CN101569597A - Novel cosmetic designs and products using intronic rna - Google Patents

Abstract

The present invention relates to a method and composition for generating a non-naturally occurring intron and its components capable of being processed into small hairpin RNA (shRNA) and/or microRNA (miRNA) molecules by skin cells and thus inducing specific gene silencing effects on skin pigment-related genes and/or aging-causing genes in the cells. The gene silencing effects so obtained are not only useful for lightening and whitening skin colors but also useful for suppressing unwanted aging gene activities in skins.

Description

The ribonucleic technology of using intron is in the design and the product of novel cosmetic

Technical field

The invention relates to a kind of generation and be used for the cosmetics method that skin is safeguarded.More particularly, the invention relates to a kind of method and composition, this method is used for producing the intron that a non-natural produces, and its composition can form bob folder ribonucleic acid (small hairpin RNA via decomposition in Skin Cell, shRNA) or micro ribonucleic acid (microRNA, miRNA) for the specific gene modificator gene of the cell effect of mourning in silence, particularly for skin pigment related gene and skin aging gene.This gene silencing effect is not only whitened effectively to the colour of skin, suppresses aging gene for Skin Cell and also has effect.

Background technology

Prevention pigment accumulation (as sunburn) is the main method that has healthy skin with skin aging.Yet many skin pigment accumulations are relevant with individual gene activity with ageing process.For example, Tyrosinase (tyrosinase) is a kind of glycoprotein on the melanocyte film, and Tyrosinase is a speed decision ferment for the melanin generative process on skin and hair.In addition, (hyaluronan is in the main aging-resistant intercellular substance of Skin Cell HA) to hyaluronic acid, and (hyaluronidase Hyal) causes wrinkle of skin via decomposing subcutaneous hyaluronic acid to hyaluronidase.So, can make the skin young healthy by suppressing these ferment gene activities.

At present, no any prior art relevant with Hyaluronidase inhibitor is used to remove wrinkle.Many prior arts that are used for skin-whitening are by using the deutero-inhibition of hormone to win peptide, micromolecular compound and plant extract suppress the Tyrosinase activity, wherein plant extract comprises few peptide (the Pinel U.S.Pat.No.7 that wins, 268,108, and Schonrock U.S.Pat.No.6,852,699), hydroxyl tetronic acid (hydroxytetronic acid) derivant (Perricone U.S.Pat.No.7,019,029), contain benzene compound (Kim U.S.Pat.No.6,838,481), contain Benzodiazepines (hydroquinone) thing (Wortzman U.S.Pat.No.6,998,130 and 7,025,977), the analog of dihydroxylic alcohols and trihydroxylic alcohol (Brown U.S.Pat.No.7,250,157), kojic acid derivative (Ancira U.S.Pat.No.6,710,076), ascomycetes derive ferment (Mammone U.S.Pat.No.6,514,506) and plant extract (Nagamine U.S.Pat.No.7,192,617; Lee U.S.Pat.No.7,125,572; Steck U.S.Pat.No.6,521,267; PaulyU.S.Pat.No.7,105,184; Leverett U.S.Pat.No.6,994,874,7,060,304, and7,247,321; Arquette U.S.Pat.No.7,025,957,7,029,709, and 7,097, and 866; Chaudhuri U.S.Pat.No.6,649,150 and 6,969,509).Though these materials and method may be external powerful, have only minority to cause desalination pigment effect people (2006) such as (, pigment cell Res.19:550-571) Solano among them in clinical trial.Yet it is to have cytotoxicity that the deutero-benzoquinone of all Benzodiazepines derivants (quinone) are inferred.Therefore, in vivo and the wide gap between the in vitro tests hinting that the method that need have more innovation confirms the safety and the effectiveness of these chemical compounds.

Recently, The RNA interference technology (RNAi technology) is progressive, novel ribonucleic acid reagent has been disclosed can have the potential effect of inhibition to specific gene, and wherein this reagent comprises and uses short double stranded RNA/siRNA (as dsRNA/siRNA) (people (1998) Nature 391:806-811 such as Fire; People such as Elbashir (2001) Nature 411:494-498) and the The RNA interference molecule (as D-RNAi) of DNAization (people (2001) Biochem.Biophys.Res.Commun.281:639-644 such as Lin).Therefore, perhaps these ribonucleic acid reagent can be used to develop novel cosmetic design and the product that is used for skin.In theory, The RNA interference (RNAi) mechanism causes a back open gene mourn in silence (PTGS), this back open gene is mourned in silence and can be suppressed specific gene under nano-scale dosage, this The RNA interference mechanism is proved and has the persistence effect simultaneously, and than using anti-meaning oligonucleotide (antisense oligonucleotides) or micromolecule mortifier gene knockout method toxicity little people (2001) Current Cancer Drug Targets 1:241-247 such as () Lin traditionally.Along with many paper publishings (Grant, S.R. (1999) Cell 96:303-306; People such as Elbashir (2001) supra; People such as Lin, (2001) supra; People such as Lin (2004a) Drug Design Reviews 1:247-255), the ribonucleic acid (siRNA) of mourning in silence causes that gene silencing is sustainable to surpass a week, (deoxyribonucleotidylated-RNA interfering molecules, yet effect D-RNAi) can last till one month the The RNA interference molecule of DNAization.This siRNA/D-RNAi causes Messenger RNA (mRNA) decomposition of particular sequence in a series of cells and translates process of inhibition with it, yet siRNA/D-RNAi also may influence whole open genes of sequence similarity, and this phenomenon is referred to as common inhibition (co-suppression).For example, the nucleotide of alien gene or viral gene can be by RNaseIII Cobra venom endonuclease (RNaseIII endoribonucleases, Dicer) (RNA-directed RNA polymerases RdRp) handles the back and produces little ribonucleic acid fragment and then produce common the inhibition with the RNA-directed RNA polymerase.Based on the good The RNA interference mechanism of construction, prior art is used to suppress Tyrosinase activity (Binetti US Pat.Application Publication No.20050137151 and Collin-Djangone US Pat.Application Publication No.20070134188) by synthetic siRNA and double stranded RNA technology emphatically

Suppress the specific gene activity though the The RNA interference technology can act on skin, it is used and does not confirm as yet its stable and safety especially not confirm yet in high vertebrates on fish, bird, mammal and human body.For example, nearly allly go up siRNA reagent by the double stranded RNA form in vertebrates and all demonstrate the nonspecific ribonucleic acid that similar interferon causes and decompose (people (1998) Annu.Rev.Biochem.67:227-264 such as Stark; People supra such as Elbashir; U.S.Pat.No.4,289,850 to Robinson; Lau U.S.Pat.No.6,159,714).The cell-cytotoxic reaction that this similar interferon causes has reduced specific gene gene silencing effect and nonspecific ribonucleic acid is decomposed.Particularly in mammalian cell, when the size of siRNA/ double stranded RNA will make nonspecific ribonucleic acid decompose greater than 25 base pairs (base-pairs) The RNA interference effect.And may also can't overcome the problems referred to above less than the siRNA of 25 base pairs or the transfection of shRNA, because of people such as people such as Sledz and Lin have confirmed that the siRNA of high dose and shRNA (＞250nM in human T cells) can cause the similar serious cytotoxicity that double stranded RNA produced greater than 25 base pairs.This toxicity is to be decomposed and the cell carving institute of dying causes by the nonspecific ribonucleic acid that the double stranded RNA structure causes by the similar interferon of activation, and this apoptosis process is via PKR in the cell and 2-5A system path.The protein kinase PKR that interferon brought out (protein kinase PKR) can the activated cell apoptosis be well known, wherein interferon causes 2 ', the activation of 5 '-oligoadenylate (oadenylate) one-tenth enzyme (2-5A system) will cause the cracking of popularity sub-thread ribonucleic acid, and PKR and 2-5A system all have double stranded RNA abutting end (motif).Except this problem, the most difficult problem is to transmit these unsettled siRNA/shRNA and enters in the body, because the activity of ribonuclease (RNase) very high in vertebrates (Brantl S. (2002) Biochimica et Biophysica Acta 1575,15-25).

Since The RNA interference be result from by alien gene or viral gene transcribe nucleotide deutero-micro ribonucleic acid product (21-25 nucleotide base), so Pol-III-synthetic (mediated) siRNA/shRNA performance carrier (Pol-III-mediated siRNA/shRNA expression vector) can be provided at the interior metastable ribonucleic acid of body effect people (2002) Nat Biotechnol.20:446-448 such as () Tuschl of mourning in silence.Though prior art (people (2002) Nat Biotechnol 20:497-500 such as Miyagishi; People such as Lee (2002) Nat Biotechnol 20:500-505; People such as Paul (2002) Nat Biotechnol 20:505-508) attempt to use siRNA method successfully to keep stable gene silencing effect with carrier fashion, yet their strategy but loses focusing ribonucleic acid and mourns in silence effect at specific cells kenel or tissue, because use is that the 3rd type ribonucleic acid polymerase activates son (Pol-III promoter).The 3rd type ribonucleic acid polymerase activates son, and for example U6 and H1 can be activated in the cell of all categories almost and make and organize the specific gene of mourning in silence not take place.Moreover, because the 3rd type rna transcription makes a mistake and does not carry out normal transcription pausing through the segment DNA (deoxyribonucleic acid) of being everlasting, and then produce ribonucleic acid greater than 25 base pairs, should long ribonucleic acid can produce the similar interferon cytotoxicity of not expecting (people (1999) J Mol Biol.286:745757 such as Gunnery; People such as Schramm (2002) Genes Dev 16:2593-2620).In addition, the 3rd type ribonucleic acid polymerase activates competitiveness that son and other carrier activate son (for example LTR is sub with the CMV activation) and conflicts and also can have problems.The The RNA interference system (Pol-III-directed RNAi system) of other the 3rd type ribonucleic acid polymerase guiding can produce the siRNA/shRNA of high concentration and then make own microRNA (miRNA) path supersaturation in the cell, thereby the miRNA that produces popularity suppresses and cell death people (2006) Nature 441:537-541 such as () Grimm.These shortcomings cause uses the The RNA interference system of the 3rd type ribonucleic acid polymerase guiding to produce obstruction aspect the skin care purposes.

In brief, in order to improve of stability, pointer specificity, the safety of The RNA interference technology, therefore use novel The RNA interference mechanism in an effective percentage, stable, safe gene engineering method and composition and be used to suppress specific gene and still wait to satisfy its demand at transfer system.

Summary of the invention

To translate that the exon of function (exon) forms be to introduce fully in the literature about having albumen according to the research (for example Messenger RNA (mRNA)) of genetic transcription, do not have albumen this moment and translate the intron of function (intron) then can be decomposed people (2003) RNA 9:607-617 such as () Nott.Is yet intron really a hereditary refuse and do not have any function? recently this misunderstanding is corrected (people (2003) Biochem Biophys Res Commun.310:754-760 such as Lin via the micro ribonucleic acid of observing intron (intronic microRNA); People such as Ying (2004) Gene 342:25-28; People such as Ying (2005) Biochem Biophys Res Commun.326:515-520).The micro ribonucleic acid of intron (intronic miRNA, be called for short intronic miRNA) be that a group is by the deutero-little sub-thread ribonucleic acid of intron, wherein intron can further be broken down into bob folder micro ribonucleic acid, usually the miRNA size is between 18 to 27 nucleotide, and can directly degrade it complementary specific gene Messenger RNA or suppress it the protein of complementary specific gene translate.In view of this, intronic miRNA and aforementioned siRNA/shRNA are similar, do not need the second type ribonucleic acid polymerase that they are handled but difference is siRNA/shRNA.In addition, because intron comprise usually many translate stop son being used for nonsense mediation degraded (nonsense-mediated dacay) (NMD) system recognize and most of ribonucleic acid is degraded fast and avoid being accumulated in cell and then toxigenicity (Zhang et al. (1994) Nature 372:809-812; Lewiset al. (2003) Proc.Natl.Acad.Sci.USA 100:189-192).After the NMD system handles, be retained and be transported in the Cytoplasm to stop according to the intron of estimating about montage of 10% to 30%, therefore hint that cell itself has original intronic miRNA (Clement et al. (1999) RNA 5:206-220) to its decomposition.The invention provides a kind of method that in human body cell, is used to bring out ribonucleic acid (RNA) montage (splicing) and acts on the gene silencing effect of (processing) dependency, comprise following steps: step a. is construction one a gene recombinaton nucleotide (recombinant nucleotide), wherein gene recombinaton nucleotide comprises the intron (intron) of the meson (intronic insert) of at least one intron with gene silencing effector (gene silencing effector), the gene silencing effector is connected by exon (exon), and intron can separate with exon and bring out gene silencing effect (RNA-mediated gene silencing) via ribonucleic acid, and exon connects and can be translated into protein; Step b. enters carrier (vector) for gene recombinaton nucleotide sanction is met (cloning); And the step c transfection carrier enters among many strains human cell, wherein the human cell produces the parent ribosomal ribonucleic acid (primary RNA) of a plurality of gene recombinaton nucleotide, this moment human cell's intravital spliceosome (humancells spliceosomes) montage intron and make and be located away from the parent ribosomal ribonucleic acid, the gene silencing effector has to mourn in silence and gene silencing effector sequence is complementary and homologous gene to such an extent as to produce.

The present invention also provides a kind of gene recombinaton nucleotide that is used to bring out the gene silencing of ribonucleic acid montage, comprise at least one intron (the present invention is also referred to as SpRNAi) with meson (intronic insert) of an intron, wherein this intron is connected by exon and can be handled by ribonucleic acid splicing system in the cell (cellular RNAsplicing machinery) and separate; And a plurality of exons (exon), wherein exon can connect and form a gene with specific function.As shown in Figure 1, intronic miRNA generative process is to rely on the clustering that second type is transcribed forerunner's Messenger RNA (pre-mRNA) that polymerase transcribes and intron spliceosome (spliceosome) in the cell, and this process is to occur in the nucleus near near (people (2004a) supra such as Lin chromatic; People such as Ghosh (2000) RNA 6:1325-1334).In eukaryotic cell, have translate protein function genetic transcription molecule (for example, Messenger RNA mRNA) by second type ribonucleic acid polymerase (Pol-II) manufacturing.Gene transcription produces pre-mRNA, it has four big major parts and comprises: five terminal-do not translate zone (5 '-untranslated region, UTR), have the exon (protein-coding exon) of albumen conversion ability, tool is not translated the intron (non-coding intron) of function and three ends-do not translate zone (3 '-untranslated region), and gene recombinaton nucleotide of the present invention comprises intron and exon.In general, five terminal-do not translate zone and three ends-do not translate the zone can be considered the intron that similar not tool is translated function; Wherein, the tool intron of translating function has not accounted for whole pioneer's Messenger RNA and has transcribed molecule overwhelming majority sequences; Wherein, each intron length range and need just be made pre-mRNA become ripe mRNA about about 30000 base pairs after the montage.This becomes the montage (splicing) that ripe mRNA process is called ribonucleic acid, and wherein this process is performed by spliceosome (spliceosome).After the ribonucleic acid montage, the ribonucleic acid fragment of some introns is further processed and forms miRNA, this miRNA can be via the The RNA interference mechanism specific gene of mourning in silence individually, effectively, at the same time, exon is can be engaged and form sophisticated Messenger RNA to translate synthetic to treat protein.

We have confirmed that the intron of vertebrates gene can produce sophisticated miRNA effectively, yet this generative process is and siRNA and different (Lin et al. (2003) supra of intergenic micro ribonucleic acid (intergenic miRNA); Lin et.al. (2005) Gene 356:32-38).In order to confirm its difference, Fig. 2 has shown that more original generative process and The RNA interference mechanism are siRNA, intergenic miRNA and intronicmiRNA.Wherein, siRNA is formed by bifilar complementary ribonucleic acid, this bifilar complementary ribonucleic acid is to activate that son institute is transcribed and further (RNaseIII endoribonuclease Dicer) is processed into 20 to 25 base pair sizes by the 3rd type endoribonuclease by the anti position of same dna substrate (DNA template).Be different from siRNA, intergenic miRNA (for example, lin-4 and let-7) generative process be to involve in not having pioneer's rna transcription molecule of functional transcription, wherein this pioneer's rna transcription molecule is to transcribe polymerase or the 3rd type is transcribed the polymerization of polymerase institute by second type.Yet, the micro ribonucleic acid of intron system by second type transcribe polymerase transcribe and disengage form one can be by the intron of montage.In nucleus, forerunner's micro ribonucleic acid system is formed as hair clip circular ring structure (stem-loop) by Drosha-like RNase (effect back and generate intergenic miRNA) or NMD system (effect back and generate intronic miRNA) montage, be referred to as forerunner's micro ribonucleic acid, and the effect that is transported in the Cytoplasm becomes sophisticated miRNA.Next, these three kinds of ribonucleic acid are all induced the complex of mourning in silence (RNA-induced silencing complex, RISC) merging with ribonucleic acid at last.Yet it is different paths (Tang, G. (2005) Trends Biochem Sci.30:106-114) for the path that siRNA and miRNA acted on that the 3rd type endoribonuclease is induced the complex of mourning in silence with ribonucleic acid.Therefore, the effect of miRNA is come more single-minded than siRNA, because miRNA has only the effect of sub-thread ribonucleic acid.In other words, siRNA mainly is catalysis mRNA degraded, and miRNA then can cause the degraded of specific mRNA, or the intercrescence that suppresses specific protein becomes.Because intronic miRNA path is regulated and control by system in many cells, the interior system of these cells comprises second type and transcribes polymerase system, ribonucleic acid splicing system and NMD system, therefore, to be considered in these three kinds of The RNA interference paths be full blast, single-minded, safe a kind of (Lin et al. (2008) Frontiers in Bioscience 13:2216-2230) to the gene silencing effect of intronicmiRNA.Simultaneously, the parent ribosomal ribonucleic acid of gene recombinaton nucleotide of the present invention (primary RNA) is produced by re-recording system, and re-recording system is the unified one of selecting from the second type re-recording system (Pol-II), the first type re-recording system (Pol-I) and virus transcription.

The present invention discloses the novel capabilities that is used for the gene regulation aspect of an intron, shown in Fig. 3 A and 3B, mechanism based on montage and the processing of intronic miRNA, preferred embodiment of the present invention is the intron (called after SpRNAi) that one second type ribonuclease gene representation system (Pol-II-mediated recombinant gene expression system) comprises an energy montage, and this SpRNAi can suppress specific gene via complementary series.This SpRNAi is derived from the formed pre-mRNA of the second type ribonucleic acid polymerase.After the montage, SpRNAi further is processed into sophisticated gene silencing agent (as shRNA and miRNA).After intron was removed, the gene recombinaton of exon (recombinant) was transcribed molecule and is connected and forms a sophisticated messenger rna molecule and further be translated into protein.Gene recombinaton nucleotide of the present invention further comprises at least one many restriction enzyme digestions position (multiplerestriction/cloning site) that is used for connecting the performance carrier of the rna transcription molecule that shows this gene recombinaton nucleotide; And a plurality of correct rna transcription molecules that are used for forming this gene recombinaton nucleotide transcribe and translate termination (transcription and translation terminationsites).Wherein this intron comprises meson (intronic insert), five terminal montage place and three end montages place, branch point district and many pyrimidines district of the intron with gene silencing effector.

As shown in Figure 3A, the neccessary composition of SpRNAi comprises several consistent nucleotide sequences, comprising five terminal montage place (5 '-splice site), a branch point district (branch point motif, BrP), the district of pyrimidine more than (apoly-pyrimidine tract) and one or three end montages place (3 '-splice site).In addition, pioneer's micro ribonucleic acid of a similar shRNA is to insert among the SpRNAi, and wherein this pioneer's micro ribonucleic acid is between five terminal montage place and branch point district.This SpRNAi can form (lariat) structure of lassoing when the ribonucleic acid montage.The U2 of spliceosome and U6 utricle nuclear ribonucleoprotein (snRNPs) are to participate in unclamping of lassoing to make with excision and form forerunner's micro ribonucleic acid.In addition, three ends of SpRNAi comprise to translate one more and stop the subarea, and this is can accurately carry out for the montage that makes intronic miRNA and NMD process.Translate when this more and to stop son (multiple translational stopcodon region) and find expression in the Messenger RNA in the Cytoplasm, more this translates and stops son and can transmit the message that activates the NMD system path any unusual rna structure is degraded in cell.Yet this shRNA of insertion SpRNAi and pre-miRNA can individually be retained to the Dicer montage and form sophisticated siRNA and miRNA.Add, in order in cell, to show, we utilize Drall restriction enzyme digestion position to connect a red fluorescent albumen (red fluorescent protein SpRNAi, RGFP) gene (from Heteractis crispa) and form the proteic SpRNAi of containing of a gene recombinaton of red fluorescent (SpRNAi-RGFFP) gene, the 208 nucleotide position of wherein red fluorescent protein gene is limited to understand the breakpoint that produces an AG-GN nucleotide after the enzyme Drall effect, and in the outstanding structure of three nucleotide of breakpoint two ends generation, these two ends can form five terminal montage place and three end montages place after SpRNAi embeds.Because the embedding of SpRNAi causes red fluorescent albumen normally to show, after but waiting the intron montage, this red fluorescent albumen just can recover normal performance, we can utilize the performance of red fluorescent albumen to measure the amount that shRNA/miRNA disengaged of judging intron, this moment red fluorescent albumen also can provide many exon montages to promote son (exonic splicing enhancer ESE) can help the correct and efficient of the montage of ribonucleic acid.

Among another embodiment shown in Fig. 3 B, the invention provides the genetic engineering method of an artificial synthetic rna montage of use and processing components, produce a non-natural gene, for example form synthetical SpRNAi (artificial intron) with montage place of synthetical five terminal, branch point district, many pyrimidines district and three end montages place, this synthetical SpRNAi comprises the rna structure of at least one insertion, and this structure can be the structure of the anti-ribonucleic acid of anticipating (antisense RNA) or shRNA or miRNA.Can (come the chemosynthesis manufacturing and connect these assemblies (for example meson of SpRNAi intron such as miR-tyr or intron such as mir-302) by DNA (deoxyribonucleic acid) synthesizer (DNA synthesizer) from Sigma-Genosys services (Woodlands, TX)).These assemblies also can be made and connect with restriction endonuclease on the other hand.But this SpRNAi is a direct transfection to be transfected into cell jointly and to be transcribed the polymerase effect by second type to cell or with different cytogenes.Through after ribonucleic acid montage and the Messenger RNA maturing, the rna structure that is inserted among the SpRNAi will can be transcribed molecule by tool inhibition specific gene via spliceosome in the cell and NMD systemic effect.At this moment, exon can normally connect the function that shows this gene to form sophisticated Messenger RNA, and for example reporter gene is translated or following several marker protein: red fluorescent albumen, green fluorescent albumen (green fluorescent protein), luciferin (luciferase), lactose gene regulation group (lac-Z) and their derivant.Existence about report/marker protein is useful for the position of understanding the existence of shRNA/miRNA molecule, especially is to recognize gene silencing effect aspect.

In addition, it is helpful that ripe Messenger RNA also may go to repair the gene that damages or lose for traditional gene therapy by the connection exon, also may be helpful for improving the specific gene performance.In other aspect, the invention provides novel composition (SpRNAi (artificial intron)) and method and produce the gene silencing molecule to be used for trigger cell via the ribonucleic acid montage and the treatment mechanism of intron, this molecule of mourning in silence is to suppress the specific gene function via anti-meaning gene knockout or The RNA interference effect.Gene silencing molecule derived from artificial intron SpRNAi comprises anti-meaning ribonucleic acid (antisense RNA), ribose ferment (ribozyme), short interim ribonucleic acid (shorttemporary RNA, stRNA), double stranded RNA, small interference ribonucleic acid (small interfering RNA, siRNA), the ribonucleic acid of small no codon (tiny non-coding RNA, tncRNA), bob folder ribonucleic acid (short hairpin RNA, shRNA), similar clip ribonucleic acid (hairpin-like RNA structure), micro ribonucleic acid (microRNA, miRNA) and the nucleic acid structure of the precursor relevant with The RNA interference.In the present invention, gene recombinaton nucleotide is one to have the gene of cell of intron own.By using these ribonucleic acid (recombinant nucleotide) with intron gene silencing reagent of deriving to have effect for mourning in silence of specific gene, and these recombinant nucleotides are to change from causing a disease to grow gene (pathogenic transgenes), viral gene (viralgenes), mammalian genes, jumping gene, mutant gene (mutant genes), oncogene (oncogenes), with disease association small ribonucleic acid gene (disease-related small RNA genes), protein coding gene is arranged and anyly have or do not have that albumen is translated relevant gene and the blended gene of above gene selects one.

The present invention uses the representation system (SpRNAi-RGFPexpression system) of transcribing the proteic SpRNAi of containing of polymerase of red fluorescent by this second type, we are successfully at human benign prostatic cancerous cell (prostatecancer LNCaP), produce ripe shRNA and miRNA in human cervical cancer (human cervical cancer HeLa) and the rat neural stem cell cell (rat neuronal stem HCN-A94-2 cell) (Lin et al. (2006a) Methods Mol Biol.342:295-312), as at Brachydanio rerio (zebrafish) with gene silencing effect, in chicken and mice (mouse) body (Lin et al. (2006b) Methods Mol Biol.342:321-334).We tested different forerunner micro ribonucleic acid structures with many human cell's strains at green fluorescent albumen and other cytogene Brachydanio rerio, and learnt that than the efficient gene micro ribonucleic acid of mourning in silence be between five terminal montage place and branch point district.Shown in Fig. 3 C, there is a significant gene silencing effect to betide the group (line4) of transfection at the proteic forerunner's micro ribonucleic acid of green fluorescent (anti-EGFP pre-miRNA), detected yet there is no any effect at other experimental group and matched group; These experimental grouies and matched group in regular turn (by left-to-right) be 1, blank vehicle group (blank vector control, Ctl).2, at forerunner's micro ribonucleic acid group of HIV (human immunodeficiency virus) albumen (HIV-p24).3, at anti-meaning green fluorescent albumen and do not have little clamping structure (antisense EGFP insertwithout the hairpin loop structure) group and 5, counter-rotating forerunner micro ribonucleic acid sequence set; This counter-rotating forerunner micro ribonucleic acid sequence set be complementary to fully anti-green fluorescent drive before proteic micro ribonucleic acid (anti-EGFP pre-miRNA, miR*).At gene, for example red fluorescent albumen and actin (actin) there is no the phenomenon of mourning in silence and take place in non-, and the The RNA interference that the micro ribonucleic acid of expression SpRNAi is got involved is a tool height specificity.In order to confirm the The RNA interference effect of ribonucleic acid montage in intron, we after tested these second different types transcribe the representation system of the proteic SpRNAi of containing of polymerase of red fluorescent, as Fig. 3 D show by left-to-right be the red fluorescent protein carrier group of 1. intronlesses; 2. the red fluorescent protein carrier group (vector expressing RGFP with an intronicanti-EGFP pre-miRNA insert) that has the anti-green fluorescent albumen forerunner micro ribonucleic acid of intron; 3. the red fluorescent protein carrier group that has the anti-green fluorescent albumen forerunner micro ribonucleic acid (5 end montage place defective) of intron.Show that by Northern bolting analysis of data sophisticated miRNA only forms out in the red fluorescent protein carrier group of the anti-green fluorescent albumen forerunner micro ribonucleic acid with intron, therefore confirming needs to form intronic miRNA by montage mechanism in the cell.

In addition, we have further determined the structural design of preferable forerunner's micro ribonucleic acid meson (pre-miRNA insert) to be used for bringing out best gene silencing effect (Lin et.al. (2005) Gene 356:32-38) via the RISC complex.The RISC complex is a pyrenoids ribosomal ribonucleic acid complex (protein-RNA complex), can cause specific gene to transcribe molecular degradation or suppress to translate via The RNA interference mechanism.For the formation of RISC complex, bifilar siRNA plays the part of important role, and this bifilar siRNA is different on function, and the RISC complex is that tendency is to wherein one reacts.Pattern based on siRNA, infer that miRNA and the double stranded RNA that ribonucleic acid complementary with it formed are also very important for the formation of RISC complex, if this viewpoint is true, the RISC complex is right for miRNA and ribonucleic acid complementary with it ability that should all can be degraded, yet find that according to experimental result the RISC complex has certain preference to miRNA.

Shown in Fig. 4 A, the mesons of two introns with different micro ribonucleic acids (miRNA) performance carriers (different intronic miRNA-inserted SpRNAi-RGFP expression vectors) are called after miRNA*-stemloop-miRNA[1 respectively] and miRNA-stemloop-miRNA*[2] (miRNA* be represent one can with the complementary miRNA of ripe miRNA sequence).These the two groups carriers with different micro ribonucleic acids comprise identical bifilar circular ring structure (stemloop structure), and this circular ring structure can be to the nucleotide sequence of EGFP gene the 280th to the 302nd effect of mourning in silence.These carriers of transfection (60ug each) entered the Brachydanio rerio rataria after 24 hours, and the micro ribonucleic acid (miRNA) that will have the effect potentiality of mourning in silence via the latex beads in the mirVana micro ribonucleic acid separation tubing string precipitates.After sequence alignment, having the micro ribonucleic acid (miRNA) of the effect of mourning in silence to be chosen out is to be miRNA-stemloop-miRNA*[2], shown in Fig. 4 A.Because ripe micro ribonucleic acid (miRNA) is only at transfection miRNA-stemloop-miRNA*[2] Brachydanio rerio in be found, so inference RISC complex tendency is and miRNA-stemloop-miRNA*[2] effect but not miRNA*-stemloop-miRNA[1].In this experiment, utilize the Brachydanio rerio (Tg (actin-GAL4:UAS-gfp)) that reaches via actin activation sublist to experimentize, this Brachydanio rerio can be expressed green fluorescent albumen always in various types of cells.Shown in Fig. 4 B, in this Brachydanio rerio transfection SpRNAi-RGFP carrier and express one and can work as and be the proteic red fluorescent albumen of pointer.The result observe gastrointestinal partly SpRNAi-RGFP the gene silencing effect a little less than, supposition is the stronger cause of ribonuclease RNase activity at this position.Among Fig. 4 C, west ink dot method (Western blotting) can detect miRNA*-stemloop-miRNA[1] and miRNA-stemloop-miRNA*[2] the performance of red fluorescent albumen, yet the proteic gene silencing of green fluorescent is only in transfection miRNA-stemloop-miRNA*[2] Brachydanio rerio be found, as Fig. 4 B.Because of miRNA*-stemloop-miRNA[1] and miRNA-stemloop-miRNA*[2] structure the spitting image of seemingly, so the circular ring structure (stem-loop) of forerunner's micro ribonucleic acid of intron (intronic pre-miRNA) may to form ripe micro ribonucleic acid (mature miRNA) relevant with the RISC complex.

Because the circular ring structure of above-mentioned forerunner's micro ribonucleic acid (pre-miRNA) is too big, performance for the SpRNAi-RGFP carrier may be not good, therefore adopt the annulus (5 '-(A/U) UCCAAGGGGG-3 ') of transfer RNA (tRNA) (tRNA) to replace originally bigger circular ring structure, this less annulus is proved to be and can quickens micro ribonucleic acid (miRNA) and be transported to outside the nuclear in examining.Recently, the present invention uses the pre-mir-302 circular ring structure (being SEQ.ID.NO.2 as SEQ.ID.NO.1 and 5 '-GCCTGGCTTAGC-3 ' as 5 '-GCTAAGCCAGGC-3 ') of an improvement can provide forerunner's micro ribonucleic acid (pre-miRNA) equally fast to transport and do not disturb the transportation of transfer RNA (tRNA) (tRNA).The pre-mir-302 circular ring structure of this improvement can be expressed at the embryonic stem cell camber, but the expression degree is lower in noble cells, therefore, with the pre-mir-302 circular ring structure of this improvement can't interference itself the ribonucleic acid path.

Insertion process about forerunner's micro ribonucleic acid (pre-miRNA), because the restriction enzyme digestion of this gene recombinaton SpRNAi-RGFP is positioned at five terminal and three ends are respectively PvuI and MluI, the meson of this original intron (intronicinsert) can be excised (for example, forerunner's micro ribonucleic acid of anti-green fluorescent albumen and anti-Tyrosinase (anti-Tyr)) by the replacement of forerunner's micro ribonucleic acid (pre-miRNA) of many other specificity genes.Be used for the antagonism or the different genes of mourning in silence by changing forerunner's micro ribonucleic acid meson (pre-miRNA insert) and transcribe molecule, the micro ribonucleic acid of this intron (intronic miRNA) generation system can be applied to a powerful tool that is used to bring out target gene silencing effect.In order to determine it is correct meson (insert) size, can by round pcr with SpRNAi-RGFP (10ng) utilize introduction (primer) (for example, 5 '-CTCGAGCATG GTGAGCGGCC TGCTGAA-3 ' and 5 '-TCTAGAAGTT GGCCTTCTCG GGCAGGT-3 ') 94 ℃ (1min.), 52 ℃ (1min.), and 70 ℃ (1min.) duplicate 25 cycle periods (cycles).The end-product of last PCR again via 2% agar gel (agarosegel) chromatography and utilize gel to reclaim test kit (gel extraction kit) (Qiagen, CA) purification and sequence are confirmed.

The present invention adopts the SpRNAi-RGFP representation system of one second type polymerase (Pol-II) and utilizes this system and develop and to be used for the novel cosmetic that skin is taken care of.In preferred embodiment, the invention provides a method of using non-abiogenous intron (intron), the method can make this intron be processed into shRNA and miRNA by Skin Cell and the gene silencing effect of bringing out skin pigment related gene and skin aging related gene.The method comprises several steps: a step provides 1) one can show the target gene and 2 that is subjected to matter at skin) one can be subjected to produce in the matter recombination of the forerunner's rna transcription molecule with intron (primary RNA transcript) of gene silencing effect at skin; The b step is handled this skin with this forerunner's rna transcription molecule (primary RNAtranscript) with intron and is subjected to matter and makes the target gene function be mourned in silence or suppress.This skin is subjected to mass-energy situation following table genes up to standard such as (ex vivo) in the in vitro tests or a junctor of (in vivo), ex vivo in (in vitro), the body outside organism.In some aspect, forerunner's micro ribonucleic acid that can produce the gene silencing effect is transcribed molecule (pre-miRNA) (as intronic insert) can be to specific demarcation gene for example, Tyrosinase (Tyr), hyaluronidase (Hyal), hyaluronicly had by matter such as adhesion molecule CD44, CD168, oncogene and NF-kappaB and other and chromogenesis and skin aging related gene to mourn in silence or depression effect.In other embodiments, forerunner's micro ribonucleic acid meson (pre-miRNA insert) (or the alleged gene recombinaton nucleotide of the present invention) can be incorporated the intron fragment of cytogene by genetic engineering method into.In general, the commentaries on classics that comprises similar plastid of this intron insertion technology grows that gene transfection (plasmid-like transgene transfection), homologous genes merge exchange (homologuous recombination), transposon transmission (transposon delivery), DNA (deoxyribonucleic acid) engages (DNA ligation), inserts to change and grow gene (transgene insertion), jumping gene chimeric (jumping gene integration) and retroviral infection (retroviral infection).

In another embodiment, recombination performance of the present invention is relevant with forerunner's Messenger RNA (pre-mRNA).This recombination is made up of exon (exon) and intron (intron).Exon can be connected after the ribonucleic acid montage and form a functional Messenger RNA (mRNA) and then be translated into albumen, simultaneously intron is disengaged nucleus and then is processed into and had the mourn in silence gene silencing effector (genesilencing effector) of function of specific gene, this gene silencing effector (gene silencing effector) comprises anti-meaning ribonucleic acid (antisense RNA), micro ribonucleic acid (miRNA), shRNA, siRNA, the predecessor of double stranded RNA and above ribonucleic acid (for example, pre-miRNA and piRNA).The gene silencing effector of these introns (intronic gene silencing effector) may comprise the circular ring structure (hairpin-like stem-loop structure) (being equal to similar little bob folder nucleotide) of a similar hair clip, this structure sequence be with come from 5 '-GCTAAGCCAGGC-3 ' (SEQ.ID.NO.1) or 5 '-GCCTGGCTTAGC-3 ' (SEQ.ID.NO.2), this sequence can promote the montage of correct ribonucleic acid molecule can promote that also this molecule is transported in the Cytoplasm by nucleus.And the meson of these introns (intronic insert) comprises complementation or the same sequence that comes from specific target gene.Between 1,500 base pairs of about 15 base pairs to of the meson of this homology or complementary intron (intronicinsert) sequence size, be preferably about 18 to 27 base pairs.The meson of these introns (intronic insert) is between the complementation or homology about 30% to 100% of similar bob folder nucleotide and target gene order, be preferably between 35% to 49%, the meson of this intron (intronic insert) is that an anti-meaning nucleotide comprises the complementary rate of sequence for the sequence 30% to 100% of the gene of desiring to mourn in silence, and the complementary rate scope of preferable sequence is 90% to 100%.

In addition, the five terminal of non-abiogenous intron comprises montage place (5 '-splicing site or, 5 ' clip), wherein this five terminal montage place is a nucleotide sequence and with coming from 5 '-GTAAGAGK-3 ' (SEQ.ID.NO.3) or GU (A/G) AGU sequence (for example, 5 '-GTAAGAGGAT-3 ', 5 '-GTAAGAGT-3 ', 5 '-GTAGAGT-3 ' or 5 '-GTAAGT-3 ').Three end montages place (3 '-splicing site or, 3 ' clip) sequence is with coming from GWKSCYRCAG (SEQ.ID.NO.4) or CT (A/G) A (C/T) NG sequence (for example, 5 '-GATATCCTGCAG-3 ', 5 '-GGCTGCAG-3 ', 5 '-CCACAG-3 ').In addition, one branch point (branch point) sequence is between five terminal and three end montages place, this branch point district is positioned at a nucleotide sequence with (SEQ.ID.NO.5) (for example coming from 5 '-TACTWAY-3 ', 5 '-TACTAAC-3 ' and 5 '-TACTTAT-3 '), this branch point district comprises a branch point, and this branch point is that (adenosine A) can form (lariat) structure of lassoing to a gland nucleoside.This many pyrimidines district (poly-pyrimidine tract) is between this branch point district and three end montages place in addition, wherein this many pyrimidines district one has the nucleotide sequence of many thymus pyrimidines (Thymine) and cytosine (Cytosine), and the nucleotide sequence of this many pyrimidines district (poly-pyrimidine tract) is with coming from 5 '-(TY) m (C/-) (T) nS (C/-)-3 ' (SEQ.ID.NO.6) and 5 '-(TC) nNCTAG (G/-)-3 ' (SEQ.ID.NO.7).Wherein, " m " with " n " be meant that the multiple complex sequences more than or equal to, the sequence number of preferable m are between one to three and the sequence number of n is between seven to 12."-", be meant no any nucleotide.All these introns are to connect nucleotide by some to connect, based on 37CFR1.822 regulation (TaiWan, China " nucleotide and amino acid sequence table record form " too), W is meant that adenine (adenine (A)) or thymus pyrimidine (thymine (T))/uracil (uracil (U)) .K is meant guanine (guanine (G)) or thymus pyrimidine (T)/uracil (U), S is meant cytosine (C) or guanine (G), Y is meant cytosine (C) or thymus pyrimidine (T)/uracil (U), and R is meant that adenine (A) or guanine (G) and N are meant adenine (A), cytosine (C), guanine (G) or thymus pyrimidine (T)/uracil (U) or other.

In another preferred embodiment of the present invention, the recombination composition is to be incorporated into the performance carrier to be used for gene transfection by reorganization.This performance carrier comprises plastid (plasmids), coemid (cosmids), phasmid (phagemids), yeast artificial chromosome (yeast artificial chromosomes), jumping gene (jumpinggenes), transposon (transposons), change and grow gene (transgene), counter-rotating seat (retrotransposons), retrovirus vector (retroviral vectors), slow virus carriers such as viral vector (lentiviral vectors), λ carrier (ambda vectors), adenovirus vector (adenoviral (AMV) vectors), gland relevant viral vector (adeno-associated viral (AAV) vectors), the viral hepatitis of modification (modified hepatitis-viral (HBV) vectors), relevant viral vector (cytomegalovirus (CMV)-associated viral vectors) the relevant mosaic virus (plant-associated mosaic virus) of cytomegalovirus with plant for example, tobacco mosaic virus (TMV) (tabacco mosaic virus) is (TMV), TOMV (tomato mosaic virus) (ToMV), cauliflower mosaic virus Cauliflowermosaic virus (CaMV) and flower of poplar mosaic virus (poplar mosaic virus) are (PopMV).In transfection SpRNAi-RGFP process, mourn in silence these carriers of intron of effector of performance different genes can be used to reach the effect of mourning in silence of single or multiple target gene.In other embodiments, a plurality of different genes effector of mourning in silence can produce and make numerous gene silencings from the shRNA of SpRNAi-RGFP meson (insert).The advantage of the method is to grow gene transfection or viral infection and the stable and secular relatively specific gene effect of mourning in silence is provided by use changeing.Wherein, the present invention can produce The RNA interference gene silencing molecule (RNAi-related gene silencing molecules) via montage of intracellular nucleic ribosomal ribonucleic acid and treatment mechanism, this molecule comprises little interference (smallinterfering) RNA, siRNA, micro ribonucleic acid (microRNA (miRNA)) and bob folder ribonucleic acid (small hairpin RNA (shRNA)).And activate son (promoter) by specific gene ribonucleic acid in the cell and controlled, for example, the second type ribonucleic acid polymerase activates son (Pol-II promoter) and activated viral.This activated viral comprise the huge virus of cell (cytomegalovirus) (CMV), the long stub area of retrovirus (retrovirus long-terminal region) (LTR), hepatitis virus B (hepatitis B virus (HBV)), adenovirus (adenovirus) (AMV), adeno-associated virus (adeno-associated virus) (AAV) and the relevant mosaic virus (plant-associated mosaic virus) of plant to wait the ribonucleic acid of virus to activate sub.For example, slow virus (lentiviral) LTR activates son can provide above 5x10 in each cell ⁵Forerunner's Messenger RNA of duplicating.Yet inhibition (repressor) that inserts a pair of medicaments insensitive can be controlled its performance speed (expression rate) at the front end of these activated viral.This suppresses son and can be suppressed by chemicals or antibiotic, and these antibiotic comprise G418, tetracycline (tetracycline), neomycin (neomycin), Ampicillin (ampicillin), health mycin (kanamycin) and above-mentioned antibiotic derivant.

Except novel skin nursing purposes, potentiality of the present invention is used and is comprised skin treating, for example by mourning in silence or suppressing the research of disease related gene, the epidermal vaccine with antiviral gene, the external treatment that is used for the relevant pathogenic bacterium of microorganism, skin message conducting path and in conjunction with the method for quickly detecting of biochip gene function etc.The present invention also can be as the instrument of a research gene function on Skin Cell or as being used for improving the composition and the method for skin condition, and this skin condition comprises normally, animal or human's class skin of morbid state, cancerization, viral infection, infected by microbes, physiological decease, genetic mutation.

The invention provides a novel method of in cell, producing intron ribonucleic acid (intronic RNA), be preferably and can produce ripe siRNA, miRNA and shRNA, these ribonucleic acid can bring out The RNA interference gene silencing effect (RNAi/PTGS-associated gene silencing effects).Wherein, cell can act on the meson (intronic insert) of intron of the present invention and produce single or multiple gene silencing effector, for example, the proteic forerunner's micro ribonucleic acid of anti-green fluorescent (pre-miRNA) is shown on the Brachydanio rerio by allosome, as shown in Figure 3A, form ripe micro ribonucleic acid (mir-EGFP 282/300 and mir-EGFP280-302) and produce two, this is hinting that the meson (insert) of single SpRNAi has generation and surpasses a kind of gene silencing effector (gene-silencing effectors).And different montage (spliced RNA effectors) can produce and just anticipates (sense) or anti-meaning (antisense) configuration.In some example, can be formed double stranded RNA with some target genetic transcription molecular hybridizations and then drive the The RNA interference effect by the ribonucleic acid of montage.Simultaneously, siRNA, miRNA and shRNA express on performance carrier of the present invention and can alleviate the doubt that ribonucleic acid is degraded fast.

In different embodiment, the present invention further provides the method for the anti-meaning micro ribonucleic acid (antisense miRNA) of the complementary micro ribonucleic acid of just anticipating of a generation, the method can suppress target micro ribonucleic acid (targetmiRNA) in Skin Cell.Because micro ribonucleic acid (miRNA) can carry out the The RNA interference effect of mourning in silence, and anti-meaning (antisense) miRNA has just the anticipating gene silencing effect of micro ribonucleic acid (sense miRNA) of neutralization, also therefore can make the gene restore funcitons that is suppressed by micro ribonucleic acid originally.Engage fully unlike the bifilar of siRNA, anti-meaning (antisense) miRNA engages with the partial sequence of just anticipate (sense miRNA) and can produce misconnection zone (mismatchedbase-paired region), and this zone can be by ribonuclease excision degraded.And this misconnection zone may be positioned at the centre position of circle ring area (stem-arm) or be positioned at the circular ring structure of forerunner's micro ribonucleic acid (pre-miRNA).In addition, on siRNA, this misconnection zone has been proved gene silencing effect (Holen et al. (2002) the Nucleic Acid Res.30:1757-1766 that can suppress siRNA; Krol et al. (2004) J.Biol.Chem.279:42230-42239).This phenomenon may be relevant with intron enhancement phenomenon (intron-mediatedenhancement phenomena in plant) in the plant, according to the research of previous Arabic mustard, the meson of intron (intronic insert) after transcribe and play the part of important role in the modification and the performance of specific gene is improved or (Rose A.B. (2002) the RNA 8:1444-1451 that descends; Stoutjesdijk et al. (2002) Plant Physiol.129:1723-1730).Intron is promoted phenomenon can be used for suppressing the micro ribonucleic acid (miRNA) of specific gene to recover twice or to arrive the target specific gene performance above ten times by suppressing.

Description of drawings

Fig. 1 is micro ribonucleic acid (intronic mircoRNA, miRNA) generting machanism of intron in the cell of the present invention.

Fig. 2 is for showing siRNA, exonic (intergenic) microRNA and intronic microRNA path mechanism.

Fig. 3 A is the SpRNAi-RGFP recombination constituent (Fig. 3 A) of preferred embodiment of the present invention and principle (Fig. 3 B) thereof the artificial micro ribonucleic acid with the micro ribonucleic acid (intronic miRNA) that produces an imitation intron to 3D.Cell build-in test SpRNAi-RGFP performance carrier directly suppresses green fluorescent albumen and is presented at the green fluorescent protein gene the 85% gene knockout effect of surpassing is arranged in Brachydanio rerio, and is confirmed by Western engram analysis (blot analysis).And micro ribonucleic acid (intronic miRNA) and montage predecessor thereof with the proteic intron of green fluorescent of mourning in silence can and be observed behind Northern engram analysis (blot analysis) via 1% formaldehyde-agarose gel (formaldhyde agarose gel) electrophoresis.

Fig. 4 A to 4C show of the present invention in the SpRNAi-RGFP structure ribonucleic acid meson (intronic RNA insert) of the intron of different designs form and in Brachydanio rerio, produce efficiently the green fluorescent albumen effect of mourning in silence to be used for efficient micro ribonucleic acid, confirmed between 5 '-miRNA*-stemloop-miRNA-3 ' [1] and 5 '-miRNA-stemloop-miRNA*-3 ' [2] hairpin RNA in the asymmetric preference of RISC complex (Fig. 4 A).The only discovery in transfection forerunner micro ribonucleic acid structure [2] of in vivo gene silencing, rather than in transfection structure [1], be found, and confirm its preference.Red because of presenting after green fluorescent albumen and the proteic colour superimposition of red fluorescent greater than deep orange green as that figure is manifested, therefore the proteic amount of green fluorescent be far below red fluorescent albumen in forerunner's micro ribonucleic acid structure [2] transfection group, this moment, the red fluorescent albumen of pointer of carrier then was (Fig. 4 B) on average expressively.Analyze the proteic amount of green fluorescent with Western trace (blot), confirm in transfection forerunner micro ribonucleic acid structural group [2], to have tangible gene silencing effect (Fig. 4 C).Other experimental group for example only the carrier (Vctr) of liposome (Liposome only), no any meson and siRNA (siR) group all do not have the gene silencing effect and occur.

Fig. 5 can utilize the gene silencing effect that via mir-434 the Tyrosinase gene is resulted from mouse skin removed pigment in the cell for of the present invention.

Fig. 6 produces a narrow spectrum Tyrosinase gene silencing effect for artificial miR-Tyr meson of the present invention (insert) shows mouse skin.

Fig. 7 A upward surpasses 50% Tyrosinase gene silencing effect to 7C for the present invention utilizes miR-Tyr meson (insert) at human arm skin (Fig. 7 A) and original (primary) skin cultured cell (Fig. 7 B and C).

Fig. 8 A is gene chip analysis (the Affymetrix human GeneChip U133A﹠amp of Skin Cell strain of forerunner's micro ribonucleic acid (pre-miRNA) transfection of artificial anti-Tyrosinase of the present invention to 8C; B CA), shows that the present invention is that the specificity gene silencing effector also higher than general miRNA (genesilencing effector) is as mir-434.

The specific embodiment

In order clearly to describe the present invention, adopt following particular terms in the literary composition.Yet the present invention is not limited only to these particular terms.It is interpreted as each element-specific and all comprises all technical equipollents, and it can reach close purpose by similar means.

" nucleotide (Nucleotide) " speech means a monomolecular DNA (deoxyribonucleic acid) (deoxyribonucleotide) (DNA) or (RNA) molecule of ribonucleic acid (ribonucleotide) at this, and these molecules comprise pentose (pentose), phosphate radical (phosphate) and base (nitrogenous heterocyclicbase).This base is to be connected into a nuclear (nucleoside) via glycosidic bond (glycosidic bond) and pentose, and this nuclear is connected with phosphate radical with the position of five terminal with pentose three ends and is nucleotide.

" oligonucleotide (Oligonucleotide) " speech means a part at this and comprises plural DNA or RNA, is preferably above three.And its accurate dimensions is to depend on its best-of-breed functionality state.Oligonucleotide is to reach in the blended mode of upper type with chemosynthesis, dna replication dna, reverse transcription.

" nucleic acid (Nucleic Acid) " speech can be sub-thread or bifilar at this polymer that means nucleotide (Nucleotide).

It is different with A, T, C, G or U but similar and can replace normal oligodeoxynucleotide in nucleic acid that " nucleotide homologue (Nucleotide Analog) " speech means the structure of a purine (purine) or pyrimidine (pyrimidine) nucleotide at this.

" gene (Gene) " speech has the password that wins peptide (protein) RNA or in this sequence that means a nucleic acid more, and this gene is RNA or DNA.

" base pair (Base Pair (bp)) " speech means the pairing of A and T or C and G in the distrand DNA molecule at this.In RNA, U replaces T and A pairing.In general base pair is connected with hydrogen bond (hydrogen bonding).

" forerunner's Messenger RNA (Precursor messenger RNA (pre-mRNA)) " speech means the original rna transcription molecule (primary ribo-nucleotide transcripts) of a gene that is produced by the poly-ribozyme (Pol-II) of the second type RNA at this in eukaryotic cell, this process is for transcribing (transcription), and forerunner's Messenger RNA sequence comprises the non-zone (5 '-end untranslated region) of translating of five terminal, the non-zone (3 '-end untranslated region) of translating of three ends, exon (exon) and intron (intron).

" intron (intron) " speech means the genetic transcription molecule of a part at this, and this molecule has non-password of translating the zone.

" exon (exon) " speech means the genetic transcription molecule of a part at this, and this molecule has the password of translating the zone.

" Messenger RNA (mRNA) " speech means in intron cell montage mechanism at this and removes the exon of back forerunner's Messenger RNA and combine and have the mRNA that albumen is translated password.

" complementary DNA (cDNA) (cDNA) " speech this mean one with the complementary single-stranded DNA of mRNA sequence, this cDNA does not have any intron sequences.

" nucleic acid (sense) of just anticipating " speech means sequence order and its composition same come from this mRNA identical with mRNA of a nucleic acid molecules at this.This nucleic acid configuration of just anticipating is to be denoted as "+", " s " or " sense ".

" anti-sense nucleic acid (antisense) " speech means the sequence order of a nucleic acid molecules and the meaning of this gene (sense) complementation at this.This anti-sense nucleic acid configuration is to be denoted as "-", " a " or " antisense ", for example " aDNA " or " aRNA ".

What " five terminal (5 '-end) " speech meant end points meaning that a continuous nucleotide is not connected with No. three carbon locations of next nucleotide with phosphodiester bond (phosphodiester bond) in the position of No. five carbon of pentose at this is five terminal.

What " three ends (3 '-end) " speech meant end points meaning that a continuous nucleotide is not connected with No. five carbon locations of next nucleotide with phosphodiester bond (phosphodiester bond) in the position of No. three carbon of pentose at this is three ends.

" template (Template) " speech means a nucleic acid molecules that can be duplicated by ribonucleic acid polymerase at this, according to ribonucleic acid polymerase, template be can be sub-thread, bifilar, part is bifilar.Synthetic replicating nucleic acid is complementary to masterplate, and one in wherein bifilar at least is complementary or part is complementary.

" nucleic acid-templated (Nucleic Acid Template) " speech this mean a distrand DNA, bifilar RNA, DNA-RNA are hybridized bifilar or single-stranded DNA or single-stranded RNA.

It is consistent with original series that " consistent (Conserved) " speech means a nucleotide sequence at this.

" complementary (Complemetary or complementarity or complementation) " speech means complementary nucleotide at this, for example sequence " AGT " be to be complementary to sequence " TCA " or " TCU ".Complementation can be between two gangs of DNA, between DNA and the RNA, between two gangs of RNA.Complementation can be partially or completely.The part complementation is to have only some nucleotide base pairing; Yet complementation then is that the complete nucleotide base is all matched fully.And complementary degree has material impact for the efficient of two bursts of hybridization.

" homology (homologous or homology) " speech means the sequence similarity of nucleotide sequence and a gene or mRNA at this.One nucleotide sequence may be partially or completely and the sequence complementation of a specific gene or mRNA, and for example homology may represent also that a certain proportion of similar nucleotide surpasses whole nucleotide quantity.

" complementary base (Complemetary base) " speech means when DNA or RNA form bifilar configuration at this, the pairing of nucleotide.

" complementary nucleotide sequence (Complemetary Nucleotide Sequence) " speech means enough single-minded another strand that be complementary to of nucleotide sequence of a single-stranded RNA or DNA at this, wherein is to form complementation with hydrogen bond strength.

" hybridization (Hybirdize and Hybridization) " speech means nucleotide sequence at this and forms bifilar situation via base complementrity.And hybridization can provide archaeal dna polymerase to carry out the dna replication dna initial step after introduction (primer) carries out complementation to specific nucleic acid sequence sometimes.

" The RNA interference (RNA interference (RNAi)) " speech means in eukaryotic cell one via RNA small fragment (for example, micro ribonucleic acid (miRNA) and siRNA) the activated back open gene mechanism of mourning in silence at this.These RNA small fragments can and then disturb the interior specific gene of cell complementary with it to transcribe molecule as the gene silencing effector.

" micro ribonucleic acid (MicroRNA (miRNA)) " speech means the sub-thread ribonucleic acid (RNA) that can transcribe complementary element with specific gene at this.MiRNA is normally between 17 to 27 nucleotide, and can translate according to Messenger RNA in the complementary directly degradation of cell between miRNA and the mRNA or the albumen that suppresses specific gene.The miRNA of cell own can find in all eukaryotic cells, as the important mechanisms of a defence viral infection.

" forerunner's micro ribonucleic acid (Pre-miRNA) " speech means the sub-thread ribonucleic acid with bob clamping structure at this, and this Pre-miRNA comprises circular ring structure zone (stem-arm and stem-loop region) and is used for producing a gene silencing effector (gene silencing effector) with RNaseIII restriction endonuclease reciprocal action.This Pre-miRNA can transcribe molecule with specific gene and form complementary wholly or in part.

" bob folder ribonucleic acid (small or short hairpin RNA (shRNA)) " speech means the sub-thread ribonucleic acid with a part or complete complementary circular ring structure sequence at this.Many micro ribonucleic acids are to derive from the shRNA predecessor, and this shRNA predecessor is called forerunner's micro ribonucleic acid (pre-miRNA) again.

" carrier (Vector) " speech means one at this to have and carries to show the recombinant nucleic acid molecules of specific hereditary material.In general, this recombinant nucleic acid molecules be connect into one ring-like.This carrier is to duplicate automatically in cell.Wherein a kind of carrier of form be clutch dyeing corpusculum (episome) can be outside chromosome self replication.Wherein have performance gene protein ability person and be performance carrier (expression vector).

" cistron (Cistron) " speech means a nucleotide sequence at this and has the amino acid conversion ability, and respectively there is DNA performance control zone on the sequence and lower end.

" activate son (Promoter) " speech this mean one can be aggregated the enzyme identification nucleic acid and can activated transcription.

" antibody (Antibody) " speech means one at this to have and interactive peptide or the protein moleculars of winning of a specific amido acid sequence more.

The invention relates to a kind of method and composition, this method improves the Skin Cell inherited character by the ribonucleic acid of intron.This improvement is to produce by the gene silencing of intron mechanism, focus on this mechanism and be by one can montage intron (called after SpRNAi) bring out.The meson that this SpRNAi can carry intron is via the mechanism of the montage of ribonucleic acid and processing and disengage the meson of this intron and suppress specific gene via the RNAi/PTGS effect of mourning in silence with complimentary fashion.In general, shown in Fig. 4 to 7, after recombination utilized chemical mode or liposome (liposome) transfection or viral infection to enter Skin Cell, the meson of this intron (intronic insert) was transcribed via the second type ribonuclease and by behind the machining function of the montage of spliceosome (spliceosome) and NMD system handles and disengage.After disengaging, the meson of the artificial intron of SpRNAi (intronic insert) forms a lasso ribonucleic acid (lariat RNA) and further be processed into gene silencing effector (gene silencingeffectors), comprises ribonucleic acid (short-temporary RNA (stRNA)) when of short duration, anti-meaning ribonucleic acid (antisense RNA), siRNA (siRNA), bob folder ribonucleic acid (shRNA), micro ribonucleic acid (miRNA), ribose ferment ribonucleic acid (ribozyme RNA), the predecessor of Piwi-interacting RNA (piRNA) and these ribonucleic acid and derivant and the blended ribonucleic acid of above ribonucleic acid select one.Afterwards, will degrade via the RISC complex their target genetic transcription molecule or the albumen that suppresses the target gene of these gene silencing effectors is translated.

For pre-mRNA montage and treatment mechanism in the emulation cell, we use the interior spliceosome of cell and NMD system catalysis intron removes and treatment S pRNAi-RGFP representation system.Disengaged with further formation gene silencing effector (gene silencing effector) via SpRNAi after the spliceosome effect in a succession of cell.The method of spliceosome system identification being incorporated into SpRNAi is respectively at embodiment one and two exposure.

Second type that design, construction and assessment can produce the effector of mourning in silence of intron is transcribed the red fluorescent of polymerase The representation system of albumen (SpRNAi-RGFP)

The proteic performance carrier system of red fluorescent (SpRNAi-RGFP expression system) that the present invention uses second type to transcribe polymerase (Pol-II) has been proved effect, this SpRNAi-RGFP representation system has the SpRNAi that can produce gene silencing effector (gene silencing effector), shown in Fig. 3 A and 3B, these effectors of mourning in silence have miRNA and shRNA.These effectors of mourning in silence can be via being disengaged behind spliceosome in a succession of cell and the NMD systemic effect.Yet in other embodiments, via same spirit and principle, ribosome precursor (ribosomal precursor) RNA (pre-rRNA) that is transcribed by the first type ribonucleic acid polymerase also can produce the identical gene silencing effector of function (gene silencing effector).The rna transcription molecule (as the parent ribosomal ribonucleic acid of gene recombinaton nucleotide) that this external enwergy is used for producing SpRNAi comprises the derivant and the predecessor of Messenger RNA (mRNA), heterogeneous nuclear ribonucleic acid (hnRNA), rRNA (rRNA), transfer RNA (tRNA) tRNA, snoRNA, utricle nuclear ribonucleic acid snRNA, forerunner's micro ribonucleic acid (pre-miRNA), viral ribonucleic acid viralRNA and above ribonucleic acid.

Shown in embodiment 1 to 2 and Fig. 3 A, utilize Drall restriction enzyme digestion position to connect a red fluorescent albumen (red fluorescent protein SpRNAi, RGFP) gene (from Heteractis crispa) and form the proteic SpRNAi of containing of a gene recombinaton of red fluorescent (SpRNAi-RGFP) gene structure, because the embedding of SpRNAi causes red fluorescent albumen normally to show, after but waiting intron by montage, this red fluorescent albumen just can recover normal performance, and the bob folder amount that ribonucleic acid (shRNA)/micro ribonucleic acid (miRNA) is disengaged of judging intron is measured in the red fluorescent albumen performance that we can utilize red fluorescent wavelength 570nm to be detected.SpRNAi-RGFP makes up the architectural characteristic that is based on pre-mRNA, and SpRNAi (artificial intron) is comprised five terminal montage place, branch point district, many pyrimidines district (being used for and the spliceosome reciprocal action) and three end montages place by the major part of spliceosome identification.Shown in Fig. 3 B, the SpRNAi (artificial intron) with the effector of mourning in silence of the present invention comprises meson, branch point district, many pyrimidines district and three end montages place of five terminal montage place, intron.In addition, some to translate terminator be three end montages place that are positioned near SpRNAi.

In general, five terminal montage place is a nucleotide sequence, this sequence homology in 5 '-GTAAGAGK-3 ' (SEQ.ID.NO.3) or GU (A/G) AGU sequence (for example, 5 '-GTAAGAGGAT-3 ', 5 '-GTAAGAGT-3 ', 5 '-GTAGAGT-3 ' and 5 '-GTAAGT-3 ').Three end montages place are with coming from GWKSCYRCAG (SEQ.ID.NO.4) or CT (A/G) A (C/T) NG sequence (for example, 5 '-GATATCCTGCAG-3 ', 5 '-GGCTGCAG-3 ', 5 '-CCACAG-3 ').In addition, one branch point sequence is to be positioned at five terminal and three end montages place, this branch point district is positioned at a nucleotide sequence with (SEQ.ID.NO.5) (for example coming from 5 '-TACTWAY-3 ', 5 '-TACTAAC-3 ' and 5 '-TACTTAT-3 '), this branch point district comprises a branch point, and this branch point is that (adenosine A) can form (lariat) structure of lassoing to a gland nucleoside.This many pyrimidines district is positioned between this branch point district and three end montages place in addition, wherein this many pyrimidines district one has the nucleotide sequence of many thymus pyrimidines (Thymine) and cytosine (Cytosine), and the nucleotide sequence in this many pyrimidines district is with coming from 5 '-(TY) m (C/-) (T) nS (C/-)-3 ' (SEQ.ID.NO.6) and 5 '-(TC) nNCTAG (G/-)-3 ' (SEQ.ID.NO.7).Wherein, " m " with " n " be meant that the multiple complex sequences more than or equal to, the sequence number of preferable m are between one to three and the sequence number of n is between seven to 12."-" is meant no any nucleotide.All these introns are to connect nucleotide by some to connect, stipulate based on 37CFR1.822, W is meant adenine (adenine (A)) or thymus pyrimidine (thymine (T))/uracil (uracil (U)), K is meant guanine (guanine (G)) or thymus pyrimidine/uracil, S is meant cytosine or guanine, Y is meant cytosine or thymus pyrimidine/uracil, and R is meant that adenine or guanine and N are meant adenine, cytosine, guanine or thymus pyrimidine/uracil and other.For whole spliceosome identification zones, thymic acid (deoxythymidine) is urinated nucleic acid (uridine) and is replaced.

For the meson (insert) of determining SpRNAi position at the meson of intron, determined by the restriction enzyme digestion position that by this position of what wherein restriction endonuclease is from AatII, AccI, AflII/III, AgeI, ApaI/LI, AseI, Asp718I, BamHI, BbeI, BclI/II, BglII, BsmI, Bsp120I, BspHI/LU11I/120I, BsrI/BI/GI, BssHII/SI, BstBI/U1/XI, ClaI, Csp6I, DpnI, DraI/II, EagI, Ecl136II, EcoRI/RII/47III, EheI, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI/II, KasI, KpnI, MaeII/III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, NdeI, NgoMI, NotI, NruI, NsiI, PmII, Ppu10I, PstI, PvuI/II, RsaI, SacI/II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiI, TaqI, XbaI, XhoI, XmaI and the blended restriction endonuclease of above restriction endonuclease select one.Wherein the meson of these introns (intronic insert) is a dna profiling, and this template comprises the ribonucleic acid of lassoing, (short-temporary) RNA (stRNA), the anti-ribonucleic acid of anticipating (antisense RNA), siRNA (siRNA), bob folder ribonucleic acid (shRNA), micro ribonucleic acid (miRNA), Piwi-interacting RNA (piRNA), ribose ferment and the predecessor of these ribonucleic acid and the mixture of above-mentioned ribonucleic acid when of short duration.

The convenience that transmits for gene activates to bring out specific cells, preferable gene recombinaton SpRNAi of the present invention is merged in the performance carrier, and this carrier is to be selected from plastid (plasmid), coemid (cosmid), phasmid (phagmid), yeast artificial chromosome (yeast artificial chromosome), to change and grow gene (transgene), transposon (transposon), counter-rotating seat (retrotransposon), jumping gene, viral vector and the blended carrier of above carrier.This carrier enters specific cells or tissue by transfection method, and these transfection methods comprise liposome transfection method (liposomal transfection), chemistry infection protocol (chemical transfection), deoxyribonucleic engages (DNA ligation), insert to change and grow gene, chemistry changes shape method (chemical transformation), electroporation (electroporation), homologous genes merges exchange (homologous recombination), transposon TRANSFER METHOD (transposon insertion), jumping gene infection protocol (jumping genetransfection), viral infection method (viral infection), viroid infects in counter-rotating, microinjection (micro-injection), particle bombardment (gene-gun penetration) and the blended method of above method.In addition, this carrier further comprises activation of at least one virus or the second type ribonucleic acid polymerase (Pol-II) with performance SpRNAi-RGFP, one Kozak rotaring intertranslating start place (Kozak consensus translation initiationsite) is to be increased in the efficient of translating in the eukaryotic cell, the polyadenylation signal of one multiple SV40 (polyadenylation signals) is at the downstream area of SpRNAi-RGFP, one pUC replication initiation (originof replication), at least two restriction enzyme digestion positions are used for and close SpRNAi-RGFP and go into carrier, one any (optional) SV40 replication initiation in mammalian cell is used to express SV40 T antigen, one has the SV40 early stage (early) that shows at least one antiviral antibiotic gene (antibiotic resistance gene) in prokaryotic cell activates son, the position that above assembly is incorporated the SpRNAi-RGFP carrier into is determined that by the restriction enzyme digestion position wherein restriction endonuclease is from AatII, AccI, AflII/III, AgeI, ApaI/LI, AseI, Asp718I, BamHI, BbeI, BclI/II, BglII, BsmI, Bsp120I, BspHI/LU11I/120I, BsrI/BI/GI, BssHII/SI, BstBI/U1/XI, ClaI, Csp6I, DpnI, DraI/II, EagI, Ecl136II, EcoRI/RII/47III, EheI, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI/II, KasI, KpnI, MaeII/III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, NdeI, NgoMI, NotI, NruI, NsiI, PmlI, Ppu10I, PstI, PvuI/II, RsaI, SacI/II, SalI Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiI, TaqI, XbaI, XhoI, XmaI and the blended restriction endonuclease of above restriction endonuclease select one.Wherein, the expression of gene of this antiviral antibiotic is the pointer that is used to screen specific cells as, and this antiviral antibiotic gene is can resist to comprise benzylpenicillin (penicillin G), Ampicillin (ampicillin), neomycin (neomycin), paromomycin (paromycin), health mycin (kanamycin), streptomycin (streptomycin), erythromycin (erythromycin), Spike mycin (spectromycin), fiery suddenly mycin (phophomycin), tetracycline (tetracycline), rifamycin (rifapicin), amphotericin B (amphotericin B), be good for his mycin (gentamycin), chloromycetin (chloramphenicol), cephamycin (cephalothin), taimycin (tylosin), G418 and the blended antibiotic of above antibiotic.

This SpRNAi-RGFP carrier is crossed and can be suppressed the green fluorescent protein expression in the Brachydanio rerio body build-in test of (Tg (actin-GAL4:UAS-gfp)) strain, shown in embodiment three and Fig. 3 C, the proteic miRNA of anti-green fluorescent demonstrates very significant green fluorescent albumen via liposome transfection SpRNAi-RGFP group (line4) and suppresses phenomenon (suppressing greater than 80% albumen approximately), is detected yet there is no any effect at other experimental group and matched group; These experimental grouies and matched group in regular turn (by left-to-right) be 1, blank vehicle group (blank vector control, Ctl).2, organize at forerunner's micro ribonucleic acid (pre-miRNA) of HIV (human immunodeficiency virus) albumen (HIV-p24).3, at anti-meaning green fluorescent albumen and do not have little clamping structure (antisense EGFP insert without the hairpin loop structure) group and 5, counter-rotating forerunner micro ribonucleic acid sequence set; This counter-rotating forerunner micro ribonucleic acid sequence set be complementary to fully the proteic forerunner's micro ribonucleic acid of anti-green fluorescent (anti-EGFP pre-miRNA, miR*).At gene, for example red fluorescent albumen and actin (actin) there is no the phenomenon of mourning in silence and take place in non-, and the The RNA interference that the micro ribonucleic acid of expression SpRNAi is got involved is a tool height specificity.Show that as Fig. 3 D Northern trace (bolting) analysis of data shows that sophisticated micro ribonucleic acid (miRNA) only forms out (middle secondary series) in the red fluorescent protein carrier group of the anti-green fluorescent albumen forerunner micro ribonucleic acid with intron, this phenomenon does not manifest (left side first row) in the red fluorescent protein groups that does not have intron, this moment, red fluorescent albumen was can normally be connected to form a ripe ribonucleic acid to express.

Micro ribonucleic acid (miRNA) structure of assessment intron is in intracellular efficient

Experiment has before determined that the micro ribonucleic acid (intronic miRNA) of intron can produce the gene silencing effect in cell.For the further efficient of the gene silencing effect of the micro ribonucleic acid of assessment intron and the structure that determines preferable micro ribonucleic acid, therefore select Brachydanio rerio as experiment material, further understand the RISC complex for which kind of micro ribonucleic acid structure preference to some extent.

In experiment, find the combination of circular ring structure (stem-loop) decision RISC complex with the miRNA of pre-miRNA, the complex different (Lin et.al. (2005) Gene 356:32-38) that one of this combination RISC complex and siRNA-RISC make up.SiRNA bifilar played the part of important role in the siRNA-RISC complex, bifilar siRNA has only one to be incorporated in the RISC complex, and this phenomenon is because the dynamic thermal stability of the base pair of the bifilar five terminal of siRNA determines.Based on this siRNA pattern, the bifilar complementation of miRNA miRNA complementary with it (claiming miRNA* again) is considered to form a critical step of RISC complex.If this pattern is correct, specific one the phenomenon of no any preference is occurred, yet experiment finds that the circular ring structure of intronic pre-miRNA plays an important role for the composition of RISC complex.

In embodiment 1 and 2, utilize SpRNAi-RGFP carrier and the miRNA*-stemloop-miRNA[1 of performance anti-EGFP miRNA] and miRNA-stemloop-miRNA*[2] meson (intronic insert) the performance carrier of intron of (the miRNA* representative is and the complementary micro ribonucleic acid of ripe micro ribonucleic acid sequence) these two different micro ribonucleic acids (miRNA), this different manifestations meson is synthetic and indivedual the insertion in the preprepared SpRNAi-RGFP carriers in the DNA synthesis machine.These two groups of carriers comprise identical bifilar circular ring structure (stem-loop structure), and this circular ring structure can be to the nucleotide sequence of EGFP gene the 280th to the 302nd effect of mourning in silence.Because the meson of intron (intronic insert) is connected by PvuI and MluI restriction enzyme digestion position, so this meson can be replaced by many other different anti-gene mesons (for example, anti-EGFP, anti-Tyr or anti-Hyal) easily.By this application-specific, the instrument that the micro ribonucleic acid of this intron (intronic insert) representation system can provide a miRNA heredity that develops in cell to use.

In order to determine which kind of pre-miRNA structure preference to some extent, (TX) latex bead in (latex beads) micro ribonucleic acid that will have effect potentiality of mourning in silence in the Brachydanio rerio precipitates for Ambion, Austin to separate tubing string via the mirVana micro ribonucleic acid.This miR-EGFP (280-302) is proved can be to the nucleotide sequence of EGFP gene the 280th to the 302nd effect of mourning in silence, shown in Fig. 4 A.Because this effective miRNA is only at the miRNA-stemloop-miRNA*[2 of transfection Brachydanio rerio] be found effective, therefore infer that the RISC complex is to miRNA-stemloop-miRNA*[2] structural preference arranged, shown in Fig. 4 B, utilization activates Brachydanio rerio (Tg (actin-GAL4:UAS-gfp)) that sublist reaches via actin (beta-actin) and experimentizes to represent the relation of target gene silencing effect and miRNA performance visually, and this Brachydanio rerio is expression green fluorescent albumen in various types of cells always.In this Brachydanio rerio transfection SpRNAi-RGFP carrier and express one and can work as and be the proteic red fluorescent albumen of pointer.Utilize FuGene lipofectamine reagent (cationic liposomal reagent) (Roche, In) after transfection SpRNAi-RGFP carrier enters Brachydanio rerio, find that all carriers can as a child enter in two all big Brachydanio rerio juvenile fish fully in transfection 24, except skeleton and fish scale part.

The proteic pointer albumen of this redness fluorescent is detected in transfected Brachydanio rerio, however the transfected miRNA-stemloop-miRNA*[2 of the effect of mourning in silence of green fluorescent albumen EGFP] the Brachydanio rerio group of pre-miRNA in be observed.Shown in Fig. 4 C, the quantitative property of west ink dot analytic process ground determines that the gene silencing effect is low than other tissue at intestinal (GI), and this phenomenon may be relevant with higher RNase activity in the intestinal.Because the heat stability of the five terminal of anti-EGFPpre-miRNA cane (stem-arms) is identical, therefore infer that the circular ring structure of this pre-miRNA is relevant with the combination of RISC complex.Therefore based on the multiformity of circular ring structure, utilize one group of pre-mir-302 annulus (for example 5 '-GCTAAGCCAGGC-3 ' (SEQ.ID.NO.1) and 5 '-GCCTGGCTTAGC-3 ' (SEQ.ID.NO.2)) with the combination of RISC complex to bring into play effectiveness of the present invention.

On mouse skin, use intronic microRNA to suppress Tyrosinase and hyaluronidase

Based on above-mentioned experiment, utilize the SpRNAi-RGFP carrier of pre-miRNA meson with miR-Tyr or miR-Hyal, pigment accumulation related gene such as Tyr or aging related gene such as Hyal are suppressed.Voluntarily She Ji miR-Tyr and miR-Hyal pre-miRNA be at one between the mankind or mouse the consistent zone of sequence height.This mouse provides an experiment made on the living animal that is used to test safety of SpRNAi-RGFP carrier and effectiveness.At occurring in nature, there is the miRNA of 54 cells itself to have inhibition Tyrosinase (Tyr; 2082 base pairs) function, these 54 sequences comprise mir-1, mir-15a, mir-16, mir-31, mir-101, mir-129, mir-137, mir-143, mir-154, mir-194, mir-195, mir-196b, mir-200b, mir-200c, mir-206, mir-208, mir-214, mir-221, mir-222, mir-292-3p, mir-299-3p, mir-326, mir-328, mir-381, mir-409-5p, mir-434-5p, mir-450, mir-451, mir-452, mir-464, mir-466, mir-488, mir-490, mir-501, mir-522, mir-552, mir-553, mir-570, mir-571, mir-582, mir-600, mir-619, mir-624, mir-625, mir-633, mir-634, mir-690, mir-697, mir-704, mir-714, mir-759, mir-761, mir-768-5p, and mir-804.These sequences are according to miR data base miRBase::Sequence program (http://microrna.sanger.ac.uk) analyze and obtain, all anti-Tyr miRNA are at Tyrosinase (NCBI accession number NM000372) 300 nucleotide of front end, have the miRNA of nine cells itself can be used for suppressing hyaluronidase (Hyal in addition; 2518 bp; NCBI accession number NM007312) comprises mir-197, mir-349, mir-434-5p, mir-549, mir-605, mir-618, mir-647, mir-680, mir-702 and mir-763.In these miRNA, mir-434-5p uniquely can suppress sequence at the most effective miRNA of Tyr and Hyal two genes, also be the sequence that least can disturb other gene.Yet because almost all miRNA is all influential to surpassing 50 specific target genes, so these miRNA just do not have specificity yet, and the safety of skin nursing is caused anxiety.

In order to test the feasibility of miRNA, by the pre-mir-434-5p of SpRNAi-RGFP performance carrier of the present invention express cell on mouse skin itself for skin-whitening.As shown in Figure 5, mottled albefaction skin is shaved the mouse that removes at melanin and is formed, this is to continue four days (totally 200 μ g) by the pre-mir-434-5p performance carrier (50 μ g) that continuous subcutaneous transfection has, and wherein Tyrosinase Tyr is memebrane protein catalytic rate deciding step in forming melanic process.In transfection latter two week of the first time, the black of observing skin and hair have significantly and reduces.On the contrary, the siRNA of control group and transfection the 3rd type polymerase (Pol-III) does not but have this effect and occurs under same dose, take out sample and analyze discovery from this hair follicle via Northern blot, the transfection of pre-mir-434-5p performance carrier makes Tyr performance amount reduce 76.1% ± 5.3% two days later, yet other matched group such as siRNA group (as the GAPDH group) just do not have this effect of mourning in silence.The siRNA/shRNA of the high concentration that people such as Grimm are produced via the 3rd type polymerase (Pol-III) at report in 2006 can make in the cell miRNA path supersaturation (over-saturate) and cause popularity miRNA dysregulation (dysregulation).Therefore, the miRNA of Pol-II provides one relatively more effective percentage, more compatible, safer skin is looked after method.Yet because pre-mir-434-5p also can suppress other five kinds of cytogenes and comprise TRPS1, PITX1, LCOP, LYPLA2 and Hyal.

For specificity and the safety that improves miRNA, She Ji mir-434-5p sequence can form 459-482 nucleotide zone reciprocal action with 3-25 nucleotide or the Hyal of Tyr again, wherein this sequence be used for making the pre-miRNA insert sequence of Tyr gene silencing be 5 '-GTCCGATCGT CGCCCTACTC TATTGCCTAAGCCGCTAAGC CAGGCGGCTT AGGCAATAGA GTAGGGCCGA CGCGTCAT-3 ' (SEQ.ID.NO.8), this sequence can form the gene silencing effector of the ribonucleic acid of a similar hair clip, and be processed into that miR-Tyr miRNA sequence comprises or with coming from 5 '-GCCCTACTCT ATTGCCTAAG CC-3 ' (SEQ.ID.NO.9), in other embodiments, the pre-miRNA that Hyal is suppressed be 5 '-GTCCGATCGT CAGCTAGACA GTCAGGGTTTGAAGCTAAGC CAGGCTTCAA ACCCTGACTG TCTAGCTCGA CGCGTCAT-3 ' (SEQ.ID.NO.10), this sequence can form the ribonucleic acid of a different similar hair clip, and is processed into that miR-Hyal miRNA sequence comprises or with coming from 5 '-AGCTAGACAG TCAGGGTTTG AA-3 ' (SEQ.ID.NO.11).Though, pre-miR-Tyr and pre-miR-Hyal structure are based on identical mir-434-5p and mir-302 circular ring structure, sophisticated miR-Tyr and miR-Hyal are different fully mutually, as shown in Figure 6, miR-Tyr and miR-Hyal transfection make Tyrosinase be suppressed above 90% on mouse skin, and hyaluronidase is suppressed above 67%, suppress to produce without any non-narrow spectrum mourning in silence simultaneously, the performance amount of sophisticated miR-Tyr and miR-Hyal miRNA is analyzed institute quantitatively by Northern trace (bot), and Tyrosinase and hyaluronidase are analyzed quantitatively by Western trace (blot).

Gene silencing specificity and the safety of miR-Tyr on human skin and miR-Hyal

At the miR-Tyr and the miR-Hyal The RNA interference effector of the intron of the present invention of understanding the gene silencing effect, be that specificity and safety are arranged in order further to test the SpRNAi-RGFP carrier that in human skin cell and tissue, has miR-Tyr and miR-Hyal.For effective transfection carrier enters the human epidermal cell, SpRNAi-RGFP carrier solution (1 μ g/ml) (this solution is that the SpRNAi-RGFP carrier of 100 μ g and no DNase glycerol (DNase-free glycerin) and the 1ml sterilization deionized water of 99ml mix) is transfected into cell.Wherein, no DNase glycerol (DNase-free glycerin) can be transfected into the efficient of deep skin and penetrating of cell membrane with increase with helping miR-Tyr formation cyst.This is to be used for the main component of skin whitening, in other embodiments, and also can be by adding other composition to promote abnormal smells from the patient, color, effectiveness and stability to become the cosmetics of finishing.Shown in Fig. 7 A, Asia boy student's arm skin was relatively found comparatively fair really through three days with the SpRNAi-RGFP vehicle group of no any effector of mourning in silence after handling via this main component of 2ml.

And institute's cultured skin cell is to agree and take from one's body the donor via the donor, and all processing procedures all pass through under the principle of agreement and just handled.Transfection carrier is to these Skin Cells, shown in embodiment three and six.Fig. 7 B shows, analyzes via Western blot, and Tyrosinase that is reduced and the melanin that is produced thereof have statistical meaning (p＞0.001).The minimizing of Tyrosinase amount and its melanin are directly proportional with the dosage of the miR-Tyr of institute transfection by matter, and this phenomenon shows that the dosage increase of miR-Tyr is subjected to matter to become positive correlation with Tyrosinase and melanin thereof.Other experimental group for example not the SpRNAi-RGFP vehicle group (miR-gfp) of the SpRNAi-RGFP vehicle group (glycerin) of any miRNA insert of tool and performance anti-EGEP pre-miRNA insert just do not have this and reduce phenomenon and take place.During the transfection of miR-Tyr performance carrier (1 μ g/ml), the maximum of Tyrosinase effect about 55% to 60% and the melanin effect about 30% to 45% of mourning in silence of mourning in silence, actin is not disturbed by miR-Tyr to mourn in silence simultaneously, therefore hints that the present invention has safe specificity phenomenon.Fig. 7 C shows that further dermal melanin has obvious minimizing, and shown in the bright district (bright-field) that Skin Cell is cultivated, yet in the normal skin cells of no miR-Tyr, melanin is to precipitate near nucleus.And the melanin deposition phenomenon of process miR-Tyr cells transfected is considerably less appearance, and this has shown miR-Tyr Pear Power effect in cell.Reduce phenomenon according to this melanin, also be accompanied by the minimizing of Tyrosinase in the Skin Cell through the miR-Tyr transfection, this phenomenon can be by immunocytochemical stain analysis (immunocytochemical staining analysis), shown in Fig. 7 C.Therefore, arrive as 7C based on Fig. 7 A, the SpRNAi-RGFP carrier of miR-Tyr miRNA is success to suppress Tyrosinase and melanin effectively in cell.

After the gene silencing effect of miR-Tyr is set up, utilize biochip (GeneChipU133A﹠amp in human skin cell; B arrays, Affymetrix, Santa Clara, CA) analyze ribonucleic acid and have miR-Tyr cells transfected and the comparative analysis of no miR-Tyr cells transfected to be evaluated at above 32668 human genes, the more narrow spectrum gene silencing of analysis result demonstration is howed a lot than mourning in silence of no narrow spectrum gene.Whole RNA of every strain test cell strain by RNeasy spin column (Qiagen, Valencia, CA) purified.Shown in Fig. 8 A, no miR-Tyr shows that with the analyzing biochips of the cell strain that miR-Tyr is arranged the change amount of having only two genes surpasses 1.5 times (amount of gene performance just has the change greater than 50%), this two gene is Tyrosinase gene and TRP1 gene interactive with it (shown in Fig. 8 B), and this has hinted that the gene silencing effect that miR-Tyr caused is very single-minded for Tyrosinase.There is no other cytotoxicity in addition or the PKR/2-5A path is affected, this phenomenon proof miR-Tyr gene silencing effect has suitable safety (shown in Fig. 8 B) for the dermal application aspect.These are conformed to the experimental result shown in Fig. 8 A and the 8B with confirmation by gene (shown in Fig. 8 C) the performance degree that biochip recognized further also to utilize Northern blotting to analyze relatively.Further miR-Tyr transfection group (miR+) (Fig. 8 A right side) and no transfection group (miR-) are found relatively that the correlation coefficient (correlationcoefficiency) 32558 gene performances is 99.8%, and the correlation coefficient of mir-434-5p transfection group and no transfection group (miR-) is 77.6%, this is meaning the miR-Tyr transfection group and is having only 65 genes to be subjected to the influence of miR-Tyr, but has 7317 genes to be subjected to the influence of mir-434-5p transfection and change.Because miRNA has the function of mourning in silence at numerous genes, this function is based on their unmatched cane (mismatched stem-arms) structure, so the present invention confirms that it is necessary designing this cane (stem arms) structure for this miRNA safety again.

Therefore, the present invention's use includes similar bob folder (intronic hairpin-like) miRNA/shRNA performance carrier can provide an effective method to look after at intracellular skin, especially for pigmentation and aging the prevention.Under identical disposal, Pol-II-transcribed intronic miRNA can't cause any cytotoxicity of detecting, and brings out non-specific mRNA degraded (Sledzet.al.supra as Pol-III-directed siRNA; Lin (2004b) supra).This emphasizes that intronic miRNA is effective percentage and narrow spectrum method and it there is no the cytotoxicity of bifilar siRNA.Because this intronic miRNA-mediated gene silencing path be with numerous cells in the regulator control system synergism, therefore the gene silencing effector is by comprising the Pol-II re-recording system, systematic collaboration runnings such as RNA ribonucleic acid splicing system (intron excision mechanism) and NMD system, and make the effect of mourning in silence of intronic miRNA be considered to more effective, single-minded, safety is in present all known RNAi paths, based on all superiority conditions, use the intronic miRNAs of design again to provide one long-term relatively in skin nursing, effectively, single-minded and safe gene regulation method can be avoided the non-single-minded gene silencing cytotoxicity that produces as traditional siRNA

The present invention is described by above-mentioned related embodiment, yet the foregoing description is only for implementing example of the present invention.Must be pointed out that the embodiment that has disclosed does not limit the scope of the invention.On the contrary, being contained in the spirit of claim and the modification and the equalization of scope is provided with all within the scope of the present invention.

Following experimental design is for illustrating, but do not limit the scope of the invention.Concerning all have the knack of those skilled in the art, can do rational variation to this without departing from the spirit and scope of the present invention.

Embodiment one construction one comprises the recombination (SpRNAi-RGFP) of SpRNAiSynthesize and be used to produce three kinds of different SpRNAi nucleotide sequences, this sequence comprises: N1-sense, and 5 '-pGTAAGAGGAT CCGATCGCAGGAGCGCACCA TCTTCTTCAA GA-3 ' is (SEQ.ID.NO.12); N1-antisense, 5 '-pCGCGTCTTGAAGAAGATGGT GCGCTCCTGC GATCGGATCC TCTTAC-3 ' is (SEQ.ID.NO.13); N2-sense, 5 '-pGTAAGAGGAT CCGATCGCTT GAAGAAGATG GTGCGCTCCT GA-3 ' is (SEQ.ID.NO.14); N2-antisense, 5 '-pCGCGTCAGGA GCGCACCATC TTCTTCAAGC GATCGGATCC TCTTAC-3 ' is (SEQ.ID.NO.15); N3-sense, 5 '-pGTAAGAGGAT CCGATCGCAG GAGCGCACCA TCTTCTTCAAGTTAACTTGA AGAAGATGGT GCGCTCCTGA-3 ' is (SEQ.ID.NO.16); N3-antisense, 5 '-pCGCGTCAGGA GCGCACCATC TTCTTCAAGT TAACTTGAAG AAGATGGTGC GCTCCTGCGATCGGATCCTC TTAC-3 ' is (SEQ.ID.NO.17); N4-sense, 5 '-pCGCGTTACTA ACTGGTACCTCTTCTTTTTT TTTTTGATAT CCTGCAG-3 ' is (SEQ.ID.NO.18); N4-antisense, 5 '-pGTCCTGCAGG ATATCAAAAA AAAAAGAAGA GGTACCAGTTAGTAA-3 ' (SEQ.ID.NO.19).In addition, two exon fragments are produced by the 208th nucleotide place of the red fluorescent RGFP gene of DraII restriction enzyme digestion (SEQ.ID.NO.20), and are further formed blunt end (bluntend) by the five terminal after cutting by T4DNA polymerase.Can be filled up by artificial SpRNAi intron by the space after cutting.This RGFP is to a red fluorescent protein gene, and this albumen is to form by adding the 69th the amino acid place of an extra Radix Asparagi amino acid (Aspartate) in the colored protein (chromoproteins) of HcRed1 (being derived by Heteractis crispa).(BDBiosciences CA) develops the red fluorescent 570nm wavelength ray that less degeneration and almost twice intensity.Utilize pHcRed1-N1/1 carrier (Clontech BD Biosciences, Palo Alto, CA; Catalog#6365-1) be modified as SpRNAi-RGFP performance carrier, the pHcRed1-N1/1 carrier has contained the red fluorescent protein gene of HcRed1, and wherein HcRed1 albumen is by purification among the sea anemone Heteractis crispa.Utilization pHcRed1-N1/1 carrier separates with XhoI and XbaI restriction endonuclease and with the carrier of the no RGFP of the RGFP genetic fragment of 2% agarose gel (agarose gel) electrophoresis purification total length 769bp and 3934bp.

N1-sense and N1-antisense, N2-sense and N2-antisense, N3-sense and N3-antisense and N4-sense and N4-antisense do not heated each complementary series to 94 ℃ (2 minutes) 70 ℃ afterwards (10 minutes) and in 1xPCR buffer (50mM Tris-HCl, 25 ℃ of pH9.2at, 16mM (NH ₄) ₂SO ₄).Then by cool off N1-N4, N2-N4 gradually, N3-N4 (1: 1) connects N1, N2, N3 to N4, temperature by 50 ℃ to 10 ℃ effects above 1 hour, use T4 ligase ligase and corresponding buffer (Roche afterwards, IN) mix 12 hours (12 ℃) with it, and make intron can insert the appropriate location of exon.After RGFP exon fragment was added into reaction (1: 1: 1), T4 ligase and corresponding buffer were adjusted and carry out coupled reaction again 12 hours (12 ℃).For recombination RGFP that will correct size inserts carrier, the connection nucleotide of 10ng (ligated nucleotide) sequence utilize round pcr and the specific introduction of a pair of RGFP (primer) 5 '-CTCGAGCATG GTGAGCGGCC TGCTGAA-3 ' (SEQ.ID.NO.21) with 5 '-TCTAGAAGTTGGCCTTCTCG GGCAGGT-3 ' (SEQ.ID.NO.22) in the PCR condition in 94 ℃ (1 minutes), 52 ℃ (1 minute), 68 ℃ (2 minutes) and carry out 30 same reactions.Utilize nucleotide sequence that 2% agarose gel (agarose gel) isolates the product of PCR and about 900bp size by Gel Extraction kit (Qiagen, CA) purified come out.The RGFP gene with SpRNAi function of the nucleotide of this 900bp size is further determined with sequence alignment.

Because recombination is to utilize XhoI and XbaI restriction enzyme digestion position at five terminal and three ends recombination to be inserted in the carrier respectively, this carrier must have the skin compatibility, and the feature that can in organism, show, this performance carrier comprises plastid (plasmids), coemid (cosmid), phasmid (phagmids), yeast artificial chromosome (yeast artificial chromosomes), jumping gene (jumping genes), transposon (transposons), reverse transcription jump (retrotransposons), retrovirus vector (retroviralvectors).In addition, because this insertion recombination by PvuI and MluI restriction enzyme digestion five terminal that the position is connected and three ends, therefore also can utilize same restriction enzyme digestion position that other different recombinations are inserted carrier.This insertion recombination is preferably the gene silencing effector (gene silencing effector) of a similar clip, and this gene silencing effector can be mourned in silence at sequences such as having green fluorescent albumen, luciferin gene, lactose control group (lac-Z), viral gene, bacterial gene, plant gene, animal and human gene.Between the complementation or homology about 30% to 100% of these mourn in silence effector meson (insert) and its target gene orders, (insert) is preferably between 35% to 49% to the hairpin-shRNA meson, for sense-stRNA and antisense-siRNA meson, the complementary rate scope of preferable sequence is 90% to 100%.

The recombination (SpRNAi-RGFP) that embodiment two construction one comprise SbRNAi enters the performance carrier

Because reorganization SpRNAi-RGFP gene has restriction enzyme digestions such as XhoI and XbaI and is positioned at five terminal and three ends, and can utilize these to cut the position recombination is inserted carrier, SpRNAi-RGFP is mixed with 1: 16 (w/w) with the pHcRed-N1/1 carrier of 3934bp, and cooling surpasses 50 minutes from 65 ℃ to 15 ℃, adds T4 ligase (ligase) and buffer thereof afterwards and mixes 12 ℃ (12 hours).The SpRNAi-RGFP carrier can utilize E.coli DH5 α LB (50ug/ml kanamycin (kanamycin) (Sigma Chemical, St.Louis, Mo)) carry out massive duplication, and utilize round pcr and the specific introduction of RGFP (SEQ.ID.NO.21) thereof and (SEQ.ID.NO.22) in 94 ℃ (1 minutes), 68 ℃ (2 minutes) and carry out 30 circular response and its sequence is confirmed in comparison.For recombination is inserted viral vector, identical program also can utilize XhoI/XbaI-linearizing (linearized) pLNCX2 retrovirus vector (BD) to carry out.Because SpRNAi by PvuI and MluI restriction enzyme digestion five terminal that the position is connected in and three ends, therefore can utilize these to cut the position removal or connect sequences such as anti-EGFP shRNA or miR-Tyr or miR-Hyal.

Synthesizing ribonucleotide sequence can be used to produce many different artificial introns of SpRNAi and comprises how different miR-Tyr or miR-Hyal meson (insert), this meson is similar clip forerunner micro ribonucleic acid, as follows: miR-Tyr-sense, 5 '-GTCCGATCGT CGCCCTACTC TATTGCCTAA GCCGCTAAGC CAGGCGGCTTAGGCAATAGA GTAGGGCCGA CGCGTCAT-3 ' is (SEQ.ID.NO.8); MiR-Tyr-is counter to anticipate (antisense), and 5 '-ATGACGCGTC GGCCCTACTC TATTGCCTAA GCCGCCTGGC TTAGCGGCTT AGGCAATAGAGTAGGGCGAC GATCGGAC-3 ' (SEQ.ID.NO.23); With miR-Hyal-sense, 5 '-GTCCGATCGTCAGCTAGACA GTCAGGGTTT GAAGCTAAGC CAGGCTTCAA ACCCTGACTG TCTAGCTCGACGCGTCAT-3 ' (SEQ.ID.NO.10); MiR-Hyal-antisense, 5 '-ATGACGCGTC GAGCTAGACAGTCAGGGTTT GAAGCCTGGC TTAGCTTCAA ACCCTGACTG TCTAGCTGAC GATCGGAC-3 ' (SEQ.ID.NO.24).These mesons can mats hybridization modes as miR-Tyr-sense individually to miR-Tyr-antisense and individually miR-Hyal-sense miR-Hyal-antisense is carried out the sequence complementation.These miR-Tyr and miR-Hyal performance carrier can utilize E.coli DH5 α LB (50ug/ml kanamycin (kanamycin) (being used for the pHcRed1-N1/1 carrier) or 100ug/ml kanamycin (kanamycin) (being used for the pLNCX2 carrier)) to carry out massive duplication, and the plasmid extraction box (Maxi-prep plasmid extraction kit) (Qiagen, CA) purification and single that utilize a small amount of preparation (Mini-prep) or prepare in a large number from the SpRNAi-RGFP carrier.As for the pLNCX2 carrier, can utilize packaging cell line (packaging cell lines) PT67 (BD) to be used for producing to infect but the virus of reproducible not, the PT67 cell strain of this infection is in 1xDMEM medium (medium) (10%FBS, 4mM L-glutaminate (glutamine), 1mM. Sodium Pyruvate (sodium pyruvate), 100ug/ml streptomycin sulfate (streptomycin sulfate) and and 50ug/ml neomycin (neomycin) (Sigma Chemical, MO) at 37 ℃ of at, 5%CO ₂Down), viral dosage is about 10 ⁶About cfu/ml.

Embodiment three in vivo transfections

Enter cell strain for transfection carrier, Brachydanio rerio seedling and mouse skin, at first can anti-EGFP will be had, SpRNAi-RGFP performance carrier and FuGene reagent (the reagent) (Roche of miR-Tyr or miR-Hyal pre-miRNA insert, IN) after the mixing, and the use of abideing by FuGene reagent (reagent) is indicated, cell strain is directly individually placed or spread upon to the carrier that then will have no meson (insert-free) RGFP and SpRNAi-RGFP structure, on Brachydanio rerio seedling and the mouse skin, be to organize as negative control (negative control) at this moment with the pre-miRNA insert group of anti-(against) HIV gag-p-24.And after after the transfection 0,24,48 and 72 hour the external form and the fluorescence staining phenomenon thereof of observation of cell or tissue.For the in vivo experiment on the human skin (in vivo) rotaring transfecting mode, be to have anti-EGFP or do not have anti-EGFP, miR-Tyr or (autoclaved) ddH of the SpRNAi-RGFP carrier of miR-Hyal pre-miRNAinsert, 1ml autoclaved by mixing 1-1000 μ g with the SpRNAi-RGFP carrier solution of handling well in advance ₂The 100% no DNase glycerol (DNase-free glycerin) (or glycerol (glycerol)) of O and 99ml.Then, this mixed solution can directly be smeared and massage on human body skin and be produced its effectiveness.

Embodiment four Northern engram analysis (Blot Analysis)

RNA (20 μ g total RNA or 2ug poly[A+] RNA) via utilizing capillarity that RNA is adsorbed on (Schleicher﹠amp on the nylon membrane after 1% formaldehyde-agarose gel (formaldehyde-agarose gels) electrophoretic separation; Schuell, Keene, NH).The complementation of synthetic probe design energy is at the 5 end exons and the 75bp junction sequence (junction sequence) between the anti-EGFPpre-miRNA insert that connect RGFP or be complementary to miR-Tyr (SEQ.ID.NO.9) or miR-Hyal (SEQ.ID.NO.10), wherein miR-Hyal is by Prime-It II kit (Stratagene, La Jolla, CA) demarcate, and by random primer extension (randomprimer extension) technology, use [ ³²P]-dAP (＞3000Ci/mM, Amersham International, Arlington Heights, IL) and 10 purified bp-cutoff Micro Bio-Spin chromatographic column (chromatography columns) (Bio-Rad, Hercules CA) demarcates sequence.(pH 7.0 by mixing 50% deionized formamide (deionized formamide) again, 5x Denhardt ' s solution (solution), 0.5%SDS, the salmon physeter fragment of 4x SSPE and 250mg/mL degeneration (denatured salmon spermDNA fragments) (18hr, 42 ℃)) reduces non-specificity signal.The reuse nylon membrane is in 2x SSC afterwards, 0.1%SDS (15min, 25 ℃) and 0.2x SSC, the mode of 0.1%SDS (45min, 37 ℃) with the impurity eccysis after, carry out (automatically) radiography (autoradiography).

Embodiment five SDS-PAGE and WesternEngram analysis (Blot Analysis)

Immunoblotting for specific protein, removing the separated cell strain of culture fluid wipes away through the PBS profit of ice, with CelLytic-Mlysis/ extract examination mark (extraction reagent) (Sigma MO) and according to operation instruction replenishes protease inhibitor. (protease inhibitors), leupeptin (Leupeptin), TLCK, TAME and PMSF.Cell is as for using in the room temperature afterwards; Vibrator (shaker) mixing after 15 minutes cell scraped in the test tube and with centrifugal 5 minutes of the rotating speed of 12000xg with the cell residue precipitation, and will have proteinic cell extraction liquid and collect and be stored in-70 ℃ with to be used.And (Molecular Devices, Sunnyvale is CA) with protein quantification in E--max microplate reader (microplate reader) to utilize SOFmax software kit (software package).The cell extraction thing of per 30 μ g is added into SDS-PAGE sample buffer (sample buffer) (reduction or the 50mM DTT that do not reduce are arranged) and above-mentioned sample was boiled 3 minutes, sample is being injected 8% polyacrylamide gel (polyacylamide gels) before, earlier 2～3 μ l protein tenders (protein marker) (Bio-Rad) are being injected wherein.And being the establishing criteria program, SDS-polyacrylamide gel electrophoresis (polyacrylamide gel electrophoresis) carries out (Molecular Cloning, 3rd ED).Protein chromatographic upward and with Odyssey blocks reagent (blocking reagent) (Li-Cor Biosciences with protein adsorption at nitrocellulose filter (nitrocellulose membrane) after change stain (electroblotting) method by electricity, Lincoln is NB) room temperature effect 1～2 hour.And utilize antibody first antibody (primary antibody) directly to specific protein (EGFP (and 1: 5,000; JL-8, BD), RGFP (1: 10,000; BD), and Tyr (1: 2,000; Santa Crutz), or (or) Hyal (1: 2,000; Santa Crutz)) demarcate, the whole night in 4 ℃ of effects.It is inferior then to give a baby a bath on the third day after its birth with TBS-T buffer (buffer), and again with second antibody (secondary antibody) act on this nitrocellulose filter (nitrocellulose membrane) (goat-anti mice (goat anti-mouse) IgG pairing and (conjugatewith) Alexa Fluor 680 reactive dye (reactive dye) (and 1: 2,000; Molecular probe (MolecularProbes)), the room temperature effect is carried out imaging after reuse TBS-T buffer (buffer) is given a baby a bath on the third day after its birth time after one hour and with Li-Cor Odyssey infrared image instrument (Infrared Imager) and Odyssey software (Softeare) (Li-Cor) record image v.10.

Embodiment six nbccs gene of intron in Brachydanio rerio effect (Intronic RNA-mediated that mourns in silence Gene Silencing)

This strain Tg (actin-GAL4:UAS-gfp) Brachydanio rerio juvenile fish is supported in the container with 10ml 0.2x serum-free (serum-free) RPMI RPMI-1640 to treat transfection, elder generation is with 60 μ l FuGene lipofectamine (liposomal transfection reagent) (Roche Biochemicals when transfection, Indianapolis IN) mixes with 1ml 1x serum-free RPMI RPMI-1640.To have again with SpRNAi-RGFP carrier that does not have anti-EGFP pre-miRNA insert such as embodiment one and mix with two described modes, mix to carry out transfection with above-mentioned blended culture fluid at last, and this mixed liquor placed on ice the container of directly putting into the Brachydanio rerio juvenile fish after 30 minutes, all three dosage are by 12 hours (whole 60 μ g) spaced apart, and treat after the transfection that 60 as a child collected sample and observe.

The mir-434-5p and the miR-Tyr-synthetic (mediated) of embodiment seven in vivo mouse skin introns Gene silencing effect (Intronic mir-434-5p and miR-Tyr-mediated Gene Silencing)

The mottled melanin of albefaction skin reject mouse (W-9 black strain) by the continuous subcutaneous injection list from the SpRNAi-RGFP performance carrier with mir-434-5p pre-miRNA insert four days (the about 200 μ g of dosage altogether) or by continuing six days (the about 240 μ g of dosage altogether) twice SpRNAi-RGFP performance carrier every day that direct cutaneous is injected liposomal encapsulated (liposome-encapsulated) with miR-Tyrpre-miRNA.In order to produce SpRNAi-RGFP performance carrier with natural (native) mir-434-5p pre-miRNA meson (insert), utilization is as described in the embodiment two, except not using the meson (intronic insert) (5 '-GTCCGATCGT CUCGACUCUG GGUUUGAACC AAAGCUCGACUCAUGGUUUG AACCAUUACU UAAUUCGUGG UUUGAACCAU CACUCGACUC CUGGUUCGAACCAUCCGACG CGTCAT-3 ' (SEQ.ID.NO.25)) of synthetic mir-434-5p pre-miRNA when intron.In order more efficiently carrier to be transfected into particular organization, carrier is that (Roche IN) mixes as embodiment three and six described hybrid modes formation with FuGene lipofectamine liposomal transfection reagent.

The intronic miR-Tyr-mediated gene silencing effect of embodiment eight on human skin

In order effectively the carrier transfection to be entered in the human body skin layer, 1 μ g/ml SpRNAi-RGFP carrier solution can be dissolved in (autoclaved) ddH of the autoclaved of 1ml by 100 μ g carriers ₂The solution of O and the 100%D of 99ml do not have DNase glycerol or glycerol Nase-free glycerin or glycerol) mix.No DNase glycerol (DNase-free glycerin) is used to make miR-Tyr formation capsule shell-like to go deep into the cell deep layer in order to carrier and transmits.Therefore, utilize this mode that one inventor's left hand arm directly is coated with the mixed liquor (arm right side) of the above-mentioned miR-Tyr of having that is covered with 2ml and do not have mi R-Tyr mixed liquor 2ml in arm left side, found that after two days, really it is comparatively fair to have the arm that the mixed liquor of miR-Tyr handles, and also further confirms its effect in human body skin.

Embodiment nineImmunocytochemistry (ICC) dyeing chemical examination (Immunocytochemical (ICC) StainingAssay)

(Imgenex San Diego is CA) and according to making operation instruction for one chemo-immunity dye test group.Sample section elder generation profit in PBS is wiped away three times and is steeped Zeller ' s solution (solution) (10mM Tris, 100mM MgCl again ₂5% hyclone (fetal calf serum), 1%BSA and 0.5%Tween-20, pH 7.4) soaked 30 minutes, then at first antibody (primary antibody) (using Zeller ' s solution (solution) dilution) the whole night and leave in 4 ℃ of refrigerators with sample section bubble, to cut into slices every other day and use the TBST flushing three times and bubble in second antibody (secondary antibody) two hours, be to be second antibody (secondary antibody (Chemicon at this moment with biotinylated goat-anti rabbit or horse anti-mouse antibody (biotinylated goat anti-rabbit or horse anti-mouse antibody), Temecula, CA).Reuse TBST washes the sample section and once works as the 3rd antibody (tertiary antibody) and make its colour generation with DAB substrate (substrate) with Streptavidin (streptavidin)-HRP in the back.With the 100x microscope and with 100x and 400x (TE2000 inversion microscopic quantity system (inverted microscopic quantitation system) observed result.

Embodiment ten analyzing biochips (Microarray Analysis)

For the probe (probe) preparing to demarcate be used for biochip on gene recombination, the whole ribonucleic acid (2 μ g) that extract are transformed into bifilar cDNA, and use subscript selective system (Superscript Choicesystem) kit (Gibco/BRL, Gaithersburg, MC) and the oligh (dT) after modifying ₂₄-T7 activates sub-introduction (promoter primer) as 5 '-GGCCAGTGAA TTGTAATACG ACTCACTATAGGGAGGCGG-(dT) ₂₄-3 ', subsequent steps is as its user description of step.After bifilar cDNAs extracted with phenol/chloroform (phenol/chloroform), utilize ethanol with it precipitation and again Hui Rong to 0.5 μ g/ μ l pyrocarbonic acid diethyl ester (diethyl pyrocarbonate) (DEPC)-treated ddH ₂O.And isolated glue (Phase-LockGel) (Boulder CO) can be used to increase extraction yield for 5 ' Prime → 3 ' Prime, Inc..And external (invitro) transcribes the cDNA of available T7 ribonucleic acid polymerase and 1 μ g, unlabeled 7.5mM (unlabeled) ATP and GTP, unlabeled (unlabeled) UTP of 5mM and CTP, and and 2mM biotin labeling (biotin-labeled) CTP and UTP (biotin-11-CTP, biotin-16-UTP, EnzoDiagnostics) be reflected at 37 ℃ of 4 hours generation cRNA jointly, then cRNA utilizes RNeasy column spinner (spincolumns) (Qiagen, CA) purification, the agarose gel of reuse 1% (agarose gel) confirms its size, then be heated to 94 ℃ 35 minutes in 40mM Tris-acetate, pH 8.0, and 100mM KOAc/30mMMgOAc makes cRNA be broken down into about 50 the nucleotide sizes of size at random.

Utilize biochip (the GeneChip U133A﹠amp of one group in four nucleotide; B arrays, Affymetrix, Santa Clara CA), wherein comprises 32668 genes altogether and can be used to hybridize, and hybridization is to finish under 40 ℃ of continuous stirrings in 16 hours of the AFFY buffer of 200 μ l (Affymetrix).After hybridization is finished; biochip is with 6x SSPE-T buffer (buffer) (the 1x 0.25M sodium chloride (sodium chloride)/15mM sodium phosphate (sodium phosphate) of 200 μ l; pH 7.6/1mM EDTA/0.005%Triton) profit is wiped away 3 times and was then washed one hour in 50 ℃ with the 6x SSPE-T buffer of 200 μ l; then wipe away twice and 0.5x SSPE-T washed 15 minutes in 50 ℃ with 0.5X SSPE-T profit; after using 2 μ g/ml streptavidin-phycoerythrin (streptavidin-phycoerythrin) (molecular probe (Molecular Probes)) and 1mg/ml acetylizad (acetylated) BSA (Sigma) in 6x SSPE-T (pH 7.6) to dye afterwards, biochip is inserted confocal scanning instrument (confocal scanner) (molecular dynamics (Molecular Dynamics)) carry out interpretation and analyze with Affymetrix Microarray Suite version 4.0 softwares (software).By the mean deviation of (perfectly matched) probe of Perfect Matchings and mismatch (mismatched) probe with sample standardization (normalize) after, collect the signal of signal difference greater than twice.

Embodiment 11 statistical are analysed

The biochip result is rendered as meansigma methods ± SE.The statistical analysis of these sample data calculates by one way (one-way) ANOVA mode, and when having statistics and go up significant difference, Dunnett ' s post-hoc test (test) is used to identification and the discrepant sample group of etalon.In order to compare between two groups, two tail student checks (two-tailed sudent t test) are to be used.In order to compare above two groups, ANOVA compares by post-hoc multiple range check (multiple range test), probability value p＜0.05 is identified as has statistical meaning, and all p values are to decide by two-tailed test (two-tailed test).

Sequence table

C＜110〉U.S. Lip river biotechnology limited company

＜120〉use ribonucleic acid (intronic microRNA) technology of intron in novel cosmetic design and product

<130>US?61/000797

<150>US?61/000797

<151>2007-10-30

<160>25

<210>1

<211>12

<212>DNA

＜213〉artificial sequence

<220>stem_loop

＜223〉Gai Liang pre-mir-302 circular ring structure

<400>1

gctaagccag?gc

12

<210>2

<211>12

<212>DNA

＜213〉artificial sequence

<220>stem_loop

＜223〉Gai Liang pre-mir-302 circular ring structure

<400>2

gcctggctta?gc

12

<210>3

<211>8

<212>DNA

＜213〉artificial sequence

<220>5’clip

＜223〉five terminal montage place

<400>3

gtaagagk

8

<210>4

<211>10

<212>DNA

＜213〉artificial sequence

<220>3’clip

＜223〉three end montages place

<400>4

gwkscyrcag

10

<210>5

<211>7

<212>DNA

＜213〉artificial sequence

<220>Misc_signal

＜223〉branch point district

<400>5

tactway

7

<210>6

<211>17

<212>DNA

＜213〉artificial sequence

<220>Misc_RNA

＜223〉many pyrimidines district

<400>6

tytycttttt?tttttts

17

<210>7

<211>19

<212>DNA

＜213〉artificial sequence

<220>Misc_RNA

＜223〉many pyrimidines district

<400>7

tctctctctc?tctcnctag

19

<210>8

<211>78

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉be used for making the pre-miRNA insert sequence of Tyr gene silencing

<400>8

gtccgatcgt?cgccctactc?tattgcctaa?gccgctaagc?caggcggctt?aggcaataga?gtagggccga?cgcgtcat

78

<210>9

<211>22

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉be used for making the pre-miRNA insert sequence of Tyr gene silencing

<400>9

gccctactct?attgcctaag?cc

22

<210>10

<211>78

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉be used for making the pre-miRNA insert sequence of Hyal gene silencing

<400>10

gtccgatcgt?cagctagaca?gtcagggttt?gaagctaagc?caggcttcaa?accctgactg?tctagctcga?cgcgtcat

78

<210>11

<211>22

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉be used for making the pre-miRNA insert sequence of Hyal gene silencing

<400>11

agctagacag?tcagggtttg?aa

22

<210>12

<211>42

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>12

gtaagaggat?ccgatcgcag?gagcgcacca?tcttcttcaa?ga

42

<210>13

<211>46

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>13

cgcgtcttga?agaagatggt?gcgctcctgc?gatcggatcc?tcttac

46

<210>14

<211>42

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>14

gtaagaggat?ccgatcgctt?gaagaagatg?gtgcgctcct?ga

42

<210>15

<211>46

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>15

cgcgtcagga?gcgcaccatc?ttcttcaagc?gatcggatcc?tcttac

46

<210>16

<211>70

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>16

gtaagaggat?ccgatcgcag?gagcgcacca?tcttcttcaa?gttaacttga?agaagatggt?gcgctcctga

70

<210>17

<211>74

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>17

cgcgtcagga?gcgcaccatc?ttcttcaagt?taacttgaag?aagatggtgc?gctcctgcga?tcggatcctc?ttac

74

<210>18

<211>47

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>18

cgcgttacta?actggtacct?cttctttttt?tttttgatat?cctgcag

47

<210>19

<211>45

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉be used to produce three kinds of different SpRNAi nucleotide sequences

<400>19

gtcctgcagg?atatcaaaaaa?aaaaagaaga?ggtaccagtt?agtaa

45

<210>20

<211>689

<212>DNA

＜213〉Heteractis crispa sea anemone

<400>20

atggtgagcg?gcctgctgaa?ggagagtatg?cgcatcaaga?tgtacatgga?gggcaccgtg?aacggccact?acttcaagtg

cgagggcgag?ggcgacggca?accccttcgc?cggcacccag?agcatgagaa?tccacgtgac?cgagggcgcc

cccctgccct?tcgccttcga?catcctggcc?ccctgctgcg?agtacggcag?caggacgacc?ttcgtgcacc?acaccgccga

gatccccgac?ttcttcaagc?agagcttccc?cgagggcttc?acctgggaga?gaaccaccac?ctacgaggac?ggcggcatcc

tgaccgccca?ccaggacacc?agcctggagg?gcaactgcct?gatctacaag?gtgaaggtgc?acggcaccaa

cttccccgcc?gacggccccg?tgatgaagaa?caagagcggc?ggctgggagc?ccagcaccga?ggtggtgtac

cccgagaacg?gcgtgctgtg?cggccggaac?gtgatggccc?tgaaggtggg?cgaccggcac?ctgatctgcc

accactacac?cagctaccgg?agcaagaagg?ccgtgcgcgc?cctgaccatg?cccggcttcc?acttcaccga?catccggctc

cagatgctgc?ggaagaagaa?ggacgagtac?ttcgagctgt?acgaggccag?cgtggcccgg?tacagcgacc

tgcccgagaa?ggccaactg

689

<210>21

<211>27

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉the specific introduction of RGFP

<400>21

ctcgagcatg?gtgagcggcc?tgctgaa

27

<210>22

<211>27

<212>DNA

＜213〉artificial sequence

<220>Misc_feature

＜223〉the specific introduction of RGFP

<400>22

tctagaagtt?ggccttctcg?ggcaggt

27

<210>23

<211>78

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉miR-Tyr is used for Tyr gene underlying stock transcripton is suppressed

<400>23

atgacgcgtc?ggccctactc?tattgcctaa?gccgcctggc?ttagcggctt?aggcaataga?gtagggcgac?gatcggac

78

<210>24

<211>78

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉miR-Hyal is used for the anti-burst transcripton of Hyal gene is suppressed

<400>24

atgacgcgtc?gagctagaca?gtcagggttt?gaagcctggc?ttagcttcaa?accctgactg?tctagctgac?gatcggac

78

<210>25

<211>116

<212>DNA

＜213〉artificial sequence

<220>intron

＜223〉miR-434-5p is used for the specific gene transcripton is suppressed

<400>25

gtccgatcgt?cucgacucug?gguuugaacc?aaagcucgac?ucaugguuug?aaccauuacu?uaauucgugg

uuugaaccau?cacucgacuc?cugguucgaa?ccauccgacg?cgtcat

116

Claims (55)

1. a method that is used to bring out ribonucleic acid (RNA) montage (splicing) and acts on the gene silencing effect of (processing) dependency in human body cell is characterized in that, comprises following steps:

A. construction one gene recombinaton nucleotide (recombinant nucleotide), wherein this gene recombinaton nucleotide comprises the intron (intron) of the meson (intronic insert) of an at least one intron with gene silencing effector (gene silencing effector), this gene silencing effector is connected by an exon (exon), and this intron can separate with this exon and bring out gene silencing effect (RNA-mediated gene silencing) via ribonucleic acid, and this exon connects and can be translated into a protein;

B. this gene recombinaton nucleotide sanction is met (cloning) and enter a carrier (vector); And

C. this carrier of transfection enters among many strains human cell, wherein these human cells produce the parent ribosomal ribonucleic acid (primary RNA) of a plurality of these gene recombinaton nucleotide, this moment the intravital spliceosome of human cell (human cellsspliceosomes) this intron of montage and make and be located away from these parent ribosomal ribonucleic acids, these gene silencing effectors have to mourn in silence and this gene silencing effector sequence is complementary and homologous gene to such an extent as to produce.

2. gene silencing method as claimed in claim 1 is characterized in that, this human cell's strain comprises the human skin cell strain.

3. gene silencing method as claimed in claim 1 is characterized in that, further comprises synthetic this gene recombinaton nucleotide, and wherein this gene recombinaton nucleotide comprises intron and exon.

4. gene silencing method as claimed in claim 1 is characterized in that, this gene recombinaton nucleotide is via DNA (deoxyribonucleic acid) synthesizer (DNA synthesizer) chemosynthesis or connection.

5. gene silencing method as claimed in claim 1, it is characterized in that, this gene recombinaton nucleotide is to connect by genetic engineering method, and this genetic engineering method is to merge exchange (homologous genecombination) from homologous genes, DNA (deoxyribonucleic acid) engages (DNA ligation), insert to change and grow gene (transgeneinsertion), transposon transmits (transposon delivery), jumping gene chimeric (jumping geneintegration), retroviral infection (retroviral infection) and the blended method of above method are selected one.

6. gene silencing method as claimed in claim 1 is characterized in that, further comprises a method of mixing a plurality of these carriers of difference, and wherein this method arrives between the step c between step b.

7. gene silencing method as claimed in claim 1 is characterized in that, at least one this intron comprises a similar bob folder rna structure (hairpin-like RNA structure).

8. gene silencing method as claimed in claim 1 is characterized in that, this gene recombinaton nucleotide is to engage with the DNA (deoxyribonucleic acid) of this intron to make by engineered restriction endonuclease shearing to produce a non-natural gene.

9. gene silencing method as claimed in claim 1 is characterized in that, this gene recombinaton nucleotide is one to have the gene (cellular gene) of the cell of this intron itself.

10. gene silencing method as claimed in claim 9, it is characterized in that the gene of this cell itself is from viral gene, mammalian genes, jumping gene, has protein coding (protein-coding) gene, no protein coding (non-protein-coding) gene and the blended gene of above gene to select one.

11. gene silencing method as claimed in claim 9, it is characterized in that, this intron is by the chimeric gene that enters this cell itself of genetic engineering method, and this genetic engineering method merges exchange (homologous gene combination) from homologous genes, DNA (deoxyribonucleic acid) engages (DNA ligation), insert to change and grow gene (transgene insertion), transposon transmits (transposon delivery), jumping gene chimeric (jumping gene integration), retroviral infection (retroviral infection) and the blended method of above method are selected one.

12. gene silencing method as claimed in claim 1, it is characterized in that, this intron is a nucleotide, this nucleotide comprises this meson with this intron of a gene silencing effector, a branch point district (branch pointmotif), the district of pyrimidine more than (a poly-pyrimidine tract), five terminal montage place (5 '-splice site, 5 ' clip) and one or three end montages place (3 '-splice site, 3 ' clip).

13. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is a nucleotide, this nucleotide sequence is with complementation or homology or both the mode specific gene of mourning in silence, and specific gene is to select one from Tyrosinase (tyrosinase) hyaluronidase (hyaluronidase), adhesion molecule 44 (CD44), adhesion molecule 168 (CD168) and the blended gene of above gene.

14. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is one to have the nucleotide of a gene silencing effector (gene silencing effector), and this gene silencing effector is from lassoing type ribonucleic acid (lariat-form spliced RNA), (the short temporary sense RNA of ribonucleic acid when of short duration, stRNA), anti-meaning ribonucleic acid (antisense RNA, aRNA), bob folder ribonucleic acid (short-hairpin RNA, shRNA), micro ribonucleic acid (microRNA, miRNA), ribose ferment ribonucleic acid (ribozyme RNA), the predecessor of above ribonucleic acid and derivant and the blended ribonucleic acid of above ribonucleic acid select one.

15. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is that an anti-meaning nucleotide (antisense RNA) comprises the complementary rate of sequence for the sequence 30% to 100% of the gene of desiring to mourn in silence, and the complementary rate scope of preferable sequence is 90% to 100%.

16. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is that similar bob folder nucleotide comprises the complementary rate of sequence for the sequence 30% to 100% of the gene of desiring to mourn in silence, and the complementary rate scope of preferable sequence is 35% to 49% or with the sequence that comes from the gene of desiring to mourn in silence.

17. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is that a similar bob folder nucleotide (hairpin-like nucleic acid) comprises a circulus (stem-loop structure), and this similar bob nucleotide sequence is with coming from SEQ.ID.NO.1 or SEQ.ID.NO.2.

18. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is a similar hair clip forerunner micro ribonucleic acid (hairpin-like precursor microRNA, pre-miRNA), this similar hair clip forerunner micro ribonucleic acid sequence homology is in SEQ.ID.NO.8 or SEQ.ID.NO.10 or SEQ.ID.NO.25.

19. gene silencing method as claimed in claim 1 is characterized in that, this gene silencing effector (genesilencing effector) is a micro ribonucleic acid (miRNA), and this micro ribonucleic acid sequence homology is in SEQ.ID.NO.9 or SEQ.ID.NO.11.

20. gene silencing method as claimed in claim 1, it is characterized in that, the meson of this intron (intronicinsert) is and closes (incorporation) and go into this intron, be to be undertaken and close, and the restriction enzyme digestion position is from AatII by at least one restriction enzyme digestion position (restriction site), AccI, AflII/III, AgeI, ApaI/LI, AseI, Asp718I, BamHI, BbeI, BclI/II, BglII, BsmI, Bsp120I, BspHI/LU11I/120I, BsrI/BI/GI, BssHII/SI, BstBI/U1/XI, ClaI, Csp6I, DpnI, DraI/II, EagI, Ecl136II, EcoRI/RII/47III, EheI, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI/II, KasI, KpnI, MaeII/III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, NdeI, NgoMI, NotI, NruI, NsiI, PmlI, Ppu10I, PstI, PvuI/II, RsaI, SacI/II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiI, TaqI, XbaI, XhoI, one is selected in XmaI and the above blended position of cutting, position of cutting.

21. gene silencing method as claimed in claim 12, it is characterized in that, this branch point district (branch pointmotif) comprises a branch point (branch point), and this branch point be a gland nucleoside (adenosine, A) and be positioned at one with the nucleotide sequence of SEQ.ID.NO.5 sequence homology.

22. gene silencing method as claimed in claim 12 is characterized in that, this branch point district comprises a branch point, and this branch point be a gland nucleoside (adenosine, A) and be positioned at a nucleotide sequence and comprise 5 '-TACTAAC-3 '.

23. gene silencing method as claimed in claim 12, it is characterized in that, this many pyrimidines district one has the nucleotide sequence of many thymus pyrimidines (Thymine) and cytosine (Cytosine), and the nucleotide sequence in this many pyrimidines district is with coming from SEQ.ID.NO.6 and SEQ.ID.NO.7.

24. gene silencing method as claimed in claim 12 is characterized in that, this five terminal montage place is a nucleotide sequence and comes from SEQ.ID.NO.3 together.

25. gene silencing method as claimed in claim 12 is characterized in that, this five terminal montage place is a nucleotide sequence and comes from 5 '-GTAAG-3 ' together.

26. gene silencing method as claimed in claim 12 is characterized in that, this three ends montage place is a nucleotide sequence and comes from SEQ.ID.NO.4 together.

27. gene silencing method as claimed in claim 12 is characterized in that, this three ends montage place is a nucleotide sequence and comes from 5 '-CTGCAG-3 ' together.

28. gene silencing method as claimed in claim 1, it is characterized in that, this carrier is a performance carrier, and this carrier is grown gene (transgene), transposon (transposon), counter-rotating seat (retrotransposon), jumping gene, viral vector and the blended carrier of above carrier from plastid (plasmid), coemid (cosmid), phasmid (phagmid), yeast artificial chromosome (yeast artificial chromosome), commentaries on classics.

29. gene silencing method as claimed in claim 1, it is characterized in that this carrier comprises at least one virus or the second type ribonucleic acid polymerase activates son, Kozak rotaring intertranslating start place (Kozak consensus translationinitiation site), polyadenylation signal (polyadenylation signals) and a plurality of restriction enzyme digestions position.

30. gene silencing method as claimed in claim 29, it is characterized in that, this activated viral comprises huge activated viral of cell (cytomegalovirus, CMV promoter), the long end sequence of retrovirus activates son (retrovirus long-terminal region (LTR) promoter), hepatitis virus B activation (hepatitis B virus, HBV), adenovirus activates son (adenovirus AMV promoter), adeno-associated virus activates son (adeno-associated virus (AAV) promoter) and the relevant mosaic virus (plant-associated mosaic virus) of plant activates son.

31. gene silencing method as claimed in claim 29, it is characterized in that the restriction endonuclease of these restriction enzyme digestion positions is from AatII, AccI, AflII/III, AgeI, ApaI/LI, AseI, Asp718I, BamHI, BbeI, BclI/II, BglII, BsmI, Bsp120I, BspHI/LU11I/120I, BsrI/BI/GI, BssHII/SI, BstBI/U1/XI, ClaI, Csp6I, DpnI, DraI/II, EagI, Ecl136II, EcoRI/RII/47III, EheI, FspI, HaeIII, HhaI, HinPI, HindIII, HinfI, HpaI/II, KasI, KpnI, MaeII/III, MfeI, MluI, MscI, MseI, NaeI, NarI, NcoI, NdeI, NgoMI, NotI, NruI, NsiI, PmlI, Ppu10I, PstI, PvuI/II, RsaI, SacI/II, SalI, Sau3AI, SmaI, SnaBI, SphI, SspI, StuI, TaiI, TaqI, XbaI, XhoI, XmaI and the blended restriction endonuclease of above restriction endonuclease select one.

32. gene silencing method as claimed in claim 1, it is characterized in that this carrier further comprises pUC replication initiation (origin of replication), and has any (optional) SV40 replication initiation of SV40 early activation and in mammalian cell that shows at least one antiviral antibiotic gene (antibiotic resistance gene) in prokaryotic cell.

33. gene silencing method as claimed in claim 32, it is characterized in that this antiviral antibiotic gene is can resist to comprise benzylpenicillin (penicillin G), Ampicillin (ampicillin), neomycin (neomycin), paromomycin (paromycin), health mycin (kanamycin), streptomycin (streptomycin), erythromycin (erythromycin), Spike mycin (spectromycin), fiery suddenly mycin (phophomycin), tetracycline (tetracycline), rifamycin (rifapicin), amphotericin B (amphotericin B), be good for his mycin (gentamycin), chloromycetin (chloramphenicol), cephamycin (cephalothin), taimycin (tylosin), G418 and the blended antibiotic of above antibiotic.

34. gene silencing method as claimed in claim 1, it is characterized in that, this carrier enters this human cell by the gene transfection method transfection, and this gene transfection method comprises liposome transfection method (liposomaltransfection), chemistry infection protocol (chemical transfection), chemistry changes shape method (chemicaltransformation), electroporation (electroporation), homologous genes merges exchange (homologousrecombination), transposon TRANSFER METHOD (transposon insertion), jumping gene infection protocol (jumpinggene transfection), viral infection method (viral infection), microinjection (micro-injection), particle bombardment (gene-gun penetration) and the blended method of above method.

35. gene silencing method as claimed in claim 1, it is characterized in that, the parent ribosomal ribonucleic acid of this gene recombinaton nucleotide is produced by re-recording system, and this re-recording system is selected one from the second type re-recording system (Pol-II), the first type re-recording system (Pol-I) and virus transcription system.

36. gene silencing method as claimed in claim 1, it is characterized in that the parent ribosomal ribonucleic acid of this gene recombinaton nucleotide comprises the derivant and the predecessor of Messenger RNA (mRNA), heterogeneous nuclear ribonucleic acid (hnRNA), rRNA (rRNA), transfer RNA (tRNA) tRNA, snoRNA, utricle nuclear ribonucleic acid (snRNA), forerunner's micro ribonucleic acid (pre-miRNA), viral ribonucleic acid (viral RNA) and above ribonucleic acid.

37. gene silencing method as claimed in claim 1, it is characterized in that, this gene silencing effector is to separate with intron by intron excision mechanism (intron excision mechanism), and intron excision mechanism comprises (NMD) the blended hybrid system of system and above system of ribonucleic acid splicing system, nonsense mediation degraded (nonsense-mediated decay).

38. gene silencing method as claimed in claim 1, it is characterized in that this gene silencing effect is to mourn in silence (posttranscriptional gene silencing), The RNA interference (RNAinterference) or NMD systemic effect and produce by back open gene in the cell.

39. a gene recombinaton nucleotide that is used to bring out the gene silencing of ribonucleic acid montage is characterized in that, comprises:

At least one intron with meson (intronic insert) of an intron, wherein this intron is connected by exon and can be handled by ribonucleic acid splicing system in the cell (cellular RNA splicing machinery) and separate; And

A plurality of exons, wherein exon can connect and form a gene with specific function.

40. gene recombinaton nucleotide as claimed in claim 39 is characterized in that, further comprises:

At least one many restriction enzyme digestions position (multiple restriction/cloning site) that is used for connecting the performance carrier of the rna transcription molecule that shows this gene recombinaton nucleotide; And

A plurality of correct rna transcription molecules that are used for forming this gene recombinaton nucleotide transcribe and translate termination (transcription and translation termination sites).

41. gene recombinaton nucleotide as claimed in claim 39 is characterized in that, this intron comprises:

One has the meson of an intron of a gene silencing effector;

One five terminal montage place and one or three end montages place;

One branch point district; And

The district of pyrimidine more than.

42. gene recombinaton nucleotide as claimed in claim 39, it is characterized in that, the meson of this intron (intronic insert) is a nucleotide, this nucleotide sequence is with complementation or homology or both the mode specific gene of mourning in silence, and specific gene is to select one from Tyrosinase (tyrosinase) hyaluronidase (hyaluronidase), adhesion molecule 44 (CD44), adhesion molecule 168 (CD168) and the blended gene of above gene.

43. gene recombinaton nucleotide as claimed in claim 39, it is characterized in that, the meson of this intron (intronic insert) is one to have a gene silencing effector nucleotide, and this gene silencing effector is from lassoing type ribonucleic acid (lariat-form spliced RNA), (the short temporary senseRNA of ribonucleic acid when of short duration, stRNA), anti-meaning ribonucleic acid (antisense RNA, aRNA), bob folder ribonucleic acid (short-hairpinRNA, shRNA), micro ribonucleic acid (microRNA, miRNA), ribose ferment ribonucleic acid (ribozyme RNA), the predecessor of above ribonucleic acid and derivant and the blended ribonucleic acid of above ribonucleic acid select one.

44. gene recombinaton nucleotide as claimed in claim 39, it is characterized in that, the meson of this intron (intronic insert) is that an anti-meaning nucleotide comprises the complementary rate of sequence for the sequence 30% to 100% of the gene of desiring to mourn in silence, and the complementary rate scope of preferable sequence is 90% to 100%.

45. gene recombinaton nucleotide as claimed in claim 39, it is characterized in that, the meson of this intron (intronic insert) is that a similar clip nucleotide comprises the complementary rate of sequence for the sequence 30% to 100% of the gene of desiring to mourn in silence, and the complementary rate scope of preferable sequence is 35% to 49% or with the sequence that comes from the gene of desiring to mourn in silence.

46. gene recombinaton nucleotide as claimed in claim 39, it is characterized in that, the meson of this intron (intronic insert) is that a similar clip nucleotide (hairpin-like nucleic acid) comprises a circulus (stem-loop structure), and this similar clip nucleotide sequence is with coming from SEQ.ID.NO.1 or SEQ.ID.NO.2.

47. gene recombinaton nucleotide as claimed in claim 39, it is characterized in that, the meson of this intron (intronic insert) is a similar clip forerunner micro ribonucleic acid (hairpin-like precursormicroRNA, pre-miRNA), this similar clip forerunner micro ribonucleic acid sequence homology is in SEQ.ID.NO.8 or SEQ.ID.NO.10 or SEQ.ID.NO.25.

48. gene recombinaton nucleotide as claimed in claim 41, it is characterized in that, this gene silencing effector (genesilencing effector) is a micro ribonucleic acid (miRNA), and this micro ribonucleic acid sequence homology is in SEQ.ID.NO.9 or SEQ.ID.NO.11.

49. gene recombinaton nucleotide as claimed in claim 41 is characterized in that, this branch point district comprises a branch point, and this branch point be a gland nucleoside (adenosine, A) and be positioned at one with the nucleotide sequence of SEQ.ID.NO.5 sequence homology.

50. gene recombinaton nucleotide as claimed in claim 41 is characterized in that, this branch point district comprises a branch point, and this branch point is a gland nucleoside and is positioned at a nucleotide sequence and comprises 5 '-TACTAAC-3 '.

51. gene recombinaton nucleotide as claimed in claim 41, it is characterized in that, this many pyrimidines district one has the nucleotide sequence of many thymus pyrimidines (Thymine) and cytosine (Cytosine), and the nucleotide sequence in this many pyrimidines district is with coming from SEQ.ID.NO.6 and SEQ.ID.NO.7.

52. gene recombinaton nucleotide as claimed in claim 41 is characterized in that, this five terminal montage place is a nucleotide sequence and comes from SEQ.ID.NO.3 together.

53. gene recombinaton nucleotide as claimed in claim 41 is characterized in that, this five terminal montage place is a nucleotide sequence and comes from 5 '-GTAAG-3 ' together.

54. gene recombinaton nucleotide as claimed in claim 41 is characterized in that, this three ends montage place is a nucleotide sequence and comes from SEQ.ID.NO.4 together.

55. gene recombinaton nucleotide as claimed in claim 41 is characterized in that, this three ends montage place is a nucleotide sequence and comes from 5 '-CTGCAG-3 ' together.

Images