CN101148466B - RNA disturbance target point for inhibiting MDV proliferating and application thereof - Google Patents

Abstract

The present invention belongs to the field of molecular biology and preventive veterinary medicine, and discloses one group of RNA interfere target points on MDV and MDV treating preparations with siRNA or antisense RNA obtained based on these target sequences. Through initial screening based on the available results and transfecting cell with siRNA expression vector, six RNA interfere target points on MDV genome is screened out, with the No. 4 target point having MDV proliferation inhibiting rate as high as 97 %. The present invention relates to the acting site for gene therapy, and may be applied in screening new medicines for preventing and treating MDV infection.

Description

Suppress the RNA disturbance target point and the application thereof of MDV propagation

Technical field

The invention belongs to molecular biology and Preventive Veterinary Medicine field, particularly one group is carried out RNA interferential target spot at MDV, and obtains siRNA or sense-rna is used to prepare the preparation for the treatment of MDV according to these target sequences.

Background technology

Marek (Marek ' s Disease, MD) be by marek's disease virus (Marek ' s Disease Virus, the lymphoproliferative disease of a kind of hyperinfection of the chicken that MDV) causes.MD is widely current in the whole world, is one of the most serious transmissible disease of current harm poultry husbandry, has caused enormous economic loss to aviculture.From developing history and the anti-system present situation of MD, it is not enough only depending on vaccine to control MD, can cause immuning failure such as several factors such as early infection and virus virulence evolution.The MD expert of various countries and researchist are controlling MD new technology and Study on new method and discussion untiringly, in the hope of the enhanced MD that tackles more effectively that epidemiology constantly changes and virulence is evolved day by day.Utilize RNA to disturb (RNAinterference, RNAi) technology provides very effectively and has reached the means of tool prospect for the control of MD, utilize the RNA perturbation technique can obtain the short rna molecular medicine of special inhibition MD virus fast, simultaneously also can obtain to be used for the special gene action site of drug research, these special short rna molecules for the evolution of the early infection of control MD and virulence provides may.

RNA disturbs and to be meant that (Double-stranded RNA dsRNA) induces a kind of special gene silencing (gene silencing) phenomenon of generation to biological double center chain RNA.RNAi extensively is stored in the organisms such as nematode, fruit bat, fungi, plant and animal, is these biological blocking-up transposon effects, resists a kind of important protection mechanism of virus infection, has high conservative on evolving.The research of RNAi has in recent years obtained remarkable progress, the particularly progress on the dsRNA technology of preparing, make this technology of RNAi be applied to a plurality of research fields rapidly, quickened research, and this technology has been applied in the gene therapy research of cancer and virus disease gene function, genetic development, signal transduction mechanism.At present to the RNAi effect really cutter system it be unclear that, it is generally acknowledged, dsRNA is by endonuclease (RNase III, be called as the dicer enzyme at fruit bat RNase III) cut into siRNA (the small in terference RNA of 19～23bp, siRNA, siRNA again with body in some enzymes (comprise restriction endonuclease, excision enzyme, helicase) in conjunction with forming the reticent mixture RISC of RNA inductive (RNA induced silencingcomplex, RISC) RISC combines with the homologous region of mRNA more specifically, effect by enzyme makes the mRNA degraded, makes genes involved silence (gene silence).But this does not influence people's research enthusiasm at all yet, multinomial studies show that, and RNAi is effective at anti-virus aspect, and RNAi is just going on the stage of virus disease prevention and control, is expected to become the strong tool of following control virus infection.Reports such as Gitlin offer the human body cell of vitro culture with specific siRNA, find that siRNA can enter cell and the infection of poliomyelitis virus effectively as medicine.Lee etc. with the carrier cotransfection of HIV, PNL4 3 proviral DNAs and synthetic siRNA to 239 cells, find that HIV 1 DNA expression is obviously suppressed, thereby reduced the infection rate of HIV to mammalian cell, they also find siRNA when cell inner expression, will produce the immunizing power that anti-HIV 1 infects again.Novina etc. utilize siRNA to act on HIV intracellular receptor CD4 and virus structure Gag albumen, have reduced the ability that virus enters cell, thereby have suppressed the infection of HIV effectively.Reports such as Ge Q on cell or chicken embryo, utilize the mRNA of the reticent influenza virus of RNAi technology target, can directly reduce virus mRNA transcribing in host cell, thereby reduce duplicating of virus effectively.In addition, also obtaining similar progress aspect the anti-herpesvirus infection.Because MD virus also belongs to the simplexvirus family member, all be dna virus, the two intracellular duplicate quite similar.On the other hand, on chicken embryo model, use the RNAi technology and succeed, the chicken embryo is described, even also there is RNAi mechanism in chicken body itself.In view of the above, we think, utilize the RNAi technology to come the proteic mRNA of reticent MD encoding viral, will suppress MD virus duplicating in host cell, thereby reduce even eliminate its damage to the chicken body.

Summary of the invention

The objective of the invention is to utilize these target spots to carry out the RNAi effect at the special RNAi action target spot of MDV, can obviously suppress the propagation of MDV, and can this prepare the medicine or the preparation of the anti-MDV effect of tool for obtaining.

The present invention obtain at the special RNAi action target spot of MDV, derive from: at first the online online design tool that provides by U.S. Ambion company obtains the target spot that duplicates at MDV, rule of thumb screen and design the siRNA expression template again, make up the siRNA expression vector, last transfection CEF cell reduces test by plaque and obtains special effective target spot.

The present invention proposes the experience foundation of screening RNAi action target spot sequence: AA (N19) TT or the similar motif of 1. seeking 23 based compositions in the MDV genome.2. select the motif of G/C content between 36%～52%.3. the target sequence of BLAST selection carries out the homology analysis, gets rid of siRNA and suppresses chicken body and the segmental possibility of other virogenes non-specificly.

The present invention proposes the short-cut method that makes up and identify the siNRA expression vector.Synthesizing single-stranded target gene fragment, annealing connects, phosphorylation annealing fragment, with being connected of Psilencer2.1-U6 neo BamH I+Hind III linearized vector, connect the conversion of product and the enzyme of specific siRNA expression vector and cut evaluation, particularly Sal I (GTCGAC) restriction enzyme site is arranged in 3 of strand target gene fragment ' end design, if insert correct, just should be able to be cut by Sal I enzyme, solved because the target sequence that inserts is shorter, the problem that restriction enzyme digestion and the inconvenience of conventional agarose gel electrophoresis are identified, the enzyme that greatly facilitates recon is cut evaluation.

The present invention proposes and judge specific siRNA expression vector RNAi effective means.With specific siRNA expression vector transfection CEF cell, continue to cultivate 8 hours, every hole inoculation 100PFU MDV1 type virulent forms inhibiting rate according to plaque and judges that these target spots are to the effect of MDV inhibition of proliferation.

Target sequence of the present invention is as follows:

AAACATGGACCATTTACCGAC derives from MD virus VP 22 proteic 138 bit sequences;

AAACATAAATCGGCGAAAGCC derives from MD virus VP 22 proteic 171 bit sequences;

AAGATCCTCCGCGAACAAATG derives from MD virus VP 22 proteic 424 bit sequences;

AAACTATTGGAAGAGTCTGGA derives from MD virus VP 22 proteic 537 bit sequences;

AAGAGTCTGGATTATCCCAGG derives from MD virus VP 22 proteic 547 bit sequences;

AAATCTGAACGTACAAGACGC derives from MD virus VP 22 proteic 606 bit sequences;

Experimental results show that, target spot of the present invention has the good restraining effect to MDV propagation, siRNA that obtains according to these target spots or sense-rna can be separately or with the reagent compatibility of any ratio, any array mode and other any treatment MD virus infectiones, or cooperate with other any methods of treatment, with prevention and the treatment that is applied to the MD virus infection.

Sequence that the present invention obtains and action site thereof also have certain meaning to the diagnosis of MD virus, and have the potential using value.

Description of drawings

Accompanying drawing 1 is the evaluation electrophorogram of MDV Ji Yin Group specific siRNA expression vector, and 1 cuts the carrier segments that MDV Ji is obtained Yin Group specific siRNA expression vector for cutting enzyme with the restricted endoenzyme of Sal I among the figure.2 is that MDV Ji is Yin Group specific siRNA expression vector.3 is DL15000 DNA Marker (precious biotechnology (Dalian) company limited).Product plasmid pSi Iencer ^TM2.1-U6 neo does not have Sal I restriction enzyme site, and we have designed the restriction enzyme site of Sal I in the insertion sequence the inside, if insert correctly, just should be able to be cut by Sal I enzyme.The electrophoretic analysis results suggest, MDV Ji is Yin the success of Group specific siRNA expression vector establishment.

Embodiment

The experiment that suppresses MD virus infection CEF cell below in conjunction with different siRNA is described in further details the present invention.

1. experimental technique

1.1siRNA dna profiling design: according to experiment experience, utilize biosoftware, the gene order of the MDV (virus strain is Md5) that delivers according to GENEBANK designs and has prepared 6 siRNA, and the gene of institute's target is a UL49 gene order of expressing viral cortex albumen Vp22 in the MDV virus.The BLAST software that adopts NCBIGenBank (u.s. national library of medicine and NIH write) to provide at last, the target sequence of selecting is carried out the homology analysis, get rid of siRNA and suppress chicken body and the segmental possibility of other virogenes non-specificly.PSilencer ^TM2.1-U6 neo vector has the U6 promotor, can transcribe siRNA.Design can be cloned into pSilencer ^TM2.1-U6 the hair fastener shape siRNA of neo vector, after oligonucleotide forms two strands, have BamH I (GATCC) restriction enzyme site at 5 ' end, have Sal I (GTCGAC) and Hind III (TTCGA) restriction enzyme site at 3 ' end, it is the positive-sense strand of 19 Nucleotide that 5 ' end begins, to form hairpin structure, 3 ' end is added with transcription termination signal TTTTTT to 9 Nucleotide TTCAAGAGA of middle adding at interval.

Table 1 siRNA dna profiling sequence

1.2 the annealing of strand target gene fragment connects

With 50 μ L annealing buffers (200mmol/L NaCL, 20mmol/L Tris, pH7.6) dissolving synthetic strand target gene fragment, respectively get 2 μ L (1.32 μ g/ μ L), join in the 16 μ L annealing buffers, 5min in 94 ℃ of water-baths naturally cools to room temperature then.

1.3 phosphorylation annealing fragment is connected with Psilencer2.1-U6 neo BamH I+Hind III linearized vector

The phosphorylation fragment of annealing is connected with Psilencer2.1-U6 neo BamH I+Hind III linearized vector, linked system is: 10X T4 dna ligase damping fluid 1 μ L, Psilencer2.1-U6 neo BamH I+Hind III linearized vector 1 μ L, phosphorylation annealing fragment 1 μ L, T4 dna ligase 1 μ L, moisturizing to 10 μ L, centrifugal mixing, room temperature two hours, 4 ℃ of overnight incubation.

1.4 connect the conversion of product and the Screening and Identification of specific siRNA expression vector

In 100 μ L competence DH5 α, add 5 μ L and connect product, mixing, ice bath 30min, 42 ℃ of heat shock 90sec add 900 μ L LB substratum in the ice bath, cultivate 1h, get 50 μ L and coat Amp resistance LB flat board, 37 ℃ of overnight incubation for 37 ℃.3 bacterium colonies of picking are inoculated in the LB test tube that 5mL contains Amp at random, 37 ℃ of overnight incubation.Use the plasmid a small amount of extraction agent box of QIAGEN company to extract plasmid then, carry out Sal I enzyme at last and cut evaluation.The endonuclease reaction system is: 10 * H, 1 μ L, extract plasmid 8 μ L, and Sal I 1 μ L, reaction volume are 10 μ L.Hatch 2h for 37 ℃, get 10 μ L and on 1.5% sepharose, carry out electrophoresis.Evaluation can be expressed the recombinant vectors of UL49 gene specific siRNA, is labeled as pVP22siRNAs.

1.5 specific siRNA expression vector pVP22siRNAs transfection CEF cell is also observed its restraining effect to the MDV virus multiplication

Transfection the day before yesterday,,, treat that cell can be used as transfection when growing to 60～80% left and right sides with 5 * 104 cell inoculations in every hole (nutrient solution is the DMEM that contains 10% serum) in 24 porocyte culture plates with the former generation CEF monolayer cell trysinization of growing fine.With DMEM substratum dilution specific siRNA expression vector pVP22siRNA to the 0.1ug/ μ L that does not contain serum.Draw 33 μ L and dilute the DMEM substratum that good pVP22siRNA and 837.1 μ L do not contain serum, be mixed, add 9.9 μ L transfection reagent TransFast (Promega) again, mixing gently, vortex and low-speed centrifugal, room temperature is placed 10min.With the nutrient solution sucking-off in the culture plate, with the DMEM of serum-free washing 2 times and blot.Mixed solution with above-mentioned preparation joins in the culture plate again, every hole 200 μ L.Put to cultivate in 37 ℃, 5%CO2 incubator and add the DMEM that 1mL contains 3% serum behind the 1h and continue to cultivate 8 hours, cell culture fluid is abandoned in suction, wash gently twice with PBS, inoculation MDV1 type virulent RB1B strain, every hole 100PFU, put in 37 ℃, 5%CO2 incubator and adsorb 30min, every hole adds the DMEM 1mL that contains 2% serum continues to cultivate 5 days, observes plaque and forms situation.

2. experimental result

2.1 the evaluation of specific siRNA expression vector

From identifying electrophorogram (accompanying drawing 1) as can be seen, the UL49 gene specific siRNA expression vector that contains the siRNA expression cassette successfully makes up.

2.2 different siRNA expression vector transfection CEF cells are to the effect of MDV inhibition of proliferation

The results are shown in Table 2.As can be seen from Table 2,4 pairs of MDV inhibition of proliferation of sequence effect is best, the plaque inhibiting rate reaches 97%, 1,5 pairs of MDV inhibition of proliferation effects of sequence are better, the plaque inhibiting rate is all above 80%, and the propagation of 6 couples of MDV of sequence has moderate inhibition effect, and the plaque inhibiting rate reaches 66.67%, and 2,3 pairs of MDV inhibition of proliferation effects of sequence a little less than, the plaque inhibiting rate all is lower than 50%.

The different siRNA expression vector of table 2 transfection CEF cell is to the effect of MDV inhibition of proliferation

Sequence table

Claims (2)

1. suppress the RNA disturbance target point Nucleotide of MDV propagation, its nucleotides sequence is classified as:

5’-AAACTATTGGAAGAGTCTGGA-3’。

2. the application of the RNA disturbance target point Nucleotide of the described inhibition of claim 1 MDV propagation in preparation control MDV virus infective medicament.

Images