JP2013005814A - Method for producing cosmetic for skin care - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing cosmetics for skin care, using a recombinant nucleic acid composition including non-naturally occurring intron.SOLUTION: The components of the non-naturally occurring intron can be processed into small hairpin RNA (shRNA) and/or microRNA (miRNA) molecules by skin cells and thus can induce specific gene silencing effects on skin pigment-related genes and/or aging-causing genes in the cells. The cosmetics not only useful for lightening and whitening skin colors but also useful for suppressing unwanted aging gene activity in skin are obtained by using the recombinant nucleic acid composition including the intron.

Description

  The present invention relates to a means for the development and production of cosmetics for skin care. Specifically, the present invention relates to methods and compositions for producing non-naturally occurring introns. The components of the non-naturally occurring intron are related to intracellular skin pigments because they can be processed by skin cells to become short hairpin RNA (shRNA) and / or microRNA (miRNA) molecules. Specific gene silencing effects can be induced on genes and / or genes that cause senescence. The gene silencing effect thus obtained is not only useful for skin color brightness and whitening, but also effective in suppressing unnecessary aging gene activity in the skin.

  This application claims priority based on a US provisional patent application dated October 31, 2007, whose title is “Design and Product of New Cosmetics Using Intron RNA Technology” by Shi-Lung Lin and David Wu et al. To do. This application was also filed on May 15, 2003, US patent application Ser. No. 10 / 439,262, “RNA Splicing and Processing Induced Gene Silencing and its Applications,” and March 31, 2006. US patent application Ser. No. 11 / 278,143 claims the benefit of “new gene transfer methods using intron RNA” and is incorporated herein by reference.

  Although pigmentation (ie sunburn) and prevention of aging are key to maintaining healthy skin, many skin pigments and aging processes are associated with an individual's genetic activity. For example, hyaluronidase (Hyal) often causes skin wrinkles by degrading subcutaneous hyaluronic acid (HA), the main anti-aging extracellular matrix in the skin, but tyrosinase, a chromosomal membrane-bound glycoprotein (Tyr) is an important rate-limiting enzyme for melanin (black pigment) biosynthesis in skin and hair. Therefore, good skin care can be achieved by inhibiting these unnecessary activities.

  At present, there is no technology related to hyaluronidase inhibitors for wrinkle removal. To make light and whitened skin, many prior art attempts to inhibit tyrosinase function have often used hormone-derived inhibitory peptides, small molecule chemicals and several plant extracts. These plant extracts include oligopeptides (for example, Patent Document 1 by Pinel, Patent Document 2 by Schonrock), hydroxytetronic acid derivatives (for example, Patent Document 3 by Perricone), benzoyl Compounds (eg, Patent Document 4 by Kim), hydroquinone compositions (eg, Patent Documents 5 and 6 by Wortzman), alcohol diols and triol analogs (eg, Patent Document 7 by Brown), kojic acid Derivatives (for example, Patent Document 8 by Ancira), enzymes derived from Ascomycetes (for example, Patent Document 9 by Mamone), and plant extracts (for example, Patent Document 10 by Nagamine, Lee) Patent Document 11 by Lee, Patent Document 12 by Stick, Patent Document 13 by Pauly, Patent Documents 14, 15 and 16 by Riverette, Patent Documents 17, 18 and 19 by Arquette U.S. Pat. Nos. 6,028,049 to Chaudhuri. Although these substances and methods work well in vitro, only a few substances such as hydroquinone and its derivatives induce good pigmentation-reducing effects in clinical trials (Non-patent Document 1). Can do. Nevertheless, all hydroquinone derivatives derived to reactive quinones are presumed to be cytotoxic drugs. These differences between in vitro and in-vivo studies suggest that innovative strategies are needed to demonstrate their safety and efficacy. (These publications in this application, as well as all other cited publications and patents, are hereby incorporated by reference.)

  With recent advances in RNA interference (RNAi) technology, novel small RNA agents include double-stranded small interfering RNA (eg, dsRNA / siRNA) (Non-patent Documents 2 and 3), and doxy. It has been found to have a more potent effect in targeted gene suppression, including the use of ribonucleotide RNA-interfering molecules (eg, D-RNAi) (Non-Patent Document 4). Perhaps these small RNA drugs could be used to design new cosmetic products and products for skin care. In principle, the RNAi mechanism has a powerful effect at a few nanomolar doses, eliciting a post-transcriptional gene silencing (PTGS) phenomenon that can repress specific gene functions, but this dose is It has been proved to have a longer lasting effect and less toxicity than conventional gene deletion methods using sense oligonucleotides and small molecule chemical inhibitors (Non-Patent Document 5). According to many previous studies (Non-patent document 6, Non-patent document 3, Non-patent document 4 and Non-patent document 7), the siRNA-induced gene silencing effect lasts for one week, while the D-RNAi effect is After a single treatment, it can be maintained for another month. siRNA / D-RNAi agents cause a series of intracellular sequence-specific mRNA degradation and / or translational repression processes, affecting all gene transcripts or cosuppressions that exhibit a high degree of homology. Co-suppression resulting from the production of small RNA products (21-25 nucleotide bases) due to enzymatic activity towards abnormal RNA templates by RNase III endoribonuclease (Dicer) and / or RNA-dependent RNA polymerase (RdRp) has been observed Yes. This cosuppression is usually a derivative from a foreign transgene or viral genome (Non-Patent Document 6, Non-Patent Document 3, and Non-Patent Document 4). Based on this established RNAi mechanism, prior art attempts to inhibit tyrosinase function using synthetic siRNA and / or dsRNA agents include Patent Document 22 by Binetti and Collin-Djangon. Patent document 23 is mentioned.

  Despite current RNAi technology opening up new avenues for the suppression of unnecessary gene functions in the skin, these applications are still ongoing for higher vertebrates including fish, birds, mammals and humans. It has not been proved to be effective and safe. For example, most siRNA drugs are based on the form of double-stranded RNA (dsRNA). This form has been shown to cause non-specific RNA degradation mediated by interferons in vertebrates (Non-Patent Document 8, Non-Patent Document 3, Robinson, US Pat. Patent Document 25). Such interferon-mediated cytotoxic reactions reduce the target specificity of siRNA-induced gene silencing effects and often result in extensive RNA degradation in vertebrate cells (Non-Patent Document 8 and Non-Patent Document 3). . In particular, it has been clarified that the RNAi effect is prevented when the siRNA / dsRNA size is longer than 25 base pairs (bp) in mammalian cells (Non-patent Document 3). Transfection of siRNA or short hairpin RNA (shRNA) less than 25 bp in size will not completely eliminate such problems. It is reported that high doses of siRNA and shRNA (eg,> 250 nM in human T cells) are high, as reported in Sledz et al. [9] and Lin et al. [10] This is because it can cause strong cytotoxic effects similar to doses of long dsRNA. This toxicity is due to the double-stranded RNA form they possess, which promotes interferon-mediated non-specific RNA degradation and programmed cell death via the cellular PKR and 2-5A system signaling pathways. Interferon-inducible protein kinase PKR is activated when activation of the interferon-inducible 2 ', 5'-oligoadenylate synthase activity (2-5A) system is induced to large cleavage of single-stranded RNA (ie, mRNA) Inducing cell apoptosis is well known (Non-patent Document 8). Both the PKR and 2-5A systems contain a dsRNA binding motif that has a high affinity for the form of double-stranded RNA. Furthermore, the most difficult problem is that large amounts of RNase activity in higher vertebrates makes it impossible to deliver these small and unstable siRNA / shRNA constructs in vivo (Non-patent Document 11).

  Since the RNAi effect is naturally caused by the production of a small RNA product (21-25 nucleotide bases) from a transcription template derived from a foreign transgene or viral genome (Non-Patent Document 6 and Non-Patent Document 4), Pol Recent utilization of siRNA / shRNA expression vectors mediated by -III provides a relatively stable RNAi effect in vivo. (Non-patent document 12). Prior art (Non-Patent Document 13, Non-Patent Document 14, and Non-Patent Document 15) that tried the siRNA based on such a vector succeeded in maintaining a constant gene silencing effect. The reason that their strategy failed to focus on the RNAi effect on the targeted cell or tissue population was due to the use of the ubiquitous type III RNA polymerase (Pol-III) promoter. Pol-III promoters such as U6 and H1 are activated in almost all types of cells, making tissue-specific gene targeting impossible. In addition, in short RNA templates that do not have an appropriate assembly, in many cases, leakage of the read-through activity of Pol-III transcription occurs, so that a desired high molecular weight RNA product longer than 25 bp is synthesized. This will cause unexpected interferon cytotoxicity (Non-Patent Document 16 and Non-Patent Document 17). Such problems can also be attributed to a competitive conflict between the Pol-III promoter and another vector promoter (ie, LTR and CMV promoter). Moreover, high concentrations of siRNA / shRNA generated from a Pol-III-dependent RNAi system oversaturate the cellular natural microRNA (miRNA) pathway, thereby causing massive inhibition of miRNA and cell death. Recently, it has been attracting attention (Non-patent Document 18). These disadvantages prevent the use of Pol-III based RNAi vector systems in health care.

US Pat. No. 7,268,108 US Pat. No. 6,852,699 US Patent No. 7,019,029 US Pat. No. 6,838,481 US Pat. No. 6,998,130 US Patent No. 7,025,977 US Pat. No. 7,250,157 US Pat. No. 6,710,076 US Pat. No. 6,514,506 US Patent No. 7,192,617 US Pat. No. 7,125,572 US Pat. No. 6,521,267 US Pat. No. 7,105,184 US Pat. No. 6,994,874 US Patent No. 7,060,304 US Pat. No. 7,247,321 US Pat. No. 7,025,957 US Pat. No. 7,029,709 US Pat. No. 7,097,866 US Pat. No. 6,649,150 US Pat. No. 6,969,509 US Patent Application Publication No. 20050137151 US Patent Application Publication No. 20070134188 U.S. Pat. No. 4,289,850 US Pat. No. 6,159,714

Solano et al., Pigment Cell Res. 19: 550-571, 2006 Fire et al., Nature, 391, 806-811, 1998. Elbashir et al., Nature, 411, 494-498, 2001. Lin et al., Biochem. Biophys. Res. Commun. 281: 639-644, 2001 Lin et al., Current Cancer Drug Targets, Volume 1, pp. 241-247, 2001 Grant, S.M. R. Cell, 96, 303-306, 1999. Lin et al., Drug Design Reviews, Vol. 1, 247-255, 2004a Stark et al., Annu. Rev. Biochem. 67, 227-264, 1998 Sledz et al., Nat Cell Biol. 5: 834-839, 2003 Lin et al., Intrn'l J. et al. Oncol. 24, 81-88, 2004b Brantl S.M. Biochimica et Biophysica Acta, 1575, 15-25, 2002. Tuschl et al., Nat Biotechnol. 20: 446-448, 2002 Miyagi et al., Nat Biotechnol, Vol. 20, 497-500, 2002 Lee et al., Nat Biotechnol, Vol. 20, pp. 500-505, 2002 Paul et al., Nat Biotechnol, 20, 505-508, 2002 Gunner et al., J Mol Biol. 286, 745, 757, 1999. Schramm et al., Genes Dev, Vol. 16, pp. 2593-2620, 2002 Grimm et al., Nature, 441, 537-541, 2006.

  In order to improve the delivery stability, target specificity and safety of current RNAi technology for skin health care, favorable guidance and maintenance strategies are highly expected. Therefore, there is still a need for an effective, stable and safe gene preparation method, and a need for pharmaceutical compositions to inhibit unnecessary gene function in the skin using a novel RNAi mechanism. is doing.

  In order to solve the above-mentioned object, the invention according to claim 1 is a method for producing a cosmetic product for skin care, which comprises: (a) genes and aging related to pigments in mammalian skin cells. A recombinant nucleic acid composition comprising at least one intron having an intron insert for encoding a microRNA or shRNA capable of inducing a specific gene silencing effect in at least one of the genes causing And (b) a cloning step for cloning the recombinant nucleic acid composition into a vector for delivery to mammalian skin cells, wherein the recombinant nucleic acid composition and vector are not integrated into the cell genome. Multiple primary RNA transcripts can be generated from recombinant nucleic acid compositions, To generate a micro RNA or shRNA that inhibits at least one of the genes that cause associated genes and senescence in, provided introns are spliced by a plurality of primary RNA transcript, methods, and.

The gist of the invention described in claim 2 is that the method according to claim 1 further includes a step of synthesizing a nucleic acid composition of intron.
The gist of the invention of claim 3 is that, in the method of claim 1, the nucleic acid composition is chemically produced or linked by a DNA synthesizer.

  The invention according to claim 4 is the genetic engineering method according to claim 1, wherein the nucleic acid composition is selected from the group consisting of DNA ligation, transgene insertion, transposon delivery, retroviral infection, and combinations thereof. The gist is that they are connected by a technique.

  The invention according to claim 5 is the method according to claim 1, wherein the microRNA or shRNA is modified from the precursor of microRNAmir-434 or microRNAmir-434 having the sequence of SEQ ID NO: 25. The gist.

  The gist of the invention according to claim 6 is that, in the method according to claim 1, at least one of the pigment-related gene and the gene causing aging is a tyrosinase gene or a hyaluronidase gene.

  The invention according to claim 7 is the method according to claim 1, wherein the recombinant nucleic acid composition is an artificial non-recombinant prepared by restriction enzyme cleavage of a synthetic DNA sequence of an intron and a genetic engineering technique of DNA recombination. The gist is that it is a natural gene.

  The gist of the invention described in claim 8 is that, in the method according to claim 1, the recombinant nucleic acid composition is a cellular gene prepared by incorporation of the intron within the sequence of the nucleic acid composition. To do.

  The invention according to claim 9 is the method according to claim 8, wherein the cellular gene is a gene selected from the group consisting of a viral gene, a mammalian gene, a protein coding gene, a non-protein coding gene, and a combination thereof. That is the gist.

  The invention according to claim 10 is the method according to claim 8, wherein the intron is selected from the group consisting of homologous recombination, DNA ligation, transgene insertion, transposon delivery, retroviral infection, and combinations thereof. The gist is to be incorporated into the cellular gene by genetic engineering techniques.

  The invention according to claim 11 is the method according to claim 1, wherein the intron is at least one of microRNA and shRNA, branch point motif, polypyrimidine region, donor splice site and acceptor splice site. The gist of the present invention is a nucleic acid sequence comprising a component of the intron insert that encodes one.

  The invention according to claim 12 is the method according to claim 1, wherein the intron insert is selected from shRNA, microRNA, shRNA and microRNA precursors, shRNA and microRNA derivatives, and combinations thereof. The gist is to code at least one.

  The gist of the invention described in claim 13 is that, in the method described in claim 1, the intron insert contains at least a sequence complementary to the tyrosinase gene or hyaluronidase gene.

  The invention according to claim 14 is the method according to claim 1, wherein the intron insert encodes a hairpin-like nucleic acid comprising a stem-loop structure comprising any one of SEQ ID NO: 1 and SEQ ID NO: 2. The gist of that is.

  The invention according to claim 15 is the method according to claim 1, wherein the intron insert comprises at least a sequence of SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 25, a hairpin-like precursor microRNA (pre-miRNA) The gist of this is to code.

  The gist of the invention of claim 16 is that, in the method of claim 1, the microRNA (miRNA) or the shRNA comprises the sequence of SEQ ID NO: 9 or SEQ ID NO: 11.

  The invention according to claim 17 is the method according to claim 1, wherein the intron insert is AatII, AccI, AflII / III, AgeI, ApaI / LI, AseI, Asp718I, BamHI, BbeI, BclI / II, BglII BsmI, Bsp120I, BspHI / LU11I / 120I, BsrI / BI / GI, BssHII / SI, BstBI / U1 / XI, ClaI, Csp6I, DpnI, DraI / II, EagI, Ecl136II, EcoRI / RII / 47III, Ihe , HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI / II, KasI, KpnI, MaeII / III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, N eI, NgoMI, NotI, NruI, NsiI, PmlI, Ppu10I, PstI, PvuI / II, RsaI, SacI / II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaIh, TaIh The gist is to be incorporated into the intron through at least one restriction / cloning site selected from the group consisting of a site and a combination thereof.

  The gist of the invention described in claim 18 is the method according to claim 11, wherein the branch point is an adenosine (A) nucleotide located in the nucleic acid sequence comprising the sequence of SEQ ID NO: 5.

  The invention according to claim 19 is the method according to claim 11, wherein the branch point is an adenosine located within a nucleic acid sequence comprising at least one oligonucleotide motif comprising a sequence that is 5'-TACTAAC-3 ' (A) The gist is that it is a nucleotide.

  The invention according to claim 20 is the method according to claim 11, wherein the polypyrimidine region is a nucleic acid sequence containing a high content of T or C containing the sequence of SEQ ID NO: 6 or 7 The gist.

The gist of the invention described in claim 21 is that, in the method described in claim 11, the donor splice site is a nucleic acid sequence comprising the sequence of SEQ ID NO: 3.
22. The method according to claim 11, wherein the donor splice site is a nucleic acid sequence comprising a 5′-GTAAG-3 ′ sequence.

The invention according to claim 23 is characterized in that, in the method according to claim 11, the acceptor splice site is a nucleic acid sequence comprising the sequence of SEQ ID NO: 4.
The gist of the invention described in claim 24 is that, in the method described in claim 11, the acceptor splice site is a nucleic acid sequence containing the sequence of 5′-CTGCAG-3 ′.

  The invention according to claim 25 is the method according to claim 1, wherein the vector is an expression selected from the group consisting of a plasmid, a cosmid, a phagemid, a yeast artificial chromosome, a transposon, a retrotransposon, a viral vector, and combinations thereof. The gist is that it is a possible vector.

  The invention according to claim 26 is the method according to claim 1, wherein the recombinant nucleic acid composition or the vector is at least one of a virus and a type II RNA polymerase (Pol-II) promoter, or both. The gist is to include at least one of a Kozak common translation initiation site, a polyadenylation signal, and a plurality of restriction / cloning sites.

  The invention according to claim 27 is the method according to claim 26, wherein the viral promoter is cytomegalovirus (CMV), retrovirus long terminal region (LTR), hepatitis B virus (HBV), adenovirus. (AMV), adeno-associated virus (AAV), or RNA promoters and their derivatives isolated from plant-associated mosaic viruses.

  The invention according to claim 28 is the method according to claim 26, wherein the restriction / cloning site is AatII, AccI, AflII / III, AgeI, ApaI / LI, AseI, Asp718I, BamHI, BbeI, BclI / II, BglII, BsmI, Bsp120I, BspHI / LU11I / 120I, BsrI / BI / GI, BssHII / SI, BstBI / U1 / XI, ClaI, Csp6I, DpnI, DraI / II, EagIII, Ecl136II, EcoRI / RII / III, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI / II, KasI, KpnI, MaeII / III, MfeI, MluI, MscI, MseI, NaeI, NarI, Nc I, NdeI, NgoMI, NotI, NruI, NsiI, PmlI, Ppu10I, PstI, PvuI / II, RsaI, SacI / II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiIh The gist thereof is an oligonucleotide cleavage domain for an endonuclease selected from the group consisting of XmaI restriction enzymes and combinations thereof.

  The invention of claim 29 is the method of claim 1, wherein the vector further comprises a pUC origin of replication and an SV40 early promoter for expressing at least an antibiotic resistance gene in a replicable prokaryotic cell. , Selective SV40 origin for replication in mammalian cells.

  The invention according to claim 30 is the method according to claim 29, wherein the antibiotic resistance gene is penicillin G resistance gene, ampicillin resistance gene, neomycin resistance gene, puromycin resistance gene, kanamycin resistance. Gene, streptomycin resistance gene, erythromycin resistance gene, spectromycin resistance gene, fosfomycin resistance gene, tetracycline resistance gene, rifapicin resistance gene, amphotericin B resistance gene, gentamicin resistance gene, chloramphenicol The gist is selected from the group consisting of a resistance gene, a cephalothin resistance gene, a tyrosine resistance gene, a G418 resistance gene, and combinations thereof.

  The invention according to claim 31 is the method according to claim 1, wherein the recombinant nucleic acid composition is a group consisting of liposomal transfection, electroporation, transposon insertion, microinjection, gene gun penetration, and combinations thereof. The gist is to be introduced into the skin cells of the mammal by a more selected delivery method.

  The invention according to claim 32 is the method according to claim 1, wherein the RNA primary transcript of the recombinant nucleic acid composition is type II (Pol-II), type I (Pol-I), and viral. The gist is that it is produced by a transcription mechanism selected from the group consisting of RNA polymerase transcription mechanisms.

  The invention according to claim 33 is the method according to claim 1, wherein the RNA primary transcript of the recombinant nucleic acid composition is mRNA, hnRNA, rRNA, tRNA, snoRNA, snRNA, pre-microRNA, viral RNA and the like. It is a ribonucleotide sequence selected from the group consisting of RNA precursors and derivatives thereof.

  The invention according to claim 34 is the method according to claim 1, wherein the microRNA or the shRNA is an intron excision selected from the group consisting of RNA splicing, nonsense mutation-dependent degradation (NMD) processing, and combinations thereof. The gist is that it is released from the intron by a mechanism.

  The gist of the invention according to claim 35 is that, in the method according to claim 1, the specific gene silencing effect is caused by intracellular silencing after transcription, RNA interference or nonsense mutation-dependent degradation mechanism. And

  Studies on the assembly of protein coding exons based on gene transcription (eg, mRNA) are fully described in the literature, and of course, spliced noncoding introns are destined to be completely digested (Nott et al., RNA 9, Vol. 607-617, 2003). The fact is that an intron protein of a gene is a non-functional gene waste product or whether its function has not yet been discovered. Recently, this misconception was corrected by observation of intron microRNA (miRNA) (Lin et al., Biochem Biophys Res Commun., 310, 754-760, 2003; Ying et al., Gene, 342, 25-28, 2004; Ying et al., Biochem Biophys Res Commun., 326, 515-520, 2005). Intron miRNAs are a new class of small single-stranded regulatory RNAs (pre-mRNAs) derived from gene introns, which are spliced out of the precursor messenger RNA (pre-mRNA) of the coding gene and further short hairpins. It is processed into miRNA. miRNAs typically have a length of 18-27 nucleotides (nt) and, depending on the complementarity between the miRNA and its target, reduce the messenger RNA (mRNA) target or target mRNA protein Translation can be suppressed. In this way, intronic miRNAs are functionally similar to the previously described siRNA / shRNA, but differ in the requirements for intracellular processing for type II RNA polymerase (Pol-II) transcription and RNA splicing for biogenesis. (Non-Patent Document 4). Introns also naturally contain multiple translation stop codons for recognition by intracellular nonsense mutation-dependent degradation mechanisms (NMDs) (Zhang et al., Nature, 372, 809-812, 1994; Lewis et al., Proc. Natl. Acad. Sci. USA, 100, 189-192, 2003), most unstructured intron sequences cause excessive accumulation that is toxic to cells. It can be rapidly degraded after RNA splicing to prevent. Approximately 10% -30% of spliced introns have been determined to be retained after NMD digestion and further transported to the cytoplasm with a mild half-life, suggesting the cellular origin of naturally occurring intron miRNAs (Clement et al., RNA, Vol. 5, pp. 206-220, 1999).

  As shown in FIG. 1, natural intron miRNA biogenesis occurs in a specific nuclear region close to the genomic perichromatin fiber, and nascent Pol-II-mediated pre-mRNA transcription and intron splicing / removal (Non-Patent Document 7 and Ghosh et al., RNA, Vol. 6, pp. 1325-1334, 2000). In eukaryotes, protein-coding gene transcription such as mRNA is generated by type II RNA polymerase (Pol-II). Transcription of the genomic gene produces precursor messenger RNA (pre-mRNA). The precursor messenger RNA contains four major parts: a 5'-untranslated region (UTR), a protein coding exon, a non-coding intron and a 3'-UTR. Generally speaking, both 5'- and 3'-UTR are seen as a kind of intron extension. Introns occupy the largest portion of non-coding sequences in pre-mRNA. Each intron includes a range of up to 30 kilobases and requires removal from the pre-mRNA content prior to mRNA maturation. This process of pre-mRNA excision and intron removal is called RNA splicing and is performed by the intracellular spliceosome. After RNA splicing, some intron-derived RNA fragments are further processed to form microRNA (miRNA) -derived molecules. The molecule effectively silences each target gene through an RNA interference (RNAi) -like mechanism when exons of pre-mRNA are combined together to form mature mRNA for protein synthesis.

  We have already demonstrated that effective mature miRNAs can be generated from introns of vertebrate genes. The biogenesis process is different from that of siRNA and intergenic miRNA (Lin et al., 2003, supra, Lin et al., Gene, 356, 32-38, 2005). To demonstrate these differences, FIG. 2 shows a comparison of innate biogenesis and RNAi mechanisms in siRNA, intergenic (exon) miRNA and intron miRNA. Presumably, siRNA is formed by two fully complementary RNAs transcribed by two promoters placed inversion from one DNA template, then hybridized, and further by RNaseIII endoribonuclease, Dicer. Processed into a 20-25 bp duplex. Unlike this siRNA model, the biogenesis of intergenic miRNAs, such as lin-4 and let-7, is involved in long non-coding precursor RNA transcription or primary transcription (pri-miRNA). The transcription is transcribed directly from the Pol-II or Pol-III RNA promoter, whereas the intron pri-miRNA is co-transcribed with the encoded gene in Pol-II alone and RNA splicing as a spliced intron. Released after. In the cell nucleus, pri-miRNA is further excised by Drosha-like RNases (for intergenic miRNAs) or NMD mechanism (for intron miRNAs) and called a stem-loop precursor called hairpin-like pre-miRNA Form. It is then transported to the cytoplasm to be processed into mature miRNA by a miRNA-related dicer (Dicer *). Thereafter, all three small regulatory RNAs are incorporated into the RNA-induced silencing complex (RISC). The RISC contains either siRNA strands or single-stranded miRNAs. It is well known that dicers and RISCs for siRNA and miRNA pathways are different (Tang, G., Trends Biochem Sci., 30, 106-114, 2005). As a result, the effects of miRNA are usually more specific and less harmful compared to siRNA. The reason is that a single chain is involved. On the other hand, siRNAs initially cause mRNA degradation, but miRNAs can induce either mRNA degradation or suppression of protein synthesis, or both, depending on sequence complementarity to target gene transcription. Since the intron miRNA pathway is well regulated by multiple intracellular regulatory systems including Pol-II transcription, RNA splicing and NMD processing, the gene silencing effect of intron miRNA is the most effective of the three RNAi pathways And seems to be specific and safe (Lin et al., Frontiers in Bioscience, Vol. 13, pp. 22216-2230, 2008).

  The present invention discloses new functions of introns in terms of genetic regulation and the practical aspects associated with it. As shown in FIGS. 3A and 3B, based on the mechanism of intron RNA splicing and processing, a preferred embodiment of the present invention is a Pol-II inducible recombinant gene comprising at least one splicable intron, namely SpRNAi. It is an expression system and can inhibit unnecessary gene functions having high complementarity to intron sequences. This SpRNAi is co-transcribed by Pol-II RNA polymerase (P) together with a recombinant gene precursor mRNA (pre-mRNA), and the pre-mRNA is cleaved by RNA splicing. The spliced SpRNAi can then be further processed into mature gene silencing agents such as shRNA and miRNA to cause RNAi-related gene silencing. After intron removal, the exons of the recombinant gene transcript are joined together to form mature mRNA molecules for translational synthesis of markers or functional proteins.

  As shown in FIG. 3A, the essential components of the SpRNAi intron are several consensus nucleotide elements composed of a 5 ′ splice site, a branch point motif (BrP), a polypyrimidine region (PPT), and a 3 ′ splice site. Is included. In addition, the hairpin shRNA-like pre-miRNA sequence is inserted inside an SpRNAi intron located between the 5 'splice site and the branch point motif (BrP). This intron portion usually forms a lariat structure during RNA splicing and processing. We have discovered that both helicases, spliceosomal U2 and U6 snRNP, are involved in unwinding and excision of the lariat RNA fragment to become pre-miRNA, but the detailed process has been elucidated. It has not been. In addition, the 3'-end of the SpRNAi construct contains multiple translation stop codon regions (T codons) to improve the accuracy of intron RNA splicing and NMD processing. When present in cytoplasmic mRNA, this T codon signals the activity of the nonsense mutation-dependent degradation (NMD) pathway to reduce the accumulation of unstructured RNA in the cell. However, the insertion of highly secondary structure type shRNA and pre-miRNA is withheld for further Dicer cleavage to form mature siRNA and miRNA, respectively. Furthermore, for intracellular expression, the SpRNAi construct was manually incorporated into the DraII restriction site of the red fluorescent protein (RGFP) gene isolated from the mutant chromoprotein of the coral reef Heteractis crispa, thereby producing a recombinant SpRNAi-RGFP gene. Formed. RGFP cleavage at the 208th nucleotide site by the restriction enzyme DraII generates an AG-GN nucleotide cleavage with 3 resting nucleotides at each end, and each end forms a 5 'and 3' splice site after SpRNAi insertion. . Because this intron insertion destroys the structure of the functional RGFP protein that can be restored by intron splicing, the appearance of red RGFP around the affected cells determines the release of intron shRNA / miRNA and RGFP-mRNA maturation . The RGFP gene also provides multiple exon splicing enhancers (ESEs) to improve the accuracy and effectiveness of RNA splicing.

  In another preferred embodiment (FIG. 3B), the present invention includes synthetic RNA splicing and 5 ′ splice sites, branch point motifs (BrP), polypyrimidine regions (PPT), and 3′-splice sites. Artificial methods for the use of processing elements and comprising at least one desired RNA insert for the production of antisense RNA, small hairpin RNA (shRNA) and / or microRNA (miRNA) Of SpRNAi introns. A DNA synthesizer can chemically produce or combine these elements. Alternatively, the linking of these elements can be achieved by enzyme restriction and ligation. The introns thus obtained can be used directly for transfection into relevant cells, or can be added to cellular genes for co-expression with gene transcription by Pol-II (ie pre-mRNA). Can be taken. During RNA splicing and mRNA maturation, the desired RNA insert is excised and released by the intracellular spliceosome and the NMD mechanism. When the exons of the recombinant gene transcription are linked together to form the mature mRNA for the expression of the desired gene function, the highly complementary effect of the desired gene silencing on the specific gene transcription is exerted on the inserted RNA sequence. cause. Here, the desired gene function is a translation of a reporter or marker protein selected from the group consisting of red / green fluorescent protein (RGFP / EGFP), luminescent enzyme, lac-Z and their derivative analogs. Is. The presence of the reporter / marker protein is useful for placing the product of the inserted shRNA / miRNA molecule in the affected cell, facilitating identification of the desired gene silencing / RNAi effect.

  According to the present invention, mature mRNAs formed by exon ligation are also useful in conventional gene therapy for replacement of impaired or missing gene function or increased specific gene expression. In another aspect, the present invention provides gene silencing by intron RNA splicing and processing mechanisms to elicit either antisense gene knockout or RNA interference (RNAi) effects that are useful in inhibiting target gene function. Novel compositions and means for inducing cellular production of molecules are provided. Intron-derived gene silencing molecules thus obtained are antisense RNA, ribozyme, short transient RNA (stRNA), double-stranded RNA (dsRNA), small interfering RNA (siRNA), and very small non-molecular RNA. Includes coding RNA (tncRNA), short hairpin RNA (shRNA), microRNA (miRNA) and RNAi-related precursor RNA constructs (pri- / pre-miRNA). These intron RNA-derived gene silencing agents can be used from pathogenic transgenes, viral genes, mutant genes, oncogenes, disease-related small RNA genes and any other protein coding genes and any other non-coding genes. It will be a powerful tool for targeting and silencing unnecessary genes selected from the group consisting of.

  By utilizing this Pol-II mediated SpRNAi-RGFP expression system of the present invention, we have identified in human prostate cancer LNCaP, human cervical cancer HeLa, and rat neural stem HCN-A94-2 cells. (Lin et al., Methods Mol Biol., 342, 295-312, 2006a), and in vivo in zebrafish, chicken and mice (Lin et al., Methods Mol Biol., 342, 321). -334, 2006 b), successfully generated mature shRNA and miRNA molecules with full gene silencing capacity. Different pre-miRNA insertion constructs targeting green EGFP and zebrafish and other cellular gene expression in various human cell lines were tested and effective gene silencing miRNAs were identified with 5 'splice sites and branch points. It was confirmed to be derived from the 5 ′ proximity of the intron sequence between As shown in FIG. 3C, a strong gene silencing effect occurs only in the transfection of the anti-EGFP pre-miRNA insert (lane 4), while the left to right lane (1: blank vector control (Ctl ), 2: pre-miRNA insert targeting HIV-p24 (mock), 3: antisense EGFP insert without anti-hairpin loop structure (anti), and 5: anti-EGFP pre-miRNA (miR *) No effect is detected from the other inserts shown by the reverse pre-miRNA sequence, which is perfectly complementary to, but not against genes that are not targets such as marker RGFP and housekeeping β-actin. Such intron miRNA-mediated RNA To further confirm the role of RNA splicing in intron RNAi effects, we have left-to-right lanes (1: any Vector that expresses vector intron-free RGFP in the absence of pre-miRNA insert, 2: Vector that expresses vector RGFP in the presence of intron anti-EGFP pre-miRNA insert, 3: Similar to construct of 2: 2, but SpRNAi 3 different SpRNAi-RGFP expression systems, as shown in Figure 3D, were also tested (by a vector with a defective 5 'splice site in the intron). SpRNAi with pre-miRNA insert Only from the spliced intron Kuta construct and vector 2 construct is identical ones indicate that it has been opened, the vector, indicates that for intronic miRNA biogenesis is necessary cellular RNA splicing.

  After understanding as described above, we determined the optimal structural design of the pre-miRNA insert to induce maximal gene silencing effects, and a strong structural bias is the RNAi effector, Upon assembly of the RNA-induced gene silencing complex (RISC), it was confirmed to be present in cell selection of mature miRNA strands (Lin et al., Gene, 356, 32-38, 2005). RISC is a protein RNA complex that induces either degradation of the target gene transcript or translational repression by the RNAi mechanism. The formation of siRNA duplexes plays a major role in the assembly of siRNA-related RISCs. The two strands of the siRNA duplex are functionally asymmetric. However, assembly into a RISC complex is preferential for a single strand. Such preference is determined by the thermodynamic stability of each 5 'terminal base pair in the chain. Based on this siRNA model, the formation of miRNA and its complementary miRNA (miRNA *) duplex was considered a necessary step in the assembly of miRNA-related RISC. If this is the case, no functional bias will be observed in the stem-loop structure of the pre-miRNA. Nevertheless, the inventors observed that intron pre-miRNA stem-loop localization was associated with strand selection for mature miRNA for RISC assembly in zebrafish.

  As shown in FIG. 4A, we have two different introns, each containing a pair of symmetric pre-miRNA constructs, miRNA * stem loop miRNA [1] and miRNA stem loop miRNA * [2]. A miRNA insertion type SpRNAi-RGFP expression vector was constructed. Both pre-miRNAs contain the same double-stranded stem arm structure. Its structure is derived relative to the sequence from positions 280-302 of EGFP nucleotides. For purposes of this definition, miRNA refers to the exact complete sequence of mature microRNA, while miRNA * refers to the reverse nucleotide sequence that is complementary to the mature microRNA sequence. After liposome transfecting these miRNA-expressing SpRNAi-RGFP vectors (60 μg each) into 2-week-old zebrafish larvae for 24 hours (Lin et al., 2005, supra), we have miRNA isolation columns ( Ambion, Austin, TX) was used to isolate zebrafish small RNA, and then any miRNA that might match the target EGFP region was precipitated by latex beads containing the target sequence. After sequencing, one effective miRNA identity, miR-EGFP (280-302), was transfected into the 5′-miRNA stem loop miRNA * -3 ′ construct [2] as shown in FIG. 4A. Active in (grey shaded sequence). Since mature miRNAs are detected only in zebrafish transfected with the [2] 5′-miRNA stem-loop miRNA * -3 ′ construct, miRNA-related RISC is rather than [1] pre-miRNA construct [2 ] Preferably to interact, which demonstrates the existence of a structural bias for intron miRNA-RISC assembly. In this experiment, we are using actin promoter-inducible Tg (UAS: gfp) species of zebrafish, Tg (actin GAL4: UAS-gfp), where Tg is in the fish body of most cell types. Constitutively expresses the green fluorescent EGFP protein. As shown in FIG. 4B, transfection of the SpRNAi-RGFP vector in these zebrafish silenced the target EGFP and co-expressed the red fluorescent marker protein RGFP, producing intron miRNA in the affected cells. Used as a positive indicator. The gene silencing effect in the gastrointestinal tract is somewhat lower than other tissues, probably due to the high activity of RNase in this region. Furthermore, based on Western blot analysis (FIG. 4C), the indicator RGFP protein expression is either 5′-miRNA * stem loop miRNA-3 ′ or 5′-miRNA stem loop miRNA * -3 ′ pre-miRNA. Detected in both fish transfected with. On the other hand, gene silencing of target EGFP expression (green) was detected only in fish transfected with 5′-miRNA stem-loop miRNA * -3 ′ pre-miRNA construct [2], which is the result of FIG. 4B To demonstrate. Since the heat resistance of the 5 ′ end stem arm of both pre-miRNA constructs is the same, we have determined that the intron pre-miRNA stem loop is involved in the selection of the strand of the mature miRNA sequence during RISC assembly. The conclusion was reached. Assuming that the Dicer cleavage site in the stem arm is known to determine the selection of the strand of the mature miRNA (Lee et al., Nature, 425, 415-419, 2003), the intron pre- The stem loop of the miRNA will function as a determinant to identify special cleavage sites.

In the above design, since many of the natural pre-miRNA stem loop structures are too large to be suitable for the SpRNAi-RGFP expression vector for efficient expression, we have the natural pre-miRNA. Instead of a loop, it is necessary to use a short tRNA ^met loop (ie 5 ′-(A / U) UCCAAGGGGG-3 ′) (SEQ ID NO: 26). The tRNA ^met loop has been shown to efficiently facilitate the export of designed miRNAs from the nucleus to the cytoplasm via the same Ran-GTP and Export-5 transport mechanisms (Lin et al., 2005, The above). At present, the present invention provides a pair of manually modified pre-mir-302 loops (ie, 5′-GCTAAGCCAGGC-3 ′ (SEQ ID NO: 1) and 5′-GCCTGGCTTAGC-3 ′ (SEQ ID NO: 2)). And they provide nuclear transport efficiencies similar to natural pre-miRNA without interfering with tRNA transport. The design for these new pre-miRNA loops is based on a mock modification of the short stem loop of mir-302s, which is highly expressed in ES cells but not in other differentiated tissue cells. For this reason, the use of these artificial pre-miRNA loops will not interfere with the natural miRNA pathway in our body.

  For pre-miRNA insertion, the intron insertion site of the recombinant SpRNAi-RGFP gene is adjacent to the PvuI and MluI restriction sites at its 5 ′ and 3 ′ ends, respectively, so that the intron primary insert is a consistent attachment It is easily removed or replaced by various gene-specific pre-miRNA inserts with termini (eg, anti-EGFP and anti-Tyr pre-miRNA). By altering the pre-miRNA insert induced in different gene transcripts, this intron miRNA production system may serve as a powerful tool to induce target gene silencing in vitro and in vivo. it can. To confirm the correct insert size, the pre-miRNA-inserted SpRNAi-RGFP gene (10 ng) was paired with 25 cycles of 1 minute each at 94 ° C, 52 ° C and 70 ° C respectively. Can be amplified by polymerase chain reaction (PCR) using oligonucleotide primers (ie, 5'-CTCGAGCATG GTGAGCGGCC TGCTGAA-3 '(SEQ ID NO: 21) and 5'-TCTAGAAGTT GGCCTTCTGGGGCAGGT-3' (SEQ ID NO: 22)) . The resulting PCR product is fractionated on a 2% agarose gel and extracted and purified using a gel extraction kit (Qiagen, CA) to confirm the sequence.

  The present invention employs the principle verification design of the Pol-II mediated SpRNAi-RGFP expression system and uses that design for the development of new cosmetics for skin care. In one preferred embodiment, the present invention provides a method of using non-naturally occurring introns and components thereof, wherein the components are short hairpin RNA (shRNA) and / or microRNA by skin cells. It is processed into (miRNA) molecules and induces a specific gene silencing effect on skin pigment-related genes and / or genes that cause intracellular aging. The method comprises the steps of: a) i) a dermal substrate expressing a target gene and ii) an expressible composition comprising a recombinant gene capable of producing an intron-encoded RNA primary transcript. The transcript can then generate a pre-designed gene silencing molecule from introns encoded by intracellular RNA splicing and processing mechanisms, and then destroy target gene expression in the skin matrix, Or a step capable of suppressing the target gene function, and b) treating the skin matrix with the same composition under conditions such that the target gene function in the skin matrix is inhibited. The skin matrix can express the target gene either in vitro, ex vivo or in vivo. In one embodiment, the gene silencing molecule generated by RNA splicing and processing is a hairpin-like pre-miRNA insert located within the intron region of the recombinant gene, and is a tyrosinase (Tyr), hyaluronidase (Hyal), hyaluronan receptor. Having the ability to silence target genes selected from the group consisting of CD44 and CD168, NF kappa B, and other dye-related and / or aging-related genes and oncogenes. Alternatively, such pre-miRNA inserts can be artificially incorporated into the intron region of cellular genes in the skin. In general, this type of intron insertion technique involves plasmid-like transgene transfection, homologous recombination, transposon delivery, jumping gene integration and retroviral infection.

  In another embodiment, the recombinant gene of the present invention expresses a structure reminiscent of a pre-mRNA structure. Recombinant genes are mainly composed of two parts: exons and introns. Exon moieties are ligated after RNA splicing to form functional mRNAs and proteins to distinguish intron RNA release. On the other hand, the intron portion is spliced out from the recombinant gene transcript, further processed into the desired intron RNA molecule, and antisense RNA, miRNA, shRNA, siRNA, dsRNA and their precursors (ie, pre-miRNA and pre-piRNA). ) Function as a gene silencing effector. These desired intron RNA molecules consist of a hairpin-like stem loop structure containing a sequence motif homologous to 5'-GCTAAGCCAG GC-3 '(SEQ ID NO: 1) or 5'-GCCTGGCTTA GC-3' (SEQ ID NO: 2). Not only accurately excise the desired RNA molecule from the intron, but also promotes nuclear transfer of the desired RNA molecule to the cytoplasm. The stem arms of these intron-derived RNA molecules also contain homology and / or complementarity to the target gene or the coding sequence of the target gene gene transcript. The homologous or complementary sequence of the desired RNA molecule is sized to about 15-1500 nucleotide bases, most preferably about 18-27 nucleotide bases. The percentage of homology and / or complementarity of the desired intron RNA molecule to the target gene sequence ranges from about 30-100%, but more preferably for the desired hairpin-like intron RNA. 35-49% and 90-100% for linear intron RNA molecules.

  In addition, the 5 ′ end of the non-naturally occurring intron contains 5′-GTAAGAGK-3 ′ (SEQ ID NO: 3) and a GU (A / G) AGU motif (ie, 5′-GTAAGAGGAT-3 ′ (SEQ ID NO: 27)), 5′-GTAAGAGT-3 ′, 5′-GTAGAGGT-3 ′ and 5′-GTAAGGT-3 ′), including a donor splice site having homology with GWKSCYRCAG (SEQ ID NO: 4) Or any of CT (A / G) A (C / T) NG motifs (ie, 5′-GATATCCTGC AG-3 ′ (SEQ ID NO: 28), 5′-GGCTGCAG-3 ′ and 5′-CCACAG-3 ′) It is a receptor splice site having homology with the moth. In addition, the branch point sequence is located between the 5 ′ and 3 ′ splice sites, and 5′-TACTWAY-3 ′ (such as 5′-TACTAAC-3 ′ and 5′-TACTTAT-3 ′ ( SEQ ID NO: 5) contains a homologue with the motif. The branch point sequence adenosine “A” nucleotide is linked (2′-5 ′) by cellular (2′-5 ′) oligoadenylate synthase and spliceosome in almost all spliceosomal introns. It forms part of the lariat intron RNA. Furthermore, the polypyrimidine region is located in close proximity between the branch point and the 3 'splice site, and 5'-(TY) m (C /-) (T) nS (C /-)-3. It contains an oligonucleotide sequence rich in T or C having homology with either the '(SEQ ID NO: 6) or 5'-(TC) nNCTAG (G /-)-3 '(SEQ ID NO: 7) motif. Here, the symbols “m” and “n” indicate that the number of repetitions is 1 or more, and most preferably, m is equal to 1-3 and n is equal to 7-12. The symbol “-” means a blank nucleotide in the sequence. There is also a linker nucleotide sequence for linking all these intron components. Based on the 37 CFR 1.822 guidelines for codes and formats used for nucleotide and / or amino acid sequence data, the code W means adenine (A) or thymine (T) / uracil (U) and the code K is Guanine (G) or thymine (T) / uracil (U) means cytosine (C) or guanine (G), Y means cytosine (C) or thymine (T) / uracil (U) ), R represents adenine (A) or guanine (G), N represents adenine (A), cytosine (C), guanine (G) or thymine (T) / uracil (U) To do.

In another preferred embodiment of the invention, the recombinant gene composition is cloned into an expressible vector for gene transfection. The expressible vector is selected from the group consisting of: plasmid, cosmid, phagemid, yeast artificial chromosome, jumping gene, transposon, retrotransposon, retroviral vector, lentiviral vector, lambda vector, adenovirus (AMV) ) Vector, adeno-associated virus (AAV) vector, improved hepatitis virus (HBV) vector, cytomegalovirus (CMV) -associated virus vector, and tobacco mosaic virus (TMV), tomato mosaic virus (ToMV), cauliflower mosaic virus ( Plant-related mosaic viruses such as CaMV) and poplar mosaic virus (PopMV). Upon transfection of the SpRNAi-RGFP gene, multiple vectors expressing different intron gene silencing effectors may be used to achieve gene silencing effects on one gene or multiple target genes. Alternatively, multiple gene silencing effectors can be generated from intron hairpin RNA inserts of the SpRNAi-RGFP gene to provide multiple gene silencing effects. The advantage of this strategy lies in delivery stability through the use of vector-based transgene transfection and viral infection, providing a stable and relatively long-term effect on specific gene silencing. In one aspect, the present invention utilizing cellular RNA splicing and processing mechanisms can manage gene-specific RNA promoter promoters (eg, type II RNA polymerase (Pol-II) promoter and viral promoter, or both) in the cell. Can produce RNAi-related gene silencing molecules, including small interfering RNA (siRNA), microRNA (miRNA) and / or short hairpin RNA (shRNA). Viral promoters are isolated from cytomegalovirus (CMV), retrovirus long terminal region (LTR), hepatitis B virus (HBV), adenovirus (AMV), adeno-associated virus (AAV) and plant-associated mosaic virus. Modified RNA promoters and derivatives thereof. For example, the lentiviral LTR promoter is sufficient to provide up to 5 × 10 ⁵ copies of immature mRNA for each cell. In order to control the expression rate, it is possible to insert a drug-sensitive repressor in front of the lentiviral promoter. The repressor can be inhibited by a chemical agent or antibiotic selected from the group consisting of G418, tetracycline, neomycin, ampicillin, kanamycin and derivatives thereof.

  In addition to the use of skin care invented in the present application, the potential applications of the present invention include skin treatment by suppression of disease-related genes, vaccination of epidermis induced against viral genes, and external use for microbial-related pathogens Includes treatment, research on signal transduction pathways in the skin, and high-throughput screening of gene function in conjunction with microarray technology and the like. The present invention can also be used as a tool for studying gene function in the skin or providing compositions and methods for altering skin type characteristics. Skin types are normal skin, pathogenic skin, cancerous skin, virus infected skin, microbially infected skin, physiologically diseased skin, genetically altered animal or human skin More can be selected.

  The present invention provides a novel approach for producing intronic and intracellular intron RNA molecules by RNA splicing and processing mechanisms, preferably comprising mature siRNA, miRNA and shRNA molecules that can induce RNAi / PTGS-related gene silencing effects. Is to generate. Desired siRNA, miRNA and / or shRNA molecules can be produced in single or multiple units depending on how the cellular mechanism expresses and processes the intron precursor miRNA / shRNA insert of the invention. For example, as already reported, as shown in FIG. 3A, ectopic expression of one anti-EGFP pre-miRNA-inserted intron in zebrafish ensures that miR-EGFP (282/300) and miR -Generate two mature microRNAs of different sizes, such as EGFP (280-302), showing that one of the gene silencing RNA inserts of the SpRNAi intron can generate one or more gene silencing RNA effectors Yes. The same or different spliced RNA effectors can be generated in either the sense form or the antisense form, or both, having complementarity to the target gene transcript. In certain cases, the spliced RNA molecule can be hybridized with a target gene transcript (ie, mRNA) to form a double stranded RNA (dsRNA) to cause a secondary RNAi / PTGS effect. Intron siRNA, miRNA and / or shRNA are always formed by the expressible vectors of the present invention, which alleviates interest in rapid degradation of small RNAs for in vivo applications.

  Alternatively, the present invention further provides a novel means for the production of antisense microRNA (miRNA *) induced against target microRNA (miRNA) genes in skin cells, resulting in: The target miRNA function can be suppressed. Since miRNA normally functions in RNAi-related gene silencing, miRNA * can neutralize this gene silencing effect and restore the function of miRNA-inhibited genes. Unlike perfectly matched siRNA, binding of miRNA * to miRNA creates a mismatched base pair region for RNase cleavage and degradation. Such a mismatch base pair region is preferably located either in the center of the stem arm region of the miRNA precursor (pre-miRNA) or in the stem loop structure. As already indicated, the mismatched base pair in the middle of siRNA inhibits the silencing effect of siRNA (Holen et al., Nucleic Acid Res., 30, 1757-1766, 2002; Krol et al., J. Biol. Chem., 279, 42230-42239, 2004). Perhaps in previous studies on Arabidopsis and tobacco species, as well as intron-mediated enhancement effect (IME) phenomena in plants, intron inserts are transcribed for both enhanced and silencing specific gene expression. Later it was shown to play an important role in gene modulation (Rose AB, RNA, Vol. 8, 1444-1451, 2002; Stoutjesdjk et al., Plant Physiol., 129, 1723. -1730, 2002). The IME mechanism can restore target gene expression by a factor of 2 to 10 or more by targeting miRNA that is complementary to the target gene.

  As described above, according to the present invention, for skin care using a recombinant nucleic acid composition capable of inducing a specific gene silencing effect on at least one of a gene related to intracellular skin pigment and a gene causing aging. A method for producing a cosmetic product is provided.

Figure 2 illustrates the intracellular mechanism of natural intron microRNA (miRNA) biogenesis. Figure 5 shows different biogenesis mechanisms between siRNA, exon-type (intergenic) microRNA and intron microRNA pathways. A to D simulate the preferred embodiment of the SpRNAi-incorporating recombinant gene (SpRNAi-RGFP) construct in the expressible vector composition (A) (SEQ ID NO: 29) and the biogenesis of natural intron miRNA, A strategy (B) using this composition to produce RNA is shown. In vivo testing of SpRNAi-RGFP expression compositions induced against fish green EGFP has shown that in particular, more than 85% knockdown in target EGFP gene expression, as determined by Western blot analysis (C) Showed the effect. Intron-derived anti-EGFP microRNA and its spliced precursors were observed on 1% formaldehyde agarose gel electrophoresis after Northern blot analysis (D). A through C show different designs for intron RNA inserts within the SpRNAi-RGFP construct for effective microRNA biogenesis and gene splicing resulting in zebrafish targeted green fluorescent protein (EGFP) expression , [1] transfection of 5′-miRNA * stem loop miRNA-3 ′ construct (SEQ ID NO: 30) and [2] 5′-miRNA stem loop miRNA * -3 ′ hairpin RNA construct (SEQ ID NO: 31, SEQ ID NO: 32). ) Demonstrates selection of asymmetric preferences in RISC assembly during transfection of (A). In vivo gene silencing was observed only in the transfection of the pre-miRNA construct of [2], not the construct of [1]. Since the combination of EGFP and RGFP colors is displayed in red rather than green (as shown in deep orange), the expression level of the target EGFP (green) is entirely determined by the vector index RGFP (red). Is clearly reduced in the pre-miRNA transfection of [2] (B). Western blot analysis of EGFP protein levels confirms the specific silencing results for pre-miRNA transfection of [2] (C). Detectable gene silencing has not been detected at all with other treatments such as liposome only (Lipo), blank vector without insert (Vctr) and siRNA (siR). The tyrosinase (Tyr) gene silencing effect in skin depigmentation of mice with natural mir-434 expressed according to the present invention is shown, and it is shown that local skin gene modulation can be performed in vivo using the present invention. The results of the use of improved artificial anti-Tyr pre-miRNA (miR-Tyr) inserts expressed in accordance with the present invention in mouse skin are more specific for targeted tyrosinase (Tyr) and off It shows gene silencing effect with less influence on the target gene. A to C are similar to the method of FIG. 6, but human arm skin (A) and primary skin cells of the improved artificial anti-Tyr pre-miRNA (miR-Tyr) insert expressed by the present invention. Results of use in cultures (B and C) are shown, showing a knockdown rate of 50% or more in tyrosinase (Tyr) expression. A to C show the results of gene microarray analysis (Affymetrix human GeneChip U133A & B, CA) of altered gene expression in primary skin cell cultures transfected with the artificial anti-Tyr pre-miRNA described above, mir-434. Compared to the use of natural microRNA, the gene silencing effect is much higher in target specificity and less affected for off-target genes.

  FIG. 1 represents the biogenesis of natural intron microRNA (miRNA). It is co-transcribed along with the precursor messenger RNA (pre-mRNA) by Pol-II when the linked exon becomes mature messenger RNA (mRNA) for protein synthesis, and the pre-mRNA is excised by RNA splicing. It is logic. Spliced intron miRNAs with antisense or hairpin-like secondary structure are further processed into mature miRNAs capable of causing RNAi-related gene silencing effects. Therefore, we designed an artificial intron containing at least one precursor microRNA (pre-miRNA) structure, the so-called SpRNAi, mimicking the biogenesis of natural intron miRNA (FIGS. 3A and 3B). SpRNAi is incorporated into cells or recombinant genes expressed by type II RNA polymerase (Pol-II) based on the control of either Pol-II or the viral RNA promoter (P). In intracellular transcription, the gene transcript thus produced undergoes RNA splicing and processing operations to release pre-designed intron RNA molecules in the transfected cells. In certain embodiments, the desired RNA molecule is an antisense RNA construct that can be provided as an antisense oligonucleotide probe for gene knockdown. In other embodiments, the desired RNA molecule is composed of a small antisense RNA fragment and a small sense RNA fragment and functions as a double stranded siRNA for RNAi induction. In yet another embodiment, the desired RNA molecule is a hairpin-like RNA construct capable of causing an RNAi-related gene silencing effect.

  The above description shows preferred embodiments of the present invention for the purpose of illustration only and is not intended to limit the present invention. Various changes and modifications will be apparent to those skilled in the art, and such changes and modifications are deemed to be within the spirit and scope of the present invention and are intended to be included within the scope of the following claims. .

  The present invention provides novel compositions and methods for altering the genetic properties of skin cells using intron-derived RNA. A newly discovered intron-mediated type caused by transfection of a recombinant gene containing at least one splicable intron, the so-called SpRNAi, in the cell or organism of interest without being bound by any particular logic The gene silencing mechanism induces such changes in gene characteristics. SpRNAi introns also retain intron RNA inserts, which can be released by intracellular RNA splicing and processing mechanisms, and target gene transcription that is highly complementary to intron RNA inserts Causes RNAi / PTGS-related gene silencing effects on the product. In general, as shown in FIGS. 4-7, intronic RNA insertion when the recombinant gene is chemically transformed, transfected with liposomes, or introduced by viral infection of skin cells. The product is transcribed with the recombinant gene by Pol-II and then released from the recombinant gene transcript by RNA splicing and processing mechanisms, such as spliceosome and nonsense mutation-dependent degradation (NMD) systems. After RNA splicing, intron RNA forms lariat RNA, and in addition, small transient RNA (stRNA), antisense RNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA) ), Processed into small gene silencing effector RNA, such as Piwi interacting RNA (piRNA) and / or their precursor RNA. As a result, these gene silencing effector RNAs reduce target gene transcripts by the action of RNAi-induced initiators of functional assembly and RNA-induced silencing complex (RISC) and / or transcription silencing (RITS) Or suppress protein translation of target gene transcripts.

  Simulating the natural pre-mRNA splicing and processing mechanism, we used intron removal and processing of the SpRNAi-RGFP expression system we invented using the intracellular spliceosome and the NMD mechanism. Catalyze. SpRNAi introns are released by sequential assembly of intracellular spliceosome components to the snRNP discriminating element of multiple SpRNAi introns (eg, binding sites for snRNP U1, U2 and U4 / U6.U5tri-snRNP), and , Processed into small molecule gene silencing effectors. Methods for incorporating a synthetic snRNP identification element into the SpRNAi intron of the present invention and then incorporating SpRNAi into a recombinant RGFP gene are described respectively in Examples 1-2. For spliceosome introns, the mode of sequential assembly of spliceosome snRNPs into their associated identification sites is in a species-specific order in all eukaryotes (Lewin B., Genes, Seventh Edition). , Oxford University press, 688-690, 2000). Due to the variety of intracellular RNA splicing and processing mechanisms of different species, Lewin B. Is a well-known fact, that is, "splice sites are unique to the genus (omitted) and the organ for splicing is not tissue specific (omitted)". This is said to be a general property of all spliceosome introns. In fact, the sequential sequence of the intron RNA splicing process occurs as follows: first bind U1 snRNP to the 5'-intron splicing linkage (5'-donor splice site) and then U2 snRNP to the branch point motif. And finally to U1 and U2 snRNPs U4 / U6. Bind U5tri-snRNP. Thereby, an early splicing complex is formed for precise cleavage of the 5 'splicing bond. After splicing release of the 5 'splicing intron bond, the 3' splicing intron bond (3'-receptor splice site) is subsequently cleaved by the late splicing complex formed with U5 snRNP and several other splicing proteins. However, little is known about protein / protein interactions and RNA / protein interactions that crosslink the components of U4 / U6 and U5 snRNP within eukaryotic tri-snRNP, and in U4 / U6 and U5 snRNP There is still much unknown about the protein binding site.

  Design, structure and evaluation for a Pol-II mediated artificial recombinant SpRNAi-RGFP gene expression system capable of inducing intron RNA mediated gene silencing effects in vivo.

  Strategies for inducing gene silencing mechanisms that induce desired intracellular RNA splicing and / or processing in vivo have already been tested using the Pol-II transcribed recombinant gene vector of the present invention, the so-called SpRNAi-RGFP. . The SpRNAi-RGFP contains artificial splicable introns (SpRNAi) for expressing intron gene silencing RNA effectors (FIGS. 3A and B) such as microRNA (miRNA) and hairpin-like shRNA. Incorporation of the SpRNAi intron into the fluorescent protein gene (RGFP) shifted to red is genetically processed by sequential ligation of multiple synthetic DNA sequences, as shown in Example 1-2. SpRNAi introns contain precursor miRNA or shRNA inserts and can be released by intracellular RNA splicing and processing mechanisms such as spliceosome and NMD system components, and then the gene silencing effector of mature miRNA or shRNA Induction induces an intron RNA-mediated gene silencing mechanism. Although we have now shown a model that induces target gene silencing by intracellular RNA splicing and processing of recombinant gene transcripts, the same principle is primarily transcribed by type I RNA polymerase (Pol-I). It can be applied to the design and production of intron gene silencing RNA inserts that function through RNA processing of ribosome precursor RNA (pre-rRNA). Other RNA transcripts that can be used for expression and processing of SpRNAi introns include hnRNA, rRNA, tRNA, snoRNA, snRNA, viral RNA and their precursors and derivatives.

  As shown in Examples 1 and 2 and FIG. 3A, SpRNAi introns were synthesized and incorporated into an intron-free red-shifted fluorescent protein gene (RGFP or rGFP). The fluorescent protein gene (RGFP or rGFP) shifted to red is mutated from the HcRed1 chromoprotein of Heteractis crispa. Since the inserted SpRNAi intron disrupted the functional fluorescent protein structure of RGFP, we succeeded in reproducing the red fluorescence emission at a wavelength of 570 nm in transfected cells and organs. Removal and mRNA maturation of the RGFP gene transcript could be detected. The structure of this recombinant SpRNAi-RGFP gene was based on the natural structure of the spliceosome intron in the precursor messenger RNA (pre-mRNA). The main components of the SpRNAi intron are 5′-donor splice sites (DS) and 3′-acceptor (AS) splice sites for precise cleavage at the ends, branch point motifs (BrP) for splicing discrimination A plurality of polypyrimidine regions (PPT) for spliceosome interactions, linkers to link each of these components to several restriction / cloning sites for the desired intron insertion It contains a snRNP recognition site and a linker. As shown in FIG. 3B, structurally, from the 5 ′ to 3 ′ end, the SpRNAi intron of the present invention comprises a 5 ′ splice site, an anti (target gene) intron insert, a branch point motif (BrP), a poly It contains a pyrimidine region (PPT) and a 3'-receptor (AS) splice site for functional spliceosome assembly. In addition, some translation termination codons (T codons) may be located in the linker sequence near the 3 'splice site of the SpRNAi intron.

  In general, the 5′-donor splice site is 5′-GTAAGAGK-3 ′ (SEQ ID NO: 3) or (5′-GTAAGAGGAT-3 ′ (SEQ ID NO: 27), 5′-GTAAGAGGT-3 ′, 5′- Nucleotide sequences comprising or homologous to any of the GU (A / G) AGU motifs (such as GTAGAGT-3 ′ and 5′-GTAAGT-3 ′), while 3′-receptor splices Site is GWKSCYRCAG (SEQ ID NO: 4) or CT (such as 5'-GATATCCTGC AG-3 '(SEQ ID NO: 28), 5'-GGCTGCAG-3' and 5'-CCACAG-3 ') (A / G) It is a nucleotide sequence that contains or has homology with any of the A (C / T) NG motifs. In addition, the branch point sequence is located between the 5 'and 3' splice sites, and 5'-TACTWAY-3 such as 5'-TACTAAC-3 'and 5'-TACTTAT-3'. '(SEQ ID NO: 5) has homology with the motif. The branch point sequence adenosine “A” nucleotide is linked (2′-5 ′) by the cellular (2′-5 ′)-oligoadenylate synthase and spliceosome in almost all spliceosome introns. It forms part of the lariat intron RNA. Furthermore, the polypyrimidine region is located in close proximity between the branch point and the 3 'splice site, and 5'-(TY) m (C /-) (T) nS (C /-)-3. It contains an oligonucleotide sequence that is homologous to either the '(SEQ ID NO: 6) or 5'-(TC) nNCTAG (G /-)-3 '(SEQ ID NO: 7) motif and is rich in T or C. The symbols “m” and “n” indicate one or more repetitions, most preferably m is equal to 1-3 and the n number is equal to 7-12. The symbol “-” means a blank nucleotide in the sequence. Multiple linker nucleotide sequences also exist to link all these intron components. Based on the 37 CFR 1.822 guidelines for codes and formats used for nucleotide and / or amino acid sequence data, the code W means adenine (A) or thymine (T) / uracil (U) and the code K is Guanine (G) or thymine (T) / uracil (U) means cytosine (C) or guanine (G), Y means cytosine (C) or thymine (T) / uracil (U) ), R represents adenine (A) or guanine (G), N represents adenine (A), cytosine (C), guanine (G) or thymine (T) / uracil (U) To do. For all the spliceosome identification components described above, deoxythymidine (T) nucleotides can be replaced with uridine (U).

  To test the function of the spliced SpRNAi insert, various oligonucleotide agents can be cloned into the anti- (target gene) intron insertion site of the recombinant SpRNAi-RGFP gene construct. The anti (target gene) intron insertion site contains multiple restriction sites and cloning sites, which are AatII, AccI, AflII / III, AgeI, ApaI / LI, AseI, Asp718I, BamHI, BbeI, BclI / II. , BglII, BsmI, Bsp120I, BspHI / LU11I / 120I, BsrI / BI / GI, BssHII / SI, BstBI / U1 / XI, ClaI, Csp6I, DpnI, DraI / II, EagIII, Ecl136II, EcoRI / Rh / 47 , FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI / II, KasI, KpnI, MaeII / III, MfeI, MluI, MscI, MseI, NaeI, N rI, NcoI, NdeI, NgoMI, NotI, NruI, NsiI, PmlI, Ppu10I, PstI, PvuI / II, RsaI, SacI / II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, SspI, StuI It is identified by a restriction enzyme selected from the group consisting of XhoI, XmaI endonuclease and combinations thereof. These intron oligonucleotide inserts include Lariat RNA, short transient RNA (stRNA), antisense RNA, small interfering RNA (siRNA), double stranded RNA (dsRNA), short hairpin RNA (shRNA) ), MicroRNA (miRNA), Piwi interfering RNA (piRNA), ribozymes and their precursors and derivatives, selected from the group consisting of their sense forms or antisense forms, or both, and combinations thereof A DNA template encoding structural RNA.

  For convenient gene delivery and activation in cells or organisms of interest, the recombinant SpRNAi-RGFP gene of the present invention comprises plasmids, cosmids, phagemids, yeast artificial chromosomes, transposons, jumping genes, viral vectors and the like It can be preferably cloned into an expressible vector selected from the group consisting of The vector thus obtained is selected from the group consisting of liposome transfection, chemical transfection, chemical transformation, electroporation, transposon recombination, jumping gene insertion, viral infection, microinjection, gene gun penetration and combinations thereof. And introduced into cells or organisms by highly efficient gene delivery methods. In addition, the vector may contain at least one virus or type II RNA polymerase (Pol-II) promoter for expressing the SpRNAi-RGFP gene, or both, and Kozak common translation initiation to increase translation efficiency in eukaryotic cells. A plurality of SV40 polyadenylation signals downstream of the SpRNAi-RGFP gene to process the 3 ′ end of the recombinant gene transcript, a replicating pUC origin for propagation in prokaryotic cells, and the SpRNAi-RGFP gene Expresses at least two restriction / cloning sites for incorporation into the vector, a selective SV40 origin for replication in mammalian cells expressing the SV40 T antigen, and an antibiotic resistance gene in replicable prokaryotic cells Selective SV40 initial promoter for It contains. The expression of the antibiotic resistance gene was used to serve as a selective marker to look for successfully transfected or infected clones, penicillin G, ampicillin, neomycin, puromycin (paromycin). , Kanamycin, streptomycin, erythromycin, spectromycin, phophomycin, tetracycline, rifapicin, amphotericin B, gentamicin, chloramphenicol, cephalothin, and combinations thereof Resistant to antibiotics.

  The SpRNAi-RGFP vector construct thus obtained was tested in vivo on its target for its green EGFP gene expression of Tg (Actin-GAL4: USA-gfp) species zebrafish. As shown in Example 3 and FIG. 3C, liposome transfection of the anti-EGFP pre-miRNA insert in the SpRNAi-RGFP plasmid construct (lane 4) has a very strong EGFP gene silencing effect (> 80% gene). Knockdown), while those other inserts indicated by left to right lanes showed no effect. These lanes are 1: blank vector control (Ctl), 2: pre-miRNA insert (mock) targeting HIV-p24, 3: antisense EGFP insert without hairpin loop structure (anti) And 5: reverse pre-miRNA sequences that are perfectly complementary to anti-EGFP pre-miRNA (miR *). No effect on non-target genes such as marker RGFP and housekeeping β-actin has been detected, suggesting that such intron miRNA-mediated RNA interference (RNAi) is very target specific. In addition, by using low stringency northern blot analysis (FIG. 3D), we have generated only small intron RNA that is effective only from the desired SpRNAi-RGFP gene transcript (center lane 2). And release was observed, but not from a natural transcript of RGFP without an intron (left lane 1) or a transcript of a defective SpRNAi-RGFP construct without a functional 5 ′ splice site. . On the other hand, spliced RGFP exons were joined together to form mature RNA for functional red fluorescent protein synthesis.

Evaluation on Effective Intron MicroRNA (miRNA) Constructs in Vivo The above experiments established the fact that intron miRNA provides an effective means for silencing target gene expression in vivo. We first evaluated the efficacy for intron miRNA-mediated gene silencing and then determined the optimal structural design for intron pre-miRNA inserts that can induce optimal gene silencing effects. . Based on these studies, we have determined that in the selection of the mature miRNA strands for intracellular assembly of RNAi-related gene silencing effectors, ie RNA-transduced gene silencing complex (RISC), a strong structure Confirmed that there was a priority. RISC is a protein RNA complex that induces either target gene transcript degradation or translational repression by RNA interference (RNAi) or post-transcriptional gene silencing (PTGS) mechanisms.

  In zebrafish, the stem-loop structure of pre-miRNA differs from the well-known siRNA-related RISC assembly (Lin et al., Gene, 356, 32-38, 2005) and matures to RISC assembly. It was observed to determine the miRNA sequence. siRNA duplex formation plays an important role in the assembly of RISCs associated with siRNA. The two strands of the siRNA duplex are functionally asymmetric, but assembly into the RISC complex is preferential to only one strand. Such preference is determined by the thermodynamic stability of each 5 'terminal base pair in the strand of the siRNA duplex. Based on this siRNA model, the formation of miRNA and its complementary miRNA (miRNA *) duplex is considered an essential step for the assembly of RISCs associated with miRNA. If this is the case, no functional bias should be observed from the stem-loop structure of the pre-miRNA. However, it was observed that the stem loop of intron pre-miRNA is involved in the selection of the mature miRNA strand for intracellular RISC assembly.

  In the experiment, an anti-EGFP miRNA-expressing SpRNAi-RGFP vector as described in Example 1-2 was constructed and two symmetric pre-miRNAs, miRNA * stem loop miRNA [1] and miRNA stem loop miRNA * [2 ] Were synthesized with a DNA synthesizer and inserted into a recombinant SpRNAi-RGFP gene vector prepared in advance. All pre-miRNA constructs contain the same double-stranded stem arm region, which was derived against the EGFP nucleotide (nt) 280-302 sequence. Since the intron insertion site of the SpRNAi-RGFP gene is flanked by PvuI and MluI restriction / cloning sites at the 5′- and 3 ′ ends, respectively, the primary insert has various anti-gene inserts with sticky ends ( For example, it is easily removed and replaced by anti-EGFP, anti-Tyr or anti-Hyal). By allowing changes in the SpRNAi inserts induced for different gene transcripts, this intron miRNA expression system provides a valuable tool in the development of miRNA-related gene applications in vivo.

  In order to determine the structural preference of the designed pre-miRNA, zebrafish small RNAs were isolated by the mirVana miRNA isolation filter column (Ambion, Austin, TX) and targeted by latex beads containing the target sequence All potential miRNA sequences that are complementary to EGFP were precipitated. One full-length miRNA, miR-EGFP (280-302), is active in transfection of 5′-miRNA stem loop miRNA * -3 ′ constructs as shown in FIG. 4A (gray shaded sequence). It was confirmed that. Since this effective mature miRNA is detected only in zebrafish transfected with the 5′-miRNA stem-loop miRNA * -3 ′ construct [2], miRNA-related RISCs are more likely than [1] pre-miRNA structures. Also desirably tended to interact with the construct [2]. For visual display of the correlation between target gene silencing and miRNA gene expression (FIG. 4B), a Tg (actin GAL4: UAS-gfp) species zebrafish was used. The zebrafish constitutively expresses the green fluorescent EGFP protein induced by the normal β-actin promoter present in almost all cells of the zebrafish, while transferring the anti-EGFP SpRNAi-RGFP gene vector to the zebrafish. In the expression, the red fluorescent protein RGFP is coexpressed and provided as a positive marker indicator for miRNA production in the affected cells. After applying the SpRNAi-RGFP vector encapsulated with FuGene cation liposome-type reagent (Roche, IN) to fish (zebrafish), all tested vectors were completely transferred to 2 weeks old zebrafish larvae within 24 hours It was found that it provided complete systemic delivery of the vector, except for scales and bones.

  The marker RGFP (red) was detected from zebrafish transfected with all vectors, but silencing of target EGFP expression (green) was 5′-miRNA stem loop miRNA * -3 ′ [2] pre -Observed from fish transfected with miRNA. As shown in FIG. 4C, Western blot analysis quantitatively confirmed the results of this gene silencing and showed> 85% RGFP knockdown in [2] transfected zebrafish. However, the silencing effect of the gene in the gastrointestinal tract (GI) is lower than that of other tissues, which may be attributed to the high activity of RNase in this region. Since the same 5 ′ end thermal stability is applied to both anti-EGFP pre-miRNA stem arms, the stem-loop structure of the pre-miRNA is responsible for strand selection in the mature miRNA for functional RISC assembly. Propose that Assuming that the Dicer cleavage site in the stem arm is well known to determine the selection of the mature miRNA strand, the stem loop of the pre-miRNA may function as a determinant for recognition of a particular cleavage site. unknown. Therefore, based on the extensive heterogeneity of the native stem loop structure in various natural miRNA species, we selectively used the manually modified pre-mir-302 loop pair in these experiments. The loop pairs are, for example, 5′-GCTAAGCCAGGC-3 ′ (SEQ ID NO: 1) and 5′-GCCTGGCTTAGC-3 ′ (SEQ ID NO: 2), which are optimal RISC assembly effects for the present invention. Have been tested to provide.

Intron microRNA-mediated tyrosinase and hyaluronidase gene silencing in mouse skin Based on the above studies, miR-Tyr or miR to silence unnecessary pigmentation-related gene Tyr or aging-related gene Hyal in mouse skin -Optimal SpRNAi-RGFP gene constructs were designed and tested using any of Hyal's pre-miRNA inserts. These manually designed miR-Tyr pre-miRNAs and miR-Hyalpre-miRNAs represent highly conserved regions (> 98% homology) in both the human and mouse Ty and Hyal genes, respectively. Target. Both humans and mice provide useful animal models to test the efficacy and safety of these optimal SpRNAi-RGFP gene constructs in the skin in vivo. In fact, there are 54 natural miRNAs that can target human tyrosinase (Tyr; 2082 bp) for pigmentation gene silencing, including mir-1, mir-15a, mir -16, mir-31, mir-101, mir-129, mir-137, mir-143, mir-154, mir-194, mir-195, mir-196b, mir-200b, mir-200c, mir-206 , Mir-208, mir-214, mir-221, mir-222, mir-292-3p, mir-299-3p, mir-326, mir-328, mir-381, mir-409-5p, mir-434 -5p, mir-450, mir-451, mir-452, mir-46 Mir-466, mir-488, mir-490, mir-501, mir-522, mir-552, mir-553, mir-570, mir-571, mir-582, mir-600, mir-619, mir -624, mir-625, mir-633, mir-634, mir-690, mir-697, mir-704, mir-714, mir-759, mir-761, mir-768-5p and mir-804 It is. According to the miR target search database of the miRBBase :: sequence program (http://microrna.sanger.ac.uk), all these anti-Tyr miRNAs are the first 300 nucleotides of the Tyr gene transcript (NCBI accession number NM000372). Guided against the area. In addition, there are nine natural miRNAs that can target hyaluronidase (Hyal; 2518 bp, NCBI accession number NM007312) for senescence gene silencing, including mir-197, mir-349, mir -434-5p, mir-549, mir-605, mir-618, mir-647, mir-680, mir-702, and mir-763. Of these natural miRNAs, mir-434-5p is the only one that targets both the human Tyr and Hyal genes and minimally targets genes that are not target genes other than Tyr and Hyal It is also one of the most efficient miRNAs to do. However, almost all natural miRNAs have several to 50 or more targets, and they tend to bind to some target genes that are more powerful than others, so these natural miRNAs Use is not specific and will not be safe enough for skin care purposes.

  In order to test the feasibility of milan-mediated skin whitening, the SpRNAi-RGFP expression system of the present invention was used to express native pre-mir-434-5p in mouse skin. As shown in FIG. 5, the repaired albino (white) skin of the melanin-knocked down mouse (W-9 black) is a pre-mir-434-5p expression vector introduced against tyrosinase (Tyr). (50 μg) of continuous intradermal (ic) transduction (total 200 μg over 4 days). Tyr, type I membrane proteins and copper-containing enzymes catalyze an important and rate-limiting step for tyrosine hydroxylation in the biosynthesis of melanin (black pigment) in the skin and hair. First i. c. Starting about 2 weeks after injection, it was observed that skin and hair melanin was only significantly lost upon pre-miRNA transfection. On the other hand, the blank control and Pol-III (U6) induced siRNA transfection did not show such an effect at the same amount used. Northern blot analysis using mRNA isolated from pre-mir-434-5p transfected hair follicles showed a 76.1% ± 5.3% decrease in Tyr expression 2 days after transfection. Gentle non-specific degradation of random gene transcripts was detected from siRNA-transfected skin (see unclear patterns of both housekeeping control GAPDH and target Tyr mRNA). Grimm et al. (2006) report that high concentrations of siRNA / shRNA generated by the Pol-III inducible RNAi system supersaturate the cellular microRNA pathway and cause global miRNA dysregulation. This result indicates that the siRNA pathway is incompatible with the natural miRNA pathway in skin tissue. Thus, the use of miRNA is considered to be more efficient, compatible and safer for skin care. However, because natural mir-434-5p also targets other five cellular genes for cellular gene silencing (including TRPS1, PITX1, LCOR, LYPLA2, and Hyal), this natural pre- The off-target effect of mir-434-5p transfection has not yet been determined.

  In order to improve the target specificity and safety of miRNA drugs, the mir-434-5p species sequence was redesigned to produce Tyr nucleotides 3-25 (so-called miR-Tyr) or Hyal nucleotides 459-482 (so-called miR). A highly compatible region was formed that bound to any of -Hyal). The pre-miRNA insert sequence for Tyr gene silencing (pre-miR-Tyr) is 5'-GTCCGATCCGCGCCCTACT TATCTGCCTAA GCCGCTAAGC CAGGCGGCTTAGGCATAGATA GTAGGGCCGA CpG And is further processed into a mature miR-Tyr microRNA (miRNA) sequence containing or having homology with 5′-GCCCACTACT ATTGCCTAAG CC-3 ′ (SEQ ID NO: 9). Alternatively, the pre-miRNA insert for Hyal gene silencing (pre-miR-Hyal) is 5'-GTCCGATCGT CAGCTAGGACA GTCAGGGTTT GAAGCTAAGC CAGGCTTCAA ACCCTGACTG TCTGTCCAT-3 CCGGTCAT-3 A different type of hairpin-like RNA is formed and further processed to a mature miR-Hyal miRNA sequence that contains or has homology with 5′-AGCTAGACAG TCAGGGTTTG AA-3 ′ (SEQ ID NO: 11). Both the pre-miR-Tyr construct and the pre-miR-Hyal construct were redesigned based on the same mir-434-5p backbone and mir-302 stem loop, and the resulting mature miR-Tyr and mature miR-Hyals are completely different from each other. As shown in FIG. 6, transfection expression of miR-Tyr and miR-Hyal in mouse skin crossed the targeted Tyr gene (over 90% reduction) and Hyal gene (over 67% reduction). Each was specifically suppressed without any off-target effect. Expression levels of mature miR-Tyr microRNA and mature miR-Hyal microRNA are directly measured by Northern blot analysis, while knockdown rates of targeted Tyr and Hyal gene products (proteins) are Western blot analysis Determined by.

Target specificity and safety for microRNA-mediated gene silencing of miR-Tyr and miR-Hyal in human skin cells Optimal gene silencing effect for intron miR-Tyr and miR-Hyal RNAi effectors designed by the present invention After understanding these, we have used these miRNA-Tyr pre-miRNA or miR-Hyal pre-miRNA for skin care using these SpRNAi-RGFP genes in human skin cells and tissues. The effectiveness, target specificity and safety of the construct were continuously tested. For efficient vector transfection into the human skin surface cell layer, 1 μg / ml SpRNAi-RGFP vector solution was converted to 100 μg purified SpRNAi-RGFP vector in ddH ₂ O treated with 1 ml autoclave. And 99 ml of 100% deoxyribonuclease free glycerin (also referred to as glycerol). Glycerin without deoxyribonuclease was used to encapsulate miR-Tyr for the purpose of delivery to deep skin and cell membrane penetration. This forms the base of the main ingredients used in products that whiten and light the skin. After this, more other cosmetic ingredients can be added to increase the color, scent, effect and / or stability of the final cosmetic. As shown in FIG. 7A, Asian male arm skin treated with 2 ml of this major component-based expression of miR-Tyr (right side) as described above was treated with blank SpRNAi-RGFP without any miRNA insert. Comparison was made with the same skin treated with vector (glycerin control, left side). The results of skin whitening (reduction in black pigment-melanin) obtained by miR-Tyr treatment were observed for 3 days after treatment twice a day, as shown in FIG.

  The primary culture of skin cells is then transplanted with trypsin-dissociated skin from a donor tested with personal consent (all treatments are based on this consent). Obtained by piece. Vector transfection in primary skin cultures was performed as described in Examples 3 and 6 (60 μg total). As shown in FIG. 7B, Western blot analysis for loss of target tyrosinase protein and its substrate melanin is biostatistically significant (p> 0.001). The decreased amount of tyrosinase protein and its substrate melanin in the skin is proportional to the treated concentration of the miR-Tyr expression vector, and the positive between the increase in miR-Tyr treatment and the loss of target tyrosinase protein and substrate melanin Correlation is shown. What is the effect of other treatments with vectors such as the blank SpRNAi-RGFP vector (glycerin) without any miRNA insert and the SpRNAi-RGFP vector expressing the anti-EGFP pre-miRNA insert (miR-gfp) Also not found. At a concentration of 1 μg / ml miR-Tyr expression vector transfection, the maximum Tyr gene silencing rate is about 55% -60% for tyrosinase and 30% -45% for melanin. On the other hand, the expression of non-target housekeeping control β-actin was not affected by miR-Tyr treatment, indicating the high target specificity of this artificial microRNA molecule. FIG. 7C further shows that skin melanin levels are clearly reduced while melanin (black dots around cell nuclei) is miR, as shown in the bright field (BF) photograph of the skin cell primary culture (upper panel). -It is highly expressed in normal skin cells without Tyr treatment (ie blank and glycerin only). Skin cells after miR-Tyr treatment show that melanin accumulation is suppressed, demonstrating an effective skin whitening effect in vivo. For this reduction in skin melanin, target tyrosinase expression is simultaneously reduced in skin cells after miR-Tyr treatment, as confirmed by immunocytochemistry (ICC) staining analysis (lower panel of FIG. 7C). . Thus, based on the overall results of FIGS. 7A-7C, the designed miR-Tyr microRNA was used to successfully inhibit melanin production by suppressing tyrosinase expression in human skin in vivo. Can be done.

  After the efficacy of miR-Tyr gene silencing in human skin has been established, we have developed a primary culture of skin cells transfected with miR-Tyr as described above and primary of untreated skin cells. Gene microarray analysis (GeneChip U133A & B array, Affymetrix, Santa Clara, Calif.) Was used to assess changes in over 32,668 human gene expression in culture. And compared with the use of natural mir-434, it has much more target specificity and shows less gene silencing effect for genes other than the target gene. Total RNA from each cell culture tested was isolated using an RNeasy spin column (Qiagen, Valencia, CA). As shown in FIG. 8A (left side), microarray analysis results in untreated (miR−) skin cell primary cultures and miR-Tyr transfected (miR +) skin cell primary cultures showed that target tyrosinase Only two genes, including (Tyr) and its associated TRP1 gene, were changed more than 1.5 times (> 50% change in gene expression) (FIG. 8B), miR-Tyr mediated The type gene silencing effect is very specific for the target Tyr. Moreover, genes related to cytotoxicity and the interferon-mediated PKR / 2-5A pathway are not affected, suggesting that this gene silencing effect is safe for skin care treatments. (FIG. 8B). The inventors also compared and evaluated the gene expression levels of these microarray confirmatory genes using Northern blot analysis (FIG. 8C), confirming that the results were similar to FIGS. 8A and 8B. In a further comparison performed using the results of native mir-434-5p transfection (FIG. 8A, right), the correlation coefficient (CC) ratio was determined in miR-Tyr transfected (miR +) cells. Shows that a high ratio of 99.8% of the 32,668 gene expression remains unchanged, but a low ratio of 77.6% CC in cells transfected with mir-434-5p It's been found. This means that the expression pattern of only 65 cellular genes is altered by the designed miR-Tyr transfection. In contrast, more than 7,317 genes have been altered by transfection with natural mir-434-5p. Because it is well known that almost all natural microRNAs (miRNAs) target multiple cellular genes due to their mismatch stem arms, our invention is based on the target-specific gene silencing of these miRNAs. We show that these stem arm areas need to be redesigned for safe use in Sing applications.

  Thus, the use of the intron hairpin-like microRNA (miRNA) / shRNA expression vector of the present invention provides a powerful new strategy for skin care in vivo, particularly for pigmentation treatment and aging prevention. In a similar treatment, Pol-II transcribed intron miRNA caused no detectable cytotoxicity, while Pol-III inducible siRNA induced non-specific mRNA degradation as previously reported ( Sledz et al., Supra; Lin et al., 2004b, supra). This highlights the fact that intron miRNAs are both effective and target-specific in vivo without any influence from the potential cytotoxicity of double-stranded siRNA. Since such intron miRNA-mediated gene silencing pathways are well coordinated in multiple intracellular regulatory systems including Pol-II transcription, RNA splicing and NMD processing, the gene silencing effect of intron miRNA is already known. All three RNAi pathways considered are considered to be the most efficient, specific and safe. The use of redesigned intron miRNAs provides a relatively long-term, effective, specific and safe genetic manipulation approach in skin care applications, as demonstrated by conventional siRNA methods Silencing cytotoxicity against genes, ie off-target genes, can be blocked.

A. Definitions In order to facilitate understanding of the present invention, several terms are defined as follows:
Nucleotide: A unit of DNA or RNA monomer composed of a sugar moiety (pentose), phosphoric acid and a nitrogen-based heterocyclic base. The base is linked to the sugar moiety via a glycoside carbon (1 'carbon of pentose), and the combination of base and sugar is a nucleoside. A nucleoside containing at least one phosphate group attached to the 3 ′ or 5 ′ position of the pentose is a nucleotide.

  Oligonucleotide: A molecule consisting of two or more, preferably three or more, and usually ten or more deoxyribonucleotides or ribonucleotides. The exact size depends on various factors, but they also depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be produced by any method, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof.

Nucleic acid: A polymer of nucleotides, which may be single-stranded or double-stranded.
Nucleotide analogs: Purine and pyrimidine nucleotides that are structurally different from A, T, G, C, or U, but are sufficiently similar to alternatives for normal nucleotides in nucleic acid molecules.

Gene: A nucleic acid whose nucleotide sequence encodes RNA and / or polypeptide (protein). The gene may be either RNA or DNA.
Base pair (bp): A pair of adenine (A) and thymine (T) or cytosine (C) and guanine (G) in a double-stranded DNA molecule. In RNA, uracil (U) replaces thymine. In general, the pair is formed by hydrogen bonds.

  Precursor messenger RNA (pre-mRNA): A ribonucleotide primary transcript of a gene, produced by a type II RNA polymerase (Pol-II) mechanism in eukaryotic cells by an intracellular mechanism called transcription. The pre-mRNA sequence contains a 5 'end untranslated region, a 3' end untranslated region, exons and introns.

Intron: A part or parts of a gene transcription sequence that encodes a non-protein reading frame.
Exon: A part or parts of a gene transcription sequence that encodes a protein reading frame.

  Messenger RNA (mRNA): An assembly of pre-mRNA exons, formed after intron removal by an intracellular spliceosome mechanism and used as protein coding RNA for protein synthesis.

cDNA: single-stranded DNA that is complementary to the mRNA sequence and does not contain any intron sequences.
Sense: A nucleic acid molecule that has the same sequence order and composition as a homologous mRNA. The form of this sense is indicated by the sign “+”, “s” or “sense”.

  Antisense: A nucleic acid molecule that is complementary to each mRNA molecule. Antisense forms are indicated by a “−” sign or “a” or “antisense” before DNA or RNA, for example “aDNA” or “aRNA”.

  5 'end: The end lacking a nucleotide at the 5' position of a contiguous nucleotide where the 5'-hydroxyl group of one nucleotide is linked to the 3'-hydroxyl group of the next nucleotide by a phosphodiester bond. Other functional groups such as one or more phosphates may be present at the end.

  3 'end: The end lacking a nucleotide at the 3' position of a contiguous nucleotide in which the 5'-hydroxyl group of one nucleotide is linked to the 3'-hydroxyl group of the next nucleotide by a phosphodiester bond. There may be other functional groups at the end, in many cases hydroxyl groups.

  Template: A nucleic acid molecule that is copied with a nucleic acid polymerase. The template may be single stranded, double stranded, or partially double stranded, depending on the polymerase. The synthesized copy is complementary to at least one strand of the template or a double-stranded or partially double-stranded template. Both RNA and DNA are synthesized in the 5 'to 3' direction. The two strands of the nucleic acid duplex are always aligned so that the 5 'ends of the two strands are opposite ends of the duplex (and the 3' ends are similar if necessary) Is).

  Nucleic acid template: DNA-RNA or RNA-DNA hybrid, or double-stranded DNA molecule, double-stranded RNA molecule, hybrid molecule, such as single-stranded DNA or RNA molecule.

Conservation: When hybridized non-randomly with the exact complement of a preselected sequence, the nucleotide sequence is conserved with respect to the preselected (referenced) sequence.
“Complementary”, “complementarity” or “complementation”: used in reference to polynucleotides (ie, sequences of nucleotides) that are related by base pairing rules. For example, the sequence “AGT” is complementary to the sequence “TCA” and is also complementary to “TCU”. Complementarity can be either between two DNA strands, between DNA and RNA strands, or between two RNA strands. Complementarity may be “partial” or “complete” or “total”. Some complementarity or complementation occurs only when some nucleobases become symmetrical according to the base pairing rules. Full or total complementarity or complementation occurs when the bases are completely symmetrical between the strands of nucleic acid. The degree of complementarity between nucleic acid strands has a clear effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions. It is equally important in detection methods that follow the binding between nucleic acids. The percentage of complementarity or complementation refers to the number of mismatched bases relative to the total bases of one strand of nucleic acid. Thus, 50% complementation means that half of the bases are mismatched and half of the bases are matched. Even if the two strands have different numbers of bases, the two strands can be complementary. In this situation, complementation also occurs between the shorter strand base paired with the shorter strand base.

  “Homologous” or “homology”: means a polynucleotide sequence having similarity to a gene or mRNA sequence. A nucleic acid sequence can have, for example, partial or complete homology to a particular gene or mRNA sequence. Homology can be expressed as a percentage determined by the number of similar nucleotides relative to the total number of nucleotides.

Complementary bases: nucleotides that are normally paired when DNA or RNA incorporates a double-stranded structure.
Complementary nucleotide sequence: A sequence of nucleotides in a single-stranded molecule of DNA or RNA that is sufficiently complementary to another single strand that specifically hybridizes between two strands by subsequent hydrogen bonding. It is.

  “Hybridize” and “hybridization”: the formation of a duplex between nucleotide sequences that are sufficiently complementary to form a complex via base pairing. When a primer (or splice template) “hybridizes” with a target (template), such a complex (or hybrid) is sufficiently stable and is required by DNA polymerase to initiate DNA synthesis. Priming function is provided. There is a specific or non-random interaction between two complementary polynucleotides that are competitively inhibited.

  RNA interference (RNAi): A post-transcriptional gene silencing mechanism in eukaryotes, caused by small RNA molecules such as microRNA and small interfering RNA. These small RNA molecules usually function as gene silencers and interfere with the expression of intracellular genes that contain either full or partial complements to the small RNA.

  MicroRNA (miRNA): A single-stranded RNA that can be ligated to a target gene transcript that has a partial complement to miRNA. miRNAs are typically about 17-27 oligonucleotides long and directly degrade intracellular mRNA targets or directly inhibit protein translation of target mRNAs, depending on the complementarity between the miRNA and its target mRNA. Can do either. Natural miRNAs are found in almost all eukaryotes, function as defenses from viral infections, and allow for regulation of gene expression during plant and animal development.

  Pre-miRNA: interacts with intracellular RNase III endoribonuclease to generate one or more microRNAs that can silence one or more target genes that are complementary to the microRNA sequence Hairpin-like single-stranded RNA for use, comprising a stem arm and a stem loop region. The stem arm of the pre-miRNA forms either a full (100%) or partial (including mismatched) hybridized duplex form, while the stem loop has a cycle or hairpin loop form. It is connected to one end of the stem arm duplex to form.

  Small interfering RNA (siRNA): a short pair that can be sized into approximately 18-25 full base pair ribonucleotide duplexes and can degrade target gene transcripts that are almost perfectly complementary Stranded RNA.

  Small or short hairpin RNA (shRNA): A pair of partially matched or fully matched stem arm nucleotide sequences divided by non-matching loop oligonucleotides to form a hairpin-like structure. Single-stranded RNA containing. Many natural miRNAs are derived from hairpin-like RNA precursors, so-called precursor microRNAs (pre-miRNAs).

  Vector: A recombinant nucleic acid molecule such as recombinant DNA (rDNA) that can move and stay in different genetic environments. In general, another nucleic acid is effectively linked. Vectors can self-replicate in cells, in which case the vector and attached segments are replicated. One preferred vector is an episome, ie, a nucleic acid molecule capable of extrachromosomal replication. Preferred vectors are those capable of self-replication and / or expression of nucleic acids to which they are linked. A vector capable of inducing the expression of a gene encoding one or more polypeptides is referred to herein as an “expression vector”. A particularly important vector allows the cloning of cDNA from mRNA generated using reverse transcriptase.

Cistron: A sequence of DNA molecules that encode a sequence of amino acid residues and includes upstream and downstream DNA expression control elements.
Promoter: A nucleic acid that a polymerase molecule identifies, possibly binds, and initiates synthesis. For the purposes of the present invention, a promoter can be any sequence that can initiate synthesis with a desired polymerase, such as a known polymerase binding site, enhancer, and the like.

Antibody: A peptide or protein molecule having a preselected conserved domain structure that encodes a receptor capable of binding a preselected ligand.
B. Compositions A recombinant nucleic acid composition for introducing gene silencing associated with RNA splicing and / or processing is a) at least one intron, adjacent to a plurality of exons, and intracellular RNA splicing and And / or an intron that can be cleaved from an exon by a processing mechanism, and b) a plurality of exons that can be linked to form a gene with the desired function.

  The recombinant nucleic acid composition further comprises: a) at least one restriction / cloning site, the recombinant nucleic acid in an expressible vector for expressing an RNA primary transcript of the recombinant nucleic acid composition in skin cells Restriction / cloning sites used to incorporate the composition, and b) multiple transcription and translation termination sites, used to generate an RNA transcript of the correct size of the recombinant nucleic acid composition. Transcription and translation termination sites.

  The intron of the recombinant nucleic acid composition described above further includes a) a gene silencing effector insert that is complementary or homologous to the target gene, b) a 5 ′ donor splice site, and c) 3 'Receptive splice sites, d) branch point motifs for spliceosome type discrimination, e) polypyrimidine regions for spliceosome interactions, and f) multiple components for linking the above components A linker.

  The 5′-donor splice site is 5′-GTAAGAGK-3 ′ (SEQ ID NO: 3) or (5′-GTAAGAGGAT-3 ′ (SEQ ID NO: 27), 5′-GTAAGAGGT-3 ′, 5′-GTAGAGGT-3 ′. And any GU (A / G) AGU motif (such as 5′-GTAAGT-3 ′) or a homologous nucleotide sequence, while the 3′-receptor splice site is GWKSCYRCAG CT (A / G) A (C / (such as 5′-GATATCCTGC AG-3 ′ (SEQ ID NO: 28), 5′-GGCTGCAG-3 ′ and 5′-CCACAG-3 ′)) T) A nucleotide sequence that contains or has homology with any of the NG motifs. In addition, the branch point sequence is located between the 5 'and 3' splice sites, and 5'-TACTWAY-3 such as 5'-TACTAAC-3 'and 5'-TACTTAT-3'. '(SEQ ID NO: 5) has homology with the motif. The branch point sequence adenosine “A” nucleotide is linked (2′-5 ′) by the cellular (2′-5 ′)-oligoadenylate synthase and spliceosome in almost all spliceosome introns. It forms part of the lariat intron RNA. Furthermore, the polypyrimidine region is located in close proximity between the branch point and the 3 'splice site, and 5'-(TY) m (C /-) (T) nS (C /-)-3. It contains an oligonucleotide sequence that is homologous to either the '(SEQ ID NO: 6) or 5'-(TC) nNCTAG (G /-)-3 '(SEQ ID NO: 7) motif and is rich in T or C. The symbols “m” and “n” indicate one or more repetitions, most preferably m is equal to 1-3 and the n number is equal to 7-12. The symbol “-” means a blank nucleotide in the sequence. Multiple linker nucleotide sequences also exist to link all these intron components. Based on the 37 CFR 1.822 guidelines for codes and formats used for nucleotide and / or amino acid sequence data, the code W means adenine (A) or thymine (T) / uracil (U) and the code K is Guanine (G) or thymine (T) / uracil (U) means cytosine (C) or guanine (G), Y means cytosine (C) or thymine (T) / uracil (U) ), R represents adenine (A) or guanine (G), N represents adenine (A), cytosine (C), guanine (G) or thymine (T) / uracil (U) To do. For all the spliceosome identification components described above, deoxythymidine (T) nucleotides can be replaced with uridine (U).

C. Methods In vivo methods for introducing gene silencing effects associated with RNA splicing and processing in human skin cells include: a) Recombination involving spliceosomal introns encoding gene silencing effectors adjacent to exons. Constructing a nucleic acid composition comprising: wherein the intron encodes a hairpin-like RNA structure and can be cleaved from an exon to induce RNA-mediated gene silencing; and b) recombinant Cloning the nucleic acid composition into an expressible vector, and c) introducing the vector into a plurality of skin cells in vivo, wherein the skin cells are a plurality of RNA primary transcripts of the recombinant nucleic acid composition. And the skin cells splice introns from the primary RNA transcript. Rice to provide a gene silencing effect for genes that have homology to the gene silencing effector or that contain complementary sequences, and exons are linked together to encode the protein. And obtaining a process.

Examples The following examples illustrate certain preferred embodiments and aspects of the present invention, but do not limit the scope of the invention.

  In the following experiments, the following abbreviations are used: M (molar), mM (molar), μm (micromolar), mol (molar), pmol (picomolar), gm (gram), mg (milligram). , Μg (microgram), ng (nanogram), L (liter), ml (milliliter), μl (microliter), ° C. (degrees Celsius), cDNA (copy or complementary DNA), DNA (deoxyribonucleic acid), ssDNA (Single-stranded DNA), dsDNA (double-stranded DNA), dNTP (deoxyribonucleotide triphosphate), RNA (ribonucleic acid), PBS (phosphate buffered saline), NaCl (sodium chloride), HEPES (N- 2-hydroxyethylpiperazine-N-2-ethanesulfonic acid), HBS (HEPES buffered saline), SDS (dosed Sodium Sil sulfate), Tris-HCl (tris hydroxymethyl aminomethane hydrochloride) and ATCC (American Type Culture Collection, Rockville, MD).

Construction of SpRNAi-Containing Recombinant Gene (SpRNAi-RGFP) The synthetic nucleic acid sequences used to generate three different SpRNAi introns, including sense inserts, antisense inserts or hairpin-EGFP inserts, include: N1 sense 5′-pGTAAGAGGAT CCGATCGCCAG GAGCGCACCA TCTCTCTCAA GA-3 ′ (SEQ ID NO: 12), N1 antisense, 5′-pCGCGTCTTGA AGAAGATGGT GCGCTCCTGGCGATCGGATCC TCTTAC-3 ′ (SEQ ID NO: 13 -3 ′ (SEQ ID NO: 14), N2 antisense, 5′-pCGCGTCAGGA GCGCA CATC TTCTTCAAGC GATCGGATCC TCTTAC-3 '(SEQ ID NO: 15), N3 sense, 5'-pGTAAGAGGAT CCGATCGCAG GAGCGCACCA TCTTCTTCAA GTTAACTTGA AGAAGATGGT GCGCTCCTGA-3' (SEQ ID NO: 16), N3 antisense, 5'-pCGCGTCAGGA GCGCACCATC TTCTTCAAGT TAACTTGAAG AAGATGGTGC GCTCCTGCGA TCGGATCCTC TTAC -3 '(SEQ ID NO: 17), N4 sense, 5'-pCGCGTTACTA ACTGGTACCT CTTCTTTTTTTTTTATATACCTGCAG-3' (SEQ ID NO: 18), N4 antisense, 5'-pGTCCTGCAGG ATATA AAAA AAAAAGAGAGA GGTACCAGTT AGTAA-3 ′ (SEQ ID NO: 19). In addition, two exon fragments were generated by DraII restriction enzyme cleavage at the 208th nucleotide (nt) site of the red fluorescent RGFP gene (SEQ ID NO: 20), and the 5 ′ fragment was further terminated by T4 DNA polymerase. Has been smoothed. RGFP means a novel fluorescent mutated chromoprotein gene shifted to red, which is Heteractis crispa. Produced by inserting an additional aspartate at the 69th amino acid (aa) site of the HcRed1 chromoprotein from (BD Biosciences, CA), almost double the association at 570 nm wavelength. Strong near-infrared fluorescence emission. In addition, the pHcRed1-N1 / 1 plasmid (BD Biosciences, CA) was cleaved with XhoI and XbaI restriction enzymes and the full-length 769-bp RGFP gene fragment isolated by 2% agarose gel electrophoresis and 3,934- Each of the bp blank plasmids was purified.

Hybridization of N1 sense to N1 antisense, N2 sense to N2 antisense, N3 sense to N3 antisense, and N4 sense to N4 antisense is such that the sense and antisense sequences are 1: Each complementary mixture of 1 was heated at 94 ° C. for 2 minutes, then 1 × PCR buffer (eg, 50 mM Tris-HCl, 16 mM (NH ₄ ) ₂ SO ₄ , 1.75 mM MgCl ₂ , pH 9.2 at 25 ° C.). Each was carried out by heating at 70 ° C. for 10 minutes. Subsequently, any of the N1, N2 or N3 hybrids are sequentially ligated with the N4 hybrid, and the N1-N4 hybrid, the N2-N4 hybrid, or the N3-N4 hybrid (all are 1: 1) Each is gradually cooled from 50 ° C. to 10 ° C. over 1 hour, T4 ligase and relative buffer (Roche, IN) are mixed in the mixture for 12 hours at 12 ° C. An intron was obtained for insertion into the provided exons. After the RGFP exon fragment was added to the reaction (1: 1: 1), T4 ligase and buffer were similarly adjusted to repeat the ligation for an additional 12 hours at 12 ° C. In order to clone the correct size recombinant RGFP gene, 10 ng of the ligated nucleotide sequence was converted into RGFP specific primer pairs 5'-CTCGAGCATG GTGAGGGGCC TGCTGAA-3 '(SEQ ID NO: 21) and 5'- PCR amplification was performed using TCTAGAAAGTT GGCCTTCTGCGGCAGGT-3 ′ (SEQ ID NO: 22) for 30 cycles of 94 ° C. for 1 minute, 52 ° C. for 1 minute, and 68 ° C. for 2 minutes. The resulting PCR product was fractionated on a 2% agarose gel and the ˜900-bp nucleotide sequence was extracted and purified with a gel extraction kit (Qiagen, Calif.). The construction of this ~ 900 bp SpRNAi-containing RGFP gene was further confirmed by sequencing.

  Since the recombinant gene possesses XhoI and XbaI restriction sites at the 5 'and 3' ends, respectively, it can be easily cloned into a vector with sticky ends to the XhoI and XbaI cloning sites. The vector must be an organism or sub-organism that can be expressed with a skin affinity selected from the group consisting of plasmids, cosmids, phagemids, yeast artificial chromosomes, jumping genes, transposons and viral vectors. Moreover, because the insert within the intron is also adjacent to the PvuI and MluI restriction sites at its 5 ′ and 3′-ends, respectively, the insert is inserted into the PvuI cloning site and MluI. Other different insertion sequences with sticky ends to the cloning site can be used for removal and replacement. The inserted sequence is highly complementary to a gene target selected from the group consisting of a fluorescent protein (GFP) gene, a luminescent enzyme gene, a lac-Z gene, a viral gene, a bacterial gene, a plant gene, an animal gene and a human gene It is preferably a hairpin-like gene silencing effector having sex. The degree of complementarity and / or homology between the gene silencing effector insert and its target gene is in the range of about 30% -100%, but 35% -49% for the hairpin shRNA insert, sense- More preferably, it is in the range of 90% -100% for both stRNA and antisense-siRNA inserts.

Cloning of SpRNAi-containing genes into expressible vectors The recombinant SpRNAi-RGFP gene has XhoI and XbaI restriction sites at its 5 'and 3'-ends, respectively, and therefore has cohesive ends to the XhoI and XbaI cloning sites Can be easily cloned in vectors. The present inventors mixed the SpRNAi-RGFP gene with a linearized 3,934-bp blank pHcRed1-N1 / 1 plasmid at a ratio of 1:16 (w / w). Cool from 65 ° C. to 15 ° C. over 50 minutes, then add T4 ligase and relative buffer for 12 hours at 12 ° C. to perform the ligation. This formed the SpRNAi-RGFP expression vector, which contains 50 μg / ml kanamycin (Sigma Chemical, St. Louis, MO). can be grown in E. coli DH5α LB cultures. Positive clones were confirmed by PCR using RGFP-specific primer pairs (SEQ ID NO: 21 and SEQ ID NO: 22) and subsequent sequencing for 30 cycles of 94 ° C. for 1 minute and then 68 ° C. for 2 minutes. Cloning into a viral vector can be performed in a similar ligation step, except that the XhoI / XbaI-linearized pLNCX2 retovirus vector (BD) is used instead. The insert within the SpRNAi intron is flanked by PvuI and MluI restriction sites at its 5 ′ and 3 ′ ends, respectively, thus removing the anti-EGFP shRNA insert and entering the PvuI and MluI cloning sites. Can be replaced with a miR-Tyr or miR-Hyal insertion sequence having the sticky ends of

The synthetic nucleic acid sequences used to generate various SpRNAi introns, including either miR-Tyr inserts or miR-Hyal inserts, are as follows: miR-Tyr Sense, 5'-GTCCGATCGT TCCCCTACTTC ATTGCCCTAAGGCAGGCGGCT AGGCAATAGA GTAGGGCCGA CGCGTCAT-3 '(SEQ ID NO: 8), miR-Tyr antisense, 5'-ATGACGCGTC GGCCCTACTC TATTGCCTAA GCCGCCTGGC TTAGCGGCTT AGGCAATAGA GTAGGGCGAC GATCGGAC-3' (SEQ ID NO: 23), and miR-Hyal sense, 5'-GTCCGATCGT CAGCTAGACA GTCAGGGTTT GAA GCTAAGC CAGGCTTCAA ACCCTGAACTG TCTAGCTCCGA CGCGCATCAT-3 '(SEQ ID NO: 10), miR-Hyal antisense, 5'-ATGACGCGTC GAGCTAGCA GTCTAGCGACTGTGCTACTG' These inserts were formed upon hybridization of miR-Tyr sense to miR-Tyr antisense and miR-Hyal sense to miR-Hyal antisense, respectively. These miR-Tyr- and miR-Hyal expression vectors thus obtained are 50 μg / ml kanamycin (for the pHcRed1-N1 / 1 plasmid-based vector) or 100 μg / ml ampicillin (for the pLNCX2 viral vector). ) Including any of E. can be grown in E. coli DH5α LB cultures. The propagated SpRNAi-RGFP vector can be isolated and purified using the Mini-prep or Maxi-prep plasmid extraction kit (Qiagen, CA) according to the manufacturer's instructions. For the pLNCX2 vector, the packaging cell line PT67 (BD) may be used to produce infectious and non-replicatable viruses. Transfected PT67 cells were cultured at 37 ° C. and 5% CO ₂ with 4 mM L-glutamine, 1 mM sodium pyruvate, 100 μg / ml streptomycin sulfate and 50 μg / ml neomycin (Sigma Chemical, MO) and cultured in 1 × DMEM medium supplemented with 10% fetal calf serum. The titer of virus produced in PT67 cells was determined to be at least 10 ⁶ cfu / ml prior to transfection.

In Vivo Vector Transfection For vector transfection into cell culture, fry and mouse skin, first an SpRNAi-RGFP expression plasmid containing either anti-EGFP, miR-Tyr insert or miR-Hyal pre-miRNA insert Vector and FuGene reagent (Roche, IN) were mixed according to the manufacturer's instructions. The mixture was then applied directly to each of the cell culture (ie primary culture of human skin), fry or mouse skin. A vector containing the RGFP gene with no insert for the HIV gag-p24 gene and the SpRNAi-RGFP gene with the pre-miRNA insert was used as a negative control. Tissue or cell morphology and fluorescence images were taken at 0, 24, 48, and 72 hours after the initial transfection. For transfection into human skin in vivo, prefabricated SpRNAi-RGFP vector solution, anti-EGFP, pre-miRNA insert of miR-Tyr or miR-Hyal in ddH ₂ O was autoclaved in 1ml A predetermined amount (ie 1-1000 μg) of purified SpRNAi-RGFP vector with or without any of the above was formed by mixing with glycerin (or glycerol) completely free of deoxyribonuclease. This solution was then applied directly to the skin and gently massaged for 3 minutes.

Northern blot analysis RNA (20 μg total RNA or 2 μg poly [A ⁺ ] RNA) was fractionated on a 1% formaldehyde agarose gel and transferred to a nylon membrane (Schleicher & Schuell, Keene, NH). . Either a 75 base pair conjugation sequence adjacent between the RGFP 5′-exon and the anti-EGFP pre-miRNA insert or miR-Tyr (SEQ ID NO: 9), or miR-Hyal (SEQ ID NO: 10) by random primer extension in the presence of a synthetic probe having complementarity ^{[32 P] -dATP (> 3000Ci} / mM, Amersham International, Arlington Heights, IL) against, Prime-It II kit (Stratagene, La Jolla, CA) and purified on a 10 bp-cutoff microbiospin chromatography column (Bio-Rad, Hercules, CA). High in a mixture of 50% fresh deionized formamide (pH 7.0), 5 × Denhardt's solution, 0.5% SDS, 4 × SSPE and 250 mg / mL denatured salmon semen DNA fragment (18 hours, 42 ° C.) Hybridization was performed. Prior to autoradiography, the membranes were sequentially washed twice with 2x SSC, 0.1% SDS (15 minutes at 25 ° C), once with 0.2x SSC, 0.1% SDS (45 minutes at 37 ° C) Washed.

SDS-PAGE and Western blot analysis For target protein immunoblotting, the isolated cells after removal from the growth medium are washed with ice-cold PBS and supplemented with protease inhibitors, leupeptin, TLCK, TAME and PMSF. CelLytic-M lysis / extraction reagent (Sigma, MO) was used and processed according to the manufacturer's instructions. The cells were incubated on a shaker at room temperature for 15 minutes, seeded in a microtube, and centrifuged at 12,000 × g for 5 minutes to pellet cell debris. Protein-containing cell lysates were collected and stored at -70 ° C until use. Protein determination was performed using an E-max microplate reader (Molecular

  (Devices, Sunnyvale, CA) using the SOFTmax software package. 30 μg of each cell lysate is added to SDS-PAGE sample buffer with 50 mM DTT (reduced) or without 50 mM DTT (non-reduced) and before loading onto an 8% polyacrylamide gel. While boiling for minutes, the control lane was loaded with 2-3 μl of molecular weight marker (Bio-Rad). SDS-polyacrylamide gel electrophoresis was performed according to standard protocols (Molecular Cloning, 3rd ED). Protein fractions were electroblotted onto nitrocellulose membrane and blocked with Odyssey blocking reagent (Li-Cor Biosciences, Lincoln, NB) for 1-2 hours at room temperature. Then, EGFP (1: 5,000; JL-8, BD), RGFP (1: 10,000; BD), Tyr (1: 2,000; Santa Crutz) or Hyal (1: 2,000; Santa Crutz) ) Protein expression was assessed overnight at 4 ° C. using primary antibodies directed against any of Protein blots were washed 3 times with TBS-T and secondary antibody goat anti-mouse IgG conjugate (1: 2,000, molecular probe) containing Alexa Fluor 680 reactive dye for 1 hour. Exposed at room temperature. Further, after washing 3 times with TBS-T, Li-Cor Odyssey infrared imaging device and Odyssey software v. Scanning and image analysis were performed using 10 (Li-Cor).

Zebrafish intron RNA-mediated gene silencing Tg (actin GAL4: UAS-gfp) species of zebrafish fry are raised in fish containers using 10 ml of 0.2x serum-free RPMI 1640 medium at the time of transfection. did. The transfection premix (pre-mix) was prepared by gently dissolving 60 μl of FuGene liposome transfection reagent (Roche Biochemicals, Indianapolis, IN) in 1 ml of 1 × serum-free RPMI 1640 medium. As described in Examples 1 and 2, SpRNAi-RGFP vector (20 μg) with or without anti-EGFP pre-miRNA insert was mixed with the premix solution and left on ice for 30 minutes. The Tg (actin GAL4: UAS-gfp) fish in the container was directly applied. A total of 3 doses were given at 12 hour intervals (60 μg total). Samples were taken 60 hours after the first transfection.

Intron mir-434-5p and miR-Tyr mediated gene silencing of mouse skin in vivo Patched albino (white) skin of melanin knockdown mice (in the W-9 black line) over 4 days (total 200 μg) By sequential intradermal injection (ic) of an isolated SpRNAi-RGFP gene expression vector containing the native mir-434-5p pre-miRNA insert, or twice a day for 6 days ( A total of 240 μg) was generated by direct introduction of the liposome-encapsulated SpRNAi-RGFP gene expression vector containing the designed miR-Tyr pre-miRNA insert into the skin. For the generation of SpRNAi-RGFP gene expression vectors, including the natural mir-434-5p pre-miRNA insert, the synthetic mir-434-5p pre-miRNA (ie, 5'-GTCCGATCGT CUCGACUUGUG GUAGUGUGACC AAUGUCACC AAAGUCUG AAGUCUG The procedure described in Example 2 was followed, except using AACCAUUACU UAAUUCGUGG UUUGACACCAU CACUCGACUC CUGGUUCGAA CCAUCCCGACG CGTCAT-3 '(SEQ ID NO: 25)). The construct was mixed with FuGene liposomal transfection reagent (Roche, IN) according to similar protocols described in Examples 3 and 6 for efficient delivery to the target tissue.

Intron miR-Tyr mediated gene silencing in human skin In order to efficiently transfect a vector into human multiple cell layers, 1 μg / ml SpRNAi-RGFP vector solution was added in 1 ml ddH ₂ O autoclaved. Of 100 μg of the purified SpRNAi-RGFP vector and 99 ml of glycerin containing no deoxyribonuclease (also referred to as glycerol). Glycerin without any deoxyribonuclease was used to encapsulate miR-Tyr for the purpose of delivery to deep skin and cell membrane penetration. This formed the base of the main ingredients for whitening and lightening the skin according to the present invention. Next, in one of the arms of the inventor (left arm), 2 ml of the base solution of this main component expressing miR-Tyr designed directly is applied to the right part of the arm, and as a comparison, the left part is Another 2 ml of blank SpRNAi-RGFP vector without the miRNA insert was applied directly. The effect of skin whitening by miR-Tyr treatment (reduction of black pigment melanin) was observed for 3 days after treatment twice a day.

Immunocytochemical staining (ICC) method The immunochemical staining kit was obtained from Imgenex (San Diego, CA) and used according to the manufacturer's instructions. Specimens were first washed 3 times with PBS and incubated with Zeller solution (10 mM Tris, 100 mM MgCl ₂ , 5% fetal calf serum, 1% BSA and 0.5% Tween 20, pH 7.4) for 30 minutes. . The specimens were then incubated overnight with primary antibody (diluted with Zeller solution) in a humidified chamber at 4 ° C. Thereafter, these specimens were washed with TBST three times and cultured for 2 hours using a biotinylated goat anti-rabbit antibody or horse anti-mouse antibody as a secondary antibody (Chemicon, Temecula, CA). Thereafter, the specimen was washed once with TBST, and streptavidin-HRP was used as a tertiary antibody for another 2 hours. Subsequently, the specimens were washed once with PBT and the bound antibody was detected with DAB substrate. Positive results were observed under a 100 × microscope with full range scanning and recorded at 100 × and 400 × magnification (inverted microscope TE2000 quantification system).

Microarray analysis To prepare labeled probes for microarray hybridization, the extracted total RNA (2 μg) was modified using the Superscript Choice system kit (Gibco / BRL, Gaithersburg, MD) Conversion to double stranded cDNA using oligo (dT) ₂₄ -T7 promoter primer (eg, 5′-GGCCAGTGAA TTGTAATACG ACTCACTATA GGGAGGCGG- (dT) ₂₄ -3 ′) (SEQ ID NO: 33) according to manufacturer's protocol did. Double-stranded cDNA was purified by phenol / chloroform extraction, precipitated with ethanol, and resuspended in 0.5 μg / μl concentrate of ddH ₂ O treated with diethyl pyrocarbonate (DEPC). Phase lock gel (5 ′ Prime → 3 ′ Prime, Inc., Boulder, CO) was used in all organic extractions to increase recovery. In vitro transcription consists of T7 RNA polymerase, 1 μg cDNA, 7.5 mM unlabeled ATP and GTP, 5 mM unlabeled UTP and CTP, 2 mM biotin labeled CTP and TP ( Biotin-11-CTP, Biotin-16-UTP, Enzo Diagnostics). The reaction was carried out at 37 ° C. for 4 hours, and the cRNA was purified with an RNeasy spin column (Qiagen, CA). Samples were separated on a 1% agarose gel to confirm the size range, and then μg of cRNA was transferred to 40 mM Tris acetate, pH 8.0, 100 mM KOAc / 30 mM MgOAc at 94 ° C. for 35 minutes. Was randomly fragmented to an average size of 50 bases.

  A set of 4 oligonucleotide microarrays (GeneChip U133A & Barrys, Affymetrix, Santa Clara, Calif.) Containing a total of 32,668 genes were used for hybridization. Hybridization was completed in 200 μl AFFY buffer (Affymetrix) with constant mixing for 16 hours at 40 ° C. After hybridization, the array was washed 3 times with 200 μl 6 × SSPE-T buffer (1 × 0.25 M sodium chloride / 15 mM sodium phosphate, pH 7.6 / 1 mM EDTA / 0.005% Triton). Then, it was washed with water at 50 ° C. for 1 hour using 200 μl of 6 × SSPE-T. The array was washed twice with 0.5XSSPE-T and washed with water for 15 minutes at 50 ° C. using 0.5 × SSPE-T. Staining was performed with 2 μg / ml streptavidin-phycoerythrin (Molecular Probes) and 1 mg / ml acetylated BSA (Sigma) in 6 × SSPE-T (pH 7.6). The arrays were read at 7.5 μm using a confocal scanner (Mokecular Dynamics) and analyzed by Affymetrix Microarray Suite version 4.0 software. Samples were normalized by using the sum of the average differences between perfectly matched and mismatched probes. Differential signals induced greater than 2 times were collected.

Statistical analysis The results are shown as mean ± SE. Statistical analysis of the data was performed by one-way analysis of variance (One-way ANOVA). When the main effect was significant, Dunnett's post-hoc test was used to identify significantly different groups from subjects. A two-tailed Student T test was used to compare pairwise between the two treatment groups. For experiments involving more than one treatment group, ANOVA was performed according to a multiple comparison multiple range test. Established values of p <0.05 were considered significant. All p values were determined in a two-sided test.

  The examples and embodiments described herein are for illustrative purposes only, and various modifications or changes have been suggested to those skilled in the art, and such modifications or changes are also appended to the appended claims. It is understood that these are encompassed within the spirit and scope of the present invention as described herein. All publications and patents cited herein are incorporated by reference in their entirety.

Claims (35)

In a method of producing a cosmetic product for skin care, the method includes:
(A) Intron insertion to encode a microRNA or shRNA capable of inducing a specific gene silencing effect in at least one of a pigment-related gene and a gene causing aging in mammalian skin cells Constructing a recombinant nucleic acid composition comprising at least one intron having a product;
(B) a cloning step of cloning the recombinant nucleic acid composition into a vector for delivery to the mammalian skin cells,
The recombinant nucleic acid composition and vector are not integrated into the cell genome, and a plurality of primary RNA transcripts can be generated from the recombinant nucleic acid composition, the dye-related gene and the gene causing senescence The intron is spliced from the plurality of primary RNA transcripts to produce the microRNA or shRNA that inhibits at least one of the plurality. 2. The method of claim 1, further comprising the step of synthesizing the nucleic acid composition of the intron. 2. The method of claim 1, wherein the nucleic acid composition is chemically produced or linked by a DNA synthesizer. The method of claim 1, wherein the nucleic acid compositions are linked by a genetic engineering technique selected from the group consisting of DNA ligation, transgene insertion, transposon delivery, retroviral infection, and combinations thereof. . 2. The method of claim 1, wherein the microRNA or the shRNA is modified from a microRNAmir-434 or a precursor of microRNAmir-434 having the sequence of SEQ ID NO: 25. The method according to claim 1, wherein at least one of the pigment-related gene and the gene causing aging is a tyrosinase gene or a hyaluronidase gene.   The method according to claim 1, wherein the recombinant nucleic acid composition is an artificial non-natural gene produced by a genetic engineering technique of restriction enzyme cleavage of the synthetic DNA sequence of the intron and DNA recombination. . The method according to claim 1, wherein the recombinant nucleic acid composition is a cellular gene prepared by incorporation of the intron within the sequence of the nucleic acid composition. The method according to claim 8, wherein the cellular gene is a gene selected from the group consisting of a viral gene, a mammalian gene, a protein coding gene, a non-protein coding gene, and combinations thereof. The intron is incorporated into the cellular gene by a genetic engineering technique selected from the group consisting of homologous recombination, DNA ligation, transgene insertion, transposon delivery, retroviral infection, and combinations thereof. Item 9. The method according to Item 8. The intron is a nucleic acid sequence comprising a component of the intron insert encoding at least one of microRNA and shRNA, branch point motif, polypyrimidine region, donor splice site and acceptor splice site. The method according to claim 1. 2. The intron insert encodes at least one selected from shRNA, microRNA, shRNA and microRNA precursors, shRNA and microRNA derivatives and combinations thereof. Method. 2. The method of claim 1, wherein the intron insert comprises at least a sequence complementary to a tyrosinase gene or a hyaluronidase gene. 2. The method of claim 1, wherein the intron insert encodes a hairpin-like nucleic acid comprising a stem loop structure comprising either the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The intron insert encodes a hairpin-like precursor microRNA (pre-miRNA) comprising at least the sequence of SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 25. Method. The method according to claim 1, wherein the microRNA (miRNA) or the shRNA comprises the sequence of SEQ ID NO: 9 or SEQ ID NO: 11. The intron insert is AatII, AccI, AflII / III, AgeI, ApaI / LI, AseI, Asp718I, BamHI, BbeI, BclI / II, BglII, BsmI, Bsp120I, BspHI / LU11I / 120I, BsrI / BI / BssHII / SI, BstBI / U1 / XI, ClaI, Csp6I, DpnI, DraI / II, EagI, Ecl136II, EcoRI / RII / 47III, EheI, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI, HpaI, HpaI KpnI, MaeII / III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, NdeI, NgoMI, NotI, NruI, NsiI, P A group consisting of II, Ppu10I, PstI, PvuI / II, RsaI, SacI / II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiI, TaqI, XbaI, XhoI, XmaI and combinations thereof 2. The method of claim 1, wherein the method is incorporated into the intron via at least one restriction / cloning site. 12. The method of claim 11, wherein the branch point is an adenosine (A) nucleotide located within a nucleic acid sequence comprising the sequence of SEQ ID NO: 5. 12. The branch point is an adenosine (A) nucleotide located within a nucleic acid sequence comprising at least one oligonucleotide motif comprising a sequence that is 5′-TACTAAC-3 ′. Method. The method according to claim 11, wherein the polypyrimidine region is a nucleic acid sequence containing a high content of T or C containing the sequence of SEQ ID NO: 6 or SEQ ID NO: 7. 12. The method of claim 11, wherein the donor splice site is a nucleic acid sequence comprising the sequence of SEQ ID NO: 3. 12. The method of claim 11, wherein the donor splice site is a nucleic acid sequence comprising a 5'-GTAAG-3 'sequence. 12. The method of claim 11, wherein the acceptor splice site is a nucleic acid sequence comprising the sequence of SEQ ID NO: 4. 12. The method of claim 11, wherein the acceptor splice site is a nucleic acid sequence comprising the sequence 5'-CTGCAG-3 '. The method according to claim 1, wherein the vector is an expressible vector selected from the group consisting of a plasmid, a cosmid, a phagemid, a yeast artificial chromosome, a transposon, a retrotransposon, a viral vector, and combinations thereof. . The recombinant nucleic acid composition or the vector comprises at least either a virus or a type II RNA polymerase (Pol-II) promoter, or both, a Kozak common translation initiation site, a polyadenylation signal, and a plurality of restriction / cloning. The method according to claim 1, comprising at least one of a site and a site. The viral promoter can be cytomegalovirus (CMV), retrovirus long terminal region (LTR), hepatitis B virus (HBV), adenovirus (AMV), adeno-associated virus (AAV), or plant-associated type. 27. The method of claim 26, comprising an RNA promoter isolated from mosaic virus and derivatives thereof. The restriction / cloning sites are AatII, AccI, AflII / III, AgeI, ApaI / LI, AseI, Asp718I, BamHI, BbeI, BclI / II, BglII, BsmI, Bsp120I, BspHI / LU11I / 120I, BsrI / BI , BssHII / SI, BstBI / U1 / XI, ClaI, Csp6I, DpnI, DraI / II, EagI, Ecl136II, EcoRI / RII / 47III, EheI, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI, HpaI, HpaI , KpnI, MaeII / III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, NdeI, NgoMI, NotI, NruI, Nsi PmlI, Ppu10I, PstI, PvuI / II, RsaI, SacI / II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiI, TaqI, XbaI, XhoI, XmaI, and combinations thereof 27. The method of claim 26, wherein the method is an oligonucleotide cleavage domain for the selected endonuclease. The vector further comprises a pUC origin of replication, an SV40 early promoter for expressing at least an antibiotic resistance gene in a replicable prokaryotic cell, and a selective SV40 origin for replication in a mammalian cell. The method of claim 1, comprising: The antibiotic resistance gene includes penicillin G resistance gene, ampicillin resistance gene, neomycin resistance gene, puromycin resistance gene, kanamycin resistance gene, streptomycin resistance gene, erythromycin resistance gene, spectomycin resistance gene , Fosfomycin resistance gene, tetracycline resistance gene, rifapicin resistance gene, amphotericin B resistance gene, gentamicin resistance gene, chloramphenicol resistance gene, cephalothin resistance gene, tyrosine resistance gene, G418 resistance 30. The method of claim 29, wherein the method is selected from the group consisting of genes and combinations thereof. The recombinant nucleic acid composition is introduced into the mammalian skin cells by a delivery method selected from the group consisting of liposomal transfection, electroporation, transposon insertion, microinjection, gene gun penetration and combinations thereof. The method according to claim 1. The RNA primary transcript of the recombinant nucleic acid composition is generated by a transcription mechanism selected from the group consisting of type II (Pol-II), type I (Pol-I), and viral RNA polymerase transcription mechanisms. The method according to claim 1. The RNA primary transcript of the recombinant nucleic acid composition is a ribonucleotide selected from the group consisting of mRNA, hnRNA, rRNA, tRNA, snoRNA, snRNA, pre-microRNA, viral RNA and their RNA precursors and their derivatives. The method of claim 1, wherein the method is an array. The microRNA or the shRNA is released from the intron by an intron excision mechanism selected from the group consisting of RNA splicing, nonsense mutation-dependent degradation (NMD) processing, and combinations thereof. The method described. The method according to claim 1, wherein the specific gene silencing effect is caused by intracellular silencing, RNA interference, or nonsense mutation-dependent degradation mechanism.