CN109679952B

CN109679952B - Porcine-derived miR-c89 for resisting PRRSV infection and application thereof

Info

Publication number: CN109679952B
Application number: CN201811583181.XA
Authority: CN
Inventors: 肖书奇; 李爽; 闫云欢; 张晓彬
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2018-12-24
Filing date: 2018-12-24
Publication date: 2022-04-15
Anticipated expiration: 2038-12-24
Also published as: CN109679952A

Abstract

The invention discloses a porcine miR-c89 for resisting PRRSV infection, which is proved for the first time by RT-qPCR, TCID50 and western blot methods to be that miR-c89 from pig coding can obviously inhibit the replication and proliferation of high-pathogenicity and low-pathogenicity PRRSV, and the microRNA is expected to be developed into a novel medicament for preventing and treating porcine reproductive and respiratory syndrome and the development of a genetically modified pig for resisting the porcine reproductive and respiratory syndrome, thereby laying a foundation for the prevention and control of the PRRSV.

Description

Porcine-derived miR-c89 for resisting PRRSV infection and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to porcine miR-c89 for resisting PRRSV infection and application thereof.

Background

Porcine Reproductive and Respiratory Syndrome (PRRS) is a viral infectious disease caused by PRRS virus (PRRSV) and characterized mainly by the symptoms of sow reproductive disorders and piglet respiratory tract impairment. The disease first outbreaks in the united states in 1987, and then spreads and epidemics worldwide, bringing enormous economic losses to the swine industry worldwide. In 2006, "high swine fever" which is characterized mainly by high fever, high morbidity and high mortality is outbreaked in southern swine farms in China, and the pathogen causing the disease is finally proved to be a variant PRRSV which is named as a Highly pathogenic PRRSV (HP-PRRSV). HP-PRRSV infects herds of different ages, stages and sexes and presents a high morbidity and mortality compared to classical strains. The prevalence of HP-PRRSV brings a heavy hit to the pig industry in China again. Because the PRRS virus has the characteristics of antigen variability, macrophage-avidity, antibody-dependent enhancement (ADE) and persistent infection, the existing vaccine has limited protective effect on the PRRS virus, and no specific medicine for resisting the PRRS virus exists at present.

microRNA is a non-coding single-stranded RNA molecule with the length of about 22 nucleotides and coded by endogenous genes, and plays an extremely important post-transcriptional regulation role in the interaction of viruses and hosts. On the one hand, viral infection can lead to changes in the expression level of host-encoded microRNAs, which regulate many links of the viral life process by targeting viral or self genes. On the other hand, many viruses can also encode microRNA to regulate the expression of host and virus self genes, and play an important role in the process of infecting host cells by the viruses.

In the aspect of virus infection, the microRNA is applied to clinical tests as an inhibitor of hepatitis C virus infection. And researches prove that in the process of infecting host cells by PRRSV, microRNA coded by the host plays an important regulation and control role on the infection of the PRRSV. Therefore, providing a porcine-derived miR-c89 with resistance to PRRSV infection for preparing a medicament or a preparation for preventing or treating porcine reproductive and respiratory syndrome is a problem to be solved by the technical personnel in the field.

Disclosure of Invention

In view of the above, the invention provides porcine miR-c89 with PRRSV infection resistance, which can be used for preparing a medicament or a preparation for preventing or treating porcine reproductive and respiratory syndrome and developing a genetically modified porcine with porcine reproductive and respiratory syndrome resistance to realize effective prevention and control of the porcine reproductive and respiratory syndrome.

In order to achieve the purpose, the invention adopts the following technical scheme:

a porcine miR-c89 sequence resisting PRRSV infection, wherein the RNA sequence coded by the miR-c89 nucleotide sequence is as follows:

GUACAGUACUGUGAUAACUGA；SEQ ID NO.1。

further, the application of the pig-derived miR-c89 in preparation of a medicine or a preparation for preventing or treating porcine reproductive and respiratory syndrome.

Further, the miR-c89 sequence transfected PAMs can inhibit the replication and proliferation of PRRSV in the PAMs.

Further, a precursor RNA of a porcine miR-c89 sequence resisting PRRSV infection, wherein the miR-c89 nucleotide sequence codes the precursor RNA sequence as follows:

GGUUAUCAUGGUACCGAUGCUGUAUAUCUGAAAGGUACAGUACUGUGAUAACUGA；SEQ ID NO.2。

further, the application of the miRNA precursor RNA coded by the porcine miR-c89 sequence in preparing a medicine or a preparation for preventing or treating porcine reproductive and respiratory syndrome.

Further, the PAMs transfected by the miRNA precursor RNA encoded by the porcine miR-c89 sequence can inhibit the replication and proliferation of PRRSV in the PAMs.

Further, the application of the miRNA precursor RNA coded by the porcine miR-c89 sequence in the development of the porcine reproductive and respiratory syndrome resistant genetically modified pig.

According to the technical scheme, compared with the prior art, the invention discloses and provides the porcine miR-c89 for resisting PRRSV infection, the method of RT-qPCR, TCID50 and western blot proves that miR-c89 derived from pig codes can obviously inhibit the replication and proliferation of high-pathogenicity and low-pathogenicity PRRSV for the first time, and the microRNA is expected to be developed into a novel medicament for preventing and treating porcine reproductive and respiratory syndrome and the development of genetically modified pigs for resisting the porcine reproductive and respiratory syndrome, so that a foundation is laid for the prevention and control of the PRRSV.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a diagram showing the relative expression amount of PRRSV ORF7 in HP-PRRSV GD-HD strain infected after miR-c89 mimic is transfected in PAMs cells;

FIG. 2 is a western blot detection result of PRRSV N protein when HP-PRRSV GD-HD strain is infected after miR-c89 simulant is transfected in PAMs cell;

FIG. 3 is a drawing showing the infection of HP-PRRSV GD-HD strain after transfection of miR-c89 simulant in PAMs cells, and PRRSV genome copy number in PAMs cell culture supernatant;

FIG. 4 is a graph showing the viral titer in cell culture supernatants of the invention when infected with GD-HD strains following transfection of miR-c89 mimics in PAMs cells;

wherein, in FIGS. 1-4, the miR-c89 mimic: transfecting a miR-c89 mimetic in a cell; control simulant: transfecting an unrelated miRNA mimic in the cell; normal cell control: adding only transfection reagent and no mimic to the cells; blank control: no transfection reagent nor mock was added to the cells;

FIG. 5 is a graph showing the relative expression amount of PRRSV ORF7 when the N-PRRSV CH1a strain is infected after transfection of miR-c89 mimic in PAMs cells;

FIG. 6 is a drawing showing the number of copies of PRRSV genome in culture supernatants of PAMs cells infected with N-PRRSV CH1a strain after transfection of miR-c89 mimic in PAMs cells in accordance with the present invention;

FIG. 7 is a graph showing the virus titer in cell culture supernatants of the invention when infected with the N-PRRSV CH1a strain following transfection of a miR-c89 mimic in PAMs cells;

wherein, in FIGS. 5-7, the miR-c89 mimic: experimental groups of miR-c89 mimetics transfected in cells; control simulant: an experimental group of unrelated miRNA mimics transfected in cells; normal cell control: experimental groups with cells added with transfection reagents only and no mock; blank control: experimental groups without adding transfection reagents or mock in cells;

FIG. 8 is a graph showing the relative expression amount of PRRSV ORF7 transfected with miR-c89 mimic after infection of HP-PRRSV GD-HD strain in PAMs cells;

FIG. 9 is a drawing showing the miR-c89 mimic transfected after infection of HP-PRRSV GD-HD strain in PAMs cells, and the PRRSV genome copy number in PAMs cell culture supernatant;

FIG. 10 is a graph showing the viral titer in cell culture supernatants following transfection of miR-c89 mimics of the present invention following infection of GD-HD strains in PAMs cells;

wherein, in FIGS. 8-10, the miR-c89 mimic: experimental groups of miR-c89 mimetics transfected in cells; control simulant: an experimental group of unrelated miRNA mimics transfected in cells; normal cell control: experimental groups with cells added with transfection reagents only and no mock; blank control: experimental groups without adding transfection reagents or mock in cells;

FIG. 11 is a graph showing the relative expression amount of PRRSV ORF7 transfected with miR-c89 mimic after infection of N-PRRSV CH1a strain in PAMs cells;

FIG. 12 is a drawing showing the miR-c89 mimic transfected after infection of N-PRRSV CH1a strain in PAMs cells, and the PRRSV genome copy number in PAMs cell culture supernatant;

FIG. 13 is a graph showing the viral titer in cell culture supernatant following transfection of miR-c89 mimetics following infection of the N-PRRSV CH1a strain in PAMs cells in accordance with the present invention;

wherein, in FIGS. 11-13, the miR-c89 mimic: experimental groups of miR-c89 mimetics transfected in cells; control simulant: an experimental group of unrelated miRNA mimics transfected in cells; normal cell control: experimental groups with cells added with transfection reagents only and no mock; blank control: experimental groups without adding transfection reagents or mock in cells;

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

DMEM medium, Opti-MEM medium and RPMI-1640 medium were purchased from Life Tech; trypsin and fetal calf serum were purchased from BI corporation; microRNA mimics were purchased from lunbo biotechnology limited, guangzhou; primers were synthesized by Shanghai Invitrogen corporation; FastStart Universal SYBR Green Master and siRNA transfection reagents were purchased from Roche;

HS enzymes, RNA extraction reagents (RNAioso Plus), reverse transcription Kit (PrimeScript RT Reagent Kit) purchased from Takara; trans5 α competent cells, DNA purification kit (Easy Pure Quick Gel Extraction kit) from Kyoto Kogyo Biotech, Inc.; the psiCheck2 vector and Dual-Luciferase reporter System were purchased from Promega; PAMs cells are lung tissue (porcine alveolar macrophages) isolated from 6-week-old piglets; MARC-145 cell (derived from Vero MA-104 cell)Cell line), highly pathogenic PRRSV strain GD-HD (GenBank ID: KP793736.1) and low pathogenic PRRSV strain CH1a (GenBank ID: AY032626.1) was maintained by the veterinary etiology and biology laboratory of the university of agriculture and forestry, science and technology, northwest.

Example 1 Effect of miR-c89 on HP-PRRSV replication upon infection with highly pathogenic HP-PRRSV following transfection of 50nM miR-c89 mimic in PAMs

(1) miR-c89 mimic transfection and cell inoculation:

1) plate paving: isolation of porcine alveolar macrophages from 6-week-old piglet lung tissue, cell counting and plating at 37 ℃ with 5% CO₂Culturing in an incubator;

2) transfection: the Transfection Reagent is X-tremagene siRNA Transfection Reagent from Roche, and Transfection is carried out according to the operation steps of the Transfection Reagent. After plating for 12h, transfection mix (mock and siRNA transfection reagent were dissolved in Opti-MEM, respectively, and mixed) was incubated at room temperature for 20 min. Taking out the 24-well plate from the incubator, washing the 24-well plate by PBS, replacing the washed plate with Opti-MEM, dropwise adding the mixture into the incubator, shaking the mixture uniformly, and placing the mixture into a cell culture box for culture;

3) and (3) virus inoculation: after 24h of transfection, virus inoculation is carried out, HP-PRRSV GD-HD strain is inoculated with 0.1MOI, and the required virus solution is calculated according to the formula PFU (number of cells multiplied by MOI) multiplied by 0.7 multiplied by TCID 50; taking out the 24-pore plate, washing with PBS, adding virus diluent, culturing at 37 ℃ for 1h, removing the virus liquid, and changing to 1640 culture medium with serum content of 3%;

4) collecting a sample: collecting cell samples and cell culture supernatant at 0h, 12h and 24h after infection, and storing at-80 ℃; the cell sample is used for detecting the relative expression level of PRRSV ORF7 gene and the expression condition of N protein in the cell, and the cell culture supernatant is used for detecting the copy number of virus genome released into the culture supernatant and the virus titer.

(2) RT-qPCR detection of PRRSV ORF7 mRNA relative expression level:

1) extracting RNA from cells and performing reverse transcription to obtain cDNA;

total RNA after PRRSV infection of PAMs cells was extracted using Takara rnalso Plus:

the method comprises the following steps: adding RNAioso Plus from TAKARA, and fully lysing; sequentially adding chloroform and isopropanol according to the operation instruction, centrifuging, and depositing RNA at the bottom of the tube; adding 75% ethanol to clean RNA, and adding a proper amount of RNase-free water to dissolve after the precipitate is dried;

determination of RNA concentration, purity and integrity, determination of RNA concentration and purity on a nucleic acid protein analyzer, OD₂₆₀/OD₂₈₀The ratio of (A) to (B) is between 1.8 and 2.0, and the concentration is more than 2 mu g/mu l; simultaneously, agarose gel electrophoresis is carried out, 5S rRNA,18S rRNA and 28SrRNA bands of the detected RNA are observed by a gel imaging system, and three bands are clear and complete.

The extracted RNA was subjected to reverse transcription using reverse transcription kit (PrimeScriptTM RT Regentikit) of Takara.

Reverse transcription reaction system: 5 XPrimeScript Buffer, 2. mu.l;

RT Enzyme MixI，0.5μl；Oligo dT Primer(50μM)，0.5μl；Random Primer(100μM)，0.5μl；Total RNA，500ng；RNase Free ddH₂o, make up to 10. mu.l.

The reaction conditions of reverse transcription are as follows: at 37 ℃ for 20 min; 5s at 85 ℃; 4 ℃ is prepared.

2) qPCR detection was performed to detect the mRNA expression levels of PRRSV ORF7 and internal reference HPRT-1 gene in each sample, PCR reaction system (10. mu.l): 2 × SYBR Green Mix 5.0 μ l, ddH₂O2.0. mu.l, forward primer (12. mu.M) 0.25. mu.l, reverse primer (12. mu.M) 0.25. mu.l, and template cDNA 2.5. mu.l.

The PCR reaction program is: 10min at 95 ℃; 15s at 95 ℃; 30s at 60 ℃; 15s at 95 ℃; 40 cycles.

By using

Results were analyzed using StepOne Software v2.3 Software from the Real-Time PCR System Instrument.

The qPCR primers were:

PRRSV-ORF7-F：AGATCATCGCCCAACAAAAC；SEQ ID NO.3；

PRRSV-ORF7-R：GACACAATTGCCGCTCACTA；SEQ ID NO.4；

HPRT1-F：TGGAAAGAATGTCTTGATTGTTGAAG；SEQ ID NO.5；

HPRT1-R：ATCTTTGGATTATGCTGCTTGACC；SEQ ID NO.6。

the results are shown in FIG. 1, infection of HP-PRRSV GD-HD strains after transfection of miR-c89 mimetics in PAMs cells reduced the relative expression of PRRSV ORF7 by approximately 97.8% at both 12hpi and 24hpi compared to the control mimetics group.

(3) Detecting the expression condition of PRRSV N protein by western blot:

1) sample preparation: centrifuging the collected cell sample at 500 Xg for 10min, discarding the supernatant, then resuspending the cell precipitate with PBS (K +), centrifuging at 500 Xg for 10min, and discarding the supernatant; lysing the cells with NP40 lysate containing protease inhibitor, and fully lysing for 30min on ice; centrifuging at 4 deg.C for 10min at 12,000 Xg, transferring the supernatant to a new centrifuge tube, and labeling; determining the protein concentration in the sample according to the BCA protein quantitative kit instruction of Beijing Bomaide gene technology Co., Ltd; unifying the total protein concentration of each sample by NP40 lysate, adding 5 xSDS-PAGE loading buffer, and boiling for 5min at 100 ℃; the treated protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

2) SDS-PAGE: after assembling the gel plates according to Bio-Rad instructions and fixing them on the gel-dispensing frame, 12% separation gel (10ml) was first dispensed: 3.8ml of ddH is sequentially added into a conical flask special for preparing the glue₂O, 3.4ml of 30% acrylamide, 2.6ml of 1.5M Tris-HCl (pH 8.8), 0.1ml of 10% SDS, 0.1ml of 10% ammonium persulfate, 0.004ml of TEMED. After the addition, the mixture is gently shaken and uniformly mixed to prevent bubbles, the uniformly mixed separation gel is quickly filled into a gap between two layers of glass plates of the assembled rubber plate, after the mixture is added to two thirds of the height of the rubber plate, a layer of ultrapure water is gently covered on the upper layer of the separation gel by a 200 mu l pipettor, and the mixture is kept standing for 30-60min at room temperature. After the separation gel solidified, pouring out ultrapure water on the upper layer of the separation gel, and slightly sucking the ultrapure water by using absorbent paper, and immediately preparing 5% concentrated gel (4 ml): ddH₂O2.8 ml, 30% acrylamide 0.66ml, 1.0M Tris-HCl (pH 6.8)0.5ml, 10% SDS 0.04ml, 10% ammonium persulfate 0.04ml, TEMED 0.004 ml. In the process of cleaningAdding the above components into a clean conical flask, mixing, filling the gap with rubber plate, inserting into a corresponding comb, and standing at room temperature for 30-60 min.

After the gel is prepared, the gel plate is taken down from the gel preparation frame and inserted into an electrophoresis tank according to the Bio-Rad specification, the comb in the gel is slightly and vertically pulled out, and the processed sample and the protein Marker with the same volume are added into the sample adding hole. And adding a proper amount of electrophoretic solution into the electrophoresis tank, switching on a power supply, adjusting to a constant voltage of 200V, starting electrophoresis, and stopping electrophoresis until the bromophenol blue migrates to the bottom of the separation gel.

3) Film transfer: after completion of SDS-PAGE, the gel plate was removed, the two glass plates were carefully separated, the gel removed and the concentrated gel excised. Soaking the rest gel, the activated PVDF membrane (soaked in methanol for 30s), two pieces of filter paper and sponge in the membrane transferring solution; opening a film-transferring clamp, stacking sponge, filter paper, gel, a PVDF film, filter paper and sponge (especially paying attention to the fact that no air bubbles exist between the gel and the sponge) from a negative electrode to a positive electrode in sequence, and quickly fastening the clamp after the sponge and the gel are placed, so that the gel and the PVDF film are prevented from moving; after the assembly is finished, the clamp is inserted into a film transferring groove to supplement a proper amount of film transferring buffer solution, and the film transferring groove is placed in ice water so as to prevent protein degradation caused by a large amount of heat generated in the film transferring process; the power is switched on and the constant voltage is adjusted to 100V for 1-2 h.

4) Blocking and incubation of antibodies: sealing, taking out the PVDF membrane after the membrane transfer is finished, soaking the PVDF membrane in sealing liquid, and sealing for 1h at 37 ℃; then soaking the PVDF membrane in a corresponding primary antibody diluent, and incubating for 2h at room temperature or incubating overnight at 4 ℃ on an incubation shaker; after the primary antibody incubation is finished, washing the PVDF membrane in PBST for 3 times, and 10min each time; after membrane washing, cutting the PVDF membrane according to the size of protein, respectively soaking in corresponding HRP-labeled secondary antibody diluent, and incubating for 1h at room temperature; after the incubation of the secondary antibody is finished, washing the membrane for 3 times by PBST, and each time for 10 min;

5) color development: after color development is carried out by using an ECL chemiluminescence kit, the PVDF membrane is placed into a chemiluminescence color development imaging system, and pictures are shot and stored.

The results are shown in FIG. 2, when HP-PRRSV GD-HD strains are infected after miR-c89 mimics are transfected in PAMs cells, the western blot detection result is consistent with the qPCR detection result, and the expression of PRRSV N protein is hardly detected before 24h after infection after miR-c89 mimics are transfected.

(4) RT-qPCR assay determination of PRRSV genomic copy number in supernatant samples:

1) mixing 400ul of the cell culture supernatant collected in the step (1) with 400ul of RNAioso Plus, then cracking, extracting RNA and dissolving in 15 ul of RNase-free water;

2) preparing a reverse transcription reaction system: 5 XPrimeScript Buffer, 2. mu.l;

RT Enzyme MixI, 0.5. mu.l; oligo dT Primer (50. mu.M), 0.5. mu.l; random Primer (100. mu.M), 0.5. mu.l; total RNA, 6.5. mu.l; the reaction conditions of reverse transcription are as follows: at 37 ℃ for 20 min; 5s at 85 ℃; 4 ℃;

3) positive standards (plasmid standards containing PRRSV ORF7 gene fragment) were prepared and the PRRSV genomic copy number in the supernatant samples was calculated: the complete CDS region (372bp) of PRRSV ORF7 is cloned into a pMD-18T vector, transformed to trans5 alpha competence, and subjected to sequencing identification after plasmid extraction. Plasmid DNA concentration was determined and designated pMD-18T-ORF7 (initial concentration 5.5 ng/. mu.l) as an absolute quantitative standard, and a 10-fold gradient dilution was performed according to the formula: copy number (copies) × (mass/molecular weight) × 6.0 × 1023, the copy number of the standard substance of different dilutions was calculated to form a standard curve of RT-qPCR, detection was performed with PRRSV-ORF7 RT-qPCR primers, data were analyzed with a Real time PCR analyzer, and the PRRSV genome copy number per ml of cell culture supernatant was calculated.

The results are shown in figure 3, where HP-PRRSV GD-HD strains 12hpi and 24hpi were infected after transfection of miR-c89 mimetics in PAMs cells, PRRSV genomic copy number in PAMs cell culture supernatants decreased 94.3% and 96.5% compared to the control mimetics group, respectively.

(5) TCID50 assay of PRRS virus titers in supernatant samples:

1) plate paving: pancreatic enzyme-digested MARC-145 cells were added to a suitable amount of DMEM medium containing 10% FBS to adjust the density to 1X 10⁵Adding to 96-well cell culture plate to allow cells to growGrowing into a single layer;

2) the harvested virus-containing cell supernatants were serially diluted 10-fold in sterile EP tubes with serum-free DMEM medium from 10^-1～10^-10Each dilution is mixed thoroughly and homogeneously;

3) sequentially inoculating the cells into MARC-145 cells from high dilution to low dilution, inoculating one vertical row of 8 holes in each dilution, inoculating 100 mu l of each hole, and taking two vertical rows as normal cell controls;

4) observing day by day from the second day and recording the result, wherein the observation is generally needed for 5-7 days;

5) the calculation was made for TCID50 with reference to the Reed-Muench method.

Results As shown in FIG. 4, when GD-HD strains were infected after transfection of miR-c89 mimetics in PAMs cells, the virus titers in cell culture supernatants were reduced by 0.5-log and 1.2-log (P <0.05) at 12hpi and 24hpi, respectively.

The results show that miR-c89 can obviously inhibit the replication of HP-PRRSV when miR-c89 is transfected in PAMs first and then the HP-PRRSV is infected.

Example 2 Effect of miR-c89 on replication of Low-pathogenic N-PRRSV when 50nM miR-c89 mimic is transfected and then infected into the low-pathogenic N-PRRSV in PAMs cells

(1) miR-c89 mimic transfection and cell inoculation:

plating, transfection, inoculation (0.1MOI N-PRRSV CH1a) and collection were as in example 1.

RT-qPCR detection of PRRSV ORF7 mRNA relative expression level

RNA extraction from cells, reverse transcription into cDNA and qPCR detection were as in example 1.

The results are shown in figure 5, and when the N-PRRSV CH1a strain was infected after transfection of 50nM miR-c89 mimic in PAMs cells, the relative expression of PRRSV ORF7 was reduced by 96.6% and 99.3% at 12hpi and 24hpi, respectively, compared to the control mimic group.

RT-qPCR detection of PRRSV genomic copy number in supernatant samples

The same procedure as in example 1 was followed for extracting RNA from the cell culture supernatant, reverse transcription, preparing a positive standard (plasmid standard containing PRRSV ORF7 gene fragment) and calculating the PRRSV genomic copy number in the upper clear sample.

The results are shown in figure 6, and when N-PRRSV vh 1a strain 12hpi and 24hpi were infected after transfection of miR-c89 mimetics in PAMs cells, PRRSV genomic copy number in the PAMs cell culture supernatant decreased 59.7% and 97.6%, respectively, compared to the control mimetics group.

Determination of PRRS Virus titre in supernatant samples by TCID50

Plating, dilution by fold of the virus-containing cell supernatant, measurement, observation and calculation were the same as in example 1.

The results are shown in FIG. 7, where the N-PRRSV CH1a strain 12hpi and 24hpi were infected after transfection of the miR-c89 mimic in PAMs cells, the viral titer in the cell culture supernatant decreased by 1.0-log and 2.4-log (P <0.05) at 12hpi and 24hpi, respectively.

The results are combined to show that miR-c89 can obviously inhibit the replication of N-PRRSV when miR-c89 is transfected in PAMs first and then the N-PRRSV is infected.

Example 3 Effect of miR-c89 on replication of highly pathogenic HP-PRRSV when 50nM miR-c89 mimic is transfected after infection of PAMs cells with highly pathogenic HP-PRRSV

(1) Cell inoculation and transfection with miR-c89 mimic:

1) planking was the same as in example 1;

2) and (3) virus inoculation: plating for 12h, inoculating HP-PRRSV GD-HD strain with 0.01MOI, and calculating the required virus liquid according to the formula PFU-cell number multiplied by MOI-0.7 multiplied by TCID 50; taking out the 24-well plate, washing with PBS, adding virus diluent, and culturing at 37 ℃;

3) transfection: the Transfection Reagent is X-tremeGENE siRNA Transfection Reagent of Roche, and the Transfection is carried out according to the operation steps of the Transfection Reagent; after infection for 1h, preparing a transfection mixed solution (the mimic and the siRNA transfection reagent are respectively dissolved in Opti-MEM and then mixed) and incubating for 20min at room temperature; taking out the 24-well plate from the incubator, changing the virus liquid into Opti-MEM, adding the mixture drop by drop, shaking, uniformly mixing, and placing in a cell culture box for culture;

4) collecting a sample: collecting cell samples and cell culture supernatant at 0h, 12h and 24h after infection, and storing at-80 ℃; cell samples were used to detect the relative expression level of PRRSV ORF7 gene in the cells, and cell culture supernatants were used to detect the copy number of the viral genome released into the culture supernatants.

(2) RT-qPCR detection of PRRSV ORF7 mRNA relative expression level:

RNA was extracted from the cells, reverse transcribed to cDNA and qPCR detected as in example 1.

The results are shown in FIG. 8, and the relative expression of PRRSV ORF7 was reduced by 85.9% and 84.6% at 12hpi and 24hpi, respectively, compared to the control mimetic group by transfecting the miR-c89 mimetic after infection of HP-PRRSV GD-HD strain in PAMs cells.

(3) RT-qPCR assay determination of PRRSV genomic copy number in supernatant samples:

The results are shown in FIG. 9, transfection of miR-c89 mimic after infection of HP-PRRSV GD-HD strain in PAMs cells, at 12hpi and 24hpi, the PRRSV genomic copy number in PAMs cell culture supernatant decreased by 97.8% and 99.7% respectively compared to the control mimic group.

(4) TCID50 assay of PRRS Virus titre in supernatant samples

Results As shown in FIG. 10, transfection of the miR-c89 mimic following infection of the GD-HD strain in PAMs cells reduced the viral titer in the cell culture supernatant by 0.5-log and 0.3-log (P <0.05) at 12hpi and 24hpi, respectively.

The results show that miR-c89 can obviously inhibit the replication of HP-PRRSV when 50nM miR-c89 simulant is transfected after the HP-PRRSV is infected in PAMs.

Example 4 Effect of miR-c89 on replication of Low-pathogenic N-PRRSV when 50nM miR-c89 mimic is transfected following infection of Low-pathogenic N-PRRSV in PAMs

(1) Cell inoculation and transfection with miR-c89 mimic:

plating, inoculation (0.01MOI N-PRRSV CH1a), transfection and harvesting were the same as in example 3.

(2) RT-qPCR detection of PRRSV ORF7 mRNA relative expression level:

RNA extraction from cells, inversion to cDNA and qPCR detection were as in example 3.

The results are shown in FIG. 11, and the relative expression of PRRSV ORF7 was reduced by 90.9% and 94.9% at 12hpi and 24hpi, respectively, compared to the control mimetic group by transfecting the miR-c89 mimetic after infection of the N-PRRSV CH1a strain in PAMs cells.

the same procedure as in example 3 was followed for extracting RNA from the cell culture supernatant, reverse transcription, preparing a positive standard (plasmid standard containing a fragment of PRRSV ORF7 gene) and calculating the PRRSV genomic copy number in the supernatant sample.

The results are shown in FIG. 12, and the miR-c89 mimic is transfected after infection of N-PRRSV CH1a strain in PAMs cells, and at 12hpi and 24hpi, PRRSV genome copy number in PAMs cell culture supernatant is reduced by 65.3% and 81.9% respectively compared with the control mimic group.

(4) TCID50 assay of PRRS Virus titre in supernatant samples

Plating, dilution by fold of the virus-containing cell supernatant, measurement, observation and calculation were the same as in example 3.

Results as shown in figure 13, transfection of miR-c89 mimetics after infection of the N-PRRSV CH1a strain in PAMs cells reduced the viral titer in the cell culture supernatant by 0.71-log and 0.38-log (P <0.05) at 12hpi and 24hpi, respectively.

The results show that miR-c89 can obviously inhibit N-PRRSV replication when 50nM miR-c89 mimic is transfected after N-PRRSV infection in PAMs.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> northwest agriculture and forestry science and technology university

<120> porcine miR-c89 for resisting PRRSV infection and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence

<400> 1

guacaguacu gugauaacug a 21

<210> 2

<211> 55

<212> RNA

<213> Artificial Sequence

<400> 2

gguuaucaug guaccgaugc uguauaucug aaagguacag uacugugaua acuga 55

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 3

agatcatcgc ccaacaaaac 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

gacacaattg ccgctcacta 20

<210> 5

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 5

tggaaagaat gtcttgattg ttgaag 26

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 6

atctttggat tatgctgctt gacc 24

Claims

The application of miR-c89 in preparing a preparation for inhibiting PRRSV replication is characterized in that an RNA sequence coded by the miR-c89 nucleotide sequence is as follows:

GUACAGUACUGUGAUAACUGA；SEQ ID NO.1。