CN109694867A

CN109694867A - A kind of application of DICER1 gene and its siRNA

Info

Publication number: CN109694867A
Application number: CN201811584728.8A
Authority: CN
Inventors: 肖书奇; 李爽; 张晓彬
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2018-12-24
Filing date: 2018-12-24
Publication date: 2019-04-30
Anticipated expiration: 2038-12-24
Also published as: CN109694867B

Abstract

The invention discloses a kind of DICER1 genes and its siRNA to influence the application in PRRSV duplication, the present invention strikes low DICER1 using siRNA specificity, then influence of the DICER1 to PRRSV infection host cell is had detected by qRT-PCR and TCID50, and find this host factor DICER1 by specificity strike it is low after can influence the duplication and proliferation of PRRSV, the specific siRNA of host factor DICER1 can be used for developing the drug for preventing and treating PRRSV, and corresponding to gene DICER1 can be used for the research of anti-PRRSV transgene pig.

Description

A kind of application of DICER1 gene and its siRNA

Technical field

The present invention relates to antiviral study technical field, more particularly to a kind of DICER1 gene and its siRNA Influencing the application in PRRSV duplication.

Background technique

Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, It PRRS) is to cause North America, the pig disease in Europe and Asian economy loss most serious.The cause of disease of the disease is PRRS viral (PRRSV), Piglet respiratory disease mainly is caused, growth performance is poor, dysgenesia and intra-uterine infection etc..In loss caused by PRRS Dysgenesia accounts for about 45%, mainly has miscarriage, stillborn foetus, the mummification of fetus and respiratory disorder in newborn piglet.When most serious Dysgenesia can lead to the newborn piglet death rate up to 90%.The pig to survive in uterine infection becomes the malicious pig of band afterwards, leads to ground The sexy dye drove in side.

PRRSV can be divided into European genotype (1 type) and North American genotype (2 type), and Lelystad and VR-2332 are respectively original Type bacterial strain.In every kind of genotype, virus according to its genome signature and pathogenic can be divided into different hypotypes.In China, HP- PRRSV occurred in 2006, has in NSP2 gene there are two the genetic marker of discontinuous 30aa (29aa+1aa) missing, causes The annual death more than 1,000,000 pigs in 2006, and have become the main PRRSV strain in Asia.Recently, NADC30-like PRRSV occurs in China, similar to NADC30.During the past two years, NADC30-like PRRSV has diffused into several provinces Part, become the main strain of vaccinated pig locality.Occur since with 2006 and the height for becoming Chinese Major Epidemic strain causes a disease Property PRRSV (HP-PRRSV) is compared, and the virulence of NADC30-like PRRSV is relatively low, leads to clinical respiratory symptom, and pig is dead Dying rate is 30-50%.The outburst for being inoculated with the NADC30-like PRRSV of swinery implies the invalid of current commercial vaccine.

In living cells, acted as in the Dicer enzyme usually larger protein complex needed for starting RNA silencing approach With.In tetrahymena thermophila, Dcr2 and RNA Dependent RNA polymerase Rdr1 physical coupling, the biology for siRNAs occur. In Drosophila melanogaster, Dcr-2 and albumen R2D2 interact and siRNA are promoted to be loaded on Ago2.In Caenorhabditis elegans, Dcr-1 is associated with other protein factors more than 20 kinds, and is present at least two different function compounds, these compounds It is responsible for starting endogenous and exogenous rna interference (RNAi) approach.Other than generating tiny RNA duplex, Dicer itself also be can be used Make the molecular scaffold in all these compounds.Machitani et al. proves that Dicer mediates the tiny RNA s processing of adenovirus coding To play the role of negative regulation adenoviral replication.But the duplication of PRRSV whether is influenced about DICER1 gene mutation at present And proliferation, there are no relevant reports.

Therefore it provides a kind of siRNA that can be influenced PRRSV duplication and be proliferated is those skilled in the art's urgent need to resolve Problem.

Summary of the invention

In view of this, the present invention provides a kind of DICER1 genes and its siRNA to influence the application in PRRSV duplication.

To achieve the goals above, the present invention adopts the following technical scheme:

A kind of siRNA targeting DICER1, the sequence of the siRNA are as follows:

Positive-sense strand: UCCAGAGCUGCUUCAAGCA；SEQ ID NO.1；

Antisense strand: UGCUUGAAGCAGCUCUGGA；SEQ ID NO.2.

Further, the siRNA of the targeting DICER1 is inhibiting the application in host factor DICER1 expression.

Further, the siRNA of the targeting DICER1 prevents and treats the application in PRRSV drug in preparation.

Further, a kind of host factor DICER1 is inhibiting the application in PRRSV duplication and proliferation, and specificity is struck low After the siRNA transfection PAMs cell of DICER1, it can effectively inhibit DICER1 expression, to inhibit PRRSV in PAMs cell In duplication and proliferation.

Further, a kind of host factor DICER1 is in the application developed in anti-PRRSV transgene pig.

The nucleotide sequence of host factor DICER1 is as shown in SEQ ID NO.3.

It can be seen via above technical scheme that compared with prior art, the present disclosure provides a kind of DICER1 genes And its application of the siRNA in influence PRRSV duplication, the present invention strike low DICER1 using siRNA specificity, then pass through qRT- PCR and TCID50 has detected influence of the DICER1 to PRRSV infection host cell, and finds that this host factor DICER1 is special Property strike it is low after can influence the duplication and proliferation of PRRSV, the specific siRNA of host factor DICER1 can be used for developing pre- Anti- and treatment PRRSV drug, corresponding to gene DICER1 can be used for the research of anti-PRRSV transgene pig.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this The embodiment of invention for those of ordinary skill in the art without creative efforts, can also basis The attached drawing of offer obtains other attached drawings.

When Fig. 1 attached drawing is present invention infection HP-PRRSV GD-HD strain, the relative expression of DICER1 mRNA in PAMs Amount；

When Fig. 2 attached drawing is present invention infection HP-PRRSV GD-HD strain, the relative expression quantity of PRRSV ORF7 mRNA；

When Fig. 3 attached drawing is present invention infection HP-PRRSV GD-HD strain, PRRSV gene in PAMs cell culture supernatant Group copy number；

Virus drop when Fig. 4 attached drawing is present invention infection HP-PRRSV GD-HD strain, in PAMs cell culture supernatant Degree；

In Fig. 1-Fig. 4, DICER1-siRNA: transfection is directed to the siRNA postoperative infection HP-PRRSV of DICER1 in PAMs GD-HD strain；Control siRNA group: unrelated siRNA postoperative infection HP-PRRSV GD-HD is transfected in PAMs；Normal cell controls: PAMs infects HP-PRRSV GD-HD；Blank control: transfection reagent postoperative infection HP-PRRSV GD-HD is added in PAMs；

When Fig. 5 attached drawing is present invention infection N-PRRSV strain, the relative expression quantity of DICER1 mRNA in PAMs；

When Fig. 6 attached drawing is present invention infection N-PRRSV strain, the relative expression quantity of PRRSV ORF7 mRNA；

When Fig. 7 attached drawing is present invention infection N-PRRSV strain, PRRSV genome copies in PAMs cell culture supernatant Number；

Virus titer when Fig. 8 attached drawing is present invention infection N-PRRSV strain, in PAMs cell culture supernatant；

In Fig. 4-Fig. 8, DICER1-siRNA: siRNA postoperative infection N-PRRSV poison of the transfection for DICER1 in PAMs Strain；Control siRNA group: unrelated siRNA postoperative infection N-PRRSV is transfected in PAMs；Normal cell controls: PAMs infects N-PRRSV； Blank control: transfection reagent postoperative infection N-PRRSV is added in PAMs；

When Fig. 9 attached drawing is present invention infection NADC30-like strain, the relative expression quantity of DICER1 mRNA in PAMs；

When Figure 10 attached drawing is present invention infection NADC30-like strain, the relative expression quantity of PRRSV ORF7 mRNA；

When Figure 11 attached drawing is present invention infection NADC30-like strain, PRRSV genome in PAMs cell culture supernatant Copy number；

In Fig. 9-Figure 11, DICER1-siRNA: transfection is directed to the siRNA postoperative infection NADC30- of DICER1 in PAMs Like strain；Control siRNA group: unrelated siRNA postoperative infection NADC30-like is transfected in PAMs；Normal cell controls: PAMs sense Contaminate NADC30-like；Blank control: transfection reagent postoperative infection NADC30-like is added in PAMs；

When Figure 12 attached drawing is present invention infection GZ11-G1 strain, the relative expression quantity of DICER1 mRNA in PAMs；

When Figure 13 attached drawing is present invention infection GZ11-G1 strain, the relative expression quantity of PRRSV ORF7 mRNA；

In Figure 12-Figure 13, DICER1-siRNA: siRNA postoperative infection GZ11-G1 poison of the transfection for DICER1 in PAMs Strain；Control siRNA group: unrelated siRNA postoperative infection GZ11-G1 is transfected in PAMs；Normal cell controls: PAMs infects GZ11-G1； Blank control: transfection reagent postoperative infection GZ11-G1 is added in PAMs.

Specific embodiment

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other Embodiment shall fall within the protection scope of the present invention.

DMEM culture medium, Opti-MEM culture medium, RPMI-1640 culture medium and siRNA transfection reagent are purchased from Life Tech company；Trypsase and fetal calf serum are purchased from BI company；SiRNA sequence and primer are closed by Shanghai Invitrogen company At；FastStartUniversal SYBR Green Master reagent is purchased from Roche company；HS enzyme, RNA extracts reagent (RNAiso Plus), and reverse transcription reagent box (PrimeScriptTM RT ReagentKit) is purchased from Takara Company；PAMs cell is the lung tissue that (porcine alveolar macrophage) is located away from 6 weeks piglets；MARC-145 cell (Macaca Kidney The derived cell system of cell MA-104), highly pathogenic PRRSV strain GD-HD (GenBank ID:KP793736.1), it is low cause a disease Property PRRSV strain CH1a (GenBank ID:AY032626.1), NADC30-like, GZ11-G1 (GenBank: KF001144.1 it) is saved by Xibei Univ. of Agricultural & Forest Science & Technology's animal doctor's Pathogen Biology laboratory.

Embodiment 1 strikes the influence that low DICER1 replicates HP-PRRSV in PAMs cell

(1) the siRNA transfection of DICER1 and cell connect poison:

1) bed board: separating porcine alveolar macrophage from the piglet lung tissue of 6 week old, and carries out cell count and paving Plate, in 37 DEG C of 5%CO₂It is cultivated in incubator；

2) transfect: transfection reagent be Life Tech company Lipofectamine RNAiMAX Reagent, according to turn The operating procedure of transfection reagent is transfected.Transfection cocktail (the siRNA and Lipofectamine of DICER1 is prepared after bed board 12h RNAiMAX Reagent is dissolved in Opti-MEM respectively, then the two is mixed) incubation at room temperature 5min.By 24 orifice plates from incubator It takes out, changes Opti-MEM into after being cleaned with PBS, mixture is added dropwise and rocks mixing, is placed in cell incubator and cultivates；

3) connect poison: transfection is followed by poison for 24 hours, is inoculated with HP-PRRSV GD-HD strain with 0.01MOI, thin according to formula PFU= Born of the same parents' number × MOI=0.7 × TCID50 calculates required virus liquid.24 orifice plates are taken out, after being cleaned with PBS, it is dilute that virus is added Liquid is released, connect virus liquid is discarded after 37 DEG C of culture 1h, is changed to 1640 culture mediums of serum content 3%；

4) it receives sample: 0h, 12h after infection, collecting cell sample and cell culture supernatant, -80 DEG C of preservations with 36h for 24 hours. Cell sample is used to detect the relative expression levels of PRRSV ORF7 gene in cell, and cell culture supernatant is for detecting release Virus genomic copy number and virus titer into culture solution supernatant.

(2) RT-qPCR detects DICER1 the and PRRSV ORF7 mRNA relative expression levels in PAMs:

1) it extracts the RNA in cell and is reversed to cDNA

The total serum IgE of PAMs cell is extracted using Takara company RNAiso Plus.

Step are as follows: the RNAiso Plus of TAKARA company is added in cell, sufficiently cracks；Successively add according to operating instruction Enter chloroform, isopropanol, RNA is sunken to tube bottom after centrifugation；75% ethyl alcohol cleaning RNA is added, after drying to be precipitated, is added suitable RNase-free water is dissolved.

RNA concentration, purity and integrality are measured, RNA concentration and purity are measured on Biotek micropore quantitative instrument, OD₂₆₀/OD₂₈₀Ratio between 1.8-2.0, while carrying out agarose gel electrophoresis, detected with gel imaging system observation 5S rRNA, 18S rRNA and 28S the rRNA band of RNA finds three band complete displays.

Using Takara company reverse transcription reagent box (PrimeScriptTM RT Reagent Kit) for extracted RNA carries out reverse transcription.

Reverse transcription reaction system: for 5 × PrimeScript Buffer, 2 μ l；RT Enzyme MixI, 0.5 μ l；Oligo dT Primer (50 μM), 0.5 μ l；Random Primer (100 μM), 0.5 μ l；Total RNA, 500ng；RNase Free ddH₂O supplies 10 μ l.

The reaction condition of reverse transcription are as follows: 37 DEG C, 20min；85 DEG C, 5s；4℃.

2) RT-qPCR detection is carried out, each sample needs to detect the mRNA table of the DICER1 and PRRSV ORF7 in PAMs Up to amount, internal reference is all HPRT-1 gene, PCR reaction system (10 μ l): 2 × SYBR Green Mix, 5.0 μ l, 2.0 ddH2O μ L, upstream primer (12 μM) 0.25 μ l, downstream primer (12 μM) 0.25 μ l, 2.5 μ l of template cDNA.

PCR response procedures are as follows: 95 DEG C of 10min；95℃15s；60℃30s；95℃15s；40 circulations.

WithThe StepOne Software v2.3 software of Real-Time PCR System instrument into The analysis of row result.

RT-qPCR primer are as follows:

DICER1-F:GCTTGAAGCAGCTCTGGAT；SEQ ID NO.4；

DICER1-R:CAGCTGACACTTGTTGAGCA；SEQ ID NO.5；

PRRSV-ORF7-F:AGATCATCGCCCAACAAAAC；SEQ ID NO.6；

PRRSV-ORF7-R:GACACAATTGCCGCTCACTA；SEQ ID NO.7；

HPRT1-F:TGGAAAGAATGTCTTGATTGTTGAAG；SEQ ID NO.8；

HPRT1-R:ATCTTTGGATTATGCTGCTTGACC；SEQ ID No.9.

The relative expression quantity result of DICER1 mRNA is as shown in Figure 1, transfection is for DICER1's in PAMs in PAMs When siRNA postoperative infection HP-PRRSV GD-HD strain, in PAMs the relative expression quantity of DICER1 mRNA 0hpi, 12hpi, For 24 hours when pi and 36hpi, 67.6%, 70%, 72.8% and 62.7% is reduced respectively compared with compareing siRNA group.

The relative expression quantity result of PRRSV ORF7 mRNA is as shown in Fig. 2, transfection is for DICER1's in PAMs When siRNA postoperative infection HP-PRRSV GD-HD strain, the relative expression quantity of PRRSV ORF7 mRNA is in 12hpi, pi for 24 hours 36hpi reduces 66.5%, 87.1% and 85.2% compared with compareing siRNA group respectively.

(3) PRRSV genome copy numbers in RT-qPCR detection assay cell culture supernatant:

1) cell culture supernatant of the 400ul collected in step (1) is mixed with 400ul RNAiso Plus laggard Row cracking is extracted RNA and is dissolved in the RNase-free water of 15 μ l；

2) reverse transcription reaction system: 5 × PrimeScript Buffer, 2 μ l is configured；RT Enzyme MixI, 0.5 μ l；Oligo dT Primer (50 μM), 0.5 μ l；Random Primer (100 μM), 0.5 μ l；Total RNA, 6.5μl.The reaction condition of reverse transcription are as follows: 37 DEG C, 20min；85 DEG C, 5s；4℃；

3) it prepares positive criteria product (plasmid standard containing PRRSV ORF7 genetic fragment) and calculates in cell culture PRRSV genome copy numbers in clear liquid: being cloned into pMD-18T carrier for the complete region CDS (372bp) of PRRSV ORF7, conversion To trans5 α competence, identification is sequenced after extracting plasmid.Plasmid DNA concentration is measured, as the standard items of absolute quantitation, name For pMD-18T-ORF7 (initial concentration is 5.5ng/ μ l), the gradient dilution with 10 for multiple is carried out, according to formula: copy number (copies)=(quality/molecular weight) × 6.0 × 1023, calculate the copy number of different dilution standard items, form RT-qPCR's Standard curve is detected with PRRSV-ORF7RT-qPCR primer, is analyzed data with Real time PCR analyzer, is calculated PRRSV genome copy numbers in every milliliter of cell culture supernatant.

As a result as shown in figure 3, transfecting the siRNA postoperative infection HP-PRRSV GD-HD strain for being directed to DICER1 in PAMs 12hpi, for 24 hours pi and 36hpi when, under PRRSV genome copy numbers are compared with compareing siRNA group respectively in PAMs culture supernatant Drop 53.3%, 96.5% and 96.3%.

(4) TCID50 measures the titre of PRRS virus in cell culture supernatant:

1) bed board: being added suitable DMEM culture medium containing 10%FBS for the MARC-145 cell that pancreatin has digested, and adjusts Whole density is 1 × 10⁵A/ml is added in 96 porocyte culture plates, cell is made to grow up to single layer；

2) it will collect in the DMEM culture medium of sterilizing EP Guan Zhongyong serum-free and connect containing virulent cell supernatant Continuous 10 times of dilutions, from 10^-1~10^-10, each dilution will be sufficiently mixed uniformly；

3) it is successively inoculated into MARC-145 cell from high to low by dilution, each dilution is inoculated with 8 hole of a tandem, often Hole is inoculated with 100 μ l, and taking two tandems is normal cell controls；

4) since observed and recorded day by day second day as a result, from 5~7 days；

5) TCID50 is calculated referring to Reed-Muench method.

As a result as shown in figure 4, transfecting the siRNA postoperative infection HP-PRRSV GD-HD strain for being directed to DICER1 in PAMs When, the virus titer in cell culture supernatant has dropped 0.29-log, 0.63- in 12hpi, pi and 36hpi for 24 hours respectively Log and 0.67-log (P < 0.05).

The above results show that the expression for striking low DICER1 can significantly inhibit duplication of the HP-PRRSV in PAMs cell.

Embodiment 2 strikes the influence that low DICER1 replicates N-PRRSV in PAMs cell

(1) the siRNA transfection of DICER1 and cell connect poison:

Bed board transfects, meets malicious (0.1MOIN-PRRSV CH1a) and receive sample with embodiment 1.

(2) RT-qPCR detects DICER1 the and PRRSV ORF7 mRNA relative expression levels in PAMs

It extracts RNA in cell, be reversed to cDNA and RT-qPCR detection with embodiment 1.

The relative expression quantity result of DICER1 mRNA is as shown in figure 5, transfection is for DICER1's in PAMs in PAMs When siRNA postoperative infection N-PRRSV CH1a strain, the relative expression quantity of DICER1 mRNA is in 0hpi, 12hpi, for 24 hours pi in PAMs When with 36hpi, 83.4%, 90.3%, 71.2% and 77.2% is reduced respectively compared with compareing siRNA group.

The relative expression quantity result of PRRSV ORF7 mRNA is as shown in fig. 6, transfection is for DICER1's in PAMs When siRNA postoperative infection N-PRRSV CH1a strain, the relative expression quantity of PRRSV ORF7 mRNA is in 12hpi, for 24 hours pi and 36hpi When, 96.4%, 99.8% and 98% is reduced respectively compared with compareing siRNA group.

(3) PRRSV genome copy numbers in RT-qPCR detection assay Supernatant samples

RNA, reverse transcription, preparation positive criteria product (contain PRRSV ORF7 genetic fragment in extraction cell culture supernatant Plasmid standard) and calculate in Supernatant samples PRRSV genome copy numbers with embodiment 1.

As a result as shown in fig. 7, transfecting the siRNA postoperative infection N-PRRSV CH1a strain for being directed to DICER1 in PAMs 12hpi, for 24 hours pi and 36hpi when, under PRRSV genome copy numbers are compared with compareing siRNA group respectively in PAMs culture supernatant Drop 89.2%, 99.4% and 99.9%.

(4) TCID50 measures the titre of PRRS virus in cell culture supernatant

Bed board, doubling dilution containing virulent cell supernatant, measurement, observation and are calculated with embodiment 1.

As a result as shown in figure 8, when transfection is directed to the siRNA postoperative infection N-PRRSV CH1a strain of DICER1 in PAMs, Virus titer in cell culture supernatant had dropped respectively in 12hpi, pi and 36hpi for 24 hours 1.7-log, 3.0-log and 3.3-log(P<0.05)。

The above results show that the expression for striking low DICER1 can significantly inhibit duplication of the N-PRRSV in PAMs cell.

Embodiment 3 strikes the influence that low DICER1 replicates NADC30-like in PAMs cell

(1) the siRNA transfection of DICER1 and cell connect poison:

Bed board transfects, meets malicious (0.01MOI NADC30-like) and receive sample with embodiment 1.

RT-qPCR primer are as follows:

NADC30-like-ORF7-F:ATGGCCAGCCAGTCAATCAGCTGTG；SEQ ID NO.10；

NADC30-like-ORF7-R:CCCGGTCCCTTGCCTCTGGACTGGT；SEQ ID NO.11.

The relative expression quantity result of DICER1 mRNA is as shown in figure 9, transfection is for DICER1's in PAMs in PAMs When siRNA postoperative infection NADC30-like strain, the relative expression quantity of DICER1 mRNA is in 0hpi, 12hpi, for 24 hours pi in PAMs When with 36hpi, 70.5%, 61.1%, 65% and 80.4% is reduced respectively compared with compareing siRNA group.

The results are shown in Figure 10 for the relative expression quantity of PRRSV ORF7 mRNA, and transfection is for DICER1's in PAMs When siRNA postoperative infection NADC30-like strain, the relative expression quantity of PRRSV ORF7 mRNA is in 12hpi, for 24 hours pi and 36hpi When, 63.9%, 80.6% and 98.6% is reduced respectively compared with compareing siRNA group.

(3) PRRSV genome copy numbers in RT-qPCR detection assay cell culture supernatant

RNA, reverse transcription, preparation positive criteria product (contain PRRSV ORF7 genetic fragment in extraction cell culture supernatant Plasmid standard) and calculate in cell culture supernatant PRRSV genome copy numbers with embodiment 1.

As a result as shown in figure 11, siRNA postoperative infection NADC30-like strain of the transfection for DICER1 in PAMs 12hpi, for 24 hours pi and 36hpi when, PRRSV genome copy numbers are compared with compareing siRNA group point in PAMs cell culture supernatant 61.7%, 71.3% and 99.2% is not had dropped.

The above results show that the expression for striking low DICER1 can significantly inhibit duplication of the NADC30-like in PAMs cell.

Embodiment 4 strikes the influence that low DICER1 replicates GZ11-G1 in PAMs cell

(1) the siRNA transfection of DICER1 and cell connect poison:

Bed board transfects, meets malicious (0.01MOI GZ11-G1) and receive sample with embodiment 1.

RT-qPCR primer are as follows:

GZ11-G1-ORF7-F:ATGGCCGGTAAAAATCAGAGCCAGA；SEQ ID NO.12；

GZ11-G1-ORF7-R:CTAGGTTGCTGGCGCTGGGACTTTA；SEQ ID NO.13.

The relative expression quantity result of DICER1 mRNA is as shown in figure 12 in PAMs, and transfection is for DICER1's in PAMs When siRNA postoperative infection GZ11-G1 strain, in PAMs the relative expression quantity of DICER1 mRNA 0hpi, 12hpi, for 24 hours pi and When 36hpi, 73.1%, 76.8%, 94.8% and 63.6% is reduced respectively compared with compareing siRNA group.

The relative expression quantity result of PRRSV ORF7 mRNA is as shown in figure 13, and transfection is for DICER1's in PAMs When siRNA postoperative infection GZ11-G1 strain, the relative expression quantity of PRRSV ORF7 mRNA in 12hpi, pi and 36hpi for 24 hours, with Control siRNA group is compared reduces 68.4%, 68.0% and 52.0% respectively.

The above results show that the expression for striking low DICER1 can significantly inhibit duplication of the GZ11-G1 in PAMs cell.

The foregoing description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, as defined herein General Principle can be realized in other embodiments without departing from the spirit or scope of the present invention.Therefore, of the invention It is not intended to be limited to the embodiments shown herein, and is to fit to and the principles and novel features disclosed herein phase one The widest scope of cause.

Sequence table

<110>Xibei Univ. of Agricultural & Forest Science & Technology

<120>application of a kind of DICER1 gene and its siRNA

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> RNA

<213> Artificial Sequence

<400> 1

uccagagcug cuucaagca 19

<210> 2

<211> 19

<212> RNA

<213> Artificial Sequence

<400> 2

ugcuugaagc agcucugga 19

<210> 3

<211> 5995

<212> DNA

<213> Artificial Sequence

<400> 3

ttgaaacact ggatgaatga aaagccctgc tttgcaaccc ctcagcatgg caggcctgca 60

gctcatgacc cctgcttcct caccaatggg tcctttcttt ggactgccat ggcaacaaga 120

agcaattcat gataacattt atacgccaag aaaatatcag gttgaactgc ttgaagcagc 180

tctggatcat aataccatag tctgtttaaa cactggctca gggaagacgt ttattgcagt 240

actactcact aaagagctgt cctatcagat caggggagac ttcaacagaa atggcaaaag 300

gacggtgttc ttggtcaact ctgcaaacca ggttgctcaa caagtgtcag ctgttaggac 360

tcactcggat ctcaaggttg gggaatactc gaacctagaa gtaaatgcat cttggacaaa 420

agagaaatgg aaccaagagt ttactaagca ccaggttctt gttatgactt gctctgtcgc 480

cttgaatgtt ttgaaaaatg gttacttagc actgtcagac attaaccttt tggtgttcga 540

tgagtgtcat cttgcaatcc tagatcaccc ctaccgagag attatgaagc tctgtgaaaa 600

ttgtccatca tgtcctcgta ttttggggct aactgcttcc attttaaatg ggaaatgtga 660

tccagaggaa ttggaagaaa agatacagaa actggagaaa attcttaaga gtaatgctga 720

aactgcaact gacttggtgg tcttagacag atatacttct cagccatgtg agattgtggt 780

agactgtgga ccatttactg acagaagtgg gctttatgaa agactgctga tggaattaga 840

agaagctctc aattttatca atgactgtaa catagctgta cattcaaaag aaagagattc 900

tactttaatt tccaaacaga tactgtcaga ctgtcgtgca gtattggtag ttctgggacc 960

ttggtgtgca gataaagtag ctggaatgat ggtaagagaa ctacagaaat atatcaaaca 1020

tgaacaagag gagctgcaca ggaaatttct attgtttaca gacactttcc tgaggaaagt 1080

acacgcgctg tgtgaagggc acttctcccc tgccgcgctt gacctgagat ttgtgactcc 1140

taaagtcata aaactgctcg aaatcttacg caagtacaaa ccctacgagc gacagcagtt 1200

tgaaagcgtt gagtggtata ataataggaa tcaggataat tacgtgtctt ggagtgattc 1260

ggaggatgat gaggaggacg aagaaattga agaaaaagaa aagccggaga cgaattttcc 1320

ttctccattt accaatattt tatgtggaat tatttttgtg gaaagaagat acacggcagt 1380

tgtcttaaac agattgataa aggaagctgg caaacaagat ccagagctgg cttacatcag 1440

cagcagcaat tttataactg gacatggcat tggaaagaat cagcctcgta acaaacagat 1500

ggaagcagaa ttcagaaaac aggaagaggt acttaggaaa tttcgagctc acgaaaccaa 1560

cctgctgatt gccacgagca ttgtggaaga gggtgttgat ataccaaaat gcaacctggt 1620

ggttcgtttc gatctgccca cagagtatcg atcctacgtt cagtctaagg gaagagcaag 1680

ggcgccaatc tctaattacg tcatgttagc agatacggac aaaataaaga gttttgaaga 1740

agaccttaaa acatacaaag ctattgaaaa gatcttgaga aacaaatgct ccaagtccgt 1800

tgagagtggg gagaccgacc ttgagcccgt ggtggatgac gacgacatct tcccccccta 1860

cgtgctgcgg cccgacgatg gcggtccccg ggtcaccatc aacacggcca ttggacacat 1920

caacagatac tgtgctagat tacccagtga cccgtttact catctggctc ctaagtgtag 1980

aacccgagag ttgcctgatg gtacatttta ttcaactctt tatctgccaa ttaattcacc 2040

tcttcgagcc tccattgttg gccccccaat gagctgtata cgattggctg aaagagtcgt 2100

ggctctcatt tgctgtgaaa aactgcacaa aattggtgaa ctggatgacc atttgatgcc 2160

ggttgggaaa gagacggtta aatacgaaga ggagcttgat ttacatgatg aggaggagac 2220

cagtgttcca ggaagaccag gctccacaaa acgaagacag tgctacccaa aagcgattcc 2280

agaatgtttg cgggacagct accccaagcc cgatcagccc tgttacctgt atgtgatagg 2340

gatggttctg acaacacctc tccccgatga actcaacttt agaaggcgga agctctatcc 2400

ccccgaggac accacaagat gcttcggaat actgacagcc aaacccatac ctcagattcc 2460

tcactttcct gtgtacacac gctctggaga ggtcaccatt tccattgagt tgaagaagtc 2520

tggtttcacg ctgtctctgc aaatgcttga gctgattaca agacttcacc agtatatatt 2580

ttcacatatt cttcggcttg agaaacctgc actagagttt aaacccaccg acgctgactc 2640

agcatactgt gttctacctc ttaatgtcgt taatgactcc agcactttgg acattgactt 2700

taaattcatg gaagacatcg agaaatcaga agctcgcata ggcattccca gtacaaagta 2760

ttcaaaagaa acaccttttg tttttaaatt agaagattac caagatgcag ttatcattcc 2820

aaggtatcgc aattttgatc agcctcatcg attttacgta gctgatgtgt acactgatct 2880

taccccactg agtaaatttc cttcccctga gtatgaaact tttgcagaat attataaaac 2940

gaagtataac cttgacctga ccaatctcaa ccagccgctg ctggatgtgg accacacatc 3000

gtcaagactt aatcttttga cacctcgcca tttgaatcag aaggggaaag ctcttcctct 3060

gagcagcgct gaaaagagga aagccaaatg ggagagtctg cagaacaaac agatcctggt 3120

tccggaactc tgtgctatcc atccaattcc agcatcactg tggagaaaag cagtctgtct 3180

ccccagcatc ctttatcgcc ttcactgcct tctgaccgcg gaggagctaa gagcccagac 3240

ggccagcgat gctggtgtgg gagtcagatc acttcccgtg gattttagat accccaactt 3300

agacttcggg tggaaaaaat ccatcgacag caaatctttc atctcagttg ctaactcctc 3360

ttcagctgaa aacgagaact actgtaagca cagccccctc gtccctgaac atgctgcaca 3420

tcgaggtgct aaccgaccct ccgctctcga aaatcacggc cacacgtctg tgacctgccg 3480

agcgctcctc agcgagtccc ctgctaagct cccgatcgac gttgcaacag atctgacagc 3540

agtgaacggt ctttcgtaca ataaaaatct tgccaatggc agttacgact tagctaacag 3600

agacttttgc caaggaaatc atctgagtta ctacaagcag gaaatacctg tacaaccaac 3660

tacctcatat cccattcaga atttatacaa ttacgagaac cagccccagc ccagcgatga 3720

atgtactcta ctgagtaata aataccttga tggaaatgct aacaaatcta cctcagaagg 3780

acgtcccacg atgcctggta ctacagaggc tggtaaggcg ctttcggaaa ggatggcttc 3840

tgcgcagagc cctgctccgg gctactcccc gaggactcct ggcccaaacc ctggactcat 3900

ccttcaggct ctgacccttt caaacgctag cgacggattt aacctggagc ggctcgaaat 3960

gctcggtgac tccttcttaa agcacgccat caccacgtat ctcttttgca cttaccctga 4020

tgctcacgag ggccgccttt cgtatatgag aagcaaaaag gtcagcaact gtaacctgta 4080

tcggcttggg aagaagaagg gcctgcccag ccgcatggtg gtgtcgatat ttgatccccc 4140

tgtgaactgg cttcctcctg gttatgtagt aaatcaagac aaaagtaaca cagacaaatg 4200

ggaaaaagat gaaatgacaa aagactgcgt gctggctaac ggcagactgg acgccgacct 4260

ggaggaggag gacgccgccg cgctcatgtg gaggccgccc agggaggagg ccgaggacga 4320

cgaggacctc ctggagtacg accaggagca catcaggttc atagacagca tgctgatggg 4380

gtcaggagcc ttcgtcaaga agattgctct tgctcccttc gccgccgccg atcctgccta 4440

cgaatggaag atgcccaaaa aggcccccct ggggagcatg cccttttccg cagatttcga 4500

ggactttgac tacagctcgt gggatgccat gtgctatctg gaccccagca aagccgttga 4560

ggaggatgac tttgtggtgg gcttctggaa tccatccgaa gagaactgtg gtgtggacac 4620

aggcaaacag tccatttctt acgacttgca cacggagcag tgcatcgctg acaaaagcat 4680

cgccgactgt gtggaagccc tgctgggctg ctacttgacc agctgtggcg agcgggccgc 4740

tcagctcttc ctctgctcgc tgggcctgaa ggtgctcccg gcggtgaaga ggaccgatcg 4800

ggcacaggcc gcctgcccgg ccagggagag cttcaccagc caacaaaaga ccctttccgg 4860

gggccggccc gccgccggct cccgctcttc cgggttgaaa gacttggagt acggctgttt 4920

gaagatccca ccgagatgta tgtttgatca cccagacgca gacaggacac tcagtcacct 4980

catctcgggc tttgagaact tcgaaaggaa gatcaactac agcttcaaga ataaggctta 5040

ccttctgcag gccttcaccc acgcctccta ccactacaac accatcaccg attgttacca 5100

gcgcctggag ttcctgggag atgccattct ggactacctc ataaccaagc acctttacga 5160

agacccgcgg cagcactccc cgggggtcct gaccgacctg cgctctgctc tggtcaacaa 5220

caccatcttc gcctcgctgg ccgtcaagta cgactaccac aagtacttca aggccgtgtc 5280

gcccgagctc ttccacgtca tcgatgattt tgtgcagttt cagcttgaga agaacgagat 5340

gcaggggatg gattctgagc ttaggagatc tgaggaggat gaagagaaag aagaggatat 5400

tgaagttccg aaggccatgg gggacatttt tgagtcgctt gctggtgcca tttacatgga 5460

tagtggaatg tcactggagg tggtttggca ggtgtactat ccgatgatgc ggccgctaat 5520

agaaaaattt tctgcaaacg tgccccgttc gcctgtgcga gaattgcttg aaatggaacc 5580

agaaaccgcc aaatttagcc cggctgagag aacttacgat ggcaaggtca gagtcaccgt 5640

ggaagtcgta ggaaagggga aattcaaagg tgttggccga agttacagga ttgccaaatc 5700

tgcagcagca cgacgagccc tgcgaagcct caaagctaat caacctcagg ttcccaacag 5760

ctgaaacccc tttttaaaat aacgaaaaga agcagagtta aggtggaaaa tatttaagtg 5820

gaaaaggatg atttaaaatt ggcagtgagt ggaatgaatt gaaggcagaa gttaaagttt 5880

gataacaagc tagattgcag aataaaacat ttaacatatg tataaaacct ttggaactaa 5940

ttgtagtttt agttttttgc gcaaacacaa tcttgtcttc tttcctcact tctgc 5995

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 4

gcttgaagca gctctggat 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

cagctgacac ttgttgagca 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

agatcatcgc ccaacaaaac 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

gacacaattg ccgctcacta 20

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 8

tggaaagaat gtcttgattg ttgaag 26

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 9

atctttggat tatgctgctt gacc 24

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 10

atggccagcc agtcaatcag ctgtg 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 11

cccggtccct tgcctctgga ctggt 25

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 12

atggccggta aaaatcagag ccaga 25

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 13

ctaggttgct ggcgctggga cttta 25

Claims

1. a kind of siRNA for targeting DICER1, which is characterized in that the sequence of the siRNA is as follows:

Positive-sense strand: UCCAGAGCUGCUUCAAGCA；SEQ ID NO.1；

Antisense strand: UGCUUGAAGCAGCUCUGGA；SEQ ID NO.2.

2. a kind of siRNA for targeting DICER1 according to claim 1, which is characterized in that the siRNA is inhibiting host Application in factor D ICER1 expression.

3. a kind of siRNA for targeting DICER1 according to claim 1, which is characterized in that the siRNA prevents in preparation With the application in treatment PRRSV drug.

4. a kind of host factor DICER1 is inhibiting the application in PRRSV duplication and proliferation, which is characterized in that specificity is struck low After the siRNA transfection PAMs cell of DICER1, it can effectively inhibit DICER1 expression, to inhibit PRRSV in PAMs cell In duplication and proliferation.

5. a kind of host factor DICER1 is in the application developed in anti-PRRSV transgene pig.