CN103275971A - RNA interference targets for hepatitis b virus (HBV) infection treatment - Google Patents

Abstract

The invention relates to 42 different hepatitis b virus (HBV)-targeting RNA interference targets for HBV infection treatment. The RNA interference targets can be used for preparation of a drug for HBV infection treatment. The invention provides recombinant expression vectors for expression of HBV-targeting siRNA and/or miRNA and/or ribozyme and/or antisense oligonucleotide. The invention relates to cells which can inhibit HBV gene expression and can express and/or be introduced with the siRNA and/or the miRNA and/or the ribozyme and/or the antisense oligonucleotide and/or a drug obtained according to the RNA interference targets.

Description

The RNA disturbance target point that can be used for treating hepatitis B virus infection

The application is to be that June 13, application number in 2008 are dividing an application of 200810110686.4 application of the same name the applying date.

Technical field

The present invention relates generally to molecular biology, cytobiology and field of gene.More specifically, the RNA that the present invention relates to can be used for treating hepatitis B virus infection disturbs 42 target spots of (RNAi) and uses the recombinant expression vector of these target spots and use the medicine that can be used for treating hepatitis B virus infection and the method that these target spots obtain in every way.

Background technology

It is one of most important public health problem in the whole world that hepatitis B virus (Hepatitis B virus) infects.HBV infects the relative disease cause and comprises acute or chronic hepatitis B, and is further developed the liver cirrhosis (HC), hepatocellular carcinoma (HCC) etc. of initiation by chronic hepatitis B.The wide range that HBV infects, the whole world has 400,000,000 HBV the infecteds approximately at present, and about 2,000,000,000 people infected HBV.Have some to develop into CHB among the Chronic HBV carrier, part patient is developed into HC, HCC, and the annual number dead because HBV infects surpasses 1,000,000 (Don Ganem etc., New England's medical science,, 35 volumes: the 1118-1129 page or leaf) in 2004.China is that HBV infects the district occurred frequently, and it is 9.75% that the HBV infection rate is about 56.7%, HBV virus carrying rate, and about 1.2 hundred million people carry HBV(1992-1995 whole nation stream for a long time and transfer).In various virus type hepatitis, the harm of the human health of HBV is the most serious.Along with the appearance of HBV vaccine in nineteen eighty-two, the infection rate of HBV has obvious reduction, and the appearance of antiviral simultaneously also makes the treatment of hepatitis B obtain certain progress.Yet because HBV carrier quantity is huge, and present antiviral still can't effect a radical cure HBV and infect, and therefore will have a large amount of HBV carrier to face the danger that may develop into liver cirrhosis and hepatocellular carcinoma.Therefore, press for the new treatment means of development to tackle the threat of HBV.

RNA disturbs (RNA interference, RNAi) be a kind of by double-stranded RNA (double-stranded RNA, dsRNA) mechanism of Jie Dao intracellular sequence-specific inhibition of gene expression, be in nematode, to carry out genetic expression in 1998 to suppress to be proposed (Fire A etc. first in the research, nature, 1998,391 volumes: the 806-811 page or leaf).After this, discover that further RNAi extensively is present in nearly all eukaryote such as higher mammal and fungi, Arabidopis thaliana, hydra, turbellarian worm, trypanosome, zebra fish, be the mechanism of a kind of ubiquity and the inhibition of gene expression of guarding, can play effect (Dykxhoorn DM etc. such as regulate gene expression, antiviral invasion, the activity of inhibition transposon, nature molecular cytobiology summary, 2003,4 volumes: the 457-467 page or leaf).The mechanism of RNAi effect is at present illustrated substantially: endogenous or dsRNA molecule that external source produces in tenuigenin by the Dicer of genus RNA enzyme III cut into siRNA (small interfering RNA, siRNA).Typical siRNA constitutional features is: 5' holds phosphorylation, and the 3' end is the outstanding 2-3nt of symmetry and hydroxyl, and length is the dsRNA of 19-23nt.The silencing complex that siRNA molecule and RNA induce (RNA-inducing silencing complex, protein complexes RISC) carries out combination, and RISC has helicase and endonuclease activity.The siRNA molecule in complex body by depolymerization, wherein antisense strand is combined by basepairing rule with the said target mrna that can match, and guide the RISC of combination with it that said target mrna is being held the position enzymolysis of 10nt with the middle part, land of antisense strand apart from 5', thereby suppress target gene expression.The method that obtains siRNA at present mainly contains: can express bobby pin RNA(short hairpin RNA, plasmid shRNA) and recombinant viral vector, chemical synthesis process, in-vitro transcription etc.

At present, the RNAi technology has demonstrated good prospects for application in the study on prevention that comprises diseases such as hepatitis b virus infected virus disease and tumour.Study display target can suppress HBV in expression (Konishi M etc., Hepatology,, 38 volumes: the 842-850 page or leaf) in 2003 with virogene of copying from the human hepatoma cell strain of vitro culture to the siRNA of HBV mRNA.Because the pathogenesis of HBV is comparatively complicated, reach effective therapeutic purpose and must efficiently suppress virus replication and genetic expression.Yet, be not that all meet the RNAi target spot that conventional design requires and can both effectively suppress target gene expression, the inhibition efficient between different target spots respectively has difference.Therefore, select to obtain the suitable high RNAi target spot that suppresses efficient that has and become the important factor whether the RNAi technology can be successfully applied to anti-HBV treatment.Select suitable R NAi target spot to take all factors into consideration from aspects such as constitutional features, inhibition efficient, non-human dna homologs.Spendable householder method comprises siRNA Autocad, RNA analysis of the molecular structure, nucleic acid sequence analysis comparison and the experiment experience etc. that proposed at present, and is verified by concrete inhibition assessment.

Be that the basis will be expected to develop novel more effective method that can be used for treating hepatitis B virus infection with the RNA perturbation technique, the methods for the treatment of of the type need provide the RNA disturbance target point that can effectively suppress hbv replication and expression.The present invention has satisfied this requirement, and the RNA disturbance target point that can be used for this purpose, recombinant expression vector etc. are provided.

Summary of the invention

The invention provides the RNA disturbance target point of target HBV, can be used for making up the expression plasmid, recombinant viral vector and the cell that comprise or imported the nucleic acid sequence encoding of the RNA disturbance target point that the present invention relates to, and can be used for obtaining to include the medicine that is obtained by the RNA disturbance target point that the present invention relates to.

But RNA disturbance target point target HBV provided by the invention can suppress copying and viral gene expression of HBV.RNA disturbance target point provided by the invention obtains by the following method: but the RNA interfered target sequence of selection design target HBV, make up shRNA by designing suitable primer, and be cloned into expression vector and obtain corresponding shRNA expression plasmid, this plasmid is carried out cotransfection experiments with the HBV infective cloned plasmids respectively, and the expression level by detecting HBV albumen and identifying suppresses specificity etc. and analyzes screening and obtain suitable R NA disturbance target point.

The invention provides the RNA interfered target sequence of (special) target HBV, this sequence is selected from:

(1) sequence shown in any one among the SEQ ID NO:1-42, perhaps

(2) with (1) in sequence have at least 70%(preferably at least 80%, 85%, 90%, 95%, 98% or higher) conforming sequence, perhaps

(3) under stringent condition or under the height stringent condition with (1) in the nucleotide sequence that can hybridize of sequence, perhaps

(4) with (1) middle sequence 1-3 (preferred 1-2, more preferably 1) different sequence of Nucleotide only arranged; Perhaps

(5) fragment of above-mentioned sequence or complementary sequence.

One concrete aspect, described RNA interfered target sequence can target HBV X, S, P or C gene.

In a preferred embodiment, described RNA disturbance target point is selected from siHBV7(SEQ ID NO:7) and siHBV12(SEQ ID NO:12).

RNA disturbance target point provided by the invention can be DNA or RNA sequence.

The present invention also provides nucleic acid construct or carrier such as the expression vector that comprises this RNA interfered target sequence.The recombinant expression vector that comprises this RNA interfered target sequence can be used for expressing siRNA and/or miRNA and/or ribozyme and/or the antisense oligonucleotide of target HBV of the present invention.

The present invention also provides the siRNA that can express target HBV of the present invention and/or the recombinant expression vector of miRNA and/or ribozyme and/or antisense oligonucleotide.

In one embodiment, recombinant expression vector of the present invention has following feature: comprised the siRNA of RNA interfered target sequence provided by the invention and/or the nucleic acid sequence encoding of miRNA and/or ribozyme and/or antisense oligonucleotide, these nucleic acid sequence encodings are operably connected with expression control sequenc, making can be at zooblast (mammalian cell particularly, as people's cell, preferred liver cell and stem cell) middle siRNA and/or miRNA and/or ribozyme and/or antisense oligonucleotide of expressing described target HBV.

Recombinant expression vector of the present invention can be plasmid vector or virus vector, for example retroviral vector, lentiviral vectors, adenovirus carrier, gland relevant viral vector etc.

The present invention also provides according to the expression that obtain, that can suppress the HBV corresponding gene of above-mentioned RNA interfered target sequence and/or the siRNA that copies and/or infect or miRNA or ribozyme or the antisense oligonucleotide of HBV.

The invention still further relates to isolated cells, it comprises: (1) RNA interfered target sequence of the present invention, perhaps (2) contain nucleic acid construct or carrier such as the expression vector of RNA interfered target sequence of the present invention.

The invention still further relates to conversion or transfection or the isolated cells of the recombinant expression vector of having transduceed, described recombinant expression vector can be expressed siRNA and/or miRNA and/or ribozyme and/or the antisense oligonucleotide of target HBV of the present invention.

The invention still further relates to a kind of cell (comprising for example preferred people's of Mammals cell of animal, preferred liver cell and stem cell) of transformation, it can express or include siRNA of the present invention or miRNA or ribozyme or antisense oligonucleotide.

The invention still further relates in genome or carry the cell of the nucleic acid sequence encoding of the RNA disturbance target point that the present invention relates to outside the genome, comprise that prokaryotic cell prokaryocyte is (as bacterial cell, as Bacillus coli cells) and eukaryotic cell (as the fungal cell, insect cell, vegetable cell, zooblast, preferred mammal such as people's cell, preferred liver cell and stem cell), it includes the nucleic acid sequence encoding (these nucleic acid sequence encodings can be operably connected with expression control sequenc, make to express described siRNA and/or miRNA and/or ribozyme and/or antisense oligonucleotide in this cell) of the RNA disturbance target point that the present invention relates to.

The invention still further relates to and imported by the siRNA of RNA disturbance target point acquisition provided by the invention and/or the cell of miRNA and/or ribozyme and/or antisense oligonucleotide, comprise that prokaryotic cell prokaryocyte is (as bacterial cell, as Bacillus coli cells) and eukaryotic cell (as the fungal cell, insect cell, vegetable cell, zooblast, preferred mammal such as people's cell, preferred liver cell and stem cell), it has been imported into and has included siRNA and/or miRNA and/or ribozyme and/or the antisense oligonucleotide that is obtained by the RNA disturbance target point that the present invention relates to.

In a preferred embodiment, can make cell obtain to suppress the ability of hbv replication and viral gene expression after the shRNA Expression element that contains the nucleic acid sequence encoding of the RNA disturbance target point that the present invention obtains imports liver cell.

The invention still further relates to the tissue and the biology that comprise above-mentioned cell, as animal.The invention still further relates to the pharmaceutical composition that comprises cell of the present invention.

On the other hand, the invention still further relates to the method for preparing engineered cells of the present invention, comprise with recombinant expression vector conversion of the present invention or transfection or transducer cell (comprising for example preferred people's of Mammals cell of animal, preferred liver cell and stem cell).

In one embodiment, described method comprises liver cell and the stem cell with recombinant viral vector of the present invention (lentiviral vectors for example, as slow virus Lenti-siHBV7 etc.) the preferred people of transduction Mammals.

At aforesaid method, described cell can be (or the exsomatizing) of separating, for example separate from the patient that infects HBV or normal individual, or at body, or the cell strain of vitro culture.

The invention still further relates to the combination of dna sequence dna, it comprises or is made up of first dna sequence dna of the just RNA fragment of coding and second dna sequence dna of encoding antisense RNA fragment, described just RNA fragment comprises the coded RNA sequence of target sequence of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can suppress copying of HBV expression of gene and/or HBV and/or infect.

The invention still further relates to small molecule disturbance ribonucleic acid (siRNA), it comprises just RNA fragment and sense-rna fragment, described just RNA fragment comprises the RNA sequence of target sequence coding of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can suppress copying of the expression of HBV corresponding gene and/or HBV and/or infects.

The invention still further relates to the siRNA that obtained by RNA disturbance target point provided by the invention and/or miRNA and/or ribozyme and/or antisense oligonucleotide infects or HBV patient's medicine and/or the purposes in the pharmaceutical composition at preparation treatment HBV.

The invention still further relates to the siRNA that obtained by RNA disturbance target point provided by the invention and/or miRNA and/or ribozyme and/or antisense oligonucleotide and suppress hbv replication or the medicine of HBV genetic expression and/or the purposes in the pharmaceutical composition in preparation.

The invention still further relates to RNA interfered target sequence of the present invention or nucleic acid construct or carrier or the recombinant expression vector purposes in preparation treatment HBV infection or HBV patient's medicine.

The invention still further relates to the cell (comprising for example preferred people's of Mammals cell of animal, preferred liver cell and stem cell) through transforming of the present invention infects or HBV patient's medicine and/or the purposes in the pharmaceutical composition at preparation treatment HBV.

The invention still further relates to the application of siRNA target sequence of the present invention in the anti-HBV medicine of screening.

The invention still further relates to treatment HBV infection or HBV patient's method, comprise to the individuality that needs are arranged giving RNA interfered target sequence of the present invention, nucleic acid construct or carrier, recombinant expression vector, siRNA or miRNA or ribozyme or antisense oligonucleotide or cell.

The invention still further relates to carrier of the present invention and cell and be used for the treatment of that HBV infects or HBV patient's purposes.

The invention still further relates to treatment HBV infection or HBV patient's method, comprise RNA interfered target sequence of the present invention from significant quantity to the patient, nucleic acid construct or carrier, siRNA or the miRNA or ribozyme or antisense oligonucleotide, expression vector, cell, dna sequence dna combination or the siRNA that treat.

The invention still further relates to the method that suppresses hbv replication or HBV genetic expression, comprise RNA interfered target sequence of the present invention from significant quantity to the individuality that needs are arranged, nucleic acid construct or carrier, siRNA or the miRNA or ribozyme or antisense oligonucleotide, expression vector, cell, dna sequence dna combination or the siRNA that give.

The invention still further relates to RNA interfered target sequence of the present invention, nucleic acid construct or carrier, siRNA or miRNA or ribozyme or antisense oligonucleotide, expression vector, cell, dna sequence dna combination or siRNA, be used for the treatment of HBV and infect or HBV patient, perhaps be used for suppressing hbv replication or HBV genetic expression.

The present invention will be described in more detail below in conjunction with accompanying drawing.From detailed description hereinafter, above-mentioned aspect of the present invention and other aspects of the present invention will be tangible.

Description of drawings

Fig. 1 is the structure schematic flow sheet of pSUPER-siRNA series expression plasmid.

The siRNA expression plasmid that Fig. 2 has shown our 42 RNA disturbance target points obtaining of target respectively with HBV infective cloned plasmids cotransfection experiments in to the inhibition of HBV genetic expression.The result shows that these RNA disturbance target points can suppress HBV.

Fig. 3 has shown that expression vector plasmid pSUPER-siHBV7, the HepG2-N10 cell after the pSUPER-siHBV12 transfection of the siRNA expressed sequence that carries target HBV can demonstrate the ability that suppresses the HBV expression, can suppress the expression of HBsAg in the HepG2-N10 cell.

Fig. 4 has shown that expression vector plasmid pSUPER-siHBV7, the HepG2-N10 cell after the pSUPER-siHBV12 transfection of the siRNA expressed sequence that carries target HBV can demonstrate the ability that suppresses hbv replication, can reduce the copy amount of HBV nucleic acid in the HepG2-N10 cells and supernatant.

Fig. 5 has shown that the HepG2-N10 cell after recombinant slow virus Lenti-siHBV7, the Lenti-siHBV12 of the siRNA expressed sequence that carries target HBV transduce can demonstrate the ability that suppresses the HBV expression, can suppress the expression of HBsAg in the HepG2-N10 cell.

Fig. 6 has shown that the HepG2-N10 cell after recombinant slow virus Lenti-siHBV7, the Lenti-siHBV12 of the siRNA expressed sequence that carries target HBV transduce can demonstrate the ability that suppresses hbv replication, can reduce the copy amount of HBV nucleic acid in the HepG2-N10 cells and supernatant.

Fig. 7 has shown that the mouse liver cell after expression vector plasmid pSUPER-siHBV7, the pSUPER-siHBV12 injection of the siRNA expressed sequence that carries target HBV is transduceed can demonstrate the ability that HBV expresses that suppresses, can suppress the expression of HBV infective cloned plasmids, reduce the level of HBsAg in serum.

Fig. 8 has shown that the mouse liver cell after expression vector plasmid pSUPER-siHBV7, the pSUPER-siHBV12 injection of the siRNA expressed sequence that carries target HBV is transduceed can demonstrate the ability that suppresses hbv replication, can suppress the expression of HBV infective cloned plasmids, reduce the copy amount of serum HBV nucleic acid.

Fig. 9 has shown the inhibition of siRNA HBV of the RNA disturbance target point of synthetic target HBV.HepG2-N10 cell after siR-HBV7 and the siR-HBV12 transfection can demonstrate and suppress the ability that HBV expresses, and can suppress the expression of HBsAg in the HepG2-N10 cell.

Figure 10 has shown the inhibition of siRNA HBV of the RNA disturbance target point of synthetic target HBV.HepG2-N10 cell after siR-HBV7 and the siR-HBV12 transfection can demonstrate the ability that suppresses hbv replication, can reduce the copy amount of HBV nucleic acid in the HepG2-N10 cells and supernatant.

Figure 11 shown synthetic and through 2 '-Ome(2 '-methoxyl group) inhibition of the siRNA HBV of the RNA disturbance target point of modification and/or phosphorylation modification and/or sterol-modified target HBV.HepG2-N10 cell after siRpo-HBV7, siRpo-HBV12, siRpoC-HBV7, the siRpoC-HBV12 transfection can demonstrate and suppress the ability that HBV expresses, and can suppress the expression of HBsAg in the HepG2-N10 cell.

Figure 12 has shown synthetic and through the inhibition of the siRNA HBV of the RNA disturbance target point of 2 '-OMe modification and/or phosphorylation modification and/or sterol-modified target HBV.HepG2-N10 cell after siRpo-HBV7, siRpo-HBV12, siRpoC-HBV7, the siRpoC-HBV12 transfection can demonstrate the ability that suppresses hbv replication, can reduce the copy amount of HBV nucleic acid in the HepG2-N10 cells and supernatant.

Embodiment

Unless stated otherwise, term of the present invention has the normally used implication in this area.

But the invention provides the RNA disturbance target point of target HBV, comprise following sequence or have 70%(at least preferably at least 80%, 85%, 90%, 95%, 98% or higher with it) any one or several sequence in the conforming sequence: SEQ ID NO:1-42.

Consistence (identity) can be calculated according to method well known in the art.A preferred example that is suitable for determining the algorithm of sequence identity and sequence similarity percentage ratio is BLAST and BLAST2.0 algorithm, and they are described in (1990) J.Mol.Biol.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and Altschul respectively.Adopt for example parameter described herein, BLAST and BLAST2.0 can be used for determining the sequence identity percentage ratio of polynucleotide of the present invention and polypeptide.Carrying out software that BLAST analyzes can be obtained by the public by state-run biotechnology information center.

In other embodiments, the polynucleotide sequence that the sequence of described RNA disturbance target point has under stringent condition or height stringent condition and polynucleotide provided herein or its fragment or its complementary sequence can be hybridized.Hybridization technique is known in biology field.Illustrative purposes for example, the condition of described hybridization is stringent condition, for example DNA of being combined with filter membrane about 45 ℃ of hybridization down in 6 * sodium chloride/sodium citrate (SSC) do one or repeatedly wash down in about 50-65 ℃ afterwards in 0.2 * SSC/0.1%SDS; The height stringent condition, for example nucleic acid of being combined with filter membrane about 45 ℃ of hybridization down in 6 * SSC, work one or repeatedly washing under about 68 ℃ in 0.1 * SSC/0.2%SDS afterwards; Or other tight hybridization conditions well known by persons skilled in the art is (referring to for example Ausubel, volumes such as F.M., 1989, Current Protocols in Molecular Biology, the 1st volume, Green Publishing Associates, Inc. and John Wiley﹠amp; Sons, Inc., New York, 6.3.1-6.3.6 and 2.10.3 page or leaf).

The invention still further relates under stringent condition or nucleotide sequence that arbitrary sequence of height stringent condition and SEQ ID NO:1-42 or its fragment or its complementary sequence can be hybridized.

In the present invention, siRNA and/or miRNA and/or ribozyme and/or antisense oligonucleotide can be designed to the target goal gene or regulate sequence, for example need to suppress gene or its regulating and controlling sequence of its expression, in order to suppress or reduce its expression.At gene or its regulating and controlling sequence can be any gene or its regulating and controlling sequence that need to suppress or reduce its expression, for example from pathogenic agent or that participate in the cancer formation and development those, target HBV particularly.SiRNA of the present invention, miRNA, ribozyme and antisense oligonucleotide can design according to ordinary method.

" siRNA, the miRNA, ribozyme and the antisense oligonucleotide that obtain according to RNA interfered target sequence of the present invention " refers to by design and expresses or siRNA, miRNA, ribozyme and antisense oligonucleotide that mode obtains such as design is synthetic, its target sequence that acts on (can be DNA or RNA sequence) for or include the RNA interfered target sequence that the present invention relates to.

But the conventional design method reference of siRNA (as: Reynolds A etc., Nature Biotechnol,, 22 volumes: 326-330) or the description among the open source information of company's sites such as Amhion, Qiagen or the embodiment 1 in 2004.But conventional design method reference (the Lo HL etc. of miRNA, gene therapy, 2007,14 volumes: the 1503-1512 page or leaf), select the method for target sequence similar to the method for design of siRNA, for example the positive-sense strand that contains target sequence and the corresponding antisense strand of design can be substituted on the pri-microRNA, make the miRNA of structure can stop the expression of the mRNA that contains target sequence.But conventional design method reference (the Haseloff J etc. of ribozyme, nature, 1988,334 volumes: the 585-591 page or leaf), for example the nucleotide sequence with the front and back sequence complementation of target sequence can be placed respectively before and after the sequence (as hammehead structure) of ribozyme conservative property core, make the ribozyme of structure can contain the nucleic acid of target sequence in the cutting of target sequence place.But the conventional design method reference of antisense oligonucleotide (Matveeva OV etc., nucleic acids research,, 31 volumes: the 4989-4994 page or leaf) in 2003.

The promotor that the present invention uses can be any promotor that is suitable for expressing goal gene in cell.Can be composing type, also can be induction type.Can also be combined promoter, as double-promoter.

The mode of connection that refers to the molecule that connects of " being operably connected " makes it possible to realize the function of expecting.For example, expression control sequenc with exercisable connection of gene coded sequence can realize that expression control sequenc is to the expression control action kou of gene coded sequence.

" expression control sequenc " is to realize the needed control sequence of genetic expression, is well known in the art.Usually must comprise promotor, usually also comprise also can comprising other sequences, as enhancer sequence by transcription termination sequence.Genetic expression refers to transcribe for siRNA, miRNA, ribozyme and antisense oligonucleotide etc., also can comprise and transcribe post-treatment; Typically refer to for protein coding sequence and to transcribe and to translate, produce ripe protein.

But the invention provides the RNA disturbance target point of target HBV and siRNA, miRNA, ribozyme and the antisense oligonucleotide that designs according to this target spot.SiRNA of the present invention, miRNA, ribozyme and antisense oligonucleotide comprise the phosphoric acid skeleton that constitutes siRNA, miRNA, ribozyme and antisense oligonucleotide and/or the modified outcome that component parts such as ribose and/or base are carried out chemically modified, modifying method is known in the art, can be thio-modification and/or sterol-modified and/or PEG modification and/or sugar-modified and/or LNA modification etc., can be referring to document: Dykxhoorn DM etc., biomedical engineering year summarizes, 2006,8 volumes: 377-402 page or leaf; Behlke MA etc., molecular therapy,, 13 volumes: 644-670 page or leaf in 2006.

In a specific embodiments, the present invention relates to small molecule disturbance ribonucleic acid (siRNA), it comprises just RNA fragment and sense-rna fragment, described just RNA fragment comprises the RNA sequence of RNA disturbance target point coding of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can suppress copying of the expression of HBV corresponding gene and/or HBV and/or infects.

In the present invention, term " small molecular core ribosomal ribonucleic acid ", " small molecule disturbance ribonucleic acid " or " siRNA " are used interchangeably, and they all refer to suppress the HBV expression of target gene, comprise the Yeast Nucleic Acid (RNA) of just RNA segment area and sense-rna segment area.

Relatively, the present invention also provides the combination of dna sequence dna, it comprises or is made up of first dna sequence dna of the just RNA fragment of coding and second dna sequence dna of encoding antisense RNA fragment, described just RNA fragment comprises the coded RNA sequence of target sequence of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can (disturb by RNA) and suppresses copying and/or infecting of HBV expression of gene and/or HBV.

At this respect of the present invention, described just RNA fragment may reside on two different RNA chains with the sense-rna fragment or is present on the RNA chain, for example comprises just RNA fragment and sense-rna fragment at a single stranded RNA molecule.

For example, siRNA of the present invention can be hair clip type single stranded RNA molecule, and wherein the complementary region between just RNA fragment and the sense-rna fragment forms the double-stranded RNA zone.

The length of justice RNA fragment and sense-rna fragment is preferably 8-50 Nucleotide, and preferred 10-30(is 15-27 more preferably, and 19-23 is as 19,20 or 21) individual.But also can be longer or shorter.

The complementary region of the double-stranded RNA that forms in just RNA fragment and sense-rna fragment has 10 (preferred 15, more preferably 18, as 19,20 or 21) base pairs at least.Preferably, the complementary region between described just RNA fragment and the sense-rna fragment contains 19,20 or 21 pairs of complementary bases.

In one embodiment, between just RNA fragment and sense-rna fragment, allowed a spot of mispairing, for example 1-5, as 1 or 2 or 3 or 4 base mispairings.In a preferred embodiment, just RNA fragment and sense-rna fragment are complementary fully.

In one embodiment, siRNA of the present invention is preferred for having 10-30(, 15-27, more preferably 19-23) to the double stranded rna molecule of base, have 10 (preferred 15, more preferably 18) base complementrity pairings in the described two strands at least.

In a preferred embodiment, the GC content of just RNA fragment and sense-rna fragment is 35%-75%, for example 40-60%, 45-55%, 48-52%, according to appointment 50%.

In a preferred embodiment, just RNA fragment and sense-rna fragment and known person genoid and genetic expression fragment do not have significant consistence.Significant consistence refers at least 60%, for example 70,80,90% consistence.

Preferably, the ratio that the Nucleotide quantity sum that the base of described just RNA fragment in 19 nucleotide sequences of 5 ' end beginning is the Nucleotide quantity of guanine (G) with base is cytosine(Cyt) (C) accounts for TT 19 Nucleotide quantity in addition of removing 3 ' end is that 35%-75%(is the G/C ratio), the mutant of described sense-rna fragment and an one Nucleotide and known person genoid and genetic expression fragment do not have remarkable consistence.

In an embodiment of recombinant expression vector of the present invention, recombinant expression vector of the present invention comprises the nucleic acid sequence encoding of the RNA disturbance target point that the present invention relates to, these nucleic acid sequence encodings are operably connected with expression control sequenc, making can be at zooblast (mammalian cell particularly, as people's cell, as liver cell or stem cell) in express as described in siRNA and/or miRNA and/or ribozyme and/or the antisense oligonucleotide of target HBV.

Similarly, in preparing the method for engineered cells of the present invention, can be by (comprising for example preferred people's of Mammals cell of animal with the expression vector conversion of nucleic acid sequence encoding that comprises the RNA disturbance target point that the present invention relates to or transfection or transducer cell, preferred liver cell and stem cell) obtain engineered cells of the present invention, as long as the cell that finally obtains comprises the nucleic acid sequence encoding of the RNA disturbance target point that the present invention relates to.

Also can include the siRNA that obtained by RNA disturbance target point provided by the invention and/or miRNA and/or ribozyme and/or antisense oligonucleotide and obtain engineered cells of the present invention by in described cell, importing, as long as the cell that obtains includes siRNA and/or miRNA and/or ribozyme and/or the antisense oligonucleotide that is obtained by RNA disturbance target point provided by the invention.

Recombinant expression vector of the present invention can be plasmid vector, or virus vector (for example retroviral vector, lentiviral vectors, adenovirus carrier, gland relevant viral vector etc.).

The cell of transformation of the present invention is the cell of Mammals (preferred people) preferably, preferred liver cell, preferred stem cell.Described cell carries the nucleic acid sequence encoding of the RNA disturbance target point that the present invention relates in genome or outside the genome, these nucleic acid sequence encodings are operably connected with expression control sequenc, make to express described siRNA and/or miRNA and/or ribozyme and/or antisense oligonucleotide in this cell.

Recombinant vectors of the present invention and engineered cells can be used for the treatment to the HBV infection.

In specific embodiment, relate to following content:

1. the RNA interfered target sequence of target HBV:

siHBV1： AGGACCCCTGCTCGTGTTACA （SEQ ID NO.1）

siHBV2： GGACCCCTGCTCGTGTTACAG （SEQ ID NO.2）

siHBV3： GACCCCTGCTCGTGTTACAGG （SEQ ID NO.3）

siHBV4： ACCCCTGCTCGTGTTACAGGC （SEQ ID NO.4）

siHBV5： AGAGTCTAGACTCGTGGTGGA （SEQ ID NO.5）

siHBV6： AGTCTAGACTCGTGGTGGACT （SEQ ID NO.6）

siHBV7： GAGTCTAGACTCGTGGTGGAC （SEQ ID NO.7）

siHBV8： GTCTAGACTCGTGGTGGACTT （SEQ ID NO.8）

siHBV9： AGACTCGTGGTGGACTTCTCT （SEQ ID NO.9）

siHBV10： GACTCGTGGTGGACTTCTCTC （SEQ ID NO.10）

siHBV11： ACTCGTGGTGGACTTCTCTCA （SEQ ID NO.11）

siHBV12： GATGTGTCTGCGGCGTTTTAT （SEQ ID NO.12）

siHBV13： GGATGTGTCTGCGGCGTTTTA （SEQ ID NO.13）

siHBV14： ATGTGTCTGCGGCGTTTTATC （SEQ ID NO.14）

siHBV15： GTGTCTGCGGCGTTTTATCAT （SEQ ID NO.15）

siHBV16： ATCCTGCTGCTATGCCTCATC （SEQ ID NO.16）

siHBV17： GCTGCTATGCCTCATCTTCTT （SEQ ID NO.17）

siHBV18： AAGGTATGTTGCCCGTTTGTC （SEQ ID NO.18）

siHBV19： AGGTATGTTGCCCGTTTGTCC （SEQ ID NO.19）

siHBV20： GGTATGTTGCCCGTTTGTCCT （SEQ ID NO.20）

siHBV21： GTATGTTGCCCGTTTGTCCTC （SEQ ID NO.21）

siHBV22： ATGTTGCCCGTTTGTCCTCTA （SEQ ID NO.22）

siHBV23： GCCGATCCATACTGCGGAACT （SEQ ID NO.23）

siHBV24： GTGTGCACTTCGCTTCACCTC （SEQ ID NO.24）

siHBV25： GTGCACTTCGCTTCACCTCTG （SEQ ID NO.25）

siHBV26： GCACTTCGCTTCACCTCTGCA （SEQ ID NO.26）

siHBV27： ACTTCGCTTCACCTCTGCACG （SEQ ID NO.27）

siHBV28： GGAGGCTGTAGGCATAAATTG （SEQ ID NO.28）

siHBV29： GAGGCTGTAGGCATAAATTGG （SEQ ID NO.29）

siHBV30： AGGCTGTAGGCATAAATTGGT （SEQ ID NO.30）

siHBV31： AAGCCTCCAAGCTGTGCCTTG （SEQ ID NO.31）

siHBV32： AGCCTCCAAGCTGTGCCTTGG （SEQ ID NO.32）

siHBV33： AGAAGAAGAACTCCCTCGCCT （SEQ ID NO.33）

siHBV34： GAAGAAGAACTCCCTCGCCTC （SEQ ID NO.34）

siHBV35： AAGAAGAACTCCCTCGCCTCG （SEQ ID NO.35）

siHBV36： AGAAGAACTCCCTCGCCTCGC （SEQ ID NO.36）

siHBV37： GAAGAAGAACTCCCTCGCCTC （SEQ ID NO.37）

siHBV38： AAGAACTCCCTCGCCTCGCAG （SEQ ID NO.38）

siHBV39： AGAACTCCCTCGCCTCGCAGA （SEQ ID NO.39）

siHBV40： GAACTCCCTCGCCTCGCAGAC （SEQ ID NO.40）

siHBV41： GATCCATACTGCGGAACTCCT （SEQ ID NO.41）

siHBV42： AACTCCCTCGCCTCGCAGACG （SEQ ID NO.42）

2. expression vector, the preferred virus carrier can be used for transforming liver cell or stem cell.

Can express the recombinant viral vector of the ribozyme of single or multiple siRNAs and/or miRNAs and/or target HBV.

The application of this virus vector on liver cell and/or stem cell. can be used for the molecule of the anti-HBV of stably express, as can be in liver cell and/or stem cell the siRNA of specific blockage hbv replication.

3. the cell of Gai Zaoing, as liver cell and stem cell, it includes the nucleic acid sequence encoding of the RNA disturbance target point that the present invention relates to, and can express described siRNA and/or miRNA and/or ribozyme and/or antisense oligonucleotide; Or be imported into siRNA and/or miRNA and/or ribozyme and/or the antisense oligonucleotide that is obtained by RNA disturbance target point provided by the invention.

The sequence of RNA disturbance target point (SEQ ID NO:1-42)

Embodiment

Design and the structure of the siRNA expression vector plasmid of embodiment 1. target HBV

The design of the RNA interfered target sequence of target HBV: be target sequence with the HBV reference sequences, select the good zone of conservative property to go on foot and moves design siRNA sequence; The siRNA sequence that primary election obtains is carried out the BLAST retrieval in GenBank, select to have the different sequence of 3 or 3 above bases as candidate sequence with non-target sequence.

The structure of siRNA expression plasmid: in the present embodiment, be the expression vector that example makes up siRNA with pSUPER carrier (the Cat.No VEC-PBS-0001/0002 of oligoengine company), concrete building process can make up the visible synoptic diagram 1 of concise and to the point flow process referring to the pSUPER carrier experiment guide (www.oligoengine.com) of the said firm.The synthetic primer that has the RNA interference sequence respectively is connected to pSUPER carrier through Bgl II and Hind III double digestion with complementary primer after anneal, cut and check order through enzyme and identify and obtain correct siRNA expression plasmid.

The structure of contrast siRNA expression plasmid: the concrete sequence of siRNA sequence siRNA-luc(with special target luciferase gene is 5 '-GTGCGCTGCTGGTGCCAAC-3 ') and the concrete sequence of irrelevant siRNA sequence siRNA-Nk(that is not complementary with HBV and Human genome be 5 '-TGCATCGGAAAATAGATGT-3 ') in contrast.Build up on the pSUPER carrier by the aforesaid method synthetic primer, cut and check order through enzyme and obtain corresponding siRNA expression plasmid pSUPER-luc and pSUPER-Nk respectively after identifying.

The screening of embodiment 2. cotransfection experiments obtains to suppress the RNA disturbance target point of HBV

(this plasmid comprises about 1.4 times of HBV genome (GenBank accession number: AY707087) to the pN31-N10 plasmid.Construction process is summarized as follows: after mammalian cell expression vector plasmid pCDNA3.1 (+) (the Cat.No V790-20 of Invitrogen company) cuts with the SpeI enzyme, reclaim carrier from successively win plasmid pN31.Respectively with N1f(ACT AGT GGA TCC TTC GCG GGA CGT CC)/N1r(GAA TTC CAC TGC ATG GCC TGA G), N2f(GAA TTC CAC TGC CTT CCA CC)/N2r(GAT ATC CAC ATT GTG TAA ATG G), N3f(GAT ATC CTG CCT TAA TGC CTT TG)/N3r(GGG CCC ACA AAT TGT TGA CAC C) these 3 pairs of primers carry out pcr amplification to the HBV genome, product is cloned into the T carrier respectively and obtains pTN1, pTN2, pTN3.PTN3 cuts fragment that the back obtains and pN31 with EcoRV and ApaI enzyme and is connected acquisition pN31-N3 through the carrier of EcoRV and the ApaI enzyme is cut back recovery.Be connected acquisition pN31-N1N3 with SpeI with the carrier that the EcoRI enzyme is cut the pN31-N3 recovery with the fragment that the EcoRI enzyme is cut the pTN1 recovery with SpeI.PTN2 cuts the back with EcoRI and EcoRV enzyme and reclaims fragment, be connected with carrier that pN31-N1N3 reclaims behind EcoRI and EcoRV double digestion and obtain pN31-N10) be the HBV infective cloned plasmids, (as people liver derived cell HepG2 cell, huh7 cell etc.) have the ability that can express HBV viral protein and virus particle behind the suitable mammalian cell of transfection.HBsAg is the membranin of HBV, can reflect by the content that detects the HBsAg albumen in the cell conditioned medium also to be proportionate the expression level of viral protein and virus particle with virus titer.Therefore can with the siRNA expression plasmid respectively with HBV infective cloned plasmids (pN31-N10 plasmid, also can use other HBV infective cloned plasmids) in the Huh-7 cell, carry out cotransfection experiments, come that by the expression level that detects the HBsAg albumen of cell behind the cotransfection different siRNA are suppressed HBV and express the efficient that copies and test.

Huh-7 cell (Japanese Collection of Research Bioresources, JCRB0403) be incubated in the 24 porocyte culture plates, substratum is that the DMEM substratum (adds 10%FBS, 2mM L-glutamine, 0.1mM MEM Non-Essential Amino Acids and 1%penicillin-streptomycin), converge rate and be about 70%.The siRNA expression plasmid of every porocyte transfection 0.1 μ g pN31-N10 plasmid and 1 μ g behind the 12h, transfection reagent is Lipofectamine2000(Invitrogen Cat.No11668-027), transfection method is referring to the operational guidance of this reagent.Collecting cell culture supernatant respectively behind cotransfection 48h detects the activity of HBsAg in the cells and supernatant or HBeAg albumen with HBsAg protein detection kit (Beijing ten thousand Thailands, the accurate word S10980090 of traditional Chinese medicines) or HBeAg protein detection kit (Beijing ten thousand Thailands, the accurate word S10980088 of traditional Chinese medicines) behind gradient dilution.With cotransfection HBsAg in the culture supernatant of Huh-7 cell of contrast siRNA expression plasmid and HBV infective cloned plasmids or the activity of HBeAg albumen be contrast, calculate the inhibition efficient of the HBV of each siRNA.By relatively, 42 RNA disturbance target points that can suppress HBV have been obtained.Accompanying drawing 2 has shown respectively with these 42 RNA interfered target sequences and has made up the siRNA expression plasmid that the obtains inhibition efficient to the HBV viral gene expression after being transfected into cell.

Be the RNA interfered target sequence that can be used for suppressing HBV that we obtain below:

siHBV1： AGGACCCCTGCTCGTGTTACA （SEQ ID NO.1）

siHBV2： GGACCCCTGCTCGTGTTACAG （SEQ ID NO.2）

siHBV3： GACCCCTGCTCGTGTTACAGG （SEQ ID NO.3）

siHBV4： ACCCCTGCTCGTGTTACAGGC （SEQ ID NO.4）

siHBV5： AGAGTCTAGACTCGTGGTGGA （SEQ ID NO.5）

siHBV6： AGTCTAGACTCGTGGTGGACT （SEQ ID NO.6）

siHBV7： GAGTCTAGACTCGTGGTGGAC （SEQ ID NO.7）

siHBV8： GTCTAGACTCGTGGTGGACTT （SEQ ID NO.8）

siHBV9： AGACTCGTGGTGGACTTCTCT （SEQ ID NO.9）

siHBV10： GACTCGTGGTGGACTTCTCTC （SEQ ID NO.10）

siHBV11： ACTCGTGGTGGACTTCTCTCA （SEQ ID NO.11）

siHBV12： GATGTGTCTGCGGCGTTTTAT （SEQ ID NO.12）

siHBV13： GGATGTGTCTGCGGCGTTTTA （SEQ ID NO.13）

siHBV14： ATGTGTCTGCGGCGTTTTATC （SEQ ID NO.14）

siHBV15： GTGTCTGCGGCGTTTTATCAT （SEQ ID NO.15）

siHBV16： ATCCTGCTGCTATGCCTCATC （SEQ ID NO.16）

siHBV17： GCTGCTATGCCTCATCTTCTT （SEQ ID NO.17）

siHBV18： AAGGTATGTTGCCCGTTTGTC （SEQ ID NO.18）

siHBV19： AGGTATGTTGCCCGTTTGTCC （SEQ ID NO.19）

siHBV20： GGTATGTTGCCCGTTTGTCCT （SEQ ID NO.20）

siHBV21： GTATGTTGCCCGTTTGTCCTC （SEQ ID NO.21）

siHBV22： ATGTTGCCCGTTTGTCCTCTA （SEQ ID NO.22）

siHBV23： GCCGATCCATACTGCGGAACT （SEQ ID NO.23）

siHBV24： GTGTGCACTTCGCTTCACCTC （SEQ ID NO.24）

siHBV25： GTGCACTTCGCTTCACCTCTG （SEQ ID NO.25）

siHBV26： GCACTTCGCTTCACCTCTGCA （SEQ ID NO.26）

siHBV27： ACTTCGCTTCACCTCTGCACG （SEQ ID NO.27）

siHBV28： GGAGGCTGTAGGCATAAATTG （SEQ ID NO.28）

siHBV29： GAGGCTGTAGGCATAAATTGG （SEQ ID NO.29）

siHBV30： AGGCTGTAGGCATAAATTGGT （SEQ ID NO.30）

siHBV31： AAGCCTCCAAGCTGTGCCTTG （SEQ ID NO.31）

siHBV32： AGCCTCCAAGCTGTGCCTTGG （SEQ ID NO.32）

siHBV33： AGAAGAAGAACTCCCTCGCCT （SEQ ID NO.33）

siHBV34： GAAGAAGAACTCCCTCGCCTC （SEQ ID NO.34）

siHBV35： AAGAAGAACTCCCTCGCCTCG （SEQ ID NO.35）

siHBV36： AGAAGAACTCCCTCGCCTCGC （SEQ ID NO.36）

siHBV37： GAAGAAGAACTCCCTCGCCTC （SEQ ID NO.37）

siHBV38： AAGAACTCCCTCGCCTCGCAG （SEQ ID NO.38）

siHBV39： AGAACTCCCTCGCCTCGCAGA （SEQ ID NO.39）

siHBV40： GAACTCCCTCGCCTCGCAGAC （SEQ ID NO.40）

siHBV41： GATCCATACTGCGGAACTCCT （SEQ ID NO.41）

siHBV42： AACTCCCTCGCCTCGCAGACG （SEQ ID NO.42）

By top experiment, we have proved that 42 RNA disturbance target points of the present invention can be used for suppressing the HBV expression of gene.

In following experiment, we have chosen siHBV7 from above-mentioned RNA disturbance target point, and siHBV12 is example, further make up respectively and can express target siHBV7, the recombinant viral vector of the siRNA of siHBV12.We can express target siHBV7 to make up, and the recombinant slow virus of the siRNA of siHBV12 is example, and construction process is seen embodiment 3 and embodiment 4.

Embodiment 3. expresses the structure of the recombinant virus expression vector of siRNA

We can express target siHBV7 to make up, and the recombinant slow virus expression vector of the siRNA of siHBV12 is example.

Expression vector: in this embodiment, the expression vector pDEST-MR(number of patent application of the slow virus system that we use: 200510112917.1; Publication number: CN1948475) comprised the expression cassette of being controlled by the H1 promotor that can be used for expressing siRNA.

The construction process of expression vector pDEST-siHBV7, pDEST-siHBV12:

Synthesize siHBV7, siHBV12 gene fragment (having comprised the RNA interfered target sequence siHBV7(SEQ ID NO:7 shown in the embodiment 2 here respectively), siHBV12(SEQ ID NO:12 respectively) as example, but also can comprise other RNA interfered target sequences provided by the invention), 5 ' end of fragment adds Age I site, and 3 ' end adds Sma I site; Gene fragment is connected with the pDEST-MR plasmid of cutting through same enzyme after Age I, Sma I enzyme are cut, and makes up and obtains expression vector pDEST-siHBV7, pDEST-siHBV12.

Embodiment 4. expresses the structure of the recombinant virus of siRNA

We can express target siHBV7 to make up, and the recombinant slow virus of the siRNA of siHBV12 is example.

Expression vector plasmid except the siRNA that can express target HBV, making up other required plasmid of recombinant slow virus is pLP1, pLP2, VSVG, buy from Invitrogen company, product are by name: pLenti4/V5-DEST Gateway Vector Kit, article No.: V469-10.

The preparation method of recombinant slow virus:

(1) with the CsCl-ethidium bromide density gradient centrifugation a large amount of extract four kinds of plasmid pVSVG, pLP1, pLP2, expression vector plasmid (as among this embodiment as pDEST-siHBV7 plasmid, the pDEST-siHBV12 plasmid of example) (extracting method is referring to " molecular cloning experiment guide ", J. Sa nurse Brooker D.W. Russell is outstanding, Science Press, 2002);

(2) (Invitrogen Catalog#R700-07) is incubated at (interpolation 10%FBS, 2mM L-glutamine, 0.1mM MEM Non-Essential Amino Acids and 1%penicillin-streptomycin) in the DMEM substratum to the 293FT cell;

(3) with the 293FT cell cultures on the Tissue Culture Plate of diameter 10cm, converge rate about 70%.Behind the 12h with the calcium phosphate transfection method mediate 10 μ g pLP1,10 μ g pLP2,10 μ g pVSVG, 20 μ g expression vector plasmids totally 4 kinds of plasmids carry out cotransfection (method be referring to " molecular cloning experiment guide ", J. Sa nurse Brooker D.W. Russell is outstanding, Science Press, 2002);

(4) collecting cell culture supernatant behind the transfection 48h, the membrane filtration of 0.45 μ m; With SW28 rotary head (BECKMAN company) with 25,000rpm at 4 ℃ of centrifugal 90min;

(5) supernatant discarded adds 500 μ L PBS dissolution precipitations;

(6) packing collection virus liquid, be stored in-80 ℃ standby.

Obtain to express respectively the recombinant slow virus of the siRNA of target siHBV7, siHBV12 thus, be called Lenti-siHBV7, Lenti-siHBV12.

The siRNA of embodiment 5. target HBV imports the HepG2-N10 cell strain to the restraining effect of HBV by the expression vector plasmid

The HepG2-N10 cell strain (Pan Jinshui etc., world Chinese digests magazine, and 2006,14 volumes: the 1172-1177 page or leaf) for the human liver cell source, carry the HBV genome, can express HBV antigen protein and HBV virus particle.We use the inhibition of the HBV of HepG2-N10 cell checking siRNA.

We with the expression vector plasmid of the siRNA that can express target HBV be example (in the present embodiment, we with expression vector plasmid pSUPER-siHBV7, the pSUPER-siHBV12 of the siRNA that can express target siHBV7, siHBV12 respectively as example, but can comprise that also other can express the expression vector plasmid of the siRNA of target RNA disturbance target point provided by the invention), the siRNA of target HBV is described by the mode of expression vector plasmid transfection cell, engineered cells makes cell obtain the ability that suppresses HBV genetic expression and copy.

Experimental technique: siRNA expression plasmid pSUPER-siHBV7, pSUPER-siHBV12 are carried out transfection experiment in HepG2-N10, come that with HBeAg protein-active and HBV DNA copy number different siRNA inhibition HBV are expressed the efficient that copies by the HBsAg in the cell conditioned medium after the detection transfection and test.HepG2-N10 is incubated at 24 porocyte culture plates, and substratum is DMEM substratum (adding 10%FBS, 2mM L-glutamine, 0.1mM MEM Non-Essential Amino Acids and 1%penicillin-streptomycin), converges rate and is about 80%.The siRNA expression plasmid of every porocyte transfection 2 μ g behind the 12h, transfection reagent is Lipofectamine2000(Invitrogen Cat.No11668-027), transfection method is referring to the operational guidance of this reagent.Difference collecting cell culture supernatant behind transfection 48h, behind gradient dilution, detect the activity of HBsAg albumen in the cells and supernatant with the HBsAg detection kit, and use the copy amount that hepatitis B virus (HBV) nucleic acid amplification (PCR) fluorescence quantitative kit (Shanghai Kehua Bio-engineering Co., Ltd, the accurate word S20030059 of traditional Chinese medicines) detects HBV DNA in the cells and supernatant.Experiment contrast has been the HepG2-N10 cell of untransfected and the transfection HepG2-N10 cell of contrast siRNA expression plasmid pSUPER-Nk.

The result as shown in Figure 3, Figure 4, the HepG2-N10 cell after pSUPER-siHBV7, the pSUPER-siHBV12 transfection all can demonstrate the ability that HBV expresses and copies that suppresses.This siRNA that shows anti-HBV in the cell behind the expression vector plasmid transfection of the siRNA expressed sequence that carries target HBV has obtained expression in these cells, thereby suppresses the expression of HBV and copy.

The siRNA of embodiment 6. target HBV imports the HepG2-N10 cell strain to the restraining effect of HBV by recombinant virus

We with the recombinant slow virus of the siRNA that can express target HBV be example (in the present embodiment, we with recombinant slow virus Lenti-siHBV7, the Lenti-siHBV12 of the siRNA that can express target siHBV7, siHBV12 respectively as example, but can comprise that also other can express the recombinant virus of the siRNA of target RNA disturbance target point provided by the invention), the siRNA of target HBV is described by the mode of recombinant virus transducer cell, engineered cells makes cell obtain the ability that suppresses HBV genetic expression and copy.

Experimental technique: slow virus Lenti-siHBV7, Lenti-siHBV12 change liquid with the moi=40 HepG2-N10 cell of transduceing respectively behind the centrifugal 60min of 600g; Have the siRNA Expression element sequence of contrast recombinant slow virus Lenti-luc(target lucifezase gene of siRNA Expression element of target luciferase gene with embodiment 1; Method according to embodiment 3 and 4 prepares this contrast virus) with moi=40 transduction HepG2-N10 cell, change liquid behind the centrifugal 60min of 600g; HepG2-N10 cell after the transduction is gathered cells and supernatant 37 ℃ of cultivations behind 72h, detect the content of HBsAg albumen in the cells and supernatant with the HBsAg protein detection kit.Simultaneously, use the copy amount that hbv nucleic acid amplification (PCR) fluorescence quantitative kit detects HBV DNA in the cells and supernatant.Experiment contrast is the HepG2-N10 cell of not transduction and the HepG2-N10 cell of contrast recombinant slow virus Lenti-luc transduction.

Result such as Fig. 5, shown in Figure 6, the HepG2-N10 cell after recombinant slow virus Lenti-siHBV7, the Lenti-siHBV12 transduction all can demonstrate the ability that HBV expresses and copies that suppresses.This siRNA that shows anti-HBV in the cell after the transduction of the recombinant slow virus of the siRNA expressed sequence that carries target HBV expresses in these cells, thereby suppresses the expression of HBV and copy.

The siRNA of embodiment 7. target HBV in the mouse model body to the restraining effect of HBV

Laboratory animal: SPF level Balb/c mouse was 7～8 ages in week, and body weight is about 18～22g.Every group 6, repeat 3 times.

In the present embodiment, we with expression vector pSUPER-siHBV7, the pSUPER-siHBV12 of the siRNA that can express target siHBV7, siHBV12 respectively as example, after the siRNA importing intravital mouse cell of target HBV is described, can make cell obtain to suppress the ability of HBV.

Experimental technique: with siRNA expression plasmid pSUPER-siHBV7(40 μ g/ only), pSUPER-siHBV12(40 μ g/ only), control plasmid pSUPER-Nk(40 μ g/ is only) carry out common injection with pN31-N10 plasmid (20 μ g/ are only) by mouse tail vein high-pressure injection method (hydrodynamic transfection) respectively, injection cumulative volume about 2ml injected in 5 seconds and finishes.Gather mice serum every day before injection and after the injection, with the content of HBsAg albumen in the HBsAg protein detection kit detection mice serum, detects the copy amount of HBV DNA in the mice serum with hbv nucleic acid amplification (PCR) fluorescence quantitative kit.Experiment contrast is normal Balb/c mouse and only injects the Balb/c mouse of pN31-N10 plasmid and inject pN31-N10 plasmid and the Balb/c mouse that contrasts siRNA expression plasmid pSUPER-Nk altogether.

Detected result (Fig. 7, Fig. 8) shows that the mouse of the expression plasmid of the siRNA of injection expression target HBV can suppress the expression of HBsAg, has also suppressed the HBV DNA carrying capacity in the mice serum simultaneously.This shows that the siRNA of the anti-HBV that produces in the cells in vivo after the transduction of the expression vector of the siRNA expressed sequence that carries target HBV can suppress the expression of HBV and copies.

The inhibition of the HBV of siRNA of embodiment 8. chemosynthesis

We have chosen siHBV7 from above-mentioned RNA disturbance target point, siHBV12 is example (having comprised the RNA interfered target sequence siHBV7(SEQ ID NO:7 shown in the embodiment 2 here respectively), siHBV12(SEQ ID NO:12) as example, but also can comprise other RNA interfered target sequences provided by the invention), synthesized and to have distinguished target siHBV7, the siRNA of siHBV12, the just RNA fragment of siRNA comprises target sequence siHBV7(SEQ ID NO:7 of the present invention respectively), siHBV12(SEQ ID NO:12) coded RNA sequence, the sense-rna fragment can form double-stranded RNA with just RNA fragment complementation, and (antisense strand and positive-sense strand are complementary fully in the present embodiment, but also can allow antisense strand and positive-sense strand that a spot of mispairing is arranged, as 1 or 2 or 3 or 4), add dTdT respectively at 3 ' end of just RNA fragment and sense-rna fragment.Above-mentioned siRNA is called after siR-HBV7 and siR-HBV12 respectively.Simultaneously, the siRNA(siR-Nk that has synthesized the irrelevant RNA disturbance target point siRNA-Nk that target is not complementary with HBV and Human genome) (sequence of siRNA-Nk is with embodiment 1) in contrast.

The synthetic method of siRNA is summarized as follows: adopt β-acetonitrile phosphorous acid amination synthesis method, use full-automatic dna synthesizer just RNA fragment and the sense-rna fragment of synthetic siRNA respectively, mixed in molar ratio such as synthetic good just RNA fragment and sense-rna fragment, through sex change, annealing process, obtain required siRNA at the PCR instrument.

Experimental technique: with synthetic siR-HBV7, siR-HBV12 and siR-Nk difference transfection HepG2-N10 cell, come that with HBeAg protein-active and HBV DNA copy number different siRNA inhibition HBV are expressed the efficient that copies by the HBsAg in the cell conditioned medium after the detection transfection and test.The HepG2-N10 cell cultures is converged rate and is about 80% in 24 porocyte culture plates.The siRNA of every porocyte transfection 50pM behind the 12h, transfection reagent is Lipofectamine2000, transfection method is referring to the operational guidance of this reagent.Difference collecting cell culture supernatant behind transfection 48h, detect the activity of HBsAg albumen in the cells and supernatant with the HBsAg detection kit, and use the copy amount that hbv nucleic acid amplification (PCR) fluorescence quantitative kit detects HBV DNA in the cells and supernatant.Experiment contrast has been the HepG2-N10 cell of untransfected and the transfection HepG2-N10 cell of contrast siR-Nk.

Result such as Fig. 9, shown in Figure 10 behind synthetic siR-HBV7, the siR-HBV12 transfection HepG2-N10 cell, all can suppress HBV and express and copy.

Embodiment 9. chemosynthesis are the inhibition of the modified HBV of siRNA also

We have chosen siHBV7 from above-mentioned RNA disturbance target point, siHBV12 is example (having comprised the RNA interfered target sequence siHBV7(SEQ ID NO:7 shown in the embodiment 2 here respectively), siHBV12(SEQ ID NO:12) as example, but also can comprise other RNA interfered target sequences provided by the invention), synthesized and to have distinguished target siHBV7, the siRNA of siHBV12, the just RNA fragment of siRNA comprises target sequence siHBV7(SEQ ID NO:7 of the present invention respectively), siHBV12(SEQ ID NO:12) coded RNA sequence, sense-rna fragment and just RNA fragment complementation form double-stranded RNA, and (antisense strand and positive-sense strand are complementary fully in the present embodiment, but also can allow antisense strand and positive-sense strand that a spot of mispairing is arranged, as 1 or 2 or 3 or 4), add dTdT respectively at 3 ' end of just RNA fragment and sense-rna fragment.Adopted different modification modes respectively in the building-up process simultaneously.Wherein, siRpo-HBV7 and siRpo-HBV12 modify (modification of 2 '-methoxyl group) and the difference target siHBV7 of phosphorylation modification, the siRNA(synthetic method of siHBV12 through 2 '-OMe: adopt β-acetonitrile phosphorous acid amination synthesis method, use full-automatic dna synthesizer just RNA fragment and the sense-rna fragment of synthetic siRNA respectively, wherein three bases of three bases of 5 ' of just RNA fragment and sense-rna fragment end and 3 ' end dTdT front are synthetic with the mononucleotide that 2 '-0Me modifies, and 5 ' terminal bases of sense-rna fragment is carried out phosphorylation and handled.Mixed in molar ratio such as synthetic good just RNA fragment and sense-rna fragment through sex change, annealing process, obtain required siRNA at the PCR instrument); SiRpoC-HBV7 and siRpoC-HBV12 are the same through the siRNA(synthetic method of 2 '-OMe modification and phosphorylation modification and sterol-modified difference target siHBV7, siHBV12, different places is when synthetic just RNA fragment, three bases of 3 ' end dTdT front are not carried out 2 '-0Me and are modified, as synthetic upholder, the base in 3 ' end dTdT front connects the cholesterol group by thiophosphatephosphorothioate with the Glass carrier that contains cholesterol-hexosamine-tetramethyleneimine (cholesterol-aminocaproic-acid-pyrrolidine) joint.All the other steps all method with above-mentioned synthetic siRpo-HBV7 and siRpo-HBV12 are identical).Simultaneously, synthesized respectively target not with HBV and Human genome be complementary irrelevant RNA disturbance target point siRNA-Nk's and through same siRNA(siRpo-Nk and the siRpoC-Nk that modifies) in contrast.Here comprised respectively the RNA interfered target sequence siHBV7(SEQ ID NO:7 shown in the target embodiment 2), siHBV12(SEQ ID NO:12) synthetic siRNA carry out 2 '-OMe modification and/or phosphorylation modification and/or sterol-modified as example, but can comprise that also the synthetic siRNA to other RNA interfered target sequences provided by the invention of target carries out the modification of other different modes.

Experimental technique: with synthetic siRpo-HBV7, siRpo-HBV12, siRpoC-HBV7, siRpoC-HBV12, siRpo-Nk, siRpoC-Nk difference transfection HepG2-N10 cell, come that with HBeAg protein-active and HBV DNA copy number different siRNA inhibition HBV are expressed the efficient that copies by the HBsAg in the cell conditioned medium after the detection transfection and test.The HepG2-N10 cell cultures is converged rate and is about 80% in 24 porocyte culture plates.The siRNA of every porocyte transfection 50pM behind the 12h, transfection reagent is Lipofectamine2000, transfection method is referring to the operational guidance of this reagent.Difference collecting cell culture supernatant behind transfection 48h, detect the activity of HBsAg in the cells and supernatant with the HBsAg detection kit, and use the copy amount that hbv nucleic acid amplification (PCR) fluorescence quantitative kit detects HBV DNA in the cells and supernatant.Experiment contrast has been the HepG2-N10 cell of untransfected and the transfection HepG2-N10 cell of contrast siRpo-Nk, siRpoC-Nk.

Result such as Figure 11, shown in Figure 12 after synthetic siRpo-HBV7, siRpo-HBV12, siRpoC-HBV7, siRpoC-HBV12 is transfected into the HepG2-N10 cell, all can suppresses HBV and express and copy.

Those skilled in the art should understand, although illustrative purposes this paper has described specific embodiments of the present invention for example, can carry out various modifications and without departing from the spirit and scope of the present invention to it.Therefore, specific embodiments of the present invention and embodiment should not be considered as limiting the scope of the invention.The present invention only is subjected to the restriction of claims.All documents of quoting among the application are all intactly incorporated this paper into as a reference.

Claims (21)

1. the RNA disturbance target point of target HBV, its sequence is selected from:

(1) sequence of SEQ ID NO.12; Perhaps

(2) complementary sequence of above-mentioned sequence.

2. the nucleic acid construct that comprises the RNA disturbance target point of claim 1.

3. the carrier that comprises the RNA disturbance target point of claim 1.

4. according to the expression that obtain, that can suppress the HBV corresponding gene of the described RNA disturbance target point of claim 1 and/or the siRNA that copies and/or infect of HBV, its sequence is GAUGUGUCUGCGGCGUUUUAU UUCAAGAGA AUAAAACGCCGCAGACACAUC UU.

5. recombinant expression vector, it can express the siRNA of claim 4.

6. the recombinant expression vector of claim 5, it comprises the nucleic acid sequence encoding of the siRNA of target HBV, and these nucleic acid sequence encodings are operably connected with expression control sequenc, make to express described siRNA in zooblast.

7. the recombinant expression vector of claim 6, wherein said zooblast is mammalian cell.

8. the recombinant expression vector of claim 7, wherein said mammalian cell is people's cell.

9. the recombinant expression vector of claim 6, wherein said zooblast is liver cell.

10. the recombinant expression vector of claim 5, it is plasmid vector or virus vector.

11. the recombinant expression vector of claim 10, wherein said virus vector is retroviral vector.

12. the recombinant expression vector of claim 11, wherein said retroviral vector is lentiviral vectors.

13. conversion or transfection or each the isolated cells of recombinant expression vector of claim 5-12 of having transduceed.

14. the cell of the transformation of a separation, it can express or include the siRNA of claim 4.

15. the cell of the transformation of claim 14, it carries the nucleic acid sequence encoding of the RNA disturbance target point described in the claim 1 in genome or outside the genome, these nucleic acid sequence encodings are operably connected with expression control sequenc, make to express described siRNA in this cell.

16. the cell of the transformation of claim 15, wherein said cell is mammalian cell.

17. the cell of the transformation of claim 16, wherein said mammalian cell are people's cells.

18. the cell of the transformation of claim 15, wherein said cell is liver cell.

19. each the method for cell of preparation claim 13-18 comprises each recombinant expression vector conversion or transfection or the transducer cell with claim 5-12.

20. the siRNA of claim 4 or claim 5-12 each recombinant expression vector or claim 13-18 each cell preparation treatment HBV infect or HBV patient's medicine in purposes.

21. each recombinant expression vector or each cell of claim 13-18 of the siRNA of claim 4 or claim 5-12 suppresses purposes in the medicine of hbv replication or HBV genetic expression in preparation.

Images