotide mismatch occurs, for example, at the 3'-terminal nucleotide of the iRNA.

The term sense strand or follower strand as used herein refers to an iRNA strand that contains a region substantially complementary to that of the antisense strand, as the term is defined herein.

As used herein, the term cleavage site refers to the area immediately adjacent to the cleavage site. The cleavage site is the site in the target at which cleavage occurs. In some embodiments, the cleavage site contains three bases at either end of the cleavage site that is immediately adjacent to it. In some embodiments, the cleavage site contains two bases at either end of the cleavage site that is immediately adjacent to it. In some embodiments, the cleavage site is specifically located at the site bordering nucleotides 10 and 11 of the antisense strand and the cleavage site contains nucleotides 11, 12 and 13.

As used herein, the term complementary, unless otherwise indicated, when used to describe a first nucleotide sequence with respect to a second nucleotide sequence, means the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure under specified conditions with an oligonucleotide or polynucleotide containing the second nucleotide sequence, which will be understood by a person skilled in the art. Such conditions, for example, may be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50 or 70°C for 12-16 h followed by washing (see ., for example, Molecular Cloning: A Laboratory Manual, Sambrook, et al (1989) Cold Spring Harbor Laboratory Press). You can use other conditions, such as physiologically appropriate conditions that may occur in the body. One skilled in the art will be able to determine the set of conditions most appropriate for testing the complementarity of two sequences according to the end use of the hybridized nucleotides.

Complementary sequences in an iRNA, such as in a dsRNA described herein, include base pairing an oligonucleotide or polynucleotide containing a first polynucleotide sequence with an oligonucleotide or polynucleotide containing a second nucleotide sequence over the entire length of one or both of the nucleotide sequences. In this document, such sequences may be referred to as fully complementary to each other. However, in the case where the first sequence is considered to be substantially complementary to the second sequence herein, the two sequences may be fully complementary, or may have one or more mismatches, but generally no more than 5, 4, 3, or 2 base pairs when hybridized to form a duplex of up to 30 base pairs while retaining the ability to hybridize under conditions most appropriate to their end use, such as inhibition of gene expression via the RISC pathway. However, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs will not be considered mismatches for purposes of determining complementarity. For example, a dsRNA containing one 21 nucleotide long oligonucleotide and another 23 nucleotide long oligonucleotide, where the longer oligonucleotide contains a 21 nucleotide sequence that is fully complementary to the shorter oligonucleotide, may still be referred to as fully complementary for the purposes described herein.

Complementary sequences used herein may also include or may be formed entirely from non-Watson-Crick base pairs and/or base pairs formed from unnatural and modified nucleotides, to the extent that the above requirements are met. in relation to their ability to hybridize. Such non-Watson-Crick base pairs include, without limitation, ambiguous G:U or Hoogsteen base pairs.

The expressions complementary, fully complementary, and substantially complementary herein can be applied to a base match between a sense strand and a dsRNA antisense strand, or between an iRNA-based agent antisense strand and a target sequence, as will be understood from the context of their use.

As used herein, a polynucleotide that is substantially complementary to at least

- 33 039127 least part messenger RNA (mRNA) refers to a polynucleotide that is essentially complementary to a continuous portion of the mRNA of interest (eg, the mRNA encoding the HBV gene). For example, a polynucleotide is complementary to at least a portion of an HBV mRNA if the sequence is substantially complementary to a contiguous portion of the HBV-encoding mRNA.

Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target HBV sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the HBV target sequence and contain a contiguous nucleotide sequence that is at least about 80% complementary throughout its length to an equivalent portion of the nucleotide sequence of SEQ ID NO: 1 or fragment under SEQ ID NO: 1, such as about 85% complementary, about 86% complementary, about 87% complementary, about 88% complementary, about 89% complementary, about 90% complementary, about 91% complementary, about 92% complementary , by about 93%, by about 94%, by about 95%, by about 96%, by about 97%, by about 98%, or by about 99%.

In one embodiment, the RNAi agent of the present invention includes a sense strand that is substantially complementary to an antisense polynucleotide that is in turn complementary to an HBV target sequence, wherein the sense strand polynucleotide contains a contiguous nucleotide sequence that is at least at least approximately 80% complementary throughout its length to an equivalent portion of the nucleotide sequence of any of the sequences under SEQ ID NO: 6, 8, 10, 12, 38 and 40 or a fragment of any of the sequences under SEQ ID NO: 6, 8 , 10, 12, 38 and 40, such as about 85% complementary, about 86% complementary, about 87% complementary, about 88% complementary, about 89% complementary, about 90% complementary, about 91% complementary, about 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, or approximately about 99%. In another embodiment, the RNAi agent of the present invention comprises an antisense strand that is substantially complementary to the HBV target sequence and contains a contiguous nucleotide sequence that is at least about 80% complementary throughout its length to an equivalent portion of the nucleotide sequence of any of sequences under SEQ ID NO: 5, 7, 9, 11, 37 and 39 or a fragment of any of the sequences under SEQ ID NO: 5, 7, 9, 11, 37 and 39, such as approximately 85% complementary, approximately 86% approximately 87% approximately 88% approximately 89% approximately 90% approximately 91% approximately 92% approximately 93% approximately 94% approximately 95% by about 96%, by about 97%, by about 98%, or by about 99%.

In some embodiments, the majority of the nucleotides of each strand are ribonucleotides, but as detailed herein, each or both strands may also include one or more nucleotides that are not ribonucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. In addition, iRNA may contain ribonucleotides with chemical modifications. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications that are used in the iRNA molecule are covered by the term iRNA in the context of these descriptions and claims.

In one aspect of the present invention, an agent for use in the methods and compositions of the present invention is a single-stranded antisense nucleic acid molecule that inhibits the target mRNA through an antisense inhibition mechanism. The single-stranded antisense RNA molecule is complementary to the sequence in the target mRNA. Single stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing with mRNA and physically disrupting the translation mechanism, see Dias, N. et al. (2002) Mol. Cancer Ther 1:347-355. The length of the single-stranded antisense RNA molecule may be from about 15 to about 30 nucleotides and have a sequence complementary to the target sequence. For example, a single-stranded antisense RNA molecule may contain a sequence that contains at least about 15, 16, 17, 18, 19, 20 or more contiguous nucleotides from any of the antisense sequences described herein.

As used herein, a subject is an animal, such as a mammal, including a primate (such as a human, a non-human primate, such as a monkey and a chimpanzee) other than an animal primate (such as a cow, pig, camel, llama, horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, mouse, horse and whale) or bird (such as a duck or goose). In one embodiment, the subject is a human, such as a human being treated for or being evaluated for a disease, disorder, or condition that would benefit from reduced expression and/or replication of the HBV gene; a person at risk of developing a disease, disorder, or condition that would benefit from reduced expression and/or replication of the HBV gene; a human with a disease, disorder, or condition that would benefit from reduced HBV gene expression and/or replication; and/or a person being treated for a disease, disorder, or condition that would benefit from a reduction in HBV gene expression and/or replication, as described herein. In another embodiment, the subject has a hepatitis B virus (HBV) infection. In another embodiment, the subject has both hepatitis B virus (HBV) infection and hepatitis D virus (HDV) infection.

As used herein, the terms treatment or treatment refers to a beneficial or desired outcome, including, without limitation, alleviation or reduction in the severity of one or more symptoms associated with undesired HBV gene expression and/or HBV replication, for example, the presence of HBV cccDNA in serum and / or liver, presence of HBV antigen in serum and / or liver, for example, HBsAg and / or HBeAg, elevated ALT, elevated AST, no or low levels of antibodies to HBV, liver damage; cirrhosis; delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma; serum-like syndrome; anorexia; nausea; vomiting, subfebrile body temperature; myalgia; fatigue; impaired gustatory and olfactory functions (aversion to food and cigarettes); and/or right upper quadrant and epigastric pain (episodic, mild to moderate); hepatic encephalopathy; drowsiness; sleep disorders; confusion; to whom; ascites; bleeding in the gastrointestinal tract; coagulopathy; jaundice; hepatomegaly (slightly enlarged, soft liver); splenomegaly; palmar erythema; spider hemangioma; muscle atrophy; forms of stellate angioma; vasculitis; varicose bleeding; peripheral edema; gynecomastia; testicular atrophy; expansion of the collateral veins of the abdomen (jellyfish head); high levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the range of 1000-2000 IU/ml, although values up to 100 times the upper limit of normal (ULN) may also be detected; ALT levels higher than AST levels; elevated levels of gamma-glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP) (for example, not more than 3 times the ULN); slightly reduced levels of albumin; elevated serum iron levels; leukopenia (ie granulocytopenia); lymphocytosis; increased erythrocyte sedimentation rate (ESR); reduced lifespan of erythrocytes; hemolysis; thrombocytopenia; lengthening the international normalized ratio (INR); the presence in the blood serum and / or liver of HBsAg, HBeAg, antibodies to the core protein of the hepatitis B virus (antibodies to HBc) in the form of immunoglobulin M (IgM); antibodies to the surface antigen of the hepatitis B virus (antibodies to HBs), antibodies to the envelope antigen of the hepatitis B virus (antibodies to HBe) and/or HBV DNA; elevated levels of aminotransferases (<5 times ULN); ALT levels higher than AST levels; elevated bilirubin levels, prolonged prothrombin time (PT); hyperglobulinemia; the presence of non-tissue-specific antibodies such as anti-smooth muscle antibodies (ASMA) or antinuclear antibodies (ANA) (10-20%); the presence of tissue-specific antibodies, such as antibodies to thyroid cells (10-20%); elevated levels of rheumatoid factor (RF); hyperbilirubinemia, prolonged PT, low platelet and leukocyte levels, AST levels higher than ALT levels; elevated levels of alkaline phosphatase (ALP) and GGT; hepatic lobules with degenerative and regenerative hepatocellular changes and concomitant inflammation; predominantly centrilobular necrosis, both detected and not detected. Treatment can also mean prolonging survival compared to expected survival without treatment.

The term lower when applied to the level of HBV gene expression and/or HBV replication in a subject or as a marker or symptom of a disease refers to a statistically significant decrease in such level. The reduction may be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85 %, at least 90%, at least 95% or more, and preferably to a level accepted as being in the normal range for an individual without such a disorder. In some embodiments, target expression is normalized, ie. reduced to a level acceptable within the normal range for an individual without such a disorder, for example, a disease marker such as ALT or AST is reduced to a level accepted as being within the normal range for an individual without such a disorder.

As used herein, warning or warning, when used in relation to a disease, disorder, or condition that would benefit from a decrease in HBV gene expression and/or replication, refers to reducing the likelihood that a subject will develop a symptom associated with such disease,

- 35 039127 disorder or condition, for example, a symptom of an unwanted HBV infection, such as the presence of HBV cccDNA in the blood serum and/or liver, the presence of HBV DNA in the blood serum, the presence of HBV antigen in the blood serum and/or liver, for example, HBsAg and/or HBeAg, elevated ALT, elevated AST, no or low anti-HBV antibodies, liver damage; cirrhosis; delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma; serum-like syndrome; anorexia; nausea; vomiting, subfebrile body temperature; myalgia; fatigue; impaired gustatory and olfactory functions (aversion to food and cigarettes); and/or right upper quadrant and epigastric pain (episodic, mild to moderate); hepatic encephalopathy; drowsiness; sleep disorders; confusion; to whom; ascites; bleeding in the gastrointestinal tract; coagulopathy; jaundice; hepatomegaly (slightly enlarged, soft liver); splenomegaly; palmar erythema; spider hemangioma; muscle atrophy; forms of stellate angioma; vasculitis; varicose bleeding; peripheral edema; gynecomastia; testicular atrophy; expansion of the collateral veins of the abdomen (jellyfish head); high levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the range of 1000-2000 IU/ml, although values up to 100 times the upper limit of normal (ULN) may also be detected; ALT levels higher than AST levels; elevated levels of gamma-glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP) (for example, not more than 3 times the ULN); slightly reduced levels of albumin; elevated serum iron levels; leukopenia (ie granulocytopenia); lymphocytosis; increased erythrocyte sedimentation rate (ESR); reduced lifespan of erythrocytes; hemolysis; thrombocytopenia; lengthening the international normalized ratio (INR); the presence in the blood serum and / or liver of HBsAg, HBeAg, antibodies to hepatitis B core protein (antibodies to HBc) in the form of immunoglobulin M (IgM); antibodies to the surface antigen of the hepatitis B virus (antibodies to HBs), antibodies to the envelope antigen of the hepatitis B virus (antibodies to HBe) and/or HBV DNA; elevated levels of aminotransferases (<5 times ULN); ALT levels higher than AST levels; elevated bilirubin levels, prolonged prothrombin time (PT); hyperglobulinemia; the presence of non-tissue-specific antibodies such as anti-smooth muscle antibodies (ASMA) or antinuclear antibodies (ANA) (10-20%); the presence of tissue-specific antibodies, such as antibodies to thyroid cells (10-20%); elevated levels of rheumatoid factor (RF); hyperbilirubinemia, prolonged RT, low platelet and leukocyte levels, AST levels exceeding ALT levels; elevated levels of alkaline phosphatase (ALP) and GGT; hepatic lobules with degenerative and regenerative hepatocellular changes and concomitant inflammation; predominantly centrilobular necrosis, both detectable and undetected. The likelihood of developing, for example, liver fibrosis is reduced, for example, if an individual who has one or more risk factors for developing liver fibrosis, such as chronic hepatitis B, either does not develop liver fibrosis, or develops liver fibrosis with less severity of the relative group who have the same risk factors and are not receiving treatment as described in this document. Failure to develop a disease, disorder, or condition, or reduction in the development of a symptom associated with such disease, disorder, or condition (e.g., by at least about 10% of the clinically accepted scale for that disease or disorder), or delaying the onset of latent symptoms (for example, several days, weeks, months or years) is considered an effective warning.

As used herein, the expression hepatitis B virus-associated disease or HBV-associated disease means a disease or disorder that is caused by or associated with infection and/or replication of HBV. The term HBV-associated disease includes a disease, disorder, or condition that would benefit from a reduction in HBV gene expression and/or replication. Non-limiting examples of HBV-associated diseases include, for example, hepatitis D virus infection, delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma.

In one embodiment, the HBV-associated disease is an infection caused by hepatitis D virus. Hepatitis D virus or delta hepatitis virus (HDV) is a human pathogen. However, the virus is defective and depends on the obligate helper functions provided by the hepatitis B virus (HBV) for transmission; in fact, HDV requires that an associated or pre-existing HBV infection become generalized and develop, in particular, a viral envelope containing the hepatitis B surface antigen. HDV can lead to the development of severe acute and chronic forms of liver disease in association with HBV. Hepatitis D virus infection and/or delta hepatitis is highly endemic in several African countries, the Amazonian region and the Middle East, while in industrialized countries, with the exception of the Mediterranean, its prevalence is low.

Transmission of HDV can occur either by co-infection with HBV (co-infection) or co-infection with chronic hepatitis B or occur in a hepatitis B carrier state (su

- 36 039127 peri-infection). Both superinfection and coinfection with HDV result in more severe complications compared to infection with HBV alone. Such complications include a higher likelihood of liver failure in acute infections and rapid progression of liver cirrhosis with an increased likelihood of liver cancer in chronic infections. When combined with hepatitis B virus, hepatitis D has the highest mortality rate of any hepatitis infection, which is 20%.

In one embodiment, the HBV-associated disease is acute hepatitis B. Acute hepatitis B includes inflammation of the liver that lasts less than six months. Typical symptoms of acute hepatitis B are fatigue, anorexia, nausea, and vomiting. Very high aminotransferase values (>1000 IU/l) and hyperbilirubinemia are often noted. Severe cases of acute hepatitis B can rapidly progress to acute liver failure, characterized by poor synthetic liver function. It is often defined as a prothrombin time (PT) of 16 seconds or an international normalized ratio (INR) of 1.5 in the absence of prior liver disease. Acute hepatitis B can develop into chronic hepatitis B.

In one embodiment, the HBV-associated disease is chronic hepatitis. Chronic hepatitis B (CHB) involves inflammation of the liver that lasts more than six months. Subjects with chronic hepatitis B disease may be immunotolerant or have chronic infection in an inactive phase without any evidence of active disease, nor do they have any symptoms. Patients with chronic active hepatitis, especially in the replicative state, may have symptoms similar to those of acute hepatitis. Persistence of HBV infection in subjects with SNV is due to HBV cccDNA. In one embodiment, the subject with SNR is positive for HBeAg. In another embodiment, the SNR subject is HBeAg negative. Subjects with SNV have a serum HBV DNA level of less than about 105 and persistent elevations in transaminases, eg, ALT, AST, and gamma-glutamyltransferase. In a subject with SNV, a liver biopsy score may be less than about 4 (eg, a score of necroinflammatory activity). In addition, the subject with SNV may present with acute fulminant hepatitis B. In one embodiment, the HBV-associated disease is acute fulminant hepatitis B. The subject with acute fulminant hepatitis B has symptoms of acute hepatitis and additional symptoms of confusion or coma (due to the inability of the liver to neutralize toxic chemicals) and bruising or bleeding (due to lack of clotting factors).

Subjects with an HBV infection, such as SNV, may develop hepatic fibrosis. Accordingly, in one embodiment, the HBV-associated disease is hepatic fibrosis. Liver fibrosis or cirrhosis is defined by histological analysis as a diffuse hepatic process characterized by fibrosis (an excess of coarse fibrous connective tissue) and the transformation of the normal structure of the liver into structurally abnormal nodes.

Subjects with an HBV infection, such as SNV, may develop end-stage liver disease. Accordingly, in one embodiment, the HBV-associated disease is end-stage liver disease. For example, liver fibrosis may progress to a level where the body can no longer compensate for, for example, reduced liver function resulting from liver fibrosis and lead to, for example, mental and neurological symptoms and liver failure.

Subjects with an HBV infection, such as SNV, may develop hepatocellular carcinoma (HCC), also known as malignant hepatoma. Accordingly, in one embodiment, the HBV-associated disease is HCC. HCC usually develops in subjects with SNV and may be fibrolamellar, pseudoglandular (adenoid), pleomorphic (giant cell), or clear cell.

An HDV-associated disorder or a hepatitis D virus-associated disorder is a disease or disorder associated with HDV expression. Illustrative HDV-associated disorders include hepatitis B virus infection, acute hepatitis B, acute hepatitis D; acute fulminant hepatitis D; chronic hepatitis D; liver fibrosis; end-stage liver disease; and hepatocellular carcinoma.

A therapeutically effective amount as used herein is understood to include an amount of an RNAi agent that, when administered to a patient to treat a subject with an HBV infection and/or an HBV associated disease, is sufficient to effectively treat the disease (e.g., by reducing, attenuating the severity of an existing disease or one or more symptoms of a disease or maintenance of an organism in an existing disease). The therapeutically effective amount may vary depending on the RNAi agent, the route of administration of the agent, the disease and its severity and history of the disease, age, weight, family history, genetic characteristics, stage of disease processes mediated by HBV gene expression, types of previous or concomitant treatment, if the presence of such, and other indie

- 37 039127 visual features of the patient to be treated.

A prophylactically effective amount as used herein is meant to include an amount of an RNAi agent which, when administered to a subject who has not yet developed or exhibited symptoms of an HBV infection and/or an HBV-associated disease, but who may be predisposed to the disease, sufficient to prevent or reduce the severity of the disease or one or more symptoms of the disease. Reducing the severity of the disease includes slowing down the course of the disease or reducing the severity of the disease that will develop later. The prophylactically effective amount may vary depending on the RNAi agent, the route of administration of the agent, the degree of risk of developing the disease and the history of the disease, age, weight, family history, genetic characteristics, types of previous or concomitant treatment, if any, and other individual characteristics of the patient, which is to be treated.

A therapeutically effective amount or a prophylactically effective amount also includes an amount of an RNAi agent that produces some desired local or systemic effect at an acceptable benefit/risk ratio with respect to any treatment. The RNAi agents used in the methods of the present invention may be administered in an amount sufficient to obtain an acceptable benefit/risk ratio for such treatment.

The term sample as used herein includes a collection of similar fluids, cells, or tissues isolated from a subject's body, as well as fluids, cells, or tissues present in a subject's body. Examples of biological fluids include blood, blood serum and serous fluids, blood plasma, cerebrospinal fluid, intraocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or local areas. For example, samples can be obtained from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be obtained from the liver (e.g., the entire liver, or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes), the retina or part of the retina (e.g., the retinal pigment epithelium), the central nervous system or parts of the central nervous system (for example, the ventricles or choroid plexus) or the pancreas or certain cells or parts of the pancreas. In some embodiments, the subject-derived sample refers to cerebrospinal fluid obtained from the subject. In preferred embodiments, the implementation of the sample obtained from the subject means blood or blood plasma taken from the subject. In additional embodiments, the subject-derived sample refers to liver tissue (or constituents thereof) or retinal tissue (or constituents thereof) derived from the subject.

II. iRNA according to the present invention.

The present invention provides iRNAs that inhibit the expression of one or more HBV genes. In one embodiment, the iRNA-based agent includes double-stranded ribonucleic acid (dsRNA) molecules for inhibiting HBV gene expression in a cell, such as a cell within a subject, e.g., a mammal, such as a human, with an HBV-associated disease, e.g., chronic hepatitis B The .dsRNA includes an antisense strand with a complementary region that is complementary to at least a portion of the mRNA generated by expression of the HBV gene. The length of the complementarity region is about 30 nucleotides or less (eg, the length is about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less). When contacted with a cell expressing the HBV gene, the iRNA inhibits the expression of the HBV gene by at least about 10%, as determined by analysis, for example, by PCR, or by a branched DNA (bDNA) method, or by a method based on protein analysis, such as by immunofluorescence analysis using, for example, Western blotting or flow cytometry techniques.

dsRNA contains two strands of RNA that are complementary and hybridize to form a duplex structure under the conditions under which the dsRNA will be used. One strand of dsRNA (antisense strand) contains a complementary region that is essentially complementary and usually fully complementary to the target sequence. The target sequence can be obtained from the mRNA sequence generated during the expression of the HBV gene. The other strand (the sense strand) contains a region that is complementary to the antisense strand such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, complementary dsRNA sequences can also be contained as self-complementary regions of a single nucleic acid molecule, rather than being located on separate oligonucleotides.

Usually the length of the duplex structure is from 15 to 30 base pairs, for example, the length is 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15- 21, 15-20, 15-19, 15-18, 15-17, 18-30, 1829, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-38 039127

24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 2129, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Range and length values intermediate to the range and length values listed above are also considered part of the present invention.

Similarly, the length of the complementarity region for the target sequence is from 15 to 30 nucleotides, for example, the length is 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18- 23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides. Range and length values intermediate to the range and length values listed above are also considered part of the present invention.

In some embodiments, the dsRNA is about 15 to about 20 nucleotides in length, or about 25 to about 30 nucleotides in length. Typically, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, as is well known in the art, dsRNAs greater than about 21-23 nucleotides in length can serve as substrates for Dicer. It will also be appreciated by one skilled in the art that the region of RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where appropriate, part of the target mRNA is a contiguous target mRNA sequence of sufficient length to allow it to be a substrate for RNAi-directed cleavage (ie, cleavage via the RISC pathway).

One of skill in the art will also appreciate that a duplex region is a major functional portion of a dsRNA, e.g., a duplex region of about 9-36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 1235, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 1433, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 1530, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18- 30, 18-29, 1828, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19- 28, 19-27, 19-26, 19-25, 19-24, 1923, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20- 26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-

28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 bp. Thus, in one embodiment, to the extent that they become processed into a functional duplex of, for example, 15-30 base pairs, which targets the desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region larger than 30 base pairs are dsRNA. Thus, one skilled in the art will understand that in one embodiment, the miRNA is a dsRNA. In another embodiment, the dsRNA is a non-natural miRNA. In another embodiment, the iRNA-based agent useful for targeting HBV gene expression is not produced in the target cell by cleavage of the larger dsRNA.

The dsRNA described herein may further comprise one or more single-stranded nucleotide overhangs, eg, 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang may have surprisingly superior inhibitory properties compared to their blunt-ended counterparts. The nucleotide overhang may comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) end(s) may be within the sense strand, the antisense strand, or a combination thereof. In addition, the overhang nucleotide(s) may be present at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA.

dsRNA can be synthesized using standard methods known in the art, discussed further below, for example using an automated DNA synthesizer such as commercially available from, for example, Biosearch, Applied Biosystems, Inc.

Compounds based on iRNA of the present invention can be obtained using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are obtained separately. The constituent threads are then annealed. Single strands of the siRNA compound can be prepared using liquid phase synthesis or solid phase organic synthesis, or both. Organic synthesis has the advantage that oligonucleotide strands containing unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the present invention can be obtained using liquid phase or solid phase organic synthesis, or both.

In one aspect, the dsRNA of the present invention contains at least two nucleotide sequences, a sense sequence and an antisense sequence. The semantic thread is selected from the group of sequences given in any of the tables. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26, and the corresponding antisense strand for the sense strand is selected from a group of sequences from any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25, and 26. In this aspect, one of the two sequences is complementary to the other of the two sequences, one of the sequences being essentially complementary to the mRNA sequence generated when expressing the HBV gene. In this regard, in this aspect, dsRNA will contain two oligonucleotides, where one oligonucleotide is described as a sense strand in any of the tables. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26, and the second oligonucleotide is described as the corresponding antisense strand for the sense strand in any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25, and 26. In one embodiment, substantially complementary dsRNA sequences are contained in separate oligonucleotides. In another embodiment, substantially complementary dsRNA sequences are contained in a single oligonucleotide.

It will be understood that while some of the sequences in Table. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26 are described as modified and/or conjugated sequences, RNA from among the iRNA of the present invention, for example, dsRNA of the present invention, may contain any of the sequences set out in Table. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26 which is unmodified, unconjugated and/or modified and/or conjugated in a manner other than described therein.

It is well known to one skilled in the art that dsRNAs with a duplex structure of approximately 20-23 base pairs, e.g. 21 base pairs, have been found to be particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877 -6888). However, other researchers have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the above embodiments, according to the nature of the oligonucleotide sequences listed in any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25, and 26, the dsRNAs described herein may contain at least one strand that is at least 21 nucleotides in length. With sufficient probability, we can assume that shorter duplexes with one of the sequences from any of the tables. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26, with the exception of only a few nucleotides at one or both ends, can be effective, similar to the dsRNAs described above. Therefore, dsRNA with a sequence of at least 15, 16, 17, 18, 19, 20 or more contiguous nucleotides derived from one of the sequences in any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25, and 26, and differing in their ability to inhibit HBV gene expression by no more than about 5, 10, 15, 20, 25, or 30% inhibition from dsRNA, containing the complete sequence are considered to be within the scope of the present invention.

In addition, the RNA listed in any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26 identify site(s) in the HBV transcript that are susceptible to RISC-mediated cleavage. Thus, the present invention further provides iRNAs that target one of these sites. For the purposes of this document, an iRNA is said to target a particular site on an RNA transcript if the iRNA promotes cleavage of the transcript anywhere at that particular site. Such an iRNA will typically contain at least about 15 contiguous nucleotides from one of the sequences shown in any of the tables. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26, connected with additional nucleotide sequences taken from the region adjacent to the selected sequence in the HBV gene.

While the target sequence is typically about 15-30 nucleotides in length, there is a wide range of suitability for specific sequences in this range to direct the cleavage of any given target RNA. The various software packages and principles outlined herein provide guidance on identifying the optimal target sequences for any given target gene, but an empirical approach can also be taken in which a window or mask of a given size (21 nucleotides as a non-limiting example) is literally or figuratively (including, for example, in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By gradually moving the sequence window one nucleotide up or down from the starting position of the target sequence, the next potential target sequence can be identified until the full set of possible sequences for any given selected target size is identified. Using this method, in combination with systemic synthesis and testing of identified sequences (using assays described herein or known in the art) to identify sequences with optimal characteristics, it is possible to identify those RNA sequences that, when targeted with an iRNA-based agent, mediate the best inhibition of target gene expression. Thus, despite the fact that the identified sequence, for example, in any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25, and 26 are effective target sequences, it is expected that further optimization of inhibition efficiency can be achieved by gradually moving the window one nucleotide up or down from the target sequences for identification

- 40 039127 sequences with the same or better inhibition characteristics.

In addition, it is also assumed that for any identified sequence, for example, in any of the table. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26, further optimization can be achieved by systematically either adding or deleting nucleotides to produce longer or shorter sequences and testing those sequences obtained by moving the window , longer or shorter in size, above or below the target RNA at a given point. Also as a result of combining this approach to generate new candidate targets, together with testing the effectiveness of iRNA based on these target sequences in an inhibition assay known in the art or described herein, there may be further improvements in the effectiveness of inhibition. Moreover, such optimized sequences can be adjusted by, for example, introducing modified nucleotides as described herein or known in the art, adding or changing an overhang, or other modifications known in the art and/or described herein for further optimization of the molecule (e.g., increased serum stability or circulating half-life, increased thermal stability, improved transmembrane delivery, targeting a specific position or specific cell type, increased interaction with silencing pathway enzymes, increased release from endosomes) as an expression inhibitor.

An iRNA, as described herein, may contain one or more mismatches with the target sequence. In one embodiment, the iRNA described herein contains no more than 3 mismatches. If the iRNA antisense strand mismatches the target sequence, it is preferable that the mismatch region is not in the center of the complementarity region. If the iRNA antisense strand contains mismatches with the target sequence, it is preferred that the mismatch be limited to the last 5 nucleotides from either the 5' or 3' end of the complementarity region. For example, in the case of a 23 bp iRNA-based agent, the strand complementary to the HBV gene region typically does not contain any mismatch within the central 13 bp. The methods described herein, or methods known in the art, can be used to determine whether an iRNA containing a mismatched base relative to a target sequence is effective in inhibiting HBV gene expression. Consideration of the effectiveness of mismatched iRNAs in inhibiting HBV gene expression is important, especially if a particular complementarity site in the HBV gene is known to be characterized by population variability in polymorphic sequences.

III. Modified iRNAs of the present invention.

In one embodiment, the RNA from among the iRNAs of the present invention, for example, dsRNA, is unmodified and does not contain, for example, chemical modifications and/or conjugations known in the art and described in this document. In another embodiment, an RNA from among the iRNAs of the present invention, for example, dsRNA, is chemically modified to improve stability or other useful characteristics. In certain embodiments of the present invention, substantially all of the iRNA nucleotides of the present invention are modified. In other embodiments of the present invention, all nucleotides in the iRNA of the present invention are modified. iRNAs of the present invention in which essentially all nucleotides are modified are substantially but not completely modified and may contain no more than 5, 4, 3, 2, or 1 unmodified nucleotide.

The nucleic acids described in the present invention can be synthesized and/or modified using methods well known in the art, such as those described in Current protocols in nucleic acid chemistry, Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5' end modifications (phosphorylation, conjugation, inverted bonds) or 3' end modifications (conjugation, DNA nucleotides, inverted bonds, etc.); base modifications, for example, substitution with stabilizing bases, destabilizing bases or bases that form a base pair with an extended partner repertoire, base deletion (nucleotides with a nitrogenous base removed), or base conjugation; sugar modifications (eg, at the 2'-position or 4'-position) or sugar substitution and/or backbone modifications, including modification or replacement of phosphodiester linkages. Specific examples of iRNA-based compounds useful in the embodiments described herein include, without limitation, RNAs containing modified backbones or non-naturally occurring internucleoside bonds. Backbone-modified RNAs include, among others, those that do not contain a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referred to in the art, modified RNAs that do not contain a phosphorus atom in their internucleoside backbone may also be considered oligonucleosides. In some embodiments

- 41 039127 the modified iRNA will contain a phosphorus atom in its internucleoside backbone.

Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates, and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters and boranophosphates with normal 3'-5'-bonds, their analogues with 2'-5'-bonds, as well as those with inverted polarity, where adjacent pairs of nucleoside units are connected in the direction from 3'-5 ' to 5'-3' or from 2'-5' to 5'-2'. Also included are various salts, mixed salts, and free acid forms.

Illustrative US patents, which set out the idea of obtaining the above phosphorus-containing bonds, include, without limitation, US patent No. 3687808; 4469863; 4476301; 5023243;

5177195; 5188897; 5264423; 5276019; 5278302; 5286717; 5321131; 5399676; 5405939; 5453496; 5455233;

5466677; 5476925; 5519126; 5536821; 5541316; 5550111; 5563253; 5571799; 5587361; 5625050; 6028188;

6124445; 6160109; 6169170; 6172209; 6239265; 6277603; 6326199; 6346614; 6444423; 6531590; 6534639;

6608035; 6683167; 6858715; 6867294; 6878805; 7015315; 7041816; 7273933; 7,321,029 and US Patent RE39464, the entire contents of which are incorporated herein by reference.

Modified RNA backbones that do not contain a phosphorus atom in their composition are backbones formed by short chain alkyl or cycloalkyl internucleoside bonds, mixed heteroatomic and alkyl or cycloalkyl internucleoside bonds, or one or more short chain heteroatomic or heterocyclic internucleoside bonds. These include backbones with morpholine bonds (formed in part from the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; foracetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimine and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones and others containing a mixture of constituent parts N, O, S and CH ₂ .

Illustrative US patents, which set out the idea of obtaining the above oligonucleosides, include, without limitation, US patent No. 5034506; 5166315; 5185444; 5214134; 5216141; 5235033; 564562; 5264564; 5405938; 5434257; 5466677; 5470967; 5489677; 5541307; 5561225; 5596086; 5602240; 5608046; 5610289; 5618704; 5623070; 5663312; 5633360; 5677437 and 5677439, the entire contents of which are hereby incorporated herein by reference.

In other embodiments, suitable RNA mimetics for use in iRNA are contemplated, in which both the sugar and the internucleoside bond, ie. backbone of nucleotide units, replaced by new groups. The base units are retained for hybridization with the corresponding target nucleic acid compound. One such oligomeric compound, an RNA mimetic, which has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the RNA sugar backbone is replaced by an amide-containing backbone, in particular, an aminoethylglycine backbone. Nucleotide bases are retained and bind directly or indirectly to the nitrogen atoms of the aza group of the amide backbone. Illustrative US patents that teach the idea of making PNA compounds include, without limitation, US Pat. Nos. 5,539,082; 5714331 and 5719262, the entire contents of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

Some embodiments provided in the present invention include RNA with phosphorothioate backbones and oligonucleosides with heteroatomic backbones and in particular CH2--NH-CH2-, --CH2--N (CH ₃ )--O--CH ₂ - - [known as methylene (methylimine) or MMI backbone], --CH2--O-- _N (CH 3 )--CH ₂ --, --CH ₂ --N(CH ₃ )--N(CH ₃ )--CH ₂ -- and --N(CH ₃ )--CH ₂ --CH ₂ -- [wherein the native phosphodiester backbone is represented as --O--P--O--CH ₂ --] according to the above US Pat. No. 5,489,677 and amide backbones of the aforementioned US Pat. No. 5,602,240. In some embodiments, the RNAs provided herein have morpholine backbone structures of the aforementioned US Pat. No. 5,034,506.

Modified RNAs may also contain one or more substituted sugar moieties. iRNAs, eg dsRNAs provided herein may contain one of the following at the 2' position: OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl or Oalkyl-O-alkyl, where alkyl, alkenyl and alkynyl may be substituted or unsubstituted by C1-C10 alkyl or C ₂ -C ₁₀ alkenyl and alkynyl. Illustrative suitable modifications include O [(CH ₂ )nO] _and CH3, O _{(CH 2 ) nON} [(CH ₂ )nCH3)] ₂ , where n and t are from 1 to about 10. In other embodiments, the dsRNAs include one of the following at the 2' position: C1- _C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl , O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH3, SO ₂ CH ₃ , ONO2, NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted

- 42 039127 silyl, RNA cleaving group, reporter group, intercalator, group for improving the pharmacokinetic properties of iRNA or group for improving the pharmacodynamic properties of iRNA and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O--CH ₂ CH ₂ OCH ₃ , also known as 2'-O-(2-methoxyethyl) or 2'MOE) (Martin et al., Helv Chim Acta, 1995, 78:486-504) i.e. an alkoxy-alkoxy group. Another illustrative modification is 2'-dimethylaminooxyethoxy, i.e. the O(CH ₂ ) ₂ ON(CH ₃ ) ₂ group, also known as 2'-DMAOE, described in the examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2 '-DMAEOE), i.e. 2'-O--CH ₂ -O--CH2--N(CH2)2.

Other modifications include 2'-methoxy (2'-OCH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH ₂ NH ₂ ) and 2'fluoro (2'-F). Similar modifications can also be made at other positions in iRNA RNA, in particular at the 3' position of the sugar in the 3'-terminal nucleotide or in dsRNA with 2'-5' bonds and at the 5'-position of the 5'- terminal nucleotide. iRNAs can also contain sugar mimetics, such as cyclobutyl moieties, instead of pentofuranosyl sugar. Illustrative US patents that teach the idea of making such modified sugar structures include, without limitation, US Pat. Nos. 4,4981,957; 5118800; 5319080; 5359044; 5393878; 5446137; 5466786; 5514785; 5519134; 5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5658873; 5670633 and 5700920, some of which have a common applicant with this application. The entire contents of each of the aforementioned sources are hereby incorporated herein by reference.

An iRNA may also contain modifications or substitutions of a nucleotide base (often referred to in the art simply as a base). As used herein, unmodified or natural nucleotide bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleotide bases include other synthetic and natural nucleotide bases such as deoxythymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl- and other adenine alkyl derivatives and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenuracil and cytosine, 5-propinyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil ), 4-thiouracil, 8halo-, 8-amino-, 8-thiol-, 8-thioalkyl-, 8-hydroxyl- and other 8-substituted adenines and guanines, 5halo-, in particular 5-bromo-, 5-trifluoromethyl - and other 5-substituted compounds of uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, as well as 3deazaguanine and 3-deazaadenine. Additional nucleotide bases include those disclosed in US Pat. No. 3,687,808, disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.L., ed. John Wiley & Sons, 1990, disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and disclosed in Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Some of these nucleotide bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2-, N-6-, and O-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press , Boca Raton, 1993, p. 276-278) and are exemplary base substitutions, even more specifically in combination with 2'-O-methoxyethyl sugar modifications.

Illustrative US patents that set out the idea of obtaining some of the above modified nucleotide bases, as well as other modified nucleotide bases, include, without limitation, the above US patent No. 3687808; 4845205; 513030; 5134066; 5175273; 5367066; 5432272; 5457187; 5459255; 5484908; 5502177; 5525711; 5552540; 5587469; 5594121; 5596091; 5614617; 5681941; 5750692; 6015886; 6147200; 6166197; 6222025; 6235887; 6380368; 6528640; 6639062; 6617438; 7045610; 7427672 and 7495088, the entire contents of which are incorporated herein by reference.

An iRNA RNA can also be modified to contain one or more bicyclic sugar moieties. A bicyclic sugar is a furanosyl ring modified by bridging two atoms. A bicyclic nucleoside (BNA) is a nucleoside with a sugar moiety containing a bridge connecting two carbon atoms of the sugar ring, thus forming a bicyclic ring system. In certain embodiments, the implementation of the bridge connects the 4'-carbon atom and 2'-carbon atom in the sugar ring. Thus, in some embodiments, the agent of the present invention may comprise one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide containing a modified ribose fragment, where the ribose fragment contains an additional bridge connecting the 2' and 4' carbon atoms. Others

- 43 039127 words, LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively locks the ribose into the 3'endo structural conformation. The addition of locked nucleic acids to siRNA has been shown to increase the stability of siRNA in serum and reduce the number of off-target effects (Elmen, J. et al. (2005) Nucleic Acids Research 33 (1): 439-447; Mook, OR. et al. (2007) Mol Cane Ther 6 (3): 833-843 Grunweller, A. et al (2003) Nucleic Acids Research 31 (12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the present invention include, without limitation, nucleosides containing a bridge between the 4' and 2' ring atoms of the ribosyl residue. In certain embodiments, the antisense polynucleotide agents of the present invention comprise one or more bicyclic nucleosides containing a 4'-2' bridge. Examples of such 4'-2' bridged bicyclic nucleosides include, without limitation, 4'-(CH ₂ )-O-2'(LNA);4'-(CH ₂ )-S-2';4'-(CH ₂ ) ₂ -O-2'(ENA);4'CH(CH ₃ )-O-2' (also called conformationally hindered by ethyl or cEt) and 4'CH(CH ₂ OCH ₃ )-0-2' (and its analogs; see, for example, US patent No. 7399845 ); 4'-C(CH ₃ )(CH ₃ )-O-2' (and its analogues; see, for example, US patent No. 8278283); 4'-CH ₂ -N(OCH ₃ )-2' (and its analogues; see, for example, US patent No. 8278425); 4'-CH ₂ -ON(CH ₃ )-2' (see, for example, US Patent Publication No. 2004/0171570); 4'-CH2-N(R)-O-2', where R represents H, C1-C ₁₂ -alkyl or a protective group (see, for example, US patent No. 7427672); 4'-CH2-C(H)(CH3)-2' (see e.g. Chattopadhyaya et al., J. Dep. Chem., 2009, 74, 118134); and 4'-CH ₂ -C(=CH ₂ )-2' (and its analogues; see, for example, US patent No. 8278426). The entire contents of each of the aforementioned sources are hereby incorporated herein by reference.

Additional illustrative US patents and US patent publications that teach the idea of making locked nucleic acid nucleotides include, without limitation, the following: US Pat. Nos. 6,268,490; 6525191; 6670461; 6770748; 6794499; 6998484; 7053207; 7034133;7084125; 7399845; 7427672; 7569686; 7741457; 8022193; 8030467; 8278425; 8278426; 8278283; US 2008/0039618 and US 2009/0012281, the entire content of each of which is incorporated herein by reference.

Any of the above bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and βD-ribofuranose (see WO 99/14226).

An iRNA RNA can also be modified to contain one or more ethyl-hindered nucleotides. As used herein, an ethyl hindered nucleotide or cEt is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH ₃ )-O-2' bridge. In one embodiment, the ethyl hindered nucleotide is in the S conformation, referred to herein as S-cEt.

The iRNA of the present invention may also contain one or more conformationally restricted nucleotides (CRNs). CRNs are nucleotide analogs with a linker connecting the C2' and C4' carbons of the ribose or the C3 and C5' carbons of the ribose. CRN locks the ribose ring into a stable conformation and increases the affinity of hybridization to mRNA. The linker is long enough to place the oxygen atom in an optimal position for stability and affinity, resulting in less wrinkling of the ribose ring.

Illustrative publications that outline the idea of obtaining some of the above CRNs include, without limitation, US Patent Publication No. 2013/0190383 and PCT Publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference.

One or more nucleotides of the iRNA of the present invention may also include a hydroxymethyl-substituted nucleotide. The hydroxymethyl substituted nucleotide is an acyclic 2'-3' seconucleotide, also known as a modification called unlocked nucleic acid (UNA).

Illustrative US publications that outline the idea of making UNA include, without limitation, US Patent No. 8,314,227 and US Patent Publication No. 2013/0096289; 2013/0011922 and 2011/0313020, the entire contents of which are incorporated herein by reference.

Potentially stabilizing modifications at the ends of RNA molecules may include N(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-caproyl-4-hydroxyprolinol (Hyp-C6), N-acetyl-4-hydroxyprolinol (Hyp-NHAc) , thymidine-2'-O-deoxythymidine (ether), N(aminocaproyl)-4-hydroxyprolinol (Nur-C6-amino), 2-docosanoyluridine-3-phosphate, inverted base dT (idT), etc. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

Other iRNA nucleotide modifications of the present invention include a 5'-phosphate or 5'-phosphate mimetic, eg, a 5'-phosphate or phosphate mimetic on the antisense strand of the RNAi agent. Suitable phosphate mimetics are disclosed, for example, in US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.

A. Modified iRNAs containing motifs from the present acquisition In some as

The double-stranded RNAi agents of the present invention include chemically modified agents as disclosed, for example, in WO 2013/075035, filed Nov. 16, 2012, the entire contents of which are incorporated herein by reference. As shown herein and in PCT Publication No. WO 2013/075035, an excellent result can be obtained by introducing one or more motifs with three identical modifications of three consecutive nucleotides into the sense strand and/or antisense strand of an RNAi agent, in particular into cleavage site or near it. In some embodiments, the sense strand and the antisense strand of the RNAi agent may be otherwise completely modified. The introduction of such motifs breaks the modification pattern, if any, of the sense and/or antisense strand. An RNAi agent, such as a sense strand, may optionally be conjugated to a GalNAc derived ligand. The resulting RNAi agents have excellent gene silencing activity.

More specifically, it has surprisingly been found that in cases where the sense strand and antisense strand of a double-stranded RNAi agent are completely modified to have one or more motifs with three identical modifications of three consecutive nucleotides in the cleavage site of at least one strand of the RNAi agent or close to it, then the gene silencing activity of the RNAi agent was best enhanced.

Accordingly, the present invention provides double-stranded RNAi agents capable of inhibiting the expression of a target gene (ie, the HBV gene) in vivo. The RNAi tool contains a sense strand and an antisense strand. The length of each strand of the RNAi agent can vary from 12 to 30 nucleotides. For example, the length of each strand may be 14 to 30 nucleotides, 17 to 30 nucleotides, 25 to 30 nucleotides, 27 to 30 nucleotides, 17 to 23 nucleotides, 17 to 21 nucleotides, 17 to 19 nucleotides, 19 to 25 nucleotides, 19 to 23 nucleotides, 19 to 21 nucleotides, 21 to 25 nucleotides, or 21 to 23 nucleotides.

The sense strand and antisense strand typically form a double-stranded RNA duplex (dsRNA), also referred to herein as an RNAi vehicle. The duplex region of the RNAi agent may be 12-30 bp in length. For example, the length of the duplex region may be 14-30 bp, 17-30 bp, 27-30 bp, 17-23 bp, 17-21 bp, 17-19 bp, 19-25 bp, 19 -23 bp, 19-21 bp, 21-25 bp, or 21-23 bp. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 27 nucleotides in length.

In one embodiment, the RNAi agent may comprise one or more overhangs and/or capping groups at the 3' end, 5' end, or both ends of one or both strands. The length of the overhang can be 1-6 nucleotides, such as 2-6 nucleotides, 1-5 nucleotides, 2-5 nucleotides, 1-4 nucleotides, 2-4 nucleotides, 1-3 nucleotides, 2-3 nucleotides, or 1-2 nucleotides. . The protruding ends may be due to one strand being longer than the other, or may be due to two strands of the same length being offset. The protruding end may form a mismatch with the target mRNA, or it may be complementary to the target gene sequences or may have a different sequence. The first and second strands can also be connected, for example, with additional bases to form a hairpin or with other base-free linkers.

In one embodiment, each of the nucleotides in the overhang of the RNAi agent can independently be a modified or unmodified nucleotide, including but not limited to a 2'-modified sugar such as 2-F, 2'-O-methyl, thymidine ( T), 2'-Omethoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof. For example, the overhang sequence at both ends of each strand may be a TT. The protruding end may form a mismatch with the target mRNA, or it may be complementary to the target gene sequences or may have a different sequence.

The 5' or 3' overhangs of the sense strand, the antisense strand, or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang(s)(s) comprise(s) comprise two nucleotides with a phosphorothioate between the two nucleotides, the two nucleotides being the same or different. In one embodiment, the overhang is present at the 3' end of the sense strand, the antisense strand, or both. In one embodiment, this 3' overhang is present in the antisense strand. In one embodiment, this 3' overhang is present in the sense strand.

The RNAi agent may contain only one overhang, which can increase the interfering activity of the RNAi without affecting its overall stability. For example, the single-stranded overhang may be located at the 3' end of the sense strand, or alternatively at the 3' end of the antisense strand. RNAi can also have a blunt end located at the 5' end of the antisense strand (or 3' end of the sense strand) or vice versa. Typically, the RNAi antisense strand has a nucleotide overhang at the 3' end and the 5' end is a blunt end. Not

- 45 039127 limited by any theory, it is believed that the asymmetric blunt end at the 5' end of the antisense strand and the 3' overhang of the antisense strand contribute to the inclusion of the guide strand in the process involving RISC.

In one embodiment, the RNAi agent is a blunt-ended oligonucleotide 19 nucleotides in length, where the sense strand contains at least one motif of three 2'-F modifications of three consecutive nucleotides at positions 7, 8, 9 from 5 '-end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In another embodiment, the RNAi agent is a 20 nucleotide long double blunt oligonucleotide, where the sense strand contains at least one motif of three 2G modifications of three consecutive nucleotides at positions 8, 9, 10 from the 5' end . The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In another embodiment, the RNAi agent is a blunt-ended oligonucleotide 21 nucleotides in length, where the sense strand contains at least one motif of three 2'-F modifications of three consecutive nucleotides at positions 9, 10, 11 from 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2'-P modifications of three consecutive nucleotides at positions 9, 10, 11 from 5' - end; the antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end, where one end of the RNAi agent is blunt while the other end contains a ridge from 2 nucleotides. Preferably, a 2 nucleotide overhang is located at the 3' end of the antisense strand.

In cases where a 2-nucleotide overhang is at the 3' end of the antisense strand, there may be two phosphorothioate internucleotide bonds between the three terminal nucleotides, with two of the three nucleotides being overhang nucleotides and the third nucleotide being the paired nucleotide following the overhang. . In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide bonds between the terminal three nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand. In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of the motifs, is a modified nucleotide. In one embodiment, each residue is independently modified with 2'-O-methyl or 3'fluoro, eg in an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc ₃ ). In one embodiment, the RNAi agent comprises a sense and an antisense strand, where the sense strand is 25-30 nucleotide residues long, in which, starting at the 5'-terminal nucleotide (position 1), positions 1-23 of the first strand contain at least 8 ribonucleotides; the length of the antisense strand is 36-66 nucleotide residues and, starting from the 3'-terminal nucleotide, contains at least 8 ribonucleotides in positions paired with positions 1-23 of the sense strand to form a duplex; where at least the 3'-terminal nucleotide of the antisense strand is unpaired with the sense strand and up to 6 consecutive 3'-terminal nucleotides are unpaired with the sense strand, thereby forming a 3'-single-strand overhang of 1-6 nucleotides; where the 5'-end of the antisense strand contains from 10-30 consecutive nucleotides unpaired with the sense strand, thereby forming a 5'-single-stranded overhang of 10-30 nucleotides; where at least the 5'-terminal and 3'-terminal nucleotides of the sense strand are base paired with nucleotides of the antisense strand, while the sense and antisense strands are aligned for maximum complementarity, thereby forming, in fact, a duplex region between the sense and antisense strands; and the antisense strand is sufficiently complementary to the target RNA for at least 19 ribonucleotides of the antisense strand in length to reduce expression of the target gene when the double-stranded nucleic acid is introduced into a mammalian cell; and where the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides, where at least one of the motifs is at or near the cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at or near the cleavage site.

In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the RNAi agent comprises a first strand that is at least 25 and not more than 29 nucleotides long and a second strand that is not more than 30 nucleotides long, at least with one motif of three 2'-O-methyl modifications of three consecutive nucleotides at position 11, 12, 13 from the 5' end; where the 3'-end of the first strand and the 5'-end of the second strand form a blunt end, and the second strand at its 3'-end is 1-4 nucleotides longer than the first strand, where the length of the duplex region is

- 46 039127 at least 25 nucleotides, and the second strand is sufficiently complementary to the target mRNA for at least 19 nucleotides of the length of the second strand, to reduce the expression of the target gene, where the agent for RNAi is introduced into a mammalian cell, and where the cleavage of the agent for RNAi using Dicer preferably results in siRNA containing the 3'-end of the second strand, thereby providing a decrease in the expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

In one embodiment, the sense strand of the RNAi agent contains at least one motif with three identical modifications of three consecutive nucleotides, where one of the motifs is at a cleavage site in the sense strand.

In one embodiment, the antisense strand of the RNAi agent may also contain at least one motif with three identical modifications of three consecutive nucleotides, where one of the motifs is at or near a cleavage site in the sense strand.

For an RNAi agent with a duplex portion that is 17-23 nucleotides in length, the antisense strand cleavage site is typically located approximately 10, 11 and 12 positions from the 5' end. Thus, motifs with three identical modifications can be in positions 9, 10, 11; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions or 13, 14, 15 positions of the antisense strand, while counting starts from the 1st nucleotide from the 5' end of the antisense strand, or the count starts from the 1st paired nucleotide in the duplex region from the 5' end antisense strand. The cleavage site in the antisense strand may also vary according to the length of the RNAi agent duplex from the 5' end.

The sense strand of the RNAi agent may contain at least one motif with three identical modifications of three consecutive nucleotides at the strand cleavage site; and the antisense strand may have at least one motif with three identical modifications of three consecutive nucleotides at or near the strand cleavage site. In cases where the sense strand and antisense strand form a dsRNA duplex, the sense strand and antisense strand can be aligned such that one three nucleotide motif in the sense strand and one three nucleotide motif in the antisense strand have at least one nucleotide overlap. , i.e. at least one of the three motif nucleotides in the sense strand base pairs with at least one of the three motif nucleotides in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

In one embodiment, the sense strand of the RNAi agent may contain multiple motifs with three identical modifications of three consecutive nucleotides. The first motif may be at or near the cleavage site of the strand, and the other motifs may be a flanking modification. The term flanking modification as used herein refers to a motif located in another part of a strand that is separated from or adjacent to a motif at a cleavage site in the same strand. The flanking modification is either adjacent to the first motif or separated by at least one or more nucleotides. In cases where the motifs are directly adjacent to each other, the chemical structure of the motifs differs from each other, and if the motifs are separated by one or more nucleotides, then the chemical structures may be the same or different. Two or more flanking modifications may be present. For example, if two flanking modifications are present, then each flanking modification may occur at one end relative to the first motif, which is at or near the cleavage site, or on both sides of the main motif.

Like the sense strand, the antisense strand of the RNAi agent may contain multiple motifs with three identical modifications of three consecutive nucleotides, with at least one of the motifs located at or near the strand's cleavage site. A given antisense strand may also contain one or more flanking modifications, in alignment similar to flanking modifications, that may be present in the sense strand.

In one embodiment, the flanking modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

In another embodiment, the flanking modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.

Where the sense strand and antisense strand of the RNAi agent each contain at least one flanking modification, then the flanking modifications may fall on the same end of the duplex region and have an overlap of one, two, or three nucleotides.

In cases where the sense strand and the antisense strand of the RNAi agent each contain at least two flanking modifications, then the sense strand and the antisense strand can be aligned such that two modifications, each from the same strand, fall at one end of the duplex region with an overlap of one, two or three nucleotides; two modifications, each from one strand, fall on the other end of the duplex region with an overlap of one, two or three nucleotides; two modifications of one strand fall on either side of the main motif with an overlap of one, two, or three nucleotides in the duplex region.

In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modifications, which may include one or more changes to one or both non-phosphate-bound oxygens and/or one or more phosphate-bound oxygens; changing the ribose sugar component, for example, the 2'-hydroxyl in the ribose sugar; complete replacement of the phosphate moiety with dephosphorylated linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose phosphate backbone.

Since nucleic acids are polymers of subunits, many modifications occur at a position that is repeated within the nucleic acid, such as modification of a base, or a phosphate moiety, or a non-bonding O atom of a phosphate moiety. In some cases, the modification will be at all of the considered positions in the nucleic acid, but in many cases it will not. By way of example, the modification may only be in the 3' or 5' position, may be only in the terminal region, for example, in the position of the terminal nucleotide, or in the last 2, 3, 4, 5 or 10 nucleotides of the strand. The modification may be in the double strand section, in the single strand section, or both. The modification may only be in a double-stranded RNA region, or it may only be in a single-stranded RNA region. For example, the phosphorothioate modification at the unbound O position may be at only one or both ends, may be only at the terminal site, for example, at the terminal nucleotide position, or at the last 2, 3, 4, 5, or 10 nucleotides of the strand, or may be at the double strand. and single-strand sections, in particular, at the ends. The 5' end or ends may be phosphorylated.

This makes it possible, for example, to improve stability, to include specific bases in overhangs, or to include nucleotides with modifications or nucleotide mimics in single-stranded overhangs, for example, in the 5' or 3' overhang, or both. For example, it may be desirable to include purine nucleotides at the overhangs. In some embodiments, all or some of the bases at the 3' or 5' overhang may be modified, for example, using the modification described herein. Modifications may include, for example, the use of modifications at the 2'-position of the ribose sugar with modifications that are known in the art, for example, the use of deoxyribonucleotides, 2'deoxy-2'-fluoro-(2'-F), or 2'-O -methyl-modified instead of a ribose sugar of a nitrogenous base, and a modification of the phosphate group, for example, a modification of phosphorothioate. The overhangs need not be homologous to the target sequence.

In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2 '-deoxy, 2'-hydroxyl or 2'-fluoro. Threads can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

At least two different modifications are typically present in the sense strand and the antisense strand. These two modifications may be 2'-O-methyl or 2'-fluoro modifications or other modifications.

In one embodiment, N _a and/or Nb contain alternating pattern modifications. The term alternating motif, as used herein, refers to a motif with one or more modifications, with each modification occurring on alternating nucleotides on the same strand. An alternating nucleotide may refer to every second nucleotide, or every third nucleotide, or a similar pattern. For example, if A, B, and C each represent the same type of nucleotide modification, then the alternating motif could be ABABABABABA..., AABBAABBAABB..., AABAAABAAABA..., AAABAAAAAAAAB..., AAABBBAAAABB... or ABSABCAABC. .. etc.

The type of modifications contained in the alternating motif may be the same or different. For example, if each of A, B, C, D represents one type of nucleotide modification, then the alternating patterns, i.e. the modifications of every second nucleotide may be the same, but each of the sense strand or antisense strand may be selected from several possible modifications in the alternating motif, such as ABABAB..., ACACAC..., BDBDBD... or CDCDCD... etc.

In one embodiment, the RNAi agent of the present invention comprises a modification pattern for the alternating sense strand motif shifted relative to the modification pattern for the alternating antisense strand motif. The shift may be such that the modified sense strand nucleotide group corresponds to the otherwise modified antisense strand nucleotide group, and vice versa. For example, when a sense strand is paired with an antisense strand in a dsRNA duplex, an alternating motif in the sense strand may begin with ABA-48 039127

BAB from the 5' to 3' end of the strand, and the alternating motif in the antisense strand may begin with BABABA from the 5' to 3' end of the strand in the duplex region. As another example, an alternating motif in a sense strand may begin with AABBAABB from the 5' to 3' end of the strand, and an alternating motif in an antisense strand may begin with BBAABBAA from the 5' to 3' end of the strand in the duplex region, so that there is a complete or partial shift in modification patterns between the sense strand and the antisense strand.

In one embodiment, an RNAi agent comprising a 2'-O-methyl modification and a 2'-F alternating motif pattern in the sense strand is initially shifted with respect to the 2'-O-methyl modification and 2' alternating motif pattern. -F modifications in the antisense strand, i.e., a 2'O-methyl modified nucleotide in base pairs of the sense strand with a 2'-F modified nucleotide in the antisense strand and vice versa. Position 1 in the sense strand may begin with the 2'F modification, and position 1 in the antisense strand may begin with the 2'-O-methyl modification.

The introduction of one or more motifs with three identical modifications of three consecutive nucleotides into the sense strand and/or antisense strand disrupts the original pattern of modifications present in the sense strand and/or antisense strand. Such disruption of the pattern of modifications of the sense and/or antisense strand by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense and/or antisense strand unexpectedly increases gene silencing activity against the target gene.

In one embodiment, when a motif of three identical modifications of three consecutive nucleotides is introduced into any of the strands, the modification of the nucleotide following the motif is a modification other than the modification of the motif. For example, the part of the sequence containing the motif is ...N _a YYYN _b ..., where Y is a modification of the motif with three identical modifications of three consecutive nucleotides, and N _a and N _b are the modification of the nucleotide following the motif YYY , which is different from the modification Y, and where N _a and N _b may be the same or different modifications. Alternatively, N _a and/or N _b may or may not be present if a flanking modification is present.

The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide bond. Modification of the phosphorothioate or methylphosphonate internucleotide bond may be present at any nucleotide of the sense strand or antisense strand, or both, at any position on the strand. For example, an internucleotide bond modification may be present at each nucleotide of the sense strand and/or antisense strand; wherein each modification of the internucleotide bond may be present in an alternating pattern in the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide bond modifications in an alternating pattern. The alternating pattern of internucleotide bond modifications in the sense strand may be the same as or different from the antisense strand, and the alternating pattern of internucleotide bond modifications in the sense strand may be shifted relative to the alternating pattern of internucleotide bond modifications in the antisense strand. In one embodiment, the double-stranded RNAi agent contains 6-8 phosphorothioate internucleotide bonds. In one embodiment, the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and two phosphorothioate internucleotide bonds at the 3' end, and the sense strand contains at least two phosphorothioate internucleotide bonds at either the 5' end or the 3' end. end.

In one embodiment, the RNAi agent has a modification of the phosphorothioate or methylphosphonate internucleotide bond in the overhang. For example, the overhang may contain two nucleotides with a phosphorothioate or methylphosphonate internucleotide bond between the two nucleotides. Internucleotide bond modifications can also be made to connect overhangs to terminal paired nucleotides in the duplex region. For example, at least 2, 3, 4, or all of the overhang nucleotides may be linked via a phosphorothioate or methylphosphonate internucleotide bond, and additional phosphorothioate or methylphosphonate internucleotide bonds may optionally be present connecting the overhang to the paired nucleotide followed by the overhang. For example, at least two phosphorothioate internucleotide bonds may be present between the three terminal nucleotides, with two of the three nucleotides being overhang nucleotides and the third being the paired nucleotide following the overhang. These three terminal nucleotides may be at the 3'end of the antisense strand, the 3'end of the sense strand, the 5'end of the antisense strand, and/or the 5'end of the antisense strand.

In one embodiment, the 2 nucleotide overhang is at the 3' end of the antisense strand and two phosphorothioate internucleotide bonds are present between the three terminal nucleotides, whereby two of the three nucleotides are overhang nucleotides and the third nucleotide is the paired nucleotide following the overhang.

Optionally, the RNAi agent may further have two phosphorothioate internucleotide bonds between the terminal three nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand.

In one embodiment, the RNAi agent comprises mismatch(es) with the target, in duplex, or combinations thereof. The mismatch may occur in a raised portion or a duplex portion. Base pairs can be aligned based on their ability to promote dissociation or melting (e.g. the free energy of association or dissociation of a particular pairing, the simplest approach being to study the pairs separately for each base pair, but nearest neighbor analysis or the like can also be used). In terms of promoting dissociation: A:U is more preferable than G:C; G:U is preferred over G:C; and 1:C is more preferred than G:C (1=inosine). Mismatches, such as non-canonical or non-canonical match types (described elsewhere in this document), are preferred over canonical match types (A:T, A:U, G:C); and pairing types that include a universal base are preferred over canonical pairing types.

In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs in duplex regions from the 5' end of the antisense strand, independently selected from the group consisting of: A:U, G: U, I:C and mismatches, eg, non-canonical or non-canonical match types, or match types that include a universal base, to promote dissociation of the antisense strand at the 5' end of the duplex.

In one embodiment, the nucleotide at position 1 within the duplex region, in the direction from the 5' end of the antisense strand, is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs within the duplex region, in the direction from the 5' end of the antisense strand, is an AU base pair. For example, the first base pair within the duplex region, away from the 5' end of the antisense strand, is the AU base pair.

In another embodiment, the nucleotide at the 3' end of the sense strand is deoxythymine (dT). In another embodiment, the nucleotide at the 3' end of the antisense strand is deoxythymine (dT). In one embodiment, a short sequence of deoxythymine nucleotides is present, such as two dT nucleotides at the 3' end of the sense and/or antisense strand.

In one embodiment, the sequence of the sense strand may be represented by formula (I)

5' n _p -N _a -(XXX )iN _b -YYY -N _b -(Z Ζ Ζ ) _: -N _a -n _q 3' (I), where i and j are each independently 0 or 1;

each of p and q is independently 0-6;

each Na is independently an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two unequally modified nucleotides;

each N _b is independently an oligonucleotide sequence containing 0-10 modified nucleotides;

each n _p and n _q is independently an overhanging nucleotide;

where N _b and Y have different modification; and each of XXX, YYY and ZZZ is independently a single motif with three identical modifications of three consecutive nucleotides.

Preferably in YYY all nucleotides are 2'-F-modified.

In one embodiment, Na and/or N _b contains alternating pattern modifications.

In one embodiment, the YYY motif is located at or near the semantic strand cleavage site. For example, if the RNAi agent contains a duplex region that is 17-23 nucleotides in length, then the YYY motif may be at or near the cleavage site (e.g., may be at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) in the sense strand, with the count starting from the 1st nucleotide from the 5' end; or, optionally, counting starts at the 1st paired nucleotide in the duplex region from the 5' end.

In one embodiment, i is 1, a j is 0, or i is 0, a j is 1, or both i and j are 1. Thus, the semantic thread can be represented by the following formulas:

5' n _p -N _a -YYY-N _b -ZZZ-N _a -n _q 3'(lb);

5' n _p -N _a -XXX-N _b -YYY-N _a -n _q 3'(1s); or

5' n _p -N _a -XXX-N _b -YYY-N _b -ZZZ-N _a -n _q 3' (Id).

Where the sense strand is represented by formula (Ib), then N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N _a can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

- 50 039127

Where the sense strand is represented by formula (Ic), then N _b is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the sense strand is represented by formula (Id), each N _b is independently an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5, or 6. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Each of X, Y and Z can be the same or different from the rest.

In other embodiments, i is 0, a j is 0, and the thread may be represented by the formula

5' n _p -N _a -YYY- N _a -n _q 3' (la) .

Where the sense strand is represented by formula (Ia), each Na can independently be an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

In one embodiment, the RNAi antisense strand sequence can be represented by formula (II)

5' nq.-^'-fZ'Z'ZQrNb'-Y'Y'Y'-Nb'-iX'X'XQi-NQ-np' 3' (II) where k and l are each independently 0 or 1;

each of p' and q' is independently 0-6;

each N _a ' is independently an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two unequally modified nucleotides;

each N _b ' is independently an oligonucleotide sequence containing 0-10 modified nucleotides;

each n _p ' and n _q ' is independently an overhanging nucleotide;

where Nb' and Y' have different modification; and each of X'X'X', Y'Y'Y' and Z'Z'Z' is independently a single motif with three identical modifications of three consecutive nucleotides.

In one embodiment, N _a ' and/or N _b ' contains alternating pattern modifications.

The Y'Y'Y' motif is located at or near the antisense strand cleavage site. For example, if the RNAi agent contains a duplex region that is 17-23 nucleotides long, then the Y'Y'Y' motif may be at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14 or 13, 14, 15 of the antisense strand, with the count starting from the 1st nucleotide from the 5' end; or optionally counting starts from the 1st paired nucleotide in the duplex region from the 5'-end. Preferably the Y'Y'Y' motif is in positions 11, 12, 13.

In one embodiment, in the Y'Y'Y' motif, all nucleotides are 2'-OMe-modified.

In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

Thus, the antisense strand can be represented by the following formulas:

5' n _q ,-N _a '-Z 'Z 'Z '-N _b '-Y ' Y ' Y '-N _a '-p _p , 3' (I lb) ;

5' n _q ,-N _a '-Y ' Y ' Y '-N _b '-X'X'X '-n _p , 3'(lie); or

5' n _q ,-N _a '- Z ' Z ' Z '-N _b '-Y ' Y ' Y '-N _b ' - X'X'X '-N _a '-n _p , 3' (lid ).

Where the antisense strand is represented by formula (IIb), N _b ' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N _a ' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the antisense strand is represented by formula (IIe), N _b ' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each Na' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the antisense strand is represented by formula (lid), each N _b ' is independently an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02, or 0 modified nucleotides. Each Na' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Preferably Nb is 0, 1, 2, 3, 4, 5 or 6.

In other embodiments, k is 0 and l is 0, and the antisense strand can be represented by the formula:

5'Pr<-N _a --Y'Y'Y'- N _a ,-n _q , 3' (la).

Where the antisense strand is represented by formula (IIa), then each Na' is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Each of X', Y' and Z' may be the same or different from the others.

Each nucleotide of the sense strand and antisense strand can be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2 'hydroxyl or 2'-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluorine. Each X, Y, Z, X', Y' and Z', in particular, may be a 2'-O-methyl modification or a 2'-fluoro modification.

In one embodiment, the sense strand of the RNAi agent may contain a YYY motif located at positions 9, 10, and 11 of the strand, in cases where the duplex region is 21 nucleotides, counting from the 1st nucleotide from the 5' end, or optionally counting starts from the 1st paired nucleotide in the duplex region from the 5' end; and Y is the 2'-F modification. The semantic strand may additionally contain the XXX motif or ZZZ motifs as flanking modifications at the opposite end of the duplex region; and each of XXX and ZZZ is independently a 2'-OMe modification or a 2'-F modification.

In one embodiment, the antisense strand may contain a Y'Y'Y' motif located at positions 11, 12, 13 of the strand, counted from 1 nucleotide from the 5' end, or optionally counted from 1- th paired nucleotide in the duplex region from the 5'-end; and Y' is the 2'-O-methyl modification. The antisense strand may further comprise the X'X'X' motif or Z'Z'Z' motifs as flanking modifications at the opposite end of the duplex region; and each of X'X'X' and Z'Z'Z' is independently a 2'-OMe modification or a 2'-F modification.

A sense strand represented by any of formulas (Ia), (Ib), (Ic) and (Id) above forms a duplex with an antisense strand represented by any of formulas (IIa), (IIb), (IIc) and (IId ) respectively.

Accordingly, RNAi agents for use in the methods of the present invention may comprise a sense strand and an antisense strand, each strand containing 14 to 30 nucleotides, the RNAi duplex represented by formula (III):

sense strand: 5' n _p -N _a - (XXX) _± -N _b - YYY -N _b -(ZZZ)jN _a -n _q 3' antisense strand: 3' n _p '-N _a '- (X 'X'X') k ^-N b' ^_γ ' ^γ ' ^γ ' ^-N b' ^_ ( ^zzz ) i ^_ N _a '-n _q '5' (III) where i, j, k and l are each independently equal to 0 or 1;

each of p, p', q and q' is independently 0-6;

each N _a and N _a ' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two unequally modified nucleotides;

each N _b and N _b ' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

where each np', np, n _q ' and n _q , each of which may or may not be present, is independently an overhanging nucleotide; and each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif with three identical modifications of three consecutive nucleotides.

In one embodiment, i is 0, a j is 0; or i is 1, a j is 0; or i is 0, a j is 1; or both i and j are 0; or both i and j are 1.

In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

Exemplary combinations of sense strand and antisense strand forming an RNAi duplex include the formulas below:

- 52 039127 ' n _p - N _a -Υ YY -N _a -n _q 3 '

3' n _p '-N _a '-Y ' Υ ' Υ ' -N _a 'n _q '5' (Sha)

5' η _ρ -N _a -Υ YY -N _b -Ζ Ζ Ζ -N _a -n _q 3'

3'Πρ'-N _a '-Υ ' Υ ' Υ '-N _b '-Ζ ' Ζ ' Ζ '-N _a 'n _q '5' (IHb) ' n _p -N _a - XXX -N _b - Υ Υ Υ - N _a -n _q 3 '

3'Πρ'-N _a '-X 'X 'X ' -N _b '-Y ' Y ' Y ' -N _a '-n _q '5' (IIIc) ' n _p -N _a -XXX -N _b -YYY -N _b - Ζ Ζ Z -N _a -n _q 3 '

3'np'-N _a '-X'X'X'-N _b '-Y'Y'Y'-N _b '-Z 'Ζ 'Z '-N _a -n _q '5' (Hid)

Where the RNAi agent is represented by formula (IIIa), then each N _a is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the RNAi agent is represented by formula (IIIb), then each N _b is independently an oligonucleotide sequence containing 1-10, 1-7, 1-5, or 1-4 modified nucleotides. Each N _a is independently an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.

Where the RNAi agent is represented by formula (IIIc), then each Nb, Nb' is independently an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4 , 0-2 or 0 modified nucleotides. Each Na is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the RNAi agent is represented by formula (IIId), each Nb, Nb' is independently an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02 or 0 modified nucleotides. Each N _a , N _a ' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Each of Na, Na', Nb and Nb' independently contains alternating pattern modifications.

Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc) and (IIId) may be the same or different from the rest.

Where the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), then at least one of the Y nucleotides may base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides form base pairs with the corresponding Y' nucleotides.

Where the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides form base pairs with the corresponding Z' nucleotides.

Where the RNAi agent is represented by formula (IIIc) or (IIId), then at least one of the X nucleotides may base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides form base pairs with the corresponding X' nucleotides.

In one embodiment, the Y nucleotide modification is different from the Y' nucleotide modification, the Z nucleotide modification is different from the Z' nucleotide modification, and/or the X nucleotide modification is different from the X' nucleotide modification.

In one embodiment, where the RNAi agent is represented by formula (IIId), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications. In another embodiment, where the RNAi agent is represented by formula (IIId), the Na modifications are 2'-O-methyl or 2'-fluoro modifications and np'>0 and at least one np' linked to an adjacent nucleotide via a phosphorothioate bond. In yet another embodiment, where the RNAi agent is represented by formula (IIId), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one np ' is connected to an adjacent nucleotide via a phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker (described below). In another embodiment, where the RNAi agent is represented by formula (IIId), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one np' is linked to adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a bivalent or trivalent branched linker.

In one embodiment, when the RNAi agent is represented by formula (IIIa), the Na modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one np' is connected to an adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are joined to each other at the 5' end, and one or both of the 3' ends optionally conjugated with a ligand. Each agent can target the same gene or two different genes; or each of the agents may target the same gene at two different target sites.

Various publications describe multimeric RNAi agents that can be used in the methods of the present invention. Such publications include WO 2007/091269, US Pat. No. 7,858,769, WO 2010/141511, WO 2007/117686, WO 2009/014887, and WO 2011/031520, the entire contents of each of which are incorporated herein by reference.

As described in more detail below, an RNAi agent containing one or more carbohydrate moieties conjugated to the RNAi agent can improve one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to the modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of the dsRNA agent can be replaced with other moieties, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this way is referred to herein as a modified ribose subunit (RRMS). The cyclic support may be a carbocyclic ring system, i. e. all atoms in the ring are carbon atoms, or a heterocyclic ring system, i.e. one or more atoms in the ring may be heteroatoms, eg nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system or may contain two or more rings, such as fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one backbone attachment point, preferably two backbone attachment points, and (ii) at least one binding attachment point. The point of attachment to the backbone as used herein refers to a functional group, e.g., a hydroxyl group, or, generally, a bond available for incorporation of a support into a backbone, e.g., phosphate or modified phosphate, e.g. for this, ribonucleic acid. The linking point of attachment (TAP) in some embodiments refers to a ring atom of a cyclic carrier, for example, a carbon atom or a heteroatom (other than the atom that provides the point of attachment to the backbone) to which the selected moiety binds. A moiety can be, for example, a carbohydrate, such as a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, and a polysaccharide. Optionally, the selected fragment is attached via an intermediate linking fragment to a cyclic carrier.

Thus, the cyclic carrier will often include a functional group, such as an amino group, or generally provide a bond suitable for introducing or linking another chemical entity, such as a ligand, into the ring.

The RNAi agents can be conjugated to the ligand via a carrier, where the carrier may be a cyclic group or an acyclic group; the cyclic group is preferably selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]-dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinyl and caline ; preferably the acyclic group is selected from a serinol backbone or a diethanolamine backbone.

In some specific embodiments, the RNAi agent for use in the methods of the present invention is an agent selected from the group of agents listed in any of the tables. 3, 4, 6, 7, 12, 13, 22, 23, 25 and 26. Such agents may further contain a ligand.

IV. iRNA conjugated with ligands.

Another iRNA modification of the RNA of the present invention includes chemically linking the RNA to one or more ligands, fragments, or conjugates that increase the activity, cellular distribution, or cellular uptake of the iRNA. Such moieties include, without limitation, lipid moieties such as cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem Let., 1994, 4:10531060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g. dodecanediol or undecyl residues (Saison- Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipid , for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-0-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotid es, 1995, 14:969-973), or adamantanoacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

In one embodiment, the ligand alters the distribution, targeting, or duration of action of the iRNA-based agent into which it is administered. In preferred embodiments, the ligand provides increased affinity for a selected target, e.g., molecule, cell, or cell type, compartment, e.g., a cellular compartment, or part of an organ, tissue, organ, or body site, such as compared to species lacking such a ligand. Preferred ligands will not participate in duplex pairing in a duplex nucleic acid.

Ligands may include a naturally occurring substance such as a protein (eg, human serum albumin (HSA), low density lipoprotein (LDL) or globulin); a carbohydrate (eg dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine or hyaluronic acid) or a lipid. The ligand may also be a recombinant or synthetic molecule such as a synthetic polymer, eg a synthetic polyamino acid. Examples of polyamino acids include polyamino acid, which is polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, L-lactide-glycolide copolymer, divinyl ether-maleic anhydride copolymer, N-(2 -hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, polyamine peptidomimetic, polyamine dendrimer, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha helical peptide.

Ligands can also include targeting groups, eg, a cell or tissue targeting agent, eg, a lectin, glycoprotein, lipid, or protein, eg, an antibody, that binds to a specific cell type, eg, a kidney cell. Target group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, carbohydrate mucin, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate , polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

Other examples of ligands include dyes, intercalators (eg acridines), crosslinkers (eg psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatic hydrocarbons (eg phenazine, dihydrophenazine), artificial endonucleases (eg EDTA), lipophilic molecules, e.g. cholesterol, cholic acid, adamantanacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3propanediol, heptadecyl group , palmitic acid, myristic acid, O3(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine and peptide conjugates (e.g. antennapedia peptide, Tat-peptide), alkylating agents, phosphate, amino, mercapto, PEG (eg PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (eg biotin), substances transport/absorption aids (eg, aspirin, vitamin E, folic acid), synthetic ribonucleases (eg, imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complex of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

Ligands can be proteins, such as glycoproteins, or peptides, such as molecules with a specific affinity for a coligand, or antibodies, such as an antibody that binds to a specific cell type, such as a liver cell. Ligands can also include hormones and hormone receptors. They may also include compounds other than peptides, such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose or polyvalent fucose. For example, the ligand may be a lipopolysaccharide, a p38 MAP kinase activator, or an NF-κB activator.

The ligand can be a substance, such as a drug, that can increase the uptake of the iRNA-based agent by the cell, such as by disrupting the cell's cytoskeleton, such as disrupting microtubules, microfilaments, and/or intermediate filaments of the cell. The drug may be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlaquinolide, latrunculin A, phalloidin, swincholide A, indanocin or myoservin.

In some embodiments, a ligand is attached to an iRNA as described herein and acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophils, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, and so on. Exemplary PK modulators include, without limitation, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides that contain some phosphorothioate linkages are also known to bind to whey protein, therefore short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, containing multiple phosphorothioate linkages in the backbone are also suitable. in the present invention as ligands (eg as PK modulating ligands). In addition, aptamers that bind to serum components (eg, serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

The ligand-conjugated oligonucleotides of the present invention can be synthesized using an oligonucleotide that carries a pendant reactive functional group, such as that obtained by attaching a binding molecule to an oligonucleotide (described below). This reactive oligonucleotide can react with commercially available ligands, ligands that are synthesized with any of a variety of protecting groups, or ligands that have a linker moiety attached to them.

The oligonucleotides used in the conjugates of the present invention can be obtained using a convenient and standard method of well-known solid phase synthesis. Equipment for such synthesis is sold by several manufacturers, including, for example, Applied Biosystems (Foster City, CA). Additionally or alternatively, any other means for such synthesis known in the art may be used. It is also known to use similar techniques to prepare other oligonucleotides such as phosphorothioates and alkyl derivatives.

Ligand-conjugated oligonucleotides and a ligand-molecule carrying the sequence-specific linked nucleosides of the present invention, oligonucleotides and oligonucleosides can be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already carry a binding moiety, ligand-nucleotide or nucleoside-conjugate precursors that already carry a ligand molecule, or building blocks that carry a ligand other than a nucleoside.

When using nucleotide conjugate precursors that already carry a binding moiety, the synthesis of sequence-specific linked nucleosides is typically completed and the ligand molecule is then reacted with the binding moiety to form a ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized using an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to standard phosphoramidites and non-standard phosphoramidites that are commercially available and commonly used in oligonucleotide synthesis.

A. Lipid conjugates.

In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds to a serum protein, such as human serum albumin (HSA). Svya

- 56 039127 naming with HSA ligand provides distribution of the conjugate in the target tissue, for example, in target body tissue other than kidney tissue. For example, the target tissue may be the liver, including parenchymal liver cells. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. The lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to the target cell or cell membrane, and/or (c) can be used to adjust serum protein binding e.g. HSA .

A lipid-based ligand can be used to inhibit, for example, regulate the binding of a conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds more strongly to HSA is less likely to be targeted to the kidneys and therefore less likely to be excreted from the body. A lipid or lipid-based ligand that binds less strongly to HSA can be used to target the conjugate to the kidneys.

In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably it binds HSA with an affinity sufficient for the conjugate to preferentially distribute to tissue other than kidney tissue. However, it is preferred that the affinity is not so strong that the binding of the HSA ligand is irreversible.

In another preferred embodiment, the lipid-based ligand binds little or no to HSA so that the conjugate will preferentially distribute to the kidney. Other moieties that target kidney cells can also be used instead of or in addition to the lipid based ligand.

In another aspect, the ligand is a moiety, such as a vitamin, that is taken up by a target cell, such as a proliferating cell. It is particularly useful in the treatment of disorders characterized by undesirable cell proliferation, eg malignant or benign type, eg cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by target cells, such as liver cells. Also included are HAS and low density lipoprotein (LDL).

B. Means that provide penetration into the cell.

In another aspect, the ligand is a cell-penetrator, preferably a helical cell-penetrator. Preferably the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it may be modified, including a peptidyl mimetic, invertomers other than peptide or pseudopeptide bonds, and it may also use D-amino acids. The helical agent is preferably an alpha helical agent which is preferably characterized by lipophilic and lipophobic phases.

The ligand may be a peptide or a peptidomimetic.

A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule that can fold into a specific three-dimensional structure similar to a natural peptide. Attachment of peptide and peptidomimetic agents to iRNA agents may affect the pharmacokinetic distribution of the iRNA, for example by increasing cellular recognition and absorption. The length of a peptide or peptidomimetic fragment may be about 5-50 amino acids, eg, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids.

The peptide or peptidomimetic may be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, consisting primarily of Tyr, Trp, or Phe). The peptide fragment may be a dendrimer peptide, a conformationally constrained peptide, or a cross-linked peptide. In another alternative, the peptide fragment may include a hydrophobic membrane transfer control sequence (MTS). An exemplary hydrophobic MTS-containing peptide is an RFGF with the amino acid sequence aavallpavllallap (seq id no: 43) An RFGF analog (e.g., the amino acid sequence aallpvllaap (seq id no: 44) containing a hydrophobic MTS can also be a targeting fragment. The peptide fragment can be a delivery peptide that can carry large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes.For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 45) and the Antennapedia Drosophila protein (RQIKIWFQNRRMKWKK (seq id NO: 4 6) are capable of functioning as delivery peptides.The peptide or peptidomimetic can be encoded by a random DNA sequence, such as a peptide identified from a phage display library or a one-bead-one-compound (EIA) combinatorial library (Lam et al. , Nature, 354:82-84, 1991) An example of a peptide or

The peptidomimetic associated with the dsRNA-based agent via the introduced monomeric unit is a cell-targeting peptide consisting of arginine-glycine-aspartic acid (RGD) or an RGD mimetic. The length of the peptide fragment can vary from about 5 amino acids to about 40 amino acids. Peptide fragments may have a structural modification, such as to improve stability or control conformational properties. You can use any of the structural modifications described below.

The RGD peptide for use in the compositions and methods of the present invention may be linear or cyclic, and may be modified, eg, glycosylated or methylated, to facilitate targeting to specific tissue(s). RGD-containing peptides and peptidomimetics may include D-amino acids as well as synthetic RGD mimetics. In addition to RGD, other moieties that target the integrin ligand can be used. Preferred conjugates with such a ligand target PECAM-1 or VEGF.

The cell entry peptide is capable of entering a cell, for example a microbial cell such as a bacterial or fungal cell, or a mammalian cell such as a human cell. The microbial entry peptide, for example, can be an α-helical linear peptide (eg, LL-37 or Ceropin P1), a disulfide bond-containing peptide (eg, α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two predominant amino acids (for example, PR-39 or indolicidin). The cell entry peptide may also include a cellular intranuclear localization signal (NLS). For example, the cell entry peptide can be a two-component amphipathic peptide such as MPG, which is derived from the gp41 HIV-1 NLS fusion peptide domain of the SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31: 2717-2724, 2003).

C. Carbohydrate conjugates.

In some embodiments, the compositions and methods of the present invention provide an iRNA oligonucleotide further comprising a carbohydrate. Carbohydrate-conjugated iRNA is preferred for in vivo delivery of nucleic acids as well as compositions suitable for in vivo therapeutic applications described herein. As used herein, the term carbohydrate refers to a compound that is a carbohydrate per se formed from one or more monosaccharide units having at least 6 carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom, associated with each carbon atom; or to a compound having as part of it a carbohydrate fragment formed from one or more monosaccharide units, each of which has at least six carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom associated with every carbon atom. Typical carbohydrates include sugars (mono-, di-, tri-, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units) and polysaccharides such as starches, cellulose, glycogen, and polysaccharide gums. Certain monosaccharides include HBV and higher (eg HBV, C6, C7 or C8) sugars; di- and trisaccharides include sugars with two or three monosaccharide units (eg HBV, C6, C7 or C8).

In one embodiment, the carbohydrate conjugate for use in the compositions and methods of the present invention is a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine, such as Formula II

In another embodiment, the carbohydrate conjugate for use in the compositions and methods of the present invention is selected from the group consisting of:

- 58 039127

- 59 039127

- 60 039127

- 61 039127

Another exemplary carbohydrate conjugate for use in the embodiments described herein includes, without limitation

- 62 039127

(formula XXIII), where one of X or Y is an oligonucleotide, while the other is hydrogen.

In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or cell entry peptide.

Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of which are incorporated herein by reference.

D. Linkers.

In some embodiments, the conjugate or ligand described herein may be attached to the iRNA oligonucleotide with various linkers, which may or may not be cleavable.

The expression linker or linker group means an organic fragment that connects two parts of the compound, for example, links two parts of the compound by covalent bonds. Linkers typically contain a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO ₂ , SO2NH, or a chain of atoms such as but not limited to substituted or unsubstituted alkyl substituted or unsubstituted alkenyl substituted or unsubstituted alkynyl arylalkyl , алкениларилалкенил, алкениларилалкинил, алкиниларилалкил, алкиниларилалкенил, алкиниларилалкинил, алкилгетероарилалкил, алкилгетероарилалкенил, алкилгетероарилалкинил, алкенилгетероарилалкил, алкенилгетероарилалкенил, алкенилгетероарилалкинил, алкинилгетероарилалкил, алкинилгетероарилалкенил, алкинилгетероарилалкинил, алкилгетероциклилалкил, алкилгетероциклилалкенил, алкилгетероциклилалкинил, алкенилгетероциклилалкил, алк enylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, in which one or more methylenes may be interrupted, SOR, 8(O, ₈ (O, 8) (O) substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclyl; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8 -17, 6-16, 7-16 or 8-16 atoms.

A cleavable linker group is a group that is reasonably stable outside of the cell, but which, upon entry into the target cell, cleaves to release the two parts that the linker holds together. In a preferred embodiment, the cleavable linker group is cleaved about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in the target cell or at a first standard condition (which may, for example, be chosen to mimic or simulate intracellular conditions) than in the subject's blood, or at a second standard condition (which may, for example, be chosen to mimic or simulate conditions that are present in blood or blood serum ).

Cleavable linker groups are susceptible to cleavage factors such as pH, redox potential, or the presence of damaging molecules. In general, cleavage factors are more abundant or occur at higher levels or have greater

- 63 039127 activity inside cells than in serum or blood. Examples of such disruptive agents include redox agents that are chosen for particular substrates or that are not substrate specific, including, for example, oxidizing or reducing enzymes or reducing agents such as mercaptans present in cells that can degrade redox a cleavable linker group by reduction; esterases; endosomes or agents that can create an acidic environment, such as those that result in a pH value of five or less; enzymes that can hydrolyze or degrade an acid-cleavable linker group, acting as a universal acid, peptidases (which may be substrate-specific), and phosphatases.

A cleavable linker group, such as a disulfide bond, may be pH sensitive. The human serum pH is 7.4, while the average intracellular pH is slightly lower, in the range of approximately 7.1-7.3. Endosomes are characterized by a more acidic pH in the range of 5.5-6.0, and lysosomes are characterized by an even more acidic pH, about 5.0. Some linkers will have a cleavable linking group that cleaves under preferred pH conditions, thereby releasing the cationic lipid from the ligand within the cell or into the desired cell compartment.

The linker may include a cleavable linker group that is cleavable by a particular enzyme. The type of cleavable linker group included in the linker may depend on the cell being targeted. For example, a liver-targeting ligand can be linked to a cationic lipid via a linker that contains an ester group. Liver cells are high in esterases and therefore the linker will be cleaved more efficiently in liver cells rather than in cell types that do not have high levels of esterases. Other cell types rich in esterases include those of the lung, renal cortex, and testis.

Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

Generally, the suitability of a candidate cleavable linker group can be assessed by testing the ability of a damaging agent (or condition) to cleave that candidate linker group. In addition, it is also desirable to test a candidate cleavable linker group for its ability to resist cleavage in the blood or when brought into contact with other non-target tissue. Thus, it is possible to determine the relative sensitivity to degradation between the first and second conditions, where the first is chosen as a measure of degradation in the target cell, and the second is chosen as a measure of degradation in other tissues or biological fluids, for example, blood or blood serum. Measurements can be made in cell-free systems, in cells, in cell culture, in organ or tissue culture, or in animals in general. It may be useful to make initial assessments under cell-free or culture conditions and confirm with further assessments in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in a cell (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions chosen to mimic extracellular conditions).

i. Linker groups cleavable by redox reactions.

In one embodiment, the cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of a linker group cleavable upon reduction is a disulfide linker group (-S-S-). To determine whether a candidate cleavable linker group is a suitable reductively cleavable linker group or, for example, suitable for use with a particular iRNA fragment and a particular targeting agent, one can refer to the methods described herein. For example, a candidate can be assessed by incubation with dithiothreitol (DTT) or other reducing agent using reagents known in the art that mimic the rate of degradation that would be observed in a cell, eg a target cell. Candidates may also be evaluated under conditions that are chosen to mimic conditions in blood or serum. In one embodiment, the candidate compounds are cleaved by no more than about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in a cell (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or in vitro conditions chosen to mimic extracellular conditions). The degree of cleavage of candidate compounds can be determined using standard enzyme kinetic assays under conditions chosen to mimic the intracellular environment and compared to conditions chosen to mimic the extracellular environment.

- 64 039127 ii. Phosphate cleavable linker groups.

In another embodiment, the cleavable linker contains a cleavable phosphate-based linker. The cleavable phosphate-based linking group is cleaved by agents that destroy or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as cell phosphatases. Examples of phosphate linker groups are -O-P(O)(ORk)-O-, O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk) -O-, -OP(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)-O -, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -SP(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)-S-, -O-P(S)(Rk)-S-. Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH) -O-, -O-P(O)(OH)-S-, -SP(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O -, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O, -S-P(S)(H)-O- , -S-P(O)(H)-S-, -O-P(S)(H)-S-.

A preferred embodiment is -O-P(O)(OH)-O-. These candidates may be evaluated using methods similar to those described above.

iii. Acid cleavable linker groups.

In another embodiment, the cleavable linker contains an acid cleavable linking group. An acid-cleavable linker group is a linker group that is cleavable under acidic conditions. In preferred embodiments, acid cleavable linker groups are cleavable in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or less) or by means , such as enzymes that can act like regular acid. In the cell, certain low pH organelles, such as endosomes and lysosomes, can provide a scavenging environment for acid-cleavable linker groups. Examples of acid-cleavable linker groups include, without limitation, hydrazones, esters, and amino acid esters. The acid-cleavable groups may be characterized by the general formula -C=NN-, C(O)O or -OC(O). A preferred embodiment is the case where the carbon atom attached to the oxygen of the ester group (in the alkoxy group) is part of an aryl group, a substituted alkyl group, or a quaternary alkyl group such as dimethylpentyl or tert-butyl. These candidates may be evaluated using methods similar to those described above.

iv. Ester linker groups.

In another embodiment, the cleavable linker contains an ester linking group. The cleavable ester linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester cleavable linker groups include, without limitation, esters with alkylene, alkenylene, and alkynylene groups. Ester cleavable linker groups are characterized by the general formula C(O)O- or -OC(O)-. These candidates may be evaluated using methods similar to those described above.

v. Cleavable groups based on peptides.

In another embodiment, the cleavable linker contains a cleavable linking group based on the peptide. The cleavable peptide-based linking group is cleaved by enzymes such as peptidases and proteases in cells. Cleavable peptide linker groups are peptide bonds formed between amino acids to form oligopeptides (eg, dipeptides, tripeptides, etc.) and polypeptides. Cleavable groups based on the peptide do not include the amide group (-C(O)NH-). The amide group may be formed between any alkylene, alkenylene or alkynene. A peptide bond is a special type of amide bond formed between amino acids to form peptides and proteins. A peptide-based cleavable group is generally limited to the peptide bond (ie, amide bond) formed between amino acids to form peptides and proteins, and does not include the entire amide functional group. Peptide-based cleavable linking groups are represented by the general formula NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of two adjacent amino acids. These candidates may be evaluated using methods similar to those described above.

In one embodiment, the iRNA of the present invention is conjugated to a carbohydrate via a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers in the compositions and methods of the present invention include, without limitation

- 65 039127

(Formula XXVIII)

- 66 039127

where one of X or Y is an oligonucleotide, while the other is hydrogen.

In some embodiments of the compositions and methods of the present invention, the ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached via a divalent or trivalent branched linker.

In one embodiment, the dsRNA of the present invention is conjugated to a divalent or trivalent branched linker selected from the group of structures shown in any of formulas (XXXII)-(XXXV):

formula XXXII formula XXXIII

formula XXXIV formula XXXV where q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C are independently for each occurrence 0-20 and where the repeating units may be the same or different;

each of R ^2A , R ^2B , R ^3A , R ^3B , R ^4A , R ^4B , R ^5A , R ^5B , R ^5C , T ^2A , T ^2B , T ^3A , T ^3B , T ^4A , T ^4B , T ^4A , T ^5B , T ^5C independently for each case is absent, represents CO, NH, O, S, OS(O), NHC(O), CH ₂ , CH2NH or CH2O;

Q ^2A , Q ^2b , Q ^3A , Q ^3b , Q ^4A , Q ^4b , Q ^5A , Q ^5B , Q ^5C independently for each occurrence are alkylene, substituted alkylene, where one or more methylenes may be interrupted or

- 67 039127 terminate in one or more of O, S, S(O), SO2, N(RN), C(R')=C(R''), C=C or C(O);

each of R ^2A , R ^2b , R ^3A , R ^3b , R ^4A , R ^4b , R ^5A , R ^5B , R ^5C independently in each occurrence is NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R ^a )C(O), -C(O)-CH(R ^a )-NH-, CO, CH=NO,

or heterocyclyl;

L ^2A , L ^2b , L ^3A , L ^3B , L ^4A , L ^4b , L ^5A , L ^5B and L ^5C are the ligand; those. each independently for each occurrence is a monosaccharide (such as GalNAc), a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, or a polysaccharide; and R ^a is H or an amino acid side chain. _{Trivalent GalNAc} conjugating derivatives are particularly suitable for use with RNAi agents for inhibiting target gene expression, such as those with formula (XXXVI) formula XXXVI --[-pSC. _QSC . _R 5C where L ^5A , L ^5B and L ^5C are a monosaccharide such as a derivative of GalNAc.

Examples of suitable divalent and trivalent branched linker groups conjugated to GalNac derivatives include, without limitation, the structures listed above as formulas II, VII, XI, X and XIII.

Illustrative US patents that teach the idea of making RNA conjugates include, without limitation, US Pat. Nos. 4,828,979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552538; 5578717, 5580731; 5591584; 5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046;

4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263; 4876335; 4904582; 4958013; 5082830;

5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873;

5317098; 5371241, 5391723; 5416203, 5451463; 5510475; 5512667; 5514785; 5565552; 5567810; 5574142;

5585481; 5587371; 5595726; 5597696; 5599923; 5599928 and 5688941; 6294664; 6320017; 6576752; 6783931; 6900297; 7037646; 8106022, the entire contents of which are incorporated herein by reference.

It is not necessary that all positions in a given compound be uniformly modified, and indeed several of the above modifications may be included in a single compound or even a single nucleoside in an iRNA. The present invention also includes iRNA-based compounds that are chimeric compounds.

iRNA-based chimeric compounds or chimeras in the context of the present invention are iRNA-based compounds, preferably dsRNA-based compounds, which contain two or more chemically distinct regions, each consisting of at least one monomeric unit, i.e. nucleotide, in the case of a dsRNA-based compound. Such iRNAs typically contain at least one site where the RNA is modified to provide the iRNA with increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. The additional iRNA region can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.

As an example, RNase H is a cellular endonuclease that cleaves an RNA strand in an RNA:DNA duplex. Activation of RNase H therefore leads to cleavage of the target RNA, thereby greatly increasing the efficiency of iRNA inhibition of gene expression. Therefore, comparable results can often be obtained with shorter iRNAs using chimeric dsRNAs compared to phosphorothioate deoxyhybridizations of dsRNAs at the same target site. Cleavage of the target RNA can usually be detected by gel electrophoresis and, if necessary, by using linked nucleic acid hybridization techniques known in the art.

In some cases, an iRNA RNA may be modified with a non-ligand group. A number of non-ligand molecules have been conjugated to iRNA to enhance activity, cellular distribution, or cellular uptake of the iRNA, and procedures for performing these types of conjugations are available in the scientific literature. Such non-ligand moieties have incorporated lipid moieties such as a cholesterol moiety (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioether, e.g. hexyl-S-68 039127 tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl . Acids Res., 1992, 20:533), an aliphatic chain, for example, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), phospholipid, e.g. ., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), polyamine or polyethylene glycol an ol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantanoacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Illustrative United States patents that teach the idea of making such RNA conjugates have been cited above. Typical conjugation schemes involve the synthesis of RNAs carrying an amino linker at one or more positions in the sequence. The amino group then reacts with the molecule to be conjugated using the appropriate condensing or activating reagents. The conjugation reaction can be performed with the RNA still bound to the solid support, or after RNA digestion, in the solution phase. Purification of the RNA conjugate by HPLC generally results in a pure conjugate.

V. Delivery of iRNA according to the present invention.

Delivery of an iRNA of the present invention to a cell, e.g., a cell of a subject such as a human subject (e.g., a subject in need thereof, such as a subject with a disease, disorder, or condition associated with HBV infection), can be accomplished in a variety of ways. For example, delivery can be accomplished by bringing the cell into contact with an iRNA of the present invention, either in vitro or in vivo. Delivery in vivo can also be done directly by administering to the subject a composition containing an iRNA, such as dsRNA. Alternatively, in vivo delivery can be accomplished indirectly by introducing one or more vectors that encode the iRNA and direct its expression. Such alternative cases are further described below.

In general, any method for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the iRNA of the present invention (see e.g. Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5 ):139-144 and WO94/02595, which are hereby incorporated by reference in their entirety). With respect to in vivo delivery, factors that are considered in the context of delivering an iRNA molecule include, for example, the biological stability of the delivered molecule, the prevention of non-specific effects, and the accumulation of the delivered molecule in the target tissue.

Non-specific effects of iRNA can be minimized by local administration, for example by direct injection or implantation into tissue, or topical administration of the drug. Local administration to the treatment site maximizes the local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be damaged by the agent or which may destroy the agent, and allows for the administration of a lower total dose of the iRNA molecule. Results from several studies show effective knockdown of gene products when iRNA is administered topically. For example, intraocular delivery of dsRNA to VEGF has been shown to be both intravitreal injection of cynomolgus monkeys (Tolentino, MJ., et al. (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ ., et al (2003) Mol Vis 9:210-216) prevents neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA into mice reduces tumor size (Pille, J., et al. (2005) Mol. Ther.11:267-274) and can prolong the survival time of mice with tumors (Kim, WJ., et al. (2006) Mol Ther 14:343-350 Li, S., et al (2007) Mol Ther 15:515-523). RNA interference has also been shown to be successful when locally delivered to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al. (2005) Gene Ther. 12 :59-66; Makimura, H., et al. (2002) BMC Neurosci. 3:18; Shishkina, GT., et al. (2004) Neuroscience 129:521-528; Thakker, ER., et al. ( 2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, KA., et al (2006) Mol Ther 14:476-484 Zhang, X., et al (2004) J Biol Chem 279:10677-10684 Bitko, V., et al (2005) Nat Med 11:50-55). With regard to the systemic administration of iRNA for the treatment of a disease, the RNA can be modified or, alternatively, delivered using a drug delivery system; both methods serve to prevent the rapid degradation of dsRNA by endo- and exonucleases in vivo.

The modification of the RNA or the pharmaceutical carrier can also allow the iRNA composition to be targeted to the target tissue and undesirable off-target effects can be avoided. iRNA molecules can be modified by chemical conjugation with lipophilic groups such as cholesterol to increase cellular uptake and prevent degradation. For example, an anti-ApoB iRNA conjugated to a lipophilic cholesterol moiety has been administered systemically to mice, resulting in apoB mRNA knockdown in both the liver and small intestine (Soutschek, J., et al. (2004) Nature 432:173-178). How

- 69 039127 iRNA conjugation with an aptamer has been shown to inhibit tumor growth and mediate tumor regression in mouse models of prostate cancer (McNamara, JO., et al. (2006) Nat. Biotechnol. 24:10051015). In an alternative embodiment, iRNA can be delivered using drug delivery systems such as a nanoparticle, dendrimer, polymer, liposomes, or cationic delivery system. Positively charged cationic delivery systems promote binding of the iRNA (negatively charged) molecule and also increase interactions at the negatively charged cell membrane to ensure efficient uptake of the iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be associated with iRNA or acted upon to form a vesicle or micelle (see, for example, Kim SH., et al. (2008) Journal of Controlled Release 129(2):107-116 ) that contain iRNA. The formation of vesicles or micelles also prevents iRNA degradation upon systemic administration. Methods for preparing and introducing cationic complexes with iRNA are within the skill of those skilled in the art (see e.g. Sorensen, DR., et al. (2003) J. Mol. Biol 327:761-766; Verma, UN., et al. al (2003) Clin Cancer Res 9:1291-1300; Arnold, AS et al (2007) J Hypertens 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic iRNA delivery include DOTAP (Sorensen, DR., et al. (2003), supra; Verma, UN., et al. (2003), supra), oligofectamine, particulate matter with lipid nucleic acid (Zimmermann, TS., et al. (2006) Nature 441:111-114), cardiolipin (Chien, PY., et al. (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al. (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME., et al. (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006 ) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, DA., et al. ( 2007) Biochem Soc Trans 35:61-67 Yoo, H., et al (1999) Pharm Res 16:1799-1804). In some embodiments, the iRNA is complexed with a cyclodextrin for systemic administration. Administration methods and pharmaceutical compositions with iRNA and cyclodextrins can be found in US Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

A. Encoded by the iRNA vector of the present invention.

iRNA targeting the HBV gene can be expressed by transcription units inserted into DNA or RNA vectors (see, for example, Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A ., et al., PCT International Publication No. WO 00/22113, Conrad, PCT International Publication No. WO 00/22114 and Conrad, US Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or long term (weeks to months or longer) depending on the particular construct used and the target tissue or cell type. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. Transgenes can also be designed to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

Individual iRNA strands or strands can be transcribed from the promoter of the expression vector. Two separate expression vectors can be co-introduced into the target cell (eg, by transfection or infection) to express two separate strands to produce, for example, dsRNA. Alternatively, each individual strand of dsRNA may be transcribed with promoters both of which are located on the same expression plasmid. In one embodiment, the dsRNA is expressed as inverted repeat polynucleotides linked by a linker polynucleotide sequence such that the dsRNA has a stem-loop structure.

iRNA expression vectors are typically DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to generate recombinant constructs for the expression of iRNA as described herein. Expression vectors for eukaryotic cells are well known in the art and are available from a number of commercial sources. Typically, such vectors are contemplated to contain suitable restriction sites for inserting the desired nucleic acid segment. Delivery of iRNA-expressing vectors can be systemic, such as by intravenous or intramuscular administration, by introduction into target cells explanted from the patient followed by reintroduction into the patient, or by any other method that allows introduction into the desired target cell.

Target cells can be transfected with iRNA expression plasmids complexed with cationic lipid carriers (eg oligofectamine) or non-cationic lipid carriers (eg Transit-TKO™). The present invention also contemplates multiple lipid-assisted transfections for iRNA-mediated knockdowns targeting different regions of the target RNA over a period of a week or more. The successful introduction of vectors into host cells can be controlled using a variety of known methods. For example, transient transfection can be detected using a reporter such as a fluorescent marker such as green fluorescent protein (GFP). Stable transfection of cells ex vivo can be confirmed using markers that confer resistance to the transfected

- 70 039127 cells to certain environmental factors (eg antibiotics and drugs), such as resistance to hygromycin B.

Viral vector systems that can be used with the methods and compositions described herein include, without limitation, (a) adenovirus vectors; (b) retroviral vectors, including, but not limited to, lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex vectors; (e) SV40 based vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) poxvirus vectors such as orthopox, eg vaccinia vectors, or avipox, eg canaripox or fowl pox; and (j) helper dependent or weak adenovirus. Viruses that are replication defective may also be advantageous. Various vectors will integrate into the genome of cells or will not integrate into the genome of cells. If necessary, the constructs may include viral sequences for transfection. Alternatively, the construct may be included in vectors capable of episomal replication, such as EPV and EBV vectors. Constructs for recombinant iRNA expression will typically require regulatory elements, eg promoters, enhancers, etc., to ensure iRNA expression in target cells. Other aspects to consider with respect to vectors and constructs are further described below.

Vectors useful for iRNA delivery will include regulatory elements (promoter, enhancer, etc.) sufficient for iRNA expression in the desired target cell or tissue. Regulatory elements can be selected to obtain either constitutive or regulated/inducible expression.

iRNA expression can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, such as blood glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems suitable for directing dsRNA expression in cells or mammals include, for example, regulation with ecdysone, estrogen, progesterone, tetracycline, dimerization chemical inducers, and isopropyl-beta-D1 thiogalactopyranoside (IPTG). One skilled in the art will be able to select the appropriate regulatory/promoter sequence based on the intended use of the iRNA transgene.

You can use viral vectors that contain nucleic acid sequences encoding iRNA.

For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for proper packaging of the viral genome and integration into the DNA of the host cell. The nucleic acid sequences encoding the iRNA are cloned into one or more vectors that facilitate delivery of the nucleic acid to a patient. A more detailed description of retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells to render the stem cells more resistant to chemotherapy. Other sources illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al. Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in US Pat. Nos. 6,143,520; 5665557 and 5981276, which are incorporated herein by reference.

Adenoviruses are also contemplated for use in iRNA delivery of the present invention. Adenoviruses are particularly promising carriers, for example, for delivering genes to the epithelium of the respiratory tract. Adenoviruses naturally infect the epithelium of the respiratory tract, where they cause mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) is a review of adenovirus gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenoviral vectors for gene transfer into the respiratory tract epithelium of rhesus monkeys. Other examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225234 (1993); publications according to PCT WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing an iRNA of the present invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to target cells are described in Xia H et al. (2002), Nat. Biotech. 20:1006-1010.

Adeno-associated virus (AAV) vectors can also be used to deliver the iRNA of the present invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993), US Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate

- 71 039127 complementary single-stranded RNA molecules using a recombinant AAV vector, for example, either with RNA promoters, U6 or H1, or with the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expression of the dsRNA described in the present invention, methods for constructing a recombinant AAV vector, and methods for delivering the vectors to target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher KJ et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; US patent No. 5252479; US patent No. 5139941; International Patent Application No. WO 94/13788 and International Patent Application No. WO 93/24641, the entire disclosure of which is incorporated herein by reference.

Another viral vector suitable for delivery of the iRNA of the present invention is a poxvirus such as vaccinia virus, for example attenuated vaccinia virus such as modified Ankara virus (MVA) or NYVAC, avipoxvirus such as fowlpox or smallpox canaries.

If necessary, the tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by replacing different viral capsid proteins. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies virus, Ebola virus, Mokola virus, and the like. AAV vectors can be made to target different cells by constructing the vectors to express different capsid protein serotypes; see, for example, Rabinowitz JE et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

The vector-based pharmaceutical formulation may include the vector in a suitable diluent, or may include a sustained release matrix that includes a gene delivery vehicle. Alternatively, in the case where the whole gene delivery vector can be produced natively by recombinant cells, such as retroviral vectors, then the pharmaceutical formulation can include one or more cells that produce the gene delivery system.

VI. Pharmaceutical compositions of the present invention.

The present invention also includes pharmaceutical compositions and formulations that include the iRNA of the present invention. In one embodiment, provided herein are pharmaceutical compositions containing the iRNAs described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing iRNA are useful in the treatment of a disease or disorder associated with HBV gene expression or activity. Such pharmaceutical compositions are formulated depending on the mode of delivery. One example are compositions that are formulated for systemic administration via parenteral delivery, eg subcutaneous (SC) or intravenous (IV) delivery. Another example are compositions that are formulated for direct delivery to the brain parenchyma, for example by infusion into the brain, such as continuous infusion with a pump. Pharmaceutical compositions of the present invention may be administered at doses sufficient to inhibit HBV gene expression.

In one embodiment, the iRNA-based agent of the present invention is administered to a subject as a dose by weight. The dose by weight (eg, dose in mg/kg) is the dose of the iRNA-based agent, which will vary with the weight of the subject. In another embodiment, the iRNA-based agent is administered to the subject as a fixed dose. A fixed dose (eg, dose in mg) means that a single dose of an iRNA-based agent is administered to all subjects, regardless of any specific subject-related factors such as weight. In one specific embodiment, the fixed dose of an iRNA-based agent of the present invention is based on a predetermined weight or age.

Typically, an acceptable dose of iRNA of the present invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg /kg, approximately 3 mg/kg, approximately 10 mg/kg, approximately 20 mg/kg, approximately 30 mg/kg, approximately 40 mg/kg or approximately 50 mg/kg per single dose.

For example, dsRNA can be administered at a dose of approximately

0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1,

1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3,

- 72 039127

2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5,3.6,

3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8,4.9,

5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6, 3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4,7.5,

7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7,8.8,

8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8,9.9

Or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0. 75 to about 50 mg/kg, about 1 to about 50 mg/kg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/k g, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/kg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, from about 10 to about 45 mg/kg, from approx. 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, from about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg /kg, from about 0.5 to about 40 mg/kg, from about 0.75 to about 40 mg/kg, from about 1 to about 40 mg/kg, from about 1.5 to about 40 mg/kg, from about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg /kg, from about 4.5 to about 40 mg/kg, from about 5 to approx. about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about about 30 mg/kg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 3 0 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, from about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg , from about 0.25 to about 20 mg/kg, from about 0.5 to about 20 mg/kg, from about 0.75 to about 20 mg/kg, from about 1 to about 20 mg/kg, from about 1 .5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg /kg, from about 4 to about 20 mg/kg, from about 4.5 to about 20 mg/kg, from n about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about

- 73 039127 about 20 mg/kg or about 15 to about 20 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of approximately

0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08,

0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4,2.5,

2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7,3.8,

3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1,

5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3,6.4,

6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6,7.7,

7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9,

9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9 or approximately mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In another embodiment, the dsRNA is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/kg, about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, from about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/kg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, from about 25 to about 45 mg/kg, from about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.5 to about 40 mg/kg, from about 0.75 to about 40 mg/kg, from about 1 to about 40 mg/kg, from about 1.5 to about 40 mg/kg, from about 2 to about 40 mg/kg, from about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/kg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, from about 20 to about 30 mg/kg, from about 25 to about 30 mg/kg, from about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/kg, about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about

- 74 039127 about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg /kg or from about 15 to about 20 mg/kg. In one embodiment, the dsRNA is administered at a dose of about 10 mg/kg to about 30 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, subjects can be administered, for example, subcutaneously or intravenously, a single therapeutic amount of iRNA, such as approximately

0, 1, 0, 125, 0, 15, 0, 175, 0.2, 0.225, 0.25, 0.275,

0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525,

0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775,

0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1, 1, 1.2,

1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4,2.5,

2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7,3.8,

3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1,

5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3,6.4,

6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6,7.7,

7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9,

9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5,

12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5,18,

18.5, 19, 19, 5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24,

24.5, 25, 25, 5, 26, 26, 5, 27, 27.5, 28, 28.5, 29, 29, 5, 30.31,

32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45.46,

47, 48, 49 or approximately 50 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In some embodiments, subjects are administered, for example, subcutaneously or intravenously, multiple doses of a therapeutic amount of iRNA, such as a dose of approximately

0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275,

0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0, 7, 0.725, 0.75, 0.775,

0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2,

1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4,2.5,

2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7,3.8,

3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1,

5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3,6.4,

6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6,7.7,

7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9,

9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5,

12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5,18,

18.5, 19, 19, 5, 20, 20, 5, 21, 21.5, 22, 22.5, 23, 23.5, 24,

24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30.31,

32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45.46,

47, 48, 49 or approximately 50 mg/kg. A multi-dose regimen may include administering a therapeutic amount of iRNA daily, for example, for two days, three days, four days, five days, six days, seven days, or longer.

In other embodiments, subjects are administered, for example, subcutaneously or intravenously, a repeated dose of a therapeutic amount of iRNA, such as a dose of approximately

- 75 039127

0, 1, 0, 125, 0, 15, 0, 175, 0.2, 0.225, 0.25, 0.275,

0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0, 625, 0.65, 0, 675, 0.7, 0.725, 0.75, 0.775,

0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1, 1, 1.2,

1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, , 2.7, 2.82.6, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3 .9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2 , 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4,

6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6,7.7,

7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9, 1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5,

12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5,18,

18.5, 19, 19, 5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24,

24.5, 25, 25, 5, 26, 26, 5, 27, 27.5, 28, 28.5, 29, 29, 5, 30.31,

32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45.46,

47, 48, 49 or approximately 50 mg/kg. A repeat dose regimen may include administering a therapeutic amount of iRNA on a regular basis, such as once every two days, once every three days, once every four days, twice a week, once a week, once every two weeks or once a month.

In certain embodiments, for example, where a composition of the present invention comprises a dsRNA as described herein and a lipid, a therapeutic amount of iRNA may be administered to subjects, for example, from about 0.01 to about 5 mg/kg, from about 0 01 to about 10 mg/kg, about 0.05 to about 5 mg/kg, about 0.05 to about 10 mg/kg, about 0.1 to about 5 mg/kg, about 0.1 to about 10 mg/kg, from about 0.2 to about 5 mg/kg, from about 0.2 to about 10 mg/kg, from about 0.3 to about 5 mg/kg, from about 0.3 to about 10 mg/kg, about 0.4 to about 5 mg/kg, about 0.4 to about 10 mg/kg, about 0.5 to about 5 mg/kg, about 0.5 to about 10 mg /kg, from about 1 to about 5 mg/kg, from about 1 to n about 10 mg/kg, about 1.5 to about 5 mg/kg, about 1.5 to about 10 mg/kg, about 2 to about 2.5 mg/kg, about 2 to about 10 mg/kg kg, about 3 to about 5 mg/kg, about about 3 to about 10 mg/kg, about 3.5 to about 5 mg/kg, about 4 to about 5 mg/kg, about 4, 5 to about 5 mg/kg, about 4 to about 10 mg/kg, about 4.5 to about 10 mg/kg, about 5 to about 10 mg/kg, about 5.5 to about 10 mg/kg kg, about 6 to about 10 mg/kg, about 6.5 to about 10 mg/kg, about 7 to about 10 mg/kg, about 7.5 to about 10 mg/kg, about 8 to about 10 mg/kg, about 8.5 to about 10 mg/kg, about 9 to approx. at least 10 mg/kg, or about 9.5 to about 10 mg/kg.

Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of approximately

0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1,

1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3,

2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5,3.6,

3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8,4.9,

5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2,

6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4,7.5,

7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7,8.8,

8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8,9.9

Or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In certain embodiments of the present invention, for example, when the double-stranded RNAi agent includes a modification (e.g., one or more motifs of three identical modifications of three consecutive nucleotides) comprising one such motif at or near the agent's cleavage site, six phosphorothioate bonds and a ligand, such an agent is administered at a dose of from about 0.01 to about 0.5 mg/kg, from about 0.01 to

- 76 039127 about 0.4 mg/kg, about 0.01 to about 0.3 mg/kg, about 0.01 to about 0.2 mg/kg, about 0.01 to about 0.1 mg /kg, from about 0.01 to about 0.09 mg/kg, from about 0.01 to about 0.08 mg/kg, from about 0.01 to about 0.07 mg/kg, from about 0.01 to about 0.06 mg/kg, from about 0.01 to about 0.05 mg/kg, from about 0.02 to about 0.5 mg/kg, from about 0.02 to about 0.4 mg/kg , from about 0.02 to about 0.3 mg/kg, from about 0.02 to about 0.2 mg/kg, from about 0.02 to about 0.1 mg/kg, from about 0.02 to about 0.09 mg/kg, from about 0.02 to about 0.08 mg/kg, from about 0.02 to about 0.07 mg/kg, from about 0.02 to about 0.06 mg/kg, from about 0.02 to about 0.05 mg/kg, from about about 0.03 to about 0.5 mg/kg, about 0.03 to about 0.4 mg/kg, about 0.03 to about 0.3 mg/kg, about 0.03 to about 0, 2 mg/kg, about 0.03 to about 0.1 mg/kg, about 0.03 to about 0.09 mg/kg, about 0.03 to about 0.08 mg/kg, about 0 03 to about 0.07 mg/kg, about 0.03 to about 0.06 mg/kg, about 0.03 to about 0.05 mg/kg, about 0.04 to about 0.5 mg /kg, from about 0.04 to about 0.4 mg/kg, from about 0.04 to about 0.3 mg/kg, from about 0.04 to about 0.2 mg/kg, from about 0.04 to about 0.1 mg/kg, from about 0.04 to about 0.09 mg/kg, from about 0.04 to about 0.08 mg/kg, from about 0.04 to about 0.07 mg/kg , from about 0.04 to about 0.06 mg/kg, from about 0 .05 to about 0.5 mg/kg, about 0.05 to about 0.4 mg/kg, about 0.05 to about 0.3 mg/kg, about 0.05 to about 0.2 mg /kg, from about 0.05 to about 0.1 mg/kg, from about 0.05 to about 0.09 mg/kg, from about 0.05 to about 0.08 mg/kg, or from about 0.05 up to about 0.07 mg/kg. Values and ranges intermediate to the above values are also part of the present invention, for example, an RNAi agent may be administered to a subject at a dose of about 0.015 mg/kg to about 0.45 mg/kg.

For example, an RNAi agent, eg, an RNAi agent in a pharmaceutical composition, can be administered at a dose of about 0.01; 0.0125; 0.015; 0.0175; 0.02; 0.0225; 0.025; 0.0275; 0.03; 0.0325; 0.035; 0.0375; 0.04; 0.0425; 0.045; 0.0475; 0.05; 0.0525; 0.055; 0.0575; 0.06; 0.0625; 0.065; 0.0675; 0.07; 0.0725; 0.075; 0.0775; 0.08; 0.0825; 0.085; 0.0875; 0.09; 0.0925; 0.095; 0.0975; 0.1; 0.125; 0.15; 0.175; 0.2; 0.225; 0.25; 0.275; 0.3; 0.325; 0.35; 0.375; 0.4; 0.425; 0.45; 0.475 mg/kg or approximately 0.5 mg/kg. Values intermediate to those listed are also part of the present invention.

In some embodiments, the RNAi agent is administered at a fixed dose of about 100 to about 900 mg, such as about 100 to about 850 mg, about 100 to about 800 mg, about 100 to about very well very well very well

AT

750

650

550

850

750

650

550

850

750

650

550

850

750

650 mg, mg, mg, mg, mg, mg, mg, mg, mg, mg, mg, mg, mg, mg, from from from from from from from from from from from from from about 100 about 100 about 100 about 200 approx. 200 approx. 200 approx. 200 approx. 300 approx. 300 approx. 300 approx. , approximately 700 mg, approximately 600 mg, approximately 500 mg, approximately 800 mg, approximately 700 mg, approximately 600 mg, approximately 500 mg, approximately 800 mg, approximately 700 mg, approximately 600 mg, from from from from from from from from from from from from from from from approximately 100 approximately 100 approximately 200 approximately 200 approximately 200 approximately 200 approximately 300 approximately 300 approximately 300 approximately 300 approximately 400 approximately 40 0 about 400 about 400 up to up to up to up to up to up to up to up to approximately approximately approximately approximately approximately approximately approximately approximately approximately approximately approximately 550 mg or approximately 400 to approximately 500 mg.

in some embodiments, the RNAi agent is administered at a fixed dose of about 100 mg, about 125 mg, about 150 mg, about 175 mg, 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg , approximately 350 mg, approximately 375 mg, approximately 400 mg, approximately 425 mg, approximately 450 mg, approximately 475 mg, approximately 500 mg, approximately 525 mg, approximately 550 mg, approximately 575 mg, approximately 600 mg, approximately 625 mg, approximately 650 mg, about 675 mg, about 700 mg, about 725 mg, about 750 mg, about 775 mg, about 800 mg, about 825 mg, about 850 mg, about 875 mg, or about 900 mg.

The pharmaceutical composition may be administered by intravenous infusion over a period of time such as over periods 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20 and 21, 22, 23, 24 or approximately 25 min. Administration can be repeated, for example, regularly, such as once a week, once every two weeks (ie every two weeks) for one month, two months, three months, four months or longer. After the primary treatment regimen, drugs can be administered at a reduced frequency. For example, after administration once a week or once every two weeks for three months, the administration can be repeated once a month for six months, or a year, or longer.

The pharmaceutical composition may be administered once a day, or the iRNA may be administered in two, three or more dose portions at regular intervals throughout the day, or even by continuous infusion or delivery via a controlled release formulation. In such a case, the amount of iRNA contained in each portion of the dose should be correspondingly less to provide a total daily dose. The dosage unit can also be formulated for delivery over several days, for example using a conventional sustained release formulation that provides sustained release of the iRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents to a specific site, for example they can be used with the agents of the present invention. In this embodiment, the dosage unit contains the appropriate amount of the daily dose.

In other embodiments, a single dose of the pharmaceutical compositions may be long-acting such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days, or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered once a week. In other embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered twice a month. In some embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered once a month, once every two months, or once a quarter (ie every three months).

One of ordinary skill in the art will appreciate that certain factors may influence the dose and time frame required to effectively treat a subject, including, without limitation, the severity of the disease or disorder, types of prior treatment, the subject's general health and/or age, and other underlying medical conditions. . In addition, treatment of a subject with a therapeutically effective amount of the composition may include a single treatment period or a series of treatment periods. Calculations of effective doses and in vivo half-lives for individual iRNAs encompassed by the present invention can be made using conventional methodologies or based on in vivo testing using an appropriate animal model, as described elsewhere herein.

The pharmaceutical compositions of the present invention can be administered in a variety of ways depending on whether local or systemic treatment is needed and on the area to be treated. Administration can be topical (eg, via a transdermal patch), pulmonary, eg, by inhalation or insufflation of powders or aerosols, including via an inhaler; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example, by means of an implanted device; or intracranial, eg intraparenchymal, intrathecal or intraventricular administration.

The iRNA can be delivered in such a way that a specific tissue such as the liver (eg, liver hepatocytes) is targeted.

Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powdered or oily bases, thickeners, and the like may be necessary or desirable. Condoms, coated gloves, and the like may also be used. Suitable formulations for topical administration include those in which the iRNAs of the present invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (eg, dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine), negatively charged (eg, dimyristoylphosphatidylglycerol (DMPG)) and cationic (eg, dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidylethanolamine (DOTMA)). The iRNAs described in the present invention may be encapsulated in or complexed with liposomes, in particular with cationic liposomes. Alternatively, iRNAs can form complexes with lipids, in particular cationic lipids. Suitable fatty acids and esters include, without limitation, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristi

- 78 039127 new acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl-1-monocaprate, 1-dodecylazacycloheptan-2one, acylcarnitine, acylcholine or _{C1_20} alkyl esters (for example, isopropyl myristate (IPM)), monoglyceride, diglyceride or a pharmaceutically acceptable salt thereof. Formulations for topical administration are detailed in US Pat. No. 6,747,014, which is incorporated herein by reference.

A. iRNA-based formulations containing iRNA membrane molecular assemblies for use in the compositions and methods of the present invention can be formulated to be delivered in a membrane molecular assembly, eg, liposome or micelle. As used herein, the term liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, eg, one bilayer or multiple bilayers. Liposomes include single-layer and multilayer vesicles that have a membrane formed from a lipophilic material and an aqueous internal environment. The aqueous portion contains an iRNA-based composition. The lipophilic material separates an aqueous internal environment from an aqueous external environment, which typically does not include an iRNA-based composition, although in some examples it may. Liposomes are useful for carrying and delivering active ingredients to their site of action. Due to the fact that the liposome membrane is structurally similar to biological membranes, when liposomes are introduced into the tissue, the bilayer of the liposome merges with the bilayer of cell membranes. As the fusion of the liposome and the cell proceeds, the internal water content, which includes the iRNA, is delivered to the cell, where the iRNA can specifically bind to the target RNA and can mediate the iRNA. In some cases, liposomes are also specifically targeting, for example, to direct iRNA to specific cell types.

Liposomes containing the iRNA-based agent can be obtained using a number of methods. In one example, the lipid component of the liposome is dissolved in a detergent to form micelles from the lipid component. For example, the lipid component may be an amphipathic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be non-ionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroylsarcosine. The iRNA agent preparation is then added to micelles that include a lipid component. The cationic groups of the lipid interact with the iRNA-based agent and condense around the iRNA-based agent to form a liposome. After condensation, the detergent is removed, for example by dialysis, to obtain a liposome preparation with an iRNA-based agent.

If necessary, a carrier compound that promotes condensation may be added during the course of the condensation reaction, for example by controlled addition. For example, the carrier compound may be a polymer other than a nucleic acid (eg, spermine or spermidine). You can also adjust the pH to promote condensation.

Methods for preparing stable polynucleotide delivery agents that include a polynucleotide/cationic lipid complex as structural components of the delivery agents are further described, for example, in WO 96/37194, the entire contents of which are incorporated herein by reference. The formation of liposomes may also include one or more aspects of the exemplary methods described in Feigner, P. L. et al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987; US Pat. No. 4,897,355; US patent No. 5171678; Bangham, et al., M. Mol. Biol. 23:238, 1965; Olson, et al., Biochim. Biophys. Acta 557:9, 1979; Szoka, et al., Proc. Natl. Acad. sci. 75:4194, 1978; Mayhew, et al., Biochim. Biophys. Acta 775:169, 1984; Kim, et al., Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al., Endocrinol. 115:757, 1984. Commonly used techniques for obtaining appropriately sized lipid aggregates for use as delivery vehicles include sonication and freeze-thaw extrusion (see, for example, Mayer, et al., Biochim. Biophys. Acta 858:161 , 1986). Microfluidization can be used where consistently small (50 to 200 nm) and relatively uniform aggregates are needed (Mayhew, et al., Biochim. Biophys. Acta 775:169, 1984). Such methods are readily adaptable to the packaging of iRNA-based agent formulations in liposomes.

Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized into the endosome. Due to the acidic pH within the endosome, the liposomes rupture, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

Liposomes that are pH sensitive or negatively charged take up nucleic acids instead of complexing with them. Since both nucleic acid and lipid have the same charge, repulsion occurs instead of complex formation. However, some of the nucleic acids are captured by the aqueous internal environment of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Exogenous gene expression was detected in target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One main type of liposome compositions includes phospholipids other than naturally occurring phosphatidylcholine. Compositions for neutral liposomes, for example, can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Formulations for anionic liposomes are generally formed from dimyristoylphosphatidylglycerol, while anionic fusogenic liposomes are formed predominantly from dioleylphosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC), such as, for example, soybean PC and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

Examples of other methods for introducing liposomes into cells in vitro and in vivo include US Pat. Nos. 5,283,185; 5171678; WO 94/00569; W093/24640; WO 91/16024; Feigner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.

Non-ionic liposomal systems have also been investigated to determine their suitability for delivering drugs to the skin, in particular systems containing a non-ionic surfactant and cholesterol. Nonionic liposome formulations containing Novasome™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A to the dermal layer of the skin of mice. The results showed that such non-ionic liposomal systems were effective in providing deposition of cyclosporin A in various layers of the skin (Hu et al., S.T.P. Pharma. Sci., 1994, 4(6) 466).

Liposomes also include spatially stabilized liposomes, the term used herein refers to liposomes containing one or more specialized lipids which, when incorporated into liposomes, result in an increased circulating half-life compared to liposomes that lack such specialized lipids. Examples of sterically stabilized liposomes are those in which the vesicle-forming lipid component portion of the liposome (A) contains one or more glycolipids, such as monosialoganglioside G _M1 , or (B) is derived from one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Without wishing to be bound by any particular theory, it is believed in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derived lipids, the increased circulating half-life of these sterically stabilized liposomes results from reduced uptake by reticuloendothelial cells. systems (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (All. NY Acad. Sci., 1987, 507, 64) described the ability of monosialoganglioside G _M1 , galactocerebroside sulfate and phosphatidylinositol to increase the blood half-life of liposomes. These findings have been commented on by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). US Pat. No. 4,837,028 and WO 88/04924, both of which belong to Allen et al., disclose liposomes containing (1) sphingomyelin and (2) ganglioside G _M1 or galactocerebroside sulfate ester. US Pat. No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).

In one embodiment, cationic liposomes are used. The advantage of cationic liposomes is that they are able to fuse with the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver iRNA-based agents to macrophages.

Additional advantages of liposomes include the following: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can include a wide range of water and fat soluble drugs; liposomes can protect encapsulated iRNA-based agents in internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important factors to consider when preparing liposome formulations are lipid surface charge, vesicle size, and liposome water volume.

A positively charged synthetic cationic lipid, N-[1-(2,3dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), can be used to form small liposomes that spontaneously interact with nucleic acid to form lipid-nucleic acid complexes. acid that are able to fuse with negatively charged cell membrane lipids of tissue culture cells resulting in the delivery of an iRNA-based agent (see, e.g., Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413- 7417, 1987 and US Pat. No. 4,897,355 for describing DOTMA and its use with DNA).

The DOTMA analog, 1,2-bis(oleoyloxy)-3-(trimethylammonium)propane (DOTAP), can be used in combination with a phospholipid to form vesicles complexed with DNA. Lipofectin™ (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective vehicle for delivering highly anionic nucleic acids to living tissue culture cells that contains positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. The net charge of the resulting complexes is also positive when liposomes with a sufficient positive charge are used. The positively charged complexes produced in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and effectively deliver functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3(trimethylammonium)propane (DOTAP) (Boehringer Mannheim, Indianapolis, IN), differs from DOTMA in that the oleyl moieties are ester-linked rather than ether-linked. .

Other published compounds with cationic lipids include those that have been conjugated to a number of moieties, including, for example, carboxyspermine, which has been conjugated to one of two types of lipids, and includes compounds such as 5carboxyspermylglycine dioctaoleoilamide (DOGS) (Transfectam™, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermylamide (DPPES) (see, for example, US Pat. No. 5,171,678).

Another cationic lipid conjugate involves cholesterol-assisted lipid derivatization (DC-Choi) that have been formulated as liposomes in combination with DOPE (see, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysin obtained by conjugation of polylysine with DOPE has been reported to be effective for transfection in the presence of blood serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). In certain cell lines, such liposomes containing conjugated cationic lipids are reported to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing formulations. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, CA) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, MD). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposomal formulations are particularly suitable for topical administration, with liposomes having some advantages over other formulations. Such advantages include reduced side effects in relation to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer the iRNA-based agent into the skin. In some embodiments, liposomes are used to deliver the iRNA agent to epidermal cells, as well as to enhance the penetration of the iRNA agent into dermal tissues, such as the skin. For example, liposomes can be administered topically. Topical delivery of drugs formulated as liposomes to the skin has been described (see, for example, Weiner et al., Journal of Drug Targeting, 1992, vol. 2,405-410 and du Plessis et al., Antiviral Research, 18, 1992 , 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al. Gene 56:267-276. 1987; Nicolau, C et al., Meth. Enz. 149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:78517855, 1987).

Non-ionic liposomal systems have also been investigated to determine their suitability for delivering drugs to the skin, in particular systems containing a non-ionic surfactant and cholesterol. Nonionic liposome formulations containing Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver the drug to the dermis of the skin of mice. Such iRNA-based formulations are useful in the treatment of a dermatological disorder.

Liposomes that include iRNA can be made with high deformability. This deformability may allow liposomes to penetrate through a pore that is smaller than the average radius of the liposome. For example, a type of deformable liposomes are transfersomes. Transferosomes can be prepared by adding surface boundary activators, usually surfactants, to a standard liposomal formulation. Transfersomes that include an iRNA-based agent can be delivered, for example, subcutaneously by injection to deliver the iRNA-based agent to keratinocytes in the skin. In order to pass through intact mammalian skin, lipid vesicles must pass through a series of small pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. In addition, due to the properties of lipids, such transferosomes can be self-optimizing (adapting to the shape of pores, for example, in the skin), self-healing, and often can reach their targets without fragmentation, and can often be self-loading.

Other formulations suitable for the practice of the present invention are described, for example, in PCT Publication No. WO 2008/042973, the entire contents of which are incorporated herein by reference.

Transfersomes are another type of liposomes and are highly deformable lipid aggregates that are promising candidates for drug delivery. Transfersomes can be described as lipid droplets that are so highly deformable that they can easily penetrate through pores smaller than droplets. . Transfersomes are adaptable to the environment in which they are used, for example, they are self-optimizing (adapt to the shape of skin pores), self-healing, often reach their targets without fragmentation, and can often be self-loading. For transfersome preparation, surface boundary activators, typically surfactants, can be added to the standard liposomal formulation. Transfersomes were used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants find wide use in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is by using the hydrophilic-lipophilic balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most efficient means of categorizing the various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285 ).

If the surfactant molecule is not ionized, then it is classified as a nonionic surfactant. Nonionic surfactants find wide use in pharmaceutical and cosmetic products and are used over a wide range of pH values. Typically, their HLB values range from 2 to about 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanoamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols and ethoxylated/propoxylated block copolymers are also included in this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.

If a surfactant molecule carries a negative charge when dissolved or dispersed in water, then the surfactant is classified as anionic. Anionic surfactants include carboxylates, such as saponifiers, acyl lactylates, amino acid acylamides, sulfuric acid esters, such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates, such as alkyl benzene sulfonates, acyl isethionates, acyl taurates, and sulfosuccinates, and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and saponifiers.

If the surfactant molecule carries a positive charge when dissolved or dispersed in water, then the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used representatives of this class.

If a surfactant molecule has the ability to carry both a positive and a negative charge, then the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkyl amides, N-alkyl betaines, and phosphatides.

The use of surfactants in formulations and emulsions has been considered (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

iRNA for use in the methods of the present invention may also be provided in micellar formulations. Micelles are defined herein as a particular type of molecular assembly in which the amphipathic molecules are arranged in a spherical structure such that all hydrophobic portions of the molecules are directed inwards, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The opposite arrangement occurs if the environment is hydrophobic.

A mixed micellar formulation suitable for transdermal membrane delivery can be prepared by mixing an aqueous solution of the siRNA based formulation, alkali metal C8-C22 alkyl sulfate and micelle forming compounds. Exemplary micellar compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, oil evening primrose, menthol, trihydroxyoxocholanyl-glycine and its pharmaceutically acceptable salts, glycerol, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and analogues, polydocanol-alkyl ethers and analogues, chenodeoxycholate, deoxycholate and mixtures thereof. The micelle-forming compounds can be added simultaneously or after the addition of the alkali metal alkyl sulfate. Mixed micelles will form with almost any type of ingredient mixing, but smaller micelles require vigorous mixing.

In one method, a first micellar composition is prepared that contains an siRNA-based composition and at least an alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micelle-forming compounds to form a mixed micellar composition. In another method, a micellar composition is prepared by mixing the siRNA-based composition, alkali metal alkyl sulfate, and at least one of the micelle-forming compounds, followed by the addition of the remaining micelle-forming compounds with vigorous stirring.

Phenol and/or m-cresol can be added to the mixed micellar composition to stabilize the composition and protect against bacterial growth. Alternatively, phenol and/or m-cresol can be added with micelle forming ingredients.

An isotonic agent such as glycerin may also be added after the mixed micellar composition has been formed.

To deliver the micellar formulation as a sprayable solution, the formulation can be placed in an aerosol dispenser and the sprayer charged with a propellant. The propellant, which is under pressure, is in liquid form in the nebulizer. The ratios of the ingredients are adjusted so that the aqueous phase and the propellant phase become one, i.e. there is one phase. If two phases are present, it is necessary to shake the atomizer before spraying a portion of the contents, for example, through a dosing valve. The nebulized dose of the pharmaceutical is forced out of the metering valve as a fine nebulized solution.

Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) can be used.

Specific concentrations of the main ingredients can be determined by relatively simple experiments. Absorption through the oral cavity often requires an increase, for example, at least doubling or tripling, the dose intended for injection or administration through the gastrointestinal tract.

B. Lipid particles.

The iRNA, eg dsRNA, of the present invention can be completely encapsulated in a lipid formulation, eg LNP or other nucleic acid-lipid particle.

As used herein, the term LNP refers to a stable lipid nucleic acid particle. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents particle aggregation (eg, a PEG-lipid conjugate). LNPs are exceptionally suitable for systemic applications because they have a long circulation life after intravenous (i.v.) injection and accumulate in distal sites (eg, sites physically separated from the injection site). LNPs include pSPLP, which includes an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The average particle diameter of the present invention is usually from about 50 nm to about 150 nm, more often from about 60 nm to about 130 nm, more often from about 70 nm to about 110 nm, most often from about 70 nm to about 90 nm, and they are practically non-toxic. In addition, nucleic acids, when present in the lipid nucleic acid particles of the present invention, are resistant to nuclease degradation in aqueous solution. Particles of nucleic acid-lipid and the method of their preparation are disclosed, for example, in US patent No. 5976567; 5981501; 6534484; 6586410; 6815432; US Publication No. 2010/0324120; and PCT Publication No. WO 96/40964.

In one embodiment, the ratio of lipid to drug (weight/weight ratio) (e.g., ratio of lipid to dsRNA) will range from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to those listed above are also considered part of the present invention.

The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3 - 83 039127 dioleoyloxy)propyl)-N,N,N-trimethylammonium (DOTAP), Na(G(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2 ,3-dioleyloxy)propylamine (DODMA), 1,2dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,Ndimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-CDAP) , 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio3 -dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.C1), chloride salt 1, 2-dilinoleoyl-3-trimethylaminopropane (DLin-TAP-Cl), 1,2-dilinoleyloxy-3-(N methylpiperazino)propane (DLin-MPZ) or 3-(N,N-dilinoleyl amino)-1,2-propanediol (DLinAP), 3-(N,Ndioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin- EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogues thereof, (3aR,5s ,6aS)-N,N-dimethyl-2,2di((9Z, 12Z)-octadeca-9,12-dienyl)tetrahydro-3аН-cyclopenta[d] [1,3]-dioxol-5-amine (ALN100) , (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2 ((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1yl)ethylazandiyl)didodecan-2-ol (Tech G1) or a mixture thereof. The cationic lipid may comprise from about 20 mole % to about 50 mole % or about 40 mole % of the total lipid present in the particle.

In another embodiment, the compound 2,2-dilinoleyl-4dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in US Provisional Application No. 61/107998, filed October 23, 2008, which is incorporated herein by reference.

In one embodiment, the lipid-siRNA particle comprises 40% 2,2-dilinoleyl4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% cholesterol: 10% PEG-C-DOMG (mole percent) with size particles of 63.0 ± 20 nm and an siRNA/lipid ratio of 0.027.

The ionizable/noncationic lipid may be an anionic lipid or a neutral lipid, including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-Omonomethyl-PE, 16-O-dimethyl-PE, 18-1-trans-PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, or a mixture thereof. The content of non-cationic lipid can be from about 5 mol.% to about 90 mol.%, about 10 mol.% or about 58 mol.%, if cholesterol is included, of the total lipid content present in the particle.

The conjugated lipid that prevents particle aggregation can be, for example, a polyethylene glycol (PEG)-lipid conjugate, including but not limited to PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Ceg ) or a mixture of them. The PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl (Ci2), PEGdimyristoyloxypropyl (Ci ₄ ), PEG-dipalmityloxypropyl (Ci ₆ ) or PEG-distearyloxypropyl (Ci ₈ ). The content of conjugated lipid, which prevents particle aggregation, can be from 0 mol.% to about 20 mol.% or about 2 mol.% of the total lipid content present in the particle.

In some embodiments, the lipid nucleic acid particle further comprises cholesterol in an amount, for example, from about 10 mol% to about 60 mol% or about 48 mol% of the total lipid present in the particle.

In one embodiment, lipidoid ND98-4HCl (MW 1487) (see US Patent Application No. 12/056230, filed March 26, 2008, which is incorporated herein by reference), cholesterol (Sigma-Aldrich) and PEG-ceramide C16 (Avanti Polar Lipids) can be used to produce lipid-dsRNA nanoparticles (ie LNP01 particles). Ethanol stock solutions of each can be prepared as follows: ND98, 133 mg/mL; cholesterol, 25 mg/ml, PEG-ceramide C16, 100 mg/ml. The stock solutions of ND98, cholesterol and PEG-ceramide C16 can then be combined, for example, in a molar ratio of 42:48:10. The combined lipid solution can be mixed with an aqueous solution of dsRNA (eg, in sodium acetate, pH 5) such that the final ethanol concentration is approximately 35-45% and the final sodium acetate concentration is approximately 100-300 mM. Lipid-dsRNA-based nanoparticles usually form spontaneously upon mixing. Depending on the required particle size distribution, the resulting mixture of nanoparticles

- 84 039127 can be extruded through a polycarbonate membrane (for example, with a size cutoff of 100 nm) using, for example, a thermo-cylinder extruder such as the Lipex Extruder (Northern Lipids, Inc.). In some cases, the extrusion step can be skipped. Removal of ethanol and simultaneous replacement of the buffer can be carried out, for example, using dialysis or tangential flow filtration. The buffer can be replaced with, for example, phosphate buffered saline (PBS) with a pH of about 7, such as a pH of about 6.9, a pH of about 7.0, a pH of about 7.1, a pH of about 7.2, a pH of about 7.3, or a pH of about 7.4.

Formula 1

ND98

LNP01 formulations are described, for example, in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.

Additional exemplary lipid-dsRNA formulations are described in Table 1. one.

Table 1

Ionizable/cationic lipid Cationic lipid/non-cationic lipid/cholesterol/PEGlipid conjugate Lipid : siRNA ratio SNALP -one 1,2-dilinolenyloxy-N,Ndimethylaminopropane (DLinDMA) DLinDMA/DPRS/cholesterol/PEG-eDMA (57.1/7.1/34.4/1.4) lipid:siRNA ~ 7:1 2-XTC 2,2-dilinoleyl-4- dimethylaminoethyl-[1,3]-dioxolane (XTS) XTS/ORRS/cholesterol/PEG-cDMA 57.1/7.1/34.4/1.4 lipid:siRNA ~ 7:1 LNP05 2,2-dilinoleyl-4- dimethylaminoethyl-[1,3]-dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 57.5/7.5/31.5/3.5 lipid:siRNA ~ 6:1 LNP06 2,2-dilinoleyl-4- dimethylaminoethyl-[1,3]-dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 57.5/7.5/31.5/3.5 lipid:siRNA ~ 11:1 LNP07 2,2-dilinoleyl-4- dimethylaminoethyl-[1,3]-dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 60/7.5/31/1.5 lipid:siRNA ~ 6:1 LNP08 2,2-dilinoleyl-4- dimethylaminoethyl-[1,3]-dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 60/7.5/31/1.5 lipid:siRNA ~ 11:1 LNP09 2,2-dilinoleyl-4- dimethylaminoethyl-[1,3]-dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 50/10/38.5/1.5 lipid:siRNA 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2- di((9Z,12Z)-octadeca-9,12- dienyl)tetrahydro-ZaH- cyclopenta[d][1,3]dioxol-5-amine (ALN100) ALN100/DSPC/cholecterin/PEG-DMG 50/10/38.5/1.5 lipid:siRNA 10:1

-85 039127

LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta- 6,9,28,31-tetraen-19-yl-4- (dimethylamino)butanoate (MSZ) MS-3/ORR/cholesterol/PEG-DMG 50/10/38.5/1.5 lipid:siRNA 10:1 LNP12 1,1'- (2-(4-(2-((2-(bis(2hydroxydodecyl)amino)ethyl)(2hydroxydodecyl)amino)ethyl)piper azine-1- yl)ethylazandiyl)didodecan-2-ol (Tech G1) Tech 61/03PC/cholesterol/PE6-0M6 50/10/38.5/1.5 lipid:siRNA 10:1 LNP13 XTS XTC/DSPC/cholest/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 33:1 LNP14 MSZ MRZ/OZRS/cholest./PEG-DMG 40/15/40/5 lipid:siRNA: 11:1 LNP15 MSZ MRZ/ORS/cholest./PEG-DSG/GalNAc- PEG-DSG 50/10/35/4.5/0.5 lipid:siRNA: 11:1 LNP16 MSZ MSZ/ORS/cholest/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 7:1 LNP17 MSZ MRZ/ORS/cholest/PEG-DSG 50/10/38.5/1.5 lipid:siRNA: 10:1 LNP18 MSZ MRZ/ORS/cholest/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 12:1 LNP19 MSZ MRZ/OZRS/cholest/PEG-DMG 50/10/35/5 lipid:siRNA: 8:1 LNP2 0 MSZ MRZ/ORS/cholest/PEG-DPG 50/10/38.5/1.5 lipid:siRNA: 10:1 LNP21 С12-200 C12-200/03PC/cholest/PEG-DSG 50/10/38.5/1.5 lipid:siRNA: 7:1 LNP22 XTS XTC/DSPC/cholest/PEG-DSG 50/10/38.5/1.5 lipid:siRNA: 10:1

DSPC: distearoylphosphatidylcholine;

DPPC: dipalmitoylphosphatidylcholine;

PEG-DMG: PEG-didimyristoylglycerol (C14-PEG or PEG-C14) (PEG cf.

they say weighing 2000);

PEG-DSG: PEG-distyrylglycerol (C18-PEG or PEG-C18) (PEG avg. mol.

weighing 2000);

PEG-cDMA: PEG-carbamoyl-1,2-dimyristoyloxypropylamine (PEG av. mol. wt. 2000).

Compositions containing SNALP (1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) are described in International Publication No. WO 2009/127060, filed April 15, 2009, which is incorporated by reference.

Compositions containing CTS are described, for example, in PCT Publication No. WO 2010/088537, the entire content of which is incorporated herein by reference.

Formulations containing MC3 are described, for example, in US Publication No. 2010/0324120, filed June 10, 2010, the entire content of which is incorporated herein by reference.

- 86 039127

Formulations containing ALNY-100 are described, for example, in PCT Publication No. WO 2010/054406, the entire content of which is incorporated herein by reference.

Compositions containing C12-200 are described in PCT Publication No. WO 2010/129709, the entire content of which is incorporated herein by reference.

Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous vehicles, capsules, gelatin capsules, sachets, tablets or mini-tablets. Thickening agents, flavoring agents, diluents, emulsifiers, dispersants or binders may be required. In some embodiments, oral formulations are those in which the dsRNAs described herein are administered in combination with one or more penetration enhancers, surfactants, and chelators. Suitable surfactants include fatty acids and/or their esters or salts, bile acids and/or their salts. Suitable bile acids/bile salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucocholic acid, glycocholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, tauro-24,25- sodium dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl-1-monocaprate , 1-dodecylasecycloheptan2-one, acylcarnitine, acylcholine, or monoglyceride, diglyceride, or a pharmaceutically acceptable salt (eg, sodium) thereof. In some embodiments, combinations of penetration enhancers are used, such as fatty acids/fatty acid salts in combination with bile acids/bile salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Additional penetration aids include polyoxyethylene 9-lauryl ether, polyoxyethylene 20-cetyl ether. The DsRNAs of the present invention can be delivered orally, in the form of granules, including spray-dried particles, or complexed to form micro- or nanoparticles. Complexing agents for dsRNA include poly-amino acids; polyimines; polyacrylates; polyalkyl acrylates, polyoxethanes, polyalkyl cyanoacrylates; cationic gelatins, albumins, starches, acrylates, polyethylene glycols (PEGs) and starches; polyalkyl cyanoacrylates; DEAE derivatives of polyimines, pollulans, cellulose species and starch species. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene (PTDAE), polyaminostyrene (e.g. n-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcyanoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethyl acrylate, polyhexyl acrylate, poly(D,L-lactic acid), copolymer DL-lactic and glycolic acids (PLGA), alginate and polyethylene glycol (PEG). Oral formulations for dsRNA and their preparation are described in detail in US Patent No. 6,887,906, US Patent Publication No. 20030027780, and US Patent No. 6,747,014, each of which is incorporated herein by reference.

Compositions and formulations for parenteral, intraparenchymal (brain), intrathecal, intraventricular, or intrahepatic administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other appropriate additives such as, but not limited to, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, without limitation, solutions, emulsions, and liposome-containing formulations. Such compositions can be made from a variety of components, which includes, without limitation, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. Particularly preferred are formulations that target the liver in the treatment of liver diseases such as hepatocarcinoma.

The pharmaceutical compositions of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional procedures well known in the pharmaceutical industry. Such techniques include the step of bringing the active ingredients into association with the pharmaceutical carrier(s) or excipient(s). Generally, formulations are prepared by uniformly and thoroughly bringing the active ingredients into contact with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gelatin capsules, liquid

- 87 039127 syrups, soft gels, suppositories and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may additionally contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

C. Additional formulations.

i. emulsions.

The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets, typically greater than 0.1 µm in diameter (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG. , and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York , N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p.301). Emulsions are often two-phase systems containing two immiscible liquid phases thoroughly mixed and dispersed one into the other. Typically, emulsions can be either water-in-oil (w/o) or oil-in-water (o/w) emulsions. In those cases where the aqueous phase is finely dispersed in the total volume of the oil phase and dispersed in the form of tiny droplets in it, then the resulting composition is called a water-in-oil (w/o) type emulsion. Alternatively, when the oil phase is finely atomized in and dispersed as tiny droplets in the total volume of the aqueous phase, then the resulting composition is referred to as an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution either in an aqueous phase, an oil phase, or as a separate phase itself. Pharmaceutical excipients such as emulsifiers, stabilizers, colorants and antioxidants may be present in the emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that consist of more than two phases, such as for example in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-input ( w/o/w). Such complex formulations often provide certain advantages that simple two-component emulsions do not provide. Multiple emulsions in which the individual oil droplets of the o/w emulsion include small water droplets constitute a w/o/w emulsion. Similarly, a system of oil droplets embedded in water droplets stabilized in an oily dispersion phase provides an o/w/o type emulsion.

Emulsions are characterized by low thermodynamic stability or its absence. Often the dispersed or dispersed phase of the emulsion is well dispersed in the dispersed or continuous phase and maintained in this form by means of emulsifiers or the viscosity of the composition. Any emulsion phase can be semi-solid or solid, as is the case with emulsion-like ointment bases and creams. Other methods for stabilizing emulsions include the use of emulsifiers, which can be included in any phase of the emulsion. Emulsifiers can be broadly classified into four categories: synthetic surfactants, natural emulsifiers, absorbent bases, and fine solids (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199).

Synthetic surfactants, also known as surfactants, have found widespread use in emulsion formulations and are reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are usually amphiphilic and contain hydrophilic and hydrophobic parts. The ratio of the hydrophilic and hydrophobic nature of a surfactant is referred to as the hydrophilic-lipophilic balance (HLB) and is a valuable tool in the categorization and selection of surfactants in formulating. Surfactants can be divided into different classes depending on the nature of the hydrophilic group: non-ionic, anionic, cationic and amphoteric (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC , 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

Naturally occurring emulsifiers used in emulsion formulations include lanolin,

- 88 039127 beeswax, phosphatides, lecithin and gum arabic. Absorbent bases such as anhydrous lanolin and hydrophilic petrolatum have hydrophilic properties so that they can absorb water to form water/oil emulsions while maintaining their semi-solid consistency. Finely divided solids have also been used as suitable emulsifiers, especially in combination with surfactants and in viscous formulations. These include polar inorganic solids such as heavy metal hydroxides, non-swellable clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminosilicate, pigments, and non-polar solids such as carbon or glyceryl tristearate.

A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to certain properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty acid esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker , Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p . 199).

Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (e.g., gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (e.g., carboxymethyl cellulose and carboxypropyl cellulose), and synthetic polymers ( e.g. carbomers, cellulose ethers and carboxyvinyl polymers). They disperse or swell in water to form colloidal solutions which stabilize emulsions by forming strong interfacial films around the dispersed phase droplets and by increasing the viscosity of the dispersed phase.

Because emulsions often contain some ingredients such as carbohydrates, proteins, sterols, and phosphatides that can readily support microbial growth, such formulations often include preservatives. Commonly used preservatives included in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, phydroxybenzoic acid esters, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. The antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulphite, and antioxidant synergists such as citric acid, tartaric acid and lecithin.

The use of emulsion formulations by dermatological, oral and parenteral routes and methods for their preparation are discussed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199) . Because of the ease of formulation and effectiveness in terms of absorption and bioavailability, emulsion formulations for oral delivery have become widely used (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC ., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral oil laxatives, fat-soluble vitamins, and high-fat nutritional preparations are among the materials commonly administered orally as oil/water emulsions.

ii. Microemulsions.

In one embodiment of the present invention, iRNA and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil, and amphiphile that is the only optically isotropic and thermodynamically stable liquid solution (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC. , 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous solution of a surfactant and then adding enough of a fourth component, typically a medium chain alcohol, to form a clear system. Thus, microemulsions have also been described as thermodynamically stable, isotropically pure dispersions of two immiscible liquids that are stabilized by interfacial films of surfactant molecules (Leung and Shah, in Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are typically prepared by combining three to five components which include oil, water, surfactant, secondary surfactant and electrolyte. Whether a microemulsion is a water-in-oil (w/o) or oil-in-water (o/w) microemulsion depends on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules. (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological approach using phase diagrams has been carefully developed and this has given the person skilled in the art extensive knowledge of how to formulate microemulsions (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y. , volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions have the advantage of solubilizing water-insoluble drugs into thermodynamically stable droplets that form spontaneously.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310) , hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750) alone or in combination with secondary surfactants. The secondary surfactant, usually a short chain alcohol such as ethanol, 1-propanol and 1-butanol, serves to increase the interfacial fluidity by penetrating the film from the surfactant and thus creating a disordered film due to void space, formed among the surfactant molecules. However, microemulsions can be prepared without the use of secondary surfactants, and self-emulsifying alcohol-free microemulsion systems are known in the art. The aqueous phase is generally, but not limited to, water, aqueous drug solution, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and ethylene glycol derivatives. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C ₈ -C ₁₂ ) mono-, di- and triglycerides, polyoxyethylated fatty acid esters of glyceryl, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C ₈ C ₁₀ glycerides, vegetable oils and silicone oil.

Microemulsions are of particular interest in terms of drug solubility and enhanced drug absorption. Lipid microemulsions (both oil in water and water in oil) have been proposed to increase the oral bioavailability of drugs, including peptides (see, for example, US Pat. Nos. 6,191,105; 7,063,860; 7,070,802; , 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions provide the benefits of improved drug solubility, protection of the drug from enzymatic hydrolysis, possible increase in drug absorption due to surfactant-induced changes in membrane fluidity and permeability, ease of preparation, ease of oral administration compared to a solid dosage form, improved clinical activity and reduced toxicity (see, for example, US Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al. , 138-143). Often, microemulsions can form spontaneously when their components are combined at ambient temperature. This may be particularly advantageous when thermolabile drugs, peptides or iRNAs are formulated. Microemulsions have also been effective in the transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to promote increased systemic absorption of iRNA and nucleic acids from the gastrointestinal tract, as well as improve local cellular uptake of iRNA and nucleic acids.

The microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol and penetration enhancers to improve formulation properties and to increase the absorption of the iRNA and nucleic acids of the present invention. The penetration enhancers used in the microemulsions of the present invention can be classified into one of five main categories - surfactants, fatty acids, bile salts, chelating agents and non-chelating agents other than surfactants ( Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of these classes is discussed above.

iii. Microparticles.

The iRNA-based agent of the present invention can be incorporated into a particle, for example,

- 90 039127 microparticle. The microparticles can be obtained by spray drying, but can also be obtained by other methods, including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

iv. penetration aids.

In one embodiment, the present invention uses a variety of penetration enhancers to affect the efficient delivery of nucleic acids, in particular iRNA, to the skin of animals. Most drugs are present in solution in both ionized and non-ionized forms. However, as a rule, only fat-soluble or lipophilic drugs readily pass through cell membranes. It has been found that even non-lipophilic drugs can pass through cell membranes if the membrane to be passed is treated with a permeation agent. In addition to facilitating the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also increase permeability to lipophilic drugs.

Penetrating agents can be classified as belonging to one of the five main categories, i.e. surfactants, fatty acids, bile salts, chelating agents, and non-chelating agents other than surfactants (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above classes of penetration enhancers is described in more detail below.

Surfactants (or surfactants) are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of a solution or the interfacial tension between an aqueous solution and another fluid, resulting in increased mucosal absorption of iRNA. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, and polyoxyethylene-20-cetyl ether) (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perforated emulsions such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

A variety of fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate , tricaprate, _monoolein (1-monoleoyl-racglycerol), dilaurin, caprylic acid, arachidonic acid, glycerol -butyl) and their mono- and diglycerides (i.e. oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see, for example, Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 6 51-654).

The physiological role of bile includes assisting in the distribution and absorption of lipids and fat-soluble vitamins (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts and their synthetic derivatives act as penetration enhancers. Thus, the term bile salts includes any naturally occurring constituents of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucocholic acid (sodium glucocholate), glycocholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g. Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems , 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782 -783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

Chelating agents used in connection with the present invention can be defined as compounds that remove metal ions from solution by complexing with them,

- 91 039127 resulting in increased absorption of iRNA through the mucosa. With respect to their use as penetration enhancers, chelating agents in the present invention have the additional advantage of also acting as DNase inhibitors, since most of the characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxy salicylate, and homovalinate), collagen Nacyl derivatives, laureth-9, and beta-diketone N-aminoacyl derivatives (enamines) (see, for example, Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

As used herein, non-chelating compounds, other than penetration surfactants, can be defined as compounds that exhibit little activity as chelating agents or as surfactants, but which nonetheless increase iRNA absorption through the mucosa of the digestive tract. (See, for example, Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 133). This class of penetration enhancers includes, for example, unsaturated cycloureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92) and non-steroidal anti-inflammatory drugs, such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that increase iRNA uptake at the cellular level can also be added to pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al, US Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731) are also known to enhance uptake of dsRNA by cells. Examples of commercially available transfection reagents include, for example, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), California), DMRIE-C™ (Invitrogen; Carlsbad, CA), Freestyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), iRNAMAX ( Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grensacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grensacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grensacher Strasse, Switzerland) or Fugene (Grensacher Strasse, Switzerland), Transfectam® Reagent (Promega; Madison, WI), TransFast™ Transfection Reagent (Promega; Madison, WI), Tfx™-20 reagent (Promega; Madison, WI), Tfx™-50 reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassa Dl transfection reagent (New England Biolabs; Ipswich , Massachusetts, USA), LyoVec™/LipoGen™ (Invitrogen; San Diego, CA, USA), PerFectin transfection reagent (Genlantis; San Diego, CA, USA), NeuroPORTER transfection reagent (Genlantis; San Diego, CA, USA). USA), GenePORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection Reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA) ), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ Transfection Reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA) or HiFect™ (B-Bridge International, Mountain View, CA, USA).

Other agents can be used to increase the penetration of the introduced nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones and terpenes such as limonene and menthone.

v. Media.

Certain compositions of the present invention also contain carriers in the compound. As used herein, the terms carrier compound or carrier may refer to a nucleic acid or analog thereof that is inert (i.e., does not itself have biological activity) but is recognized as a nucleic acid in vivo by processes that reduce bioavailability. a nucleic acid having biological activity, for example by destroying the biologically active nucleic acid or by facilitating its removal from the circulation. The co-administration of a nucleic acid and a carrier compound, usually with an excess of the latter substance, can lead to a significant reduction in the amount of nucleic acid.

- 92 039127 acid extracted in the liver, kidneys or other extravascular depots, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, recovery of partially phosphorothioate dsRNA by liver tissue can be reduced when it is co-administered with polyinosinic acid, dextran sulfate, polycytidine acid, or 4-acetamido-4'-isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev ., 1995, 5, 115121; Takakura et al., DsRNA & Nucl Acid Drug Dev., 1996, 6, 177-183.

vi. Fillers.

Unlike a carrier compound, a pharmaceutical carrier or excipient is a pharmaceutically acceptable diluent, suspending agent, or any other pharmacologically inert means for delivering one or more nucleic acids to an animal. The excipient may be a liquid or a solid and is chosen according to the intended route of administration so as to provide the desired volume, consistency, etc. when combined with the nucleic acid and other components of the pharmaceutical composition. Exemplary pharmaceutical carriers include, but are not limited to, binders (eg, pregelatinized maize starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose, etc.); fillers (eg lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or dicalcium phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (eg starch, sodium starch glycolate, etc.) and wetting agents (eg sodium lauryl sulfate, etc.).

Also, pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral administration that do not adversely interact with nucleic acids can be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, without limitation, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil bases. Solutions may also contain buffers, diluents, and other suitable additives. You can use pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral, which do not interact adversely with nucleic acids.

Suitable pharmaceutically acceptable excipients include, without limitation, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

vii. Other components.

The compositions of the present invention may additionally contain other adjuvants conventionally found in pharmaceutical compositions, at application levels established in the art. Thus, for example, the compositions may contain additional compatible pharmaceutically active materials, such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful for physically formulating the compositions of the present invention in various dosage forms, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickeners and stabilizers. However, such materials, when added, should not significantly interfere with the biological activities of the components of the compositions of the present invention. The formulations may be sterile and, if desired, may be mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, osmotic salts, buffers, coloring agents, fragrances and/or fragrances, etc. which do not adversely interact with the nucleic acid(s) of the formulation.

Aqueous suspensions may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

In some embodiments, the pharmaceutical compositions described herein include (a) one or more iRNA-based compounds, and (b) one or more agents that act by a mechanism other than iRNA and that are useful in the treatment of HBV infection. Examples of such agents include, without limitation, antiviral agents aimed at suppressing or destroying HBV by disrupting viral replication; and immunomodulators aimed at stimulating the human immune system to protect against the virus. Conversely, immunomodulators such as corticosteroids, which induce increased expression of viral and viral antigens and suppression of T-lymphocyte function, or adenine arabinoside, acyclovir, or dideoxynosine, are inappropriate for the treatment of chronic hepatitis B. Suitable agents are discussed in more detail below. .

The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine LD ₅₀ (dose lethal to 50% of a group) and ED ₅₀ (therapeutically effective dose to 50% of a group). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD ₅₀ /ED ₅₀ . Compounds that have a high therapeutic index are preferred.

Data from cell culture assays and animal studies can be used to formulate a range of doses for use in humans. In the present invention, the dosage of the compositions described herein is typically within a circulating concentration range that includes the ED50 with little or no toxicity. The dose may vary within this range depending on the dosage form used and the route of administration. For any compound used in the methods described in the present invention, a therapeutically effective dose can initially be determined from the results of analyzes with cell cultures. The dose can be formulated in animal models to obtain a range of circulating plasma concentrations of the compound or, if necessary, the polypeptide product of the target sequence (e.g., achieving a reduced concentration of the polypeptide), which includes an IC ₅₀ (i.e., the concentration of the test compound by which achieve half-maximal inhibition of symptoms), when determined in cell culture. Such information can be used to more accurately determine the applicable dose in humans. Plasma levels can be measured, for example, using high performance liquid chromatography.

In addition to their administration discussed above, the iRNAs described in the present invention may be administered in combination with other known agents effective in the treatment of pathological processes mediated by HBV expression. In any case, the supervising physician may adjust the amount and timing of iRNA administration based on results observed using standard efficacy measures known in the art or described herein.

VII. Methods of the present invention.

The present invention provides therapeutic and prophylactic methods that involve administering to a subject with an HBV infection and/or an HBV-associated disease, disorder and/or condition, or who is prone to developing an HBV-associated disease, disorder and/or condition (e.g., CHB), compositions containing an iRNA-based agent, or pharmaceutical compositions containing an iRNA-based agent, or vectors containing an iRNA of the present invention.

The methods of the present invention are useful for treating a subject with an HBV infection, eg, a subject that would benefit from a reduction in HBV gene expression and/or HBV replication. In one aspect, the present invention provides methods for reducing the level of hepatitis B virus cccDNA in a subject infected with HBV. In another aspect, the present invention provides methods for reducing the level of an HBV antigen, eg, HBsAg and/or HBeAg, in an HBV-infected subject. In another aspect, the present invention provides methods for reducing the viral load generated by HBV in a subject infected with HBV. The present invention also provides methods for reducing alanine aminotransferase (ALT) and/or aspartate aminotransferase (AST) levels in an HBV-infected subject. In one aspect, the present invention provides methods for increasing the level of anti-HBV antibodies in an HBV-infected subject. In another aspect, the present invention provides methods for treating a subject with an HBV infection. In one aspect, the present invention provides methods for treating a subject with an HBV associated disease, eg, hepatitis D virus infection, delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma. In addition, since HDV infection is dependent on obligatory helper functions provided by HBV for transmission, and subjects with HBV infection may also have HDV infection, the treatments described herein are also suitable for treating a subject with HDV infection and/or an HDV-associated disorder. such as hepatitis B virus infection, chronic hepatitis B virus (SNV) infection, chronic hepatitis B virus (SNV) infection, cirrhosis, liver failure, and hepatocellular carcinoma (HCC). The methods of treatment (and use) of the present invention comprise administering to a subject, e.g., a human, a therapeutically effective amount of an iRNA based agent of the present invention targeting the HBV gene, or a pharmaceutical composition containing an iRNA based agent of the present invention targeting an HBV gene, or a vector of the present invention containing an iRNA-based agent that targets the HBV gene.

- 94 039127

In one aspect, the present invention provides methods for preventing at least one symptom in a subject with an HBV infection, for example, the presence of HBV cccDNA in serum and/or liver, the presence of HBV DNA in serum, the presence of HBV antigen in serum and/or liver eg HBsAg and/or HBeAg, elevated ALT, elevated AST, no or low anti-HBV antibodies, liver damage; cirrhosis; deltagepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; fibrosis of the liver; end-stage liver disease; hepatocellular carcinoma; serum-like syndrome; anorexia; nausea; vomiting, subfebrile body temperature; myalgia; fatigue; disturbed gustatory and olfactory functions (disgust for food and cigarettes); and/or right upper quadrant and epigastric pain (episodic, mild to moderate); hepatic encephalopathy; drowsiness; sleep disturbance; confusion of consciousness; coma; ascites; bleeding in the gastrointestinal tract; coagulopathy; jaundice; hepatomegaly (slightly enlarged, soft liver); splenomegaly; palmar erythema; arachnid hemangioma; muscle atrophy; a form of stellate angioma; vasculitis; varicose bleeding; peripheral edema; gynecomastia; testicular atrophy; expansion of the collateral veins of the abdomen (jellyfish head); high levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the range of 1000-2000 IU / ml, although values \u200b\u200bof 100 times the upper limit of normal (ULN) can also be detected; ALT levels higher than AST levels; elevated levels of gamma-glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP) (for example, not more than 3 times the ULN); slightly reduced levels of albumin; elevated levels of iron in the blood serum; leukopenia (i.e., granulocytopenia); lymphocytosis; increased erythrocyte sedimentation rate (ESR); reduced lifespan of erythrocytes; hemolysis; thrombocytopenia; lengthening the international normalized ratio (INR); the presence in the blood serum and / or liver of HBsAg, HBeAg, antibodies to the core protein of the hepatitis B virus (antibodies to HBc) in the form of immunoglobulin M (IgM); antibody to hepatitis B surface antigen (HBs antibody), antibody to hepatitis B surface antigen (HBe antibody) and/or HBV DNA; elevated levels of aminotransferases (<5 times the ULN); ALT levels higher than AST levels; elevated bilirubin levels, prolonged prothrombin time (PT); hyperglobulinemia; the presence of non-tissue-specific antibodies such as anti-smooth muscle antibodies (ASMA) or antinuclear antibodies (ANA) (10-20%); the presence of tissue-specific antibodies, such as antibodies to thyroid cells (10-20%); elevated levels of rheumatoid factor (RF); hyperbilirubinemia, prolonged RT, low platelet and leukocyte levels, AST levels higher than ALT levels; elevated levels of alkaline phosphatase (ALP) and GGT; hepatic lobules with degenerative and regenerative hepatocellular changes and concomitant inflammation; predominantly centrilobular necrosis. The methods include administering to a subject a therapeutically effective amount of an iRNA-based agent, e.g., dsRNA, pharmaceutical compositions, or vectors of the present invention, thereby preventing at least one symptom in a subject with a disorder that would benefit from a reduction in HBV gene expression, in such as a subject with HBV infection or a subject with both HBV and HDV infection.

In another aspect, the present invention provides the use of a therapeutically effective amount of an iRNA-based agent of the present invention for the treatment of a subject, e.g., a subject that would benefit from reduction and/or inhibition of HBV gene expression, such as a subject with an HBV infection or a subject with infection with both HBV and HDV.

In a further aspect, the present invention provides uses of an iRNA-based agent, e.g., a dsRNA of the present invention targeting an HBV gene, or pharmaceutical compositions comprising an iRNA-based agent targeting an HBV gene, in the manufacture of a medicament for the treatment of a subject, e.g. , a subject that would benefit from a reduction and/or inhibition of HBV gene expression and/or HBV replication, such as a subject with HBV infection, or a subject with both HBV and HDV infection, and a subject with a disorder that would benefit the effect of reducing the expression of the HBV gene, for example, associated with HBV disease.

In another aspect, the present invention provides uses of an iRNA, e.g., a dsRNA of the present invention to prevent at least one symptom in a subject suffering from a disorder that would benefit from reduction and/or inhibition of HBV gene expression and/or HBV replication.

In a further aspect, the present invention provides uses of an iRNA-based agent of the present invention in the manufacture of a medicament for the prevention of at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of HBV gene expression and/or replication. HBV, such as an HBV associated disease.

In one embodiment, an iRNA-based agent that targets

- 95 039127

HBV is administered to a subject with HBV infection or both HBV and HDV infection and/or HBV associated disease such that expression of one or more HBV genes, HBV cccDNA levels, HBV antigen levels, HBV viral load levels, ALT and/ or AST, e.g., in a cell, tissue, blood, or other tissue or fluid of the subject, decreased by at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98%, or at least about 99% or more, when a dsRNA-based agent is administered to a subject.

In one embodiment, an iRNA-based agent targeting HBV is administered to a subject with an HBV infection or infection with both HBV and HDV and/or an HBV-associated disease such that the level of anti-HBV antibodies, e.g., in a cell, tissue, blood or other tissue or fluid of the subject, increased by at least about 10, 11, 12, 13, 14, 15, 16, 17, 18,

19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,

49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,

79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98%, or at least about 99 % or more when a dsRNA-based agent is administered to a subject.

The methods and uses of the present invention include administering the composition described herein such that expression of the target HBV gene is reduced, such as by about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or about 80 hours. for about two, three, four, five, six, seven days or longer, for example, for about one week, two weeks, three weeks, or about four weeks or longer.

The administration of dsRNA in accordance with the methods and uses of the present invention may result in a reduction in the severity, improvement in the signs, symptoms and/or markers of such diseases or disorders in a patient with HBV infection or infection with both HBV and HDV and/or associated with HBV disease. A decrease in this context means a statistically significant decrease in that level. The reduction, for example, may be at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

The effectiveness of treating or preventing a disease can be assessed, for example, by measuring disease progression, disease remission, symptom severity, pain reduction, quality of life, the dose of drug required to maintain the effect of treatment, the level of a disease marker, or any other measurable parameter appropriate to a given disease, the treatment of which is carried out or the prevention of which is envisaged. Monitoring the effectiveness of treatment or prevention by measuring any of these parameters or any combination of parameters is within the skill of the art. For example, the effectiveness of the treatment of SNV can be assessed, for example, using periodic monitoring of viral load and transaminase levels. By comparing subsequent data with baseline data, the clinician obtains an indication of whether the treatment is effective. Monitoring the effectiveness of treatment or prevention by measuring any of these parameters or any combination of parameters is within the skill of the art. With respect to administration of an HBV-targeting iRNA or a pharmaceutical composition thereof effective against an HBV-associated disease, indicates that administration in a clinically acceptable manner results in a beneficial effect in at least a statistically significant proportion patients, such as relief of symptoms, cure, reduction in disease, prolongation of life, improvement in quality of life, or other effect generally considered positive by a physician familiar with the treatment of HBV infection and/or HBV associated disease and the like.

A curative or preventive effect is evident when there is a statistically significant improvement in one or more parameters of the disease state, or by the absence of aggravation or development of symptoms in cases where they would otherwise be predicted. By way of example, a favorable change in a measurable disease parameter of at least 10% and preferably at least 20%, 30%, 40%, 50%, or more may be indicative of effective treatment. The efficacy of a given iRNA-based drug or formulation with such a drug can also be judged using an experimental animal model of the disease, which is known in the art. When using an experimental animal model, the effectiveness of the treatment is proven when a statistically significant decrease in the marker or improvement in the symptom is observed.

Subjects may be administered a therapeutic amount of iRNA, such as about 0.01, 0.02, 0.03, 0.04, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3 , 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0 .95, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1 , 2.2, 2.3, 2.4, 2.5 mg/kg dsRNA, 2.6 mg/kg dsRNA, 2.7 mg/kg

- 96 039127 dsRNA, 2.8 mg/kg dsRNA, 2.9 mg/kg dsRNA, 3.0 mg/kg dsRNA, 3.1 mg/kg dsRNA, 3.2 mg/kg dsRNA, 3.3 mg/kg kg dsRNA, 3.4 mg/kg dsRNA, 3.5 mg/kg dsRNA, 3.6 mg/kg dsRNA, 3.7 mg/kg dsRNA, 3.8 mg/kg dsRNA, 3.9 mg/kg dsRNA , 4.0 mg/kg dsRNA, 4.1 mg/kg dsRNA, 4.2 mg/kg dsRNA, 4.3 mg/kg dsRNA, 4.4 mg/kg dsRNA, 4.5 mg/kg dsRNA, 4.6 mg/kg dsRNA, 4.7 mg/kg dsRNA, 4.8 mg/kg dsRNA, 4.9 mg/kg dsRNA, 5.0 mg/kg dsRNA, 5.1 mg/kg dsRNA, 5.2 mg/kg kg dsRNA, 5.3 mg/kg dsRNA, 5.4 mg/kg dsRNA, 5.5 mg/kg dsRNA, 5.6 mg/kg dsRNA, 5.7 mg/kg dsRNA, 5.8 mg/kg dsRNA , 5.9 mg/kg dsRNA, 6.0 mg/kg dsRNA, 6.1 mg/kg dsRNA, 6.2 mg/kg dsRNA, 6.3 mg/kg dsRNA, 6.4 mg/kg dsRNA, 6 .5 mg/kg dsRNA, 6.6 mg/kg dsRNA, 6.7 mg/kg dsRNA, 6.8 mg/kg dsRNA, 6.9 mg/kg dsRNA, 7.0 mg/kg dsRNA, 7.1 mg/kg dsRNA, 7.2 mg/kg dsRNA, 7.3 mg/kg dsRNA, 7.4 mg/kg dsRNA, 7.5 mg/kg dsRNA, 7.6 mg/kg dsRNA, 7.7 mg/kg dsRNA , 7.8 mg/kg dsRNA, 7.9 mg/kg dsRNA, 8.0 mg/kg dsRNA, 8.1 mg/kg dsRNA, 8.2 mg/kg dsRNA, 8.3 mg/kg dsRNA, 8 .4 mg/kg dsRNA, 8.5 mg/kg ds RNA, 8.6 mg/kg dsRNA, 8.7 mg/kg dsRNA, 8.8 mg/kg dsRNA, 8.9 mg/kg dsRNA, 9.0 mg/kg dsRNA, 9.1 mg/kg dsRNA, 9.2 mg/kg dsRNA, 9.3 mg/kg dsRNA, 9.4 mg/kg dsRNA, 9.5 mg/kg dsRNA, 9.6 mg/kg dsRNA, 9.7 mg/kg dsRNA, 9, 8 mg/kg dsRNA, 9.9 mg/kg dsRNA, 9.0 mg/kg dsRNA, 10 mg/kg dsRNA, 15 mg/kg dsRNA, 20 mg/kg dsRNA, 25 mg/kg dsRNA, 30 mg/kg dsRNA, 35 mg/kg dsRNA, 40 mg/kg dsRNA, 45 mg/kg dsRNA, or approximately 50 mg/kg dsRNA. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In certain embodiments, for example, if the composition of the present invention contains a dsRNA as described herein and a lipid, a therapeutic amount of iRNA can be administered to subjects, such as from about 0.01 to about 5 mg/kg, from about 0, 01 to about 10 mg/kg, from about 0.05 to about 5 mg/kg, from about 0.05 to about 10 mg/kg, from about 0.1 to about 5 mg/kg, from about 0.1 to about 10 mg/kg, from about 0.2 to about 5 mg/kg, from about 0.2 to about 10 mg/kg, from about 0.3 to about 5 mg/kg, from about 0.3 to about 10 mg/kg, about 0.4 to about 5 mg/kg, about 0.4 to about 10 mg/kg, about 0.5 to about 5 mg/kg, about 0.5 to about 10 mg /kg, from about 1 to about 5 mg/kg, from about 1 to about about 10 mg/kg, about 1.5 to about 5 mg/kg, about 1.5 to about 10 mg/kg, about 2 to about 2.5 mg/kg, about 2 to about 10 mg/kg, about 3 to about 5 mg/kg, about 3 to about 10 mg/kg, about 3.5 to about 5 mg/kg, about 4 to about 5 mg/kg, about 4 .5 to about 5 mg/kg, about 4 to about 10 mg/kg, about 4.5 to about 10 mg/kg, about 5 to about 10 mg/kg, about 5.5 to about 10 mg /kg, from about 6 to about 10 mg/kg, from about 6.5 to about 10 mg/kg, from about 7 to about 10 mg/kg, from about 7.5 to about 10 mg/kg, from about 8 up to about 10 mg/kg, from about 8.5 to about 10 mg/kg, from about 9 to about 10 mg/kg, or from about 9.5 mg/kg to about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, dsRNA can be administered at a dose of approximately

0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1,

1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3,

2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5,3.6,

3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8,4.9,

5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2,

6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4,7.5,

7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7,8.8,

8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8,9.9

Or about 10 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In other embodiments, for example, where a composition of the present invention comprises a dsRNA as described herein and N-acetylgalactosamine, a therapeutic amount of iRNA may be administered to subjects, such as a dose of about 0.1 to about 50 mg/kg , from about 0.25 to about 50 mg/kg, from about 0.5 to about 50 mg/kg, from about 0.75 to about 50 mg/kg, from about 1 to about 50 mg/kg, from about 1 .5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg /kg, from about 4 to about 50 mg/kg, from about 4.5 to about 50 mg/kg, from about 5 to about 50 mg/kg, from about 7.5 to about 50 mg/kg, from about 10 up to approx. 50 mg/kg, from approx. generously 15 to about 50 mg/kg, from about 20 to at

- 97 039127 about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, from about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg /kg, from about 0.5 to about 45 mg/kg, from about 0.75 to about 45 mg/kg, from about 1 to about 45 mg/kg, from about 1.5 to about 45 mg/kg, from about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg /kg, from about 4.5 to about 45 mg/kg, from about 5 to approx. 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/kg, about 1.5 to about 40 mg/kg, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 m g/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/kg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, from about 2.5 to about 30 mg/kg, from approx. about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg /kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg , about 0.75 to about 20 mg/kg, about 1 to about 20 mg/kg, about 1.5 to about 20 mg/kg, about 2 to about 20 mg/kg, about 2.5 up to about 20 mg/kg, from about 3 to about 20 mg/kg, from about 3.5 d about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg , from about 10 to about 20 mg/kg, or from about 15 to about 20 mg/kg. In one embodiment, where a composition of the present invention contains a dsRNA as described herein and N-acetylgalactosamine, a therapeutic amount of about 10 to about 30 mg/kg of dsRNA can be administered to a subject. Values and ranges intermediate to those listed are also intended to be part of the present invention.

For example, subjects can be administered a therapeutic amount of iRNA, such as approximately

- 98 039127

0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6,1.7,

1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3,

3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2,4,3,

4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5,5.6,

5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8,6.9,

7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2,

8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4,9.5,

9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5,14,

14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5,20,

20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25, 5.26,

26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34.35,

36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49

Or about 50 mg/kg. Values and ranges intermediate to those listed are also intended to be part of the present invention.

In certain embodiments of the present invention, for example, when the double-stranded RNAi agent includes a modification (e.g., one or more motifs of three identical modifications of three consecutive nucleotides) comprising one such motif at or near the agent's cleavage site, six phosphorothioate bonds and a ligand, such agent is administered at a dose of about 0.01 to about 0.5 mg/kg, about 0.01 to about 0.4 mg/kg, about 0.01 to about 0.3 mg/kg. kg, from about 0.01 to about 0.2 mg/kg, from about 0.01 to about 0.1 mg/kg, from about 0.01 to about 0.09 mg/kg, from about 0.01 to about 0.08 mg/kg, about 0.01 to about 0.07 mg/kg, about 0.01 to about 0.06 mg/kg, about 0.01 to about 0.05 mg/kg, about 0.02 to about 0.5 mg/kg, about 0.02 to about about 0.4 mg/kg, about 0.02 to about 0.3 mg/kg, about 0.02 to about 0.2 mg/kg, about 0.02 to about 0.1 mg/kg, about 0.02 to about 0.09 mg/kg, about 0.02 to about 0.08 mg/kg, about 0.02 to about 0.07 mg/kg, about 0.02 to about 0 0.06 mg/kg, about 0.02 to about 0.05 mg/kg, about 0.03 to about 0.5 mg/kg, about 0.03 to about 0.4 mg/kg, from about 0.03 to about 0.3 mg/kg, about 0.03 to about 0.2 mg/kg, about 0.03 to about 0.1 mg/kg, about 0.03 to about 0.09 mg/kg, from about 0.03 to about 0.08 mg/kg, from about 0.03 to about 0.07 mg/kg, from about 0.03 to about 0.06 mg/kg, from about 0, 03 to about 0.05 mg/kg, from about 0.04 to n about 0.5 mg/kg, about 0.04 to about 0.4 mg/kg, about 0.04 to about 0.3 mg/kg, about 0.04 to about 0.2 mg/kg, about 0.04 to about 0.1 mg/kg, about 0.04 to about 0.09 mg/kg, about 0.04 to about 0.08 mg/kg, about 0.04 to about 0 .07 mg/kg, about 0.04 to about 0.06 mg/kg, about 0.05 to about 0.5 mg/kg, about 0.05 to about 0.4 mg/kg, from about 0.05 to about 0.3 mg/kg, about 0.05 to about 0.2 mg/kg, about 0.05 to about 0.1 mg/kg, about 0.05 to about 0.09 mg/kg, about 0.05 to about 0.08 mg/kg, or about 0.05 to about 0.07 mg/kg. Values and ranges intermediate to the above values are also part of the present invention, for example, an RNAi agent may be administered to a subject at a dose of about 0.015 to about 0.45 mg/kg.

For example, an RNAi agent, e.g., an RNAi agent in a pharmaceutical composition, can be administered at a dose of about 0.01, 0.0125, 0.015, 0.0175, 0.02, 0.0225, 0.025, 0.0275, 0.03, 0.0325, 0.035, 0.0375, 0.04, 0.0425, 0.045, 0.0475, 0.05, 0.0525, 0.055, 0.0575, 0.06, 0.0625, 0.065, 0.0675, 0.07, 0.0725, 0.075, 0.0775, 0.08, 0.0825, 0.085, 0.0875, 0.09, 0.0925, 0.095, 0.0975, 0, 1,0.125,0.15,0.175,0.2,0.225,0.25,0.275,0.3,0.325,0.35,0.375,0.4,0.425,0.45,0.475mg/kg or approximately 0.5 mg/kg. Values intermediate to those listed are also part of the present invention.

In some embodiments, the RNAi agent is administered at a fixed dose of about 100 to about 900 mg, such as about 100 to about 850 mg, about 100 to about 800 mg, about 100 to about 750 mg, about 100 up to about 700 mg, from about 100 to about 650 mg, from about 100 to about 600 mg, from about 100 to about

- 99 039127 550 mg, about 100 to about 500 mg, about 200 to about 850 mg, about 200 to about 800 mg, about 200 to about 750 mg, about 200 to about 700 mg, about 200 mg up to about 650 mg, about 200 to about 600 mg, about 200 to about 550 mg, about 200 to about 500 mg, about 300 to about 850 mg, about 300 to about 800 mg, about 300 to about 750 mg, about 300 to about 700 mg, about 300 to about 650 mg, about 300 to about 600 mg, about 300 to about 550 mg, about 300 to about 500 mg, about 400 to about 850 mg , from about 400 to about 800 mg, from about 400 to about 750 mg, from approx. 400 to about 700 mg, about 400 to about 650 mg, about 400 to about 600 mg, about 400 to about 550 mg, or about 400 mg to about 500 mg.

In some embodiments, the RNAi agent is administered at a fixed dose of about 100 mg, about 125 mg, about 150 mg, about 175 mg, 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg. mg, approximately 350 mg, approximately 375 mg, approximately 400 mg, approximately 425 mg, approximately 450 mg, approximately 475 mg, approximately 500 mg, approximately 525 mg, approximately 550 mg, approximately 575 mg, approximately 600 mg, approximately 625 mg, about 650 mg, about 675 mg, about 700 mg, about 725 mg, about 750 mg, about 775 mg, about 800 mg, about 825 mg, about 850 mg, about 875 mg, or about 900 mg.

iRNA can be administered by intravenous infusion over a period of time, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or approximately 25 minute period. Administration can be repeated, for example, regularly, such as once a week, once every two weeks (ie every two weeks) for one month, two months, three months, four months or longer. After the primary treatment regimen, drugs can be administered at a reduced frequency. For example, after administration once a week or once every two weeks for three months, the administration can be repeated once a month for six months, or a year, or longer.

iRNA administration can reduce the presence of HBV cccDNA in serum and/or liver, the presence of HBV antigen in serum and/or liver, e.g. HBsAg and/or HBeAg, ALT levels and/or AST levels, e.g. in cell, tissue, blood , urine, or other patient compartment, at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98% , or at least about 99% or more, for example, below the level of detection in the assay.

Administration of iRNA can increase the presence of anti-HBV antibodies in the serum and/or liver, e.g., in a patient's cell, tissue, blood, urine, or other compartments, by at least about 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 , 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62 , 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 , 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98%, or at least about 99% or more.

Prior to a full dose of iRNA, patients can be given a lower dose, such as a 5% infusion, and observed for negative effects such as allergic reactions. In another example, a patient can be monitored for undesirable immunostimulatory effects, such as increased levels of a cytokine (eg, TNF-alpha or INF-alpha).

Due to the inhibitory effects on HBV expression, the composition according to the present invention or a pharmaceutical composition derived therefrom can improve the quality of life.

The iRNA of the present invention can be administered in naked form, where the modified or unmodified iRNA-based agent is suspended directly in an aqueous or suitable buffer solution, as free iRNA. Free iRNA is administered in the absence of a pharmaceutical composition. Free iRNA can be in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH value and osmolarity of the buffer solution containing the iRNA can be adjusted so that it is suitable for administration to the subject.

Alternatively, the iRNA of the present invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

Subjects that will benefit from a reduction and/or inhibition of HBV gene expression are subjects with HBV infection and/or an HBV-associated disease or disorder as described herein.

Treatment of a subject that would benefit from reduction and/or inhibition of HBV gene expression includes treatment for therapeutic and prophylactic purposes.

The present invention further provides methods and uses for an iRNA-based agent or a pharmaceutical composition thereof for the treatment of a subject that would benefit from reduction and/or inhibition of HBV gene expression, e.g., a subject with an HBV-associated disease, in combination with other pharmaceuticals. and/or other therapies, such as known pharmaceuticals and/or known therapies, such as those currently used to treat these disorders.

For example, in certain embodiments, an iRNA targeting one or more HBV genes is administered in combination with, for example, an agent suitable for the treatment of an HBV associated disease as described elsewhere herein. For example, additional therapeutic agents and therapies suitable for treating a subject that would benefit from a reduction in HBV expression, such as a subject with an HBV associated disease, include an iRNA-based agent targeting another part of the HBV genome, an antiviral agent, reverse transcriptase inhibitor (eg, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide, lamivudine, adefovir dipivoxil, entecavir (ETV), telbivudine, and AGX-1009), immunostimulant (eg, pegylated interferon alfa-2a (PEG-IFN-a2a), interferon α-2b, recombinant human interleukin-7 and Toll-like receptor 7 (TLR7) agonist), therapeutic vaccine (eg GS-4774, DV-601 and TG1050), viral entry inhibitor (eg Myrcludex), an oligonucleotide that inhibits secretion or release of HbsAg (eg, REP 9AC), capsid assembly inhibitor (eg, VAY41-4109 and NVR-1221), image inhibitor cccDNA (eg, IHVR-25) or other therapeutic agents and/or procedures, eg, liver transplantation, chemotherapy, for the treatment of HBV associated disease, a combination of any of the above.

In certain embodiments, a first iRNA agent targeting one or more HBV genes is administered in combination with a second iRNA agent targeting a different portion of the HBV genome. For example, a first iRNA-based agent that targets one or more structural genes can be administered in combination with a second RNAi agent that targets the X gene. a region where substantially all of the nucleotides of said first sense strand and substantially all of the nucleotides of said first antisense strand are modified nucleotides, where the first sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or several GalNAc derivatives attached via a divalent or trivalent branched linker; and the second RNAi agent comprises a second sense strand and a second antisense strand forming a double strand, where substantially all nucleotides of the second sense strand and substantially all nucleotides of said second antisense strand are modified nucleotides, wherein the second sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more derivatives of GalNAc attached via a divalent or trivalent branched linker; where the first semantic strand contains a sequence selected from the group consisting of:

5'- UCGUGGUGGACUUCUCUCA -3' (SEQ IDNO:5),

5'- GUGCACUUCGCUUCACCUCUA -3' (SEQ IDNO:7),

5'- CGUGGUGGACUUCUCUCAAUU -3' (SEQ IDNO:9),

5'- CGUGGUGGUCUUCUCUAAAUU -3' (SEQ IDNO:37),

5'-GGUGGACUUCUCUCAAUUUUA-3' (SEQ IDNO:11), and

5'-GUGUGCACUUCGCUUCACA-3' (SEQ IDNO:39) (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical throughout its length to any or from the above nucleotide sequences), and where each of the first and second antisense strands independently contains a sequence selected from the group consisting of:

5'-UGAGAGAAGUCCACCACGAUU-3' (SEQ ID NO:6);

5'- UAGAGGUGAAGCGAAGUGCACUU -3' (SEQ ID NO:8) ;

5'- AAUUGAGAGAAGUCCACCAGCAG-3' (SEQ ID NO:10);

5'- AAUUGAGAGAAGUCCACCAGCUU -3' (SEQ ID NO:38),

5'- UAAAAUUGAGAGAAGUCCACCAC -3' (SEQ ID NO:12), and

5'- UGUGAAGCGAAGUGCACACUU -3' (SEQ ID NO:40)

- 101 039127 (or a nucleotide sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical throughout its length to any of the above nucleotide sequences), due to which the subject is being treated.

In one embodiment, all nucleotides of the first and second sense strands and/or all nucleotides of the first and second antisense strands have a modification.

In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a gated nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2' -hydroxyl-modified nucleotide, 2'methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing non-naturally occurring bases, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide , a cyclohexenyl-modified nucleotide, a nucleotide containing a phosphorothioate group, a nucleotide containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic.

In certain embodiments, a first iRNA agent targeting one or more HBV genes is administered in combination with a second iRNA agent targeting a gene that is different from one or more HBV genes. For example, an iRNA-based agent that targets one or more HBV genes can be administered in combination with an iRNA-based agent that targets the CD274/PD-L1 gene. Examples of iRNA-based agents targeting the CD274/PD-L1 gene are described in WO 2011/127180, the entire content of which is incorporated herein by reference. A first iRNA agent targeting one or more HBV genes and a second iRNA agent targeting a gene other than one or more HBV genes, such as the CD274/PD-L1 gene and/or the HDV gene, can be administered as parts of a single pharmaceutical composition. Alternatively, a first iRNA agent targeting one or more HBV genes and a second iRNA agent targeting a gene other than one or more HBV genes, such as the CD274/PD-L1 gene and/or the HDV gene, can be administered as part of various pharmaceutical compositions.

CD274 or PD-L1 is a 290 amino acid Type I transmembrane protein encoded by the CD274 gene on chromosome 19 in mice and chromosome 9 in humans. CD274/PD-L1 expression has been implicated in evasion of immune responses accompanying chronic infection, e.g. by viruses (including e.g. HIV, HBV, HCV and HTLV among others), bacteria (including e.g. Helicobacter pylori among others). ) and parasites (including, for example, Schistosoma mansoni).

PD-L1 can influence immune responses by recruiting PD-1 or B7-1 (CD80) and modifying TCR or BCR signaling, but can also signal to PD-L1 expressing cells, ie. by signaling back through the PD-L1. Surface plasmon resonance studies demonstrate a specific and unique interaction between PD-L1 and B7-1 with an affinity of 1.7 μM and an affinity of 0.5 μM for the interaction between PD-L1 and PD-1. The results of chemical crosslinking studies indicate that PD-L1 and B7-1, like PD-L1 and PD-1, can also interact through their IgV-like domains. The PD-L1:B7-1 interaction boundary at least partially overlaps with the intended PD-L1:PD-1 demarcation boundary. B7-1:PD-L1 interactions can induce an inhibitory signal in T cells. Ligation of PD-L1 on CD4 T cells with B7-1 or ligation of B7-1 on CD4 T cells with PD-L1 delivers a functionally significant inhibitory signal. Since both PD-L1 and B7-1 are expressed on T cells, B cells, DCs, and macrophages, there is a possibility of bidirectional interaction between B7-1 and PDL1 on these cell types. In addition, PD-L1 on non-hematopoietic cells can interact with B7-1 as well as PD-1 on T cells for cell regulation (Keir ME et al., 2008. Annu Rev Immunol. 26:677 -704).

In chronic viral infections in humans, several groups have shown that PD-1 expression is high in HIV-specific (Petrovas C et al., 2006, J. Exp. Med. 203:2281-92; Day CL et al., 2006, Nature 443:350-54; Trautmann L et al., 2006, Nat. Med. 12: 1198-202), HBV-specific (Boettler T et al., 2006, J. Virol. 80:3532-40; Boni C et al. 2007, J. Virol. 81:4215-25) and HCV-specific T cells (Urbani S et al., 2006, J. Virol. 80: 11398-403). PD-L1 is also upregulated on CD14+ peripheral blood monocytes and myeloid DCs in patients with chronic HBV infection (Chen L et al., 2007, J. Immunol. 178:6634-41; Ceng L et al., 2006, J. Viral Hepat. 13:725-33), and on CD14+ cells and T cells in HIV patients (Trabattoni D et al., 2003. Bloodl01:2514-20). Blocking in vitro PD-LPD-L interactions eliminates depletion of HIV-specific, HBV-specific

- 102 039127 (Boni C et al. 2007, J. Virol. 81:4215-25), HCV-specific and SIV-specific (Velu V et al., 2007, J. Virol. 81:5819-28) CD8 and CD4 T cells and restores cytokine proliferation and production (Petrovas C et al., 2006, J. Exp. Med. 203:2281-92; Day CL et al., 2006, Nature 443:350-54; Trautmann L et al. ., 2006, Nat. Med. 12: 1198-202; Urbani S. et al., 2006, J. Virol. 80: 11398-403). Recent work has shown that the HCV core, a nucleocapsid protein, can upregulate PD-1 and PDL1 expression on healthy donor T cells, and that the upregulation of PD-1 is mediated by the interaction of the HCV core with the C1QBP complement receptor (Yao ZQ et al. , 2007, Viral Immunol 20:276-87).

A subject who has been administered the first RNAi agent or the first and second RNAi agents of the present invention may additionally be administered one or more other therapeutic agents that function by a mechanism other than iRNA and that are useful in the treatment of HBV infection. Exemplary therapeutic agents that can be used in the combination therapy of the present invention include immunomodulators that stimulate the immune system, for example, by enhancing T cell helper activity, maturation of B lymphocytes, inhibiting T cell suppressors, and enhancing HLA type I expression. Suitable immunomodulators include interferons, which have a number of properties, including antiviral, immunomodulatory and antiproliferative effects.

For example, the current treatment for chronic hepatitis B is interferon therapy given to patients who have documented HBV infection for at least six months, elevated levels of liver enzymes (AST and ALT), and actively dividing virus in their blood. (positive tests for HBeAg and/or HBV DNA). Therapy with interferon-a leads to a long-term sustainable remission of the disease in approximately 35% of patients with chronic hepatitis B with normalization of liver enzymes and the disappearance of three markers of active infection (HBeAg, HBV DNA and HBsAg). Subjects with acute HBV infection, end-stage cirrhosis, or other serious medical problems are not usually treated with interferon.

In addition, interferon therapy in patients with HBV-associated cirrhosis significantly reduces the incidence of hepatocellular carcinoma (HCC), especially in patients with high serum HBV DNA. In patients with HBeAg-positive compensated cirrhosis, viral and biochemical remission after interferon therapy is associated with increased life expectancy. In patients with chronic HBV infection, HBeAg clearance after interferon-a treatment is associated with improved clinical outcomes.

The standard duration of therapy is 16 weeks. Patients with low levels of viral replication at the end of the standard regimen benefit most from long-term treatment.

Other illustrative therapeutic agents that can be used in the combination therapy of the present invention include, for example, an antiviral agent, a nucleotide analog, a nucleoside analog, a reverse transcriptase inhibitor (for example, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide, lamivudine, adefovir dipivoxil, entecavir (ETV), telbivudine and AGX-1009, emtricitabine, clevudine, ritonavir, dipivoxil, lobukavir, famvir, FTC, N-acetylcysteine (NAC), PC1323, teradigm-HBV, thymosin-alpha and ganciclovir), an immunostimulant (eg, pegylated interferon alfa-2a (PEG-IFN-a2a), interferon alfa-2b, recombinant human interleukin-7 and Toll-like receptor 7 (TLR7) agonist), therapeutic vaccine (e.g. GS4774, DV-601 and TG1050), inhibitor viral entry (eg, Myrcludex), an oligonucleotide that inhibits the secretion or release of HbsAg (eg, REP 9AC), a capsid assembly inhibitor (eg, Wow41-4109 and NVR-1221), an inhibitor of cccDNA (eg, IHVR-25) or other therapeutic agents and/or procedures, eg, liver transplantation, chemotherapy, for the treatment of HBV associated disease, a combination of any of the above.

In one embodiment, the methods of the present invention comprise administering a reverse transcriptase inhibitor to a subject with an HBV infection and/or an HBV associated disease. In another embodiment, the methods of the present invention comprise administering a reverse transcriptase inhibitor and an immunostimulant to a subject with an HBV infection and/or an HBV associated disease.

The iRNA-based agent(s) and the additional therapeutic agent and/or drug may be administered simultaneously and/or in one combination, for example parenterally, or the additional therapeutic agent may be administered as part of a separate composition, or at different time points, and/or at using another method known in the art or described in this document.

The present invention also provides methods for using an iRNA-based agent of the present invention and/or a composition containing an iRNA-based agent of the present invention to reduce and/or inhibit HBV expression in a cell. In other aspects, the present invention provides an iRNA of the present invention and/or a composition comprising an iRNA of the present invention for use in reducing and/or inhibiting HBV gene expression in a cell.

- 103 039127 ke. In yet other aspects, the use of an iRNA of the present invention and/or a composition comprising an iRNA of the present invention is provided for the manufacture of a medicament for reducing and/or inhibiting HBV gene expression in a cell. In yet another aspect, the present invention provides an iRNA of the present invention and/or a composition comprising an iRNA of the present invention for use in reducing and/or inhibiting HBV replication in a cell. In still other aspects, the use of an iRNA of the present invention and/or a composition comprising an iRNA of the present invention is provided for the manufacture of a medicament for the reduction and/or inhibition of HBV replication in a cell. Methods and uses include contacting a cell with an iRNA, such as a dsRNA, of the present invention and maintaining the cell for a time sufficient to achieve destruction of the HBV mRNA transcript, thereby inhibiting HBV gene expression in the cell or inhibiting HBV replication in cell.

The reduction in gene expression can be assessed using any of the methods known in this field. For example, a decrease in HBV expression can be determined by determining the level of HBV mRNA expression using methods routine for a person skilled in the art, for example, northern blotting, qRT-PCR, by determining the level of HBV protein using methods routine for a person skilled in the art, such as Western blotting, immunological techniques, flow cytometric methods, ELISA, and/or by determining the biological activity of HBV.

In the methods and uses of the present invention, the cell may be in contact in vitro or in vivo, ie. the cell may be in the subject.

A cell suitable for treatment using the methods of the present invention may be any cell that expresses the HBV gene, such as an HBV infected cell, or a cell containing an expression vector containing the HBV genome or part of the HBV gene. A cell suitable for use in the methods and uses of the present invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate animal cell ( such as cow cage, pig cage, camel cage, llama cage, horse cage, goat cage, rabbit cage, sheep cage, hamster cage, guinea pig cage, cat cage, dog cage, rat cage, mouse cage, lion cage, tiger cage , a bear cage or a buffalo cage), a bird cage (such as a duck cage or a goose cage), or a whale cage. In one embodiment, the cell is a human cell, such as a human liver cell.

Expression of the HBV gene can be inhibited in a cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or approximately 100% i.e. below the detection level in the assay.

HBV replication can be inhibited in a cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 , 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 , 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % or approximately 100%, i. e. below the detection level in the assay.

In vivo methods and uses of the present invention may include administering to a subject a composition comprising an iRNA, wherein the iRNA comprises a nucleotide sequence that is complementary to at least a portion of the RNA transcript of the mammalian HBV gene to be treated. Where the organism to be treated is a human, then the composition may be administered by any of the methods known in the art, including, without limitation, subcutaneous, intravenous, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular , intraparenchymal and intrathecal), intramuscular, transdermal, through the upper respiratory tract (aerosol), nasal, rectal and local (including transbuccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous injection. In some embodiments, the compositions are administered by intravenous infusion or injection. In other embodiments, the compositions are administered by intramuscular injection.

In some embodiments, administration is by injection of a depot formulation. Thanks to the injection of the depot preparation, iRNA can be continuously released over a long period of time. Thus, the injection of a depot drug may reduce the frequency of administration of doses necessary to obtain the desired effect, for example, the desired inhibition of HBV, or a therapeutic or prophylactic effect. Depot injection may also provide more stable serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the injection of the depot formulation is a subcutaneous injection.

In some embodiments, the implementation of the introduction is carried out by means of a pump. The pump may be an external pump or a surgically implanted pump. In certain variants

- 104 039127 implementation of the pump is a subcutaneously implantable osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implantable pump that delivers the iRNA-based agent to the liver.

The route of administration can be selected based on whether topical or systemic treatment is needed and on the basis of the area to be treated. The route and site of administration can be chosen to enhance the targeted effect.

In one aspect, the present invention also provides methods for inhibiting HBV gene expression in a mammal, such as a human. The present invention also provides a composition containing an iRNA, eg dsRNA, that targets the HBV gene in a mammalian cell for use in inhibiting HBV gene expression in a mammal. In another aspect, the present invention provides the use of an iRNA, such as dsRNA, that targets the HBV gene in a mammalian cell, in the manufacture of a medicament for inhibiting HBV gene expression in a mammal.

Methods and uses include administering to a mammal, e.g., a human, a composition comprising an iRNA, e.g., dsRNA, that targets the HBV gene in the mammalian cell, and maintaining the mammal for a time sufficient to achieve destruction of the HBV mRNA transcript, whereby provides inhibition of HBV gene expression in a mammal.

The reduction in gene expression can be assessed in a peripheral blood sample of a subject to which an iRNA is administered using any of the methods known in the art, such as qRT-PCR as described herein. The decrease in protein production can be assessed using any of the methods known in this field, and using methods such as ELISA or Western blotting described in this document. In one embodiment, the liver biopsy obtained by puncture serves as tissue material to control the reduction in HBV gene and/or protein expression. In another embodiment, the blood sample serves as a tissue material to monitor the reduction in HBV gene and/or protein expression.

In one embodiment, confirmation of RISC-mediated target cleavage in vivo following administration of an iRNA-based agent is performed by performing 5'-RACE or modifications according to a protocol known in the art (Lasham A et al. (2010), Nucleic Acid Res., 38 (3) pel9) (Zimmermann et al. (2006), Nature 441: 111-4).

The present invention is further illustrated by the following examples, which should not be construed as limiting. The entire contents of all sources, patents, and published patent applications cited in this application, as well as the figures and sequence listing, are hereby incorporated herein by reference.

Examples

Example 1 Synthesis of iRNA.

Sources of obtaining reagents.

If the source of a reagent is not specifically listed herein, such reagent can be obtained from any supplier of reagents for use in molecular biology with standard quality/purity for use in molecular biology.

transcripts.

siRNA construction.

The choice of siRNA constructs targeting HBV was driven by two main factors: a) potency and b) the need to use siRNAs with near-perfect matches with over 90% coverage of the large number of publicly available HBV sequences of all known serotypes (A-H). The coordinates for siRNA selection were determined relative to the NCBI HBV genome reference sequence number NC_003977.1 (GenBank accession number GI: 21326584 (SEQ ID NO: 1). modifications, including various patterns with 2'-O-methyl and 2'-fluoro substituents, centrally located relative to two adjacent regions of the HBV genome encoding surface antigen (HbSAg) and HBV polymerase. acting on additional target sites with particular attention to positions 1581-1599 in SEQ ID NO: 1, which encode, in addition to HbSAg and polymerase, gene X.

A detailed listing of unmodified HBV sense and antisense strand sequences is shown in Table 1. 3.

A detailed listing of the modified HBV sense and antisense strand sequences is shown in Table 1. four.

siRNA synthesis.

- 105 039127

HBV siRNA sequences were synthesized at a scale of 1 μmol on a Mermade 192 synthesizer (BioAutomation) using a solid support mediating the features of phosphoramidate chemistry. The solid support was a custom pore size (500 A) glass support loaded with custom GalNAc ligand or an all purpose solid support (AM biochemical). Auxiliary reagents for the synthesis, 2'-F- and 2'-O-methyl-RNA and deoxophosphoramidites, were obtained from Thermo-Fisher (Milwaukee, Wisconsin) and Hongene (China). 2'F, 2'-O-methyl, GNA (glycol nucleic acids), 5'-phosphate and modifications to remove the nitrogenous base were introduced using the appropriate phosphoramidites. Synthesis of single strands conjugated to GalNAc at the 3' end was performed on a GalNAc modified CPG support. A custom-made universal solid CPG support was used to synthesize the antisense single strands. The binding time for all phosphoramidites (100 mM in acetonitrile) was 5 min using 5-ethylthio-1H-tetrazole (ETT) as activator (0.6 M in acetonitrile). Phosphorothioate linkages were prepared using a 50 mM solution of 3-((dimethylaminomethylidene)amino)-3H1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, MA, USA)) in anhydrous acetonitrile/pyridine ( 1:1 volume/volume). The oxidation time was 3 min. All sequences were synthesized with the eventual removal of the DMT group (no DMT).

Upon completion of solid phase synthesis, oligoribonucleotides were cleaved from the solid support and deprotected in sealed 96 deep well plates using 200 μl of aqueous methylamine reagent at 60° C. for 20 min. At the end of the cleavage and deprotection step, the synthesis plate was allowed to warm to room temperature and the contents were precipitated by adding 1 ml of acetonitrile:ethanol (9:1). The plates were cooled at -80°C for 2 h and the supernatant was carefully removed using a multichannel pipette. The pellet with oligonucleotides was resuspended in 20 mM NaOAc buffer and desalted using a 5 ml HiTrap size exclusion chromatography column (GE Healthcare) on an AKTA Purifier System equipped with an A905 autosampler and a Frac 950 fraction collector. The desalted samples were collected in 96-well plates. Samples from each sequence were analyzed by LC-MS for identity, UV (260 nm) for quantitation, and a selected set of samples were analyzed by IEX chromatography for purity.

Hybridization of individual HBV strands was performed on a Tesap automatic fluid handling device. An equimolar mixture of sense and antisense single strands were pooled and hybridized in 96-well plates. After combining the complementary single strands, the 96-well plate was tightly sealed and heated in an oven at 100° C. for 10 minutes, and allowed to slowly reach room temperature over a 2-3 hour period. The concentration of each duplex was normalized to 10 μM in 1X PBS.

Example 2 Screening for siRNA duplexes In vitro.

Cell culture and transfection.

Cos7 cells (ATCC, Manassas, VA) were grown to near confluency at 37° C. in 5% CO ₂ in DMEM (ATCC) supplemented with 10% FBS until detached from the plate by trypsinization. Designs of luciferase Dual-Glo®, created in the plasmid psiCHECK2, containing approximately 1.1 T. p. HBV genomic sequences were transfected in approximately 15 x 10 ⁴ cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, cat. no. 11668-019). In each well of a 96-well plate, 0.2 μl of Lipofectamine was added to 10 ng of plasmid vector in 14.8 μl of Opti-MEM and allowed to complex at room temperature for 15 minutes. The mixture was then added to the cells, which were resuspended in 80 µl of fresh complete medium. After about 24 hours, the media was removed and the cells were re-transfected with siRNA. Each siRNA was transfected into cells that had previously been transfected with a psiCHECK2-HBV vector that matched the siRNA perfectly. Transfection with siRNA was performed by adding 14.8 µl of Opti-MEM with 0.2 µl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad, CA, Cat # 13778-150) to 5 µl of siRNA duplexes per well in a 96-well plate and incubated at room temperature for 15 min. The mixture was then added to cells previously transfected with the psiCHECK2-HBV plasmid, which matched the siRNA sequence perfectly. Cells were incubated for 24 hours before measuring luciferase activity.

Single dose experiments were performed at a final duplex concentration of 10 and 0.01 nM.

Analysis using the Dual-Glo® luciferase system Twenty-four hours after transfection, firefly luciferase activity (transfection control) and Rinella (fused to HBV target sequence) were measured using siRNA. First, the cells were separated from the medium. Firefly luciferase activity was then measured by adding 75 µl of Dual-Glo® luciferase reagent, equal to the volume of the culture medium, to each well and mixing. The mixture was incubated at room temperature for 30 minutes before measuring luminescence (500 nm) on Spectramax (Molecular Devices) to detect the signal from firefly luciferase. Renilla luciferase activity was measured by adding

- 106 039127 75 µl at room temperature, with Dual-Glo® Stop & Glo® reagent added to each well and plates incubated for 10-15 min before re-measuring luminescence to determine the Renilla luciferase signal. Dual-Glo® Stop & Glo® Reagent quenches the firefly luciferase signal and maintains the luminescence of the Renilla luciferase reaction. The siRNA activity was determined by normalizing in each well the signal from Renilla (HBV) to the signal from firefly luciferase (control). The magnitude of siRNA activity was then evaluated relative to cells that were transfected with the same vector but not treated with siRNA or treated with siRNA that did not target. All transfection reactions were carried out in the amount of n=2 or more.

In table. 5 shows the results of single dose screening in Cos7 cells transfected with the indicated HBV iRNAs. Data are expressed as percentage of residual mRNA compared to the negative control.

Table 2 Nucleotide monomer abbreviations used in the presentation of a nucleic acid sequence. It should be understood that, unless otherwise indicated, these monomers, if present in the oligo________ nucleotide, are linked together by 5'-3'-phosphodiester bonds________

Abbreviated e Nucleotide(s) BUT Adenosine 3'-phosphate Af 2'-Fluoradenosine-3'-phosphate Afs 2'-Fluoradenosine-3'-phosphorothioate As Adenosine-3'-phosphorothioate FROM Cytidine-3'-phosphate cf 2'-Fluorocytidine-3'-phosphate cfs 2'-Fluorocytidine-3'-phosphorothioate Cs Cytidine-3'-phosphorothioate G Guanosine-3'-phosphate gf 2'-Fluoroguanosine-3'-phosphate Gfs 2'-Fluoroguanosine-3'-phosphorothioate Gs Guanosine-3'-phosphorothioate T 5'-Methyluridine-3'-phosphate

- 107 039127

Tf 2'-Fluoro-5-methyluridine-3'-phosphate Tfs 2'-Fluoro-5-methyluridine-3'-phosphorothioate Ts 5-Methyluridin-3'-phosphorothioate U Uridine 3'-phosphate uf 2'-Fluorouridine-3'-phosphate Ufs 2'-Fluorouridine-3'-phosphorothioate Us Uridine-3'-phosphorothioate N Any nucleotide (G, A, C, T or U) a 2'-0-Methyladenosine-3'-phosphate as 2'-0-Methyladenosine-3'-phosphorothioate c 2'-O-Methylcytidine-3'-phosphate cs 2'-O-Methylcytidine-3'-phosphorothioate g 2'-0-Methylguanosine-3'-phosphate gs 2'-0-Methylguanosine-3'-phosphorothioate t 2'-O-Methyl-5-methyluridine-3'-phosphate ts 2'-O-Methyl-5-methyluridine-3'-phosphorothioate u 2'-O-Methyluridine-3'-phosphate US 2'-O-Methyluridine-3'-phosphorothioate s Phosphorothioate bond L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol-Nur(GalNAc-alkyl)3 (dT) 2'-Deoxythymidine-3'-phosphate Y34 2-hydroxymethyltetrahydrofuran-4-methoxy-3-phosphate (devoid of nitrogenous base 2'-OMe-furanose) Y44 2-Hydroxymethyltetrahydrofuran-5-phosphate (agn) Adenosine Glycol Nucleic Acid (GNA) (Tgn) Thymidine glycol nucleic acid (GNA), 3-isomer (cgn) Cytidine Glycol Nucleic Acid (GNA) P Phosphate VP Vinyl Phosphate

- 108 039127

Table 3

Unmodified HBV dsRNA sense and antisense strand sequences duplex name Name of sense oligonucleotide semantic sequence (5'-3') SEQ ID NO Name antisense oligonucleotide Antisense sequence (5'3' ) SEQID NO: Laid e in NC_00397 7.1 AD61522.2 A-123463.2 AGUUAUAUGGAUGAUGUGGUA 47 A-123464.2 UAC CACAU CAU C CAUAUAACU GA 263 731_753 AD61547.2 A-123487.2 GGAUGUGUCUGCGGCGUUUUA 48 A-123488.2 UAAAACGСCGCAGACACAUСCAG 264 373_395 AD63938.2 A-127896.1 ACUCGUGGUGGACUUCUCUCA 49 A-127897.1 U GAGAGAAGU C CAC CAC GAGU CU 265 250_272 AD63939.2 A-127909.1 ACUCGUGGUGGACUUCUCUCA fifty A-127906.3 U GAGAGAAGU C CAC CAC GAGU CU 266 250_272 AD63940.2 A-127917.1 ACUCGUGGUGGACUUCTCUCA 51 A-127906.11 U GAGAGAAGU C CAC CAC GAGU CU 267 250_272 AD63941.2 A-127905.8 ACUCGUGGUGGACUUCUCUCA 52 A-127925.1 U GAGAGAAGU C CAC CAC GAGU CU 268 250_272 AD63942.2 A-127933.1 UCGUGGUGGACUUCUCUCA 53 A-127934.1 U GAGAGAAGU C CAC CAC GAGU 269 252_274 AD63943.2 A-127944.2 ACUCGUGGUGGACUUCUCUCA 54 A-127942.2 U GAGAGAAGU C CAC CAC GAGU CU 270 250_272 AD63945.2 A-127910.1 ACUCGUGGUGGACUUCUCUCA 55 A-127906.4 U GAGAGAAGU C CAC CAC GAGU CU 271 250_272 AD63946.2 A-127918.1 ACUCGUGGUGGACUUCUCUCA 56 A-127906.12 U GAGAGAAGUCCACCACGAGUCU 272 250_272 AD63947.2 A-127905.9 ACUCGUGGUGGACUUCUCUCA 57 A-127926.1 U GAGAGAAGU C CAC CAC GAGU CU 273 250_272 AD63948.2 A-127935.1 GUGGUGGACUUCUCUCA 58 A-127936.1 U GAGAGAAGU C CAC CAC GA 274 254_276 AD63949.2 A-127944.3 ACUCGUGGUGGACUUCUCUCA 59 A-127906.14 U GAGAGAAGU C CAC CAC GAGU CU 275 250_272 AD63950.2 A-127900.1 UCGUGGUGGACUUCUCUCAUU 60 A-127901.1 U GAGAGAAGU C CAC CAC GAUU 276 252_274 AD63951.2 A-127911.1 ACUCGUGGUGGACUUCUCUCA 61 A-127906.5 U GAGAGAAGU C CAC CAC GAGU CU 277 250_272 AD63952.2 A-127905.2 ACUCGUGGUGGACUUCUCUCA 62 A-127919.1 U GAGAGAAGU C CAC CAC GAGU CU 278 250_272 AD63953.2 A-127905.10 ACUCGUGGUGGACUUCUCUCA 63 A-127927.1 U GAGAGAAGU C CAC CAC GAGU CU 279 250_272 AD- A-127945.1 ACUCGUGGUGGACUUCUCUCA 64 A-127940.3 U GAGAGAAGU C CAC CAC GAGU CU 280 250 272

63955.2 AD63956.2 A-127902.1 UCGUGGUGGACUUCUCUCA 65 A-127903.1 U GAGAGAAGU WITH САС CAC GAUU 281 252_274 AD63957.2 A-127912.1 ACUCGUGGUGGACUUCUCUCA 66 A-127906.6 U GAGAGAAGU C CAC CAC GAGU CU 282 250_272 AD63958.2 A-127905.3 ACUCGUGGUGGACUUCUCUCA 67 A-127920.1 U GAGAGAAGU C CAC CAC GAGU CU 283 250_272 AD63959.2 A-127905.11 ACUCGUGGUGGACUUCUCUCA 68 A-127928.1 U GAGAGAAGU C CAC CAC GAGU CU 284 250_272 AD63960.2 A-126619.2 UAUUUCCUAGGGUACAA 69 A-127938.1 U GAGAGAAGU C CAC CAC GA 285 254_276 AD63961.2 A-127945.2 ACUCGUGGUGGACUUCUCUCA 70 A-127942.3 U GAGAGAAGU C CAC CAC GAGU CU 286 250_272 AD63962.2 A-127902.2 UCGUGGUGGACUUCUCUCA 71 A-127904.1 U GAGAGAAGU C CAC CAC GAUU 287 252_274 AD63963.2 A-127913.1 ACUCGUGGUGGACUUCUCUCA 72 A-127906.7 U GAGAGAAGU C CAC CAC GAGU CU 288 250_272 AD63964.2 A-127905.4 ACUCGUGGUGGACUUCUCUCA 73 A-127921.1 U GAGAGAAGU C CAC CAC GAGU CU 289 250_272 AD63965.2 A-127905.12 ACUCGUGGUGGACUUCUCUCA 74 A-127929.1 U GAGAGAAGU C CAC CAC GAGU CU 290 250_272 AD63966.2 A-127939.1 ACUCGUGGUGGACUUCUCUCA 75 A-127940.1 U GAGAGAAGU C CAC CAC GAGU CU 291 250_272 AD63967.2 A-127945.3 ACUCGUGGUGGACUUCUCUCA 76 A-127906.15 U GAGAGAAGUCCACCACGAGUCU 292 250_272 AD63968.2 A-127905.1 ACUCGUGGUGGACUUCUCUCA 77 A-127906.1 U GAGAGAAGU C CAC CAC GAGU CU 293 250_272 AD63968.4 A-127905.15 ACUCGUGGUGGACUUCUCUCA 78 A-127906.17 U GAGAGAAGU C CAC CAC GAGU CU 294 250_272 AD63968.5 A-127905.17 ACUCGUGGUGGACUUCUCUCA 79 A-127906.18 U GAGAGAAGU C CAC CAC GAGU CU 295 250_272 AD63969.2 A-127914.1 ACUCGUGGUGGACUUCUCUCA 80 A-127906.8 U GAGAGAAGU C CAC CAC GAGU CU 296 250_272 AD63970.2 A-127905.5 ACUCGUGGUGGACUUCUCUCA 81 A-127922.1 U GAGAGAAGU C CAC CAC GAGU CU 297 250_272 AD63971.2 A-127905.13 ACUCGUGGUGGACUUCUCUCA 82 A-127930.1 U GAGAGAAGUCCACCACGAGUCU 298 250_272 AD63972.2 A-127941.1 ACUCGUGGUGGACUUCUCUCA 83 A-127942.1 U GAGAGAAGU C CAC CAC GAGU CU 299 250_272 AD63973.2 A-127946.1 ACUCGUGGUGGACUUCUCUCA 84 A-127947.1 U GAGAGAAGT C CAC CAC GAGU CU 300 250_272

- 109 039127

AD63975.2 A-127915.1 ACUCGUGGUGGACUUCTCUCA 85 A-127906.9 U GAGAGAAGU WITH САС CAC GAGU CU 301 250_ _272 AD63976.2 A-127905.6 ACUCGUGGUGGACUUCUCUCA 86 A-127923.1 U GAGAGAAGU C CAC CAC GAGU CU 302 250_ _272 AD63977.2 A-127917.2 ACUCGUGGUGGACUUCTCUCA 87 A-127931.1 U GAGAGAAGU C CAC CAC GAGU CU 303 250_ _272 AD63978.2 A-127943.1 ACUCGUGGUGGACUUCUCUCA 88 A-127906.13 U GAGAGAAGU C CAC CAC GAGU CU 304 250 _272 AD63979.2 A-127908.1 ACUCGUGGUGGACUUCUCUCA 89 A-127906.2 U GAGAGAAGU C CAC CAC GAGU CU 305 250_ _272 AD63980.2 A-127916.1 ACUCGUGGUGGACUUCTCUCA 90 A-127906.10 U GAGAGAAGU C CAC CAC GAGU CU 306 250 _272 AD63981.2 A-127905.7 ACUCGUGGUGGACUUCUCUCA 91 A-127924.1 U GAGAGAAGU C CAC CAC GAGU CU 307 250 _272 AD63982.2 A-127917.3 ACUCGUGGUGGACUUCTCUCA 92 A-127932.1 U GAGAGAAGU C CAC CAC GAGU CU 308 250 _272 AD63983.2 A-127944.1 ACUCGUGGUGGACUUCUCUCA 93 A-127940.2 U GAGAGAAGU C CAC CAC GAGU CU 309 250 _272 AD63985.2 A-127961.1 GUGGUGGACUUCUCUCAAUUU 94 A-127956.4 AAAUU GAGAGAAGU C CAC CAC GA 310 254 _276 AD63986.2 A-127969.1 GUGGUGGACUUCUCUCAAUUU 95 A-127956.12 AAAUU GAGAGAAGU C CAC CAC GA 311 254_ _276 AD63987.2 A-127955.9 GUGGUGGACUUCUCUCAAUUU 96 A-127977.1 AAAUU GAGAGAAGU C CAC CAC GA 312 254 _276 AD63988.2 A-127986.1 UGGACUUCUCUCAAUUU 97 A-127987.1 AAAUU GAGAGAAGU WITH CAC C 313 258_ _2 8 0 AD63989.2 A-127996.1 GUGGUGGACUUCUCUCAAUUU 98 A-127992.2 AAAUU GAGAGAAGU C CAC CAC GA 314 254 _276 AD63990.2 A-127950.1 GGUGGACUUCUCUCAAUUUUU 99 A-127951.1 AAAUU GAGAGAAGU WITH CAC CUU 315 256_ _278 AD63991.2 A-127962.1 GUGGUGGACUUCUCUCAAUUU 100 A-127956.5 AAAUU GAGAGAAGU C CAC CAC GA 316 254_ _276 AD63992.2 A-127955.2 GUGGUGGACUUCUCUCAAUUU 101 A-127970.1 AAAUU GAGAGAAGU C CAC CAC GA 317 254_ _276 AD63993.2 A-127955.10 GUGGUGGACUUCUCUCAAUUU 102 A-127978.1 AAAUU GAGAGAAGU C CAC CAC GA 318 254_ _276 AD63994.2 A-127984.2 GGUGGACUUCUCUCAAUUU 103 A-127988.1 AAAUU GAGAGAAGU C CAC CAC 319 256 _278 AD63995.2 A-127996.2 GUGGUGGACUUCUCUCAAUUU 104 A-127993.2 AAAUU GAGAGAAGU C CAC CAC GA 320 254_ _276 AD- A-127952.1 GGUGGACUUCUCUCAAUUU 105 A-127953.1 AAAUU GAGAGAAGU WITH CAC CUU 321 256 _278 63996.2 AD63997.2 A-127963.1 GUGGUGGACUUCUCUCAAUUU 106 A-127956.6 AAAUU GAGAGAAGU C CAC CAC GA 322 254 _276 AD63999.2 A-127955.11 GUGGUGGACUUCUCUCAAUUU 107 A-127979.1 AAAUU GAGAGAAGU C CAC CAC GA 323 254 _276 AD64000.2 A-127986.2 UGGACUUCUCUCAAUUU 108 A-127989.1 AAAUU GAGAGAAGU WITH CAC C 324 258 _2 8 0 AD64001.2 A-127996.3 GUGGUGGACUUCUCUCAAUUU 109 A-127994.2 AAAUU GAGAGAAGU C CAC CAC GA 325 254 _276 AD64002.2 A-127952.2 GGUGGACUUCUCUCAAUUU 110 A-127954.1 AAAUU GAGAGAAGU WITH CAC CUU 326 256_ _278 AD64003.2 A-127964.1 GUGGUGGACUUCUCUCAAUUU 111 A-127956.7 AAAUU GAGAGAAGU C CAC CAC GA 327 254 _276 AD64004.2 A-127955.4 GUGGUGGACUUCUCUCAAUUU 112 A-127972.1 AAAUU GAGAGAAGU C CAC CAC GA 328 254_ _276 AD64005.2 A-127955.12 GUGGUGGACUUCUCUCAAUUU 113 A-127980.1 AAAUU GAGAGAAGU C CAC CAC GA 329 254 _276 AD64006.2 A-127990.1 GUGGUGGACUUCUCUCAAUUU 114 A-127991.1 AAAUU GAGAGAAGU C CAC CAC GA 330 254_ _276 AD64007.2 A-127996.4 GUGGUGGACUUCUCUCAAUUU 115 A-127995.2 AAAUU GAGAGAAGU C CAC CAC GA 331 254_ _276 AD64008.2 A-127955.1 GUGGUGGACUUCUCUCAAUUU 116 A-127956.1 AAAUU GAGAGAAGU C CAC CAC GA 332 254_ _276 AD64008.4 A-127955.15 GUGGUGGACUUCUCUCAAUUU 117 A-127956.14 AAAUU GAGAGAAGUCCACCACGA 333 254_ _276 AD64009.2 A-127965.1 GUGGUGGACUUCUCUCAAUUU 118 A-127956.8 AAAUU GAGAGAAGU C CAC CAC GA 334 254_ _276 AD64010.2 A-127955.5 GUGGUGGACUUCUCUCAAUUU 119 A-127973.1 AAAUU GAGAGAAGU C CAC CAC GA 335 254 _276 AD64011.2 A-127955.13 GUGGUGGACUUCUCUCAAUUU 120 A-127981.1 AAAUU GAGAGAAGU C CAC CAC GA 336 254_ _276 AD64012.2 A-127990.2 GUGGUGGACUUCUCUCAAUUU 121 A-127992.1 AAAUU GAGAGAAGU C CAC CAC GA 337 254_ _276 AD64013.2 A-127997.1 GUGGUGGACTTCUCUCAAUUU 122 A-127998.1 AAAUU GAGAGAAGT C CAC CAC GA 338 254_ _276 AD64014.2 A-127957.1 GUGGUGGACUUCUCUCAAUUU 123 A-127958.1 AAAUU GAGAGAAGUCCACCACGA 339 254_ _276 AD64015.2 A-127966.1 GUGGUGGACUUCUCUCAAUUU 124 A-127956.9 AAAUU GAGAGAAGU C CAC CAC GA 340 254_ _276 AD64016.2 A-127955.6 GUGGUGGACUUCUCUCAAUUU 125 A-127974.1 AAAUU GAGAGAAGU C CAC CAC GA 341 254 _276

- 110 039127

AD64017.2 A-127968.2 GUGGUGGACUTCUCUCAAUUU 126 A-127982.1 AAAUU GAGAGAAGT C GAG GAG GA 342 254_276 AD64018.2 A-127990.3 GUGGUGGACUUCUCUCAAUUU 127 A-127993.1 AAAUU GAGAGAAGU C GAG GAG GA 343 254_276 AD64019.2 A-127959.1 GUGGUGGACUUCUCUCAAUUU 128 A-127956.2 AAAUU GAGAGAAGU C GAG GAG GA 344 254_276 AD64020.2 A-127967.1 GUGGUGGACUUCUCUCAAUUU 129 A-127956.10 AAAUU GAGAGAAGU WITH САС CAC GA 345 254_276 AD64021.2 A-127955.7 GUGGUGGACUUCUCUCAAUUU 130 A-127975.1 AAAUU GAGAGAAGU C CAC CAC GA 346 254_276 AD64022.2 A-127968.3 GUGGUGGACUTCUCUCAAUUU 131 A-127983.1 AAAUU GAGAGAAGT C CAC CAC GA 347 254_276 AD64023.2 A-127990.4 GUGGUGGACUUCUCUCAAUUU 132 A-127994.1 AAAUU GAGAGAAGU C CAC CAC GA 348 254_276 AD64024.2 A-127960.1 GUGGUGGACUUCUCUCAAUUU 133 A-127956.3 AAAUU GAGAGAAGU C CAC CAC GA 349 254_276 AD64025.2 A-127968.1 GUGGUGGACUTCUCUCAAUUU 134 A-127956.11 AAAUU GAGAGAAGU C CAC CAC GA 350 254_276 AD64026.2 A-127955.8 GUGGUGGACUUCUCUCAAUUU 135 A-127976.1 AAAUU GAGAGAAGU C CAC CAC GA 351 254_276 AD64027.2 A-127984.1 GGUGGACUUCUCUCAAUUU 136 A-127985.1 AAAUU GAGAGAAGU C CAC CAC 352 256_278 AD64028.2 A-127990.5 GUGGUGGACUUCUCUCAAUUU 137 A-127995.1 AAAUU GAGAGAAGU C CAC CAC GA 353 254_276 AD64272.2 A-128001.2 GUGCACUUCGCUUCACCUCUG 138 A-128002.2 CAGAGGUGAAGCGAAGUGCACAC 354 1577_159 9 AD64274.1 A-128363.1 GUU GACAAAAAU C CU CACAAU 139 A-128364.1 AUUGUGAGGAUUUUUGUCAACAA 355 215_237 AD64275.1 A-128377.1 U GUU GACAAAAAU C CU CACAA 140 A-128378.1 UUGUGAGGAUUUUUGUCAACAAG 356 214_236 AD64276.1 A-128393.1 GGUGGACUUCUCUCAAUUUUA 141 A-128394.1 UAAAAUU GAGAGAAGU C CAC CAC 357 256_278 AD64277.1 A-128407.1 UCUUUUGGAGUGUGGAUUCGA 142 A-128408.1 U C GAAU C CACACU C CAAAAGACA 358 2259_228 1 AD64277.1 A-128407.1 UCUUUUGGAGUGUGGAUUCGA 143 A-128408.1 U C GAAU C CACACU C CAAAAGACA 359 2259_228 1 AD64278.1 A-128423.1 ACUGUUCAAGCCUCCAAGCUA 144 A-128424.1 UAGCUUGGAGGCUUGAACAAGAC 360 1857_187 9 AD64279.1 A-128435.1 UCUGCCGAUCCAUACUGCGGA 145 A-128436.1 UCCGCAGUAUGGAUCGGCAGAGG 361 1255_127 7 AD- A-128379.1 AUGUGUCUGCGGCGUUUUAUA 146 A-128380.1 UAUAAAAC G C C G CAGACACAU C C 362 375_397 64280.1 AD64281.1 A-128395.1 CCCCGUCUGUGCCUUCUCUA 147 A-128396.1 UAUGAGAAGGCACAGACGGGGAG 363 1545_156 7 AD64282.1 A-128409.1 GCCUAAUGAUCUGUUGUUGAU 148 A-128410.1 AU GAACAAGAGAU GAUUAG C GAG 364 1831_185 3 AD64283.1 A-128425.1 UCUAGACUCGUGGUGGACUUC 149 A-128426.1 GAAGU C CAC CAC GAGU CUAGACU 365 245_267 AD64284.1 A-128437.1 CUGCCGAUCCAUACUGCGGAA 150 A-128438.1 UUCCGCAGUAUGGAUCGGCAGAG 366 1256_127 8 AD64285.1 A-128365.1 UUUUUGUUGUUGACAAAAAUA 151 A-128366.1 UAUUUUU GU CAACAAGAAAAAC C 367 207_229 AD64286.1 A-128381.1 AUCUUCUUGUUGGUUCUUCUA 152 A-128382.1 UAGAAGAAC CAACAAGAAGAU GA 368 426_448 AD64289.1 A-128367.1 GUUUUUGUUGUUGACAAAAAAU 153 A-128368.1 AUUUUU GU CAACAAGAAAAAC C C 369 206_228 AD64290.1 A-128383.1 CUGCCUAAUCAUCUCUUGUUA 154 A-128384.1 UAACAAGAGAUGAUUAGGCAGAG 370 1829_185 1 AD64291.1 A-128399.1 U C CU CACAAUAC CACAGAGUA 155 A-128400.1 UACUCUGUGGUAUUGUGAGGAUU 371 226_248 AD64292.1 A-128413.1 GUU GUU GACAAAAAU C CU CAA 156 A-128414.1 UUGAGGAUUUUUGUCAACAAGAAA 372 212_234 AD64293.1 A-128439.1 GCAACUUUUUCACCUCUGCCU 157 A-128440.1 AGGCAGAGGUGAAAAAGUUGCAU 373 1814_183 6 AD64294.1 A-128369.1 GGGAACAAGAGCUACAGCAUA 158 A-128370.1 UAU GCU GUAGCU CUU GUU WITH C CAA 374 2828_285 0 AD64295.1 A-128385.1 CGUGGUGGACUUCUCUCAAUU 159 A-128386.1 AAUU GAGAGAAGU WITH СAC CAG CAG 375 253_275 AD64297.1 A-128415.1 CUGCUGCUAUGCCUCAUCUUA 160 A-128416.1 UAAGAUGAGGCAUAGCAGCAGGA 376 411_433 AD64298.1 A-128427.1 GUUGGAUGUGUCUGCGGCGUU 161 A-128428.1 AAC G C C G CAGACACAU C CAAC GA 377 370_392 AD64299.1 A-128441.1 UUCAUCCUGCUGCUAUGCCUA 162 A-128442.1 UAGGCAUAGCAGCAGGAUGAAGA 378 405_427 AD64300.1 A-128371.1 UU GUU GUU GACAAAAAU C CUA 163 A-128372.1 UAGGAUUUUU GU CAACAAGAAAA 379 210_232 AD64302.1 A-128417.1 UAUAUGGAUGAUGUGGUAUUA 164 A-128418.1 U AAU AC CAC AU C AU C C AU AU AAC 380 734_756 AD64303.1 A-128429.1 UUCAUCCUGCUGCUAUGCCUC 165 A-128430.1 GAGGCAUAGCAGCAGGAUGAAGA 381 405_427 AD64304.1 A-128443.1 GU GCACUU C GCUU GAG CU CUA 166 A-128444.1 UAGAGGUGAAGCGAAGUGCACAC 382 1577_159 9

- 111 039127

AD64305.1 A-128373.1 UU GACAAAAAU C CU CACAAUA 167 A-128374.1 UAUU GU GAGGAUUUUU GU CAACA 383 216_238 AD64307.1 A-128403.1 AAGCCUCCAAGCUGUGCCUUA 168 A-128404.1 UAAGGCACAGCUUGGAGGCUUGA 384 1864_188 6 AD64308.1 A-128419.1 CCUCUUCAUCCUGCUGCUAUA 169 A-128420.1 UAUAGCAGCAGGAUGAAGAGGAA 385 401_423 AD64309.1 A-128431.1 CCUGCUGCUAUGCCUCAUCUU 170 A-128432.1 AAGAUGAGGCAUAGCAGCAGGAU 386 410_432 AD64310.1 A-128375.1 CAUCUUCUUGUUGGUUCUUCU 171 A-128376.1 AGAAGAAC CAACAAGAAGAU GAG 387 425_447 AD64311.1 A-128391.1 CCGUCUGUGCCUUCUCAUCUA 172 A-128392.1 UAGAUGAGAAGGCACAGACGGGG 388 1547_156 9 AD64312.1 A-128405.1 CCUCAUCUUCUUGUUGGUUCU 173 A-128406.1 AGAACCAACAAGAAGAUGAGGCA 389 422_444 AD64313.1 A-128421.1 With CAC CAAAU GC With C CUAU CUUA 174 A-128422.1 UAAGAUAGGGGCAUUUGGUGGUC 390 2298_232 0 AD64314.1 A-128433.1 GCUCCUCUGCCGAUCCAUACU 175 A-128434.1 AGUAUGGAUCGGCAGAGGAGCCA 391 1250_127 2 AD64315.1 A-128363.2 GUU GACAAAAAU C CU CACAAU 176 A-128445.1 AUUGUGAGGAUUUUUGUCAACAA 392 215_237 AD64316.1 A-128377.2 U GUU GACAAAAAU C CU CACAA 177 A-128453.1 UUGUGAGGAUUUUUGUCAACAAG 393 214_236 AD64317.1 A-128393.2 GGUGGACUUCUCUCAAUUUUA 178 A-128461.1 UAAAAUU GAGAGAAGU C CAC CAC 394 256_278 AD64318.1 A-128407.2 UCUUUUGGAGUGUGGAUUCGA 179 A-128469.1 U C GAAU C CACACU C CAAAAGACA 395 2259_228 1 AD64318.1 A-128407.2 UCUUUUGGAGUGUGGAUUCGA 180 A-128469.1 U C GAAU C CACACU C CAAAAGACA 396 2259_228 1 AD64319.1 A-128423.2 ACUGUUCAAGCCUCCAAGCUA 181 A-128477.1 UAGCUUGGAGGCUUGAACAAGAC 397 1857_187 9 AD64320.1 A-128435.2 UCUGCCGAUCCAUACUGCGGA 182 A-128483.1 UCCGCAGUAUGGAUCGGCAGAGG 398 1255_127 7 AD64321.1 A-123463.3 AGUUAUAUGGAUGAUGUGGUA 183 A-128446.1 UAC CACAU CAU C CAUAUAACU GA 399 731_753 AD64322.1 A-128379.2 AUGUGUCUGCGGCGUUUUAUA 184 A-128454.1 UAUAAAACGСCGCAGACACAUСC 400 375_397 AD64323.1 A-128395.2 CCCCGUCUGUGCCUUCUCUA 185 A-128462.1 UAUGAGAAGGCACAGACGGGGAG 401 1545_156 7 AD64324.1 A-128409.2 GCCUAAUCAUCUCUUGUUCAU 186 A-128470.1 AU GAACAAGAGAU GAUUAG C GAG 402 1831_185 3 AD- A-128425.2 UCUAGACUCGUGGUGGACUUC 187 A-128478.1 GAAGU C CAC CAC GAGU CUAGACU 403 245_267 64325.1 AD64326.1 A-128437.2 CUGCCGAUCCAUACUGCGGAA 188 A-128484.1 UUCCGCAGUAUGGAUCGGCAGAG 404 1256_127 8 AD64328.1 A-128381.2 AUCUUCUUGUUGGUUCUUCUA 189 A-128455.1 UAGAAGAAC CAACAAGAAGAU GA 405 426_448 AD64330.1 A-128411.2 UUCUCUCAAUUUUCUAGGGGA 190 A-128471.1 U C C C CUAGAAAAUU GAGAGAAGU 406 263_285 AD64331.1 A-127905.16 ACUCGUGGUGGACUUCUCUCA 191 A-127907.2 U GAGAGAAGU C CAC CAC GAGU CU 407 250_272 AD64332.1 A-128001.3 GUGCACUUCGCUUCACCUCUG 192 A-128485.1 CAGAGGUGAAGCGAAGUGCACAC 408 1577_159 9 AD64333.1 A-128367.2 GUUUUUCUUGUUGACAAAAAAU 193 A-128448.1 AUUUUU GU CAACAAGAAAAAC C C 409 206_228 AD64334.1 A-128383.2 CUGCCUAAUCAUCUCUUGUUA 194 A-128456.1 UAACAAGAGAUGAUUAGGCAGAG 410 1829_185 1 AD64335.1 A-128399.2 U C CU CACAAUAC CACAGAGUA 195 A-128464.1 UACUCUGUGGUAUUGUGAGGAUU 411 226_248 AD64336.1 A-128413.2 CUU GUU GACAAAAAU C CU CAA 196 A-128472.1 UUGAGGAUUUUUGUCAACAAGAAA 412 212_234 AD64337.1 A-127955.16 GUGGUGGACUUCUCUCAAUUU 197 A-127958.2 AAAUU GAGAGAAGU C CAC CAC GA 413 254_276 AD64338.1 A-128439.2 GCAACUUUUUCACCUCUGCCU 198 A-128486.1 AGGCAGAGGUGAAAAAGUUGCAU 414 1814_183 6 AD64339.1 A-128369.2 GGGAACAAGAGCUACAGCAUA 199 A-128449.1 UAU GCU GUAGCU CUU GUU WITH C CAA 415 2828_285 0 AD64341.1 A-128401.2 UCAUCUUCUUGUUGGUUCUUA 200 A-128465.1 UAAGAAC CAACAAGAAGAU GAG G 416 424_446 AD64342.1 A-128415.2 CUGCUGCUAUGCCUCAUCUUA 201 A-128473.1 UAAGAUGAGGCAUAGCAGCAGGA 417 411_433 AD64343.1 A-128427.2 GUUGGAUGUGUCUGCGGCGUU 202 A-128479.1 AAC G C C G CAGACACAU C CAAC GA 418 370_392 AD64344.1 A-128441.2 UUCAUCCUGCUGCUAUGCCUA 203 A-128487.1 UAGGCAUAGCAGCAGGAUGAAGA 419 405_427 AD64345.1 A-128371.2 UU CUU GUU GACAAAAAU C CUA 204 A-128450.1 UAGGAUUUUU GU CAACAAGAAAA 420 210_232 AD64347.1 A-123487.3 GGAUGUGUCUGCGGCGUUUUA 205 A-128466.1 UAAAACGСCGCAGACACAUCCAG 421 373_395 AD64348.1 A-128417.2 UAUAUGGAUGAUGUGGUAUUA 206 A-128474.1 UAAUAC CACAU CAU C CAUAUAAC 422 734_756 AD64349.1 A-128429.2 UUCAUCCUGCUGCUAUGCCUC 207 A-128480.1 GAGGCAUAGCAGCAGGAUGAAGA 423 405_427

- 112 039127

AD64350.1 A-128443.2 GU GCACUU C GCUU GAG CU CUA 208 A-128488.1 UAGAGGUGAAGCGAAGUGCACAC 424 1577_159 9 AD64351.1 A-128373.2 UU GACAAAAAU C CU CACAAUA 209 A-128451.1 UAUU GU GAGGAUUUUU GU CAACA 425 216_238 AD64352.1 A-128389.2 CCAAGUGUUUGCUGACGCAAA 210 A-128459.1 UUUGCGUCAGCAAACACUUGGCA 426 1174_119 6 AD64352.1 A-128389.2 CCAAGUGUUUGCUGACGCAAA 211 A-128459.1 UUUGCGUCAGCAAACACUUGGCA 427 1174_119 6 AD64353.1 A-128403.2 AAGCCUCCAAGCUGUGCCUUA 212 A-128467.1 UAAGGCACAGCUUGGAGGCUUGA 428 1864_188 6 AD64354.1 A-128419.2 CCUCUUCAUCCUGCUGCUAUA 213 A-128475.1 UAUAGCAGCAGGAUGAAGAGGAA 429 401_423 AD64355.1 A-128431.2 CCUGCUGCUAUGCCUCAUCUU 214 A-128481.1 AAGAUGAGGCAUAGCAGCAGGAU 430 410_432 AD64356.1 A-128375.2 CAUCUUCUUGUUGGUUCUUCU 215 A-128452.1 AGAAGAAC CAACAAGAAGAU GAG 431 425_447 AD64357.1 A-128391.2 CCGUCUGUGCCUUCUCAUCUA 216 A-128460.1 UAGAUGAGAAGGCACAGACGGGG 432 1547_156 9 AD64358.1 A-128405.2 CCUCAUCUUCUUGUUGGUUCU 217 A-128468.1 AGAACCAACAAGAAGAUGAGGCA 433 422_444 AD64359.1 A-128421.2 With CAC CAAAU GC With C CUAU CUUA 218 A-128476.1 UAAGAUAGGGGCAUUUGGUGGUC 434 2298_232 0 AD64360.1 A-128433.2 GCUCCUCUGCCGAUCCAUACU 219 A-128482.1 AGUAUGGAUCGGCAGAGGAGCCA 435 1250_127 2 AD64700.1 A-129379.1 ACUCGUGGUGTACUUCUCUCA 220 A-127906.26 U GAGAGAAGU C CAC CAC GAGU CU 436 250_272 AD64701.1 A-127905.20 ACUCGUGGUGGACUUCUCUCA 221 A-129387.1 U GAGAGAAGT C CAC CAC GAGU CU 437 250_272 AD64702.1 A-127905.28 ACUCGUGGUGGACUUCUCUCA 222 A-129395.1 U GAGAGAAGU C CAC CAC GAGU CU 438 250_272 AD64703.1 A-129376.2 ACUCGUGGUGGACUUCACUCCA 223 A-129385.5 U GAGAGAAGT C CAC CAC GAGU CU 439 250_272 AD64704.1 A-129381.3 ACU C GU GGT GTACUU CACU CA 224 A-129389.6 U GAGAGAAGU C CAC CAC GAGU CU 440 250_272 AD64705.1 A-129380.1 ACU C GU GGU GTACUU CACU CA 225 A-127906.27 U GAGAGAAGU C CAC CAC GAGU CU 441 250_272 AD64706.1 A-127905.21 ACUCGUGGUGGACUUCUCUCA 226 A-129388.1 U GAGAGAAGU C CAC CAC GAGU CU 442 250_272 AD64707.1 A-127905.29 ACUCGUGGUGGACUUCUCUCA 227 A-129396.1 U GAGAGAAGT C CAC CAC GAGU CU 443 250_272 AD- A-129382.2 ACUCGUGGTGGACUUCTCUCA 228 A-129385.6 U GAGAGAAGT C CAC CAC GAGU CU 444 250_272 64708.1 AD64709.1 A-129373.4 ACUCGUGGUGGACUUCUCUCA 229 A-129391.2 U GAGAGAAGT C CAC CAC GAGU CU 445 250_272 AD64710.1 A-129373.1 ACUCGUGGUGGACUUCUCUCA 230 A-127906.20 U GAGAGAAGU C CAC CAC GAGU CU 446 250_272 AD64711.1 A-129381.1 ACU C GU GGT GTACUU CACU CA 231 A-127906.28 U GAGAGAAGU C CAC CAC GAGU CU 447 250_272 AD64712.1 A-127905.22 ACUCGUGGUGGACUUCUCUCA 232 A-129389.1 U GAGAGAAGU C CAC CAC GAGU CU 448 250_272 AD64713.1 A-127905.30 ACUCGUGGUGGACUUCUCUCA 233 A-129397.1 U GAGAGAAGT C CAC CAC GAGU CU 449 250_272 AD64714.1 A-129384.2 ACUCGUGGTGGACUUCACUCCA 234 A-129385.7 U GAGAGAAGT C CAC CAC GAGU CU 450 250_272 AD64715.1 A-129376.4 ACUCGUGGUGGACUUCACUCCA 235 A-129391.3 U GAGAGAAGT C CAC CAC GAGU CU 451 250_272 AD64716.1 A-129374.1 ACUCGUGGUGGACUUCUCUCA 236 A-127906.21 U GAGAGAAGU C CAC CAC GAGU CU 452 250_272 AD64717.1 A-129382.1 ACUCGUGGTGGACUUCTCUCA 237 A-127906.29 U GAGAGAAGU C CAC CAC GAGU CU 453 250_272 AD64718.1 A-127905.23 ACUCGUGGUGGACUUCUCUCA 238 A-129390.1 U GAGAGAAGU C CAC CAC GAGU CU 454 250_272 AD64719.1 A-127917.5 ACUCGUGGUGGACUUCTCUCA 239 A-129385.2 U GAGAGAAGT C CAC CAC GAGU CU 455 250_272 AD64720.1 A-129381.2 ACU C GU GGT GTACUU CACU CA 240 A-129385.8 U GAGAGAAGT C CAC CAC GAGU CU 456 250_272 AD64721.1 A-129382.4 ACUCGUGGTGGACUUCTCUCA 241 A-129391.4 U GAGAGAAGT C CAC CAC GAGU CU 457 250_272 AD64722.1 A-129375.1 ACUCGUGGUGGACUUCCUCA 242 A-127906.22 U GAGAGAAGU C CAC CAC GAGU CU 458 250_272 AD64723.1 A-129383.1 ACUCGUGGUGGACUUCTCUCA 243 A-127906.30 U GAGAGAAGU C CAC CAC GAGU CU 459 250_272 AD64725.1 A-127917.6 ACUCGUGGUGGACUUCTCUCA 244 A-129398.1 U GAGAGAAGT C CAC CAC GAGU CU 460 250_272 AD64726.1 A-129373.3 ACUCGUGGUGGACUUCUCUCA 245 A-129389.2 U GAGAGAAGU C CAC CAC GAGU CU 461 250_272 AD64727.1 A-129384.4 ACUCGUGGTGGACUUCACUCCA 246 A-129391.5 U GAGAGAAGT C CAC CAC GAGU CU 462 250_272 AD64728.1 A-129376.1 ACUCGUGGUGGACUUCACUCCA 247 A-127906.23 U GAGAGAAGU C CAC CAC GAGU CU 463 250_272 AD64729.1 A-129384.1 ACUCGUGGTGGACUUCACUCCA 248 A-127906.31 U GAGAGAAGU C CAC CAC GAGU CU 464 250_272

- 113 039127

AD64730.1 A-127905.25 ACUCGUGGUGGACUUCUCUCA 249 A-129392.1 U GAGAGAAGT C GAC GAG GAGU CU 465 250_ _272 AD64731.1 A-129399.1 ACUCGUGGUGGACUUCTCUCA 250 A-129385.3 U GAGAGAAGT C GAC GAG GAGU CU 466 250 _272 AD64732.1 A-129376.3 ACUCGUGGUGGACUUCACUCCA 251 A-129389.3 U GAGAGAAGU C GAC GAG GAGU CU 467 250_ _272 AD64733.1 A-129381.4 ACU C GU GGT GTACUU CACU CA 252 A-129391.6 U GAGAGAAGT CAC CAC GAGU CU 468 250_ _272 AD64734.1 A-129377.1 ACUCGUGGUGGACUUCCCUCA 253 A-127906.24 U GAGAGAAGU C CAC CAC GAGU CU 469 250 _272 AD64735.1 A-127905.18 ACUCGUGGUGGACUUCUCUCA 254 A-129385.1 U GAGAGAAGT C CAC CAC GAGU CU 470 250_ _272 AD64736.1 A-127905.26 ACUCGUGGUGGACUUCUCUCA 255 A-129393.1 U GAGAGAAGT C CAC CAC GAGU CU 471 250_ _272 AD64737.1 A-129399.2 ACUCGUGGUGGACUUCTCUCA 256 A-129398.2 U GAGAGAAGT C CAC CAC GAGU CU 472 250_ _272 AD64738.1 A-129382.3 ACUCGUGGTGGACUUCTCUCA 257 A-129389.4 U GAGAGAAGU C CAC CAC GAGU CU 473 250 _272 AD64739.1 A-129378.1 ACUCGUGGUGGACUUCGCUCA 258 A-127906.25 U GAGAGAAGU C CAC CAC GAGU CU 474 250_ _272 AD64740.1 A-127905.19 ACUCGUGGUGGACUUCUCUCA 259 A-129386.1 U GAGAGAAGT C CAC CAC GAGU CU 475 250_ _272 AD64741.1 A-127905.27 ACUCGUGGUGGACUUCUCUCA 260 A-129394.1 U GAGAGAAGT C CAC CAC GAGU CU 476 250 _272 AD64742.1 A-129373.2 ACUCGUGGUGGACUUCUCUCA 261 A-129385.4 U GAGAGAAGT C CAC CAC GAGU CU 477 250_ _272 AD64743.1 A-129384.3 ACUCGUGGTGGACUUCACUCCA 262 A-129389.5 U GAGAGAAGU C CAC CAC GAGU CU 478 250 _272

Table 4

Modified HBV dsRNA sense and antisense strand sequences

Name SEQ Name of antisense oligonucleotide SEQ duplex name SENSE oligonucleotide Semantic sequence (5'3' ) ID NO: Antisense sequence (5'-3') ID NO: AD- AfsgsUfuAfuAfuGfGfAfuGfaUfgUfgGfuA 479 usAfscCfaCfaUfcAfuccAfuAfuA 694 61522.2 A-123463.2 fL96 A-123464.2 faCfusgsa AD- GfsgsAfuGfuGfuCfUfGfcGfgCfgUfuUfuA 480 usAfsaAfaCfgCfcGfcagAfcAfcA 695 61547.2 A-123487.2 fL96 A-123488.2 fuCfcsasg AD63938.2 A-127896.1 Y4 4ACUCGUGGUGGACUUCUCUCA 481 A-127897.1 U GAGAGAAGU C CAC CAC GAGU CU 696 AD- A-127909.1 ascsucGfuGfgUfGfGfaCfuucUfcucaL96 482 A-127906.3 usGfsaGfaGfaAfgUfccaCfcAfcG 697 63939.2 faGfuscsu AD- 483 usGfsaGfaGfaAfgUfccaCfcAfcG 698 63940.2 A-127917.1 ascsucguggugdGacuuc(Tgn)cucaL96 A-127906.11 faGfuscsu AD- AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 484 usGfsaGfagaAfguccaCfcAfcgaG 699 63941.2 A-127905.8 fL96 A-127925.1 fuscsu AD- 485 usGfsaGfaGfaAfgUfccaCfcAfcG 700 63942.2 A-127933.1 uscsGfuGfgUfGfGfaCfuUfcUfcUfcAfL96 A-127934.1 fasgsu AD- 486 usGfsAfgaGfaAfgUfccaCfcAfcG 701 63943.2 A-127944.2 ascsucGfuGfguGfGfaCfuucucucaL96 A-127942.2 faguscsu AD- 487 usGfsaGfaGfaAfgUfccaCfcAfcG 702 63945.2 A-127910.1 ascsucguGfgUfGfGfaCfuucUfcucaL96 A-127906.4 faGfuscsu AD- 488 usGfsaGfaGfaAfgUfccaCfcAfcG 703 63946.2 A-127918.1 ascsucguGfgUfGfGfacuuCfucucaL96 A-127906.12 faGfuscsu AD- AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 489 usGfsaGfagaagUfccaCfcAfcgaG 704 63947.2 A-127905.9 fL96 A-127926.1 fuscsu AD- 4 9 0 usGfsaGfaGfaAfgUfccaCfcAfcs 705 63948.2 A-127935.1 gsusGfgUfGfGfaCfuUfcUfcUfcAfL96 A-127936.1 gsa AD- 491 usGfsaGfaGfaAfgUfccaCfcAfcG 706 63949.2 A-127944.3 ascsucGfuGfguGfGfaCfuucucucaL96 A-127906.14 faGfuscsu AD- Y44UfcGfuGfgUfgGfaCfuUfcUfcUfcAfus 4 92 usGfsasGfaGfaAfgUfcCfaCfcAf 707 63950.2 A-127900.1 uY4 4 A-127901.1 cGfausu AD- 493 usGfsaGfaGfaAfgUfccaCfcAfcG 708 63951.2 A-127911.1 ascsucguGfgUfGfGfaCfuucucucaL96 A-127906.5 faGfuscsu AD- AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 494 usGfsaGfaGfaagUfccaCfcAfcGf 709 63952.2 A-127905.2 fL96 A-127919.1 aGfuscsu AD- AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 495 usGfsagagaAfgUfccaCfcAfcgag 710 63953.2 A-127905.10 fL96 A-127927.1 uscsu AD- 496 usGfsAfgAfgAfaGfuccaCfCfaCf 711 63955.2 A-127945.1 ascsucgugguGfGfacuucucucaL96 A-127940.3 gAfguscsu AD- Y44uscsGfuGfgUfgGfaCfuUfcUfcUfcAfY 497 usGfsaGfaGfaAfgUfcCfaCf cAfc 712 63956.2 A-127902.1 44 A-127903.1 Gfasusu AD- 498 usGfsaGfaGfaAfgUfccaCfcAfcG 713 63957.2 A-127912.1 ascsucguGfgUfGfGfacuucucucaL96 A-127906.6 faGfuscsu AD- AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 499 usGfsagaGfaAfgUfccaCfcAfcga 714 63958.2 A-127905.3 fL96 A-127920.1 Gfuscsu AD- AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 500 usGfsaGfagaAfguccaCfcAfcgag 715 63959.2 A-127905.11 fL96 A-127928.1 uscsu AD- 5 01 PusGfsaGfaGfaAfgUfccaCfcAfc 716 63960.2 A-126619.2 usasUfuUfCfCfuAfgGfgUfaCfaAfL96 A-127938.1 sgsa AD- 502 usGfsAfgaGfaAfgUfccaCfcAfcG 717 63961.2 A-127945.2 ascsucgugguGfGfacuucucucaL96 A-127942.3 faguscsu

- 114 039127

AD63962.2 A-127902.2 Y44uscsGfuGfgUfgGfaCfuUfcUfcUfcAfY 44 503 A-127904.1 PusGfsaGfaGfaAfgUfcCfaCf cAf cGfasusu 718 AD63963.2 A-127913.1 ascsucguggUfgGfacuucucucaL96 504 A-127906.7 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 719 AD63964.2 A-127905.4 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 505 A-127921.1 usGfsaGfaGfaAfgUfccaCfcAfeg agusesu 720 AD63965.2 A-127905.12 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 506 A-127929.1 usGfsagaGfaaGfuccaCfcAfegag useu 721 AD63966.2 A-127939.1 ascsUfcGfugguGfGfaCfuuCfuCfucaL96 507 A-127940.1 usGfsAfgAfgAfaGfuccaCfCfaCf gAfgusesu 722 AD63967.2 A-127945.3 ascsucgugguGfGfacuucucucaL96 508 A-127906.15 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 723 AD63968.2 A-127905.1 Af scsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 509 A-127906.1 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 724 AD63968.4 A-127905.15 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 510 A-127906.17 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 725 AD63968.5 A-127905.17 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 511 A-127906.18 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 726 AD63969.2 A-127914.1 ascsucguggugGfacuucucucaL96 512 A-127906.8 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 727 AD63970.2 A-127905.5 Af scsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 513 A-127922.1 usGfsagaGfaagUfccaCfcAfcgaG fusesu 728 AD63971.2 A-127905.13 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 514 A-127930.1 usGfsagaGfaaguccaCfcAfegagu sesu 729 AD63972.2 A-127941.1 ascsUfcGfuGfguGfGfaCfuuCfuCfucaL96 515 A-127942.1 usGfsAfgaGfaAfgUfccaCfcAfcG fagusesu 730 AD63973.2 A-127946.1 ascsucguggudGdGacuucucucaL96 516 A-127947.1 usdGsaGfaGfaAfgdTccadCcAfcG fagusesu 731 AD63975.2 A-127915.1 ascsucguggUfgGfacuuc(Tgn)cucaL96 517 A-127906.9 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 732 AD63976.2 A-127905.6 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 518 A-127923.1 usGfsagaGfaAfgUfccaCfcAfcga gusesu 733 AD63977.2 A-127917.2 ascsucguggugdGacuuc(Tgn)cucaL96 519 A-127931.1 usdGsagagaaguccadCcacgagusc SU 734 AD63978.2 A-127943.1 ascsUfcGfuGfguGfGfaCfuUfcUfcUfcaL9 6 520 A-127906.13 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 735 AD63979.2 A-127908.1 ascsucGfuGfgUfGfGfaCfuucUfcucAfL96 521 A-127906.2 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 736 AD63980.2 A-127916.1 ascsucguggugGfacuuc(Tgn)cucaL96 522 A-127906.10 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 737 AD- A-127905.7 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA 523 A-127924.1 usGfsaGfagaAfgUfccaCfcAfcga 738 63981.2 fL96 Gfusesu AD63982.2 A-127917.3 ascsucguggugdGacuuc(Tgn)cucaL96 524 A-127932.1 PusdGsagagaaguccadCcacgagus esu 739 AD63983.2 A-127944.1 ascsucGfuGfguGfGfaCfuucucucaL96 525 A-127940.2 usGfsAfgAfgAfaGfuccaCfCfaCf gAfgusesu 740 AD63985.2 A-127961.1 gsusggugGfaCfUfUfcUfcucAfauuuL96 526 A-127956.4 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfesgsa 741 AD63986.2 A-127969.1 gsusggugGfaCfUfUfcucuCfaauuuL96 527 A-127956.12 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfesgsa 742 AD63987.2 A-127955.9 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 528 A-127977.1 asAfsaUfugagaGfaagUfcCfaccA fesgsa 743 AD63988.2 A-127986.1 usgsGfaCfUfUfcUfcUfcAfaUfuUfL96 529 A-127987.1 asAfsaUfuGfaGfaGfaagUfcCfas CSC 744 AD63989.2 A-127996.1 gsusgguggacUfUfcucucaauuuL96 530 A-127992.2 asAfsAfUfuGfaGfaGfaagUfcCfa Cfcacsgsa 745 AD63990.2 A-127950.1 Y44GfgUfgGfaCfuUfcUfcUfcAfaUfuUfus uY4 4 531 A-127951.1 asAfsasUfuGfaGfaGfaAfgUfcCf aCfcusu 746 AD63991.2 A-127962.1 gsusggugGfaCfUfUfcUfcucaauuuL96 532 A-127956.5 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfesgsa 747 AD63992.2 A-127955.2 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 533 A-127970.1 asAfsaUfuGfagaGfaagUfcCfaCf cAfesgsa 748 AD63993.2 A-127955.10 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 534 A-127978.1 asAfsauugaGfaGfaagUfcCfacca esgsa 749 AD63994.2 A-127984.2 gsgUfgGfaCfUfUfcUfcUfcAfaUfuUfL96 535 A-127988.1 PasAfsaUfuGfaGfaGfaagUfcCfa Cfcsasc 750 AD63995.2 A-127996.2 gsusgguggacUfUfcucucaauuuL96 536 A-127993.2 asAfsAfuuGfaGfaGfaagUfCfcaC fcacsgsa 751 AD63996.2 A-127952.1 Y44gsgsUfgGfaCfuUfcUfcUfCAfaUfuUfY 44 537 A-127953.1 asAfsaUfuGfaGfaGfaAfgUfcCfa Cfesusu 752 AD63997.2 A-127963.1 gsusggugGfaCfUfUfcucucaauuuL96 538 A-127956.6 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfesgsa 753 AD63999.2 A-127955.11 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 539 A-127979.1 asAfsaUfugaGfagaagUfcCfacca esgsa 754 AD64000.2 A-127986.2 usgsGfaCfUfUfcUfcUfcAfaUfuUfL96 540 A-127989.1 PasAfsaUfuGfaGfaGfaagUfcCfa scsc 755 AD64001.2 A-127996.3 gsusgguggacUfUfcucucaauuuL96 541 A-127994.2 asAfsAfUfuGfaGfaGfaagUfCfca Cfcacsgsa 756 AD64002.2 A-127952.2 Y44gsgsUfgGfaCfuUfcUfcUfcAfaUfuUfY 44 542 A-127954.1 PasAfsaUfuGfaGfaGfaAfgUfcCf aCfesusu 757 AD64003.2 A-127964.1 gsusgguggaCfuUfcucucaauuuL96 543 A-127956.7 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfesgsa 758

- 115 039127

AD64004.2 A-127955.4 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 544 A-127972.1 asAfsaUfuGfaGfaGfaagUfcCfac cacsgsa 759 AD64005.2 A-127955.12 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 545 A-127980.1 asAfsauuGfagAfgaagUfcCfacca csgsa 760 AD64006.2 A-127990.1 gsusGfgugGfaCfUfUfcUfcUfcAfaUfuuL9 6 546 A-127991.1 asAfsaUfuGfaGfaGfaagUfcCfaC fcacsgsa 761 AD64007.2 A-127996.4 gsusgguggacUfUfcucucaauuuL96 547 A-127995.2 asAfsAfUfugaGfaGfaagUfCfcaC fcacsgsa 762 AD64008.2 A-127955.1 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 548 A-127956.1 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 763 AD64008.4 A-127955.15 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 549 A-127956.14 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 764 AD64009.2 A-127965.1 gsusgguggacuUfcucucaauuuL96 550 A-127956.8 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 765 AD64010.2 A-127955.5 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 551 A-127973.1 asAfsauuGfagaGfaagUfcCfaccA fcsgsa 766 AD64011.2 A-127955.13 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 552 A-127981.1 asAfsauuGfagagaagUfcCfaccac sgsa 767 AD64012.2 A-127990.2 gsusGfgugGfaCfUfUfcUfcUfcAfaUfuuL9 6 553 A-127992.1 asAfsAfUfuGfaGfaGfaagUfcCfa Cfcacsgsa 768 AD64013.2 A-127997.1 gsusgguggacdTdTcucucaauuuL96 554 A-127998.1 asdAsAfuugaGfaGfaagdTdCcaCf cacsgsa 769 AD64014.2 A-127957.1 Y44GfsusGfgUfgGfaCfUfUfcUfcUfcAfaU fuUfL96 555 A-127958.1 PasAfsaUfuGfaGfaGfaagUfcCfa CfcAfcsgsa 770 AD64015.2 A-127966.1 gsusgguggaCfuUfcucuc(Agn)auuuL96 556 A-127956.9 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 771 AD64016.2 A-127955.6 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 557 A-127974.1 asAfsauuGfaGfaGfaagUfcCface aesgsa 772 AD64017.2 A-127968.2 gsusgguggacudTcucuc(Agn)auuuL96 558 A-127982.1 asdAsauugagagaagdTccaccsg sa 773 AD64018.2 A-127990.3 gsusGfgugGfaCfUfUfcUfcUfcAfaUfuuL9 6 559 A-127993.1 asAfsAfuuGfaGfaGfaagUfCfcaC fcacsgsa 774 AD64019.2 A-127959.1 gsusggUfgGfaCfUfUfcUfcucAfauuUfL96 560 A-127956.2 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 775 AD64020.2 A-127967.1 gsusgguggacuUfcucuc(Agn)auuuL96 561 A-127956.10 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 776 AD64021.2 A-127955.7 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 562 A-127975.1 asAfsaUfugaGfaGfaagUfcCfacc Afcsgsa 777 AD64022.2 A-127968.3 gsusgguggacudTcucuc(Agn)auuuL96 563 A-127983.1 PasdAsauugagagaagdTccaccacs gsa 778 AD- A-127990.4 gsusGfgugGfaCfUfUfcUfcUfcAfaUfuuL9 564 A-127994.1 asAfsAfUfuGfaGfaGfaagUfCfca 779 64023.2 6 cfcacsgsa AD64024.2 A-127960.1 gsusggUfgGfaCfUfUfcUfcucAfauuuL96 565 A-127956.3 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 780 AD64025.2 A-127968.1 gsusgguggacudTcucuc(Agn)auuuL96 566 A-127956.11 asAfsaUfuGfaGfaGfaagUfcCfaC fcAfcsgsa 781 AD64026.2 A-127955.8 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 567 A-127976.1 asAfsaUfugaGfagaagUfcCfaccA fcsgsa 782 AD64027.2 A-127984.1 gsgUfgGfaCfUfUfcUfcUfcAfaUfuUfL96 568 A-127985.1 asAfsaUfuGfaGfaGfaagUfcCfaC fcsasc 783 AD64028.2 A-127990.5 gsusGfgugGfaCfUfUfcUfcUfcAfaUfuuL9 6 569 A-127995.1 asAfsAfUfugaGfaGfaagUfCfcaC fcacsgsa 784 AD64272.2 A-128001.2 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCfuG fL96 570 A-128002.2 csAfsgAfgGfuGfaAfgegAfaGfuG fcAfcsasc 785 AD64274.1 A-128363.1 GfsusUfgAfcAfaAfAfAfuCfcUfcAfcAfaU fL96 571 A-128364.1 asUfsuGfuGfaGfgAfuuuUfuGfuC faAfesasa 786 AD64275.1 A-128377.1 UfsgsUfuGfaCfaAfAfAfaUfcCfuCfaCfaA fL96 572 A-128378.1 usUfsgUfgAf gGfaUfuuuUfgUfeA faCfasasg 787 AD64276.1 A-128393.1 GfsgsUfgGfaCfuUfCfUfcUfcAfaUfuUfuA fL96 573 A-128394.1 usAfsaAfaUfuGfaGfagaAfgUfcC faCfcsasc 788 AD64277.1 A-128407.1 UfscsUfuUfuGfgAfGfUfgUfgGfaUfuCfgA fL96 574 A-128408.1 usCfsgAfaUfcCfaCfacuCfcAfaA faGfascsa 789 AD64277.1 A-128407.1 UfscsUfuUfuGfgAfGfUfgUfgGfaUfuCfgA fL96 575 A-128408.1 usCfsgAfaUfcCfaCfacuCfcAfaA faGfascsa 790 AD64278.1 A-128423.1 AfscsUfgUfuCfaAfGfCfcUfcCfaAfgCfuA fL96 576 A-128424.1 usAfsgCfuUfgGfaGfgcuUfgAfaC faAfgsasc 791 AD64279.1 A-128435.1 UfscsUfgCfcGfaUfCfCfaUfaCfuGfcGfgA fL96 577 A-128436.1 usCfseGfcAfgUfaUfggaUfcGfgC faGfasgsg 792 AD64280.1 A-128379.1 AfsusGfuGfuCfuGfCfGfgCfgUfuUfuAfuA fL96 578 A-128380.1 usAf suAf aAf aCfgCfegeAfgAfcA fcAfuscsc 793 AD64281.1 A-128395.1 CfscsCfcGfuCfuGfUfGfcCfuUfcUfcAfuA fL96 579 A-128396.1 usAfsuGfaGfaAfgGfcacAfgAfcG fgGfgsasg 794 AD64282.1 A-128409.1 GfscsCfuAfaUfcAfUfCfuCfuUfgUfuCfaU fL96 580 A-128410.1 asUfsgAfaCfaAfgAfgauGfaUfuA fgGfgsasg 795 AD64283.1 A-128425.1 UfscsUfaGfaCfuCfGfUfgGfuGfgAfcUfuC fL96 581 A-128426.1 gsAfsaGfuCfcAfcCfaegAfgUfcU faGfasesu 796 AD64284.1 A-128437.1 CfsusGfcCfgAfuCfCfAfuAfcUfgCfgGfaA fL96 582 A-128438.1 usUfscCfgCfaGfuAfuggAfuCfgG fcAfgsasg 797 AD64285.1 A-128365.1 UfsusUfuUfcUfuGfUfUfgAfcAfaAfaAfuA fL96 583 A-128366.1 usAfsuUfuUfuGfuCfaacAfaGfaA faAfascsc 798 AD64286.1 A-128381.1 Af susCfuUfcUfuGfUfUfgGfuUfcUfuCfuA fL96 584 A-128382.1 usAfsgAfaGfaAfcCfaacAfaGf aA fgAfusgsa 799

- 116 039127

AD64289.1 A-128367.1 GfsusUfuUfuCfuUfGfUfuGfaCfaAfaAfaU fL96 585 A-128368.1 asUfsuUfuUfgUfcAfacaAfgAfaA faAfcscsc 800 AD64290.1 A-128383.1 CfsusGfCCfuAfaUfCfAfuCfuCfuUfgUfuA fL96 586 A-128384.1 usAfsaCfaAfgAfgAfugaUfuAfgG fcAfgsasg 801 AD64291.1 A-128399.1 UfscsCfuCfaCfaAfUfAfcCfaCfaGfaGfuA fL96 587 A-128400.1 usAfscUfcUfgUfgGfuauUfgUfgA fgGfasusu 802 AD64292.1 A-128413.1 CfsusUfgUfuGfaCfAfAfaAfaUfcCfuCfaA fL96 588 A-128414.1 usUfsgAfgGfaUfuUfuugUfcAfaC faAfgsasa 803 AD64293.1 A-128439.1 GfscsAfaCfuUfuUfUfCfaCfcUfcUfgCfcU fL96 589 A-128440.1 asGfsgCfaGfaGfgUfgaaAfaAfgU fuGfcsasu 804 AD64294.1 A-128369.1 GfsgsGfaAfcAfaGfAfGfcUfaCfaGfcAfuA fL96 590 A-128370.1 usAfsuGfcUfgUfaGfcucUfuGfuU fcCfcsasa 805 AD64295.1 A-128385.1 CfsgsUfgGfuGfgAfCfUfuCfuCfuCfaAfuU fL96 591 A-128386.1 asAfsuUfgAfgAfgAfaguCfcAfcC faGfcsasg 806 AD64297.1 A-128415.1 CfsusGfcUfgCfuAfUfGfcCfuCfaUfcUfuA fL96 592 A-128416.1 usAf saGfaUfgAfgGfcauAfgCfaG fcAfgsgsa 807 AD64298.1 A-128427.1 GfsusUfgGfaUfgUfGfUfcUfgCfgGfcGfuU fL96 593 A-128428.1 asAfscGfcCfgCfaGfacaCfaUfcC faAfcsgsa 808 AD64299.1 A-128441.1 UfsusCfaUfcCfuGfCfUfgCfuAfuGfcCfuA fL96 594 A-128442.1 usAfsgGfcAfuAfgCfagcAfgGfaU fgAfasgsa 809 AD64300.1 A-128371.1 UfsusCfuUfgUfuGfAfCfaAfaAfaUfcCfuA fL96 595 A-128372.1 usAfsgGfaUfuUfuUfgucAfaCfaA fgAfasasa 810 AD64302.1 A-128417.1 UfsasUfaUfgGfaUfGfAfuGfuGfgUfaUfuA fL96 596 A-128418.1 usAfsaUfaCfcAfcAfucaUfcCfaU faUfasasc 811 AD64303.1 A-128429.1 UfsusCfaUfcCfuGfCfUfgCfuAfuGfcCfuC fL96 597 A-128430.1 gsAfsgGfcAfuAfgCfagcAfgGfaU fgAfasgsa 812 AD64304.1 A-128443.1 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCfuA fL96 598 A-128444.1 usAfsgAfgGfuGfaAfgcgAfaGfuG fcAfcsasc 813 AD64305.1 A-128373.1 UfsusGfaCfaAfaAfAfUfcCfuGfaCfaAfuA fL96 599 A-128374.1 usAfsuUfgUfgAfgGfauuUfuUfgU fcAfascsa 814 AD64307.1 A-128403.1 AfsasGfcCfuGfcAfAfGfcUfgUfgCfcUfuA fL96 600 A-128404.1 usAfsaGfgCfaCfaGfcuuGfgAfgG fcUfusgsa 815 AD64308.1 A-128419.1 CfscsUfcUfuCfaUfCfCfuGfcUfgCfuAfuA fL96 601 A-128420.1 usAfsuAfgCfaGfcAfggaUfgAfaG faGfgsasa 816 AD64309.1 A-128431.1 CfscsUfgCfuGfcUfAfUfgCfcUfcAfuCfuU fL96 602 A-128432.1 asAfsgAfuGfaGfgCfauaGfcAfgC faGfgsasu 817 AD64310.1 A-128375.1 CfsasUfcUfuCfuUfGfUfuGfgUfuCfuUfcU fL96 603 A-128376.1 asGfsaAfgAfaCfcAfacaAfgAfaG faUfgsasg 818 AD64311.1 A-128391.1 CfscsGfuCfuGfuGfCfCfuUfcUfcAfuCfuA fL96 604 A-128392.1 usAfsgAfuGfaGfaAfggcAf cAfgA fcGfgsgsg 819 AD- A-128405.1 CfscsUfcAfuCfuUfCfUfuGfuUfgGfuUfcU 605 A-128406.1 asGfsaAf cCfaAfcAfagaAfgAfuG 820 64312.1 fL96 faGfgscsa AD64313.1 A-128421.1 CfscsAfcCfaAfaUfGfCfcCfcUfaUfcUfuA fL96 606 A-128422.1 usAfsaGfaUfaGfgGfgcaUfuUfgG fuGfgsusc 821 AD64314.1 A-128433.1 GfscsUfcCfuCfuGfCfCfgAfuCfcAfuAfcU fL96 607 A-128434.1 asGfsuAfuGfgAfuCfggcAfgAfgG faGfcscsa 822 AD64315.1 A-128363.2 GfsusUfgAfcAfaAfAfAfuCfcUfcAfcAfaU fL96 608 A-128445.1 PasUfsuGfuGfaGfgAfuuuUfuGfu CfaAfcsasa 823 AD64316.1 A-128377.2 UfsgsUfuGfaCfaAfAfAfaUfcCfuCfaCfaA fL96 609 A-128453.1 PusUfsgUfgAfgGfaUfuuuUfgUfc AfaCfasasg 824 AD64317.1 A-128393.2 GfsgsUfgGfaCfuUfCfUfcUfcAfaUfuUfuA fL96 610 A-128461.1 PusAfsaAfaUfuGfaGfagaAfgUfc CfaCfcsasc 825 AD64318.1 A-128407.2 UfscsUfuUfuGfgAfGfUfgUfgGfaUfuCfgA fL96 611 A-128469.1 PusCfsgAfaUfcCfaCfacuCfcAfa AfaGfascsa 826 AD64319.1 A-128423.2 Af scsUfgUfuCfaAfGfCfcUfcCfaAfgCfuA fL96 612 A-128477.1 PusAfsgCfuUfgGfaGfgcuUfgAfa CfaAfgsasc 827 AD64320.1 A-128435.2 UfscsUfgCfcGfaUfCfCfaUfaCfuGfcGfgA fL96 613 A-128483.1 PusCfscGfcAfgUfaUfggaUfcGfg CfaGfasgsg 828 AD64321.1 A-123463.3 AfsgsUfuAfuAfuGfGfAfuGfaUfgUfgGf uA fL96 614 A-128446.1 PusAfscCfaCfaUfcAfuccAfuAfu AfaCfusgsa 829 AD64322.1 A-128379.2 AfsusGfuGfuCfuGfCfGfgCfgUfuUfuAfuA fL96 615 A-128454.1 PusAfsuAfaAfaCfgCfcgcAfgAfc AfcAfuscsc 830 AD64323.1 A-128395.2 CfscsCfcGfuCfuGfUfGfcCfuUfcUfcAfuA fL96 616 A-128462.1 PusAfsuGfaGfaAfgGfcacAfgAfc GfgGfgsasg 831 AD64324.1 A-128409.2 GfscsCfuAfaUfcAfUfCfuCfuUfgUfuCfaU fL96 617 A-128470.1 PasUfsgAfaCfaAfgAfgauGfaUfu AfgCfgsasg 832 AD64325.1 A-128425.2 UfscsUfaGfaCfuCfGfUfgGfuGfgAfcUfuC fL96 618 A-128478.1 PgsAfsaGfuCfcAfcCfacgAfgUfc UfaGfascsu 833 AD64326.1 A-128437.2 CfsusGfcCfgAfuCfCfAfuAfcUfgCfgGfaA fL96 619 A-128484.1 PusUfscCfgCfaGfuAfuggAfuCfg GfcAfgsasg 834 AD64328.1 A-128381.2 AfsusCfuUfcUfuGfUfUfgGfuUfcUfuCfuA fL96 620 A-128455.1 PusAfsgAfaGfaAfcCfaacAfaGfa AfgAfusgsa 835 AD64330.1 A-128411.2 UfsusCfuCfuCfaAfUfUfuUfcUfaGfgGfgA fL96 621 A-128471.1 PusCfscCfcUfaGfaAfaauUf gAfg AfgAfasgsu 836 AD64331.1 A-127905.16 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 622 A-127907.2 PusGfsaGfaGfaAfgUfccaCf cAfc GfaGfuscsu 837 AD64332.1 A-128001.3 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCfuG fL96 623 A-128485.1 PcsAfsgAfgGfuGfaAfgcgAfaGfu GfcAfcsasc 838 AD64333.1 A-128367.2 GfsusUfuUfuCfuUfGfUfuGfaCfaAfaAfaU fL96 624 A-128448.1 PasUfsuUfuUfgUfcAfacaAfgAfa AfaAfcscsc 839 AD64334.1 A-128383.2 CfsusGfCCfuAfaUfCfAfuCfuCfuUfgUfuA fL96 625 A-128456.1 PusAfsaCfaAfgAfgAfugaUfuAfg GfcAfgsasg 840

- 117 039127

AD64335.1 A-128399.2 UfscsCfuCfaCfaAfUfAfcCfaCfaGfaGfuA fL96 626 A-128464.1 PusAf scUfcUfgUfgGfuauUfgUfg Af gGfasusu 841 AD64336.1 A-128413.2 CfsusUfgUfuGfaCfAfAfaAfaUfcCfuCfaA fL96 627 A-128472.1 PusUfsgAfgGfaUfuUfuugUfcAfa CfaAfgsasa 842 AD64337.1 A-127955.16 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUfuU fL96 628 A-127958.2 PasAfsaUfuGfaGfaGfaagUfcCfa CfcAfcsgsa 843 AD64338.1 A-128439.2 GfscsAfaCfuUfuUfUfCfaCfcUfcUfgCfcU fL96 629 A-128486.1 PasGfsgCfaGfaGfgUfgaaAfaAfg UfuGfcsasu 844 AD64339.1 A-128369.2 GfsgsGfaAfcAfaGfAfGfcUfaCfaGfcAfuA fL96 630 A-128449.1 PusAfsuGfcUfgUfaGfcucUfuGfu UfcCfcsasa 845 AD64341.1 A-128401.2 UfscsAfuCfuUfcUfUfGfuUfgGfuUfcUfuA fL96 631 A-128465.1 PusAfsaGfaAfcCfaAfcaaGfaAfg AfuGfasgsg 846 AD64342.1 A-128415.2 CfsusGfcUfgCfuAfUfGfcCfuCfaUfcUfuA fL96 632 A-128473.1 PusAfsaGfaUfgAfgGfcauAfgCfa GfcAfgsgsa 847 AD64343.1 A-128427.2 GfsusUfgGfaUfgUfGfUfcUfgCfgGfcGfuU fL96 633 A-128479.1 PasAfscGfcCfgCfaGfacaCfaUfc CfaAfcsgsa 848 AD64344.1 A-128441.2 UfsusCfaUfcCfuGfCfUfgCfuAfuGfcCfuA fL96 634 A-128487.1 PusAfsgGfcAfuAfgCfagcAfgGfa UfgAfasgsa 849 AD64345.1 A-128371.2 UfsusCfuUfgUfuGfAfCfaAfaAfaUfcCfuA fL96 635 A-128450.1 PusAfsgGfaUfuUfuUfgucAfaCfa AfgAfasasa 850 AD64347.1 A-123487.3 GfsgsAfuGfuGfuCfUfGfcGfgCfgUfuUfuA fL96 636 A-128466.1 PusAfsaAfaCfgCfcGfcagAfcAfc AfuCfcsasg 851 AD64348.1 A-128417.2 UfsasUfaUfgGfaUfGfAfuGfuGfgUfaUfuA fL96 637 A-128474.1 PusAfsaUfaCfcAfcAfucaUfcCfa UfaUfasasc 852 AD64349.1 A-128429.2 UfsusCfaUfcCfuGfCfUfgCfuAfuGfcCfuC fL96 638 A-128480.1 PgsAfsgGfcAfuAfgCfagcAfgGfa UfgAfasgsa 853 AD64350.1 A-128443.2 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCfuA fL96 639 A-128488.1 PusAfsgAfgGfuGfaAfgcgAfaGfu GfcAfcsasc 854 AD64351.1 A-128373.2 UfsusGfaCfaAfaAfAfUfcCfuCfaCfaAfuA fL96 640 A-128451.1 PusAfsuUfgUfgAfgGfauuUfuUfg UfcAfascsa 855 AD64352.1 A-128389.2 CfscsAfaGfuGfuUfUfGfcUfgAfcGfcAfaA fL96 641 A-128459.1 PusUfsuGfcGfuCfaGfcaaAfcAfc UfuGfgscsa 856 AD64352.1 A-128389.2 CfscsAfaGfuGfuUfUfGfcUfgAfcGfcAfaA fL96 642 A-128459.1 PusUfsuGfcGfuCfaGfcaaAfcAfc UfuGfgscsa 857 AD64353.1 A-128403.2 AfsasGfcCfuCfcAfAfGfcUfgUfgCfcUfuA fL96 643 A-128467.1 PusAfsaGfgCfaCfaGfcuuGfgAfg GfcUfusgsa 858 AD64354.1 A-128419.2 CfscsUfcUfuCfaUfCfCfuGfcUfgCfuAfuA fL96 644 A-128475.1 PusAfsuAfgCfaGfcAfggaUfgAfa GfaGfgsasa 859 AD64355.1 A-128431.2 CfscsUfgCfuGfcUfAfUfgCfcUfcAfuCfuU fL96 645 A-128481.1 PasAfsgAfuGfaGfgCfauaGf cAfg CfaGfgsasu 860 AD- A-128375.2 CfsasUfcUfuCfuUfGfUfuGfgUfuCfuUfcU 646 A-128452.1 PasGfsaAf gAfaCfcAfacaAfgAfa 861 64356.1 fL96 GfaUfgsasg AD64357.1 A-128391.2 CfscsGfuCfuGfuGfCfCfuUfcUfcAfuCfuA fL96 647 A-128460.1 PusAfsgAfuGfaGfaAfggcAfcAfg AfcGfgsgsg 862 AD64358.1 A-128405.2 CfscsUfcAfuCfuUfCfUfuGfuUfgGfuUfcU fL96 648 A-128468.1 PasGfsaAfcCfaAfcAfagaAfgAfu GfaGfgscsa 863 AD64359.1 A-128421.2 CfscsAfcCfaAfaUfGfCfcCfcUfaUfcUfuA fL96 649 A-128476.1 PusAfsaGfaUfaGfgGfgcaUfuUfg GfuGfgsusc 864 AD64360.1 A-128433.2 GfscsUfcCfuCfuGfCfCfgAfuCfcAfuAfcU fL96 650 A-128482.1 PasGfsuAfuGfgAfuCfggcAfgAfg GfaGfcscsa 865 AD64700.1 A-129379.1 ascsucguggugdTacuu(Cgn)ucucaL96 651 A-127906.26 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 866 AD64701.1 A-127905.20 Af scsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 652 A-129387.1 PusgsagagaagdTccadCcacgagus csu 867 AD64702.1 A-127905.28 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 653 A-129395.1 usGsagadGaaguccaCcacgaguscs 868 AD64703.1 A-129376.2 ascsucguggugdGacuucdAcucaL96 654 A-129385.5 usdGsagagaagdTccadCcacgagus csu 869 AD64704.1 A-129381.3 ascsucguggdTgdTacuucdAcucaL96 655 A-129389.6 usdGsagadGaaguccadCcacgagus csu 870 AD64705.1 A-129380.1 ascsucguggugdTacuucdAcucaL96 656 A-127906.27 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 871 AD64706.1 A-127905.21 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 657 A-129388.1 usdGsadGagaaguccadCcacgagus csu 872 AD64707.1 A-127905.29 Af scsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 658 A-129396.1 usgsagadGaagdTccadCcacgagus csu 873 AD64708.1 A-129382.2 ascsucguggdTgdGacuuc(Tgn)cucaL96 659 A-129385.6 usdGsagagaagdTccadCcacgagus csu 874 AD64709.1 A-129373.4 ascsucguggugdGacuu(Cgn)ucucaL96 660 A-129391.2 usdGsagadGaagdTccadCcacgagu scsu 875 AD64710.1 A-129373.1 ascsucguggugdGacuu(Cgn)ucucaL96 661 A-127906.20 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 876 AD64711.1 A-129381.1 ascsucguggdTgdTacuucdAcucaL96 662 A-127906.28 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 877 AD64712.1 A-127905.22 AfscsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 663 A-129389.1 usdGsagadGaaguccadCcacgagus csu 878 AD64713.1 A-127905.30 Af scsUfCGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 664 A-129397.1 PusgsagadGaagdTccadCcacgagu scsu 879 AD64714.1 A-129384.2 ascsucguggdTgdGacuucdAcucaL96 665 A-129385.7 usdGsagagaagdTccadCcacgagus csu 880 AD64715.1 A-129376.4 ascsucguggugdGacuucdAcucaL96 666 A-129391.3 usdGsagadGaagdTccadCcacgagu scsu 881

- 118 039127

AD64716.1 A-129374.1 ascsucguggugdGacuucu(Cgn)ucaL96 667 A-127906.21 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 882 AD64717.1 A-129382.1 ascsucguggdTgdGacuuc(Tgn)cucaL96 668 A-127906.29 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 883 AD64718.1 A-127905.23 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 669 A-129390.1 usdGsagagadAguccadCcacgagus csu 884 AD64719.1 A-127917.5 ascsucguggugdGacuuc(Tgn)cucaL96 670 A-129385.2 usdGsagagaagdTccadCcacgagus csu 885 AD64720.1 A-129381.2 ascsucguggdTgdTacuucdAcucaL96 671 A-129385.8 usdGsagagaagdTccadCcacgagus csu 886 AD64721.1 A-129382.4 ascsucguggdTgdGacuuc(Tgn)cucaL96 672 A-129391.4 usdGsagadGaagdTccadCcacgagu scsu 887 AD64722.1 A-129375.1 ascsucguggugdGacuucY34cucaL96 673 A-127906.22 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 888 AD64723.1 A-129383.1 ascsucguggugdGdAcuuc(Tgn)cucaL96 674 A-127906.30 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 889 AD64725.1 A-127917.6 ascsucguggugdGacuuc(Tgn)cucaL96 675 A-129398.1 PusdGsagagaagdTccadCcacgagu scsu 890 AD64726.1 A-129373.3 ascsucguggugdGacuu(Cgn)ucucaL96 676 A-129389.2 usdGsagadGaaguccadCcacgagus csu 891 AD64727.1 A-129384.4 ascsucguggdTgdGacuucdAcucaL96 677 A-129391.5 usdGsagadGaagdTccadCcacgagu scsu 892 AD64728.1 A-129376.1 ascsucguggugdGacuucdAcucaL96 678 A-127906.23 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 893 AD64729.1 A-129384.1 ascsucguggdTgdGacuucdAcucaL96 679 A-127906.31 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 894 AD64730.1 A-127905.25 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 680 A-129392.1 usGsagagaagdTccadCcacgagusc SU 895 AD64731.1 A-129399.1 Y34ascsucguggugdGacuuc(Tgn)cucaL96 681 A-129385.3 usdGsagagaagdTccadCcacgagus csu 896 AD64732.1 A-129376.3 ascsucguggugdGacuucdAcucaL96 682 A-129389.3 usdGsagadGaaguccadCcacgagus csu 897 AD64733.1 A-129381.4 ascsucguggdTgdTacuucdAcucaL96 683 A-129391.6 usdGsagadGaagdTccadCcacgagu scsu 898 AD64734.1 A-129377.1 ascsucguggugdGacuucdCcucaL96 684 A-127906.24 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 899 AD64735.1 A-127905.18 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 685 A-129385.1 usdGsagagaagdTccadCcacgagus csu 900 AD64736.1 A-127905.26 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 686 A-129393.1 usdGsagagaagdTccaCcacgagusc SU 901 AD- A-129399.2 Y34ascsucguggugdGacuuc(Tgn)cucaL96 687 A-129398.2 PusdGsagagaagdTccadCcacgagu 902 64737.1 SCSU AD64738.1 A-129382.3 ascsucguggdTgdGacuuc(Tgn)cucaL96 688 A-129389.4 usdGsagadGaaguccadCcacgagus csu 903 AD64739.1 A-129378.1 ascsucguggugdGacuucdGcucaL96 689 A-127906.25 usGfsaGfaGfaAfgUfccaCfcAfcG faGfuscsu 904 AD64740.1 A-127905.19 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 690 A-129386.1 usgsagagaagdTccadCcacgagusc SU 905 AD64741.1 A-127905.27 Af scsUfcGfuGfgUfGfGfaCfuUfcUfcUfcA fL96 691 A-129394.1 usGsagagaagdTccaCcacgaguscs 906 AD64742.1 A-129373.2 ascsucguggugdGacuu(Cgn)ucucaL96 692 A-129385.4 usdGsagagaagdTccadCcacgagus csu 907 AD64743.1 A-129384.3 ascsucguggdTgdGacuucdAcucaL96 693 A-129389.5 usdGsagadGaaguccadCcacgagus csu 908

- 119 039127

HBV Single Dose Screening with Dual-Glo Luciferase® System Assay

Table 5

Duplex ID 10 nM, avg. 0.1 nM avg. 10 nM SD 0.1 nM SD AD-63938.2 0.12 ND 0.01 ND AD-63950.2 0.38 ND 0.04 ND AD-63956.2 0.31 ND 0.02 ND AD-63962.2 0.16 ND 0.03 ND AD-63968.2 0.56 ND 0.10 ND AD-63968.2 0.79 ND 0.09 ND AD-63979.2 0.54 ND 0.02 ND AD-63939.2 0.51 ND 0.01 ND AD-63945.2 0.54 ND 0.08 ND AD-63951.2 0.60 ND 0.03 ND AD-63957.2 0.57 ND 0.02 ND AD-63963.2 0.91 ND 0.06 ND AD-63969.2 0.92 ND 0.02 ND AD-63975.2 0.83 ND 0.01 ND AD-63980.2 0.77 ND 0.01 ND AD-63940.2 0.77 ND 0.06 ND AD-63946.2 0.60 ND 0.10 ND AD-63952.2 0.48 ND 0.04 ND AD-63958.2 0.51 ND 0.01 ND AD-63964.2 0.58 ND 0.04 ND AD-63970.2 0.69 ND 0.07 ND AD-63976.2 0.63 ND 0.04 ND AD-63981.2 0.60 ND 0.04 ND AD-63941.2 0.56 ND 0.09 ND AD-63947.2 0.55 ND 0.08 ND AD-63953.2 0.56 ND 0.06 ND AD-63959.2 0.51 ND 0.03 ND AD-63965.2 0.55 ND 0.03 ND AD-63971.2 0.65 ND 0.02 ND AD-63977.2 0.88 ND 0.01 ND AD-63982.2 0.73 ND 0.07 ND AD-63942.2 0.32 ND 0.09 ND AD-63948.2 0.57 ND 0.09 ND AD-63960.2 0.92 ND 0.05 ND AD-63966.2 0.85 ND 0.06 ND AD-63972.2 0.82 ND 0.06 ND AD-63978.2 0.83 ND 0.02 ND AD-63983.2 0.89 ND 0.02 ND AD-63943.2 0.86 ND 0.04 ND AD-63949.2 0.76 ND 0.02 ND AD-63955.2 0.82 ND 0.02 ND AD-63961.2 0.83 ND 0.07 ND

- 120 039127

AD-63 9 67.2 0.86 ND 0.03 ND AD-63973.2 0.86 ND 0.03 ND AD-63990.2 0.27 ND 0.07 ND AD-63 9 9 6.2 0.29 ND 0.06 ND AD-64002.2 0.30 ND 0.11 ND AD-64008.2 0.28 ND 0.05 ND AD-64008.2 0.34 ND 0.07 ND AD-64014.2 0.30 ND 0.03 ND AD-64019.2 0.36 ND 0.04 ND AD-64024.2 0.27 ND 0.03 ND AD-63985.2 0.28 ND 0.06 ND AD-63991.2 0.33 ND 0.02 ND AD-63997.2 0.47 ND 0.07 ND AD-64003.2 0.69 ND 0.06 ND AD-64009.2 0.91 ND 0.03 ND AD-64015.2 0.69 ND 0.09 ND AD-64020.2 0.81 ND 0.06 ND AD-64025.2 0.77 ND 0.06 ND AD-63 9 8 6.2 0.28 ND 0.05 ND AD-63992.2 0.44 ND 0.04 ND AD-64004.2 0.45 ND 0.04 ND AD-64010.2 0.37 ND 0.05 ND AD-64016.2 0.48 ND 0.05 ND AD-64021.2 0.39 ND 0.03 ND AD-64026.2 0.30 ND 0.02 ND AD-63987.2 0.20 ND 0.02 ND AD-63993.2 0.33 ND 0.02 ND AD-63999.2 0.36 ND 0.05 ND AD-64005.2 0.45 ND 0.11 ND AD-64011.2 0.39 ND 0.08 ND AD-64017.2 0.84 ND 0.06 ND AD-64022.2 0.81 ND 0.03 ND AD-64027.2 0.38 ND 0.05 ND AD-63988.2 0.37 ND 0.04 ND AD-63994.2 0.23 ND 0.01 ND AD-64000.2 0.29 ND 0.00 ND AD-64006.2 0.40 ND 0.04 ND AD-64012.2 0.45 ND 0.17 ND AD-64018.2 0.65 ND 0.07 ND AD-64023.2 0.53 ND 0.07 ND AD-64028.2 0.52 ND 0.07 ND AD-63989.2 0.47 ND 0.04 ND AD-63995.2 0.81 ND 0.03 ND AD-64001.2 0.83 ND 0.04 ND AD-64007.2 0.87 ND 0.04 ND AD-64013.2 0.88 ND 0.03 ND

- 121 039127

AD-64289.1 0.276 ND 0.009 ND AD-64333.1 0.208 ND 0.015 ND AD-64285.1 0.324 ND 0.034 ND AD-64300.1 0.225 ND 0.005 ND AD-64345.1 0.102 ND 0.090 ND AD-64292.1 0.288 ND 0.232 ND AD-64336.1 0.199 ND 0.056 ND AD-64275.1 0.287 ND 0.185 ND AD-64316.1 0.297 ND 0.024 ND AD-64274.1 0.209 ND 0.033 ND AD-64315.1 0.199 ND 0.002 ND AD-64305.1 0.360 ND 0.035 ND AD-64351.1 0.281 ND 0.014 ND AD-64291.1 0.725 ND 0.005 ND AD-64335.1 0.478 ND 0.020 ND AD-64283.1 0.917 ND 0.018 ND AD-64304.1 0.937 ND 0.050 ND AD-64325.1 0.446 ND 0.223 ND AD-64350.1 0.934 ND 0.055 ND AD-63968.4 0.748 ND 0.008 ND AD-64331.1 0.294 ND 0.038 ND AD-64008.4 0.416 ND 0.028 ND AD-64337.1 0.318 ND 0.049 ND AD-64295.1 0.415 ND 0.034 ND AD-64276.1 0.453 ND 0.073 ND AD-64317.1 0.203 ND 0.040 ND AD-64330.1 0.313 ND 0.030 ND AD-64298.1 0.797 ND 0.007 ND AD-64343.1 0.667 ND 0.020 ND AD-61547.2 0.637 ND 0.019 ND AD-64347.1 0.418 ND 0.066 ND AD-64280.1 0.754 ND 0.092 ND AD-64322.1 0.407 ND 0.013 ND AD-64308.1 0.720 ND 0.055 ND AD-64354.1 0.315 ND 0.034 ND AD-64303.1 0.815 ND 0.150 ND AD-64349.1 0.447 ND 0.030 ND AD-64299.1 0.831 ND 0.007 ND AD-64344.1 0.404 ND 0.009 ND AD-64309.1 0.856 ND 0.005 ND AD-64355.1 0.498 ND 0.040 ND AD-64297.1 0.895 ND 0.024 ND AD-64342.1 0.508 ND 0.006 ND AD-64312.1 0.590 ND 0.034 ND AD-64358.1 0.425 ND 0.044 ND AD-64341.1 0.223 ND 0.119 ND

- 122 039127

AD-64310.1 0.301 ND 0.064 ND AD-64356.1 0.336 ND 0.024 ND AD-64286.1 0.611 ND 0.012 ND AD-64328.1 0.317 ND 0.043 ND AD-61522.2 0.447 ND 0.008 ND AD-64321.1 0.237 ND 0.009 ND AD-64302.1 0.523 ND 0.020 ND AD-64348.1 0.208 ND 0.003 ND AD-64352.1 0.343 ND 0.224 ND AD-64352.1 0.567 ND 0.015 ND AD-64314.1 0.920 ND 0.044 ND AD-64360.1 0.778 ND 0.029 ND AD-64279.1 0.882 ND 0.034 ND AD-64320.1 0.589 ND 0.017 ND AD-64284.1 0.696 ND 0.119 ND AD-64326.1 0.552 ND 0.009 ND AD-64281.1 0.921 ND 0.019 ND AD-64323.1 0.715 ND 0.097 ND AD-64311.1 0.815 ND 0.030 ND AD-64357.1 0.549 ND 0.001 ND AD-64272.2 0.965 ND 0.024 ND AD-64332.1 0.548 ND 0.013 ND AD-64293.1 0.837 ND 0.013 ND AD-64338.1 0.597 ND 0.031 ND AD-64290.1 0.489 ND 0.026 ND AD-64334.1 0.368 ND 0.003 ND AD-64282.1 0.767 ND 0.009 ND AD-64324.1 0.726 ND 0.077 ND AD-64278.1 0.951 ND 0.077 ND AD-64319.1 0.895 ND 0.029 ND AD-64307.1 0.890 ND 0.065 ND AD-64353.1 0.567 ND 0.500 ND AD-64277.1 0.416 ND 0.019 ND AD-64277.1 0.839 ND 0.058 ND AD-64318.1 0.613 ND 0.042 ND AD-64318.1 0.768 ND 0.042 ND AD-64313.1 0.698 ND 0.062 ND AD-64359.1 0.441 ND 0.081 ND AD-64294.1 0.563 ND 0.066 ND AD-64339.1 0.486 ND 0.044 ND AD-63968.5 0.57 0.72 0.07 0.03 AD-63940.3 0.81 0.83 0.11 0.03 AD-64710.1 0.79 0.85 0.12 0.04 AD-64716.1 0.73 0.85 0.08 0.01 AD-64722.1 0.67 0.80 0.06 0.02 AD-64728.1 0.74 0.87 0.06 0.05

- 123 039127

AD-64734.1 0.78 0.83 0.08 0.05 AD-64739.1 0.73 0.85 0.07 0.02 AD-64700.1 0.54 0.75 0.13 0.02 AD-64705.1 0.67 0.79 0.15 0.04 AD-64711.1 0.57 0.83 0.13 0.04 AD-64717.1 0.72 0.83 0.13 0.02 AD-64723.1 0.83 0.87 0.12 0.01 AD-64729.1 0.74 0.87 0.08 0.07 AD-64735.1 0.73 0.89 0.05 0.04 AD-64740.1 0.89 0.88 0.05 0.07 AD-64701.1 0.88 0.84 0.07 0.05 AD-64 7 06.1 0.71 0.88 0.12 0.05 AD-64712.1 0.81 0.86 0.13 0.07 AD-64718.1 0.84 0.89 0.16 0.01 AD-64730.1 0.88 0.89 0.02 0.04 AD-64 7 3 6.1 0.80 0.88 0.10 0.05 AD-64741.1 0.85 0.83 0.06 0.05 AD-64702.1 0.87 0.93 0.02 0.06 AD-64707.1 0.95 0.88 0.05 0.08 AD-64713.1 0.90 0.85 0.08 0.03 AD-64719.1 0.80 0.89 0.09 0.09 AD-64725.1 0.70 0.84 0.09 0.03 AD-64731.1 0.82 0.87 0.04 0.08 AD-64737.1 0.76 0.84 0.09 0.08 AD-64742.1 0.76 0.85 0.09 0.03 AD-64703.1 0.79 0.88 0.05 0.02 AD-64708.1 0.83 0.82 0.08 0.06 AD-64714.1 0.75 0.85 0.12 0.03 AD-64720.1 0.61 0.81 0.17 0.04 AD-64726.1 0.75 0.83 0.07 0.02 AD-64732.1 0.86 0.84 0.14 0.10 AD-64738.1 0.80 0.90 0.04 0.02 AD-64743.1 0.75 0.85 0.12 0.04 AD-64704.1 0.67 0.78 0.16 0.02 AD-64709.1 0.83 0.86 0.16 0.03 AD-64715.1 0.87 0.88 0.09 0.04 AD-64721.1 0.77 0.82 0.12 0.06 AD-64727.1 0.75 0.85 0.14 0.02 AD-64733.1 0.67 0.81 0.14 0.03

Example 3 Synthesis and in vitro screening for additional siRNA duplexes.

Additional iRNA molecules targeting the HBV genome were synthesized as described above. A detailed listing of additional unmodified HBV sense and antisense strand sequences is shown in Table 1. 6, and a detailed listing of the modified HBV sense and antisense strand sequences is shown in Table. 7.

- 124 039127

Table 6

Unmodified HBV dsRNA sense and antisense strand sequences

Duplex ID Semantic sequence (5 3' ) SEQID NO: Antisense sequence (5'-3') SEQID NO: AD-65369.1 UCGUGGUGGACUUCUCUCA 909 U GAGAGAAGU WITH СAC CAC GAUU 938 AD-65381.1 UCGUGGUGGACUUCUCUCA 910 U GAGAGAAGU WITH СAC CAC GAUU 939 AD-63962.1 UCGUGGUGGACUUCUCUCA 911 U GAGAGAAGU WITH СAC CAC GAUU 940 AD-63938.1 ACUCGUGGUGGACUUCUCUCA 912 U GAGAGAAGU WITH СAC CAC GAGU CU 941 AD-65561.1 UCGUGGUGGACUUCUCUCA 913 U GAGAGAAGU C CAC CAC GAUU 942 AD-65566.1 UCGUGGUGGACUUCUCUCA 914 U GAGAGAAGU C CAC CAC GAUU 943 AD-63944.1 UCGUGGUGGACUUCUCUCAUU 915 U GAGAGAAGU C CAC CAC GAUU 944 AD-63968.1 ACUCGUGGUGGACUUCUCUCA 916 U GAGAGAAGU C CAC CAC GAGU CU 945 AD-65406.1 UCGUGGUGGACUUCUCUCA 917 U GAGAGAAGU C CAC CAC GAUU 946 AD-65396.1 ACUCGUGGUGGACUUCUCUCA 918 UGAGAGAAGU C CAC CAC GAGUUU 947 AD-65427.1 GU GCACUU C GCUU CAC CU CUA 919 UAGAGGUGAAGCGAAGUGCACUU 948 AD-65573.1 GU GCACUU C GCUU CAC CU CUA 920 UAGAGGUGAAGCGAAGUGCACAC 949 AD-65432.1 GCACUUCGCUUCACCUCUA 921 UAGAGGUGAAGCGAAGUGCAC 950 AD-64332.1 GUGCACUUCGCUUCACCUCUG 922 CAGAGGUGAAGCGAAGUGCACAC 951 AD-64322.1 AUGUGUCUGCGGCGUUUUAUA 923 UAUAAAAC G C C G CAGACACAU C C 952 AD-64272.1 GUGCACUUCGCUUCACCUCUG 924 CAGAGGUGAAGCGAAGUGCACAC 953 AD-65583.1 GCACUUCGCUUCACCUCUA 925 UAGAGGUGAAGCGAAGUGCUU 954 AD-63994.1 GGUGGACUUCUCUCAAUUU 926 AAAUU GAGAGAAGU C CAC CAC 955 AD-65370.1 CGUGGUGGACUUCUCUCAAUU 927 AAUU GAGAGAAGU WITH СAC CAG CAG 956 AD-65265.1 GUGGUGGACUUCUCUCAAUUU 928 AAAUU GAGAGAAGU C CAC CAC GA 957 AD-65407.1 CGUGGUGGACUUCUCUCAAUU 929 AAUU GAGAGAAGU WITH СAC CAG CAG 958 AD-64027.1 GGUGGACUUCUCUCAAUUU 930 AAAUU GAGAGAAGU C CAC CAC 959 AD-65266.1 GUGGUGGACUUCUCUCAAUUU 931 AAAUU GAGAGAAGU C CAC CAC GA 960 AD-65389.1 UGGUGGUCTUCUCUAAAUU 932 AAUU GAGAGAAGU C CAC CAUU 961 AD-64008.1 GUGGUGGACUUCUCUCAAUUU 933 AAAUU GAGAGAAGU C CAC CAC GA 962 AD-65377.1 CGUGGUGGUCTUCUCUAAAUU 934 AAUU GAGAGAAGU C CAC CAGCUU 963 AD-65409.2 GGUGGACUUCUCUCAAUUUUA 935 UAAAAUU GAGAGAAGU C CAC CAC 964 AD-65403.1 GGUGGACUUCUCUCAAUUUUA 936 UAAAAUU GAGAGAAGU C CAC CAC 965 AD-65385.1 UGGACUACTCUCAAAUUUA 937 UAAAAUU GAGAGAAGU C CAUU 966

Table 7

Modified HBV dsRNA sense and antisense strand sequences_____

Duplex ID Semantic sequence (5'-3') SEQID NO: Antisense sequence (5'-3') SEQID NO: AD-65369 uscsguGfgUfGfGfacuuCfUfcucaL96 967 PusGfsagaGfaAfGfuccaCfcAfcgasusu 996 AD-65381 uscsguGfgUfGfGfacuucucucaL96 968 PusGfsagaGfaAfGfuccaCfcAfcgasusu 997 AD-63962 Y44uscsGfuGfgUfgGfaCfuUfcUfcUfcA fY4 4 969 PusGfsaGfaGfaAfgUfcCfaCfcAfcGfasusu 998 AD-63938 Y44 ACUCGUGGUGGACUUCUCUCA 970 U GAGAGAAGU C CAC CAC GAGU CU 999 AD-65561 uscsguGfgUfGfGfacuuCfUfcucaL96 971 UfsGfsagaGfaAfGfuccaCfcAfcgasusu 1000 AD-65566 uscsguGfgUfGfGfacuucucucaL96 972 UfsGfsagaGfaAfGfuccaCfcAfcgasusu 1001 AD-63944 Y44ucGuGGuGGAcuucucucAusuY44 973 UfGfagAfgAfAfGUfccaCfCAfcgAusu 1002 AD-63968 AfscsUfcGfuGfgUfGfGfaCfuUfcUfcUf cAfL96 974 usGfsaGfaGfaAfgUfccaCfcAfcGfaGfuscsu 1003 AD-65406 uscsguGfgUfGfGfacuuCfUfcucaL96 975 usGfsagaGfaAfGfuccaCfcAfcgasusu 1004 AD-65396 ascsucguGfgUfGfGfacuucucucaL96 976 usGfsagaGfaaguccaCfcAfcgagususu 1005 AD-65427 gsusgcacUfuCfGfCfuucaccucuaL96 977 PusAfsgagGfugaagcgAfaGfugcacsusu 1006 AD-65573 gsusgcacUfuCfGfCfuucaCfCfucuaL96 978 UfsAfsgagGfuGfAfagcgAfaGfugcacsasc 1007 AD-65432 gscsacUfucGfCfuucacCfucuaL96 979 PusAfsgagGfuGfAfagcgAfaGfugcsasc 1008 AD-64332 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCf uGfL96 980 PcsAfsgAfgGfuGfaAfgcgAfaGfuGfcAfcsasc 1009 AD-64322 AfsusGfuGfuCfuGfCfGfgCfgUfuUfuAf uAfL96 981 PusAfsuAfaAfaCfgCfcgcAfgAfcAfcAfuscs c 1010 AD-64272 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCf uGfL96 982 csAfsgAfgGfuGfaAfgcgAfaGfuGfcAfcsasc 1011 AD-65583 gscsacuucgdCuucac(Cgn)ucuaL96 983 usdAsgagdGugaagcgdAagugcsusu 1012 AD-63994 gsgsUfgGfaCfUfUfcUfcUfcAfaUfuUfL 96 984 PasAfsaUfuGfaGfaGfaagUfcCfaCfcsasc 1013 AD-65370 csgsugguGfgAfCfUfucucUfCfaauuL96 985 asAfsuugAfgAfGfaaguCfcAfccagcsasg 1014 AD-65265 gsusggugGfaCfUfUfcUfcucaauuuL96 986 asAfsaUfugagaGfaagUfcCfaccAfcsgsa 1015 AD-65407 csgsugguGfgAfCfUfucucUfCfaauuL96 987 asAfsuugAfgAfgAfaguCfcAfccagcsasg 1016 AD-64027 gsgsUfgGfaCfUfUfcUfcUfcAfaUfuUfL 96 988 asAfsaUfuGfaGfaGfaagUfcCfaCfcsasc 1017 AD-65266 gsusggugGfaCfUfUfcucuCfaauuuL96 989 asAfsaUfugagaGfaagUfcCfaccAfcsgsa 1018 AD-65389 usgsgudGgucdTucucuaaauuL96 990 asdAsuugagagdAagudCcaccasusu 1019 AD-64008 GfsusGfgUfgGfaCfUfUfcUfcUfcAfaUf uUfL96 991 asAfsaUfuGfaGfaGfaagUfcCfaCfcAfcsgsa 1020 AD-65377 csgsuggudGgucdTucucuaaauuL96 992 asdAsuugagagdAagudCcaccagcsusu 1021 AD-65409 gsguggaCfuU fCfUfcucaAfUfuuuaL96 993 PusAfsaaaUfuGfAfgagaAfgUfccaccsasc 1022 AD-65403 gsguggaCfuU fCfUfcucaAfUfuuuaL96 994 usAfsaaaUfuGfAfgagaAfgUfccaccsasc 1023 AD-65385 usgsgacuacdTcucaaauuuaL96 995 usdAsaaauugadGagadAguccasusu 1024

Screening for a single dose of these duplexes was performed in duplicate by transfecting HepG2.215 and Hep3V cells with duplexes and measuring HBV viral RNA using pairs

- 125 039127 primer/probe for detection of HBV P (ORF) open reading frame RNA (PORF-1_A and PORF-1_B) and/or primer sets for detection of HBV ORF S RNA (SORF-2_A and SORF-2_B). The results of analyzes on HepG2.2.15 cells are shown in table. 8, and the results of analyzes on Hep3B cells are presented in table. 9.

Table 8

I ining against .2.15th dose for HBV on cells

Kit Kit Kit Kit primer/probe primer/probe primer/probe primer/probe PORF-1 PORF-1 SORF-2 SORF-2 Experiment Duplicate Experiment Duplicate Duplex ID BUT experiment B BUT experiment B AD-65369 0.1875 0.042 0.0446 0.3018 AD-65381 0.086 0.249 0.1008 0.553 AD-63962 0.4838 0.3475 0.2237 0.5258 AD-63938 0.3587 2.1213 0.0501 1.1434 AD-65561 0.1076 0.3801 0.0718 0.6897 AD-65566 0.4127 0.3211 0.185 11.1161 AD-63944 0.9489 0.7098 0.393 0.2771 IC50 IC50 IC50 AD-63968 missing missing 1.8788 missing AD-65406 3.3749 18.8396 3.8204 2.2662 IC50 AD-65396 missing 6.8758 3.7382 4.2157 AD-65427 0.0089 0.0181 0.0066 0.015 AD-65573 0.0174 0.0332 0.0029 0.0227 AD-65432 0.0211 0.0593 0.0112 0.0366 AD-64332 0.0268 0.0329 0.0624 0.0217 AD-64322 0.0963 0.1077 0.0992 0.0963 AD-64272 0.0773 0.1199 0.0763 0.093 AD-65583 0.1624 0.2228 0.1568 0.1496 AD-63994 0.7019 0.1467 0.0832 0.0385 AD-65370 0.2404 0.7916 0.3952 0.1964 AD-65265 0.2255 0.5008 0.2893 0.318 AD-65407 0.9533 0.261 0.4254 0.1121 AD-64027 0.7692 0.5887 0.5208 0.5697 AD-652 66 3.4109 0.5055 0.8532 0.3658 AD-65389 0.9172 0.6514 0.4915 0.2872 AD-64008 1.2738 0.7865 1.9519 0.808 AD-65377 0.6052 1.6 24.9403 0.6065 AD-65409 1.8304 1.6479 0.104 0.0557 AD-65403 12.1516 0.667 1.006 0.233 IC50 IC50 IC50 IC50 AD-65385 missing missing missing missing

- 126 039127

Table 9

Single dose screening for HBV in HP3V cells Duplex ID PORF-1 primer/probe kit Experiment A Primer/probe kit PORF-1 Experiment B AD-65369 0.0982 0.0508 AD-65381 0.2392 0.1097 AD-63962 0.0769 0.0706 AD-63938 0.039 0.0111 AD-65561 0.6316 0.6931 AD-65566 0.2747 0.5331 AD-63944 0.1317 0.0566 AD-63968 0.4374 0.8811 AD-65406 1.4961 1.2573 AD-65396 1.9971 0.9952 AD-65427 0.0234 0.006 AD-65573 0.0346 0.0334 AD-65432 0.0352 0.2664 AD-64332 0.0221 0.4541 AD-64322 0.1743 0.1616 AD-64272 0.1885 0.6699 AD-65583 0.1241 8.1611 AD-63994 3.3623 5.2897 AD-65370 0.2281 IC50 missing AD-65265 IC50 missing 7.3426 AD-65407 0.1404 1.3833 AD-64027 27.1417 1.1832 AD-65266 IC50 missing IC50 missing AD-65389 IC50 missing IC50 missing AD-64008 IC50 missing IC50 missing AD-65377 IC50 missing IC50 missing AD-65409 1.8065 3.436 AD-65403 0.5113 18.0359 AD-65385 IC50 missing IC50 missing

A subset of these duplexes were also analyzed for in vitro metabolic stability using two assays: a tritosome stability assay and a cytosol stability assay.

For stability analysis in tritosomes, rat liver tritosomes (product PR14044, custom made by Xenotech) were allowed to thaw to room temperature and diluted to 0.5 U/ml acid phosphatase in 20 mM sodium citrate pH 5.0 buffer. Daily samples were prepared by mixing 100 µl of tritosomes with acid phosphatase at a concentration of 0.5 U/ml with 25 µl of a siRNA sample at a concentration of 0.4 mg/ml in a microcentrifuge tube and incubation for 24 h in an Eppendorf Thermomixer set at 37°C and 300 rpm. After 24 hours of incubation, 300 µl of Phenomenex lysis working buffer (cat. no. ALO-8498) and 12.5 µl of 0.4 mg/ml siRNA internal standard were added to each well. Samples at time 0 h were prepared by mixing 100 µl of tritosomes with acid phosphatase at a concentration of 0.5 U/ml with 25 µl of siRNA sample at a concentration of 0.4 mg/ml, 300 µl of Phenomenex lysis working buffer and 12.5 µl of internal standard siRNA at a concentration of 0.4 mg/ml. siRNA was extracted from 24-hour and 0-hour samples using the Phenomenex Clarity RTX Starter Kit (Cat. No. KSO-8494). After extracting the samples, they were transferred to a microcentrifuge tube and dried using a Labconco CentriVap concentrator (p/n 7810010). Then the samples were resuspended using 500 µl of water, which did not contain nucleases. 50 μl of each sample was run on an Agilent Technologies 1260 Infinity Binary LC column on an Agilent Technologies 6130 Quadrupole LC/MS system. The run was carried out using a method involving the use of a pump for injecting quaternary mixtures, for 12.20 minutes at a rate of 0.400 ml/min, according to the following schedule: ________________________

Time function Parameter 0.20 5% buffer A (16 mM TEA, 200 mM (100% methanol) HFIP), 95% Buffer B 2.50 5% buffer A (16 mM TEA, 200 mM (100% methanol) HFIP), 95% Buffer B 3.00 100% buffer A (16 mM TEA, 200 b 4M HFIP)

The run was carried out using a method involving the use of a pump for injecting two-component mixtures, for 12.20 minutes at a rate of 0.700 ml / min, according to the following schedule: ________________________________________________________________________________

Time function Parameter 0.00 100% buffer BUT (16 mM TEA, 200 mM HFIP) 0.40 100% buffer BUT (16 mM TEA, 200 mM HFIP) 10.00 60% buffer 1 ACN) one (16 mM TEA, 200 mM HFIP), 40% Buffer B (100% 10.10 100% buffer BUT (16 mM TEA, 200 mM HFIP) 12.20 100% buffer BUT (16 mM TEA, 200 mM HFIP)

Both the left and right columns were set to 75.00°C. The UV signal was measured at a wavelength of 260 nm. The percent residue of each filament was calculated using the following equation: % filament residual=100* (peak area of _{filament 24h} /peak area of _filament pts* ₍ peak area of _{standard Ta} 24h/peak area of standard _0h ) _. ) ) ·

For stability analysis in the cytosol, female rat liver cytosol (Xenotech, cat. no. R1500.C) was allowed to thaw to room temperature and diluted to 1 mg/ml in 50 mM Tris buffer: HCl, pH 7.4, 5 mM MgCl ₂ . 24 h time point samples were prepared by mixing 100 µl of 1 mg/ml cytosol with 25 µl of 0.4 mg/ml siRNA sample in a microcentrifuge tube and incubating for 24 h in an Eppendorf Thermomixer set at 37° C and 300 rpm. After 24 hours of incubation, 300 µl of Phenomenex lysis working buffer (cat. no. ALO-8498) and 12.5 µl of 0.4 mg/ml siRNA internal standard were added to each well. 0 h samples were prepared by mixing 100 µl of 1 mg/ml cytosol with 25 µl of 0.4 mg/ml siRNA sample, 300 µl of Phenomenex lysis running buffer, and 12.5 µl of siRNA internal standard at 0, 4 mg/ml. siRNA was extracted from 24 hour and 0 hour samples using the Phenomenex Clarity OTX Starter Kit (cat. no. KSO-8494). After extracting the samples, they were transferred to a microcentrifuge tube and dried using a Labconco CentriVap concentrator (p/n 7810010). Then the samples were resuspended using 500 µl of water, which did not contain nucleases. 50 μl of each sample was run on an Agilent Technologies 1260 Infinity Binary LC column on an Agilent Technologies 6130 Quadrupole LC/MS system. The run was carried out using a method involving the use of a pump for injecting quaternary mixtures, for 12.20 minutes at a rate of 0.400 ml/min, according to the following schedule:

The run was carried out using a method involving the use of a pump for injecting two-component mixtures, for 12.20 minutes at a rate of 0.700 ml/min, according to the following schedule:

Time function Parameter

Time function Parameter 0.00 100% buffer A (16 mM TEA, 200 mM HFIP) 0.40 100% buffer A (16 mM TEA, 200 mM HFIP) 10.00 60% buffer A (16 mM TEA, 200 mM HFIP), 40% buffer B (100% ACN) 10.10 100% buffer A (16 mM TEA, 200 mM HFIP) 12.20 100% buffer A (16 mM TEA, 200 mM HFIP)

Both the left and right columns were set to 75.00°C. The UV signal was measured at a wavelength of 260 nm. The percentage of residue of each strand was calculated using the following equation:

% Filament Residual=100*(Peak Area _{Filament 24h} /Peak Area _Filament 0h*(Peak Area Standard 24h/Peak Area Standard 0h) )

The results of stability analyzes within 24 h in tritosome are presented in table. 10, and the results of stability analyzes within 24 h in the cytosol are presented in table. eleven.

Table 10

Stability assays over 24 h in tritosome

% residual antisense strand % residual semantic thread Duplex ID 87.59 72.43 AD-65381 67.59 82, 48 AD-655 66 30.52 34, 98 AD-63968

- 128 039127

115.17 79, 61 AD-65427 43.00 76, 84 AD-65573 129.69 128.59 AD-64272 100.30 119.85 AD-65407 94.06 110.90 AD-64008 98.63 127.48 AD-65377 105.06 119.88 AD-65409 117.55 104.30 AD-65403

Table I

Stability assays for 24 hours in the cytosol_________

% residual antisense strand % residual semantic thread Duplex ID 67.78 22.42 AD-65381 55.89 15.26 AD-65566 88.39 46, 94 AD-63968 89, 50 66, 35 AD-65427 69.01 41.47 AD-65573 96, 77 78.00 AD-64272 64.46 24.10 AD-65407 35.39 26, 39 AD-64008 79, 98 66, 50 AD-65377 86, 24 74.25 AD-65409 60.45 62.41 AD-65403

Example 4 Synthesis and screening of additional siRNA duplexes.

Additional iRNA molecules targeting the HBV genome were designed and synthesized as described above. A detailed listing of additional unmodified HBV sense and antisense strand sequences is shown in Table 1. 12, and a detailed listing of the modified HBV sense and antisense strand sequences is shown in Table 1. 13.

Table 12

Unmodified HBV dsRNA sense and antisense strand sequences

Duplex ID Sense Thread ID Semantic sequence, unmodified (5'-3' ) SEQID NO: Antisense strand ID Antisense sequence, unmodified (5'-3') SEQID NO: AD-65381 A-130366.9 UCGUGGUGGACUUCUCUCA 1025 A-131904.1 U GAGAGAAGU WITH CAC CAC GAUU 1036 AD-66019 A-130366.9 UCGUGGUGGACUUCUCUCA 1026 A-131904.1 U GAGAGAAGU WITH CAC CAC GAUU 1037 AD-65375 A-130366.9 UCGUGGUGGACUUCUCUCA 1027 A-130364.7 U GAGAGAAGU WITH CAC CAC GAUU 1038 AD-65427 A-130441.7 GUGCACUUCGCUUCACCUCU A 1028 A-131905.1 UAGAGGUGAAGCGAAGUGCACUU 1039 AD-66110 A-130441.7 GUGCACUUCGCUUCACCUCU BUT 1029 A-131905.1 UAGAGGUGAAGCGAAGUGCACUU 1040 AD-65421 A-130441.7 GUGCACUUCGCUUCACCUCU A 1030 A-130442.6 UAGAGGUGAAGCGAAGUGCACUU 1041 AD-65407 A-130371.12 CGUGGUGGACUUCUCUCAAU and 1031 A-130372.5 AAUU GAGAGAAGU WITH CAC CAG CAG 1042 AD-65377 A-130384.4 CGUGGUGGUCTUCUCUAAAU and 1032 A-130748.3 AAUU GAGAGAAGU C CAC CAGCUU 1043 AD-65409 A-130388.15 GGUGGACUUCUCUCAAUUUU A 1033 A-131906.1 UAAAAUU GAGAGAAGU C CAC CAC 1044 AD-66111 A-130388.15 GGUGGACUUCUCUCAAUUUU A 1034 A-131906.1 UAAAAUU GAGAGAAGU C CAC CAC 1045 AD-65403 A-130388.15 GGUGGACUUCUCUCAAUUUU BUT 1035 A-130389.4 UAAAAUU GAGAGAAGU C CAC CAC 1046

Table 13

Modified HBV dsRNA sense and antisense strand sequences_____

Duplex ID Sense Thread ID Semantic sequence (5'-3') SEQID NO: Antisense strand ID Antisense sequence (5'-3') SEQID NO: AD-65381 A-130366.9 uscsguGfgUfGfGfacuucuc ucaL96 1047 A-131904.1 PusGfsagaGfaAfGfuccaCfcAfcga SUSU 1058 AD-66019 A-130366.9 uscsguGfgUfGfGfacuucuc ucaL96 1048 A-131904.1 VPusGfsagaGfaAfGfuccaCf cAfega asusu 1059

- 129039127

AD-65375 A-130366.9 uscsguGfgUfGfGfacuucuc ucaL96 1049 A-130364.7 usGfsagaGfaAfGfuccaCfcAfcgas usu 1060 AD-65427 A-130441.7 gsusgcacUfuCfGfCfuucac cucuaL96 1050 A-131905.1 PusAfsgagGfugaagcgAfaGfugcac SUSU 1061 AD-66110 A-130441.7 gsusgcacUfuCfGfCfuucac cucuaL96 1051 A-131905.1 VPusAfsgagGfugaagcgAfaGfugca csusu 1062 AD-65421 A-130441.7 gsusgcacUfuCfGfCfuucac cucuaL96 1052 A-130442.6 usAf sgagGfugaagcgAfaGfugcacs usu 1063 AD-65407 A-130371.12 csgsugguGfgAfCfUfucucU fCfaauuL96 1053 A-130372.5 asAf suugAf gAf gAf aguCf cAf ccag csasg 1064 AD-65377 A-130384.4 csgsuggudGgucdTucucuaa auuL96 1054 A-130748.3 asdAsuugagagdAagudCcaccagcsu SU 1065 AD-65409 A-130388.15 gsguggaCfuUfCfUfcucaA fUfuuuaL96 1055 A-131906.1 PusAfsaaaUfuGfAfgagaAfgUfcca ccsasc 1066 AD-66111 A-130388.15 gsguggaCfuUfCfUfcucaA fUfuuuaL96 1056 A-131906.1 VPusAfsaaaUfuGfAfgagaAfgUfee accsasc 1067 AD-65403 А-1301388.15 gsguggaCfuUfCfUfcucaA fUfuuuaL96 1057 A-130389.4 usAf saaaUfuGfAfgagaAfgUfccac csasc 1068

Primary screening for a single dose of these iRNA duplexes was performed using the Dual-Glo® luciferase assay as described above. The results of this screening on Cos7 cells transfected with the indicated HBV iRNAs are shown in Table 1. 14. Data are expressed as percent residual mRNA compared to the negative control after 24 hours.

Table 14

Primary screening for a single dose of HBV on Cos7 cells using the Dual-Glo Luciferase® assay

Primary screening using dual luciferase % residual messenger RNA within 24 hours DRC ED50 Duplex ID At 50 nM Standard deviation At 1 nM Standard deviation (nM) AD-65381 9.3 0.24 15.6 0.77 0.019 AD-66019 ND ND ND ND ND AD-65375 24.2 0.36 71.4 0.69 ED50 missing AD-65427 28.8 1.60 41.0 1.73 0.117 AD-66110 ND ND ND ND ND AD-65421 47.6 3, 49 85.5 4.76 ED50 missing AD-65407 14.3 0.52 25.3 2.11 0.038 AD-65377 21.8 0.31 37.9 1, 12 0.130 AD-65409 9.5 0.41 13.2 0.71 0.013 AD-66111 ND ND ND ND ND AD-65403 12.6 0.50 37.2 2.31 0.069

ND - not defined.

These duplexes were also analyzed for a dose-dependent effect on viral RNA silencing using the Dual-Glo® luciferase assay as described above. The duplex doses used for these assays were 50, 8.333333333, 1.388888889, 0.231481481, 0.038580247, 0.006430041, 0.001071674, 0.000178612, , 8.26909x10 ^-7 and 1.37818Ex10 ^-7 nM, which were a 1 to 6 dilution of duplexes, starting at 50 nM, for 12 doses. The results of this screening on Cos7 cells transfected with the indicated HBV iRNAs are shown in Table 1. 15. Data are expressed as percent residual mRNA compared to the negative control after 24 hours.

- 130 039127

Table 15

Screening for Dose-Dependent Effects on Cos7 Cells Using the Dual-Glo Luciferase® Assay

Cells infected with luciferase genes IC50 (nM) per 24 h HBV, for analysis using two reporter Duplex ID Anali 3 one Analysis 2 Analysis 3 Anali 3 four Analysis 5 Analysis 6 Analysis 7 Average Value ¹ Standard deviation AD-65381 0.019 ND ND ND ND ND ND 0.019 AD-66019 ND 0.021 0.021 0.016 0.026 0.019 0.031 0.022 0.005 AD-65375 UD 0.215 0.149 0.081 0.246 0.138 0.276 0.184 0.074 AD-65407 0.038 0.045 0.051 0.021 0.050 0.056 0.068 0.047 0.015 AD-65377 0.130 0.029 0.046 0.087 0.096 0.146 0.090 0.089 0.042 AD-65409 0.013 ND ND ND ND ND ND 0.013 AD-66111 ND 0.018 0.013 0.012 0.018 0.021 0.033 0.019 0.007 AD-65403 0.069 0.044 0.033 0.039 0.042 0.046 0.062 0.048 0.013 AD-65427 0.017 ND ND ND ND ND ND 0.117 AD-66110 ND 0.238 0.296 0.145 0.157 0.161 ND 0.199 0.065 AD-65421 UD 1.219 1.385 2.254 0.799 2.906 ND 1.713 0.852

¹ Mean values from 5-7 biological replicates in triplicate. ND - not defined.

The efficacy and in vitro activity of these duplexes were also analyzed. In particular, the dose-dependent effect of duplexes on viral RNA silencing in lysates of transfected HepG2.2.15 and Hc3B cells and on HBsAg silencing in HepG2.2.15 cell supernatants was determined. Cells were transfected with 12 separate doses of duplexes ranging from 50 nM to 1 x 10 ^-7 nM, and two seventy hours after transfection, viral RNA levels were determined using primer/probe pairs to detect ORF P and/or ORF S. HBsAg levels were determined with using an ELISA assay.

The results of viral ORF P RNA silencing on HepG2.2.15 cells using these duplexes are shown in Table 1. Table 16 shows the results of viral ORF P RNA silencing on HepG2.2.15 cells using the indicated duplexes. 17. The results of HBsAg silencing in HepG2.2.15 cells are presented in Table 1. eighteen.

The results of viral ORF P RNA silencing on Hep3B cells using these duplexes are shown in Table 1. 19.

Table 16

Screening for dose-response effect in HepG2.2.15 cells

Viral RNA silencing in HepG2.2.15 cells P-ORF primer/probe kit IC50 (nM) at 72 h Duplex ID Analysis Development Optimized Analysis Analysis 1 Analysis 2 Analysis 3 AD-65381 0.079 0.208 ND ND ND ND ND AD-66019 ND ND 0.265 0.010 0.022 0.032 0.023 AD-65375 12.3 UD UD UD 0.172 0.257 0.672 AD-65407 0.247 1.0 0.365 0.109 0.069 0.103 0.095 AD-65377 1.3 UD 4.9 UD 0.842 0.838 0.615 AD-65409 0.436 1.0 ND ND ND ND ND AD-66111 ND ND 0.456 0.030 fifty 0.294 ND AD-65403 9.2 10.4 3.4 UD 0.114 0.384 1.0 AD-65427 0.007 0.018 ND ND ND ND ND AD-66110 ND ND 0.012 0.053 0.016 0.010 0.021 AD-65421 0.069 0.091 0.034 0.006 0.002 0.003 0.007

ND - not defined.

- 131 039127

Table 17

Screening for dose-response effect in HepG2.2.15 cells

Viral RNA silencing Primer/probe kit S-ORF in HepG2 cells 2.15 IC50 (nM) Duplex ID AD-65381 at 72 o'clock Developed^ 0.252 gka anal 0.215 isa ND ND Optimism Analysis 1 ND advanced Analysis 2 ND analysis Analysis 3 ND AD-66019 ND ND 0.245 0.011 0.009 0.016 0.005 AD-65375 45 UD UD UD 0.124 0.048 0.056 AD-65407 0.232 0.645 0.577 0.015 0.021 0.023 0.016 AD-65377 1.4 8.6 UD UD 0.575 0.483 0.117 AD-65409 0.433 0.242 ND ND ND ND ND AD-66111 ND ND 2.1 0.455 ND 0.416 ND AD-65403 0.997 0.670 0.668 UD 0.074 0.270 1.1 AD-65427 0.008 0.018 ND ND ND ND ND AD-66110 ND ND 0.022 0.050 0.035 0.038 0.020 AD-65421 0.083 0.097 0.046 0.003 0.003 0.005 0.001

ND - not defined.

Table 18

Screening for dose-response effect in HepG2.2.15 cells

ELISA HBsAg IC50 (hM) Duplex ID Analysis 1 AD-65381 ND AD-66019 0.105 AD-65375 1.2 AD-65407 0.102 AD-65377 2.9 AD-65409 ND AD-66111 0.018 AD-65403 0.064 AD-65427 ND AD-66110 0.002 AD-65421 0.008

ND - not defined.

Table 19

Screening for dose-response effect in Hep3B cells

HpSV cell screening ED50 DRC P-ORF primer/probe kit Duplex ID P-ORF Cycle 1 P-ORF Cycle 2 Combined ©into AD-65381 0.239 0.110 0.194 AD-66019 ND ND ND AD-65375 ND ND ND AD-65427 0.023 0.006 0.018 AD-66110 ND ND ND AD-65421 ND ND ND AD-65407 0.140 1.383 0.527 AD-65377 ED50 missing ED50 missing ED50 missing AD-65409 1.807 3.436 2.905 AD-66111 ND ND ND AD-65403 0.511 18.036 5.013

ND - not defined.

These duplexes were also analyzed for in vitro stability using two assays:

- 132 039127 tritosome stability assay and cytosolic stability assay as described above. The results of these analyzes are presented in table. twenty.

Screening was also performed for the dose-dependent effect of various combinations on HepG2.215 cells. The duplex doses used for these assays were 50, 8.333333333, 1.388888889, 0.231481481, 0.038580247, 0.006430041, 0.001071674, 0.000178612, , 8.26909x10'7 and 1.37818Ex10' ⁷ nM, which are a 1 to 6 dilution of duplexes, starting at 50 nM, for 12 doses. 72 hours after transfection of these duplexes, the level of viral RNA (ORF P and ORF S) and the level of secreted HBsAg were determined as described above. The results of these analyzes are presented in table. 21.

Table 21

Single dose screening for HBV at seventy-two hours on HepG2.2.15 cells

Duplex ID 1C50_A S-ORF2 (nM) 1C50_B S-ORF2 (nM) IC50 combined S~ORF2 (nM) 1C50_A P-ORF1 (nM) IC50_B R- ORF1 (nM) IC50 combined P~ORF1 (nM) ED50 by ELISA Hell with S (nM) AD-66019/AD- 66110 0.0091 0.0017 0.0038 0.0213 0.002 0.0076 0.007482 AD-66019/AD- 65421 0.0438 0.2371 0.0131 0.0367 0.0106 0.0204 0.026398 AD-65375/AD66110 0.0832 1.0896 0.193 0.0377 0.2348 0.2022 0.004174 AD-65375/AD- 65421 0.084 0.0475 0.0708 0.0566 0.0388 0.0371 0.030822 AD-65407/AD66110 0.0387 0.001 0.0083 0.0402 0.0018 0.0116 0.010172 AD-65407/AD- 65421 0.0686 0.0062 0.0225 0.0711 0.0177 0.0396 0.066556 AD-65377/AD66110 0.0634 0.8267 0.6269 0.0477 0.073 0.0618 0.01435 AD-65377/AD65421 0.1461 0.0468 0.1372 0.1207 0.0088 0.0451 0.03419 AD-66111/AD- 66110 0.0382 0.0094 0.0161 0.0292 0.0027 0.0088 0.013155 AD-66111/AD65421 0.1628 0.0919 0.1579 0.1297 0.0396 0.0722 0.026889 AD-65403/AD- 66110 0.0499 0.0094 0.0444 0.0383 0.0164 0.0348 0.003783 AD-65403/AD- 65421 0.1011 0.0007 0.0208 0.1118 0.0031 0.0297 0.014569

Example 5 Synthesis and in vitro screening of additional siRNA duplexes.

Additional iRNA molecules targeting the ORF X of the HBV genome were designed and synthesized as described above. A detailed listing of additional unmodified HBV sense and antisense strand sequences is shown in Table 1. 22. A detailed listing of additional modified HBV sense and antisense strand sequences is shown in Table 1. 23.

- 133 039127

Table 22

Unmodified HBV dsRNA sense and antisense strand sequences

Duplex ID Sense oligonucleotide name Yes Semantic sequence (5'-3') SEQID NO: Name of oligonucleotide and antisense strand Antisense sequence (5'-3') SEQID NO: AD- 106 111 65776 A-131859.1 UGUGCACUUCGCUUCACCUCU 9 A-131860.1 AGAGGUGAAGCGAAGUGCACACG 5 AD- 107 111 65782 A-131877.1 UGCACUUCGCUUCACCUCUGA 0 A-131878.1 UCAGAGGUGAAGCGAAGUGCACA 6 AD- 107 111 65792 A-131865.1 GU GU GCACUU C GCUU CAC CUA one A-131866.1 UAGGUGAAGCGAAGUGCACACGG 7 AD- 107 111 65781 A-131861.1 CGUGUGCACUUCGCUUCACCU 2 A-131862.1 AGGUGAAGCGAAGUGCACACGGU eight AD- 107 111 64304 A-128443.6 GU GCACUU C GCUU CAC CU CUA 3 A-128444.5 UAGAGGUGAAGCGAAGUGCACAC 9 AD- 107 112 65771 A-131857.1 C C GU GU GCACUU C GCUU CACA four A-131858.1 UGUGAAGCGAAGUGCACACGGUC 0 AD- 107 112 65758 A-131867.1 CACUUCGCUUCACCUCUGCAA 5 A-131868.1 UUGCAGAGGUGAAGCGAAGUGCA one AD- 107 112 65777 A-131875.1 ACUUCGCUU CAC CU CU GCACA 6 A-131876.1 UGUGCAGAGGUGAAGCGAAGUGC 2 AD- 107 112 61567 A-123525.2 GGCUGUAGGCAUAAAUUGGUA 7 A-123526.2 UAC CAAUUUAU GC CUACAGC CU C 3 AD- 107 112 65772 A-131873.1 UU C GCUU CAC CU CU GCAC GUA eight A-131874.1 UACGUGCAGAGGUGAAGCGAAGU four AD- 107 112 65767 A-131871.1 UCGCUUCACCUCUGCACGUCA 9 A-131872.1 UGACGUGCAGAGGUGAAGCGAAG 5 AD- 108 112 65763 A-131869.1 CUUCGCUUCACCUCUGCACGU 0 A-131870.1 ACGUGCAGAGGUGAAGCGAAGUG 6 AD- 108 112 64281 A-128395.3 CCCCGUCUGUGCCUUCUCUA one A-128396.2 UAUGAGAAGGCACAGACGGGGAG 7 AD- 108 112 64311 A-128391.3 CCGUCUGUGCCUUCUCAUCUA 2 A-128392.2 UAGAUGAGAAGGCACAGACGGGG eight AD- 108 112 65790 A-131837.1 CCAGCACCAUGCAACUUUUUA 3 A-131838.1 UAAAAAGUUGCAUGGUGCUGGUG 9 AD- A-131841.1 CACCAGCACCAUGCAACUUUU 108 A-131842.1 AAAAGUUGCAUGGUGCUGGUGCG 113 65761 four 0 AD- 108 113 65786 A-131849.1 САС CAU GCAACUUUUU САС CU 5 A-131850.1 AGGUGAAAAAGUUGCAUGGUGCU one AD- 108 113 65785 A-131835.1 CAAU GU CAAC GAC C GAC CUUA 6 A-131836.1 UAAGGUCGGUCGUUGACAUUGCA 2 AD- 108 113 65787 A-131863.1 CGCUUCACCUCUGCACGUCGA 7 A-131864.1 UCGACGUGCAGAGGUGAAGCGAA 3 AD- 108 113 65770 A-131845.1 ACCUUGAGGCAUACUUCAAAG eight A-131846.1 CUUUGAAGUAUGCCUCAAGGUСG four AD- 108 113 65766 A-131843.1 C C GAC CUU GAGGCAUACUU CA 9 A-131844.1 UGAAGUAUGCCUCAAGGUCGGUC 5 AD- 109 113 61555 A-123521.2 GACCUUGAGGCAUACUUCAAAA 0 A-123522.2 UUUGAAGUAUGCCUCAAGGUCGG 6 AD- 109 113 65762 A-131855.1 ACCGACCUUGAGGCAUACUUA one A-131856.1 UAAGUAUGCCUCAAGGUCGGUCG 7 AD- 109 113 65755 A-131827.1 UCGCAUGGAGACCACCGUGAA 2 A-131828.1 UUCACGGUGGUCUCCAUGCGACG eight AD- 109 113 65788 A-131811.1 UUACAUAAGAGGACUCUUGGA 3 A-131812.1 UC CAAGAGU WITH CU CUUAU GUAAGA 9 AD- 109 114 65768 A-131803.1 UCUUACAUAAGAGGACUCUUA four A-131804.1 UAAGAGU WITH CU CUUAU GUAAGAC WITH 0 AD- 109 114 61561 A-123523.2 ACUU CAAAGACU GUUU GUUUA 5 A-123524.2 UAAACAAACAGU CUUU GAAGUAU one AD- 109 114 65764 A-131801.1 UACUU CAAAGACU GUUU GUUU 6 A-131802.1 AAACAAACAGU CUUU GAAGUAU G 2 AD- 109 114 65753 A-131799.1 AUACUU CAAAGACU GUUU GUU 7 A-131800.1 AACAAACAGU CUUU GAAGUAU GC 3 AD- 109 114 65765 A-131817.1 UUGUUUAAAGACUGGGAGGAA eight A-131818.1 UU C CU C C CAGU CUUUAAACAAAC four AD- 109 114 65769 A-131819.1 GCAUACUU CAAAGACU GUUUA 9 A-131820.1 UAAACAGUCUUUGAAGUAUGCCU 5 AD- 110 114 65759 A-131815.1 CAAAGACU GUUU GUUUAAAGA 0 A-131816.1 UCUUUAAACAAACAGUCUUUGAA 6 AD- 110 114 65774 A-131831.1 AGACU GUUU GUUUAAAGACUA one A-131832.1 UAGU CUUUAAACAAACAGU CUUU 7 AD- 110 114 65778 A-131807.1 GUUUGUUUAAAGACUGGGAGA 2 A-131808.1 UCU C C CAGU CUUUAAAACAAACAG eight

- 134 039127

AD65773 A-131805.1 GGGGGAGGAGAUUAGAUUAAA 110 3 A-131806.1 UUUAAUCUAAAUCUCCUCCCCCAA 114 9 AD65789 A-131825.1 GGGGAGGAGAUUAGAUUAAG 110 four A-131826.1 CUUUAAUCUAAUCUCCUSSCCGA 115 0 AD65783 A-131809.1 GUUGGGGGAGGAGAUUAGAUU 110 5 A-131810.1 AAUCUAAUCUCCUCCCCCAACUC 115 one AD65754 A-131813.1 UUGGGGGAGGAGAUUAGAUUA 110 6 A-131814.1 UAAUCUAAUCUCCUCCCCCAACU 115 2 AD65779 A-131821.1 GGGAGGAGAUUAGAUUAAAGA 110 7 A-131822.1 UCUUUAAUCUAAUCUCCUSSCC 115 3 AD65791 A-131851.1 UUAGAUUAAAGGUCUUUGUAA 110 eight A-131852.1 UUACAAAAGAC CUUUAAU CUAAU C 115 four AD65760 A-131829.1 UAGAUUAAAGGUCUUUGUACU 110 9 A-131830.1 AGUACAAAGACCUUUAAUCUAAU 115 5 AD65784 A-131823.1 AUUAGAUUAAAGGUCUUUGUA 111 0 A-131824.1 UACAAAGAC CUUUAAU CUAAU CU 115 6 AD65757 A-131853.1 GAGGAGAUUAGAUUAAAGGUA 111 one A-131854.1 UACCUUUAAUCUAAUCUCCUCCCC 115 7 AD65775 A-131847.1 GGACUCUUGGACUCUCUGCAA 111 2 A-131848.1 UU G CAGAGAGU C CAAGAGU C CU C 115 eight AD65780 A-131833.1 ACUCUUGGACUCUCUGCAAUA 111 3 A-131834.1 UAUU GCAGAGAGU C CAAGAGU C C 115 9 AD65756 A-131839.1 AGAUUAAAGGUCUUUGUACUA 111 four A-131840.1 UAGUACAAAGAC CUUUAAU CUAA 116 0

Table 23

Unmodified HBV dsRNA sense and antisense strand sequences

ID duplex a Name of sense oligonucleotide yes Semantic sequence (5'-3') SEQID NO: Name of antisense oligonucleotide Antisense sequence (5'-3') SEQID NO: AD65776 A-131859.1 UfsgsUfgCfaCfuUfCfGfcUfuCfaCfcUf cUfL96 116 one A-131860.1 asGfsaGfgU fgAfaGfcgaAfgUfgCfa Cfascsg 120 7 AD65782 A-131877.1 UfsgsCfaCfuUfcGfCfUfuCfaCfcUfcUf gAfL96 116 2 A-131878.1 usCfsaGfaGfgUfgAfagcGfaAfgUfg Cfascsa 120 eight AD65792 A-131865.1 GfsusGfuGfcAfcUfUfCfgCfuUfcAfcCf uAfL96 116 3 A-131866.1 usAfsgGfuGfaAfgCfgaaGfuGfcAfc Af csgsg 120 9 AD- A-131861.1 CfsgsUfgUfgCfaCfUfUfcGfcUfuCfaCf 116 A-131862.1 asGfsgUfgAfaGfcGfaagUfgCfaCfa 121 65781 AD64304 A-128443.6 cUfL96 GfsusGfcAfcUfuCfGfCfuUfcAfcCfuCf uAfL96 four 116 5 A-128444.5 Cfgsgsu usAf sgAfgGfuGfaAfgcgAfaGfuGfc Af csasc 0 121 one AD65771 A-131857.1 CfscsGfuGfuGfcAfCfUfuCfgCfuUfcAf cAfL96 116 6 A-131858.1 usGfsuGfaAfgCfgAfaguGfcAfcAfc Gfgsusc 121 2 AD65758 A-131867.1 CfsasCfuUfcGfcUfUfCfaCfcUfcUfgCf aAfL96 116 7 A-131868.1 usUfsgCfaGfaGfgUfgaaGfcGfaAfg Ufgscsa 121 3 AD65777 A-131875.1 AfscsUfuCfgCfuUfCfAfcCfuCfuGfcAf cAfL96 116 eight A-131876.1 usGfsuGfcAfgAfgGfugaAfgCfgAfa Gfusgsc 121 four AD61567 A-123525.2 GfsgsCfuGfuAfgGfCfAfuAfaAfuUfgGf uAfL96 116 9 A-123526.2 usAfscCfaAfuUfuAfugcCfuAfcAfg Cfcsusc 121 5 AD65772 A-131873.1 UfsusCfgCfuUfcAfCfCfuCfuGfcAfcGf uAfL96 117 0 A-131874.1 usAfscGfuGfcAfgAfgguGfaAfgCfg Afasgsu 121 6 AD65767 A-131871.1 UfscsGfcUfuCfaCfCfUfcUfgCfaCfgUf cAfL96 117 one A-131872.1 usGfsaCfgUfgCfaGfaggUfgAfaGfc Gfasasg 121 7 AD65763 A-131869.1 CfsusUfcGfcUfuCfAfCfcUfcUfgCfaCf gUfL96 117 2 A-131870.1 asCfsgUfgCfaGfaGfgugAfaGfcGfa Af gsusg 121 eight AD64281 A-128395.3 CfscsCfcGfuCfuGfUfGfcCfuUfcUfcAf uAfL96 117 3 A-128396.2 usAfsuGfaGfaAfgGfcacAfgAfcGfg Gfgsasg 121 9 AD64311 A-128391.3 CfscsGfuCfuGfuGfCfCfuUfcUfcAfuCf uAfL96 117 four A-128392.2 usAfsgAfuGfaGfaAfggcAfcAfgAfc Gfgsgsg 122 0 AD65790 A-131837.1 CfscsAfgCfaCfcAfUfGfcAfaCfuUfuUf uAfL96 117 5 A-131838.1 usAfsaAfaAfgUfuGfcauGfgUfgCfu Gfgsusg 122 one AD65761 A-131841.1 CfsasCfcAfgCfaCfCfAfuGfcAfaCfuUf uUfL96 117 6 A-131842.1 asAfsaAfgUfuGfcAfuggUfgCfuGfg Ufgscsg 122 2 AD65786 A-131849.1 CfsasCfcAfuGfcAfAfCfuUfuUfuCfaCf cUfL96 117 7 A-131850.1 asGfsgUfgAfaAfaAfguuGfcAfuGfg Ufgscsu 122 3 AD65785 A-131835.1 CfsasAfuGfuCfaAfCfGfaCfcGfaCfcUf uAfL96 117 eight A-131836.1 usAf saGfgUfcGfgUfcguUfgAfcAfu Ufgscsa 122 four AD65787 A-131863.1 CfsgsCfuUfcAfcCfUfCfuGfcAfcGfuCf gAfL96 117 9 A-131864.1 usCfsgAfcGfuGfcAfgagGfuGfaAfg Cfgsasa 122 5 AD65770 A-131845.1 AfscsCfuUfgAfgGfCfAfuAfcUfuCfaAf aGfL96 118 0 A-131846.1 csUfsuUfgAfaGfuAfugcCfuCfaAfg Gfuscsg 122 6 AD65766 A-131843.1 CfscsGfaCfcUfuGfAfGfgCfaUfaCfuUf cAfL96 118 one A-131844.1 usGfsaAfgUfaUfgCfcucAfaGfgUfc Gfgsusc 122 7 AD61555 A-123521.2 GfsasCfcUfuGfaGfGfCfaUfaCfuUfcAf aAfL96 118 2 A-123522.2 usUfsuGfaAfgUfaUfgccUfcAfaGfg Ufcsgsg 122 eight

- 135 039127

AD65762 A-131855.1 Af scsCfgAfcCfuUfGfAfgGfcAfuAfcUf uAfL96 118 3 A-131856.1 usAfsaGfuAfuGfcCfucaAfgGfuCfg Gfuscsg 122 9 AD65755 A-131827.1 UfscsGfcAfuGfgAfGfAfcCfaCfcGfuGf aAfL96 118 four A-131828.1 usUfscAfcGfgUfgGfucuCfcAfuGfc Gfascsg 123 0 AD65788 A-131811.1 UfsusAfcAfuAfaGfAfGfgAfcUfcUfuGf gAfL96 118 5 A-131812.1 usCfscAfaGfaGfuCfcucUfuAfuGfu Af asgsa 123 one AD65768 A-131803.1 UfscsUfuAfcAfuAfAfGfaGfgAfcUfcUf uAfL96 118 6 A-131804.1 usAfsaGfaGfuCfcUfcuuAfuGfuAfa Gfascsc 123 2 AD61561 A-123523.2 AfscsUfuCfaAfaGfAfCfuGfuUfuGfuUf uAfL96 118 7 A-123524.2 usAfsaAfcAfaAfcAfgucUfuUfgAfa Gfusasu 123 3 AD65764 A-131801.1 UfsasCfuUfcAfaAfGfAfcUfgUfuUfgUf uUfL96 118 eight A-131802.1 asAfsaCfaAfaCfaGfucuUfuGfaAfg Ufasusg 123 four AD65753 A-131799.1 AfsusAfcUfuCfaAfAfGfaCfuGfuUfuGf uUfL96 118 9 A-131800.1 asAfscAfaAfcAfgUfcuuUfgAfaGfu Afusgsc 123 5 AD65765 A-131817.1 UfsusGfuUfuAfaAfGfAfcUfgGfgAfgGf aAfL96 119 0 A-131818.1 usUfscCfuCfcCfaGfucuUfuAfaAfc Afasasc 123 6 AD65769 A-131819.1 GfscsAfuAfcUfuCfAfAfaGfaCfuGfuUf uAfL96 119 one A-131820.1 usAfsaAfcAfgUfcUfuugAfaGfuAfu Gfcscsu 123 7 AD65759 A-131815.1 CfsasAfaGfaCfuGfUfUfuGfuUfuAfaAf gAfL96 119 2 A-131816.1 usCfsuUfuAfaAfcAfaacAfgUfcUfu Ufgsasa 123 eight AD65774 A-131831.1 AfsgsAfcUfgUfuUfGfUfuUfaAfaGfaCf uAfL96 119 3 A-131832.1 usAfsgUfcUfuUfaAfacaAfaCfaGfu Cfususu 123 9 AD65778 A-131807.1 GfsusUfuGfuUfuAfAfAfgAfcUfgGfgAf gAfL96 119 four A-131808.1 usCfsuCfcCfaGfuCfuuuAfaAfcAfa Af csasg 124 0 AD65773 A-131805.1 GfsgsGfgGfaGfgAfGfAfuUfaGfaUfuAf aAfL96 119 5 A-131806.1 usUfsuAfaUfcUfaAfucuCfcUfcCfc Cfcsasa 124 one AD65789 A-131825.1 GfsgsGfgAfgGfaGfAfUfuAfgAfuUfaAf aGfL96 119 6 A-131826.1 csUfsuUfaAfuCfuAfaucUfcCfuCfc Cfcscsa 124 2 AD65783 A-131809.1 GfsusUfgGfgGfgAfGfGfaGfaUfuAfgAf uUfL96 119 7 A-131810.1 asAfsuCfuAfaUfcUfccuCfcCfcCfa Af csusc 124 3 AD65754 A-131813.1 UfsusGfgGfgGfaGfGfAfgAfuUfaGfaUf uAfL96 119 eight A-131814.1 usAfsaUfcUfaAfuCfuccUfcCfcCfc Afascsu 124 four AD65779 A-131821.1 GfsgsGfaGfgAfgAfUfUfaGfaUfuAfaAf gAfL96 119 9 A-131822.1 usCfsuUfuAfaUfcUfaauCfuCfcUfc Cfcscsc 124 5 AD65791 A-131851.1 UfsusAfgAfuUfaAfAfGfgUfcUfuUfgUf aAfL96 120 0 A-131852.1 usUfsaCfaAfaGfaCfcuuUfaAfuCfu Afasusc 124 6 AD65760 A-131829.1 UfsasGfaUfuAfaAfGfGfuCfuUfuGfuAf cUfL96 120 one A-131830.1 asGfsuAfcAfaAfgAfccuUfuAfaUfc Ufasasu 124 7 AD65784 A-131823.1 AfsusUfaGfaUfuAfAfAfgGfuCfuUfuGf uAfL96 120 2 A-131824.1 usAfscAfaAfgAfcCfuuuAfaUfcUfa Afuscsu 124 eight AD65757 A-131853.1 GfsasGfgAfgAfuUfAfGfaUfuAfaAfgGf uAfL96 120 3 A-131854.1 usAfscCfuUfuAfaUfcuaAfuCfuCfc Ufcscsc 124 9 AD65775 A-131847.1 GfsgsAfcUfcUfuGfGfAfcUfcUfcUfgCf aAfL96 120 four A-131848.1 usUfsgCfaGfaGfaGfuccAfaGfaGfu Cfcsusc 125 0 AD65780 A-131833.1 AfscsUfcUfuGfgAfCfUfcUfcUfgCfaAf uAfL96 120 5 A-131834.1 usAfsuUfgCfaGfaGfaguCfcAfaGfa Gfuscsc 125 one AD65756 A-131839.1 AfsgsAfuUfaAfaGfGfUfcUfuUfgUfaCf uAfL96 120 6 A-131840.1 usAfsgUfaCfaAfaGfaccUfuUfaAfu Cfusasa 125 2

Screening for a single dose of these duplexes was performed on Cos7 cells at 1 and 50 nM using the Dual-Glo® luciferase assay as described above. The results of the analyzes are presented in table. 24.

Table 24

HBV Single Dose Screening with Dual-Glo Luciferase® System Assay

Duplex ID 50 nM Standards oe deviation e 1 nM Standards oe deviation e AD-65776 20.1 1 4.21 40.79 1.89 AD-65782 26.3 1 3.10 61, 07 9, 16 AD-65792 43.3 1 5.24 61, 09 6, 02 AD-65781 25.7 7 3.66 39, 63 2.87 AD-64304 18.8 7 1.26 29, 72 3.37 AD-65771 17.1 6 1.78 37.55 2.20 AD-65758 31.7 4 8.26 65.77 11.05 AD-65777 59.7 6 11.15 77, 63 5.14

- 136 039127

AD-61567 17.6 9 5.29 26, 45 5, 66 AD-65772 58.0 7 9, 67 75, 66 4, 92 AD-65767 29, 6 5 1.60 39, 64 4.36 AD-65763 25.1 0 5.77 47.78 9, 99 AD-64281 39.0 7 6.80 51, 46 4.19 AD-64311 20.5 1 1.96 37.80 3.53 AD-65790 AD-65761 AD-65786 AD-657 8 5 AD-65787 AD-65770 AD-65766 AD-61555 50.4 1 13.3 0 12.4 5 36.8 7 27.9 7 22.6 7 31.4 4 18.4 3 7.00 4.38 3.51 6.04 5.73 5.39 3.35 10.83 70.30 21, 14 22, 62 51, 49 48.18 41, 48 50.25 22, 61 1.95 3, 49 0.33 4.18 7, 65 8.52 0.45 0.57 AD-65762 18.8 7 4.86 34.94 4.81 AD-65755 47.0 3 9.38 83, 19 9, 68 AD-65788 35.8 5 10.13 58.07 4.78 AD-65768 24.0 2 2.49 28.55 2.53 AD-61561 8.11 1.29 14.26 2.27 AD-65764 16.8 9 3.99 29, 10 1, 03 AD-65753 19.1 0 2.87 29.79 5.26 AD-65765 55.4 0 10.72 76, 93 8.79 AD-65769 19.2 4 4.47 23, 18 2.54 AD-65759 48.8 6 4.81 87.31 13.75 AD-65774 102, 27 12.33 100.7 9 3.24 AD-65778 64.3 9 2.60 80, 67 2.59 AD-65773 72.6 4 7.87 80, 80 4, 83 AD-65789 73.5 9 4.35 94.72 3.32 AD-65783 54.4 1 7.15 84.46 4.32 AD-65754 62.5 1 4.12 102.6 3 21, 42 AD-65779 47.4 0 7.51 76, 20 2.05 AD-65791 12.0 9 0.70 19, 19 3, 46 AD-65760 13.5 0 4.84 25.37 2.09 AD-65784 19.8 4 1.27 31, 04 3, 49 AD-65757 22.6 6 3.97 24.50 5.81 AD-65775 47.7 8 3.30 58.81 3, 05 AD-65780 29.1 0 2.87 42.85 2.73 AD-65756 10.4 9 1.62 19.95 2.58

Based on the results of these analyses, RNAi agents targeting five sites in the HBV ORF X (nucleotides 1551, 1577, 1580, 1806 and 1812 in GenBank accession number NC 003977.1) were selected for major optimization and additional agents were designed and synthesized. Such additional agents were evaluated in in vitro assays as described above. A detailed listing of additional unmodified sense and antisense strand sequences that target HBV ORF X is shown in Table 1. 25. A detailed listing of additional modified sense and antisense strand sequences that target HBV ORF X is shown in Table 2. 26.

Such iRNA-based agents have also been evaluated for in vivo efficacy using a mouse model of AAV-HBV (see, for example, Yang, et al. (2014) Cell and Mol Immunol 11:71). This mouse model is characterized by persistent HBV viremia after infection with a recombinant adeno-associated virus (AAV) carrying a replicable HBV gene. Liver expression of the HBV gene in these mice mimics human HBV infection, and such mice exhibit significant liver inflammation and liver damage, manifested as elevated ALT levels, fibrosis, and steatosis.

These AAV-HBV mice were dosed subcutaneously at a single 3 mg/kg dose of AD-66808, AD-66809, AD66810, AD-66811, AD-66812, AD-66813, AD-66814, AD-66815, AD-66816 and AD- 66817 and determined the level of HBsAg in the serum of animals before dosing and on days 14/15 after dosing. The results of these experiments are shown in Fig. 2 and in table. 27 and they demonstrate that serum HBsAg levels decreased after a single administration of such agents. In table. 27 also shows the results of single dose screening on Cos7 cells transfected with the indicated HBV iRNAs by the Dual-Glo® luciferase assay as described above for the same RNAi agents. Data are expressed as percent residual mRNA compared to the negative control at 24 h.

Table 25

Unmodified antisense and sense sequences of HBV ORF X

Duplex ID Semantic sequence, unmodified (5'-3') SEQ ID NO: Antisense sequence, unmodified (5'-3') SEQ ID NO: AD-668 0 8 GUCUGUGCCUUCU CAU CUA 1207 UAGAUGAGAAGGCACAGACUU 1263 AD-668 0 9 GUCUGUGCCUUCU CAU CUA 1208 UAGAUGAGAAGGCACAGACUU 1264 AD-66810 GUGUGCACUUCGCUUCACA 1209 UGUGAAGCGAAGUGCACACUU 1265 AD-66811 GUGUGCACUUCGCUUCACA 1210 UGUGAAGCGAAGUGCACACUU 1266 AD-66812 UGUGCACUUCGCUUCACCUCU 1211 AGAGGUGAAGCGAAGUGCACAUU 1267 AD-66813 UGUGCACUUCGCUUCACCUCU 1212 AGAGGUGAAGCGAAGUGCACAUU 1268 AD-66814 CACCAGCACCAUGCAACUUUU 1213 AAAAGUUGCAUGGUGCUGGUGUU 1269 AD-66815 CACCAGCACCAUGCAACUUUU 1214 AAAAGUUGCAUGGUGCUGGUGUU 1270 AD-66816 САС CAU GCAACUUUUU САС CU 1215 AGGUGAAAAAGUUGCAUGGUGUU 1271 AD-66817 САС CAU GCAACUUUUU САС CU 1216 AGGUGAAAAAGUUGCAUGGUGUU 1272

Table 26

Modified HBV ORF X Antisense and Sense Sequences

Duplex ID Semantic sequence modified (5'-3') SEQ ID NO: Antisense sequence modified (5'-3') SEQ ID NO: AD-668 0 8 gsuscuGfuGfCfCfuucucucaucuaL96 1273 usAfsgauGfaGfAfaggcAfcAfgacsusu 1283 AD-668 0 9 gsuscuGfuGfCfCfuucucucaucuaL96 1274 UfsAf sgauGfaGfAfaggcAfcAfgacsus 1284 AD-66810 gsusguGfcAfCfUfucgcuucacaL96 1275 usGfsugaAfgCfGfaaguGfcAfcacsusu 1285 AD-66811 gsusguGfcAfCfUfucgcuucacaL96 1276 UfsGfsugaAfgCfGfaaguGfcAfcacsus u 1286 AD-66812 usgsugcaCfuUfCfGfcuucaccucuL96 1277 asGfsaggUfgAfAfgcgaAfgUfgcacasu 1287

- 138 039127

SU AD-66813 usgsugcaCfuUfCfGfcuucaccucuL96 1278 AfsGfsaggUfgAfAfgcgaAfgUfgcacas usu 1288 AD-66814 csasccagCfaCfCfAfugcaacuuuuL96 1279 asAf saagUfuGfCfauggUfgCfuggugsu SU 1289 AD-66815 csasccagCfaCfCfAfugcaacuuuuL96 1280 AfsAfsaagUfuGfCfauggUfgCfuggugs usu 1290 AD-66816 csasccauGfcAfAfCfuuuuucaccuL96 1281 asGfsgugAfaAfAfaguuGfcAfuggugsu SU 1291 AD-66817 csasccauGfcAfAfCfuuuuucaccuL96 1282 AfsGfsgugAfaAfAfaguuGfcAfuggugs usu 1292

Table 27

Site (number of vRNA ¹ ) Duplex ID IC ₅₀ in vitro Luc. HBV (nM) KD log ₁₀ HBsAg In vivo at 3 mg/kg 1551(4) AD-66808 0.187 2.4 AD-66809 0.014 1.46 1577(4) AD-66810 0.290 1.7 AD-66811 0.02 9 1.3 1580 (4) AD-66812 0.795 2.19 AD-66813 0.074 »1.14 1806(4) AD-66814 0.0002 1.5 AD-66815 0.0001 »1.56 1812(4) AD-66816 0.047 1.61 AD-66817 0.0001 1.60

¹ number of silencing viral RNAs.

Example 6 In vivo screening for siRNA duplexes.

A subset of iRNA-based core agents were evaluated for in vivo efficacy using the AAV-HBV mouse model described above. AAV-HBV mice were dosed with a single dose of 3 mg/kg of AD-66019, AD-65375, AD-65047, AD-65377, AD-66111, AD-65421, or AD-66110, and the level of HBsAg in the serum of animals was determined before administration dose and on days 5 and 10 post-dose. As a control, AAV-HBV mice were dosed with 3 mg/kg dsRNA targeting mouse/rat transthyretin (mrTTR). The results of these experiments are shown in Fig.

and they demonstrate that serum HBsAg levels decreased after a single administration of such agents.

In FIG. 4 is a graph showing the results of pre-dose HBsAg percentage determination, and the percentage of HBsAg that persisted on days 5 and 10 in these animals following a single dose of 3 mg/kg was also determined. The results of these experiments are shown in Fig. 4. In FIG. Figure 4 also depicts the percentage of HBsAG that remains on day 10 post-dose versus the percentage of HBsAG that remains on day 10 post-dose in an animal treated with 3 mg/kg of control dsRNA targeting mouse/rat transthyretin (mrTTR) .

Based at least in part on the results of the in vitro and in vivo assays described above, AD65403, which inhibits 3 HBV RNAs, and AD-66810, which inhibits gene X, were selected as drug candidates (DCs) for use alone or in combination. combination therapy.

In FIG. 5 demonstrates that in a mouse model of AAV-HBV HBV infection, a single dose of AD65403 at 3 mg/kg results in a strong and specific knockdown of HBsAg. In particular, a single subcutaneous dose of AD-65403 at 3 mg/kg resulted in a 3.9 log ₁₀ reduction in HBsAg levels, with an average HBsAg reduction of 1.8 log ₁₀ 5-10 days after the single dose.

In FIG. 6A and 6B demonstrate that in a mouse model of AAV-HBV HBV infection, a single subcutaneous dose of AD-66810 at 0.3, 1, 3, or 9 mg/kg results in a strong and specific knockdown of HBsAg, especially at higher doses of AD-66810. The percentage decrease in serum HBsAg is shown on the standard scale in FIG. 6A and on the log ₁₀ scale in FIG. 6B. In FIG. 7 demonstrates that in a mouse model of AAV-HBV infection, HBV AD-66810 administered at three weekly subcutaneous doses of 3 mg/kg resulted in a strong and specific knockdown of HBsAg over a period exceeding 4 months.

Example 7 Treatment of HBV Infection with a Combination of HBV Targeting Agents.

A subset of the iRNA-based agents of the present invention were evaluated for in vivo efficacy using the AAV-HBV mouse model described above. AAV-HBV mice were administered one or more doses of AD-65403 and AD-66810, either alone or in combination with each other. Exemplary dosing regimens included a single cumulative dose of 3 mg/kg of an iRNA based agent that was AD-65403, AD-66810, or a combination of AD-65403 and AD-66810 (i.e., 1.5 mg/kg of each iRNA based agent). iRNA, for a total of 3 mg/kg iRNA-based agent administered as a mixture or as two separate doses); or a single dose of 0.3, 1, 3, or 9 mg/kg total dose of an iRNA based agent that is AD-65403, AD-66810, or a combination of AD-65403 and AD-66810. Exemplary multi-dose regimens include, for example, three weekly doses, once a week, using any of the dosage levels shown in the exemplary single dose regimens. An appropriate iRNA-based control agent was also introduced as a control, which is common in the art.

The HBsAg level was determined in the serum of the animals before dosing and at certain time intervals after dosing, for example, every five days after dosing until HBsAg levels returned to baseline in all animals. Administration of AD-65403, AD-66810, or a combination of AD-65403 and AD-66810 results in a sustained and specific knockdown of HBsAg in serum.

Example 8 Treatment of HDV Infection with iRNA Based Agents Targeting Hepatitis B Virus.

Delta hepatitis virus (HDV) is a defective RNA virus that needs the help of HBV to replicate and assemble new virions. Therefore, HDV becomes infective only in the presence of an active HBV infection. The HDV genome contains only one actively transcribed open reading frame, which encodes two isoforms of the hepatitis delta antigen. Post-translational modifications of small and large delta antigens (S-HDAg and L-HDAg), including phosphorylation and isoprenylation, respectively, endow these antigens with specific properties. Effective HBV treatment will also lessen the severity of HDV infection.

The HDV model in chimpanzees is known. A subset of the iRNA-based agents of the present invention were evaluated for in vivo efficacy using a chimpanzee HDV model or other suitable HDV model. HDV-infected chimpanzees were administered one or more doses of AD-65403 and AD-66810, either alone or in combination with each other. Exemplary dosing regimens included a single 3 mg/kg total dose of an iRNA agent that is AD-65403, AD-66810, or a combination of AD-65403 and AD-66810 (i.e., 1.5 mg/kg of each iRNA agent , and a total of 3 mg/kg iRNA-based agent administered as a mixture or as two separate doses); or a single dose of 0.3, 1, 3, or 9 mg/kg total dose of an iRNA agent that is AD-65403, AD-66810, or a combination of AD-65403 and AD-66810. Exemplary multi-dose regimens include, for example, three weekly doses, once a week, using any of the dosage levels shown in the exemplary single dose regimens. The corresponding control iRNA was also introduced as a control, which is common in the art.

The level of one or more of S-HDAg, L-HDAg and HDV RNA, optionally in combination with HBsAg, was determined in the sera of animals before dosing and at regular intervals after dosing, for example, every five days to monitor antigen or RNA levels . Administration of AD-65403, AD-66810, or a combination of AD-65403 and AD-66810 resulted in a sustained and specific knockdown of serum HBsAg, resulting in a reduction in HDV severity, as demonstrated, for example, by a statistically significant reduction in one or more of S-HDAg, L-HDAg and HDV RNA. These results demonstrate that administration of either or both AD-65403 and AD-66810 is effective in treating HDV.

Equivalents.

Those skilled in the art will recognize or be able to determine, using only standard experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be embraced by the scope of the following claims.

Claims (15)

1. A double-stranded mRNA agent for inhibiting the expression of hepatitis B virus (HBV) in a cell, which contains a sense strand and an antisense strand, which form a double-stranded region, where the specified sense strand contains the sequence 5'-GUGUGCACUUCGCUUCACA-3' (SEQ ID NO: 39) , and said antisense strand contains the sequence 5'- UGUGAAGCGAAGUGCACACUU-3' (SEQ ID NO: 40), wherein all nucleotides of said sense strand and substantially all nucleotides of said antisense strand are modified nucleotides, wherein said sense strand is conjugated to a ligand attached to the 3' end, and where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker. 2. The double-stranded mRNA agent of claim 1, wherein at least one of said modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'- fluoro-modified nucleotide, 2'deoxy-modified nucleotide, locked nucleotide, non-locked nucleotide, conformationally restricted nucleotide, conformationally hindered by ethyl nucleotide, nucleotide with removed nitrogenous base, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2 '-C-alkyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide, morpholine nucleotide, phosphoramidate, nucleotide containing non-naturally occurring bases, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide , a cyclohexenyl-modified nucleotide, a nucleotide containing a phosphorothioate group, a nucleotide yes, containing a methylphosphonate group, a nucleotide containing a 5'-phosphate, and a nucleotide containing a 5'-phosphate mimetic. 3. The double-stranded mRNA agent according to claim 1, wherein the sense strand contains the sequence 5'gsusguGfcAfCfUfucgcuucaca-3' (SEQ ID NO: 41) and the antisense strand contains the sequence 5'usGfsugaAfgCfGfaaguGfcAfcacsusu-3' (SEQ ID NO: 42), where a, g, c and u are 2'-O-methyl-(2'OMe) A, (2'-OMe) G, (2'-OMe) C and (2'-OMe) U, respectively; Af, Cf, Gf or Uf are 2'-fluoro-A, 2'-fluoro C, 2'-fluoro G, 2'-fluoro U, respectively; and s is a phosphorothioate bond. 4. A double-stranded mRNA agent according to any one of claims 1 to 3, wherein the ligand has the following structures: 5. A double-stranded mRNA agent according to claim 4, which is conjugated to a ligand as follows: where X is O or S. 6. The double-stranded mRNA agent of claim 1, wherein the sense strand contains the sequence gsusguGfcAfCfUfucgcuucacaL96 (SEQ ID NO: 1275) and the antisense strand contains the sequence usGfsugaAfgCfGfaaguGfcAfcacsusu (SEQ ID NO: 1285), where a, g, c and u are 2'- O-methyl (2'OMe) A, 2'-OMe G, 2'-OMe C and 2'-OMe U, respectively; - 141 039127 Af, Cf, Gf and Uf are 2'-fluoro A, 2'-fluoro C, 2'-fluoro G and 2'-fluoro U, respectively; s is a phosphorothioate bond; and L96 is N-[tris-(GalNAc-alkyl)amidodecanoyl)]-4-hydroxyprolinol. 7. A pharmaceutical composition for inhibiting hepatitis B virus (HBV) gene expression or HBV replication in a cell, comprising a double-stranded mRNA agent according to any one of claims 1 to 6. 8. A method for inhibiting hepatitis B virus (HBV) gene expression or HBV replication in a cell, which includes: (a) bringing the cell into contact with a double-stranded mRNA agent according to any one of claims 1 to 6 or a pharmaceutical composition according to claim 7; and (b) maintaining the cell obtained in step (a) for a time period sufficient to achieve destruction of the HBV mRNA transcript. 9. The method of claim 8, wherein the HBV gene is selected from the group consisting of C, X, P, S, and combinations thereof. 10. The method of claim 8, wherein the inhibition of HBV gene expression or replication is at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100% . 11. A method of reducing hepatitis B virus (HBV) viral load in a subject, comprising administering to the subject a therapeutically effective amount of a double-stranded RNAi agent according to any one of claims 1-6 or a pharmaceutical composition according to claim 7. 12. A method of treating a subject with hepatitis B virus (HBV) infection, comprising administering to the subject a therapeutically effective amount of a double-stranded RNAi agent according to any one of claims 1 to 6 or a pharmaceutical composition according to claim 7. 13. The method according to claim 11 or 12, where the double-stranded mRNA agent is administered at a dose of 0.01 to 10 mg/kg, 0.5 to 50 mg/kg, 10 to 30 mg/kg, 3, 10 mg/kg; or in a fixed dose of 50 to 200 mg. 14. The method of any one of claims 11-13, wherein the double-stranded mRNA agent is administered subcutaneously or intravenously. 15. The method according to any one of claims 11-14, further comprising administering to the subject an additional therapeutic agent, where the additional therapeutic agent is an antiviral agent, a reverse transcriptase inhibitor (for example, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide, lamivudine, adefovir dipivoxil, entecavir (ETV), telbivudine, and AGX-1009), an immunostimulant (eg, pegylated interferon alfa-2a (PEG-IFN-a2a), interferon alfa2b, recombinant human interleukin-7, and a Toll-like receptor 7 (TLR7) agonist), therapeutic a vaccine, a viral entry inhibitor, an oligonucleotide that inhibits the secretion or release of HbsAg, a capsid inhibitor, an inhibitor of HBV covalently closed circular (ccDNA) formation, and any combination of the foregoing.