WO2012138599A2 - Hepatocyte growth factor mimics as therapeutic agents - Google Patents
Hepatocyte growth factor mimics as therapeutic agents Download PDFInfo
- Publication number
- WO2012138599A2 WO2012138599A2 PCT/US2012/031815 US2012031815W WO2012138599A2 WO 2012138599 A2 WO2012138599 A2 WO 2012138599A2 US 2012031815 W US2012031815 W US 2012031815W WO 2012138599 A2 WO2012138599 A2 WO 2012138599A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hgf
- group
- isoleucine
- cysteine
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/06—Tripeptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/07—Tetrapeptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/02—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/02—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link
- C07K5/021—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link containing the structure -NH-(X)n-C(=0)-, n being 5 or 6; for n > 6, classification in C07K5/06 - C07K5/10, according to the moiety having normal peptide bonds
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
- C07K5/08—Tripeptides
- C07K5/0802—Tripeptides with the first amino acid being neutral
- C07K5/0804—Tripeptides with the first amino acid being neutral and aliphatic
- C07K5/0808—Tripeptides with the first amino acid being neutral and aliphatic the side chain containing 2 to 4 carbon atoms, e.g. Val, Ile, Leu
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the invention generally relates to the development of hepatocyte growth factor (HGF) mimics that can act as mimetics (agonists) or antagonists.
- HGF hepatocyte growth factor
- Mimetics act: to enhance cognitive function; as general neuroprotective/neuroregenerative agents; to facilitate wound repair; to improve insulin sensitivity and glucose transport; and to decrease tissue or organ fibrosis in order to prevent or reverse the symptoms of dementia, to protect from or reverse
- Antagonists act, for example, as anti-angiogenic and anti-cancer agents; to treat various malignancies and diseases like macular degeneration and diabetic retinopathy, which are associated with hypervascularization.
- Dementia There are approximately 10 million diagnosed dementia patients in the United States alone and that number continues to grow every year as the population ages. The costs of treatment and care of these patients are in excess of $70 billion annually and are increasing rapidly. Unfortunately, the current treatment options for the management of dementia are severely limited and largely ineffective. The lack of treatment options for a burgeoning health problem of this magnitude necessitates that new and innovative therapeutic approaches be developed as quickly as possible.
- HGF neurotrophic factor
- HGF and c-Met are actively expressed in both the developing and adult brains and nerves.
- the Met system is essential for both the central and peripheral nervous systems to function properly.
- a large number of studies have shown that HGF and c-Met are expressed in multiple areas of the brain including the frontal cortex, subependyma, thalamus, cerebellar cortex, deep gray matter, and the hippocampus, an important area for cognition.
- HGF/c-Met signaling is neurotrophic (Honda et al., 1995) and protective (Zhang et al., 2000; Takeo et al, 2007; Tyndall and Walikonis, 2007; Takeuchi et al., 2008). Similar to its activities in other tissues, Met in the brain is involved in development, acting as a guidance factor during differentiation, motogenesis and neuritogenesis (Ebens et al, 1996; Sun et al., 2002; Tyndall and Walikonis, 2007). HGF/ c-Met signaling has also been shown to promote healing of neuronal injury (Trapp et al., 2008), especially after ischemic brain injury (Takeo et al., 2007). HGF also displayed neuroprotective effects in animal models for
- HGF amyotrophic lateral sclerosis
- ALS Amyotrophic Lateral Sclerosis: ALS is a fatal rapid-onset neurodegenerative disease that is characterized by degeneration of motoneurons in the spinal cord and efferent neurons in the motor cortex and brainstem. The impact of this degeneration results in a progressive loss of muscle function culminating in total paralysis. Approximately 90% of the cases of ALS are classified as sporadic with no known etiology, while the remaining 10% appear to be familial, resulting in part from defects in copper/zinc superoxide dismutase 1 (SOD1), which leads to exaggerated oxidative stress and an unfolded protein response. The one thing that both forms of ALS have in common is that there is currently is no effective treatment available.
- SOD1 copper/zinc superoxide dismutase 1
- HGF hepatocyte growth factor
- HGF histoneum kinase receptor
- HGF is a potent neurotrophic factor (Maina and Klein, 1993; Kato et al., 2009) in many brain regions and that it is particularly effective as a pro-survival/regenerative factor for motoneurons (Ebens et al., 1996; Yamamoto et al., 1997; Hayashi et al., 2006; Elsen et al., 2009).
- Parkinson's Disease A treatment option long considered for many neurodegenerative diseases including Parkinson's disease (PD) has been the application of growth factors with the intention of halting disease progression, restoring lost function, or hopefully both (review, Rangasamy et al., 2010).
- PD Parkinson's disease
- growth factors are universally large proteins that are both metabolically labile and too large to pass the blood- brain barrier (BBB).
- BBB blood- brain barrier
- most approaches to delivery have utilized gene therapy methods with the hope that the growth factor will be expressed in the correct location at a high enough concentration and for a long enough period to provide clinical relief.
- GDNF Wang et al., 2011
- HGF hepatocyte growth factor
- c-Met its type I tyrosine kinase- receptor
- HGF neuroprotective effect of the HGF on the nigrostriatal pathway, however, should be no surprise given its recognized role in stem cell regulation, the development of tubular structures (Santos et al., 1993) and its general proliferative, anti-apoptotic, motogenic, and morphogenic actions on many cell types including hepatocytes and cells of epithelial origin (Gherardi et al., 1993).
- HGF is a potent neurotrophic factor for many neuronal cell types (Kato et al, 2009) including motoneurons ( Elsen et al., 2009; Hayashi et al, 2006), hippocampal neurons Lim et al., 2008), cerebellar granular cells (leraci et al., 2002), and sympathetic neurons (1999).
- HGF appears to be a critical regulator of neural stem cell expansion and differentiation (Nicoleau et al., 2009) suggesting that neural as well as many types of peripheral stem cells are under the control of the HGF/c-Met system.
- TBI Underlying TBI is physical injury to the brain resulting in decreased synaptic connectivity among neurons, loss and death of neurons, damage to cerebral blood vessels resulting in ischemic/hypoxic-induced damage, and secondary glial scaring.
- This loss of neurons and diminished synaptic connectivity is particularly apparent in the hippocampus (Gao et al., 2011 ; Zhang et al., 201 la; Zhang et al., 201 lb) resulting in defective long-term potentiation (Schwarzbach et al., 2006) and cognitive deficits (e.g. Dikmen et al., 2009; Patel et al., 2010).
- TBI associated injuries that result in neuronal loss and decreased synaptic connectivity denote the need for therapies which support neuronal repair and/or replacement.
- These clinical endpoints advocate for the therapeutic use of neurotrophic factors which mediate neural development, neurogenesis, neuroprotection, and
- synaptogenesis for treating TBI.
- neurotrophic factors have been considered as treatment options for TBI (Kaplan et al., 2010; Richardson et al., 2010; Qi et al., 201 1).
- One particularly attractive but mostly overlooked neurotrophic factor is HGF, which has a proven ability to both stimulate neurogenesis (Shang et al., 201 1 ; Wang et al., 201 1) and synaptogenesis (see preliminary studies below).
- HGF neurotrophic factor
- HGF and wound healing Excessive scarring is typified by unnecessary accumulation of ECM components in the wound, due to an inappropriate balance between synthesis and degradation. Therapy for pathologic scarring may be directed at inhibiting the synthesis and promoting the degradation of the ECM.
- HGF in the skin promotes wound healing effectively in several ways: motivating the proliferation and motility of dermal vascular endothelial cells; stimulating the motility of epidermal keratinocytes; enhancing local blood supply; and accelerating the re-epithelialization of the wound (Nakanishi et al., 2002). Re- epithelialization inhibits the formation of scars. Studies have shown that HGF gene transfer accelerates dermal wound healing by stimulating angiogenesis and reepithelialization (Nakanishi et al., 2002). Therapeutic approaches that augment HGF/SF would be expected to promote wound healing and prevent scar formation.
- HGF as a treatment option for metabolic syndrome and diabetes:
- Several recent studies have implicated the critical role of the HGF/c-Met system in the regulation of glucose handling, insulin secretion, and tissue insulin sensitivity. Together these investigations have highlighted the therapeutic potential of augmenting the HGF/c-Met system for the treatment of type 2 diabetes and metabolic syndrome (Fafalios et al., 201 1 ; Flaquer et al., 2012)).
- Angiogenesis is defined as the formation of new blood vessels from existing vascular bed, It is a prime requirement in physiological processes such as wound healing and the menstrual cycle, on the other hand, it is an essential step for multiple pathological conditions, like cancer, macular degeneration, atherosclerosis, diabetic retinopathy, neovascular glaucoma, psoriasis and rheumatoid arthritis. Consequently, the modulation of angiogenesis, whether it was through encouraging therapeutic angiogenesis or by stopping pathologic angiogenesis, is an exhilarating prospect for modern medicine. The equilibrium between physiological and pathological angiogenesis is mediated by the communication of numerous endogenous angiogenic and anti-angiogenic modulators.
- HGF vascular endothelial growth factor
- HGF/c-Met inhibitors are clinically relevant anti-angiogenic agents. (Gherardi et al, 2012).This is probably attained through multiple pathways, achieved either by direct or indirect action on endothelial cells.
- HGF as anti-fibrotic agent: Fibrotic disease takes many forms and is a major contributor to degraded function in the heart, kidney, and liver secondary to many pathological states including myocardial infarction, diabetes, and alcoholism. Hepatocyte growth factor (HGF) is showing a strong anti-fibrotic effect with remarkable effectiveness in ameliorating tissue fibrosis in a wide range of animal models HGF exhibits a remarkably powerful anti-fibrotic effect that ameliorates tissue fibrosis in a wide range of animal models and tissues (Liu and Yang, 2006). Evidence has documented the therapeutic effect of exogenous HGF in chronic allograft nephropathic rats, a model of chronic inflammation and progressive tissue scarring. The intramuscular administration of the human HGF gene reduced the rate of mortality, restrained inflammation and infiltration, and reduced renal fibrosis (Liu and Yang, 2006).
- Coronary artery disease (CAD) ischemic events and myocardial infarction are the major causes of cardiac failure in the Western world. The only option for severe coronary blockage and atherosclerosis is bypass surgery. Two pathological events in CAD play major roles in the loss of cardiac function observed in CAD: 1 ) blockage of the coronary arteries resulting in decreased blood perfusion to the heart; and 2) the formation of fibrotic tissue after cardiac insult resulting in ventricle remodeling and decreased compliance. Increased levels of HGF in the circulation have been reported after acute myocardial Infarction (Zhu et al., 2000; Jin et al., 2003).
- HGF vascular endothelial growth factor
- fibrotic tissue This increase in circulating HGF can be used as biological marker for heart injury and gives a clue regarding its protective role (Ueda et al., 2001).
- Pharmaceuticals that enhance the HGF/Met signaling could potentially be used in the treatment of myocardial infarction, providing protection against oxidative stress and cell death due to apoptosis as well as reducing the formation of fibrotic tissue (Ahmet et al., 2002; Kondo et al., 2004;
- HGF is known to protect the liver against external insults
- HGF generation has also been associated with several liver and extra-hepatic diseases.
- Experimental and clinical evidence indicates that HGF plays a crucial role in liver regeneration.
- Liver cirrhosis is the irreversible end result of fibrous scarring and hepatocellular regeneration and is a major cause of morbidity and mortality worldwide with no effective therapy.
- liver cirrhosis has been defined as a chronic disease of the liver in which dispersed damage and regeneration of hepatic parenchymal cells have taken place and in which dissemination of connective tissue has resulted in inadequate organization of the lobular and vascular structures (Fujimoto and Kaneda, 1999; Kaibori et al., 2002).
- approaches for the treatment of liver cirrhosis should include attenuation of fibrogenesis, encouragement of hepatocyte mitosis, and reformation of tissue architecture.
- neurotrophic factor as a therapeutic agent has two serious limitations: 1) large size and hydrophilic character precluding blood-brain barrier permeability (BBB); and 2) the need to be manufactured by recombinant methods at high cost, thus limiting its widespread use.
- BBB blood-brain barrier permeability
- HGF mimetics which are described herein, some of which are orally active, display profound pro-cognitive/anti-dementia/ neuroprotective activity, and are inexpensive to synthesize.
- Antagonists Improper activation of the c-Met receptor can be encouraged by genetic activating mutations, transcriptional upregulation or by ligand-dependent autocrine or paracrine mechanisms.
- Cancer is a heterogeneous group of diseases that result from the accumulation of genetic mutations. These mutations cause altered function in proto- oncogenes leading to dysregulation of DNA repair, proliferation, and apoptotic signaling (Tannock, 2005).
- the dysregulation in the signals within a group of cells leads to the uncontrolled growth, and invasion that either directly intrudes upon and destroys adjacent tissue or metastasizes and spread to other location in the body through the lymphatic system or the blood stream.
- HGF/c-Met pathway is one of the most dysregulated pathways in human malignancies, which include, but are not limited to: bladder, breast, cervical, colorectal, endometrial, esophageal, gastric, head and neck, kidney, liver, lung, nasopharyngeal, ovarian, pancreatic, prostate, and thyroid cancers (http://www.vai.org/met/).
- Activation of Met in cancer occurs most often through ligand autocrine or paracrine activation.
- Osteosarcomas and globlastoma mutliforme which express both c-Met and HGF are examples of dysfunctional autocrine control.
- c-Met over-expression has been reported in human primary tumors while HGF is provided by stromal cells and not the tumor itself (Houldsworth et al., 1990; Kuniyasu et al., 1992; Hara et al., 1998; Tong et al., 2004; Miller et al, 2006; Bean et al., 2007).
- HGF itself is able to trigger the transcription of c-Met (Boccaccio et al., 1994), and it is thus HGF, which is universally expressed by stromal cells throughout the body that typically drives tumor over expression of c-Met (Aguirre Ghiso et al., 1999; Parr et al., 2004).
- HGF can also abnormally stimulate c-Met in an autocrine manner, as depicted in
- c-Met is used as a general marker for cancer, is also an indicator of biological significance with respect to malignancy and patient prognosis, with high levels correlated with a poor prognosis. Molecules that inhibit c-Met and HGF can therefore be expected to interfere with the molecular causes of many cancers, and should significantly help in attenuating Recent studies from the Harding lab have confirmed the potential use of HGF antagonists as effective anti-cancer/anti-angiogenic agents (Yamamoto et al., 2010, Kawas et al., 201 1 ; Kawas et al., 2012).
- Age-related macular degeneration is the most common cause of irreversible vision loss in Americans over the age of 60. It is predicted that 10 million Americans will suffer from some level of this age-related visual damage during their retirement years.
- RPE retinal pigment epithelial
- RPE retinal pigment epithelial
- HGF/SF growth factors
- VEGF vascular endothelial growth factor
- Proliferative diabetic retinopathy which entails a distinctive neovascularization of the retina that is characterized by the invasion of vessels into the vitreous cavity, is coupled with bleeding and scarring around the proliferative channel (Katsura et al., 1998).
- PDR Proliferative diabetic retinopathy
- bFGF basic fibroblast growth factor
- IGF-I Insulin-like growth factors
- VEGF vascular endothelial growth factor
- HGF has the most pronounced effects on endothelial growth and mitogenic activity (Boulton, 1999).
- FIG. 1 A, B, and C Effect of Dihexa on spatial learning in the water maze.
- Dihexa was given orally 1.25 mg/kg/day (low dose) and 2 mg/kg/day (high dose). This was done daily before the first training trial. There were 5 trials per day for 8 days. The latency to find the pedestal was considered a measure of learning and memory. Rats receiving high dose Dihexa were able to completely overcome the
- FIG. 3A-E Time dependent effects of Nle'-AnglV and Dihexa treated neurons on spinogenesis.
- Hippocampal neurons transfected with mRFP-P-actin were treated with 10 "12 M Dihexa or Nle'-Ang IV for 5 days in culture or for 30 minutes prior to fixation on day in vitro 12 (DIV12), promote spinogenesis.
- Nlel-AnglV and Dihexa increase spine head width.
- the width of the spine head was measured as an indication of synaptic strength.
- Spine heads with a greater surface area can accommodate more neurotransmitter receptors and are more likely to form functional synapses.
- the AnglV analogue treatment-induced increase in spine head width suggests facilitated neurotransmission.
- FIG. 5A-G Neurotransmitter patterns for Nlel-AnglV and Dihexa stimulated neurons.
- Dihexa and Nlel-AnglV treated neurons were immunostained for the universal presynaptic marker synapsin and the glutamatergic presynaptic marker VGLUT1.
- the percent correlation between the postsynaptic spines (red) and presynaptic puncta (green) were measured as an indication of functional synapses.
- B) Bar graph representing the percent correlation of treatment-induced postsynaptic spines to the glutamatergic presynaptic marker VGLUT1. A high percent correlation between the presynaptic marker and the postsynaptic spines suggests that functional connections are formed (P > 0.05; mean ⁇ S.E.M.; n 25).
- FIG. 6A and B Mini-excitatory postsynaptic currents (mEPSCs) in dissociated hippocampal neurons.
- Nlel-AnglV and Dihexa treatment increase the frequency of mini- excitatory postsynaptic currents (mEPSCs).
- Recordings were done on dissociated hippocampal neurons treated with vehicle, 10 "12 M Nlel-AnglV or Dihexa for 5 days prior to recording. The currents recorded were spontaneous bursts of AMPA-mediated synaptic transmission in the absence of action potentials carried in the presence of strychnine, picrotoxin and tetrodotoxin.
- FIG. 7A and B Evaluation of Nlel-AnglV- and Dihexa-dependent spinogenesis in CA1 hippocampal neurons from rat organotypic hippocampal slice cultures. Nlel- AnglV- and Dihexa were found to support spinogenesis in CA1 hippocampal neurons.
- Organotypic hippocampal slice cultures (400 ⁇ thicknesses), representing a more intact environment, were biolistically transfected with the soluble red fluorescent protein Tomato.
- CA1 hippocampal neurons were selected for evaluation because of their known plastic response during learning.
- Slices were obtained from postnatal day 5 rats.
- Hippocampal slice cultures were biolistically transfected with the red soluble protein Tomato on DIV3 and stimulated with Dihexa or HGF on DIV5.
- Organotypic hippocampal slice cultures maintain a more intact perforant path and therefore represent a more intact environment.
- FIG. 10A-D Effect of HGF treatment on synaptogenesis in dissociated hippocampal neurons.
- HGF treatment supports the formation of functional synapses as indicated by a high correlation between postsynaptic spines (red) and markers of presynaptic active zones (green).
- FIG. 11 Effect of Dihexa and HGF treatment on the frequency of mEPSCs in dissociated hippocampal neurons.
- Dissociated hippocampal neurons transfected with mRFP-p-actin were stimulated with 10 " ' 2 M Dihexa or 10 ng/ml for 5 days prior to recording mEPSCs.
- Neurons were treated with tetrodotoxin, picrotoxin, and strychnine to suppress action potential, GABA-dependent inhibition, and glycine-dependent inhibition.
- Figure 12A and B Effect of maximal and sub-threshold doses of Angiotensin IV analogues and HGF on spinogenesis.
- a sub-threshold dose of the parent compound Nlel-Ang IV (10 " ' 3 M) also does not affect basal spine levels.
- FIG. 13A-D The effect of the novel HGF antagonist Hinge on angiotensin IV ligand- and HGF-mediated spinogenesis.
- FIG 14A-D Effect of the HGF antagonist Hinge on HGF- and Dihexa-mediated enhancement of mEPSCs in dissociated hippocampal neurons.
- Dissociated hippocampal neurons were treated with Hinge (10 "12 M), HGF, Dihexa (10 "12 M) or HGF (lOng/ml) for 5 days after at which time mEPSCs were recorded in the absence of action potentials.
- Hinge 10 "12 M
- HGF Dihexa
- HGF lOng/ml
- FIG 15A-B Distribution of c-Met protein in the adult rat brain. Gross brain regions were obtained from adult Sprague-Dawley rats and acutely frozen in liquid nitrogen. The samples were homogenized, separated by electrophoresis and immunoblotted for c-Met protein and actin. A) The bar graph represents the amount of c-Met (unspecified units) in distinct brain regions of importance to cognition. The brain samples were compared to liver where HGF is produced. B) A representative Western blot of the samples probed against c- Met protein (bands are at 145 kDa) and actin serving as a loading control. Equal amounts of protein were loaded in each lane based on BCA protein determinations.
- hippocampal slices To test whether Dihexa could activate the c-Met receptor in the adult rat brain, hippocampal slices were acutely stimulated for 30 minutes with HGF, Dihexa or vehicle (aCSF). Receptor activation was measured by phosphorylation of the c-Met receptor by Western blot. Saturating doses of HGF (100 ng/ml) and Dihexa (10 " 10 M) effectively augment c-Met phosphorylation in acutely stimulated adult hippocampal slices compared to vehicle treated slices. Sub-threshold doses of HGF (50 ng/ml) and Dihexa (10 ⁇ 12 M) did not significantly increase c-Met receptor phosphorylation compared to control.
- FIG. 18 Effect of the HGF mimetic, Dihexa, HGF-dependent cell scattering.
- Cell scattering was assessed in MDCK cells. Cells were grown to confluence on coverslips, which were then transferred to a clean plate. After treatment for four days, the number of cells that had scattered off the coverslip was quantitated.
- HEX Dihexa at 10 "10 M.
- FIG. 19 Verification of c-Met receptor knockdown. Receptor knockdown was confirmed by transfecting HEK cells with niRFP-P-actin (untransfected), a 6Myc-tagged cMet gene product that served to verify presence of protein, shRNA (c-Met) sequences (only shl was employed for the knock-down experiment) and both shRNA's combined. The transfected cells were cultured for a further 24 hours then lysed with RIPA buffer and prepared for gel electrophoresis. The samples were probed against Myc by Western blot. Untransfected cells serving as the negative control showed no signal, the 6-Myc-tagged cMet gene product was the positive control and had a strong signal. Both the shMetl and shMet2 sequences considerably attenuated the signal and combined did not have a signal indicating effective knock down of the receptor.
- FIG. 20 Effect of c-Met knock-down on spinogenesis using a shRNA.
- the picture shows a Western blot probed for Myc.
- Hippocampal neurons transfected with mRFP-p-actin alone or with shMet to knock down the c-Met receptor were stimulated with HGF (10 ng/ml), Dihexa (10-12 M) or Nlel-AnglV (10-12 M) for 48 hours.
- Neurons transfected with mRFP- ⁇ -actin and stimulated with HGF, Dihexa or Nlel-AnglV significantly increased spinogenesis (* P ⁇ 0.05; mean ⁇ S.E.M.; n 100).
- HGF and c-Met have a function in spatial learning and memory.
- the latency to locate a submerged pedestal in the Morris water maze task of spatial learning and memory was tested on rats to ascertain the effects of HGF/c-Met on learning and memory.
- Rats treated with the scopolamine ⁇ scopolamine are unable to learn the task as measured by latency to escape.
- the group latencies for rats treated with aCSF ⁇ aCSF were significantly shorter than the scopolamine treated group on day one of training.
- Norleual and -D-Nle-Tyr-Ile-NH-(CH 2 ) 5 -CONH 2 were incubated in heparinized rat blood at 37°C; the figure shows percent recovery over time (mean ⁇ SD).
- the calculated stability ti /2 based on single phase exponential decay for Norleual was 4.6 min and for D-Nle- Tyr-Ile-NH-(CH 2 )5-CONH 2 stability ti 2 was 79.97 min.
- Figure 23 Binding of D-NIe-X-Ile-NH-(CH 2 )5-CONH 2 analogs to HGF.
- FIG. 25 Inhibition of Met phosphorylation by D-Nle-X-Ile-NH-(CH 2 ) s -CONH 2 analogs.
- HEK293 cells were treated for 10 min with HGF+/- Nle-X-Ile-(6) amino-hexanoic amide analogs at the indicated concentrations.
- HEK293 cell lysates were immunoblotted with anti-phospho-Met and anti-Met antibodies.
- FIG. 26 Effects of D-NIe-X-IIe-NH-(CH 2 )s-CONH 2 analogs on MDCK cell proliferation.
- the Hinge peptide (KDYIR ) which represents the dimerization domain of HGF, was included as a positive control.
- the cells were allowed to grow for 4 days. Cell numbers were estimated on the fourth day with an MTT assay by measuring absorbance at 590.
- Figure 27 Effect of D-Nle-X-Ile-NH-(CH 2 ) 5 -CONH 2 analogs on HGF-dependent scattering in MDCK cells.
- Cell scattering in which cells lose the cell-to-cell contacts and then migrate rapidly is the classic response to HGF.
- Figure 28 Correlation between inhibition of MDCK cell scattering and interference with dimerization and the affinity to bind HGF.
- Three derivatives of the D-Nle-X-Ile-(6)amino- hexanoic amide, where X is: Cys, Trp, or Met were examined to determine whether the percent of inhibition of dimerization and the binding affinity for each compound for HGF could be correlated to in vitro cellular activity, namely inhibition of MDCK cell scattering.
- FIG. 29 Inhibition of B16-F10 melanoma lung colonization by D-Nle-Cys-Ile-NH-(CH 2 )j- CONH 2 .
- 400,000 B16-F10 murine melanoma cells were injected into the tail vein of C57BL/6 mice. Mice received daily IP injections of D-Nle-Cys-Ile-(6)-amino-hexanoic amide (10 ⁇ g/kg/day or 100 ⁇ g kg/day) or PBS vehicle.
- D-Nle-Cys-Ile-(6)-amino-hexanoic amide 10 ⁇ g/kg/day or 100 ⁇ g kg/day
- PBS vehicle PBS
- Ri is an N-acyl group such as, for example, hexanoyl, heptanoyl, pentanoyl, butanoyl, propanoyl, acetanoyl, or benzoyl,
- an amino acid such as, for example, lysine, arginine, norvaline, ornithine, or S-benzyl cysteine amino acid residues;
- R 2 is an amino acid (D or L), such as, for example, tyrosine, cysteine, phenyalanine, aspartic acid, glutamic acid, glycine, tryptophan, lysine, homocysteine, homoserine, homophenylalanine;
- R3 is a D or L isoleucine, leucine or valine amino acid residue
- n ranges from 3-6;
- covalent bonds 1, 2 and 3 are either peptide bonds (e.g. -CO-NH- or reduced peptide bonds (CH 2 -NH 2 ).
- hexafluorophosphate N-oxide (HBTU; 2.9 equivalents) was added and the suspension mixed for 30 minutes. The solution was then removed by filtration. The resin was then washed twice with DMF, twice with methanol, twice with dichloromethane, and finally twice more with DMF. Solutions were removed by filtration after each wash. Coupling efficiency was monitored using a Kaiser test for free amines. If the test was positive the amino acid was re- coupled to the resin or growing peptide chain. If the test indicated a good linkage, the resin was washed once more with DMF, deprotected with 20% piperidine/ DMF for 30 minutes as indicated above, and again washed with DMF. The coupling then proceeded as indicated above.
- HBTU hexafluorophosphate N-oxide
- the peptide resin is incubated with 20% of the appropriate acyl anhydride in DMF and DIPEA (1.5 equivalents) for 30 minutes at room temperature. The resin was now washed twice with DMF, twice with methanol, twice with dichloromethane, and finally twice more with DMF. The solution was removed by filtration and a Kaiser test was performed to verify the completeness of the capping. If free amine was detected the capping procedure was repeated.
- the resin was transferred to a sintered glass funnel (4 porosity) and the DMF removed by vacuum.
- the semi-dry resin was then suspended in 20% trifluoroacetic acid (TFA) with 2.5% triisopropyl-silane as a scavenger, incubated at room temperature for 15 minutes, and filtered.
- TFA trifluoroacetic acid
- the resin was washed three times with additional DMF and filtered.
- Ten volumes of ice-cold diethyl ether were added to the combined filtrates and the mixture allowed to set at 4°C overnight.
- Precipitated peptide was recovered by filtration and washed three times with ice-cold ether. For very hydrophobic peptides the combined ether washes were re-extracted with DMF, allowed to precipitate peptide, and filtered to recover additional peptide.
- Crude peptides were first purified by reverse phase HPLC using a C 18 column using gradient elution. The typical gradient was 10% to 40% component B over 30 minutes at a flow rate of 1 ml/min at 37°C where component A was 80 mM triethyamine phosphate, pH 3.0 and component B was acetonitrile (ACN). In all instances only a single peak with 215nm absorption was detected and collected. The collected compound was lyophilized and redissolved in 20% methanol and injected onto a second CI 8 column. .
- the HPLC MS system used was from Shimadzu (Kyoto, Japan), consisting of a CBM-20A communications bus module, LC-20AD pumps, SIL-20AC auto sampler, SPD-M20A diode array detector and LCMS-2010EV mass spectrometer. Data collection and integration were achieved using Shimadzu LCMS solution software.
- the analytical column used was an Econosphere CI 8 (100mm x 2.1mm) from Grace Davison Discovery Science (Deerfield, IL, USA).
- the mobile phase consisted of HPLC grade methanol and water with 0.1% trifluoroacetic acid.
- Separation was carried out using a non-isocratic method (20% - 50% methanol over 30 min) at 37°C and a flow rate of 0.3 mL/min.
- MS analysis a positive ion mode (Scan) was used and peaks analyzed at the anticipated m/z. Typical peak purity analysis revealed a peak purity index of >0.95. Wavelength ratioing with the diode array detector further confirmed peak purity.
- Table 1 presents a listing of compounds in Family 1, drawn to mimetics, and Famillies 2-5, drawn to antagonists, all of which have been synthesized and analyzed according to the procedures described above.
- R_ (N-acyl group) R2 R3 hexanoyl Tyr le pb heptanoyl Tyr le pb pentanoyl Tyr ie pb butanoyl Tyr le pb propanoyl Tyr le pb acetanoyl Tyr le pb benzoyl Tyr le pb hexanoyl Tyr e ⁇
- tyrosine and isoleucine at R 2 and R 3 , respectively
- a wide range of amino acid and other residues might be used for the mimetics or agonists (Family 1 and Families 2- 5, respectively) in the practice of embodiments of the invention at these other positions including, without limitation, tyrosine, cysteine, methionine, phenylalaine, aspartic acid, glutamic acid, histidine, tryptophan, lysine, leucine, valine, homocysteine, homoserine, and homophenyalanine.
- mimetics include certain N-acyl groups as specified in Table 1 (Family 1), in the practice of various embodiments of the invention other N-acyl groups or substituted or unsubstituted phenyl groups may be used at R] .
- a number of the agonists in Table 1 (Families 2-5) have norleucine at Ri, or an amino acid residue
- a number of an amino acid residues (D or L) may be used at residue Ri, including without limitation, tyrosine, phenylalanine, aspartic acid, arginine, isoleucine, serine, histidine, glycine, cysteine, methionine, tryptophan, norvaline, ornithine, S-benzyl cysteine amino acid residues.
- residue Ri including without limitation, tyrosine, phenylalanine, aspartic acid, arginine, isoleucine, serine, histidine, glycine, cysteine, methionine, tryptophan, norvaline, ornithine, S-benzyl cysteine amino acid residues.
- the methyl repeats (n) could range from 3-6 within the practice of the some of the embodiments of the present invention.
- HGF mimetic activity was typically assessed by one or both of two methods:
- HEK293 Human embryonic kidney cells 293 (HEK293), Madin Darby canine kidney cells (MDCK), and B16F10 murine melanoma cells were grown in DMEM, 10% fetal bovine serum (FBS). Cells were grown to 90-100% confluency before use. For most but not all studies HEK and MDCK cells were serum starved for 24 hours prior to the initiation of drug treatment.
- HEK293 cells were seeded in 6 well tissue culture plates and grown to 95% confluency in DMEM containing 10% FBS. The cells were serum deprived for 24 hours prior to the treatment to reduce the basal levels of phospho-Met. Following serum starvation, cocktails comprised of vehicle and HGF (2.5 ng/ml) with/without the test compound were prepared and pre- incubated for 30 minutes at room temperature. The cocktail was then added to the cells for 10 minutes to stimulate the Met receptor and downstream proteins. Cells were harvested using RIPA lysis buffer (Upstate) fortified with phosphatase inhibitor cocktails 1 and 2 (Sigma- Aldrich; St. Louis, MO).
- the lysate was clarified by centrifugation at 15,000 g for 15 minutes, protein concentrations were determined using the BCA total protein assay, and then appropriate volumes of the lysates were diluted with 2x reducing Laemmli buffer and heated for ten minutes at 95° C. Samples containing identical amounts of protein were resolved using SDS-PAGE (Criterion, BioRad Laboratories), transferred to nitrocellulose, and blocked in Tris-buffered saline (TBS) containing 5% milk for one hour at room temperature. The phospho-Met antibody was added to the blocking buffer at a final concentration of 1 : 1000 and incubated at 4° C overnight with gentle agitation.
- the membranes were then washed several times with water and TBS (PBS, 0.05% Tween-20), a 1 :5000 dilution of horseradish-peroxidase conjugated goat anti-rabbit antiserum was added, and the membranes further incubated for one hour at room temperature. Proteins were visualized using the Supersignal West Pico Chemiluminescent Substrate system (Pierce, Fenton, MO) and molecular weights determined by comparison to protein ladders
- MDCK cells were grown to 100% confluency on the coverslips in six-well plates and washed twice with PBS. The confluent coverslips were then aseptically transferred to new six well plates containing 900 ⁇ serum free DMEM. Norleual, Hinge peptide, and/or HGF (2.5 ng/ml) were added to appropriate wells. Control wells received PBS vehicle.
- D-norleucine F 5 pb pb pb D-norleucine C 5 pb pb pb D-norleucine s 5 pb pb pb D-norleucine T 5 pb pb pb D-norleucine D 5 pb pb pb D-norleucine E 5 pb pb pb D-norleucine G 5 pb pb pb pb
- D-norleucine F 5 ⁇ pb pb D-norleucine C 5 ⁇ pb pb D-norleucine s 5 ⁇ pb pb D-norleucine T 5 ⁇ pb pb D-norleucine D 5 ⁇ pb pb D-norleucine E I 5 ⁇ pb pb
- analogs or growth factor mimics of the present invention may also be represented as comprised of four elements joined by covalent peptide or reduced peptide bonds, as follows:
- I an acid such as heptanoic, hexanoic, pentanoic, butyric, proprionic, acetic, benzoic, or substituted benzoic acid, and isoforms thereof; or D or L norleucine, , lysine, arginine, norvaline, ornithine, or S-benzyl cysteine
- ⁇ a D or L cysteine, phenyalanine, aspartic acid, glutamic acid, serine, tyrosine, glycine, homocysteine, homoserine or homophenylalanine amino acid residue;
- rV amino-hexanoic, amino-pentanoic or amino butyric acid; wherein elements I, II, III and rV are joined by peptide or reduced peptide bonds.
- the analog is: hexanoic-tyrosine-isoleucine-(6)-amino-hexanoic amide.
- Rl hexanoyl
- R2 Tyr
- R3 He
- n 5.
- I hexanoic acid
- II Tyr
- III He
- IV hexanoic amide.
- Embodiments of the invention involve providing one or more HGF mimics to a subject in need thereof.
- exemplary subjects or patients which might benefit from receiving therapy such as administration of the one or more HGF mimics described herein are generally mammals, and usually humans, although this need not always be the case, since veterinary and research related applications of the technology are also contemplated.
- a suitable subject or patient in need of therapy are identified by, for example, a health care professional or professionals using known tests, measurements or criteria.
- a suitable subject or patient in need of therapy are identified by, for example, a health care professional or professionals using known tests, measurements or criteria.
- a subjects already having symptoms of dementia, or being at risk of developing symptoms of dementia will be identified. Similar identification processes will be followed for other diseases and/or disorders (e.g., cancer therapy, other cognitive dysfunction therapies, etc.).
- a suitable treatment protocol is then developed based on the patient, the disease and/or disorder and its stage of development, and the HGF mimic and its dosage and delivery format, as well as other relevant factors.
- the subject then receives treatment with HGF mimic.
- Embodiments of the invention also comprise one or more steps related to monitoring the effects or outcome of administration in order to evaluate the treatment protocol and/or to adjust the protocol as required or in a manner that is likely to provide more benefit, e.g. by increasing or decreasing doses of medication, or by changing the particular type of mimic that is administered, or by changing the frequency of dosing or the route of administration, etc.
- cognitive enhancement for example, while in some cases the improvement in cognition (or the prevention of loss of cognition) that occurs may be complete, e.g.
- compositions comprising the
- compositions which comprise the HGF analogs/mimics as described herein, usually together with a pharmacologically suitable carrier or diluent.
- one substantially purified HGF mimic is present in a composition; in other embodiments more than one HGF mimic is present, each HGF mimic being substantially purified prior to being mixed in the composition.
- the preparation of pharmacologically suitable compositions for use as medicaments is well known to those of skill in the art. Typically, such compositions are prepared either as liquid solutions or suspensions, however solid forms such as tablets, pills, powders and the like are also contemplated. Solid forms suitable for solution in, or suspension in, liquids prior to administration may also be prepared. The preparation may also be emulsified.
- the active ingredients may be mixed with excipients which are
- Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol and the like, or combinations thereof.
- the composition may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and the like. If it is desired to administer an oral form of the composition, various thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders and the like may be added.
- the composition of the present invention may contain any such additional ingredients so as to provide the composition in a form suitable for administration.
- the final amount of HGF mimic in the formulations may vary. However, in general, the amount in the formulations will be from about 1% to about 99%.
- the HGF mimic compositions (preparations) of the present invention may be administered by any of the many suitable means which are well known to those of skill in the art, including but not limited to: by injection, inhalation, orally, intravaginally, intranasally, by ingestion of a food or product containing the mimic, topically, as eye drops, via sprays, etc.
- the mode of administration is orally or by injection.
- the compositions may be administered in conjunction with other treatment modalities such as other agents which are used to treat, for example, dementia or the conditions which cause dementia in the patient, examples of which include but are not limited to the administration of anti-depressants and psychoactive drugs, administration of dopamine and similar agents.
- the HGF mimics may be administered together with analgesics and other suitable drugs.
- one or more HGF mimics may be used in combination with one or more different bioactive drugs.
- the amount of HGF inhibitor that is administered may be in the range of from about 0.1 to about 1,000 mg/kg, an preferably in the range of from about 1 to about lOOmg/kg, although as one of skill in the art will recognize, the precise amount may vary depending on one or more attributes of the drug recipient, including but not limited to: weight, overall health, gender, age, nationality, genetic history, other conditions being treated, etc., and larger or smaller doses are within the practice of this invention. Dosing may also take place periodically over a period of time, and the dosage may change (increase or decrease) with time.
- the HGF mimics of the invention may be used to treat a variety of cognitive function disorders (cognitive dysfunction) as well as other disorders that are related to HGF activity or lack thereof.
- “Cognitive function” or “cognition” as used herein refers to a range of high-level brain functions, including but not limited to: the ability to learn and remember information; the ability to organize, plan, and problem-solve; the ability to focus, maintain, and shift attention as necessary; and to understand and use language; the ability to accurately perceive the environment; the ability to perform calculations.
- Such functions include but are not limited to memory (e.g. acquiring, retaining, and retrieving new information); attention and concentration (particularly divided attention); information processing (e.g. dealing with information gathered by the five senses); executive functions (e.g.
- visuospatial functions e.g. visual perception and constructional abilities
- verbal fluency and speech e.g. word-finding
- general intellect e.g. "intelligence”
- long-term remote memory
- conversational skills e.g. reading comprehension; etc.
- cognitive dysfunction we mean the loss of such abilities. Losses may be measured, detected and/or diagnosed in any of the many ways known to those of ordinary skill in the art.
- Such methods include but are not limited to: the use of standardized testing administered by a professional (puzzles, word games or problems, etc.); by self-reporting and/or the reports of caretakers, friends and family members of an afflicted individual; by observation of the activities, life skills, habits and coping mechanisms of the individual by professional or lay persons; by the results of questionnaires administered to an afflicted individual; etc.
- Such disorders may be caused, for example, by a decrease in synaptic connectivity and/or neuron density due to a variety of factors.
- the loss is caused by a brain injury, e.g. traumatic brain injury. Traumatic brain injury, which is occurring at record levels as a result of wars and sporting activities, is characterized by reduced neuronal connectivity.
- HGF mimetics represents a viable treatment option.
- Such brain injuries may be the result of an external trauma to the brain, e.g. caused by a high impact accident (e.g. a car accident, a fall, etc.), a shooting incident, a sports injury (e.g. caused by impact to the head such a boxers and football players experience); injuries received in combat, etc.
- injuries may be the result of internal brain trauma, e.g. as the result of stroke, aneurism, surgical procedure, tumor, etc. or other types of conditions which result in lack of oxygen to the brain or to sections of the brain; injuries due to inhalation of toxic gases; due to aging of the brain; to diseases and disorders which exert a deleterious effect on the nervous system and/or brain, such as multiple sclerosis, Parkinson's disease, Huntington's disease, brain disorders such as schizophrenia, etc.
- the HGF mimics may be used for the treatment of dementia.
- dementia we mean a serious loss of cognitive ability in a previously unimpaired person, beyond what might be expected from normal aging. It may be static, the result of a unique global brain injury, or progressive, resulting in long-term decline due to damage or disease in the body. Although dementia is far more common in the geriatric population, it may occur in any stage of adulthood.
- the term “dementia” may include and/or be caused by e.g. Alzheimer's disease, vascular dementia, dementia with Lewy bodies, etc. or combinations of these.
- Alzheimer's disease may be excluded from this definition.
- Other causes of dementia which may be treated as described herein include but are not limited to hypothyroidism and normal pressure hydrocephalus.
- Inherited forms of the diseases which cause or are associated with dementia that may treated as described herein include but are not limited to: frontotemporal lobar degeneration,
- Alzheimer's disease vascular dementia
- dementia pugilistica progressive cognitive disturbance may be caused by psychiatric illness, alcohol or other drug abuse, or metabolic disturbances.
- Certain genetic disorders can cause true neurodegenerative dementia in younger populations (e.g. 45 and under). These include familial Alzheimer's disease, SCA17 (dominant inheritance); adrenoleukodystrophy (X-linked); Gaucher's disease type 3, metachromatic leukodystrophy, Niemann-Pick disease type C, pantothenate kinase- associated neurodegeneration, Tay-Sachs disease and Wilson's disease. Vitamin deficiencies and chronic infections may also occasionally mimic degenerative dementia.
- encephalopathy or delirium may develop relatively slowly and result in dementia.
- Possible causes include brain infection (viral encephalitis, subacute sclerosing panencephalitis, Whipple's disease) or inflammation (limbic encephalitis, Hashimoto's encephalopathy, cerebral vasculitis); tumors such as lymphoma or glioma; drug toxicity (e.g. anticonvulsant drugs); metabolic causes such as liver failure or kidney failure; and chronic subdural hematoma.
- the dementia that is treated according to methods of the present invention may also be the result of other conditions or illnesses. For example, there are many medical and neurological conditions in which dementia only occurs late in the illness, or as a minor feature.
- a proportion of patients with Parkinson's disease develop dementia
- Cognitive impairment also occurs in the Parkinson-plus syndromes of progressive supranuclear palsy and corticobasal degeneration (and the same underlying pathology may cause the clinical syndromes of frontotemporal lobar degeneration).
- Chronic inflammatory conditions of the brain may affect cognition in the long term, including Behcet's disease, multiple sclerosis, sarcoidosis, Sjogren's syndrome and systemic lupus erythematosus.
- inherited conditions may also cause dementia alongside other features include: Alexander disease, Canavan disease, cerebrotendinous xanthomatosis, fragile X-associated tremor/ataxia syndrome, glutaric aciduria type 1 , Krabbe's disease, maple syrup urine disease, Niemann Pick disease type C, Kufs' disease, neuroacanthocytosis, organic acidemias, Pelizaeus-Merzbacher disease, urea cycle disorders, Sanfilippo syndrome type B, and spinocerebellar ataxia type 2.
- the HGF mimics of the invention may be used for neuroprotection and/or to treat neurodegenerative diseases, some of which also involve dementia as described above.
- the HGF mimics may be administered propylactically, i.e. prior to a subject's encounter with or exposure to a potential neurohazard.
- the mimics may be administered prior to exposure to a drug, chemical or medical procedure that is known or likely to cause neuronal damage.
- HGF neurodegenerative diseases
- the general pro-survival anti-apoptotic activity of HGF supports the use of HGF mimetics for treating neurodegenerative diseases including but not limited to Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS), etc.
- Parkinson's disease Huntington's disease
- ALS amyotrophic lateral sclerosis
- the mimics may be used for the treatment of "depression”, by which we mean major depressive disorder (MDD) (also known as recurrent depressive disorder, clinical depression, major depression, unipolar depression, or unipolar disorder) and also depression that is characteristic of bipolar disorder, etc.
- MDD major depressive disorder
- depression is ultimately a disease in which neurons and synaptic contacts are lost in the hippocampus.
- the capacity of HGF to induce new synaptic connections and stimulate neurogenesis in the hippocampus supports the use of HGF mimetics for the treatment of depression.
- predispositions to cognitive dysfunction may also be increased, e.g. persons with genetic disorders such as Down's syndrome, lack of proper brain development e.g. due to lack of oxygen before or during birth, various congenital disorders which interfere with brain development, etc.
- the HGF mimics can inhibit the HGF/Met system, and therefore can be used as anti-cancer agents.
- the HGF mimics may be used to attenuate malignant and metastatic transformations.
- the HGF mimics have application in the therapy of Fibrotic Disease. Hepatic, renal, cardiac, and pulmonary fibrosis is a growing problem in our aging population. Unfortunately, the degradation of function that accompanies fibrotic changes is difficult to treat. The dramatic ability of HGF to inhibit or reverse tissue fibrosis suggests that orally-active HGF mimics provides a therapeutic option.
- the HGF mimics have application in the therapy of Peripheral Vascular Disease: Lower Extremity Arterial Disease. Vascular disease resulting in poor perfusion is a common sequel of diabetes, obesity, and atherosclerosis.
- One treatment option is the induction of new collateral vessels in the effected organs and tissues.
- the potent angiogenic activity of HGF and HGF mimics can provide a clinical utility for the treatment of vascular insufficiency.
- HGF mimics may also be used for Wound Healing. Defective wound healing is a hallmark of diabetics and burn victims. The ability of HGF to promote wound healing because of its angiogenic and mitogenic activities supports the use of HGF mimics to enhance the wound healing process. Data indicates that several HGF mimics are effective wound repair enhancers in both normal and diabetic individuals.
- Nlel-YIH tetrapeptide
- Nlel-YI tripeptide
- additional active analogues were synthesized with improved metabolic stability, blood brain barrier permeability, and oral activity.
- this Example we show the characterization of the novel, orally active, angiotensin IV analogue Dihexa.
- An intracerebroventricular (icv) guide cannula (PE-60, Clay Adams; Parsippany, NY) was stereotaxically positioned (Model 900, David Kopf Instruments; Tujunga, CA) in the right hemisphere using flat skull coordinates 1.0 mm posterior and 1.5 mm lateral to bregma (refer to Wright et al. 1985).
- the guide cannula measured 2.5 cm in overall length and was prepared with a heat bulge placed 2.5 mm from its beveled tip, thus acting as a stop to control the depth of penetration. Once in position, the cannula was secured to the skull with two stainless-steel screws and dental cement.
- the water maze consisted of a circular tank painted black (diameter: 1.6 m; height: 0.6 m), filled to a depth of 26 cm with 26-28° C water.
- a black circular platform (diameter: 12 cm; height: 24 cm) was placed 30 cm from the wall and submerged 2 cm below the water surface.
- NW n, NE, SW, and SE.
- Entry points were at the quadrant corners (i.e. N, S, E, and W) and were pseudo-randomly assigned such that each trial began at a different entry point than the preceding trial.
- Each member of the treatment groups in the scopolamine studies received an icv injection of scopolamine hydrobromide (70 nmol in 2 ⁇ aCSF over a duration of 20 s) 30 min prior to testing followed by Dihexa 10 min prior to testing.
- Control groups received scopolamine or aCSF 20 min prior to testing followed by aCSF 10 min prior testing.
- the behavioral testing protocol has been described previously in detail (Wright et al. 1999).
- the rats in the aged rat study on received Dihexa of aCSF (control group).Briefly, acquisition trials were conducted on 8 consecutive days with 5 trial s/day. On the first day of training the animal was placed on the platform for 30 s prior to the first trial.
- Trials commenced with the placement of the rat facing the wall of the maze at one of the assigned entry points.
- the rat was allowed a maximum of 120 s to locate the platform. Once the animal located the platform it was permitted a 30 s rest period on the platform. If the rat did not find the platform, the experimenter placed the animal on the platform for the 30 s rest period. The next trial commenced immediately following the rest period.
- Hippocampal cell culture preparation Hippocampal neurons (2xl0 5 cells per square cm) were cultured from P 1 Sprague Dawley rats on plates coated with poly-L-lysine from Sigma (St.Louis, MO; molecular weight 300,000). Hippocampal neurons were maintained in Neurobasal A media from Invitrogen (Carlsbad, CA) supplemented with B27 from
- Invitrogen 0.5 mM L-glutamine, and 5mM cytosine-D-arabinofuranoside from Sigma added at 2 days in vitro. Hippocampal neurons were then cultured a further 3-7 days, at which time they were either transfected or treated with various pharmacological reagents as described in (Wayman, Davare et al. 2008).
- Dendrite length was determined using the National Institutes of Health's Image J 1.41o program (NIH, Bethesda, MD) and the neurite tracing program Neuron J (Meijering, Jacob et al. 2004) Spines were manually counted.
- Hippocampi from P4 Sprague Dawley rats were cultured as previously described (Wayman, Impey et al. 2006). Briefly, 400 ⁇ slices were cultured on (Milipore, Billerica, MA) for 3 days after which they were biolistically transfected with tomato fluorescent protein (TFP) using a Helios Gen Gun (BioRad, Hercules, CA), according to the manufacturer's protocol, to visualize dendritic arbors. Following a 24 hour recovery period slices were stimulated with vehicle (H?0), lpM Nlel-AnglV or Dihexa for 2 days. Slices were fixed and mounted. Hippocampal CA1 neuronal processes were imaged and measured as described above.
- the total number of actin enriched spines adjacent to VGLUT1 or Synapsin were counted and converted to a percentage as the percent correlation of treatment-induced spines to presynaptic markers is a strong indicator of ability to transmit excitatory signals.
- the number of correlations consisted of red fluorescent- tagged actin spines against green PSD-95 immunopositive puncta which, when merged, resulted in an orange spine.
- mEPSCs Miniature EPSCs
- mEPSCs were isolated pharmacologically by blocking GABA receptor chloride channels with picrotoxin (100 ⁇ ; Sigma), blocking glycine receptors with strychnine (1 ⁇ ; Sigma), and blocking action potential generation with tetrodotoxin (TTX, 500 nM; Tocris).
- Analog signals were low-pass Bessel filtered at 2 kHz, digitized at 10 kHz through a Digidata 1440A interface (Molecular Devices), and stored in a computer using Clampex 10.2 software (Molecular Devices).
- the membrane potential was held at -70 mV at room temperature (25°C) during a period of 0.5 - 2 h after removal of the culture from the incubator. Liquid junction potentials were not corrected.
- Data analysis was performed using Clampfit 10.2 software (Molecular Devices), and Mini-Analysis 6.0 software (Synaptosoft Inc.; Fort Lee, NJ).
- the criteria for successful recording included the electrical resistance of the seal between the outside surface of the recording pipette and the attached cell >2 GO, neuron input resistance >240 ⁇ .
- the mEPSCs had a 5-min recording time.
- Nlel-AnglV has long been known to be a potent cognitive enhancing agent (Wright and Harding, 2008 ) but is limited in terms of clinical utility by its metabolic instability
- Dihexa N-hexanoic-Tyr-Ile-(6)-aminohexanoic amide
- the behavioral data suggest a quick mechanism of action is taking place during acquisition of the spatial memory task. Therefore the ability of both Dihexa and Nlel-AnglV to promote spinogenesis was measured by an acute 30 minute application on the final day of culturing ( Figure 3 E).
- niRFP-p-actin transfected neurons were immuno- stained against synaptic markers. Hippocampal neurons were stimulated for 5 days in vitro with 10 "12 M Dihexa or Nlel-AnglV ( Figure 5A-F). Nlel-AnglV and Dihexa's
- VGLUT1 Vesicular Glutamate Transporter 1
- the percent correlation for the newly formed spines to the synaptic markers was calculated as a measure for the formation of functional synapses. Dihexa and Nlel-AnglV treatment-induced spines did not differ from control treated neurons in percent correlation to VGLUT1 , Synapsin or PSD-95 (P > 0.05) ( Figure 5A, C and E and Table 4).
- Table 4 Summary of the percent correlation to markers of synaptic components and the number of spines induced by Dihexa and Nlel-AnglV treatment.
- the total number of spines for each treatment group is indicated as the number of spines per 50 ⁇ dendrite length.
- mEPSCs mini postsynaptic excitatory currents
- Dihexa like Nlel-AnglV was a potent cognitive enhancer when given either ICV or orally.
- Dihexa and Nlel-AnglV both promoted spinogenesis and enhance synaptogenesis in cultured rat hippocampal neurons.
- Dihexa exerted spine induction effects at sub-nano-molar concentrations
- Nlel-AnglV and Dihexa stimulated hippocampal neurons were immunostained against the glutamatergic presynaptic marker VGLUT1 (Balschun, Moechars et al. 2010), the general presynaptic marker Synapsin (Ferreira and Rapoport 2002) and the postsynaptic marker PSD-95 (Kennedy 1997; Han and Kim 2008) to decipher neurotransmitter phenotypes.
- Nlel-AnglV and Dihexa increase miniature synaptic activity by increasing dendritic spine densities and altering the morphological phenotype of postsynaptic spines in-vitro and may represent the mechanism that underlies facilitated learning observed AnglV analogues (Wright, Stubley et al. 1999; Lee, Albiston et al. 2004).
- organotypic hippocampal slice cultures that maintain an environment representative of an intact hippocampus were employed and evaluated for treatment-induced spinogenesis.
- Application of 10 "12 M Nel -AnglV and Dihexa in ballistically transfected hippocampal slices significantly increase spine densities ( Figure 7) implying that such changes may in fact be occurring in the intact hippocampus.
- Dihexa fits the criteria necessary for an effective anti-dementia drug: 1) it is orally active, as it survives passage through the gut and enters the brain; 2) it augments neuronal connectivity, a necessary property when faced with loss of neuronal connectivity; and 3) it is inexpensive to synthesize thus making it accessible to patients.
- EXAMPLE 2 The Target of AnglV Analogs is Hepatocyte Growth Factor
- This Example shows that the novel angiotensin IV ligand Dihexa and its parent molecule Nlel-AnglV act through the HGF/c-Met receptor system.
- An intracerebroventricular (icv) guide cannula PE- 60, Clay Adams; Parsippany, NY was stereotaxically positioned (Model 900, David Kopf Instruments; Tujunga, CA) in the right hemisphere using flat skull coordinates 1.0 mm posterior and 1.5 mm lateral to bregma (Wright et al., 1985).
- the guide cannula measured 2.5 cm in overall length and was prepared with a heat bulge placed 2.5 mm from its beveled tip, thus acting as a stop to control the depth of penetration. Once in position, the cannula was secured to the skull with two stainless-steel screws and dental cement.
- the water maze consisted of a circular tank painted black (diameter: 1.6 m; height: 0.6 m), filled to a depth of 26 cm with 26-28° C water.
- a black circular platform (diameter: 12 cm; height: 24 cm) was placed 30 cm from the wall and submerged 2 cm below the water surface.
- NW, NE, SW, and SE The maze was operationally sectioned into four equal quadrants designated NW, NE, SW, and SE. For each rat the location of the platform was randomly assigned to one of the quadrants and remained fixed throughout the duration of training. Entry points were at the quadrant corners (i.e. N, 8, E, W) and were pseudo-randomly assigned such that each trial began at a different entry point than the preceding trial.
- Each member of the treatment groups received an icv injection of scopolamine hydrobromide (70 nmol in 2 ⁇ aCSF over a duration of 20 s) 20 min prior to testing followed by Dihexa (300 pmol in 2 ⁇ aCSF), Hinge (300 pmol in 2 ⁇ aCSF), or Hinge + Dihexa (300 pmol in 4 ⁇ aCSF) 5 min prior to testing.
- This scopolamine preparation is a generally accepted animal model of the spatial memory dysfunction that accompanies dementia (Fisher et al., 2003).
- Control groups received scopolamine or aCSF 20 min prior to testing followed by aCSF 5 min prior testing.
- the behavioral testing protocol has been described previously in detail (Wright et al., 1999). Briefly, acquisition trials were conducted on 8 consecutive days, 5 trials/day. On the first day of training the animal was placed on the pedestal for 30 s prior to the first trial. Trials commenced with the placement of the rat facing the wall of the maze at one of the assigned entry points. The rat was allowed a maximum of 120 s to locate the platform. Once the animal located the platform it was permitted a 30 s rest period on the platform.
- the experimenter placed the animal on the platform for the 30 s rest period. The next trial commenced immediately following the rest period. Upon completion of each daily set of trials the animal was towel-dried and placed under a 100 watt lamp for 10-15 min and then returned to its home cage.
- One-way ANOVA was used to analyze the dendritic spine results and significant effects were analyzed by Tukey post-hoc test. Morris water maze data set mean latencies to find the platform during each daily block of five trials were calculated for each animal for each day of acquisition. One-way ANOVAs were used to compare group latencies on Days 1, 4, and 8 of training. Significant effects were analyzed by Newman-Keuls post-hoc test with a level of significance set at P ⁇ 0.05.
- MDCK cells were grown to 100% confluency on the coverslips in six -well plates and washed twice with PBS. The confluent coverslips were then aseptically transferred to new six well plates containing 900 ⁇ serum free DMEM. Norleual, Hinge peptide, and/or HGF (20 ng/ml) were added to appropriate wells. Control wells received PBS vehicle. Plates were incubated at 37°C with 5% C0 2 for 48 hours. Media was removed and cells were fixed with methanol. Cells were stained with Diff-Quik Wright-Giemsa (Dade-Behring, Newark, DE) and digital images were taken. Coverslips were removed with forceps and more digital images were captured. Pixel quantification of images was achieved using Image J and statistics were performed using Prism 5 and InStat v.3.05.
- Hippocampal neurons (2xl0 5 cells per square centimeter) were cultured from Pl-2 Sprague Dawley rats on plates coated with poly-L- lysine from Sigma (St.. Louis, MO;
- Hippocampal neurons were maintained in Neurobasal A media from Invitrogen (Carlsbad, CA) supplemented with B27 from Invitrogen, 0.5 mM L- glutamine, and 5mM cytosine-D-arabinofuranoside from Sigma added at 2 days in vitro. Hippocampal neurons were then cultured a further 3-7 days, at which time they were either transfected or treated with various pharmacological reagents as described in the text or figure legends.
- LipofectAMINETM 2000 (Invitrogen) according to the manufacturer's protocol. This protocol yielded the desired 3-5% transfection efficiency thus enabling the visualization of individual neurons. Higher efficiencies obscured the dendritic arbor of individual neurons. Expression of fluorescently tagged actin allowed clear visualization of dendritic spines, as dendritic spines are enriched in actin.
- vehicle H20
- peptides as described in the text
- DIV12 the neurons were fixed (4% paraformaldehyde, 3% sucrose, 60 mM PIPES, 25 mM HEPES, 5 mM EGTA, 1 mM MgCl 2 , pH 7.4) for 20 min at room temperature and mounted.
- aCSF aCSF
- hemispheres were separated by a mid-saggital cut and both hippocampi removed.
- Slices were sectioned cross- and length-wise (400 ⁇ ) to ensure penetrability of the drug, using a Mcllwain tissue chopper (Brinkmann, Gomshall, UK) and transferred to a gassed (95% 0 2 /5% CO?) incubation chamber containing aCSF for 90 minutes at room temperature.
- aCSF was removed by careful suctioning and replaced with aCSF containing vehicle (aCSF + aCSF), 100 ng/ml with carrier free adult recombinant Hepatocyte Growth Factor (HGF) (R and D Systems, MN, USA) in aCSF, 10 "10 M Hinge (Harding lab), 50 ng/ml in aCSF, 10 "10 M Dihexa (Harding lab) in aCSF, 10 "12 M Dihexa in aCSF or 50 ng/ml HGF + 10 " 12 M Dihexa in aCSF for 30 minutes at 37°C with gentle rocking.
- HGF Hepatocyte Growth Factor
- aCSF was removed and the slices were lysed using RIPA buffer (Upstate/Milipore, Billerica, MA) and inhibitor Cocktails I and II (Sigma, St.Louis, MO), sonicated on ice and clarified by centrifugation for 30 minutes, 13,000 rpm at 4°C. The supernatant was removed from the pellet and stored at -80°C or processed immediately for gel electrophoresis.
- RIPA buffer Upstate/Milipore, Billerica, MA
- inhibitor Cocktails I and II Sigma, St.Louis, MO
- a target sequence for c-Met was designed using RNAi central design program (see the website located at cancan.cshl.edu/). The target sequence
- GTGTCAGGAGGTGTTTGGAAAG (SEQ ID NO: 2) was inserted into pSUPER vector (Oligoengine, Seattle WA) which drives endogenous production of shRNA under the HI promoter.
- the shRNA was transfected into cells using the lipofectamine method described above. Verification of receptor knockdown was done by creating a c-Met-6-Myc tagged gene product using the Gateway cloning system (Invitrogen).
- the Met protein coding sequence was cloned from rat whole brain cDNA using primers obtained from Integrated DNA
- the amplified product was gel purified and a band corresponding to 190 kDa band excised and cloned into a PCAGGS-6-Myc destination vector (Gateway).
- Protein concentration of the samples was quantified using the BCA method (Pierce,
- Transfected neurons were treated, fixed and stained as previously described in
- VGLUT1 Synaptic Systems, Goettingen, Germany
- Balschun, Moechars et al. was employed and for general presynaptic transmission synapsinl (Synaptic Systems, Goettingen, Germany) (Ferreira and Rapoport 2002) was applied.
- a postsynaptic function was established by PSD-95 (Milipore, Billerica, MA) (El-Husseini, Schnell et al. 2000). In each instance the total number of spines was counted for the treatment groups, control, Nlel-AnglV and Dihexa, to ensure an active phenotype.
- the total number of actin enriched spines (red) adjacent to VGLUT1 or Synapsin were counted and converted to a percentage as the percent correlation of treatment-induced spines to presynaptic markers is a strong indicator of ability to transmit excitatory signals.
- the number of correlations consisted of red fluorescent-tagged actin spines against green PSD-95 immuno-positive puncta which, when merged, resulted in an orange spine.
- the culture medium was exchanged by an extracellular solution containing (in mM) 140 NaCl, 2.5 KC1, 1 MgCl 2 , 3 CaCl 2 , 25 glucose, and 5 HEPES; pH was adjusted to 7.3 with KOH; osmolality was adjusted to 310 mOsm. Cultures were allowed to equilibrate in a recording chamber mounted on inverted microscope (IX-71 ; Olympus optical, Tokyo) for 30 min before recording.
- IX-71 inverted microscope
- the pipette-to-bath DC resistance of patch electrodes ranged from 4.0 to 5.2 ⁇ , and were filled with a internal solution of the following composition (in mM): 25 CsCl, 100 CSCH3O3S, 10 phosphocreatine, 0.4 EGTA, 10 HEPES, 2 MgCl 2 , 0.4 Mg-ATP, and 0.04 Na-GTP; pH was adjusted to 7.2 with CsOH; osmolality was adjusted to 296 - 300 mOsm.
- mEPSCs Miniature EPSCs
- TTX tetrodo toxin
- Analog signals were low-pass Bessel filtered at 2 kHz, digitized at 10 kHz through a Digidata 1440A interface (Molecular Devices), and stored in a computer using
- Clampex 10.2 software (Molecular Devices). The membrane potential was held at -70 mV at room temperature (25°C) during a period of 0.5 - 2 h after removal of the culture from the incubator. Liquid junction potentials were not corrected. Data analysis was performed using Clampfit 10.2 software (Molecular Devices), and Mini-Analysis 6.0 software (Synaptosoft Inc.; Fort Lee, NJ). The criteria for successful recording included the electrical resistance of the seal between the outside surface of the recording pipette and the attached cell >2 GQ, neuron input resistance >240 ⁇ . The mEPSCs had a 5-min recording time.
- Hepatocyte Growth Factor Augments the dendritic architecture and Supports Synaptogenesis Dihexa and Nlel-AnglV have previously been shown to induce spinogenesis in mRFP-P-actin transfected hippocampal neurons (see Example 1); however the mechanism underlying this action was unknown. Because of the ability of Norleual, another AnglV analogue to block the action of HGF on c-Met (Yamamoto et al., 2010) we hypothesized that increases in spine density initiated by Dihexa and Nlel-AnglV are mediated by the HGF/c- Met system. As such, the effects of HGF on spinogenesis in dissociated hippocampal cultures were evaluated.
- Hippocampal neurons were transfected with mRFP-P-actin on day in vitro (DTV) 6 and stimulated with HGF for 5 days.
- Hippocampal slices which were biolistically transfected with the soluble red fluorescent protein Tomato were stimulated with 10 ng/ml HGF, 10 " M Dihexa or vehicle for 48 hours.
- CA1 hippocampal neurons which are known to undergo plastic changes in response to learning were easily singled out for analysis based on morphology.
- mRFP-p-actin transfected hippocampal neurons were immunostained for a general marker of presynaptic active zones, synapsin (Ferreira and Rapoport; 2002) as well as a marker specific to glutamatergic synapses, Vesicular Glutamate Transporter 1 (VGLUT1) (Balschun, Moechars et al. 2010).
- Dissociated hippocampal neurons transfected with mRFP-P-actin were stimulated for 5 days with sub-threshold concentrations of HGF and Dihexa (2.5 ng/ml + lO " 13 M, respectively), biologically active doses of HGF (10 ng/ml), Dihexa or Nlel-AnglV (10 " 12 M) or a combination of sub-threshold doses of 2.5 ng/ml HGF + 10 "12 M Dihexa or 2.5 ng/ml HGF + 10 "12 M Nlel-AnglV.
- the results are presented in Figures 12 A and B.
- Biologically active doses of HGF (10 ng/ml), Dihexa and Nlel-AnglV (10 ⁇ 12 M) produced a significant effect over control treated spines (mean ⁇ S.E.M.
- Hinge DYIRNC, SEQ ID NO: 3
- MDCK Madin-Darby canine kidney
- Hinge was tested for its effects on dissociated hippocampal neurons and was found to have no effect on spinogenesis over a wide range of doses, thus indicating that Hinge and the HGF/c-Met system do not have a significant role in the basal spinogenesis seen in the cultured neurons (Figure 13A).
- Hinge did effectively inhibit spine formation in neurons stimulated with 10 ng/ml HGF (Figure 13B), 10 "12 M Nlel-AnglV ( Figure 13C) or 10 ⁇ 12 M Dihexa ( Figure 12D) further supporting the contention that these actions are mediated by the HGF/c-Met system.
- Hinge HGF
- HGF HGF
- Dihexa 10 ⁇ 12 M
- Hinge + HGF 10 "12 M + 10 ng/ml, respectively
- Hinge + Dihexa 10 " M each.
- HGF and Dihexa frequencies were
- the proposed angiotensin IV receptor HGF is the ligand for the tyrosine kinase receptor c-Met.
- Dihexa is independently capable of activating the HGF/c-Met system in the adult rat brain alone as well as in conjunction with HGF.
- Dihexa able to dramatically augment the ability of HGF to activate c-Met by phosphorylation in HEK293 cells ( Figure 17) and stimulate MDCK cell scattering ( Figure 18).
- HGF HGF/c-met
- shRNA for c-Met was employed to knock-down the receptor.
- Dissociated hippocampal neurons were transfected with mRFP-p-actin and shMet RNA and receptor knock-down was allowed to take place for 48 hours prior to stimulating with 0.5 ⁇ g (per well) HGF (10 ng/ml), Dihexa or Nlel-AnglV (both at 10 "12 M). Longer exposure appeared to be detrimental or toxic to the neurons.
- the Morris water maze a hippocampal-dependent spatial learning task requiring rats to locate a pedestal hidden beneath the surface of the water by orienting themselves to extra- maze cues was employed to evaluate the impact of the HGF antagonist, Hinge, on the pro- cognitive effects of Dihexa.
- the groups tested included aCSF followed by aCSF, scopolamine (70 nM) followed by aCSF, scopolamine followed by Dihexa (300 pM), aCSF followed by Hinge (300 pM) and scopolamine + Hinge followed by Dihexa.
- Figure 21 represents the mean latencies to find the hidden pedestal for days 1-8 of training in the water maze.
- angiotensin TV analogues suggest that anti-dementia drugs based on this system can be developed (Braszko, Kupryszewski et al. 1988; Stubley- Weatherly, Harding et al. 1996; Pederson, Harding et al. 1998; Wright, Stubley et al. 1999).
- angiotensin IV and many AnglV analogues due to poor metabolic stability of angiotensin IV and many AnglV analogues, the inability of early analogues to penetrate the blood brain barrier, and the failure to identify the AT4 receptor, no pharmaceutical company has moved forward with their development.
- Dihexa a novel angiotensin IV analogue synthesized by our laboratory, is stable and orally active and has thus overcome the major pharmacokinetic impediments preventing development.
- Dihexa has been proven to be stable in the blood for over 5 hours (not shown), survived passage through the gut to penetrate the blood brain barrier, and overcomes cognitive deficits in acute and chronic models of dementia (not shown).
- HGF/c-Met system Both systems appear to mediate similar physiological effects.
- the Angiotensin IV/AT4 system has cerebroprotective effects (Wright, Clemens et al. 1996; Date, Takagi et al. 2004), augments long term potentiation (Kramar, Armstrong et al. 2001 ;
- HGF/c-Met system also has pro-cognitive effects (Akimoto, Baba et al. 2004; Tyndall and Walikonis 2006; Tyndall and Walikonis 2007) and is known to be involved in stem cell regulation (Urbanek, Rota et al. 2005; Nicoleau, Benzakour et al. 2009).
- HGF promoted a dose-dependent increase in spinogenesis (Figure 7) in dissociated hippocampal neurons.
- the most effective concentration of HGF (10 ng/ml) was subsequently found to stimulate hippocampal neurons in organotypic hippocampal slice cultures which are more intact preparations similar to Dihexa ( Figure 8 A and B) further establishing a mechanistic link between Dihexa and HGF/c-Met.
- HGF treatment- induced spines labeled with mRFP- -actin were immunostained for the universal presynaptic marker Synapsin that is located in the presynaptic active zones (Ferreira and Rapoport 2002) and the excitatory presynaptic marker VGLUT1 that is found at glutamatergic presynaptic synapses (Balschun, Moechars et al.).
- Sub-threshold concentrations of Dihexa and HGF or Nlel-AnglV and HGF were used to stimulate hippocampal neurons in vitro to determine whether the angiotensin IV ligands Dihexa and Nlel-AnglV, and HGF affect the same signaling cascade or act on one receptor (c-Met).
- c-Met one receptor
- Hinge like the angiotensin IV antagonist
- Hinge prevented HGF, Nlel -AnglV and Dihexa induced spinogenesis (Figure 12B-D) further suggesting that the effects observed for our angiotensin rV ligands are HGF/c-Met mediated.
- the effects of Hinge on synaptogenesis were evaluated by recording mEPSC frequencies on cultured hippocampal neurons. While Hinge alone did alter base-line synaptic transmission it attenuated HGF and Dihexa increases in AMPA- frequencies ( Figure 13 A and B).
- the newly developed angiotensin IV agonist ligand Dihexa has been shown to facilitate acquisition of a spatial learning and memory task in scopolamine treated rats (data not shown). Because it is prohibitively expensive to test HGF in the water maze, we instead evaluated its involvement in cognition by employing the HGF antagonist Hinge to block the actions of Dihexa. Treatment with the muscarinic cholinergic receptor antagonist scopolamine renders rats acutely amnesic and therefore unable to learn the task. A rescue effect is observed in rats that are given Dihexa following scopolamine pretreatment. These rats exhibit rapid facilitation of the task and did not perform differently from vehicle treated rats.
- the metabolically stabilized 6-AH family member, D-Nle-Tyr-Ile-NH-(CH 2 ) 5 -CONH 2 had a ti /2 in blood of 80 min compared to the parent compound Norleual (Nle-Tyr-Leu ⁇ -(CH 2 -NH 2 ) 3"4 -His-Pro-Phe, SEQ ID NO: 1), which had a ti /2 in blood of ⁇ 5 min.
- 6-AH family members were found to act as mimics of the dimerization domain of HGF (hinge region), and inhibited the interaction of an HGF molecule with a 3 H-hinge region peptide resulting in an attenuated capacity of HGF to activate its receptor Met. This interference translated into inhibition of HGF-dependent signaling, proliferation, and scattering in multiple cell types at concentrations down into the low picomolar range.
- 6-AH family members were found to act as mimics of the dimerization domain of HGF (hinge region), and inhibited the interaction of an HGF molecule with a 3 H-hinge region peptide resulting in an attenuated capacity of HGF to activate its receptor Met.
- This interference translated into inhibition of HGF-dependent signaling, proliferation, and scattering in multiple cell types at concentrations down into the low picomolar range.
- a member of the 6-AH family with cysteine at position 2 was a particularly effective antagonist of HGF-dependent cellular activities.
- This compound suppressed pulmonary colonization by B16-F10 murine melanoma cells, which are characterized by an overactive HGF/Met system.
- 6-AH family of AnglV analogs exert their biological activity by modifying the activity of the HGF/Met system and offer the potential as therapeutic agents in disorders that are dependent on or possess an over-activation of the HGF/Met system.
- the multifunctional growth factor hepatocyte growth factor (HGF) and its receptor Met are important mediators for mitogenesis, motogenesis, and morphogenesis in a wide range of cell types (Birchmeier et al., 2003) including epithelial (Kakazu et al., 2004), endothelial (Kanda et al., 2006), and hematopoietic cells (Ratajczak et al., 1997), neurons (Thompson et al., 2004), melanocytes (Halaban et al., 1992), and hepatocytes (Borowiak et al., 2004).
- dysregulation of the HGF/Met system often leads to neoplastic changes and to cancer (in both human and animal) where it contributes to tumor formation, tumor metastasis, and tumor angiogenesis (Christensen et al., 2005; Liu et al., 2008). Over- activation of this signaling system is routinely linked to poor patient prognosis (Liu et al., 2010). Therefore molecules that inhibit the HGF/Met system can be expected to exhibit anticancer activity and attenuate malignant and metastatic transformations.
- HGF is a vertebrate heteromeric polypeptide growth factor with a domain structure that closely resembles the proteinases of the plasminogen family (Donate et al., 1994). HGF consists of seven domains: an amino terminal domain, a dimerization-linker domain, four kringle domains (K1-K4), and a serine proteinase homology (SPH) domain (Lokker et al., 1992; Chirgadze et al., 1999).
- SPH serine proteinase homology
- the single chain pro-polypeptide is proteolytically processed by convertases to yield a mature a (heavy chain 55 KDa), and ⁇ (light chain 34 KDa) heterodimer, which are bound together by a disulfide link (Stella and Comoglio, 1999;
- HGF Birchmeier et al., 2003; Gherardi et al., 2006).
- HGF requires dimerization to be fully activated (Lokker et al., 1992; Chirgadze et al., 1999; Youles et al., 2008).
- Several reports have shown that HGF forms dimers and/or multimers, which are arranged in a head-to-tail orientation, prior to its interaction with Met (Gherardi et al., 2006).
- the dimer interface which encompasses the inter-domain linker amino acids (K122, D123, Y124, 1125, R126, and N127) is referred to as the hinge region (Gherardi et al., 2006; Youles et al., 2008).
- the hinge region Gherardi et al., 2006; Youles et al., 2008.
- pre-pro-HGF and the active disulfide-linked heterodimer bind Met with high affinity, it is only the heterodimer that is capable of activating Met (Lokker et al., 1992; Sheth et al., 2008).
- HGF Mimics 6-AH family members
- HGF Mimics 6-AH family members
- HGF Mimics 6-AH family members
- This interference translates into inhibition of HGF-dependent signaling, proliferation, and scattering in multiple cell types at concentration in the picomolar range.
- a positive correlation was evident between the ability to block dimerization and the inhibition of the cellular outcomes of HGF activation.
- D-Nle-Cys-Ile-NH-(CH 2 ) 5 -CONH 2 a member of the 6-AH family suppressed pulmonary colonization by B16-F10 murine melanoma cells, which are characterized by an overactive HGF/Met system.
- This Example highlights the ability of AnglV-like molecules to bind to HGF, block HGF dimerization, and inhibit the HGF/Met system. Moreover, these HGF mimics have utility as AnglV-related
- HGF Hepatocyte growth factor
- Antibodies Anti-Met was purchased from Cell Signaling Technology (Beverly, MA) and the phospho-Met antibody was purchased from AbCam, Inc (Cambridge,MA).
- HEK293 Human embryonic kidney cells 293 (HEK293) and Madin Darby canine kidney cells (MDCK) were grown in DMEM, 10% fetal bovine serum (FBS). Cells were grown to 100% confluency before use. HEK and MDCK cells were serum starved for 2-24 h prior to the initiation of drug treatment.
- FBS fetal bovine serum
- Nle 1 - AnglV 100 xgl mL
- 20 L of Nle 1 - AnglV 100 xgl mL
- D-Nle-Tyr-Ile-NH-(CH 2 )5-CONH 2 samples were centrifuged at 4°C for 5 min at 2300x g to pellet erythrocytes, and the plasma was transferred to clean tubes.
- the Norleual and D-Nle-Tyr-Ile-NH-(CH 2 )5-CONH2 samples were precipitated by adding 3 vol of ice-cold acetonitrile (ACN) and the samples were vortexed vigorously.
- ACN ice-cold acetonitrile
- Stability half-lives were determined assuming a normal single phase exponential decay using Prism 5 graphical/statistical program (GraphPad, San Diego, CA).
- Rats Teklad rodent diet and water ad libitum in our AAALAC certified animal facility. Rats were housed in temperature-controlled rooms with a 12 h light/dark cycle. The right jugular veins of the rats were catheterized with sterile polyurethane HydrocoatTM catheters (Access Technologies, Skokie, IL, USA) under ketamine (Fort Dodge Animal Health, Fort Dodge, IA, USA) and isoflurane (Vet OneTM, MWI, Meridian, ID, USA) anesthesia. The catheters were exteriorized through the dorsal skin.
- the catheters were flushed with heparinized saline before and after blood sample collection and filled with heparin-glycerol locking solution (6 mL glycerol, 3 mL saline, 0.5 mL gentamycin (lOOmg/mL), 0.5 mL heparin (10,000 u/mL)) when not used for more than 8 h.
- the animals were allowed to recover from surgery for several days before use in any experiment, and were fasted overnight prior to the
- the catheter was flushed with saline solution and a volume of saline equal to the volume of blood taken was injected (to maintain total blood volume).
- Blood Sample Preparation Upon collection into polypropylene microfuge tubes without heparin, blood samples were immediately centrifuged at 4°C, 2300x g for 5 min to remove any cells and clots and the serum transferred into clean microcentrifuge tubes. A volume of internal standard (Nle'-AnglV, 100 g/mL) equal to 0.1 times the sample serum volume was added. A volume of ice-cold acetonitrile equal to four times the sample serum volume was then added and the sample vortexed vigorously for 30 s. The supernatants were transferred to clean tubes, then held on ice until the end of the experiment, and stored at 4°C afterward until further processing.
- Nle'-AnglV 100 g/mL
- Serial dilutions of D-Nle-Tyr-Ile-NH-(CH 2 )5-CONH 2 in 30% ethanol were prepared from the stock used to dose the animals for standard curves. 20 lL of each serial dilution was added to 180 [lL of blood on ice for final concentrations of 0.01 g/mL, O. l g/mL, l g/mL and lO g/mL. The samples were centrifuged at 4°C, 2300x g for 5 min and the serum transferred into polypropylene microcentrifuge tubes. A volume of internal standard (Nle 1 - AnglV, 100 g/mL) equal to 0.1 times the sample serum volume was added.
- HPLC/MS system was from
- Shimadzu (Kyoto, Japan), consisting of a CBM-20A communications bus module, LC-20AD pumps, SIL-20AC auto sampler, SPD-M20A diode array detector and LCMS-2010EV mass spectrometer. Data collection and integration were achieved using Shimadzu LCMS solution software.
- the analytical column used was an Econosphere CI 8 (100mm x 2.1mm) from Grace Davison Discovery Science (Deerfield, IL, USA).
- the mobile phase consisted of
- Pharmacokinetic Analysis Pharmacokinetic analysis was performed using data from individual rats. The mean and standard deviation (SD) were calculated for the group.
- Non- compartmental pharmacokinetic parameters were calculated from serum drug concentration- time profiles by use of WinNonlin® software (Pharsight, Mountain View, CA, USA). The following relevant parameters were determined where possible: area under the concentration- time curve from time zero to the last time point (AUCo-iast) or extrapolated to infinity (AUC 0 . ⁇ ), C max concentration in plasma extrapolated to time zero (Co), terminal elimination half-life (ti /2 ), volume of distribution (Vd), and clearance (CL).
- NADPH regenerating system was prepared as follows: 1.7 mg/mL NADP, 7.8 mg/mL glucose-6-phosphate and 6 units/mL glucose-6-phosphate dehydrogenase were added to 10 mL 2% sodium bicarbonate and used immediately.
- HGF Binding The binding of 6-AH analogs to HGF was assessed by competition using a soluble binding assay. 250 ⁇ 1 of PBS containing human HGF (1.25ng) were incubated with 3 H- Hinge, the central dimerization domain of HGF, in the presence of varying concentrations of 6-AH analogs between 10 " 13 M to 10 "7 M (half-log dilutions) for 40 min at 37°C. The incubates were then spun through Bio-Gel P6 spin columns (400 ⁇ packed volume) for 1 min to separate free and bound 3 H-Hinge and the eluent was collected.
- HGF Dimerization HGF dimerization was assessed using PAGE followed by silver staining (Kawas et al., 2011). Human HGF at a concentration of 0.08ng/ l with or without 6- AH analogs was incubated with heparin at a final concentration of 5 g/ml. Loading buffer was then added to each sample and the mixture separated by native PAGE using gradient Criterion XT precast gels (4-12% Bis-Tris; Biorad Laboratories, Hercules, CA). Next the gel was silver stained for the detection of the HGF monomers and dimers. Bands were quantitated from digital images using a UVP phosphoimager (Upland, CA).
- HEK293 cells were seeded in 6 well tissue culture plates and grown to 95% confluency in DMEM containing 10% FBS. The cells were serum deprived for 24 h prior to the treatment to reduce the basal levels of phospho-Met. Following serum starvation, cocktails comprised of vehicle and HGF with/without 6-AH analogs were prepared and pre-incubated for 30 min at room temperature. The cocktail was then added to the cells for 10 min to stimulate the Met receptor and downstream proteins. Cells were harvested using RIPA lysis buffer (Millipore; Billerica, MA) fortified with phosphatase inhibitor cocktails 1 and 2 (Sigma-Aldrich; St. Louis, MO).
- the lysate was clarified by centrifugation at 15,000 nx g for 15 min, protein concentrations were determined using the BCA total protein assay (Pierce), and then appropriate volumes of the lysates were diluted with 2x reducing Laemmli buffer and heated for ten min at 95° C. Samples containing identical amounts of protein were resolved using SDS-PAGE (Criterion, BioRad
- TBS Tris-buffered saline
- the phospho-Met antibody were added to the blocking buffer at a final concentration of 1 : 1000 and incubated at 4° C overnight with gentle agitation.
- the membranes were then washed several times with water and TBS (PBS, 0.05% Tween-20), a 1 :5000 dilution of horseradish-peroxidase conjugated goat anti-rabbit antiserum was added, and the membranes further incubated for 1 h at room temperature.
- Proteins were visualized using the Supersignal West Pico Chemiluminescent Substrate system (Pierce, Fenton, MO) and molecular weights determined by comparison to protein ladders (BenchMark, Invitrogen, and Kaleidoscope, BioRad). Film images were digitized and analyzed using a UVP phosphoimager.
- HGF-dependent proliferation was determined by subtracting the basal proliferation (in the absence of HGF) from total proliferation rates in groups containing HGF.
- MDCK cells were grown to 100% confluency on the coverslips in six-well plates and washed twice with PBS. The confluent coverslips were then aseptically transferred to new six well plates containing 900 ⁇ serum free DMEM. Norleual, Hinge peptide, and/or HGF (20 ng/ml) were added to appropriate wells. Control wells received PBS vehicle. Plates were incubated at 37°C with 5% C0 2 for 48 h. Media was removed and cells were fixed with methanol. Cells were stained with Diff-Quik Wright-Giemsa (Dade-Behring, Newark, DE) and digital images were taken. Coverslips were removed with forceps and more digital images were captured. Pixel quantification of images was achieved using Image J and statistics were performed using Prism 5 and InStat v.3.05 (GraphPad; San Diego, CA).
- mice 100 g/kg or a PBS vehicle control.
- mice Two weeks later, mice were anesthetized and lungs were perfused with PBS and removed. Photos were taken and lungs were solubilized in 1% Triton x-100, 20 mM Tris, 0.15 M NaCl, 2 mM EDTA, and 0.02% sodium azide. Samples were disrupted by sonication (Mixonix, Farmingdale, NY) and spun. The supernatant was transferred to a 96 well plate and melanin absorbance at 410nm was measured using a plate reader.
- the AnglV analog D-Nle-Tyr-Ile-NH-( CH 2 ) 5-CONH2 is more metabolically stable than Norleual (SEQ ID NO: l):The AnglV- related peptidomimetic Norleual was previously shown to possess, anti-HGF/Met, anti- angiogenic, and anti-cancer activities (Yamamoto et al., 2010). The presence of unprotected peptide bonds at both the N- and C-terminal linkages predicts that Norleual should have poor metabolic stability and rapid clearance for the circulation, properties that may limit its clinical utility. In an attempt to overcome this limitation, a family of compounds, the 6-AH family was designed and synthesized to offer defense against exopeptidases. Figure 22
- the AnglV analog D-Nle-Tyr-Ile-NH-(CH 2 ) s -CONH 2 has a much longer circulating half-life than Norleual (SEQ ID NO: 1)):
- SEQ ID NO: 1 As anticipated from the in-vitro blood stability data, D-Nle-Tyr-Ile-NH-(CH 2 )5-CONH 2 exhibited an extended in vivo elimination half-life of 1012 min after IV injection in rats.
- Other relevant pharmacokinetic parameters of D-Nle-Tyr-Ile-NH-(CH 2 )5-CONH2 after a single IV bolus dose are summarized in Table 5. Serum data were modeled using
- D-Nle-Tyr-Ile-NH-(CH 2 )5- CONH 2 appeared to be extensively distributed outside the central blood compartment and/or bound within the tissues as evidenced by its large volume of distribution (Vd).
- D-Nle-Tyr-Ile- NH-(CI3 ⁇ 4)5-CONH2 is not expected to be highly bound to plasma proteins according to quantitative structure-activity relationship (QSAR) modeling (discussed below) and since total recovery from serum was greater than 35 %.
- QSAR quantitative structure-activity relationship
- D-Nle- Tyr-Ile-NH-(CH2)5-CONH 2 was predicted to be orally bioavailable.
- the P e ff value represents the predicted effective human jejunal permeability of the molecule.
- the predicted P e ff value for D-Nle-Tyr-Ile-NH-(CH2)5-CONH2 (1.53) is intermediate between the predicted P e values for enalapril (1.25) and piroxicam (2.14), two orally bioavailable drugs.
- D-Nle-Tyr-Ile-NH- (CH 2 )5-CONH2 was also predicted to be 42.68 percent unbound to plasma proteins in circulation, thus making it available for distribution into the tissues.
- HGF Dimerization D-Nle-X-Ile-NH-(CH 2 )5-CONH 2 analogs block HGF Dimerization: Several reports have shown that HGF needs to form homodimers and/or multimers, prior to its activation of Met (Chirgadze et al., 1999; Gherardi et al., 2006). This dimer is arranged in a head to tail orientation; the dimer interface comprises a central region, the hinge region that is important for the proper dimer formation and orientation.
- a homologous sequence-conservation screen against all possible transcripts that were independent of and not derived from angiotensinogen looking for similarities to AnglV identified partial homology with the hinge region
- plasminogen family of proteins, which include plasminogen itself, its anti-angiogenic degradation product, angiostatin, and the protein hormones heptocyte growth factor (HGF) and macrophage stimulating protein (MSP).
- HGF heptocyte growth factor
- MSP macrophage stimulating protein
- AnglV analog Norleual which is a potent inhibitor of the HGF/Met system, was shown to bind to HGF and block its dimerization (Kawas et al., 2011).
- Met activation initiates multiple cellular responses including increased proliferation and motility, enhanced survival, and differentiation (Zhang and Vande Woude, 2003).
- 6-AH family members As an initial test of the ability of 6-AH family members to alter HGF-dependent cellular activity we evaluated the capacity of several members of the family to modify the proliferative activity of Madin-Darby canine kidney (MDCK) cells, a standard cellular model for investigating the HGF/Met system (Stella and Comoglio, 1999). As seen in Figure 26 there is a wide range of inhibitory activity against HGF dependent cellular proliferation. Similar to the results from
- HGF/Met signaling is the hallmark effect of HGF/Met signaling; a process characterized by decreased cell adhesion, increased motility, and increased proliferation.
- the treatment of MDCK cells with HGF initiates a scattering response that occurs in two stages. First, the cells lose their cell-to-cell adhesion and become polarized. Second, they separate completely and migrate away from each other. It is expected that if the 6-AH family members are capable of inhibiting the HGF/Met system then they should be able to modify HGF dependent MDCK cell scattering.
- Figures 27 A & B indicate that those analogs that were previously found to block HGF dimerization were effective inhibitor of HGF/Met mediated cell scattering in MDCK cells, while those analogs with poor affinity for HGF were ineffective.
- Figure 28 shows a correlation between the blockade of HGF dimerization and HGF binding affinity and the ability to prevent MDCK cell scattering.
- FIG. 29a illustrates the inhibitory response that was observed with daily intraperitoneal injections at two doses ( ⁇ g/kg/day and 100 ⁇ ⁇ 3 ⁇ 4 ⁇ ) of [D-Nle-Cys-Ile-NH-(CH 2 ) 5 -CONH 2 ].
- Figure 29b provides a quantitative assessment of pulmonary colonization by measuring melanin content, which reflects the level of melanoma colonization. Together these data demonstrate that treatment of melanoma cells with D-Nle-Cys-Ile-NH-(CH2)5-CONH 2 radically prevented lung colonization and highlight the utility of the 6-AH analogs as anti-cancer agents.
- vascularization would be clinically beneficial. These could include hyper- vascular diseases of the eye like diabetic retinopathy and the wet type of macular degeneration. In both cases anti-angiogenic therapies are currently in use (see review- Jeganathan, 201 1). Anti- angiogenics are also being examined as treatment options in a variety of other disorders ranging from obesity where adipose tissue vascularization is targeted (Daquinag et al., 201 1), to chronic liver disease (Coulon et al., 201 1), to psoriasis where topical application of anti- angiogenic drugs is being considered (Canavese et al., 2010).
- this Example demonstrates a qualitative relationship between the ability of a compound to bind HGF and block HGF dimerization and its observed in vitro biological activity. Moreover these studies provide initial structure-activity data and pave the way for more extensive evaluation. The chemical modifications that were made at the N- and C-terminals of the AnglV molecule and the resultant improvement in metabolic stability highlight the critical role played by exopeptidases in the metabolism of AnglV-derived molecules.
- AUCo- ⁇ area under the curve.
- Vd volume of distribution.
- Cp° initial concentration of drug in serum.
- ti /2 biological half-life.
- KE rate of elimination.
- CL clearance rate.
- HGF Hepatocyte growth factor
- Borowiak M Garratt AN, WA/A1 ⁇ 4stefeld T, Strehle M, Trautwein C, Birchmeier C and Wigler MH (2004) Met Provides Essential Signals for Liver Regeneration.
- Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neurotrophic factor for spinal motor neurons. Neuron 17: 1 157- 1172.
- Flaquer M Franquesa M, Vidal A, Bolanos N, Torras J, Lloberas N, Herrero-Fresneda I, Grinyo JM, Cruzado JM.(2010) Hepatocyte growth factor gene therapy enhances infiltration of macrophages and may induce kidney repair in db/db mice as a model of diabetes. Diabetologia. Mar 30. [Epub ahead of print] Fujimoto J and Kaneda Y (1999) Reversing liver cirrhosis: impact of gene therapy for liver cirrhosis. GENE THERAPY -BASINGSTOKE- 3:106.
- HGF Hepatocyte growth factor
- Kane MJ Angoa-Perez M, Briggs DI, Viano DC, Kreipke CW, Kuhn DM (2011).A mouse model of human repetitive mild traumatic brain injury. J Neurosci Methods. Sep 12.
- HGF protects corneal epithelial cells from apoptosis by the PI-3K/Akt-l/Bad- but not the ERKl/2-mediated signaling pathway.
- endothelial cells is regulated by Src. Biochemical & Biophysical Research
- NLE1 -angiotensin IV and LVV-hemorphin 7, on spatial learning in rats.
- proteases matrix metalloproteinases 3 and 9 on spatial learning and synaptic
- Endogenous hepatocyte growth factor is a niche signal for subventricular zone neural stem cell amplification and self-renewal. (2009) Stem Cells. 27:408-19.
- Hepatocyte growth factor has a role in the amelioration of diabetic vascular complications via autophagic clearance of advanced glycation end products: Dispo85E, an HGF inducer, as a potential botanical drug. Metabolism. 60:888-92.
- HGF a multifunctional growth factor controlling cell scattering.
- HGF hepatocyte growth factor
- Hepatocyte growth factor acts as a mitogen and chemoattractant for postnatal subventricular zone-olfactory bulb neurogenesis. Mol Cell Neurosci. 48: 38-50.
- Zarnegar R (2002) A mechanism of cell survival: sequestration of Fas by the HGF receptor Met. Molecular Cell 9:411-421.
- HGF into plasma induced by clofibrate in rats, in.
- Hepatocyte growth factor (HGF/SF) is a muscle-derived survival factor for a subpopulation of embryonic motoneurons. Development ⁇ 24: 2903-2913.
- Impairment of synaptic plasticity in hippocampus is exacerbated by
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Crystallography & Structural Chemistry (AREA)
- Urology & Nephrology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Endocrinology (AREA)
- Dermatology (AREA)
- Obesity (AREA)
- Emergency Medicine (AREA)
- Hematology (AREA)
- Pulmonology (AREA)
- Ophthalmology & Optometry (AREA)
- Vascular Medicine (AREA)
- Psychiatry (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES12768043.7T ES2622385T3 (es) | 2011-04-02 | 2012-04-02 | Miméticos de factor de crecimiento de hepatocitos como agentes terapéuticos |
| NZ616210A NZ616210B2 (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| US14/009,459 US9150613B2 (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| CN201280026925.2A CN103582490B (zh) | 2011-04-02 | 2012-04-02 | 作为治疗剂的肝细胞生长因子模拟物 |
| CA2832113A CA2832113C (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| EP12768043.7A EP2709650B1 (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| AU2012240424A AU2012240424B2 (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| HK14109458.0A HK1196075B (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| JP2014503898A JP6173298B2 (ja) | 2011-04-02 | 2012-04-02 | 治療薬としての肝細胞増殖因子模倣体 |
| US13/768,497 US8598118B2 (en) | 2011-04-02 | 2013-02-15 | Hepatocyte growth factor mimics as therapeutic agents |
| US13/827,266 US20140094413A1 (en) | 2012-04-02 | 2013-03-14 | Hepatocyte growth factor (hgf) mimics as therapeutic agents |
| US14/038,973 US9051351B2 (en) | 2011-04-02 | 2013-09-27 | Hepatocyte growth factor mimics as therapeutic agents |
| US14/821,184 US20170049843A1 (en) | 2011-04-02 | 2015-08-07 | Hepatocyte Growth Factor Mimics as Therapeutic Agents |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161471122P | 2011-04-02 | 2011-04-02 | |
| US201161471124P | 2011-04-02 | 2011-04-02 | |
| US61/471,124 | 2011-04-02 | ||
| US61/471,122 | 2011-04-02 |
Related Child Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/009,459 A-371-Of-International US9150613B2 (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
| US13/768,497 Continuation US8598118B2 (en) | 2011-04-02 | 2013-02-15 | Hepatocyte growth factor mimics as therapeutic agents |
| US13/827,266 Continuation-In-Part US20140094413A1 (en) | 2012-04-02 | 2013-03-14 | Hepatocyte growth factor (hgf) mimics as therapeutic agents |
| US14/038,973 Continuation-In-Part US9051351B2 (en) | 2011-04-02 | 2013-09-27 | Hepatocyte growth factor mimics as therapeutic agents |
| US14/821,184 Continuation US20170049843A1 (en) | 2011-04-02 | 2015-08-07 | Hepatocyte Growth Factor Mimics as Therapeutic Agents |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012138599A2 true WO2012138599A2 (en) | 2012-10-11 |
| WO2012138599A3 WO2012138599A3 (en) | 2013-01-17 |
Family
ID=46969763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/031815 Ceased WO2012138599A2 (en) | 2011-04-02 | 2012-04-02 | Hepatocyte growth factor mimics as therapeutic agents |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US9150613B2 (https=) |
| EP (1) | EP2709650B1 (https=) |
| JP (1) | JP6173298B2 (https=) |
| CN (1) | CN103582490B (https=) |
| AU (1) | AU2012240424B2 (https=) |
| CA (1) | CA2832113C (https=) |
| ES (1) | ES2622385T3 (https=) |
| WO (1) | WO2012138599A2 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014021942A1 (en) * | 2012-08-01 | 2014-02-06 | University Of Southern California | Methods for limiting development of neurodegeneration |
| WO2014052766A1 (en) * | 2012-09-27 | 2014-04-03 | Washington State University | Hepatocyte growth factor mimics as therapeutic agents |
| CN106699868A (zh) * | 2017-03-01 | 2017-05-24 | 牡丹江医学院 | 一种蛋白质及编码其的核苷酸序列 |
| WO2018001909A1 (en) * | 2016-06-27 | 2018-01-04 | Agomab Therapeutics Bvba | Anti-met antibodies and uses thereof |
| US11021514B2 (en) | 2016-06-01 | 2021-06-01 | Athira Pharma, Inc. | Compounds |
| US11834507B2 (en) | 2018-01-03 | 2023-12-05 | Agomab Therapeutics | Anti-MET agonist antibody for use in the treatment of colorectal cancer |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050048035A1 (en) | 2001-12-07 | 2005-03-03 | Fraser John K. | Methods of using regenerative cells in the treatment of stroke and related diseases and disorders |
| US20050095228A1 (en) | 2001-12-07 | 2005-05-05 | Fraser John K. | Methods of using regenerative cells in the treatment of peripheral vascular disease and related disorders |
| US7771716B2 (en) | 2001-12-07 | 2010-08-10 | Cytori Therapeutics, Inc. | Methods of using regenerative cells in the treatment of musculoskeletal disorders |
| US9597395B2 (en) | 2001-12-07 | 2017-03-21 | Cytori Therapeutics, Inc. | Methods of using adipose tissue-derived cells in the treatment of cardiovascular conditions |
| WO2010021993A1 (en) | 2008-08-19 | 2010-02-25 | Cytori Therapeutics, Inc. | Methods of using adipose tissue-derived cells in the treatment of the lymphatic system and malignant disease |
| US20170065638A1 (en) * | 2014-02-10 | 2017-03-09 | Cytori Therapeutics, Inc. | Regenerative cell therapy for central nervous system (cns) disorders and ptsd |
| CN104788537B (zh) * | 2015-03-31 | 2018-03-13 | 中国科学院长春应用化学研究所 | 一种四肽化合物及其制备方法和应用 |
| CN110716925B (zh) * | 2019-09-05 | 2023-08-04 | 中电科大数据研究院有限公司 | 一种基于轨迹分析的跨境行为识别方法 |
| US20230000943A1 (en) * | 2021-06-29 | 2023-01-05 | Synaptogenix, Inc. | Method of inducing synaptogenesis by administering angiotensin and analogues thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE160585T1 (de) * | 1992-09-18 | 1997-12-15 | Us Gov Health & Human Serv | Eine methode zur herstellung von hepatozytwachstumsfaktor und eine zelllinie |
| US5854388A (en) * | 1993-06-24 | 1998-12-29 | Washington State University Research Foundation | Angiotensin IV peptides and receptor |
| US6777388B1 (en) * | 1998-08-21 | 2004-08-17 | Clf Medical Technology Acceleration Program, Inc. | Leptin-related peptides |
| US7192976B2 (en) | 2002-12-21 | 2007-03-20 | Angion Biomedica Corporation | Small molecule modulators of hepatocyte growth factor (scatter factor) activity |
| WO2008005531A2 (en) * | 2006-07-07 | 2008-01-10 | Washington State University Research Foundation | C-met receptor regulation by angiotensin iv (at4) receptor ligands |
| WO2011019400A2 (en) * | 2009-08-12 | 2011-02-17 | Angion Biomedica Corp. | Enhancement of cellular transplantation using small molecule modulators hepatocyte growth factor (scatter factor) activity |
-
2012
- 2012-04-02 AU AU2012240424A patent/AU2012240424B2/en active Active
- 2012-04-02 US US14/009,459 patent/US9150613B2/en active Active
- 2012-04-02 CA CA2832113A patent/CA2832113C/en active Active
- 2012-04-02 CN CN201280026925.2A patent/CN103582490B/zh active Active
- 2012-04-02 WO PCT/US2012/031815 patent/WO2012138599A2/en not_active Ceased
- 2012-04-02 JP JP2014503898A patent/JP6173298B2/ja active Active
- 2012-04-02 EP EP12768043.7A patent/EP2709650B1/en active Active
- 2012-04-02 ES ES12768043.7T patent/ES2622385T3/es active Active
-
2013
- 2013-02-15 US US13/768,497 patent/US8598118B2/en active Active
-
2015
- 2015-08-07 US US14/821,184 patent/US20170049843A1/en not_active Abandoned
Non-Patent Citations (2)
| Title |
|---|
| None |
| See also references of EP2709650A4 |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014021942A1 (en) * | 2012-08-01 | 2014-02-06 | University Of Southern California | Methods for limiting development of neurodegeneration |
| WO2014052766A1 (en) * | 2012-09-27 | 2014-04-03 | Washington State University | Hepatocyte growth factor mimics as therapeutic agents |
| US11021514B2 (en) | 2016-06-01 | 2021-06-01 | Athira Pharma, Inc. | Compounds |
| US12421276B2 (en) | 2016-06-01 | 2025-09-23 | Athira Pharma, Inc. | Methods of treating neurodegenerative disease with substituted n-hexanoic-l-tyrosine-l-isoleucine-(6)-aminohexanoic amide analogues |
| WO2018001909A1 (en) * | 2016-06-27 | 2018-01-04 | Agomab Therapeutics Bvba | Anti-met antibodies and uses thereof |
| EP3674321A3 (en) * | 2016-06-27 | 2020-09-30 | AgomAb Therapeutics | Anti-met antibodies and uses thereof |
| US11098126B2 (en) | 2016-06-27 | 2021-08-24 | Agomab Therapeutics Bvba | Anti-MET antibodies and uses thereof |
| US12084504B2 (en) | 2016-06-27 | 2024-09-10 | Agomab Therapeutics | Anti-MET antibodies and uses thereof |
| CN106699868A (zh) * | 2017-03-01 | 2017-05-24 | 牡丹江医学院 | 一种蛋白质及编码其的核苷酸序列 |
| CN106699868B (zh) * | 2017-03-01 | 2019-11-15 | 牡丹江医学院 | 一种蛋白质及编码其的核苷酸序列 |
| US11834507B2 (en) | 2018-01-03 | 2023-12-05 | Agomab Therapeutics | Anti-MET agonist antibody for use in the treatment of colorectal cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| US8598118B2 (en) | 2013-12-03 |
| AU2012240424B2 (en) | 2017-10-26 |
| EP2709650A2 (en) | 2014-03-26 |
| JP2014511858A (ja) | 2014-05-19 |
| US9150613B2 (en) | 2015-10-06 |
| NZ616210A (en) | 2015-07-31 |
| US20140088004A1 (en) | 2014-03-27 |
| EP2709650B1 (en) | 2017-02-08 |
| ES2622385T3 (es) | 2017-07-06 |
| CN103582490B (zh) | 2015-09-30 |
| WO2012138599A3 (en) | 2013-01-17 |
| JP6173298B2 (ja) | 2017-08-02 |
| CA2832113A1 (en) | 2012-10-11 |
| HK1196075A1 (en) | 2014-12-05 |
| EP2709650A4 (en) | 2015-04-22 |
| US20130165392A1 (en) | 2013-06-27 |
| US20170049843A1 (en) | 2017-02-23 |
| CN103582490A (zh) | 2014-02-12 |
| CA2832113C (en) | 2020-07-21 |
| AU2012240424A1 (en) | 2013-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012240424B2 (en) | Hepatocyte growth factor mimics as therapeutic agents | |
| Gudasheva et al. | Low‐molecular mimetics of nerve growth factor and brain‐derived neurotrophic factor: Design and pharmacological properties | |
| US20140094413A1 (en) | Hepatocyte growth factor (hgf) mimics as therapeutic agents | |
| EP0743955B1 (en) | Cyclic nerve growth factor (ngf) structural analogs and their uses | |
| US20030211982A1 (en) | Beta turn peptidomimetic cyclic compounds | |
| WO2004020462A1 (ja) | Cxcr4拮抗薬およびその用途 | |
| Saragovi et al. | Small molecule peptidomimetic ligands of neurotrophin receptors, identifying binding sites, activation sites and regulatory sites | |
| US9051351B2 (en) | Hepatocyte growth factor mimics as therapeutic agents | |
| WO2022171098A1 (zh) | 一种dapk1磷酸化底物的人工小分子干扰肽及其制药用途 | |
| D. Skaper | Peptide mimetics of neurotrophins and their receptors | |
| NZ616210B2 (en) | Hepatocyte growth factor mimics as therapeutic agents | |
| HK1196075B (en) | Hepatocyte growth factor mimics as therapeutic agents | |
| KR102532557B1 (ko) | Dsg2 유래 펩타이드 | |
| US20230095144A1 (en) | Amyloid inhibitory peptides | |
| US20150225459A1 (en) | Peptides that block leukocyte recruitment and methods of use | |
| Class et al. | Patent application title: HEPATOCYTE GROWTH FACTOR (HGF) MIMICS AS THERAPEUTIC AGENTS Inventors: Joseph W. Harding (Pullman, WA, US) John W. Wright (Pullman, WA, US) Caroline C. Benoist (Nashville, TN, US) Leen H. Kawas (Pullman, WA, US) Gary A. Wayman (Pullman, WA, US) Assignees: WASHINGTON STATE UNIVERSITY | |
| US12384816B2 (en) | Blood-brain barrier permeable peptide | |
| Kawas | Development of therapeutics targeting the hepatocyte growth factor (HGF)/MET system | |
| Class et al. | Patent application title: Hepatocyte Growth Factor Mimics as Therapeutic Agents Inventors: Joseph W. Harding (Pullman, WA, US) John W. Wright (Pullman, WA, US) Caroline C. Benoist (Nashville, TN, US) Leen H. Kawas (Pullman, WA, US) Gary A. Wayman (Pullman, WA, US) Assignees: WASHINGTON STATE UNIVERSITY | |
| Harding et al. | Number of Pages |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12768043 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2014503898 Country of ref document: JP Kind code of ref document: A Ref document number: 2832113 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2012240424 Country of ref document: AU Date of ref document: 20120402 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012768043 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012768043 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14009459 Country of ref document: US |