CN102604938B - RNA (ribonucleic acid) interference target points for inducing hepatocellular injury - Google Patents
RNA (ribonucleic acid) interference target points for inducing hepatocellular injury Download PDFInfo
- Publication number
- CN102604938B CN102604938B CN201210010355.XA CN201210010355A CN102604938B CN 102604938 B CN102604938 B CN 102604938B CN 201210010355 A CN201210010355 A CN 201210010355A CN 102604938 B CN102604938 B CN 102604938B
- Authority
- CN
- China
- Prior art keywords
- cell
- sirna
- rna
- fah
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to five different RNA (ribonucleic acid) interference target points of target FAH (fumaric acetylhydrolase) used for inducing hepatocellular injury. The RNA interference target points can be used for preparing a medicament or a composition for inhibiting FAH gene expression or inducing hepatocellular injury. The invention provides a siRNA recombinant vector capable of expressing the target FAH. The invention relates to a cell which has a capability of inhibiting FAH gene expression and can express and/or import siRNA and/or the medicament or composition obtained by the RNA interference targets provided by the invention.
Description
Invention field
The present invention relates generally to molecular biology, cytobiology and experimental zoology field.More specifically, the present invention relates to can be used for 5 RNA interference (RNAi) target spots of inducing hepatocyte damage and apply the recombinant expression vector of these target spots and the medicine or composition and the method that can be used for inducing hepatocyte damage that these target spots of application obtain in every way.
Background of invention
It is one of most important public health problem in the whole world that hepatitis B virus (Hepatitis B virus, HBV) infects.HBV infects the relative disease causing and comprises acute or chronic hepatitis B, and by chronic hepatitis B, is further developed liver cirrhosis (HC), hepatocellular carcinoma (HCC) of initiation etc.Because HBV is a kind of species specificity and the extremely strong DNA virus of tissue specificity, it infects people and High Primates animal, and do not infect mammals laboratory animal conventional in medical science, therefore need to set up a kind of effective, stable HBV infected animal model to meet the needs of current research.Building the chimeric HBV infecting mouse of people mouse model is an important research direction.Generally speaking, a prerequisite that builds the chimeric HBV infecting mouse of people mouse model is after human liver cell is implanted near Mouse Liver leaflet and parenchyma, must possess growth vigor to compete the mouse liver cell that restorability is strong, need mouse liver cell to cause specificity liver injury.
RNA disturbs (RNA interference, RNAi) be a kind of by double-stranded RNA (double-stranded RNA, dsRNA) mechanism of the intracellular sequence-specific inhibition of gene expression of mediation, it suppresses to be proposed first (Fire A etc. in research in the genetic expression nematode in 1998, nature, 1998,391 volumes: 806-811 page).After this, further research is found, RNAi is extensively present in nearly all eukaryote such as higher mammal and fungi, Arabidopis thaliana, hydra, turbellarian worm, trypanosome, zebra fish, the mechanism of a kind of ubiquity and conservative inhibition of gene expression, can play regulate gene expression, antiviral invasion, suppress effect (the Dykxhoorn DM etc. such as transposon activity, nature molecular cytobiology summary, 2003,4 volumes: 457-467 page).The mechanism of RNAi is illustrated substantially at present: the RNA enzyme III that dsRNA molecule endogenous or that external source produces is called as Dicer in tenuigenin cuts into siRNA (small interfering RNA, siRNA).Typical siRNA constitutional features is: 5 ' end is phosphorylated, and the outstanding 2-3nt of 3 ' end symmetry is also hydroxyl, the dsRNA that length is 19-23nt.SiRNA molecule and the protein complexes combination of silencing complex (RNA-inducing silencing complex, RISC) that is called RNA induction, RISC has helicase and endonuclease activity.SiRNA molecule is depolymerizated in complex body, wherein antisense strand is combined by basepairing rule with the said target mrna that can match, and the RISC that guides combination with it by said target mrna with the middle part, land of the antisense strand position enzymolysis apart from 5 ' end 10nt, thereby suppress the expression of target gene.The method that obtains at present siRNA mainly contains: can express the plasmid of bobby pin RNA (short hairpin RNA, shRNA) and recombinant viral vector, chemical synthesis process, in-vitro transcription etc.
At present, RNAi technology has been widely used in the research of specificity down-regulation of gene expression.Studies show that, fumarylacetoacetate hydrolase (FAH) is the important lytic enzyme (Grompe, al-Dhalimy et al.1993) of cell tyrosine pathways metabolism.In liver cell, the shortage of FAH can cause tyrosine katabolism to be obstructed, and cannot generate fumaric acid, etheric acid and succinate, causes tyrosine accumulating in vivo, causes hepar damnification.Therefore, the inventor proposes, and the method for disturbing by RNA is lowered the expression of FAH, thereby obtains the effect of inducing hepatocyte damage.Owing to being not the expression that all RNAi target spots that meet conventional design requirement can both effectively suppress target gene, the suppression efficiency between different target spots respectively has difference, and therefore, it is very important selecting the suitable RNAi target spot with high suppression efficiency.Select suitable RNAi target spot to consider from aspects such as constitutional features, suppression efficiency, non-human DNA homologs.Spendable householder method comprises siRNA Autocad, RNA analysis of the molecular structure, nucleic acid sequence analysis comparison and the experiment experience etc. that have proposed at present, and is verified by concrete inhibition assessment.
Utilize RNA perturbation technique can set up the method for effective inducing hepatocyte damage, but the method need to provide the RNA disturbance target point of the expression that can effectively lower FAH.The present invention has met this requirement, and RNA disturbance target point, recombinant expression vector of can be used for this object etc. are provided.
Summary of the invention
The invention provides the RNA disturbance target point of target FAH, can express expression plasmid, recombinant viral vector and the cell of the siRNA of target RNA disturbance target point of the present invention, and medicine or the composition of the siRNA that comprises target RNA disturbance target point of the present invention.
RNA disturbance target point provided by the invention can be used for target FAH, suppresses FAH genetic expression.RNA disturbance target point provided by the invention obtains by the following method: the RNA interfered target sequence that Choice and design can target FAH; By designing suitable oligonucleotide, build siRNA, and be cloned into expression vector to obtain corresponding siRNA expression plasmid; By this plasmid with the reporter plasmid of FAH gene, carry out cotransfection, and screen and obtain suitable RNA disturbance target point by the expression level of examining report gene.
The RNA disturbance target point that the invention provides target FAH, its sequence is selected from:
(1) sequence shown in any one in SEQ ID NO:1-5, or
(2) under stringent condition or under height stringent condition can with (1) in the nucleotide sequence of sequence hybridization, or
(3) only there is 1 or 2 sequence that Nucleotide is different from sequence in (1); Or
(4) fragment of above-mentioned sequence or complementary sequence.
The sequence of RNA disturbance target point provided by the invention can be DNA or RNA sequence.
The present invention also provides the nucleic acid construct that comprises this RNA interfered target sequence or carrier as expression vector.The recombinant expression vector that comprises this RNA interfered target sequence can be used for expressing siRNA and/or the miRNA of target FAH of the present invention.
The present invention also provides siRNA or the miRNA of the expression that obtain, that can suppress FAH gene according to above-mentioned RNA interfered target sequence.
The present invention also provides and can express the siRNA of target FAH of the present invention and/or the recombinant expression vector of miRNA.
In one embodiment, recombinant expression vector of the present invention has following characteristics: the siRNA that comprises target RNA disturbance target point provided by the invention and/or the nucleic acid sequence encoding of miRNA, these nucleic acid sequence encodings are operably connected with expression control sequenc, thereby make in for example zooblast of host cell (particularly mammalian cell, preferably liver cell and stem cell), to express siRNA and/or the miRNA of described target FAH.
Recombinant expression vector of the present invention can be plasmid vector or virus vector, such as retroviral vector, lentiviral vectors, adenovirus carrier, gland relevant viral vector etc.
The cell that the invention still further relates to separation, it comprises: (1) RNA interfered target sequence of the present invention, or (2) nucleic acid construct of containing RNA interfered target sequence of the present invention or carrier are as expression vector.
The invention still further relates to conversion or transfection or the cell of the separation of the recombinant expression vector of having transduceed, described recombinant expression vector can be expressed siRNA and/or the miRNA of target FAH of the present invention.
The cell (comprising such as mammalian cell of zooblast, preferably liver cell and stem cell) that the invention still further relates to a kind of transformation, it can express or comprise siRNA of the present invention and/or miRNA.
The invention still further relates in genome or genome carries the cell of the nucleic acid sequence encoding of RNA disturbance target point of the present invention outward, comprise that prokaryotic cell prokaryocyte is (as bacterial cell, as Bacillus coli cells) and eukaryotic cell (as fungal cell, insect cell, vegetable cell, zooblast, preferred mammal cell, preferably liver cell and stem cell), it includes the nucleic acid sequence encoding of the RNA disturbance target point the present invention relates to, and these nucleic acid sequence encodings can be operably connected with expression control sequenc, making can be at siRNA and/or the miRNA described in this cells.
The invention still further relates to and imported according to the siRNA of RNA disturbance target point acquisition provided by the invention and/or the cell of miRNA, comprise that prokaryotic cell prokaryocyte is (as bacterial cell, as Bacillus coli cells) and eukaryotic cell (as fungal cell, insect cell, vegetable cell, zooblast, preferred mammal cell, preferably liver cell and stem cell), it has been imported into or has included according to siRNA and/or the miRNA of RNA disturbance target point acquisition of the present invention.
In a preferred embodiment, by the siRNA Expression element transfered cell of the nucleic acid sequence encoding that contains RNA disturbance target point of the present invention, can make cell obtain the ability that suppresses FAH genetic expression.
The invention still further relates to the tissue and the biology that comprise above-mentioned cell, as animal.The invention still further relates to the medicine or the composition that comprise cell of the present invention.
On the other hand, the invention still further relates to the method for the cell of preparation transformation of the present invention, it comprises with recombinant expression vector conversion of the present invention or transfection or transducer cell (comprising such as mammalian cell of zooblast, preferably liver cell and stem cell).
In one embodiment, described method for example comprises, with recombinant viral vector of the present invention (lentiviral vectors, as slow virus Lenti-siFAH8 etc.) transduction mammalian cell.
In aforesaid method, described cell can be (or in vitro) separating, for example from normal individual, separate, or in vivo, or the cell strain of vitro culture.
The invention still further relates to the combination of DNA sequence dna (or DNA), it comprises or is comprised of coding the first DNA sequence dna of just RNA fragment and the second DNA sequence dna of encoding antisense RNA fragment, described just RNA fragment comprises the coded RNA sequence of target sequence of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can suppress the expression of FAH gene.
The invention still further relates to siRNA (siRNA), it comprises just RNA fragment and sense-rna fragment, the RNA sequence that described just RNA fragment comprises target sequence coding of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can suppress the expression of FAH gene.
The invention still further relates to the siRNA and/or the purposes of miRNA in induction liver injury that according to RNA disturbance target point provided by the invention, obtain.
The invention still further relates to the siRNA and/or the purposes of miRNA in medicine and/or the composition of preparation inhibition FAH genetic expression that according to RNA disturbance target point provided by the invention, obtain.
The invention still further relates to RNA disturbance target point of the present invention or nucleic acid construct or carrier or the recombinant expression vector purposes in the mouse of induction liver injury or generation hepar damnification, or the purposes in medicine and/or the composition of the mouse for the preparation of induction liver injury or generation hepar damnification.
The invention still further relates to the purposes of the cell through transformation of the present invention (comprising such as mammalian cell of zooblast, preferably liver cell and stem cell) in medicine and/or the composition of the mouse for the preparation of induction liver injury or generation hepar damnification.
The invention still further relates to the application of siRNA of the present invention in the medicine of screening treatment liver injury.
The invention still further relates to the method that suppresses FAH genetic expression, it comprises to having the individuality of these needs or RNA disturbance target point of the present invention, nucleic acid construct or carrier, siRNA or miRNA, expression vector, cell or the DNA sequence dna combination that cell is used significant quantity.
The invention still further relates to the method for inducing mouse hepar damnification, it comprises in RNA disturbance target point of the present invention, nucleic acid construct or carrier, siRNA or the miRNA of significant quantity, expression vector, cell or DNA sequence dna combination importing Mice Body.
Below in conjunction with drawings and Examples, embodiment of the present invention are described in detail, but it will be understood by those skilled in the art that following drawings and Examples are only for the present invention is described, rather than the restriction to scope of the present invention.With the following detailed description of preferred embodiment, it is obvious that various objects of the present invention and favourable aspect will become to those skilled in the art with reference to the accompanying drawings.
Summary of drawings
Fig. 1 is the schematic diagram (this schematic diagram, using the RNA interfered target sequence siFAH8 shown in embodiment 2 (SEQ ID NO:1) as example, still also can be used other RNA interfered target sequences provided by the invention) of the structure flow process of pSUPER-siRNA series expression plasmid.
The siRNA expression plasmid that Fig. 2 has shown 5 RNA disturbance target points that obtain with the cotransfection experiments of FAH reporter plasmid in inhibition.Result shows, for the siRNA of these RNA disturbance target points, has good inhibition.In this figure, siFAH8, siFAH10, siFAH1, siFAH12, siFAH6 represent respectively the siRNA expression plasmid for these RNA disturbance target points, and wherein target sequence and relevant experimentation are shown in embodiment 2.
Fig. 3 shows, expression vector pDEST-siFAH8, the pDEST-siFAH10 of acquisition can the coded siRNA sequence of effective expression, and has gene target specificity.When FAH reporter plasmid pGL3-FAH is during respectively with expression vector pDEST-siFAH8 or pDEST-siFAH10 cotransfection, the expression of luciferase (luciferase) gene has been subject to effective inhibition, and when contrast reporter plasmid pGL3-control and expression vector pDEST-siFAH8 or pDEST-siFAH10 cotransfection, the expression of luciferase genes can not be suppressed.
Fig. 4 carries the relative luciferase activity in cell after the recombinant slow virus transducer cell of siRNA expressed sequence of target FAH, result shows, after the recombinant slow virus transduction of using the siRNA expressed sequence that carries target FAH, cell can effectively suppress the expression of FAH reporter plasmid pGL3-FAH.Refer to embodiment 5.
The siRNA of vector expression that Fig. 5 has shown the siRNA expressed sequence that carries target FAH in Mice Body to hepatocellular damaging action.Wherein scheme A and show that the hepatic parenchymal cells damaged phenomenon of full wafer appears in the Balb/c mouse of injection siRNA expression plasmid pSUPER-siFAH8; Figure B shows that large stretch of hepatic parenchymal cells necrosis appears in the Balb/c mouse of injection siRNA expression plasmid pSUPER-siFAH8, and the liver sinusoid being comprised of hepatic parenchymal cells has not existed, and a large amount of hemocytes collects in hepatocellular injury place.Figure C and D have shown that respectively liver tissue injury does not all appear in control mice (being the Balb/c mouse of normal Balb/c mouse and injection contrast expression plasmid pSUPER-Nk).
Embodiment
Unless otherwise defined, otherwise Science and Technology term used herein has the implication that those skilled in the art conventionally understand.
The invention provides can target FAH RNA disturbance target point, it comprises following sequence: any one of SEQ ID NO:1-5 or several sequence, or (preferably at least 80%, 85%, 90%, 95%, 98% or higher) the conforming sequence that has at least 70% with it.
Consistence (identity) can be calculated according to method well known in the art.A preferred example that is suitable for the algorithm of determining sequence identity and sequence similarity percentage ratio is BLAST and BLAST 2.0 algorithms, and they are described in respectively in (1990) J.Mol.Biol.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and Altschul.Adopt for example parameter as herein described, BLAST and BLAST 2.0 can be for determining the sequence identity percentage ratio of polynucleotide of the present invention and polypeptide.Carrying out software that BLAST analyzes can be obtained by the public by state-run biotechnology information center.
In other embodiments, the polynucleotide sequence that described RNA disturbance target point has under stringent condition or height stringent condition and polynucleotide provided herein or its fragment or its complementary sequence can be hybridized.In biology field, hybridization technique is known.For illustrative purposes, the condition of described hybridization is stringent condition, for example, with the membrane-bound DNA of filter hybridization at approximately 45 ℃ in 6 × sodium chloride/sodium citrate (SSC), in 0.2 × SSC/0.1%SDS, at about 50-65 ℃, carry out one or many washing afterwards; Height stringent condition, for example, with the hybridization at approximately 45 ℃ in 6 × SSC of the membrane-bound nucleic acid of filter, carry out one or many washing afterwards in 0.1 × SSC/0.2%SDS at approximately 68 ℃; Or other tight hybridization conditions well known by persons skilled in the art is (referring to for example Ausubel, the volume such as F.M., 1989, Current Protocols in Molecular Biology, the 1st volume, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, 6.3.1-6.3.6 and 2.10.3 page).
The invention still further relates under stringent condition or height stringent condition the nucleotide sequence that can hybridize with arbitrary sequence of SEQ ID NO:1-5 or its fragment or its complementary sequence.
In the present invention, siRNA and/or miRNA can be designed to target goal gene or its regulating and controlling sequence, for example, need to suppress gene or its regulating and controlling sequence of its expression, to suppress or reduce its expression.For gene or its regulating and controlling sequence can be to need to suppress or reduce any gene or its regulating and controlling sequence of its expression, for example from pathogenic agent or that participate in formation of cancer and development those.Especially, siRNA of the present invention and/or miRNA target FAH.SiRNA of the present invention and miRNA can design according to ordinary method.
" siRNA, the miRNA that according to RNA disturbance target point of the present invention, obtain " refers to the siRNA, the miRNA that by modes such as recombinant expressed or chemosynthesis, obtain, its target sequence acting on (can be DNA or RNA sequence) for or include the RNA interfered target sequence the present invention relates to.
The conventional design method of siRNA can reference (as: Reynolds A etc., Nature Biotechnol,, 22 volumes: 326-330 in 2004) or open source information or the embodiment 1 of the company's site such as Amhion, Qiagen in description.The conventional design method of miRNA can reference (Lo HL etc., gene therapy, 2007,14 volumes: 1503-1512 page), select the method for target sequence and the method for design of siRNA similar, for example the positive-sense strand that contains target sequence of design and corresponding antisense strand can be substituted into pri-microRNA above, make the miRNA building can stop the expression of the mRNA that contains target sequence.
The promotor that the present invention uses can be any promotor being suitable at cells goal gene, and it can be composing type, can be also induction type.Promotor of the present invention can also be combined promoter, as double-promoter.
" be operably connected " and refer to that the mode of connection of connected molecule makes it possible to realize the function of expection.For example, the exercisable control action kou that can realize the expression of expression control sequenc to gene coded sequence that is connected of expression control sequenc and gene coded sequence.
" expression control sequenc " is to realize the needed control sequence of genetic expression, and it is well known in the art.Expression control sequenc must comprise promotor conventionally, usually also comprises transcription termination sequence, and can comprise other sequences, as enhancer sequence.Genetic expression refers to and transcribes for siRNA, miRNA etc., and can comprise and transcribe post-treatment; For protein coding sequence, typically refer to and transcribe and translate, produce protein.
The invention provides can target FAH RNA disturbance target point and according to the siRNA of this shot design, miRNA.
In a specific embodiments, the present invention relates to siRNA (siRNA), it comprises just RNA fragment and sense-rna fragment, the RNA sequence that described just RNA fragment comprises RNA disturbance target point coding of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA can suppress the expression of FAH gene.
In the present invention, term " siRNA " or " siRNA " are used interchangeably, and they all refer to suppress FAH genetic expression, comprise the Yeast Nucleic Acid (RNA) of just RNA segment area and sense-rna segment area.
In addition, the present invention also provides the combination of DNA sequence dna (or DNA), it comprises or is comprised of coding first DNA sequence dna (or a DNA) of just RNA fragment and second DNA sequence dna (or the 2nd DNA) of encoding antisense RNA fragment, described just RNA fragment comprises the coded RNA sequence of RNA disturbance target point of the present invention, sense-rna fragment and just RNA fragment can form double-stranded RNA, and this double-stranded RNA energy (disturbing by RNA) suppresses the expression of FAH gene.The combination of DNA or DNA sequence dna represents a kind of product, for example, can be one section or two segment DNAs, or the carrier that comprises this DNA is as expression vector, recombinant plasmid, recombinant virus.For example, a described DNA and the 2nd DNA may reside on same section of DNA, also can be present in respectively on two sections of different DNA.
At this respect of the present invention, described just RNA fragment and sense-rna fragment may reside on two different RNA chains or are present on a RNA chain, and for example a single stranded RNA molecule comprises just RNA fragment and sense-rna fragment.
For example, siRNA of the present invention can be hair clip type single stranded RNA molecule, and wherein the complementary region between just RNA fragment and sense-rna fragment forms double-stranded RNA region.
The length of justice RNA fragment and sense-rna fragment is preferably 8-50 Nucleotide, the preferably individual Nucleotide of 10-30 (more preferably 15-27,19-23, as 19,20 or 21), but also can be longer or shorter.
The complementary region of the double-stranded RNA that justice RNA fragment and sense-rna fragment form has 10 (preferably at least 15, more preferably at least 18, as 19,20 or 21) base pairs at least.Preferably, the complementary region between described just RNA fragment and sense-rna fragment is containing 19,20 or 21 pairs of complementary bases.
In one embodiment, between just RNA fragment and sense-rna fragment, allow a small amount of mispairing, for example 1-5, as 1 or 2 or 3 or 4 base mispairings.In a preferred embodiment, just RNA fragment and sense-rna fragment complete complementary.
In one embodiment, siRNA of the present invention is for having the double stranded rna molecule of 10-30 (preferably, 15-27, more preferably 19-23) to base, in described two strands, have 10 (preferably at least 15, more preferably at least 18) base complementrity pairings at least.
In a preferred embodiment, the GC content of just RNA fragment and sense-rna fragment is 35%-75%, for example 40-60%, 45-55%, 48-52%, according to appointment 50%.
In a preferred embodiment, just RNA fragment and sense-rna fragment and known Human genome and genetic expression fragment are without significant consistence.Significant consistence refers at least 60%, for example 70,80,90% consistence.
Preferably, in 19 Nucleotide that described just RNA fragment starts from 5 ' end, base is that the Nucleotide quantity of guanine (G) and base are that the ratio that the Nucleotide quantity sum of cytosine(Cyt) (C) accounts for 19 Nucleotide quantity beyond the TT that removes 3 ' end is 35%-75% (being G/C ratio), and the mutant of described sense-rna fragment and an one Nucleotide and known Human genome and genetic expression fragment are without remarkable consistence.
In an embodiment of recombinant expression vector of the present invention, the nucleic acid sequence encoding that recombinant expression vector of the present invention comprises RNA disturbance target point of the present invention, these nucleic acid sequence encodings are operably connected with expression control sequenc, make siRNA and/or the miRNA of target FAH as described in can expressing in zooblast (particularly mammalian cell, as liver cell or stem cell).
Similarly, in the method for cell of preparing transformation of the present invention, the expression vector conversion of the nucleic acid sequence encoding that can comprise the RNA disturbance target point the present invention relates to by use or transfection or transducer cell (comprise such as mammalian cell of zooblast, preferably liver cell and stem cell) obtain the cell of transformation of the present invention, as long as the nucleic acid sequence encoding that the cell finally obtaining comprises the RNA disturbance target point the present invention relates to.
Also can obtain the cell of transformation of the present invention by import the siRNA and/or the miRNA that obtain according to RNA disturbance target point of the present invention in described cell, as long as the cell obtaining includes the siRNA and/or the miRNA that obtain according to RNA disturbance target point provided by the invention.
Recombinant expression vector of the present invention can be plasmid vector, or virus vector (such as retroviral vector, lentiviral vectors, adenovirus carrier, gland relevant viral vector etc.).
Preferably mammalian cell of the cell of transformation of the present invention, preferably liver cell, preferably stem cell.Described cell in genome or genome carry the nucleic acid sequence encoding of the RNA disturbance target point the present invention relates to outward, these nucleic acid sequence encodings are operably connected with expression control sequenc, and making can be at siRNA and/or the miRNA of target FAH described in this cells.
Recombinant vectors of the present invention and engineered cells can be for suppressing FAH genetic expression, inducing hepatocyte damage, the mouse of generation hepar damnification.
In specific embodiment, relate to following content:
1. the sequence of the RNA disturbance target point of target FAH (SEQ ID NO:1-5):
siFAH8 GCTTTGG AACCACAATCTCTT (SEQ ID NO.1)
siFAH10 CCATCAGTGGATCAGACCCTT (SEQ ID NO.2)
siFAH1 CCCAAAGCCACGGATTGGTTT (SEQ ID NO.3)
siFAH12 AGTGCTGCCTGCCCTTTCATT (SEQ ID NO.4)
siFAH6 CTCAAAGCCTCCTGTGTATTT (SEQ ID NO.5)
2. expression vector, preferred virus carrier, it can be used for transforming liver cell or stem cell.
Can express the recombinant viral vector of single or multiple siRNA and/or miRNA.
The application of this virus vector on liver cell and/or stem cell, for example, can be used for the molecule of the anti-FAH of stably express, as can be in liver cell and/or stem cell specificity suppress the siRNA of FAH genetic expression.
3. the cell of transformation, as liver cell and stem cell, it includes the nucleic acid sequence encoding of the RNA disturbance target point the present invention relates to, and can express described siRNA and/or miRNA; Or be imported into according to siRNA and/or the miRNA of RNA disturbance target point acquisition provided by the invention; Or be imported into recombinant vectors of the present invention.
Embodiment
The design & formulation of the siRNA expression plasmid of embodiment 1. target FAH
Selection and the design of the RNA disturbance target point of target FAH: people and mouse FAH reference sequences are carried out to sequence alignment, be chosen in the region of the sequence (difference of at least 1 base) that has sequence difference between the two, step is moved the sequence of the siRNA of design target FAH; The siRNA sequence that primary election is obtained carries out BLAST retrieval in GenBank, selects to have the different sequence of more than 3 or 3 base as candidate sequence with non-targeted sequence.
The structure of siRNA expression plasmid: in the present embodiment, build the expression plasmid of siRNA as an example of pSUPER carrier (the Cat.No VEC-PBS-0001/0002 of oligoengine company) example.Concrete building process can, referring to the pSUPER carrier experiment guide (www.oligoengine.com) of the said firm, build the visible schematic diagram 1 of concise and to the point flow process.In brief, synthesize respectively the oligonucleotide with RNA interference sequence; By annealed complementary oligonucleotide processing, be then connected to the pSUPER carrier through Bgl II and Hind III double digestion; Through the enzyme evaluation of cutting and check order, obtain correct siRNA expression plasmid.
The structure of contrast expression plasmid: with siRNA sequence (the siRNA-luciferase of special target luciferase genes, concrete sequence is 5 '-GTGCGCTGCTGGTGCCAAC-3 ' (SEQ ID NO:6)) and the irrelevant siRNA sequence (siRNA-Nk, concrete sequence is 5 '-TGCATCGGAAAATAGATGT-3 ' (SEQ ID NO:7)) that do not match with mouse FAH and little musculus cdna is in contrast.As mentioned above, synthetic oligonucleotide also connects into pSUPER carrier, through enzyme, cuts and checks order after evaluation, obtains respectively corresponding contrast expression plasmid pSUPER-luc and pSUPER-Nk.
Embodiment 2. cotransfection experiments screenings obtain the RNA disturbance target point that can suppress FAH
The shortage of fumarylacetoacetate hydrolase (FAH) can cause tyrosine katabolism to be obstructed, cannot generate fumaric acid, etheric acid and succinate, cause tyrosine accumulating in vivo, cause hepar damnification (Grompe M. etc., gene and growth, 1993,7 volumes: 2298-2307 page).The method of disturbing by RNA is lowered the expression of FAH, to obtaining the effect of liver injury.
PGL-FAH plasmid (construction process: by pGL3-control plasmid (purchased from Promega company, between the terminator codon of luciferase genes Cat.E1741) and PolyA, insert synthetic FAH gene order (GenBank No.NM_010176.3), built reporter plasmid pGL3-FAH) be the plasmid of the mRNA that can comprise luciferase-FAH sequence at mammalian cell (as 293FT cell) transcription.Can efficient targeting FAH and cut off the siRNA of luciferase-FAH mRNA if existed in cell, the translation of luciferase-FAH mRNA can be stoped so, thereby the reduction of reporter protein luciferase expression can be detected.By detecting the reduction of luciferase activity, can calculate the suppression efficiency of siRNA.Therefore, siRNA expression plasmid and pGL-FAH plasmid are carried out to cotransfection experiments in 293FT cell, simultaneously with the siRNA-luciferase expression plasmids of target luciferase and the siRNA-Nk expression plasmid of the irrelevant sequence of target in contrast.Expression level by the luciferase protein of cell after detection cotransfection checks different siRNA to suppress the efficiency of FAH.
By 293FT cell (Invitrogen, Catalog#R700-07) be incubated in 24 porocyte culture plates, substratum is that DMEM substratum (adds 10%FBS, 2mM L-glutaminate, 0.1mM MEM non-essential amino acid and 1% penicillin-Streptomycin sulphate), converge rate and be about 70%.After 12 hours, according to the specification sheets of manufacturer, use Lipofectamine 2000 (Invitrogen Cat.No 11668-027), by the siRNA expression plasmid of every porocyte transfection 5 μ g (siRNA expression plasmid is according to building described in embodiment 1) and 1 μ g pGL-FAH reporter plasmid.The activity of luciferase protein in cotransfection detected cell respectively after 48 hours.Take cotransfection the luciferase protein activity in the 293FT cell of contrast expression plasmid and pGL-FAH plasmid be contrast, calculate the suppression efficiency of each siRNA to FAH.Thus, obtain 5 and can build the RNA disturbance target point of the siRNA with effective inhibition ability according to it.Fig. 2 has shown the suppression efficiency that builds respectively the siRNA expression plasmid obtaining according to these 5 RNA interfered target sequences.
The sequence of our RNA disturbance target point of obtaining (can build the siRNA of the ability with effective inhibition FAH according to it) below:
siFAH8 GCTTTGGAACCACAATCTCTT (SEQ ID NO.1)
siFAH10 CCATCAGTGGATCAGACCCTT (SEQ ID NO.2)
siFAH1 CCCAAAGCCACGGATTGGTTT (SEQ ID NO.3)
siFAH12 AGTGCTGCCTGCCCTTTCATT (SEQ ID NO.4)
siFAH6 CTCAAAGCCTCCTGTGTATTT (SEQ ID NO.5)
Embodiment 3. expresses the structure of the recombinant virus expression vector of siRNA
In the present embodiment, built the recombinant slow virus expression vector that can express siFAH8 and siFAH10.
Expression vector: in the present embodiment, the expression vector pDEST-MR (number of patent application: 200510112917.1 of the slow virus system that we use; Publication number: CN1948475) comprised the expression cassette that can be used for expressing siRNA by the control of H1 promotor.
The structure of expression vector pDEST-siFAH8 and pDEST-siFAH10:
(contain respectively the pSUPER carrier of siFAH8 and siFAH10 with XhoI and XbaI double digestion pSUPER-siFAH8 and pSUPER-siFAH10, its construction process is shown in embodiment 1), thereby obtain, be carried at siFAH8 under the control of H1 promotor and the nucleic acid fragment of siFAH10; Further the fragment of acquisition is connected to the pDEST-MR carrier of cutting processing through same enzyme, thus difference construction of expression vector pDEST-siFAH8 and pDEST-siFAH10.(exemplarily used the RNA disturbance target point siFAH8 shown in embodiment 2 (SEQ ID NO:1), siFAH10 (SEQ ID NO:2) here, but also can use other RNA disturbance target points provided by the invention).
We verify the validity that builds the recombinant slow virus expression vector pDEST-siFAH8 of acquisition and the expression of pDEST-siFAH10.With the siRNA-Nk expression plasmid of the siRNA-luc expression plasmid of target luciferase and the irrelevant sequence of target in contrast, carry out cotransfection and suppress experiment.Result shows, when pGL3-FAH is during respectively with expression vector pDEST-siFAH8, pDEST-siFAH10 cotransfection, the expression of luciferase genes has been subject to effective inhibition, and when pGL3-control and expression vector pDEST-siFAH8, pDEST-siFAH10 cotransfection, the expression of luciferase genes can not be suppressed (referring to Fig. 3).This explanation builds the expression vector pDEST-siFAH8, the pDEST-siFAH10 that obtain can express coded siRNA sequence, and has gene target specificity.
Embodiment 4. expresses the structure of the recombinant virus of siRNA
In the present embodiment, built the recombinant slow virus that can express the siRNA of target siFAH8 or siFAH10.
Except expressing the expression vector of siRNA of target FAH, building other required plasmid of recombinant slow virus is pLP1, pLP2, pVSVG, these plasmids are bought from Invitrogen company, and commodity are by name: pLenti4/V5-DEST Gateway Vector Kit, article No.: V469-10.
The preparation method of recombinant slow virus:
(1) with CsCl-ethidium bromide density gradient centrifugation a large amount of extraction four kinds of plasmid: pVSVG, pLP1, pLP2 and expression vectors (as the pDEST-siFAH1 plasmid as example in the present embodiment), (extracting method is referring to < < molecular cloning experiment guide > >, J. Pehanorm Brooker D.W. Russell work, Science Press, 2002);
(2) 293FT cell (Invitrogen, Catalog#R700-07) is incubated in DMEM substratum and (adds 10%FBS, 2mM L-glutaminate, 0.1mM MEM non-essential amino acid and 1% penicillin-Streptomycin sulphate);
(3) by 293FT cell cultures on the Tissue Culture Plate of diameter 10cm, converge rate approximately 70%.After 12 hours, use calcium phosphate transfection method, (method is referring to < < molecular cloning experiment guide > > with 10 μ g pLP1,10 μ g pLP2,10 μ g pVSVG, 20 μ g expression vectors, to carry out the cotransfection of 4 kinds of plasmids, J. Pehanorm Brooker D.W. Russell work, Science Press, 2002);
(4) transfection collecting cell culture supernatant after 48 hours, and filter with the filter membrane of 0.45 μ m; Centrifugal 90 minutes at 4 ℃ with 25,000rpm with SW28 rotary head (BECKMAN company);
(5) supernatant discarded, adds 500 μ L PBS dissolution precipitations;
(6) packing collection virus liquid, be stored in-80 ℃ standby.
The recombinant slow virus that obtains thus the siRNA that can express target siFAH1 or siFAH10, is called Lenti-siFAH8, Lenti-siFAH10.
The siRNA of embodiment 5. target FAH is by the restraining effect of recombinant virus transfered cell to FAH
We take can express target FAH siRNA recombinant slow virus as example (in the present embodiment, we use recombinant slow virus Lenti-siFAH8, the Lenti-siFAH10 of the siRNA that can express respectively target siFAH1, siFAH10 as example, but also can use other can express the recombinant virus of the siRNA of target RNA disturbance target point provided by the invention), proof turns transfered cell by recombinant virus by the siRNA of target FAH, makes cell obtain the ability that suppresses FAH genetic expression.
Experimental technique: with the 293FT cell of transduceing respectively of slow virus Lenti-siFAH8, Lenti-siFAH10 for moi=40, change liquid after the centrifugal 60min of 600g; With moi=40, use that (the siRNA Expression element of target luciferase genes and irrelevant sequence is with embodiment 1 with the contrast recombinant slow virus Lenti-luc of the siRNA-luc Expression element of target luciferase genes or with the contrast recombinant slow virus Lenti-Nk of the siRNA-Nk Expression element of the irrelevant sequence of target; According to the method preparation contrast recombinant slow virus of embodiment 3 and 4) transduction 293FT cell, changes liquid (in contrast) after the centrifugal 60min of 600g; 293FT cell after transduction is 37 ℃ of cultivations, airflow classification GFP positive cell after 48 hours.The positive cell obtaining with pGL-FAH transfection sorting, evaluated by detecting the expression level of luciferase protein in the cell after transfection the efficiency that different siRNA suppress FAH after 48 hours.Experiment contrast is the 293FT cell of not transduceing and contrasts the 293FT cell after recombinant slow virus Lenti-luc, Lenti-Nk transduction.
Result shows, all demonstrates the ability (referring to Fig. 4) of inhibition FAH expression with the 293FT cell after recombinant slow virus Lenti-siFAH8, Lenti-siFAH10 transduction.This shows that the siRNA of target FAH expresses in these cells in the cell of recombinant slow virus transduction of using the siRNA Expression element that carries target FAH, thereby suppresses the expression of FAH.
The siRNA that the siRNA expression plasmid of embodiment 6. target FAH is expressed in Mice Body to hepatocellular damaging action
Laboratory animal: SPF level Balb/c mouse, in 7～8 week age, body weight is about 18～22g.Every group 6, repeat 3 times.
In the present embodiment, we exemplarily use the expression plasmid pSUPER-siFAH8 (but also can use other can express the expression plasmid of the siRNA of target RNA disturbance target point provided by the invention) of the siRNA that can express target siFAH8, confirmation imports the siRNA of target FAH after intravital mouse by expression plasmid, can make mouse liver produce damage.
Experimental technique: siRNA expression plasmid pSUPER-siFAH8 (40 μ g/ only) or control plasmid pSUPER-Nk (40 μ g/ only) are injected into mouse by mouse tail vein high-pressure injection method (hydrodynamictransfection), injection cumulative volume is about 2mL, injects complete in 5 seconds.Before injection and after injection, gather mouse liver every day, investigates the expression level of the FAH in murine liver tissue and hepatic tissue with ImmunohistochemistryMethods Methods.Experiment contrast is the Balb/c mouse of normal Balb/c mouse and injection contrast expression plasmid pSUPER-Nk.
Result demonstration, the hepatic tissue that injection can be expressed the mouse of the expression plasmid of the siRNA of target FAH has produced damage (referring to Fig. 5).Especially,, there is the hepatic parenchymal cells damaged phenomenon (Fig. 5 A) of full wafer in the karyopyknosis of Mouse Liver parenchyma; And after large stretch of hepatic parenchymal cells necrosis, the liver sinusoid being comprised of hepatic parenchymal cells has not existed, and a large amount of hemocytes collects in hepatocellular injury place (Fig. 5 B).By contrast, all there is not liver tissue injury (Fig. 5 C and Fig. 5 D) in control mice (being the Balb/c mouse of normal Balb/c mouse and injection contrast expression plasmid pSUPER-Nk).This shows, by expression plasmid, the siRNA of target FAH is imported to intravital mouse, can suppress the expression of FAH in liver cell and cause murine liver tissue to produce damage.
Those skilled in the art should understand, although for illustrative purposes, this paper describes specific embodiment of the invention scheme, can carry out various modifications and without departing from the spirit and scope of the present invention to it.Therefore, specific embodiment of the invention scheme and embodiment should not be considered as limiting the scope of the invention.The present invention is only subject to the restriction of claims.All documents of quoting in the application are all intactly incorporated to herein as a reference.
Claims (19)
1. the RNA disturbance target point of target FAH, its sequence is selected from:
(1) sequence of SEQ ID NO:1, or
(2) complementary sequence of above-mentioned sequence.
2. comprise the nucleic acid construct of the RNA disturbance target point of claim 1.
3. comprise the carrier of the RNA disturbance target point of claim 1.
4. RNA disturbance target point according to claim 1 siRNA that obtain, that can suppress the expression of FAH gene, its sequence is as follows:
GCUUUGGAACCACAAUCUCUUUUCAAGAGAAAGAGAUUGUGGUUCCAAAGCUU。
5. a recombinant expression vector, it can express the siRNA of claim 4.
6. the recombinant expression vector of claim 5, the nucleic acid sequence encoding of its siRNA that comprises target FAH, described nucleic acid sequence encoding is operably connected with expression control sequenc, and making can be at the siRNA described in cells.
7. the recombinant expression vector of claim 6, wherein said cell is zooblast.
8. the recombinant expression vector of claim 6, wherein said cell is mammalian cell.
9. the recombinant expression vector of claim 5, it is plasmid vector or virus vector.
10. the recombinant expression vector of claim 9, wherein said virus vector is retroviral vector.
The recombinant expression vector of 11. claims 10, wherein said retroviral vector is lentiviral vectors.
The cell of the separation of the recombinant expression vector of 12. conversions or transfection or the claim 5-11 any one of having transduceed.
The cell of the separation of 13. 1 kinds of transformations, it can express or include the siRNA of claim 4.
The cell of the separation of the transformation of 14. claims 13, its in genome or genome carry the nucleic acid sequence encoding of RNA disturbance target point claimed in claim 1 outward, described nucleic acid sequence encoding is operably connected with expression control sequenc, and making can be at siRNA described in this cells.
The cell of the separation of the transformation of 15. claims 14, wherein said cell is zooblast.
The cell of the separation of the transformation of 16. claims 14, wherein said cell is mammalian cell.
The method of the cell of 17. preparation claim 12-16 any one, it comprises recombinant expression vector conversion or transfection or transducer cell by claim 5-11 any one.
The cell of the recombinant expression vector of the siRNA of 18. claims 4 or claim 5-11 any one or claim 12-16 any one is in the purposes of preparing in medicine or composition, and described medicine or composition can be used for suppressing the expression of FAH gene or the mouse of inducing hepatocyte damage or generation hepar damnification.
19. suppress the method for the expression of FAH gene, and it comprises the recombinant expression vector transfered cell of the siRNA of the claim 4 of significant quantity or claim 5-11 any one.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210010355.XA CN102604938B (en) | 2011-01-13 | 2012-01-13 | RNA (ribonucleic acid) interference target points for inducing hepatocellular injury |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110006691.2 | 2011-01-13 | ||
| CN201110006691 | 2011-01-13 | ||
| CN201210010355.XA CN102604938B (en) | 2011-01-13 | 2012-01-13 | RNA (ribonucleic acid) interference target points for inducing hepatocellular injury |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102604938A CN102604938A (en) | 2012-07-25 |
| CN102604938B true CN102604938B (en) | 2014-05-07 |
Family
ID=46522710
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210010355.XA Active CN102604938B (en) | 2011-01-13 | 2012-01-13 | RNA (ribonucleic acid) interference target points for inducing hepatocellular injury |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102604938B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636131B (en) * | 2016-12-05 | 2018-03-02 | 湖南农业大学 | Application of the rice fumarylacetoacetate hydrolase gene in rice fertility control |
-
2012
- 2012-01-13 CN CN201210010355.XA patent/CN102604938B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| TDI致小鼠肝细胞损伤的机制分析;于蕾等;《哈尔滨商业大学学报》;20061030(第5期);全文 * |
| 于蕾等.TDI致小鼠肝细胞损伤的机制分析.《哈尔滨商业大学学报》.2006,(第5期),全文. |
| 小干扰RNA介导的多靶点肿瘤治疗;邵荣光等;《药学学报》;20091231;第44卷(第3期);全文 * |
| 小白鼠脑以及肝细胞中RNA连接酶的研究;王镜岩等;《中国科学B辑》;19841231(第6期);全文 * |
| 王镜岩等.小白鼠脑以及肝细胞中RNA连接酶的研究.《中国科学B辑》.1984,(第6期),全文. |
| 邵荣光等.小干扰RNA介导的多靶点肿瘤治疗.《药学学报》.2009,第44卷(第3期),全文. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102604938A (en) | 2012-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101603042B (en) | RNA interference target for treating hepatitis B virus infection | |
| Sun et al. | Multi-miRNA hairpin method that improves gene knockdown efficiency and provides linked multi-gene knockdown | |
| KR101012595B1 (en) | Small interfering rna and pharmaceutical composition for treatment of hepatitis b comprising the same | |
| Zhang et al. | Antisense inhibition: oligonucleotides, ribozymes, and siRNAs | |
| JP2015003913A (en) | Conserved hbv and hcv sequences useful for gene silencing | |
| CN107365785B (en) | Gene expression vector for regulating and controlling intracellular NF-kB activity and regulating and controlling method and application thereof | |
| US9222090B2 (en) | RNA interference target for treating AIDS | |
| CN103275971A (en) | RNA interference targets for hepatitis b virus (HBV) infection treatment | |
| JP2012528588A (en) | Multi-cistron shRNA expression cassette suppressing single or multi-target genes | |
| JP2013005814A (en) | Method for producing cosmetic for skin care | |
| CN102604938B (en) | RNA (ribonucleic acid) interference target points for inducing hepatocellular injury | |
| CN101348799B (en) | Construction method and pharmaceutical use of microRNA adenovirus expression plasmid for severe hepatitis related gene hfg12, hFas and hTNFR1 | |
| Hooykaas et al. | RNA accessibility impacts potency of Tough Decoy microRNA inhibitors | |
| CN102433352B (en) | MicroRNA structure-based construction method and function verification of hepatic cell selective multi-target interfering plasmid vector | |
| Daniel-Carlier et al. | Viral infection resistance conferred on mice by siRNA transgenesis | |
| CN108517335B (en) | A kind of Lentiviral and its construction method of liver cell miR-199b low expression | |
| JP2015506696A (en) | ShRNA that suppresses TGF-β2 expression | |
| CN103952413B (en) | The rnai expression vector construction of targeting IFNAR 2 gene and application | |
| Gadkari | RNA interference & inhibition of viruses | |
| US20120065246A1 (en) | Rna molecules and therapeutic uses thereof | |
| CN101962642B (en) | Interference RNA for targeting CCP22 gene, medicament composition containing interference RNA and application thereof | |
| JP4505566B2 (en) | Lung cancer therapeutic agent | |
| CN102010880B (en) | Construction method and pharmaceutical application of hFas microRNA adenovirus expression plasmid relevant with severe hepatitis | |
| CN101148466B (en) | RNA disturbance target point for inhibiting MDV proliferating and application thereof | |
| CN102010879B (en) | Construction method and pharmaceutical application of microRNA (micro Ribonucleic Acid) adenovirus expression plasmids of severe hepatitis related gene hTNFR1 (Tumor Necrosis Factor Receptor1) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20181112 Address after: 361005 422 Siming Road, Siming District, Xiamen, Fujian Co-patentee after: Yangshengtang Co., Ltd Patentee after: Xiamen University Address before: 361005 422 Siming Road, Siming District, Xiamen, Fujian Co-patentee before: Xiamen Innovax Biotech Co., Ltd. Patentee before: Xiamen University |