CN106399313B - A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV and application thereof and detection method - Google Patents
A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV and application thereof and detection method Download PDFInfo
- Publication number
- CN106399313B CN106399313B CN201610866123.2A CN201610866123A CN106399313B CN 106399313 B CN106399313 B CN 106399313B CN 201610866123 A CN201610866123 A CN 201610866123A CN 106399313 B CN106399313 B CN 106399313B
- Authority
- CN
- China
- Prior art keywords
- prrsv
- vsrna1
- cell
- sequence
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses microRNA sample virus tiny RNA sequence of a kind of anti-PRRSV and application thereof and detection methods.The invention discloses the mature body sequence of the PRRSV-vsRNA1 and the precursor sequences and secondary structure of coding PRRSV-vsRNA1.It is inhibited in the porcine alveolar macrophage (PAMs) of PRRSV infection and strain highly pathogenic for PRRSV that the present invention by distinct methods demonstrates this PRRSV-vsRNA1.The PRRSV-vsRNA1 that the present invention illustrates anti-PRRSV can be with selectively targeted PRRSV virus nonstructural protein 2 (Nsp2), to have the function of that PRRSV is inhibited to be proliferated in PAMs cell.PRRSV-vsRNA1 of the present invention is expected to become a kind of drug for preventing and treating pig blue-ear disease, provides effective method for the prevention and control of PRRSV.
Description
Technical field
The present invention relates to microRNA sample virus tiny RNA sequence of a kind of anti-PRRSV and application thereof and detection methods, specifically
It is related to a kind of identification of the microRNA sample virus tiny RNA from porcine reproductive and respiratory syndrome virus genome and anti-
Application in PRRSV, the invention belongs to field of biotechnology.
Background technique
Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome,
It PRRS) is a kind of important viral infectious for seriously endangering world's pig breeding industry caused by PRRS viral (PRRSV) infection,
It is mainly characterized by the respiratory symptom of the breeding difficultys such as pregnant sow miscarriage, stillbirth, weak tire, the mummification of fetus, each age level pig.
Since PRRS virus has antigenic variability, thermophilic phagocytic, antibody-dependent enhancement (ADE) and persistent infection etc.
Feature, existing vaccine are limited to the protective effect of the disease, and there is presently no the specific medicaments of anti-PRRS virus.
MicroRNA is a kind of small single-stranded non-coding RNA, is played extremely in the interaction of virus and host
Important post-transcriptional control effect.On the one hand, virus infection can result in the change of host-encoded microRNA expression,
The latter regulates and controls all too many levels of viral life process by targeting virus or the gene of itself.On the other hand, many
Virus can equally encode the expression that microRNA adjusts host and viral autogene, in the process of virus infection host cell
In play a significant role.
Existing research confirms that during PRRSV infection host cell, host-encoded microRNA is for PRRSV's
Important regulating and controlling effect is played the part of in infection.And the microRNA of PRRSV coding has no relevant report so far, the present invention is explored and is identified
It is a kind of to derive from virus genomic microRNA sample virus tiny RNA (PRRSV-vsRNA1), it can be by adjusting itself base
The expression of cause, and then regulate and control virus replication and proliferation, this is the phase interaction of virus and host during understanding PRRSV infection in depth
With and the prevention and control of PRRSV virus provide completely new visual angle and strategy.
Summary of the invention
The object of the present invention is to provide microRNA sample virus tiny RNA sequences of a kind of anti-PRRSV and application thereof and inspection
Survey method, to overcome disadvantages mentioned above present in the prior art and deficiency.
Technical problem to be solved by the invention is to provide identifications from the method and inspection of the viral tiny RNA of PRRSV
Survey its mechanism of action.
The present invention provides the sense chain-orderings of the viral tiny RNA derived from PRRSV: UGCUGACUUGGCGCAACACGU.
The present invention provides the precursor sequences of the viral tiny RNA derived from PRRSV: GUGAUGCGUCCAAGCUUAGUGAUCC
UGCUACGCAGGAGUGGCUCUCUCGCAUGUGGGAUAGGGUUGACAUGCUGACUUGGCGCAACACGU。
The present invention provides the secondary structure of prediction microRNA sample virus tiny RNA and minimum Conjugated free energies (MFE)
Bioinformatics method.
The present invention provides the luciferase reporter gene detection methods for identifying the regulated and controled target gene of viral tiny RNA.
The present invention has found that there is provided viral tiny RNA the characteristic for inhibiting PRRSV duplication can use by experiment in vitro
In the novel anti-PRRSV drug of exploitation.
Technical problems to be solved needed for the present invention can be achieved through the following technical solutions:
A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV, i.e. PRRSV-vsRNA1, which is characterized in that its nucleosides
The RNA sequence of sequences code is identical as SEQ ID NO.1.
SEQ ID NO.1 includes following sequence: UGCUGACUUGGCGCAACACGU.The sequence is RNA.
The precursor RNA of the microRNA sample virus tiny RNA sequence of the anti-PRRSV, nucleotide sequence coded precursor
RNA sequence is identical as SEQ ID NO.2.
SEQ ID NO.2 includes following sequence:
GUGAUGCGUCCAAGCUUAGUGAUCCUGCUACGCAGGAGUGGCUCUCUCGCAUGUGGGAUAGGGUUGAC
AUGCUGACUUGGCGCAACACGU.The sequence is RNA.
Wherein, the target gene position of its regulation is predicted and identified to the microRNA sample virus tiny RNA sequence of the anti-PRRSV
In region NS2 Protein (Nsp2) of PRRSV.
The non-structural protein (Non-structural protein, Nsp) of PRRSV, abbreviation Nsp.
A kind of purposes of the microRNA sample virus tiny RNA sequence of anti-PRRSV, which is characterized in that the anti-PRRSV's
MicroRNA sample virus tiny RNA sequence transfection PAMs cell, which reaches, inhibits porcine reproductive and respiratory syndrome virus in PAMs cell
Duplication and proliferation effect.
A kind of detection method of the microRNA sample virus tiny RNA sequence of anti-PRRSV, which is characterized in that including following step
It is rapid:
The presence of Bioinformatics Prediction microRNA sample virus tiny RNA is used first；
Then the target gene that viral tiny RNA is regulated and controled is identified by luciferase reporter gene detection system；
Finally by qRT-PCR and TCID50Method have detected viral tiny RNA analogies to PRRSV infection host cell
Influence, test determinand inhibit PRRSV duplication and proliferation effect.
Beneficial effects of the present invention:
The present invention uses the presence of Bioinformatics Prediction microRNA sample virus tiny RNA first.Then pass through double fluorescence
Plain enzyme reporter gene detection system identifies the target gene that viral tiny RNA is regulated and controled.Finally by qRT-PCR and TCID50Side
Method has detected influence of the viral tiny RNA analogies to PRRSV infection host cell, and finds that this analogies has and significantly inhibit
The effect of PRRSV duplication and proliferation, this provides effective method for the prevention and control of PRRSV.
Detailed description of the invention
Fig. 1 is the secondary structure prediction figure of PRRSV-vsRNA1 precursor sequence of the invention.
Fig. 2 is the target gene using luciferase reporter gene carrier system detection PRRSV-vsRNA1.
Fig. 3 is after transfecting PAMs cell using qRT-PCR detection various concentration PRRSV-vsRNA1 analogies to PRRSV
The influence of ORF7mRNA expression.
Fig. 4 is after transfecting PAMs cell using qRT-PCR detection various concentration PRRSV-vsRNA1 analogies to supernatant
The influence of middle PRRSV genome copy numbers.
Fig. 5 be using qRT-PCR detection 100nM PRRSV-vsRNA1 analogies transfection PAMs cell after infection not
The influence expressed with the time for PRRSV ORF7mRNA.
Fig. 6 be detect 100nM PRRSV-vsRNA1 analogies transfection PAMs cell after infection different time for
The influence of PRRSV titre in cell supernatant.
Specific embodiment
Below in conjunction with specific embodiment, progress explanation is made to the present invention.It should be understood that following embodiment is merely to illustrate this hair
It is bright not for limiting the scope of the invention.
It in embodiment unless otherwise specified, is this field conventional laboratory techniques.
Biological material source used is as follows in embodiment:
DMEM culture medium, Opti-MEM culture medium and RPMI-1640 culture medium are purchased from Life Tech company；Trypsase
BI company is purchased from fetal calf serum；MicroRNA analogies are purchased from Shanghai Ji Ma company；Primer is by Shanghai Invitrogen company
Synthesis；FastStart Universal SYBR Green Master and siRNA transfection reagent is purchased from Roche company；HS enzyme, RNA extract reagent (RNAiso Plus), reverse transcription reagent box (PrimeScriptTM RT
Reagent Kit) it is purchased from Takara company；Trans10 competent cell, DNA purification kit (Easy Pure Quick
Gel Extraction kit) it is purchased from Beijing Quan Shijin biotech company；PsiCheck2 carrier and Dual-
Luciferase Dual-luciferase reportor systerm is purchased from Promega company；PAMs cell is that (porcine alveolar macrophage) is located away from 6
The lung tissue of all piglets；MARC-145 cell (the derived cell system of RhMK MA-104), highly pathogenic PRRSV poison
Strain GD-HD (GenBank ID:KP793736.1) is saved by Xibei Univ. of Agricultural & Forest Science & Technology's veterinary vaccination biology laboratory.
The discovery of embodiment 1:PRRSV-vsRNA1 and the prediction of structure
1. sequence download: from the website miRBase (Http:// www.mirbase.org/) in downloading it is reported all
MicroRNA mature sequence (Release 21:June 2014).From the website NCBI (Http:// www.ncbi.nih.gov) in
It downloads PRRSV genome sequence (GenBank ID:KP793736.1).
The prediction of 2.microRNA precursor sequence: utilize python script program by GD-HD strain genome sequence
(GenBank ID:KP793736.1) is divided into the sequence fragment that 1200 length are 90bp, using RNAfold to the sequence of interception
Carry out hairpin secondary structure analysis and simultaneously predict its MFE (minimum free energy), select later MFE be less than or equal to-
20Kcal.mol-1Precursor sequence of the sequence as potential microRNA.All sequences further pass through MiPred software
Identification picks out sequence progress BLASTn (nucleotide sequence comparison) the removal repetitive sequence for meeting pre-microRNA, finally
With BayesMiRFinder software prediction mature sequence.
3. the microRNA sequence that sequence alignment screens new viral source: in order to identify predicted microRNA precursor
Whether sequence is new microRNA or with known microRNA sequence homology, the mature microRNA sequence that will be predicted
Be compared with the known microRNA sequence downloaded, analyze homology, mispairing lower than 4 bases sequence be considered as with
Known microRNA has homology, then removes it from the microRNA mature sequence newly predicted.
Fig. 1 is the secondary structure figure using RNAfold software prediction PRRSV-vsRNA1 precursor sequence, finds PRRSV-
The precursor sequence of vsRNA1 has typical loop-stem structure, minimum Conjugated free energy (MFE) value of this structure are as follows:-
35.40kcal/mol。
Embodiment 2: predicting and identifies the target gene of PRRSV-vsRNA1 regulation
1. utilizing the target gene of bioinformatics software prediction PRRSV-vsRNA1 regulation: first with RNAhybrid net
Stand (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/) prediction the potential target of PRRSV-vsRNA1
Gene and its binding site.
Specific method is the downloading PRRSV strain GD-HD genome sequence from the website NCBI, using on-line prediction tool,
The sequence in GD-HD different genes region and PRRSV-vsRNA1 is uploaded, the information such as predicted binding site are downloaded.
Comprehensively consider following factor: the complementarity of miRNA and target site sequence；The target site predicted is in different strains
Conservative；Thermal stability between miRNA-mRNA double-strand；There should not be complicated secondary structure etc. at target site.
PRRSV genome encoding multiple non-structural proteins (Non-structural protein, Nsp), abbreviation Nsp.
By prediction find, five regions of PRRSV genome: Nsp1 α, Nsp2, Nsp3, Nsp9 and Nsp10 there may be
The binding site that PRRSV-vsRNA1 plays a role.
2. constructing luciferase reporter gene carrier:
1) 5.0 software Design primers of Primer Premier are utilized, Invitrogen company synthesizes by Shanghai, primer 5'
Restriction enzyme site and protection base (by taking psiCheck2-nsp2 carrier as an example) are contained in end and the end primer 3':
SEQ ID No.3psiCheck2-nsp2-F:
GCGATCGCGCCGGAAAGAGAGCAAGGAAAACACG；
SEQ ID No.4psiCheck2-nsp2-R:
GGGTTTAAACCCGCCCAGTAACCTGCCAAGAATGGCAA。
2) it extracts RNA and carries out reverse transcription and PCR amplification: extracting PRRSV infection using Takara company RNAiso Plus
Total serum IgE after PAMs cell.
Step are as follows: after cell adds the RNAiso Plus of TAKARA company, sufficiently crack；It is sequentially added according to operating instruction
Chloroform, isopropanol, RNA is sunken to tube bottom after centrifugation；75% ethyl alcohol cleaning RNA is added, after drying to be precipitated, is added suitable
RNase-free water is dissolved.
RNA concentration, purity and integrality are measured, RNA concentration and purity are measured on nucleic acid-protein analyzer, it is desirable that
For the ratio of OD260/OD280 between 1.8-2.0, concentration is greater than 2ug/ μ l, while carrying out agarose gel electrophoresis, with gel at
As 5S rRNA, 18S rRNA and 28S the rRNA band of the detected RNA of system observation, three band complete displays are needed.
Using Takara company reverse transcription reagent box (PrimeScriptTM RT Reagent Kit) for extracted
RNA carries out reverse transcription.
Reverse transcription reaction system: for 5 × PrimeScript Buffer, 2 μ l；RTEnzyme
MixI, 0.5 μ l；Oligo dT Primer (50 μM), 0.5 μ l；Random Primer (100 μM), 0.5 μ l；Total RNA,
500ng；RNase Free ddH2O supplies 10 μ l.
The reaction condition of reverse transcription are as follows: 37 DEG C, 20min；85 DEG C, 5s；4℃.Recycle Takara companyHS DNA Polymerase expands the NSP2 genetic fragment of PRRSV.50 μ l reaction systems are as follows: 5
×HS Buffer 10μl；dNTP Mixture(2.5mM each)4μl；1 μ l of F primer (20 μM)；R draws
1 μ l of object (20 μM)；1 μ l of template cDNA；HS DNA Polymerase 0.5μl；Sterilize ultrapure water 32.5
μl。
Reaction condition are as follows: 98 DEG C, 3min；98 DEG C, 10s；55 DEG C, 15s；72 DEG C, 20s；30 circulations；72 DEG C, 10min；
16 DEG C of preservations.
3) PCR product recycles: using DNA purification kit (the Easy Pure of Beijing Quan Shijin biotech company
Quick Gel Extraction kit) and operating procedure carries out the glue recycling of PCR product to specifications.
4) preparation of psiCheck2 empty carrier: reagent is extracted using the plasmid of Beijing Quan Shijin Biotechnology Co., Ltd
Box (EasyPure Plasmid MiniPrep kit) and to specifications operating procedure carry out plasmid extraction, measure plasmid
Concentration, and whether run glue verifying plasmid band correct.
5) psiCheck2 empty carrier and PRRSV genetic fragment carry out digestion connection: by psiCheck2 empty carrier and recycling
The PRRSV genetic fragment of purifying, carries out double digestion respectively, reacts 4h in 37 DEG C of water-baths.
20 μ l endonuclease reaction systems are as follows: 11 μ l of enzyme；21 μ l of enzyme；Buffer 2μl；2.0 μ l of 0.1%BSA；Purpose base
Cause/plasmid 800ng；Sterilizing ultrapure water complements to 20 μ l.
The connection of psiCheck2 empty carrier and digestion products: will linearisation psiCheck2 carrier and endonuclease bamhi respectively into
The recycling of row glue, 16 DEG C of connection 2h.
Linked system are as follows: 10 × T4DNA Ligase Buffer, 2 μ l；psiCheck2 vector 3μl；Endonuclease bamhi 9
μl；T4 DNA Ligase 1μl；Sterilize 5 μ l of ultrapure water.
6) it the conversion of connection product: is grasped according to the Trans10 competent cell of Beijing Quanshijin Biotechnology Co., Ltd
Book is explained, melts 100 μ l competent cells on ice, after 10 μ l connection products are added, is converted.
7) screening, identification and preservation of recombinant plasmid: 12h after conversion bed board, 5 monoclonal colonies of picking are inoculated in respectively
5ml contains 100 μ g/ml Amp+LB liquid medium in, 37 DEG C, 220rpm cultivate 8~12h.Carry out bacterium solution PCR verifying and
Digestion identification.Bacterium solution PCR and plasmid enzyme restriction are identified that correct bacterium solution is sent and carry out gene sequencing in Invitrogen company.It will
The sequence announced on the gene order of sequencing and NCBI is compared, and identifies the whether successful structure of double luciferase report gene carriers
It builds.
3. utilizing the target gene of Dual-luciferase reportor systerm identification PRRSV-vsRNA1 regulation:
1) double luciferase report gene carriers and synthesized analogies cotransfection HEK293FT cell.Utilize no endogenous toxic material
Plain plasmid extraction kit carries out the extracting of plasmids for correctly double luciferase report gene carriers are sequenced, measure concentration and
After purity, by extracted psiCheck2-nsp2 plasmid respectively with artificial synthesized PRRSV-vsRNA1 analogies or compare simulation
Object cotransfection HEK293FT cell.
Transfection reagent is the X-tremeGENE siRNA Transfection Reagent of Roche Holding Ag, is tried according to transfection
The operating procedure of agent is transfected.The cells trypsinised rear paving of HEK293FT for being first 80% or so by cell density
Plate is in 48 orifice plates.It is transfected when cell length to 40-50% convergence degree, PRRSV-vsRNA1 analogies, NC (negative control)
The concentration of analogies and MUT (mutant controls) analogies is disposed as 100nM, and recombinant plasmid concentration is 50ng/ μ l.
2) Dual-Luciferase Activity determination: using Promega company Dual-luciferase reportor systerm carry out firefly and
Renilla luciferase Activity determination.
It is operated according to specification, 65 1 × PLB of μ l (5 times of diluted passive lysis is added after cleaning cell with PBS
Buffer) into each hole of 48 orifice plates；48 orifice plates are placed on oscillator plate again, it is abundant that room temperature acutely vibrates 15min
Lytic cell is collected in centrifuge tube, and 12000g is centrifuged 30s；96 hole elisa Plates are taken, 20 μ l cell cracking supernatants are added；In
After 50 μ l LAR II are added in every hole, postpone 2s, reads the enzyme activity numerical value of 6s firefly luciferase.
After enzyme activity determination to firefly luciferase is complete, 50 μ l Stop&GLo reagents are added in every hole, postpone 2s, are read
6s is taken to read the enzyme activity numerical value of sea cucumber luciferase.Renilla luciferase (Ranilla Luciferase) activity of each sample
It is corrected with Fluc (Firefly Luciferase) value.
Fig. 2 can be seen that the processing group and corotation of cotransfection psiCheck2-nsp2 carrier and PRRSV-vsRNA1 analogies
Dye psiCheck2-nsp2 carrier is compared with negative control analogies or mutant controls analogies, and luciferase relative activity exists
It is remarkably decreased, illustrates that the target gene that PRRSV-vsRNA1 is acted on is located at the region PRRSV NSP2.
PRRSV-vsRNA1- is mutated analogies SEQ ID No.5UCAUAGUCUCUCGCAACACGU, negative control simulation
Object SEQ ID No.6AGCUGAUUUCGUCUUGGUA.
Embodiment 3: the influence that the PRRSV-vsRNA1 analogies of various concentration replicate PRRSV is transfected in PAMs cell
The transfection of 1.PRRSV-vsRNA1 analogies and cell connect poison:
1) bed board: separating porcine alveolar macrophage from the piglet lung tissue of 6 week old, and carries out cell count and paving
Plate is cultivated in 37 DEG C of 5%CO2 incubators；
2) transfect: transfection reagent is the X-tremeGENE siRNA Transfection Reagent of Roche Holding Ag, is pressed
It is transfected according to the operating procedure of transfection reagent.Transfection cocktail (analogies and siRNA are prepared after bed board 12h
Transfection reagent is dissolved in Opti-MEM respectively, then the two is mixed) incubation at room temperature 20min.By 24 orifice plates from
It is taken out in incubator, changes Opti-MEM into after being cleaned with PBS, mixture is added dropwise and rocks mixing, is placed in cell incubator
Culture；
3) connect poison: transfection 12h is followed by poison, is inoculated with GD-HD PRRSV strain with 0.01MOI, according to formula PFU=cell
Number × MOI=0.7 × TCID50Virus liquid needed for calculating.24 orifice plates are taken out, after being cleaned with PBS, viral dilution is added,
Connect virus liquid is discarded after 37 DEG C of culture 1h, is changed to 1640 culture mediums of serum content 3%；
4) receive sample: pi collects cell and cell culture supernatant, -80 DEG C of preservations for 24 hours after infection.Cell sample is for examining
The relative expression levels of PRRSV ORF7 gene in cell are surveyed, cell culture supernatant is discharged into culture solution supernatant for detecting
Virus genomic copy number.
2.qRT-PCR detects PRRSV ORF7 mRNA relative expression levels:
1) it extracts the RNA in cell and is reversed to cDNA, step is the same as embodiment 2.
2) qRT-PCR detection is carried out, each sample needs to detect the mRNA table of PRRSV ORF7 and internal reference HPRT-1 gene
Up to amount, step is the same as embodiment 2.WithThe StepOne Software of Real-Time PCR System instrument
The analysis of v2.3 software progress result.
QRT-PCR primer are as follows:
SEQ ID No.7 PRRSV-ORF7-F:AGATCATCGCCCAACAAAAC；
SEQ ID No.8 PRRSV-ORF7-R:GACACAATTGCCGCTCACTA；
SEQ ID No.9 HPRT1-F:TGGAAAGAATGTCTTGATTGTTGAAG；
SEQ ID No.10 HPRT1-R:ATCTTTGGATTATGCTGCTTGACC.
Fig. 3 can be seen that the PRRSV-vsRNA1 analogies that 10nM, 30nM, 60nM and 100nM are transfected in PAMs cell
When postoperative infection GD-HD strain, the relative expression quantity of PRRSV ORF7 in pi for 24 hours, the relative expression quantity of PRRSV ORF7 with it is right
It is compared according to group and has dropped 45%, 83%, 86% and 92% respectively.PRRSV-vsRNA1 analogies are inhibited in concentration-dependant
The expression of the intracellular PRRSV ORF7 of PAMs.
PRRSV genome copy numbers in 3.qRT-PCR detection assay Supernatant samples:
1) it is split after mixing the cell culture supernatant of the 400ul collected in step 1 with 1ml RNAiso Plus
Solution is extracted RNA and is dissolved in the RNase-free water of 15 μ l；
2) reverse transcription reaction system is configured: for 5 × PrimeScript Buffer, 2 μ l；RT
Enzyme MixI, 0.5 μ l；Oligo dT Primer (50 μM), 0.5 μ l；Random Primer (100 μM), 0.5 μ l；
Total RNA, 6.5 μ l.The reaction condition of reverse transcription are as follows: 37 DEG C, 20min；85 DEG C, 5s；4℃；
3) positive criteria product (plasmid standard containing PRRSV ORF7 genetic fragment) is prepared: PRRSV ORF7 is complete
The region CDs (372bp) is cloned into pMD-18T carrier, and identification, cloning process is sequenced after extracting plasmid in conversion to Top10 competence
With embodiment 2.Plasmid DNA concentration is measured, as the standard items of absolute quantitation, being named as pMD-18T-ORF7, (initial concentration is
5.5ng/ μ l μ l μ l) carry out with 10 for multiple gradient dilution, according to formula: copy number (copies)=(quality/molecular weight)
×6.0×1023, the copy number of different dilution standard items is calculated, the standard curve of qRT-PCR is formed, uses PRRSV-
ORF7qRT-PCR primer is detected, and is analyzed data with Real time PCR analyzer, is calculated in every milliliter of cell culture
PRRSV genome copy numbers in clear liquid.
Fig. 4 can be seen that the PRRSV-vsRNA1 analogies that 10nM, 30nM, 60nM and 100nM are transfected in PAMs cell
Postoperative infection GD-HD strain for 24 hours pi when, PRRSV genome copy numbers are distinguished compared with the control group in PAMs cell culture supernatant
Have dropped 74%, 82%, 89% and 97%.PRRSV-vsRNA1 analogies inhibit in PAMs cell in concentration-dependant
The proliferation of PRRSV.
Embodiment 4: it is multiple to PRRSV in different time points that 100nM PRRSV-vsRNA1 analogies are transfected in PAMs cell
The influence of system
The transfection of 1.PRRSV-vsRNA1 analogies and cell connect poison:
1) bed board transfects and connects poison with embodiment 3.
2) receive sample: 0hpi, 12hpi after infection, pi and 36hpi collects cell and cells and supernatant for 24 hours
Liquid, -80 DEG C of preservations.Relative expression levels of the cell sample for PRRSVORF7 gene in qRT-PCR detection cell, cell training
It supports supernatant and is discharged into titre viral in culture solution for detecting.
2.qRT-PCR detects PRRSV ORF7mRNA relative expression levels: 1) extracting the RNA in cell and be reversed to
CDNA, step is the same as embodiment 2.2) qRT-PCR detection is carried out, each sample needs to detect PRRSV ORF7 and internal reference HPRT-1 base
The mrna expression amount of cause, step is the same as embodiment 3.
Fig. 5 can be seen that the PRRSV-vsRNA1 analogies postoperative infection GD-HD strain that 100nM is transfected in PAMs cell
When, the relative expression quantity of PRRSV ORF7 has dropped 88%, 90% and 82% in 12hpi respectively for 24 hours when pi and 36hpi.
PRRSV-vsRNA1 analogies are after infection to the inhibiting effect of PRRSV to 36 hours.
3.TCID50Measure the titre of PRRS virus in Supernatant samples:
1) bed board: being added suitable DMEM culture medium containing 10%FBS for the MARC-145 cell that pancreatin has digested, and adjusts
Whole density is 1 × 105A/ml is added in 96 porocyte culture plates, cell is made to grow up to single layer；
2) it will collect in the DMEM culture medium of sterilizing EP Guan Zhongyong serum-free and connect containing virulent cell supernatant
Continuous 10 times of dilutions, from 10-1~10-10, each dilution will be sufficiently mixed uniformly；
3) it is successively inoculated into MARC-145 cell from high to low by dilution, each dilution is inoculated with 8 hole of a tandem, often
Hole is inoculated with 100 μ l, and taking two tandems is normal cell controls；
4) it is observed and recorded day by day since second day as a result, 5~7 days from being generally required；
5) referring to Reed-Muench method for TCID50It is calculated.
Fig. 6 can be seen that the PRRSV-vsRNA1 analogies postoperative infection GD-HD strain that 100nM is transfected in PAMs cell
When, the virus titer in cell culture supernatant has dropped 0.88,1.75 Hes in 12hpi respectively for 24 hours when pi and 36hpi
0.83.PRRSV-vsRNA1 analogies are after infection to the inhibiting effect of PRRSV to 36 hours.
A specific embodiment of the invention is illustrated above, but the present invention is not limited thereto, without departing from
Spirit of the invention, the present invention can also have various change.
Claims (1)
1. a kind of precursor RNA of the microRNA sample virus tiny RNA sequence of anti-PRRSV, which is characterized in that the precursor RNA sequence
It arranges identical as SEQ ID NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610866123.2A CN106399313B (en) | 2016-09-29 | 2016-09-29 | A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV and application thereof and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610866123.2A CN106399313B (en) | 2016-09-29 | 2016-09-29 | A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV and application thereof and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399313A CN106399313A (en) | 2017-02-15 |
| CN106399313B true CN106399313B (en) | 2019-10-18 |
Family
ID=59229098
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610866123.2A Active CN106399313B (en) | 2016-09-29 | 2016-09-29 | A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV and application thereof and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399313B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109705212A (en) * | 2018-12-04 | 2019-05-03 | 西北农林科技大学 | A kind of antibody, expression vector and therapeutic agent inhibiting PRRS virus replication |
| CN109694867B (en) * | 2018-12-24 | 2022-04-15 | 西北农林科技大学 | DICER1 gene and application of siRNA thereof |
| CN109679952B (en) * | 2018-12-24 | 2022-04-15 | 西北农林科技大学 | Porcine-derived miR-c89 for resisting PRRSV infection and application thereof |
| CN110885823B (en) * | 2019-12-05 | 2021-06-22 | 湖北省农业科学院畜牧兽医研究所 | Long-chain non-coding RNA pig Lnc-000649 and application thereof |
| CN111996213A (en) * | 2020-02-06 | 2020-11-27 | 广西大学 | Construction method of porcine reproductive and respiratory syndrome virus double-fluorescence labeling gene recombinant strain |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998055626A3 (en) * | 1997-06-05 | 1999-03-04 | Origen Inc | Recombinant porcine reproductive and respiratory syndrome virus (prrsv) for use as a vaccine |
| CN104263743A (en) * | 2014-08-29 | 2015-01-07 | 中国农业大学 | Application of porcine SOD1 gene in PRRS (Porcine Reproductive and Respiratory Syndrome) virus resistance |
| CN104710528A (en) * | 2015-03-13 | 2015-06-17 | 西北农林科技大学 | Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof |
-
2016
- 2016-09-29 CN CN201610866123.2A patent/CN106399313B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998055626A3 (en) * | 1997-06-05 | 1999-03-04 | Origen Inc | Recombinant porcine reproductive and respiratory syndrome virus (prrsv) for use as a vaccine |
| CN104263743A (en) * | 2014-08-29 | 2015-01-07 | 中国农业大学 | Application of porcine SOD1 gene in PRRS (Porcine Reproductive and Respiratory Syndrome) virus resistance |
| CN104710528A (en) * | 2015-03-13 | 2015-06-17 | 西北农林科技大学 | Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Efficacy of commercial genotype 1 porcine reproductive and respiratory syndrome virus (PRRSV) vaccine against field isolate of genotype 2 PRRSV;Ko Seong sik等;《VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY》;20160227;第172卷;第43-49页 * |
| M蛋白基因shRNA抑制PRRSV在Marc145细胞中复制的研究;黄娟等;《中国农业科学》;20081231;第41卷(第1期);第259-264页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399313A (en) | 2017-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399313B (en) | A kind of microRNA sample virus tiny RNA sequence of anti-PRRSV and application thereof and detection method | |
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| CN110885823B (en) | Long-chain non-coding RNA pig Lnc-000649 and application thereof | |
| Zheng et al. | Recombinant PRRSV expressing porcine circovirus sequence reveals novel aspect of transcriptional control of porcine arterivirus | |
| CN107267532B (en) | Construction method and application of PEDV JS2008 strain full-length infectious cDNA | |
| CN109182562A (en) | MiRNA apla-mir-25-42 relevant to laying duck follicular development and its detection primer, mortifier and application | |
| CN114058619B (en) | Construction of RIPLET knockout cell line and application of RIPLET knockout cell line as picornaviridae virus vaccine production cell line | |
| CN109402118B (en) | miRNA apla-mir-145-4 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof | |
| Oh et al. | Multi-resistance strategy for viral diseases and in vitro short hairpin RNA verification method in pigs | |
| CN112760320B (en) | Exogenous artificial miRNA for effectively inhibiting replication of porcine epidemic diarrhea virus and application thereof | |
| CN113416768B (en) | Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus | |
| CN113913532A (en) | miRNA marker related to Hu sheep papilla cell proliferation and detection primer and application thereof | |
| CN113481316A (en) | Corn drought resistance marker DRESH8 and application thereof | |
| CN109402269B (en) | Application of reagent for detecting miRNA-217-5p in preparation of duck intestinal stress detection reagent | |
| CN110904056B (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
| CN110684797B (en) | VIGS vector based on TCV with simultaneous silencing of 2 endogenous genes | |
| CN111808858A (en) | Application of siRNA sequence and target thereof in increasing PEDV (porcine reproductive and respiratory syndrome Virus) poison value | |
| CN102229928B (en) | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof | |
| CN106957820B (en) | Culture medium for in vitro chondrocyte telomere prolonged proliferation culture, kit and application | |
| CN109679952A (en) | A kind of pig source miR-c89 of anti-PRRSV infection and its application | |
| CN111454944B (en) | Method for synthesizing separated RNA and DNA template thereof | |
| CN104450770A (en) | Application of larch miR166a in plant development regulation and control | |
| CN115896035B (en) | Vero cell strain applied to virus amplification, construction method and application thereof | |
| CN109694867B (en) | DICER1 gene and application of siRNA thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |