CN109694867B

CN109694867B - DICER1 gene and application of siRNA thereof

Info

Publication number: CN109694867B
Application number: CN201811584728.8A
Authority: CN
Inventors: 肖书奇; 李爽; 张晓彬
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2018-12-24
Filing date: 2018-12-24
Publication date: 2022-04-15
Anticipated expiration: 2038-12-24
Also published as: CN109694867A

Abstract

The invention discloses a DICER1 gene and application of siRNA thereof in influencing PRRSV replication, wherein the invention specifically knocks down DICER1 by the siRNA, then detects the influence of DICER1 on PRRSV infected host cells by qRT-PCR and TCID50, and finds that the reproduction and proliferation of PRRSV can be influenced after the host factor DICER1 is specifically knocked down, the specific siRNA of the host factor DICER1 can be used for developing drugs for preventing and treating PRRSV, and the corresponding gene DICER1 can be used for research on anti-PRRSV transgenic pigs.

Description

DICER1 gene and application of siRNA thereof

Technical Field

The invention relates to the technical field of antiviral research, in particular to application of DICER1 gene and siRNA thereof in influencing PRRSV replication.

Background

Porcine Reproductive and Respiratory Syndrome (PRRS) is the most severe swine disease that causes economic loss in north america, europe and asia. The etiological agent of the disease is PRRS virus (PRRSV), which mainly causes respiratory diseases of piglets, poor growth performance, reproductive disorders, intrauterine infection and the like. Reproductive disorders in PRRS-induced losses account for approximately 45%, with abortions, stillbirths, mummies and respiratory diseases among newborn piglets. In the most severe cases, reproductive disorders can lead to a 90% mortality rate in newborn piglets. Pigs surviving uterine infections later become virulent, resulting in endemic herds.

PRRSV can be classified into european genotype (type 1) and north american genotype (type 2), with Lelystad and VR-2332 being prototype strains, respectively. In each genotype, viruses can be divided into different subtypes according to their genomic characteristics and pathogenicity. In china, HP-PRRSV appeared in 2006 with two genetic markers with two discrete 30aa (29aa +1aa) deletions in the NSP2 gene, resulting in the death of over 100 million pigs in 2006 throughout the year and has become the major PRRSV strain in asia. Recently, NADC30-like PRRSV appeared in china, similar to NADC 30. In the past two years, NADC30-like PRRSV has spread to several provinces as the main local strain for vaccinating pigs. Compared with the highly pathogenic PRRSV (HP-PRRSV) which appeared since 2006 and became the main epidemic strain in China, the toxicity of the NADC30-like PRRSV was relatively low, resulting in clinical respiratory symptoms, with a pig mortality rate of 30-50%. An outbreak of NADC30-like PRRSV vaccinated against herds indicates the ineffectiveness of the current commercial vaccine.

In living cells, Dicer enzymes generally function in the larger protein complexes required to initiate the RNA silencing pathway. In tetrahymena thermophila, Dcr2 is physically coupled to RNA-dependent RNA polymerase Rdr1 for the biogenesis of siRNAs. In Drosophila melanogaster, Dcr-2 interacts with the protein R2D2 and facilitates the loading of siRNA onto Ago 2. In C.elegans, Dcr-1 is associated with more than 20 other protein factors and is present in at least two distinct functional complexes responsible for initiating both endogenous and exogenous RNA interference (RNAi) pathways. In addition to producing small RNA duplexes, Dicer itself can also serve as a molecular scaffold in all of these complexes. Machitani et al demonstrate that Dicer mediates the processing of adenovirus-encoded small RNAs to act as a negative regulator of adenovirus replication. However, at present, no relevant report exists on whether DICER1 gene mutation affects the replication and proliferation of PRRSV.

Therefore, providing an siRNA that can affect PRRSV replication and proliferation is a problem that needs to be addressed by those skilled in the art.

Disclosure of Invention

In view of the above, the present invention provides a DICER1 gene and its siRNA application in affecting PRRSV replication.

In order to achieve the purpose, the invention adopts the following technical scheme:

an siRNA targeting DICER1, the siRNA having the sequence:

sense strand: UCCAGAGCUGCUUCAAGCA, respectively; SEQ ID No. 1;

antisense strand: UGCUUGAAGCAGCUCUGGA, respectively; SEQ ID NO. 2.

Further, the siRNA targeting DICER1 is applied to inhibiting the expression of the host factor DICER 1.

Further, the siRNA targeting DICER1 is applied to preparation of medicines for preventing and treating PRRSV.

Furthermore, the application of a host factor DICER1 in inhibiting the replication and proliferation of PRRSV, after the PAMs cells are transfected by siRNA specifically knocking down DICER1, the expression of DICER1 can be effectively inhibited, so that the replication and proliferation of PRRSV in the PAMs cells can be inhibited.

Further, the application of a host factor DICER1 in developing PRRSV resistant transgenic pigs.

The nucleotide sequence of the host factor DICER1 is shown in SEQ ID NO. 3.

According to the technical scheme, compared with the prior art, the invention discloses and provides the DICER1 gene and the application of siRNA thereof in influencing the reproduction of PRRSV, the invention specifically knocks down DICER1 by utilizing siRNA, then detects the influence of DICER1 on PRRSV infected host cells by qRT-PCR and TCID50, and finds that the reproduction and proliferation of PRRSV can be influenced after the host factor DICER1 is specifically knocked down, the specific siRNA of the host factor DICER1 can be used for developing drugs for preventing and treating PRRSV, and the corresponding gene DICER1 can be used for researching anti-PRRSV transgenic pigs.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a graph showing the relative expression level of DICER1 mRNA in PAMs when infected with HP-PRRSV GD-HD strain according to the present invention;

FIG. 2 is a graph showing the relative expression amount of PRRSV ORF7 mRNA when infecting HP-PRRSV GD-HD strain according to the present invention;

FIG. 3 is a drawing showing the copy number of PRRSV genomes in the culture supernatants of PAMs cells when the invention is infected with HP-PRRSV GD-HD strain;

FIG. 4 is a graph showing the virus titer in the culture supernatants of PAMs cells when infected with the HP-PRRSV GD-HD strain of the present invention;

in FIGS. 1-4, DICER 1-siRNA: infection of HP-PRRSV GD-HD strain after transfection of siRNA against DICER1 in PAMs; control siRNA group: infecting HP-PRRSV GD-HD after transfecting irrelevant siRNA in the PAMs; normal cell control: PAMs infect HP-PRRSV GD-HD; blank control: adding transfection reagent into PAMs to infect HP-PRRSV GD-HD;

FIG. 5 is a graph showing the relative expression level of DICER1 mRNA in PAMs when infected with N-PRRSV strains according to the present invention;

FIG. 6 is a graph showing the relative expression amount of PRRSV ORF7 mRNA when the N-PRRSV strain is infected with the present invention;

FIG. 7 is a graph showing the copy number of PRRSV genomes in the culture supernatants of PAMs cells when infected with N-PRRSV strains according to the present invention;

FIG. 8 is a graph showing the virus titer in the culture supernatants of PAMs cells when infected with N-PRRSV strains according to the invention;

in FIGS. 4-8, DICER 1-siRNA: infection of N-PRRSV strains following transfection of siRNA against DICER1 in PAMs; control siRNA group: infecting N-PRRSV after transfecting irrelevant siRNA in the PAMs; normal cell control: PAMs are infected with N-PRRSV; blank control: after adding a transfection reagent into the PAMs, infecting the PAMs with N-PRRSV;

FIG. 9 is a graph showing the relative expression levels of DICER1 mRNA in PAMs when infected with the strain NADC30-like according to the present invention;

FIG. 10 is a graph showing the relative expression amount of PRRSV ORF7 mRNA when the strain NADC30-like is infected with the present invention;

FIG. 11 is a graph showing the copy number of PRRSV genomes in the culture supernatants of PAMs cells when infected with the strain NADC30-like according to the present invention;

in FIGS. 9-11, DICER 1-siRNA: infection of NADC30-like strain following transfection of siRNA against DICER1 in PAMs; control siRNA group: infection of NADP 30-like following transfection of irrelevant siRNA in PAMs; normal cell control: PAMs infected with NADC 30-like; blank control: adding transfection reagent into PAMs and then infecting NADC 30-like;

FIG. 12 is a graph showing the relative expression levels of DICER1 mRNA in PAMs when infected with GZ11-G1 strain according to the present invention;

FIG. 13 is a graph showing the relative expression amount of PRRSV ORF7 mRNA when the GZ11-G1 strain is infected with the invention;

in FIGS. 12-13, DICER 1-siRNA: infection of the GZ11-G1 strain following transfection of siRNA against DICER1 in PAMs; control siRNA group: infection with GZ11-G1 following transfection of irrelevant siRNA in PAMs; normal cell control: PAMs infect GZ 11-G1; blank control: PAMs were infected with GZ11-G1 after addition of transfection reagents.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

DMEM medium, Opti-MEM medium, RPMI-1640 medium, and siRNA transfection reagents were purchased from Life Tech; trypsin and fetal calf serum were purchased from BI corporation; the siRNA sequence and the primer are synthesized by Shanghai Invitrogen company; FastStartUniversal SYBR Green Master reagent was purchased from Roche;

HS enzymes, RNA extraction reagents (RNAioso Plus), reverse transcription kit (PrimeScript RT regent kit) purchased from Takara; PAMs cells are lung tissue (porcine alveolar macrophages) isolated from 6-week-old piglets; MARC-145 cells (derived cell line from rhesus monkey kidney cells MA-104), highly pathogenic PRRSV strain GD-HD (GenBank ID: KP793736.1), less pathogenic PRRSV strain CH1a (GenBank ID: AY032626.1), NADC30-like, GZ11-G1(GenBank: KF001144.1) were maintained by the veterinary etiology and biology laboratory of the university of agriculture and forestry, northwest.

EXAMPLE 1 Effect of knocking-down DICER1 on HP-PRRSV replication in PAMs cells

(1) siRNA transfection and cell inoculation of DICER 1:

1) plate paving: isolation of porcine alveolar macrophages from 6-week-old piglet lung tissue, cell counting and plating at 37 ℃ with 5% CO₂Culturing in an incubator;

2) transfection: the transfection Reagent is Lipofectamine RNAIMAMAX Reagent from Life Tech company, and transfection is carried out according to the operation steps of the transfection Reagent. After plating for 12h, a transfection mixture (siRNA from DICER1 and Lipofectamine RNAImax Reagent were dissolved in Opti-MEM, respectively, and mixed) was prepared and incubated at room temperature for 5 min. Taking out the 24-well plate from the incubator, washing the 24-well plate by PBS, replacing the washed plate with Opti-MEM, dropwise adding the mixture into the incubator, shaking the mixture uniformly, and placing the mixture into a cell culture box for culture;

3) and (3) virus inoculation: after 24h of transfection, the virus was inoculated, the HP-PRRSV GD-HD strain was inoculated at 0.01MOI, and the required virus fluid was calculated according to the formula PFU-cell number × MOI-0.7 × TCID 50. Taking out the 24-pore plate, washing with PBS, adding virus diluent, culturing at 37 ℃ for 1h, removing the virus liquid, and changing to 1640 culture medium with serum content of 3%;

4) collecting a sample: cell samples and cell culture supernatants were harvested at 0h, 12h, 24h and 36h post infection and stored at-80 ℃. Cell samples were used to detect the relative expression level of PRRSV ORF7 gene in cells, and cell culture supernatants were used to detect the copy number of the viral genome released into the culture supernatants and viral titer.

(2) RT-qPCR detection of DICER1 and PRRSV ORF7 mRNA relative expression levels in PAMs:

1) RNA is extracted from cells and inverted to cDNA

Total RNA from PAMs cells was extracted using Takara RNAiso Plus.

The method comprises the following steps: adding RNAioso Plus of TAKARA company into the cells, and fully cracking; sequentially adding chloroform and isopropanol according to the operation instruction, centrifuging, and depositing RNA at the bottom of the tube; adding 75% ethanol to wash RNA, drying the precipitate, and dissolving with appropriate amount of RNase-free water.

Determination of RNA concentration, purity and integrity, determination of RNA concentration and purity on a Biotek Millipore Meter, OD₂₆₀/OD₂₈₀The ratio of (A) to (B) is 1.8-2.0, and agarose gel electrophoresis is carried out simultaneously, and 5S rRNA, 18S rRNA and 28S rRNA bands of detected RNA are observed by a gel imaging system, and the three bands are clear and complete.

The extracted RNA was subjected to reverse transcription using reverse transcription Kit (PrimeScriptTM RT Reagent Kit) of Takara.

Reverse transcription reaction system: 5 XPrimeScript Buffer, 2. mu.l;

RT Enzyme MixI，0.5μl；Oligo dT Primer(50μM)，0.5μl；Random Primer(100μM)，0.5μl；Total RNA，500ng；RNase Free ddH₂o, make up to 10. mu.l.

The reaction conditions of reverse transcription are as follows: at 37 ℃ for 20 min; 5s at 85 ℃; 4 ℃ is prepared.

2) Performing RT-qPCR detection, wherein each sample needs to detect the mRNA expression quantity of DICER1 and PRRSV ORF7 in PAMs, internal references are HPRT-1 genes, and a PCR reaction system (10 mu l): 2 XSSYBR Green Mix 5.0. mu.l, ddH2O 2.0.0. mu.l, forward primer (12. mu.M) 0.25. mu.l, reverse primer (12. mu.M) 0.25. mu.l, template cDNA 2.5. mu.l.

The PCR reaction program is: 10min at 95 ℃; 15s at 95 ℃; 30s at 60 ℃; 15s at 95 ℃; 40 cycles.

By using

Results were analyzed using StepOne Software v2.3 Software from the Real-Time PCR System Instrument.

The RT-qPCR primers are:

DICER1-F：GCTTGAAGCAGCTCTGGAT；SEQ ID NO.4；

DICER1-R：CAGCTGACACTTGTTGAGCA；SEQ ID NO.5；

PRRSV-ORF7-F：AGATCATCGCCCAACAAAAC；SEQ ID NO.6；

PRRSV-ORF7-R：GACACAATTGCCGCTCACTA；SEQ ID NO.7；

HPRT1-F：TGGAAAGAATGTCTTGATTGTTGAAG；SEQ ID NO.8；

HPRT1-R：ATCTTTGGATTATGCTGCTTGACC；SEQ ID No.9。

the results of the relative expression amount of DICER1 mRNA in PAMs are shown in FIG. 1, and when HP-PRRSV GD-HD strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression amount of DICER1 mRNA in PAMs was reduced by 67.6%, 70%, 72.8% and 62.7% when compared to the control siRNA group at 0hpi, 12hpi, 24hpi and 36hpi, respectively.

Results of relative expression of PRRSV ORF7 mRNA As shown in FIG. 2, when HP-PRRSV GD-HD strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression of PRRSV ORF7 mRNA was reduced by 66.5%, 87.1% and 85.2% at 12hpi and 24hpi, respectively, compared to the control siRNA group.

(3) RT-qPCR assay determines PRRSV genome copy number in cell culture supernatants:

1) mixing 400ul of the cell culture supernatant collected in the step (1) with 400ul of RNAioso Plus, then cracking, extracting RNA and dissolving in 15 ul of RNase-free water;

2) preparing a reverse transcription reaction system: 5 XPrimeScript Buffer, 2. mu.l;

RT Enzyme MixI, 0.5. mu.l; oligo dT Primer (50. mu.M), 0.5. mu.l; random Primer (100. mu.M), 0.5. mu.l; total RNA, 6.5. mu.l. The reaction conditions of reverse transcription are as follows: at 37 ℃ for 20 min; 5s at 85 ℃; 4 ℃;

3) positive standards (plasmid standards containing PRRSV ORF7 gene fragment) were prepared and the PRRSV genomic copy number in the cell culture supernatants was calculated: the complete CDS region (372bp) of PRRSV ORF7 is cloned into a pMD-18T vector, transformed to trans5 alpha competence, and subjected to sequencing identification after plasmid extraction. Plasmid DNA concentration was determined and designated pMD-18T-ORF7 (initial concentration 5.5 ng/. mu.l) as an absolute quantitative standard, and 10-fold gradient dilutions were made according to the formula: copy number (copies) × (mass/molecular weight) × 6.0 × 1023, the copy number of the standard substance of different dilutions was calculated to form a standard curve of RT-qPCR, detection was performed with PRRSV-ORF7RT-qPCR primers, data were analyzed with a Real time PCR analyzer, and the PRRSV genome copy number per ml of cell culture supernatant was calculated.

The results are shown in FIG. 3, where the HP-PRRSV GD-HD strains 12hpi, 24hpi and 36hpi were infected after transfection of siRNA against DICER1 in PAMs, PRRSV genomic copy number in PAMs culture supernatants was reduced by 53.3%, 96.5% and 96.3% respectively compared to the control siRNA group.

(4) TCID50 assay of PRRS virus titer in cell culture supernatants:

1) plate paving: pancreatic enzyme-digested MARC-145 cells were added to a suitable amount of DMEM medium containing 10% FBS to adjust the density to 1X 10⁵One/ml, added to a 96-well cell culture plate to allow cells to grow into a monolayer;

2) the harvested virus-containing DMEM medium without serum in sterilized EP tubesThe cell supernatant of (a) was subjected to serial 10-fold dilution from 10^-1～10^-10Each dilution is mixed thoroughly and homogeneously;

3) sequentially inoculating the cells into MARC-145 cells from high dilution to low dilution, inoculating one vertical row of 8 holes in each dilution, inoculating 100 mu l of each hole, and taking two vertical rows as normal cell controls;

4) observing day by day from the next day and recording the result, and observing for 5-7 days;

5) the calculation was made for TCID50 with reference to the Reed-Muench method.

Results As shown in FIG. 4, when HP-PRRSV GD-HD strain was infected after transfection of siRNA against DICER1 in PAMs, the virus titers in cell culture supernatants were reduced by 0.29-log, 0.63-log and 0.67-log (P <0.05) at 12hpi, 24hpi and 36hpi, respectively.

The above results indicate that knocking down DICER1 expression can significantly inhibit HP-PRRSV replication in PAMs cells.

EXAMPLE 2 Effect of knocking-down DICER1 on N-PRRSV replication in PAMs cells

(1) siRNA transfection and cell inoculation of DICER 1:

plating, transfection, inoculation (0.1MOIN-PRRSV CH1a) and collection were as in example 1.

(2) RT-qPCR detection of DICER1 and PRRSV ORF7 mRNA relative expression levels in PAMs

RNA extraction from cells, inversion to cDNA and RT-qPCR detection were as in example 1.

The results of the relative expression amounts of DICER1 mRNA in PAMs are shown in FIG. 5, and when N-PRRSV CH1a strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression amounts of DICER1 mRNA in PAMs were reduced by 83.4%, 90.3%, 71.2% and 77.2% at 0hpi, 12hpi, 24hpi and 36hpi, respectively, compared with the control siRNA group.

The results of relative expression of PRRSV ORF7 mRNA are shown in fig. 6, and when N-PRRSV CH1a strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression of PRRSV ORF7 mRNA was reduced by 96.4%, 99.8% and 98% at 12hpi, 24hpi and 36hpi, respectively, compared to the control siRNA group.

(3) RT-qPCR detection for determining PRRSV genome copy number in supernatant sample

The same procedure as in example 1 was followed to extract RNA from the cell culture supernatant, reverse transcription, prepare a positive standard (plasmid standard containing PRRSV ORF7 gene fragment), and calculate the PRRSV genomic copy number in the supernatant sample.

The results are shown in FIG. 7, where N-PRRSV CH1a strain 12hpi, 24hpi and 36hpi were infected after transfection of siRNA against DICER1 in PAMs, PRRSV genomic copy number in PAMs culture supernatants was reduced by 89.2%, 99.4% and 99.9% respectively compared to control siRNA groups.

(4) TCID50 determination of PRRS Virus titre in cell culture supernatants

Plating, dilution by fold of the virus-containing cell supernatant, measurement, observation and calculation were the same as in example 1.

Results as shown in FIG. 8, when N-PRRSV CH1a strain was infected after transfection of siRNA against DICER1 in PAMs, the viral titers in cell culture supernatants were reduced by 1.7-log, 3.0-log and 3.3-log (P <0.05) at 12hpi, 24hpi and 36hpi, respectively.

The above results indicate that knocking down DICER1 expression can significantly inhibit N-PRRSV replication in PAMs cells.

Example 3 Effect of knocking-Down DICER1 on NADC30-like replication in PAMs cells

(1) siRNA transfection and cell inoculation of DICER 1:

plating, transfection, inoculation (0.01MOI NADC30-like) and collection were as in example 1.

The RT-qPCR primers are:

NADC30-like-ORF7-F：ATGGCCAGCCAGTCAATCAGCTGTG；SEQ ID NO.10；

NADC30-like-ORF7-R：CCCGGTCCCTTGCCTCTGGACTGGT；SEQ ID NO.11。

the results of the relative expression amounts of DICER1 mRNA in PAMs are shown in FIG. 9, and when the strain NADC30-like was infected after transfection of siRNA against DICER1 in PAMs, the relative expression amounts of DICER1 mRNA in PAMs were reduced by 70.5%, 61.1%, 65% and 80.4% at 0hpi, 12hpi, 24hpi and 36hpi, respectively, compared to the control siRNA group.

Results of relative expression of PRRSV ORF7 mRNA as shown in fig. 10, when NADC30-like strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression of PRRSV ORF7 mRNA was reduced by 63.9%, 80.6% and 98.6% at 12hpi, 24hpi and 36hpi, respectively, compared to the control siRNA group.

(3) RT-qPCR detection for determining PRRSV genome copy number in cell culture supernatant

The same procedure as in example 1 was followed to extract RNA from the cell culture supernatant, reverse transcription, prepare a positive standard (plasmid standard containing PRRSV ORF7 gene fragment), and calculate the PRRSV genomic copy number in the cell culture supernatant.

The results are shown in figure 11, where NADC30-like strains 12hpi, 24hpi and 36hpi were infected following transfection of siRNA against DICER1 in PAMs, PRRSV genome copy number in the PAMs cell culture supernatants was reduced by 61.7%, 71.3% and 99.2% compared to the control siRNA group, respectively.

The above results indicate that knocking down DICER1 expression can significantly inhibit NADC30-like replication in PAMs cells.

Example 4 Effect of knocking-down DICER1 on GZ11-G1 replication in PAMs cells

(1) siRNA transfection and cell inoculation of DICER 1:

plating, transfection, inoculation (0.01MOI GZ11-G1) and collection were as in example 1.

The RT-qPCR primers are:

GZ11-G1-ORF7-F：ATGGCCGGTAAAAATCAGAGCCAGA；SEQ ID NO.12；

GZ11-G1-ORF7-R：CTAGGTTGCTGGCGCTGGGACTTTA；SEQ ID NO.13。

the results of the relative expression amounts of DICER1 mRNA in PAMs are shown in FIG. 12, and when GZ11-G1 strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression amounts of DICER1 mRNA in PAMs were reduced by 73.1%, 76.8%, 94.8% and 63.6% when compared with the control siRNA group at 0hpi, 12hpi, 24hpi and 36hpi, respectively.

The results of relative expression of PRRSV ORF7 mRNA are shown in fig. 13, and when GZ11-G1 strain was infected after transfection of siRNA against DICER1 in PAMs, the relative expression of PRRSV ORF7 mRNA was reduced by 68.4%, 68.0% and 52.0% at 12hpi, 24hpi and 36hpi, respectively, compared to the control siRNA group.

The results show that the expression of the knocking-down DICER1 can obviously inhibit the replication of GZ11-G1 in PAMs cells.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> northwest agriculture and forestry science and technology university

<120> DICER1 gene and application of siRNA thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> RNA

<213> Artificial Sequence

<400> 1

uccagagcug cuucaagca 19

<210> 2

<211> 19

<212> RNA

<213> Artificial Sequence

<400> 2

ugcuugaagc agcucugga 19

<210> 3

<211> 5995

<212> DNA

<213> Artificial Sequence

<400> 3

ttgaaacact ggatgaatga aaagccctgc tttgcaaccc ctcagcatgg caggcctgca 60

gctcatgacc cctgcttcct caccaatggg tcctttcttt ggactgccat ggcaacaaga 120

agcaattcat gataacattt atacgccaag aaaatatcag gttgaactgc ttgaagcagc 180

tctggatcat aataccatag tctgtttaaa cactggctca gggaagacgt ttattgcagt 240

actactcact aaagagctgt cctatcagat caggggagac ttcaacagaa atggcaaaag 300

gacggtgttc ttggtcaact ctgcaaacca ggttgctcaa caagtgtcag ctgttaggac 360

tcactcggat ctcaaggttg gggaatactc gaacctagaa gtaaatgcat cttggacaaa 420

agagaaatgg aaccaagagt ttactaagca ccaggttctt gttatgactt gctctgtcgc 480

cttgaatgtt ttgaaaaatg gttacttagc actgtcagac attaaccttt tggtgttcga 540

tgagtgtcat cttgcaatcc tagatcaccc ctaccgagag attatgaagc tctgtgaaaa 600

ttgtccatca tgtcctcgta ttttggggct aactgcttcc attttaaatg ggaaatgtga 660

tccagaggaa ttggaagaaa agatacagaa actggagaaa attcttaaga gtaatgctga 720

aactgcaact gacttggtgg tcttagacag atatacttct cagccatgtg agattgtggt 780

agactgtgga ccatttactg acagaagtgg gctttatgaa agactgctga tggaattaga 840

agaagctctc aattttatca atgactgtaa catagctgta cattcaaaag aaagagattc 900

tactttaatt tccaaacaga tactgtcaga ctgtcgtgca gtattggtag ttctgggacc 960

ttggtgtgca gataaagtag ctggaatgat ggtaagagaa ctacagaaat atatcaaaca 1020

tgaacaagag gagctgcaca ggaaatttct attgtttaca gacactttcc tgaggaaagt 1080

acacgcgctg tgtgaagggc acttctcccc tgccgcgctt gacctgagat ttgtgactcc 1140

taaagtcata aaactgctcg aaatcttacg caagtacaaa ccctacgagc gacagcagtt 1200

tgaaagcgtt gagtggtata ataataggaa tcaggataat tacgtgtctt ggagtgattc 1260

ggaggatgat gaggaggacg aagaaattga agaaaaagaa aagccggaga cgaattttcc 1320

ttctccattt accaatattt tatgtggaat tatttttgtg gaaagaagat acacggcagt 1380

tgtcttaaac agattgataa aggaagctgg caaacaagat ccagagctgg cttacatcag 1440

cagcagcaat tttataactg gacatggcat tggaaagaat cagcctcgta acaaacagat 1500

ggaagcagaa ttcagaaaac aggaagaggt acttaggaaa tttcgagctc acgaaaccaa 1560

cctgctgatt gccacgagca ttgtggaaga gggtgttgat ataccaaaat gcaacctggt 1620

ggttcgtttc gatctgccca cagagtatcg atcctacgtt cagtctaagg gaagagcaag 1680

ggcgccaatc tctaattacg tcatgttagc agatacggac aaaataaaga gttttgaaga 1740

agaccttaaa acatacaaag ctattgaaaa gatcttgaga aacaaatgct ccaagtccgt 1800

tgagagtggg gagaccgacc ttgagcccgt ggtggatgac gacgacatct tcccccccta 1860

cgtgctgcgg cccgacgatg gcggtccccg ggtcaccatc aacacggcca ttggacacat 1920

caacagatac tgtgctagat tacccagtga cccgtttact catctggctc ctaagtgtag 1980

aacccgagag ttgcctgatg gtacatttta ttcaactctt tatctgccaa ttaattcacc 2040

tcttcgagcc tccattgttg gccccccaat gagctgtata cgattggctg aaagagtcgt 2100

ggctctcatt tgctgtgaaa aactgcacaa aattggtgaa ctggatgacc atttgatgcc 2160

ggttgggaaa gagacggtta aatacgaaga ggagcttgat ttacatgatg aggaggagac 2220

cagtgttcca ggaagaccag gctccacaaa acgaagacag tgctacccaa aagcgattcc 2280

agaatgtttg cgggacagct accccaagcc cgatcagccc tgttacctgt atgtgatagg 2340

gatggttctg acaacacctc tccccgatga actcaacttt agaaggcgga agctctatcc 2400

ccccgaggac accacaagat gcttcggaat actgacagcc aaacccatac ctcagattcc 2460

tcactttcct gtgtacacac gctctggaga ggtcaccatt tccattgagt tgaagaagtc 2520

tggtttcacg ctgtctctgc aaatgcttga gctgattaca agacttcacc agtatatatt 2580

ttcacatatt cttcggcttg agaaacctgc actagagttt aaacccaccg acgctgactc 2640

agcatactgt gttctacctc ttaatgtcgt taatgactcc agcactttgg acattgactt 2700

taaattcatg gaagacatcg agaaatcaga agctcgcata ggcattccca gtacaaagta 2760

ttcaaaagaa acaccttttg tttttaaatt agaagattac caagatgcag ttatcattcc 2820

aaggtatcgc aattttgatc agcctcatcg attttacgta gctgatgtgt acactgatct 2880

taccccactg agtaaatttc cttcccctga gtatgaaact tttgcagaat attataaaac 2940

gaagtataac cttgacctga ccaatctcaa ccagccgctg ctggatgtgg accacacatc 3000

gtcaagactt aatcttttga cacctcgcca tttgaatcag aaggggaaag ctcttcctct 3060

gagcagcgct gaaaagagga aagccaaatg ggagagtctg cagaacaaac agatcctggt 3120

tccggaactc tgtgctatcc atccaattcc agcatcactg tggagaaaag cagtctgtct 3180

ccccagcatc ctttatcgcc ttcactgcct tctgaccgcg gaggagctaa gagcccagac 3240

ggccagcgat gctggtgtgg gagtcagatc acttcccgtg gattttagat accccaactt 3300

agacttcggg tggaaaaaat ccatcgacag caaatctttc atctcagttg ctaactcctc 3360

ttcagctgaa aacgagaact actgtaagca cagccccctc gtccctgaac atgctgcaca 3420

tcgaggtgct aaccgaccct ccgctctcga aaatcacggc cacacgtctg tgacctgccg 3480

agcgctcctc agcgagtccc ctgctaagct cccgatcgac gttgcaacag atctgacagc 3540

agtgaacggt ctttcgtaca ataaaaatct tgccaatggc agttacgact tagctaacag 3600

agacttttgc caaggaaatc atctgagtta ctacaagcag gaaatacctg tacaaccaac 3660

tacctcatat cccattcaga atttatacaa ttacgagaac cagccccagc ccagcgatga 3720

atgtactcta ctgagtaata aataccttga tggaaatgct aacaaatcta cctcagaagg 3780

acgtcccacg atgcctggta ctacagaggc tggtaaggcg ctttcggaaa ggatggcttc 3840

tgcgcagagc cctgctccgg gctactcccc gaggactcct ggcccaaacc ctggactcat 3900

ccttcaggct ctgacccttt caaacgctag cgacggattt aacctggagc ggctcgaaat 3960

gctcggtgac tccttcttaa agcacgccat caccacgtat ctcttttgca cttaccctga 4020

tgctcacgag ggccgccttt cgtatatgag aagcaaaaag gtcagcaact gtaacctgta 4080

tcggcttggg aagaagaagg gcctgcccag ccgcatggtg gtgtcgatat ttgatccccc 4140

tgtgaactgg cttcctcctg gttatgtagt aaatcaagac aaaagtaaca cagacaaatg 4200

ggaaaaagat gaaatgacaa aagactgcgt gctggctaac ggcagactgg acgccgacct 4260

ggaggaggag gacgccgccg cgctcatgtg gaggccgccc agggaggagg ccgaggacga 4320

cgaggacctc ctggagtacg accaggagca catcaggttc atagacagca tgctgatggg 4380

gtcaggagcc ttcgtcaaga agattgctct tgctcccttc gccgccgccg atcctgccta 4440

cgaatggaag atgcccaaaa aggcccccct ggggagcatg cccttttccg cagatttcga 4500

ggactttgac tacagctcgt gggatgccat gtgctatctg gaccccagca aagccgttga 4560

ggaggatgac tttgtggtgg gcttctggaa tccatccgaa gagaactgtg gtgtggacac 4620

aggcaaacag tccatttctt acgacttgca cacggagcag tgcatcgctg acaaaagcat 4680

cgccgactgt gtggaagccc tgctgggctg ctacttgacc agctgtggcg agcgggccgc 4740

tcagctcttc ctctgctcgc tgggcctgaa ggtgctcccg gcggtgaaga ggaccgatcg 4800

ggcacaggcc gcctgcccgg ccagggagag cttcaccagc caacaaaaga ccctttccgg 4860

gggccggccc gccgccggct cccgctcttc cgggttgaaa gacttggagt acggctgttt 4920

gaagatccca ccgagatgta tgtttgatca cccagacgca gacaggacac tcagtcacct 4980

catctcgggc tttgagaact tcgaaaggaa gatcaactac agcttcaaga ataaggctta 5040

ccttctgcag gccttcaccc acgcctccta ccactacaac accatcaccg attgttacca 5100

gcgcctggag ttcctgggag atgccattct ggactacctc ataaccaagc acctttacga 5160

agacccgcgg cagcactccc cgggggtcct gaccgacctg cgctctgctc tggtcaacaa 5220

caccatcttc gcctcgctgg ccgtcaagta cgactaccac aagtacttca aggccgtgtc 5280

gcccgagctc ttccacgtca tcgatgattt tgtgcagttt cagcttgaga agaacgagat 5340

gcaggggatg gattctgagc ttaggagatc tgaggaggat gaagagaaag aagaggatat 5400

tgaagttccg aaggccatgg gggacatttt tgagtcgctt gctggtgcca tttacatgga 5460

tagtggaatg tcactggagg tggtttggca ggtgtactat ccgatgatgc ggccgctaat 5520

agaaaaattt tctgcaaacg tgccccgttc gcctgtgcga gaattgcttg aaatggaacc 5580

agaaaccgcc aaatttagcc cggctgagag aacttacgat ggcaaggtca gagtcaccgt 5640

ggaagtcgta ggaaagggga aattcaaagg tgttggccga agttacagga ttgccaaatc 5700

tgcagcagca cgacgagccc tgcgaagcct caaagctaat caacctcagg ttcccaacag 5760

ctgaaacccc tttttaaaat aacgaaaaga agcagagtta aggtggaaaa tatttaagtg 5820

gaaaaggatg atttaaaatt ggcagtgagt ggaatgaatt gaaggcagaa gttaaagttt 5880

gataacaagc tagattgcag aataaaacat ttaacatatg tataaaacct ttggaactaa 5940

ttgtagtttt agttttttgc gcaaacacaa tcttgtcttc tttcctcact tctgc 5995

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 4

gcttgaagca gctctggat 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

cagctgacac ttgttgagca 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

agatcatcgc ccaacaaaac 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

gacacaattg ccgctcacta 20

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 8

tggaaagaat gtcttgattg ttgaag 26

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 9

atctttggat tatgctgctt gacc 24

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 10

atggccagcc agtcaatcag ctgtg 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 11

cccggtccct tgcctctgga ctggt 25

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 12

atggccggta aaaatcagag ccaga 25

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 13

ctaggttgct ggcgctggga cttta 25

Claims

1. The application of siRNA targeting DICER1 in preparation of a preparation for inhibiting PRRSV replication is characterized in that after the siRNA specifically knocking down DICER1 is transfected into PAMs cells, the siRNA can effectively inhibit the expression of DICER1, thereby inhibiting the replication of PRRSV in the PAMs cells;

the sequences of the siRNAs are as follows:

sense strand: UCCAGAGCUGCUUCAAGCA, respectively; SEQ ID No. 1;

antisense strand: UGCUUGAAGCAGCUCUGGA, SEQ ID NO. 2.