WO2012051519A2 - Biomarkers of brain injury - Google Patents

Biomarkers of brain injury Download PDF

Info

Publication number
WO2012051519A2
WO2012051519A2 PCT/US2011/056338 US2011056338W WO2012051519A2 WO 2012051519 A2 WO2012051519 A2 WO 2012051519A2 US 2011056338 W US2011056338 W US 2011056338W WO 2012051519 A2 WO2012051519 A2 WO 2012051519A2
Authority
WO
WIPO (PCT)
Prior art keywords
biomarkers
patient
sci
gfap
levels
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/056338
Other languages
English (en)
French (fr)
Other versions
WO2012051519A3 (en
Inventor
Allan Dale Everett
James Francis Casella
Jennifer Van Eyk
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=45938999&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2012051519(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Priority to US13/879,470 priority Critical patent/US9746481B2/en
Priority to EP11833480.4A priority patent/EP2628013B1/en
Priority to JP2013534031A priority patent/JP6071886B2/ja
Publication of WO2012051519A2 publication Critical patent/WO2012051519A2/en
Publication of WO2012051519A3 publication Critical patent/WO2012051519A3/en
Priority to IL225731A priority patent/IL225731B/en
Anticipated expiration legal-status Critical
Priority to US14/524,217 priority patent/US20150051115A1/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896Neurological disorders, e.g. Alzheimer's disease
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2871Cerebrovascular disorders, e.g. stroke, cerebral infarct, cerebral haemorrhage, transient ischemic event

Definitions

  • the present invention relates to the field of biomarkers. More specifically, the present invention relates to biomarkers useful in diagnosing brain injuries.
  • Brain injuries are complex and can have multiple severe clinical outcomes. Damage of the brain and spinal cord can result from head trauma, stroke, traumatic birth, heart surgery, cardiac arrest and patients requiring cardiovascular support with ventricular assist devices or extracorporeal membrane oxygenation (ECMO). Moreover, detection of subclinical brain injury is difficult, especially in children and neonates with birth-related injury. Children with sickle cell disease are at high risk for subclinical brain injury. Untreated subclinical brain injuries in children can progress to overt stroke, neurological damage, learning problems and memory loss.
  • ECMO extracorporeal membrane oxygenation
  • the present invention is based, at least in part, on the discovery of central nervous system (CNS)-specific protein biomarkers circulating in body fluids after brain and CNS injury. Release or secretion of proteins from cells of the CNS can be useful for CNS-specific protein biomarkers circulating in body fluids after brain and CNS injury. Release or secretion of proteins from cells of the CNS can be useful for CNS-specific protein biomarkers circulating in body fluids after brain and CNS injury. Release or secretion of proteins from cells of the CNS can be useful for
  • the present invention provides biomarkers useful for diagnosing children and adults with brain injury.
  • the brain injury is subclinical brain injury (SCI).
  • brain injury is overt brain injury.
  • the biomarkers can be used to diagnose patients, assess a patient's prognosis over time, or generally determine a patient's brain injury status.
  • a method for diagnosing brain injury in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of one or more biomarkers in the sample collected from the patient; and (c) comparing the levels of the one or more biomarkers with predefined levels of the same biomarkers that correlate to a patient having brain injury and predefined levels of the same biomarkers that correlate to a patient not having brain injury, wherein a correlation to one of the predefined levels provides the diagnosis.
  • a method for diagnosing subclinical brain injury (SCI) in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of one or more biomarkers in the sample collected from the patient; and (c) comparing the levels of the one or more biomarkers with predefined levels of the same biomarkers that correlate to a patient having SCI and predefined levels of the same biomarkers that correlate to a patient not having SCI, wherein a correlation to one of the predefined levels provides the diagnosis.
  • the one or more biomarkers can be selected from the group consisting of astrotactin 1 (ASTN1), brain angiogenesis inhibitor 3 (BAB); carnosine dipeptidase 1 (CNDP1); ERMIN; glial fibrillary acidic protein (GFAP); glutamate receptor metabotropic 3 (GRM3); kelch-like protein 32 (KLH32); melanoma antigen family E,2 (MAGE2); neuregulin 3 (NRG3);
  • NRGN neurogranin
  • OMG oligodendrocyte myelin glycoprotein
  • ZG solute carrier family 39
  • SLC39A12 solute carrier family 39
  • RTNl reticulon 1
  • MT3 metallothionein
  • the one or more biomarkers comprises NRGN. In another embodiment, the one or more biomarkers comprises OMG. In yet another embodiment, the one or more biomarkers comprises MT3. In a further embodiment, the one or more biomarkers further comprises GFAP.
  • the one or more biomarkers comprise NRGN, OMG, and MT3.
  • the biomarkers can further comprise GFAP.
  • the one or more biomarkers further comprise the biomarkers listed in Table 1 and Table 2.
  • a method for diagnosing brain injury in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of a panel of biomarkers in the sample collected from the patient, wherein the panel of biomarkers comprises ASTN1, BAI3, CNDP1, ERMIN, GFAP, GRM3, KLH32, MAGE2, NRG3, NRGN, OMG, SLC39A12, RTNl, and MT3; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same panel of biomarkers that correlate to a patient having brain injury and predefined levels of the same panel of biomarkers that correlate to a patient not having brain injury, wherein a correlation to one of the predefined levels provides the diagnosis.
  • a method for diagnosing SCI in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of a panel of biomarkers in the sample collected from the patient, wherein the panel of biomarkers comprises ASTN1, BAI3, CNDP1, ERMIN, GFAP, GRM3, KLH32, MAGE2, NRG3, NRGN, OMG, SLC39A12, RTNl, and MT3; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same panel of biomarkers that correlate to a patient having SCI and predefined levels of the same panel of biomarkers that correlate to a patient not having SCI, wherein a correlation to one of the predefined levels provides the diagnosis.
  • a method for diagnosing brain injury in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of a panel of biomarkers in the sample collected from the patient, wherein the panel of biomarkers comprises NRGN and GFAP; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same biomarkers that correlate to a patient having brain injury and predefined levels of the same biomarkers that correlate to a patient not having brain injury, wherein a correlation to one of the predefined levels provides the diagnosis.
  • the panel of biomarkers further comprises OMG, and MT3.
  • the panel of biomarkers further comprises ASTNl, BAB, CNDPl, ERMIN, GRM3, KLH32, MAGE2, NRG3, OMG, SLC39A12, RTN1, and MT3.
  • a method for diagnosing SCI in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of a panel of biomarkers in the sample collected from the patient, wherein the panel of biomarkers comprises NRGN and GFAP; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same biomarkers that correlate to a patient having SCI and predefined levels of the same biomarkers that correlate to a patient not having SCI, wherein a correlation to one of the predefined levels provides the diagnosis.
  • the panel of biomarkers further comprises OMG, and MT3.
  • the panel of biomarkers further comprises ASTNl, BAB, CNDPl, ERMIN, GRM3, KLH32, MAGE2, NRG3, OMG, SLC39A12, RTN1, and MT3.
  • a method for diagnosing brain injury in a patient comprises the steps of (a) collecting a plasma sample from the patient; (b) measuring the levels of a panel of biomarkers in the plasma sample collected from the patient, wherein the panel of biomarkers comprises NRGN and GFAP; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same biomarkers that correlate to a patient having brain injury and predefined levels of the same biomarkers that correlate to a patient not having brain injury, wherein a correlation to one of the predefined levels provides the diagnosis.
  • the panel of biomarkers further comprises OMG, and MT3.
  • the panel of biomarkers further comprises ASTNl, BAB, CNDPl, ERMIN, GRM3, KLH32, MAGE2, NRG3, OMG, SLC39A12, RTN1, and MT3.
  • a method for diagnosing SCI in a patient comprises the steps of (a) collecting a plasma sample from the patient; (b) measuring the levels of a panel of biomarkers in the plasma sample collected from the patient, wherein the panel of biomarkers comprises NRGN and GFAP; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same biomarkers that correlate to a patient having SCI and predefined levels of the same biomarkers that correlate to a patient not having SCI, wherein a correlation to one of the predefined levels provides the diagnosis.
  • the panel of biomarkers further comprises OMG, and MT3.
  • a method for determining the brain injury status in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of a panel of biomarkers in the sample collected from the patient, wherein the panel of biomarkers comprises ASTNl, BAB, CNDPl, ERMIN, GFAP, GRM3, KLH32, MAGE2, NRG3, NRGN, OMG, SLC39A12, RTN1, and MT3; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same panel of biomarkers that correlate to one or more brain injury statuses selected from the group consisting of having brain injury, not having brain injury, progressing brain injury, and regressing brain injury, wherein a correlation to
  • a method for determining the SCI status in a patient comprises the steps of (a) collecting a sample from the patient; (b) measuring the levels of a panel of biomarkers in the sample collected from the patient, wherein the panel of biomarkers comprises ASTNl, BAB, CNDPl, ERMIN, GFAP, GRM3, KLH32, MAGE2, NRG3, NRGN, OMG, SLC39A12, RTN1, and MT3; and (c) comparing the levels of the panel of biomarkers with predefined levels of the same panel of biomarkers that correlate to one or more SCI statuses selected from the group consisting of having SCI, not having SCI, progressing SCI, and regressing SCI, wherein a correlation to one of the predefined levels determines the SCI status of the patient.
  • the measuring step comprises immunoassay, immunoblotting method, immunoprecipitation assay, immunostaining method, quantitative assay, immunofluorescent assay, or a chemiluminescence assay.
  • the sample is a blood, plasma serum, cerebrospinal fluid (CSF), or urine sample.
  • CSF cerebrospinal fluid
  • the sample is a blood sample.
  • the sample is a serum sample.
  • the present invention provides kits for determining brain injury status in a patient.
  • the diagnostic kit comprises a substrate for collecting a biological sample from the patient; and means for measuring the levels of one or more biomarkers selected from the group consisting of ASTNl, BAB, CNDPl, ERMIN, GFAP, GRM3, KLH32, MAGE2, NRG3, NRGN, OMG, SLC39A12, RTN1, and MT3.
  • FIG. 1 is an overview of the approach for plasma depletion, RP-HPLC separation and MS analysis.
  • FIG. 2 shows the spectra ion table for GFAP peptide. The pepP probability was 0.7598 and the XCORR 4.016. This peptide was found in 4 of 6 SCI patients.
  • the dashed line marks the 95 th percentile value among 47 healthy controls age-matched to the SITT cohort.
  • FIG. 5 shows serial plasma GFAP levels in an 11 year-old patient with HbSS and acute stroke.
  • a red cell exchange transfusion was performed 5 hours after clinical diagnosis, and again 47 hours later for new neurologic deficits.
  • the patient's plasma GFAP remained elevated at 0.50 ng/ml 11 days after diagnosis and returned to a normal value of 0.074 ng/ml 26 days later, immediately prior to the first scheduled red cell transfusion.
  • the dashed line marks the 95 th percentile value among 47 healthy, age-matched controls.
  • FIG. 6 displays neuroimaging of acute stroke in an HbSS patient who had plasma GFAP followed serially.
  • Left Non-contrast head CT immediately after clinical diagnosis of stroke showing a wedge of hypoattenuation in the right frontal lobe.
  • Right FLAIR MRI image 29 hours after diagnosis of stroke showing evolving right anterior cerebral artery infarct.
  • FIG. 9 presents ROC curves of GFAP vs. meconium aspiration as predictors of birth neurologic injury. Top: Logistic regression of neurologic injury related to GFAP > 0.08 ng/ml within 1 day of birth matched for gestational age. Bottom: Meconium stained fluid as a predictor of neurologic injury.
  • FIG. 10 shows the logistic regression of neonatal serum GFAP at admission to the
  • NICU Day 0
  • FIG. 13 is a graph showing GFAP levels during cardiopulmonary bypass for repair of congenital heart disease.
  • FIG. 14 is table showing demographic and clinical characteristics of the 22 evaluated patients.
  • FIG. 15 is a table showing individual patient characteristics and outcomes.
  • FIG. 18 is a table summarizing the maternal and neonatal characteristics of the study population.
  • FIG. 19 displays box plots of GFAP levels (ng/ml) for control vs. cooled neonates. The number under each box is the number of samples available for analysis. * indicates ⁇ .05 compared with controls.
  • FIG. 20 is a table showing the characteristics for neonates treating with cooling.
  • FIG. 21 displays box plots of GFAP levels (ng/ml) for cooled neonates compared by results of brain MRI. The number under each box is the number of samples available for analysis. * indicates ⁇ .05 compared with neonates with normal MRI.
  • FIG. 22 is table showing GFAP levels and neurological outcomes.
  • FIG. 23 shows the spectra ion table for one of 16 unique TSP-1 peptides identified.
  • the Log (e) probability was 10 ⁇ 8'6 . This peptide was found in 10 of 15 SITT patients.
  • FIG. 24 shows the spectra ion table for one of 3 unique SELL peptides identified.
  • the Log (e) probability was 10 "4'3 . This peptide was found in 13 of 15 SITT patients.
  • FIG. 25 presents TSP-1 concentrations in age-matched (5-14 year old) normal and SCD children.
  • FIG. 26 shows plasma TSP-1 concentrations in steady-state sickle cell disease (5-14 years old).
  • FIG. 27 shows SELL concentration (mean) by ELISA in SCI and non-SCI SCD children and age and race matched controls (top). The same data is shown in bar graph format (middle) and spot graph format with mean (bottom).
  • FIG. 28 is a gel showing the minimum amount of neurogranin aptamers needed to for detection of neurogranin protein.
  • FIG. 29 shows the results of a pull-down assay using the neurogranin aptamers.
  • FIG. 30 displays the signals of neurogranin signature peptide and labeled standard peptide using an ABI Sciex Qtrap 4000 triple quadrapole mass spectrometer.
  • FIG. 31 shows His-NRGN on PAGE gel after coomassie staining.
  • the predicted molecular weight of His-NRGN is 8.5 Kd.
  • FIG. 32 shows the standard curve of the direct ELISA for recombinant NRGN using mouse monoclonal antibody 30.5.2.
  • the concentration range is 0.002-10 ng/ml.
  • FIG. 33 shows the standard curve of the direct ELISA for recombinant NRGN using an anti-human monoclonal antibody to neurogranin.
  • the concentration range is 75 ng/ml.
  • FIG. 34 shows neurogranin and GFAP levels from patients undergoing
  • an "injury” is an alteration in cellular or molecular integrity, activity, level, robustness, state, or other alteration that is traceable to an event.
  • an injury includes a physical, mechanical, chemical, biological, functional, infectious, or other modulator of cellular or molecular characteristics.
  • An event can include a physical trauma such as an impact (percussive) or a biological abnormality such as a stroke resulting from either blockade or leakage of a blood vessel.
  • An event is optionally an infection by an infectious agent.
  • brain injury refers to a condition that results in central nervous system damage, irrespective of its pathophysiological basis.
  • stroke is classified into hemorrhagic and non-hemorrhagic.
  • hemorrhagic stroke include cerebral hemorrhage, subarachnoid hemorrhage, and intracranial hemorrhage secondary to cerebral arterial malformation, while examples of non-hemorrhagic stroke include cerebral infarction.
  • TBI traumatic brain injury
  • a "non-traumatic brain injury” refers to brain injuries that do not involve ischemia or external mechanical force (e.g., stroke,
  • Alzheimer's disease Parkinson's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis, brain hemorrhage, brain infections, brain tumor, among others).
  • brain injury also refers to subclinical brain injury, spinal cord injury, and anoxic-ischemic brain injury.
  • subclinical brain injury SCI
  • SCI subclinical brain injury
  • spinal cord injury refers to a condition in which the spinal cord receives compression/detrition due to a vertebral fracture or dislocation to cause dysfunction.
  • anoxic-ischemic brain injury refers to deprivation of oxygen supply to brain tissue resulting in compromised brain function and includes cerebral hypoxia.
  • anoxic-ischemic brain injury includes focal cerebral ischemia, global cerebral ischemia, hypoxic hypoxia (i.e., limited oxygen in the environment causes reduced brain function, such as with divers, aviators, mountain climbers, and fire fighters, all of whom are at risk for this kind of cerebral hypoxia), obstructions in the lungs (e.g., hypoxia resulting from choking, strangulation, the crushing of the windpipe).
  • hypoxic hypoxia i.e., limited oxygen in the environment causes reduced brain function, such as with divers, aviators, mountain climbers, and fire fighters, all of whom are at risk for this kind of cerebral hypoxia
  • obstructions in the lungs e.g., hypoxia resulting from choking, strangulation, the crushing of the windpipe.
  • comparing refers to making an assessment of how the proportion, level or cellular localization of one or more biomarkers in a sample from a patient relates to the proportion, level or cellular localization of the corresponding one or more biomarkers in a standard or control sample.
  • comparing may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, or different from the proportion, level, or cellular localization of the corresponding one or more biomarkers in standard or control sample.
  • the term may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, different from or otherwise corresponds (or not) to the proportion, level, or cellular localization of predefined biomarker levels that correspond to, for example, a patient having subclinical brain injury (SCI), not having SCI, is responding to treatment for SCI, is not responding to treatment for SCI, is/is not likely to respond to a particular SCI treatment, or having /not having another disease or condition.
  • SCI subclinical brain injury
  • the term "comparing" refers to assessing whether the level of one or more biomarkers of the present invention in a sample from a patient is the same as, more or less than, different from other otherwise correspond (or not) to levels of the same biomarkers in a control sample (e.g., predefined levels that correlate to uninfected individuals, standard SCI levels, etc.).
  • the terms “indicates” or “correlates” in reference to a parameter, e.g., a modulated proportion, level, or cellular localization in a sample from a patient, may mean that the patient has SCI.
  • the parameter may comprise the level of one or more biomarkers of the present invention.
  • a particular set or pattern of the amounts of one or more biomarkers may indicate that a patient has SCI (i.e., correlates to a patient having SCI).
  • a particular set or pattern of the amounts of one or more biomarkers may be correlated to a patient being unaffected (i.e., indicates a patient does not have SCI).
  • "indicating," or “correlating,” as used according to the present invention may be by any linear or non-linear method of quantifying the relationship between levels of biomarkers to a standard, control or comparative value for the assessment of the diagnosis, prediction of SCI or SCI progression, assessment of efficacy of clinical treatment, identification of a patient that may respond to a particular treatment regime or pharmaceutical agent, monitoring of the progress of treatment, and in the context of a screening assay, for the identification of an anti-SCI therapeutic.
  • patient refers to a mammal, particularly, a human.
  • the patient may have mild, intermediate or severe disease.
  • the patient may be treatment naive, responding to any form of treatment, or refractory.
  • the patient may be an individual in need of treatment or in need of diagnosis based on particular symptoms or family history.
  • the terms may refer to treatment in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; and primates.
  • measuring and determining are used interchangeably throughout, and refer to methods which include obtaining a patient sample and/or detecting the level of a biomarker(s) in a sample. In one embodiment, the terms refer to obtaining a patient sample and detecting the level of one or more biomarkers in the sample. In another embodiment, the terms “measuring” and “determining” mean detecting the level of one or more biomarkers in a patient sample. Measuring can be accomplished by methods known in the art and those further described herein. The term “measuring” is also used interchangeably throughout with the term "detecting.”
  • sample encompasses a variety of sample types obtained from a patient, individual, or subject and can be used in a diagnostic or monitoring assay.
  • the patient sample may be obtained from a healthy subject, a diseased patient or a patient having associated symptoms of SCI.
  • a sample obtained from a patient can be divided and only a portion may be used for diagnosis. Further, the sample, or a portion thereof, can be stored under conditions to maintain sample for later analysis.
  • the definition specifically encompasses blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, serum, plasma,
  • a sample comprises a blood sample.
  • a serum sample is used.
  • the definition also includes samples that have been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations. The terms further encompass a clinical sample, and also include cells in culture, cell supernatants, tissue samples, organs, and the like. Samples may also comprise fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by
  • Various methodologies of the instant invention include a step that involves comparing a value, level, feature, characteristic, property, etc. to a "suitable control,” referred to interchangeably herein as an “appropriate control” or a “control sample.”
  • a “suitable control,” “appropriate control” or a “control sample” is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes.
  • a "suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc., determined in a cell, organ, or patient, e.g., a control or normal cell, organ, or patient, exhibiting, for example, normal traits.
  • the biomarkers of the present invention may be assayed for levels in a sample from an unaffected individual (UI) or a normal control individual (NC) (both terms are used interchangeably herein).
  • a "suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc. determined prior to performing a therapy (e.g., an SCI treatment) on a patient.
  • a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be determined prior to, during, or after administering a therapy into a cell, organ, or patient.
  • a "suitable control” or “appropriate control” is a predefined value, level, feature, characteristic, property, etc.
  • a "suitable control” can be a profile or pattern of levels of one or more biomarkers of the present invention that correlates to SCI, to which a patient sample can be compared. The patient sample can also be compared to a negative control, i.e., a profile that correlates to not having SCI.
  • the biomarkers of the present invention may be detected by mass spectrometry, a method that employs a mass spectrometer to detect gas phase ions.
  • mass spectrometers are time-of-flight, magnetic sector, quadrupole filter, ion trap, ion cyclotron resonance, electrostatic sector analyzer, hybrids or combinations of the foregoing, and the like.
  • the mass spectrometric method comprises matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF MS or MALDI-TOF).
  • method comprises MALDI-TOF tandem mass spectrometry (MALDI- TOF MS/MS).
  • mass spectrometry can be combined with another appropriate method(s) as may be contemplated by one of ordinary skill in the art.
  • MALDI-TOF can be utilized with trypsin digestion and tandem mass spectrometry as described herein.
  • the mass spectrometric technique is multiple reaction monitoring (MRM) or quantitative MRM.
  • the mass spectrometric technique comprises surface enhanced laser desorption and ionization or "SELDI," as described, for example, in U.S. Patents No. 6,225,047 and No. 5,719,060.
  • SELDI surface enhanced laser desorption and ionization
  • desorption/ionization gas phase ion spectrometry e.g. mass spectrometry
  • an analyte here, one or more of the biomarkers
  • SELDI mass spectrometry probe there are several versions of SELDI that may be utilized including, but not limited to, Affinity Capture Mass Spectrometry (also called Surface-Enhanced Affinity Capture (SEAC)), and Surface-Enhanced Neat Desorption (SEND) which involves the use of probes comprising energy absorbing molecules that are chemically bound to the probe surface (SEND probe).
  • SEAC Surface-Enhanced Affinity Capture
  • SEND Surface-Enhanced Neat Desorption
  • SELDI Surface-Enhanced Photolabile Attachment and Release
  • SEPAR Surface-Enhanced Photolabile Attachment and Release
  • SEPAR and other forms of SELDI are readily adapted to detecting a biomarker or biomarker panel, pursuant to the present invention.
  • the biomarkers can be first captured on a chromatographic resin having chromatographic properties that bind the biomarkers.
  • a chromatographic resin having chromatographic properties that bind the biomarkers.
  • a cation exchange resin such as CM Ceramic HyperD F resin
  • wash the resin elute the biomarkers and detect by MALDI.
  • this method could be preceded by fractionating the sample on an anion exchange resin before application to the cation exchange resin.
  • one could fractionate on an anion exchange resin and detect by MALDI directly.
  • an immuno-chromatographic resin that comprises antibodies that bind the biomarkers
  • the biomarkers of the present invention can be detected and/or measured by immunoassay.
  • Immunoassay requires biospecific capture reagents, such as antibodies, to capture the biomarkers. Many antibodies are available commercially.
  • Antibodies also can be produced by methods well known in the art, e.g., by immunizing animals with the biomarkers. Biomarkers can be isolated from samples based on their binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well-known in the art.
  • the present invention contemplates traditional immunoassays including, for example, sandwich immunoassays including ELISA or fluorescence-based immunoassays,
  • a biospecific capture reagent for the biomarker is attached to the surface of an MS probe, such as a pre-activated protein chip array. The biomarker is then specifically captured on the biochip through this reagent, and the captured biomarker is detected by mass spectrometry.
  • any other suitable agent e.g., a peptide, an aptamer, or a small organic molecule
  • an aptamer that specifically binds all neurogranin and/or one or more of its breakdown products might be used.
  • Aptamers are nucleic acid- based molecules that bind specific ligands. Methods for making aptamers with a particular binding specificity are known as detailed in U.S. Patents No. 5,475,096; No. 5,670,637; No. 5,696,249; No. 5,270,163; No. 5,707,796; No. 5,595,877; No. 5,660,985; No. 5,567,588; No. 5,683,867; No. 5,637,459; and No. 6,011,020.
  • biomarker biomarkers of the present invention may be detected by means of an electrochemicaluminescent assay developed by Meso Scale
  • Electrochemiluminescence detection uses labels that emit light when electrochemically stimulated. Background signals are minimal because the stimulation mechanism (electricity) is decoupled from the signal (light). Labels are stable, non-radioactive and offer a choice of convenient coupling chemistries. They emit light at -620 nm, eliminating problems with color quenching. See U.S. Patents No. 7,497,997; No.
  • biomarkers of the present invention can be detected by other suitable methods.
  • Detection paradigms that can be employed to this end include optical methods,
  • radio frequency methods e.g., multipolar resonance spectroscopy.
  • optical methods in addition to microscopy, both confocal and non-confocal, are detection of fluorescence, luminescence, chemiluminescence, absorbance, reflectance, transmittance, and birefringence or refractive index (e.g., surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler waveguide method or
  • Biochips generally comprise solid substrates and have a generally planar surface, to which a capture reagent (also called an adsorbent or affinity reagent) is attached. Frequently, the surface of a biochip comprises a plurality of addressable locations, each of which has the capture reagent bound there.
  • Protein biochips are biochips adapted for the capture of polypeptides. Many protein biochips are described in the art. These include, for example, protein biochips produced by Ciphergen Biosystems, Inc. (Fremont, CA.), Invitrogen Corp. (Carlsbad, CA), Affymetrix, Inc.
  • the present invention relates to the use of biomarkers to diagnose brain injury. More specifically, the biomarkers of the present invention can be used in diagnostic tests to determine, qualify, and/or assess brain injury status, for example, to diagnose brain injury, in an individual, subject or patient.
  • brain injury status can include determining a patient's subclinical brain injury status or SCI status, for example, to diagnose SCI, in an individual, subject or patient.
  • the biomarkers to be detected in diagnosing brain injury include, but are not limited to,
  • biomarkers known in the relevant art may be used in combination with the biomarkers described herein including, but not limited to, SBDP150, SBDP150i, NSE, SlOOp, MAP2, MAPI, MAP3, MAP4, MAP5, MBP, Tau, NF-L, NF-M, NF-H, UCH-L1, NSE, NeuN, CNPase, a-internexin, CB-I, CB-2; ICAM, VAM, NCAM, NL-CAM, AL- CAM, C-CAM; synaptotagmin, synaptophysin, synapsin, SNAP; CRMP-2, CRMP-I, CRMP-3, CRMP-4 iNOS, and ⁇ -tubulin.
  • brain injury status includes any distinguishable manifestation of the condition, including not having brain injury.
  • brain injury status includes, without limitation, the presence or absence of brain injury in a patient, the risk of developing brain injury, the stage or severity of brain injury, the progress of brain injury (e.g., progress of brain injury over time) and the effectiveness or response to treatment of brain injury (e.g., clinical follow up and surveillance of brain injury after treatment). Based on this status, further procedures may be indicated, including additional diagnostic tests or therapeutic procedures or regimens.
  • the power of a diagnostic test to correctly predict status is commonly measured as the sensitivity of the assay, the specificity of the assay or the area under a receiver operated characteristic ("ROC") curve.
  • Sensitivity is the percentage of true positives that are predicted by a test to be positive, while specificity is the percentage of true negatives that are predicted by a test to be negative.
  • An ROC curve provides the sensitivity of a test as a function of 1- specificity. The greater the area under the ROC curve, the more powerful the predictive value of the test.
  • Other useful measures of the utility of a test are positive predictive value and negative predictive value.
  • Positive predictive value is the percentage of people who test positive that are actually positive.
  • Negative predictive value is the percentage of people who test negative that are actually negative.
  • the biomarker panels of the present invention may show a
  • Diagnostic tests that use these biomarkers may show an ROC of at least 0.6, at least about 0.7, at least about 0.8, or at least about 0.9.
  • the biomarkers are differentially present in UI (NC or non- brain injury) and brain injury, and, therefore, are useful in aiding in the determination of brain injury status.
  • the biomarkers are measured in a patient sample using the methods described herein and compared, for example, to predefined biomarker levels and correlated to brain injury status.
  • the measurement(s) may then be compared with a relevant diagnostic amount(s), cut-off(s), or multivariate model scores that distinguish a positive brain injury status from a negative brain injury status.
  • the diagnostic amount(s) represents a measured amount of a biomarker(s) above which or below which a patient is classified as having a particular brain injury status.
  • the biomarker(s) is/are up-regulated compared to normal during brain injury, then a measured amount(s) above the diagnostic cutoff(s) provides a diagnosis of brain injury.
  • a measured amount(s) at or below the diagnostic cutoff(s) provides a diagnosis of non-brain injury.
  • the particular diagnostic cut-off can be determined, for example, by measuring the amount of biomarkers in a statistically significant number of samples from patients with the different brain injury statuses, and drawing the cut-off to suit the desired levels of specificity and sensitivity.
  • Biomarker values may be combined by any appropriate state of the art mathematical method.
  • Well-known mathematical methods for correlating a marker combination to a disease status employ methods like discriminant analysis (DA) (e.g., linear-, quadratic-, regularized-DA), Discriminant Functional Analysis (DFA), Kernel Methods (e.g., SVM), Multidimensional Scaling (MDS), Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting/Bagging Methods), Generalized Linear Models (e.g., Logistic Regression), Principal Components based Methods (e.g., SIMCA),
  • the method used in a correlating a biomarker combination of the present invention is selected from DA (e.g., Linear-, Quadratic-, Regularized Discriminant Analysis), DFA, Kernel Methods (e.g., SVM), MDS,
  • Nonparametric Methods e.g., k-Nearest-Neighbor Classifiers
  • PLS Partial Least Squares
  • Tree-Based Methods e.g., Logic Regression, CART, Random Forest Methods, Boosting Methods
  • Generalized Linear Models e.g., Logistic Regression
  • the present invention provides methods for determining the risk of developing brain injury in a patient.
  • Biomarker percentages, amounts or patterns are characteristic of various risk states, e.g., high, medium or low.
  • the risk of developing brain injury is determined by measuring the relevant biomarkers and then either submitting them to a classification algorithm or comparing them with a reference amount, i.e., a predefined level or pattern of biomarkers that is associated with the particular risk level.
  • the present invention provides methods for determining the severity of brain injury in a patient.
  • Each grade or stage of brain injury likely has a characteristic level of a biomarker or relative levels of a set of biomarkers (a pattern).
  • the severity of brain injury is determined by measuring the relevant biomarkers and then either submitting them to a classification algorithm or comparing them with a reference amount, i.e., a predefined level or pattern of biomarkers that is associated with the particular stage.
  • the present invention provides methods for determining the course of brain injury in a patient, brain injury course refers to changes in brain injury status over time, including brain injury progression (worsening) and brain injury regression
  • this method involves measuring the level of one or more biomarkers in a patient at least two different time points, e.g., a first time and a second time, and comparing the change, if any. The course of brain injury is determined based on these comparisons.
  • the methods further comprise managing patient treatment based on the status.
  • Such management includes the actions of the physician or clinician subsequent to determining brain injury status. For example, if a physician makes a diagnosis of brain injury, then a certain regime of monitoring would follow. An assessment of the course of brain injury using the methods of the present invention may then require a certain brain injury therapy regimen. Alternatively, a diagnosis of non-brain injury might be followed with further testing to determine a specific disease that the patient might be suffering from. Also, further tests may be called for if the diagnostic test gives an inconclusive result on brain injury status.
  • the present invention provides methods for determining the therapeutic efficacy of a pharmaceutical drug. These methods are useful in performing clinical trials of the drug, as well as monitoring the progress of a patient on the drug.
  • Therapy or clinical trials involve administering the drug in a particular regimen.
  • the regimen may involve a single dose of the drug or multiple doses of the drug over time.
  • the doctor or clinical researcher monitors the effect of the drug on the patient or subject over the course of administration. If the drug has a pharmacological impact on the condition, the amounts or relative amounts (e.g., the pattern or profile) of one or more of the biomarkers of the present invention may change toward a non-brain injury profile. Therefore, one can follow the course of one or more biomarkers in the patient during the course of treatment.
  • this method involves measuring one or more biomarkers in a patient receiving drug therapy, and correlating the biomarker levels with the brain injury status of the patient (e.g., by comparison to predefined levels of the biomarkers that correspond to different brain injury statuses).
  • One embodiment of this method involves determining the levels of one or more biomarkers at at least two different time points during a course of drug therapy, e.g., a first time and a second time, and comparing the change in levels of the biomarkers, if any.
  • the levels of one or more biomarkers can be measured before and after drug administration or at two different time points during drug administration. The effect of therapy is determined based on these comparisons. If a treatment is effective, then the one or more biomarkers will trend toward normal, while if treatment is ineffective, the one or more biomarkers will trend toward brain injury indications.
  • data that are generated using samples such as "known samples” can then be used to "train” a classification model.
  • a "known sample” is a sample that has been pre-classified.
  • the data that are used to form the classification model can be referred to as a "training data set.”
  • the training data set that is used to form the classification model may comprise raw data or pre-processed data.
  • the classification model can recognize patterns in data generated using unknown samples.
  • the classification model can then be used to classify the unknown samples into classes. This can be useful, for example, in predicting whether or not a particular biological sample is associated with a certain biological condition (e.g., diseased versus non-diseased).
  • Classification models can be formed using any suitable statistical classification or learning method that attempts to segregate bodies of data into classes based on objective parameters present in the data. Classification methods may be either supervised or unsupervised. Examples of supervised and unsupervised classification processes are described in Jain, "Statistical Pattern Recognition: A Review", IEEE Transactions on Pattern Analysis and Machine Intelligence, Vol. 22, No. 1 , January 2000, the teachings of which are incorporated by reference.
  • supervised classification training data containing examples of known categories are presented to a learning mechanism, which learns one or more sets of relationships that define each of the known classes. New data may then be applied to the learning mechanism, which then classifies the new data using the learned relationships.
  • supervised classification processes include linear regression processes (e.g., multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)), binary decision trees (e.g., recursive partitioning processes such as CART), artificial neural networks such as back propagation networks, discriminant analyses (e.g., Bayesian classifier or Fischer analysis), logistic classifiers, and support vector classifiers (support vector machines).
  • linear regression processes e.g., multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)
  • binary decision trees e.g., recursive partitioning processes such as CART
  • artificial neural networks such as back propagation networks
  • discriminant analyses e.g., Bayesian classifier or Fischer analysis
  • Another supervised classification method is a recursive partitioning process.
  • Recursive partitioning processes use recursive partitioning trees to classify data derived from unknown samples. Further details about recursive partitioning processes are provided in U.S. Patent Application No. 2002 0138208 Al to Paulse et al., "Method for analyzing mass spectra.”
  • the classification models that are created can be formed using unsupervised learning methods.
  • Unsupervised classification attempts to learn classifications based on similarities in the training data set, without pre-classifying the spectra from which the training data set was derived.
  • Unsupervised learning methods include cluster analyses. A cluster analysis attempts to divide the data into "clusters" or groups that ideally should have members that are very similar to each other, and very dissimilar to members of other clusters. Similarity is then measured using some distance metric, which measures the distance between data items, and clusters together data items that are closer to each other.
  • Clustering techniques include the MacQueen's K-means algorithm and the Kohonen's Self-Organizing Map algorithm.
  • the classification models can be formed on and used on any suitable digital computer. Suitable digital computers include micro, mini, or large computers using any standard or specialized operating system, such as a Unix, Windows® or LinuxTM based operating system. In embodiments utilizing a mass spectrometer, the digital computer that is used may be physically separate from the mass spectrometer that is used to create the spectra of interest, or it may be coupled to the mass spectrometer.
  • the training data set and the classification models according to embodiments of the invention can be embodied by computer code that is executed or used by a digital computer.
  • the computer code can be stored on any suitable computer readable media including optical or magnetic disks, sticks, tapes, etc., and can be written in any suitable computer
  • the learning algorithms described above are useful both for developing classification algorithms for the biomarkers already discovered, and for finding new biomarker biomarkers.
  • the classification algorithms form the base for diagnostic tests by providing diagnostic values (e.g., cut-off points) for biomarkers used singly or in combination.
  • kits for qualifying brain injury status which kits are used to detect the biomarkers described herein.
  • the kit is provided as an ELISA kit comprising antibodies to the biomarkers of the present invention including, but not limited to, ASTN1, BAB, CNDP1, ERMIN, GFAP, GRM3, KLH32, MAGE2, NRG3, NRGN, OMG, SLC39A12, RTN1, and MT3.
  • the ELISA kit may comprise a solid support, such as a chip, microtiter plate (e.g., a 96-well plate), bead, or resin having biomarker capture reagents attached thereon.
  • the kit may further comprise a means for detecting the biomarkers, such as antibodies, and a secondary antibody-signal complex such as horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody and tetramethyl benzidine (TMB) as a substrate for HRP.
  • HRP horseradish peroxidase
  • TMB tetramethyl benzidine
  • the kit for qualifying brain injury status may be provided as an immuno- chromatography strip comprising a membrane on which the antibodies are immobilized, and a means for detecting, e.g., gold particle bound antibodies, where the membrane, includes NC membrane and PVDF membrane.
  • the kit may comprise a plastic plate on which a sample application pad, gold particle bound antibodies temporally immobilized on a glass fiber filter, a nitrocellulose membrane on which antibody bands and a secondary antibody band are immobilized and an absorbent pad are positioned in a serial manner, so as to keep continuous capillary flow of blood serum.
  • a patient can be diagnosed by adding blood or blood serum from the patient to the kit and detecting the relevant biomarkers conjugated with antibodies, specifically, by a method which comprises the steps of: (i) collecting blood or blood serum from the patient; (ii) separating blood serum from the patient's blood; (iii) adding the blood serum from patient to a diagnostic kit; and, (iv) detecting the biomarkers conjugated with antibodies.
  • the antibodies are brought into contact with the patient's blood. If the biomarkers are present in the sample, the antibodies will bind to the sample, or a portion thereof.
  • blood or blood serum need not be collected from the patient (i.e., it is already collected).
  • the sample may comprise a tissue sample or a clinical sample.
  • the kit can also comprise a washing solution or instructions for making a washing solution, in which the combination of the capture reagents and the washing solution allows capture of the biomarkers on the solid support for subsequent detection by, e.g., antibodies or mass spectrometry.
  • a kit can comprise instructions for suitable operational parameters in the form of a label or separate insert. For example, the instructions may inform a consumer about how to collect the sample, how to wash the probe or the particular biomarkers to be detected, etc.
  • the kit can comprise one or more containers with biomarker samples, to be used as standard(s) for calibration.
  • SCI patients with SCI have significant learning defects and are at increased risk for stroke. Early detection of SCI would allow institution of therapies to prevent further brain injury and neurocognitive defects, including loss of I.Q. By definition, SCI patients have MRI and pathologic evidence of brain injury consistent with microinfarction. Therefore, it is likely that unique circulating biomarkers exist to identify patients with SCI as has been shown in non-SCD patients with overt stroke.
  • the present goal of is to use non-biased proteomic techniques to explore clinically paired groups of SCI and non-SCI patient plasma samples to identify lead proteins for validation as circulating biomarkers of SCI.
  • the study population comprised male and female children 6-12 years old with SCD participating in the SIT Trial (24 institutions) having an adjudicated MRI with (SCI group) or without (non-SCI group) evidence of SCI.
  • SCI group an adjudicated MRI with (SCI group) or without (non-SCI group) evidence of SCI.
  • non-SCI group an adjudicated MRI with (SCI group) or without (non-SCI group) evidence of SCI.
  • patients have CBC, Hb/Hct, hemoglobin
  • the initial discovery cohort for this Example includes 50 patients with SCI and 50 patients without SCI, all with an Hb ⁇ 8.1 g/dL, as this has been shown to be an independent risk factor for SCI.
  • LC/MS/MS LTQ Orbitrap
  • each tandem MS spectra RAW file was searched using X! Tandem, OMSSA, and SageN SEQUEST against the IPI protein database (currently vs. 3.6 with full trypsin digestion) and the protein and peptide identification results compiled for each patient in Maspectras and Scaffold.
  • Initial lead proteins were identified based on presence/absence or a > 1.5 fold change (increase or decrease) in spectral counts of peptides in the SCI and non-SCI samples.
  • Complement component 4A (Rodgers blood group) (Uncharacterized
  • A2BHY4 Complement component C4B (Childo blood group)
  • A6NII9 isoform CRA a) (Putative uncharacterized protein ENSP00000336812)
  • SCI patients with SCI have significant learning defects and are at increased riskroke. Early detection of SCI would allow institution of therapies to prevent further brain injury and neurocognitive defects, including loss of I.Q. By definition, SCI patients have MRI and pathologic evidence of brain injury consistent with microinfarction. Therefore, it is likely that unique circulating biomarkers exist to identify patients with SCI as has been shown in non-SCD patients with overt stroke. The present goal of is to use non-biased proteomic techniques to explore clinically paired groups of SCI and non-SCI patient plasma samples to identify lead proteins for validation as circulating biomarkers of SCI.
  • the study population comprised male and female children 6-12 years old with SCD participating in the SIT Trial (24 institutions) having an adjudicated MRI with (SCI group) or without (non-SCI group) evidence of SCI.
  • SCI group an adjudicated MRI with (SCI group) or without (non-SCI group) evidence of SCI.
  • patients have CBC, Hb/Hct, hemoglobin electrophoresis and other clinical studies determined.
  • citrated plasma is prepared, frozen and stored in the Biologic Repository at Johns Hopkins at -70°C.
  • the initial discovery cohort for this Example includes 50 patients with SCI and 50 patients without SCI, all with an Hb ⁇ 8.1 g/dL, as this has been shown to be an independent risk factor for SCI.
  • 750 ⁇ of plasma from each patient was depleted, providing >1 mg (as 21 ml of pooled column flow through) of depleted proteins for downstream RP-HPLC fractionation.
  • RP-HPLC ProteomeLab PPS Proteome Partitioning System
  • Cig non-porous column using a linear acetonitrile gradient, with 60 fractions collected over 30 minutes.
  • the RP-HPLC fractions for each of the five RP-HPLC runs are collected in the same plate to increase the protein concentration of each fraction.
  • LC/MS/MS LTQ Orbitrap
  • a database of protein was developed and mined for differential protein expression between the two groups and annotated into functional and cell-type specific proteins for subsequent study.
  • proteins in these fractions were quantified using the mass spectroscopy technique, multiple reaction monitoring (MRM). Briefly, after trypsin, samples were submitted for LC/MS/MS identification and quantification using peptide signatures for biomarkers proteins.
  • MRM multiple reaction monitoring
  • NCBI Neuronal Component Identities. Using the NCBFs list of brain-specific proteins based on EST tags in Unigene (NCBI), 104 brain proteins circulating in children with SCI were identified. See Table 2. These peptide identifications have an expectation value of ⁇ 0.9.
  • CAMK1G Isoform 1 of Calcium/calmodulin-dependent protein kinase type 1G
  • D0CK3 Dedicator of cytokinesis protein 3
  • FAM5B Isoform 1 of Protein FAM5B
  • GABBR1 Isoform 1A of Gamma-aminobutyric acid type B receptor subunit 1
  • GPRASP2 G-protein coupled receptor-associated sorting protein 2
  • KIF19 Isoform 1 of Kinesin-like protein KIF19
  • KIF5A Kinesin heavy chain isoform 5A
  • MAP7D2 Isoform 1 of MAP7 domain-containing protein 2
  • NAP1L3 Nucleosome assembly protein 1 -like 3
  • NCAM1 Isoform 1 of Neural cell adhesion molecule 1
  • PAX7 Isoform Long of Paired box protein Pax-7
  • SCN8A Isoform 1 of Sodium channel protein type 8 subunit alpha
  • WFIKKN2 WAP WFIKKN2 WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2
  • Example 3 Biomarker Panel for Diagnosis of Subclinical Brain Injury Further analysis of the data described herein, as well as data from a cohort of adults having heart surgery, resulted in the following panel of biomarkers that can be used individually, or in combination to diagnose/assess subclinical brain injury.
  • Example 4 Proteomic Identification of Glial Fibrillary Acidic Protein as a Plasma Biomarker of Brain Injury in Children with Sickle Cell Disease
  • Sickle cell disease is a chronic hemolytic anemia that is characterized by injury to multiple organs. Stroke is the most prominent injury that can occur to the brain in SCD.
  • Stroke risk has been reduced significantly in children by identifying those patients with elevated transcranial Doppler velocities and implementing chronic red cell transfusion.
  • GFAP glial fibrillary acidic protein
  • concentrations could serve as a biomarker of brain injury in sickle cell disease.
  • SIT Trial ClinicalTrials.gov NCT00072761
  • the SIT Trial is a multi-center, randomized, controlled trial of a three year-transfusion program in children with sickle cell disease and SCI.
  • the primary endpoint includes the occurrence of overt stroke or new or progressive SCI. All patients signed informed consent.
  • SCI is defined by a normal neurologic exam and MRI signal abnormality visible on two views on T2 weighted images. The signal abnormality must measure at least 3 mm in one dimension.
  • SCI status is adjudicated by a panel of neuroradiologists and neurologists. See Vendt et al, 22(3) J. DIGIT. IMAGING 326-43 (2009). Positive and negative control patients were selected from Johns Hopkins Hospital clinics and inpatient units. Positive control plasma samples were obtained from hospitalized children and adults admitted for overt stroke or brain surgery. Negative controls were selected from children 5-16 years old from the Harriet Lane Pediatrics Clinic at Johns Hopkins Hospital. Clinic notes were reviewed to exclude patients with any acute illness, neurologic disorder, or chronic illness other than asthma, obesity, and behavior/mood disorders. De-identified blood samples and clinical data on these controls were obtained through an IRB approved study.
  • Plasma Preparation and Mass Spectroscopic Analysis Blood was collected into ACD or EDTA tubes and spun at 1500g for 8 minutes per the SIT Trial protocol and stored at - 70°C in the Biologic Repository for the SIT Trial at Johns Hopkins University until analysis. Five hundred microliters of plasma was depleted of 12 abundant plasma proteins using an LC10 IgY column (Beckman Coulter, Fullerton, CA) on a ProteomeLab Protein Partitioning System (PPS, Beckman). IgY column flow through was separated into 39 fractions by reverse phase HPLC over a CI 8 column (Jupiter, Phenomenex) using a continuous acetonitrile gradient (PPS, Beckman).
  • GFAP Measurements GFAP was measured in undiluted duplicate plasma samples using an electrochemiluminescent sandwich immunoassay (MesoScale Discovery,
  • a GFAP peptide was identified by SEQUEST searches in 4 of 6 plasma samples from SIT Trial subjects with SCI. See FIG. 2.
  • FIG. 3 shows GFAP levels for stroke (median 0.446 ng/ml, range 0.029-4.29 ng/ml), brain biopsy (median 0.96 ng/ml, range 0.162-1.93 ng/ml), and brain resection (median 1.29 ng/ml, range 0.122-24.1 ng/ml).
  • GFAP Plasma GFAP and SCI.
  • SCI and stroke are CNS events that are well documented to occur in sickle cell disease.
  • FIG. 4 children in both the SCI and non-SCI groups had elevated GFAP concentrations.
  • FIG. 5 shows serial plasma GFAP concentrations from an 11 year-old homozygous sickle cell patient (not a SITT participant) who had an acute stroke during a febrile illness that was clinically suspicious for meningitis. CSF examination was negative for infection and hemorrhage (6 WBC ⁇ L, 2 RBC ⁇ L).
  • the initial GFAP concentration (1.5 ng/ml, 6 times higher than the 95 th percentile for normal children) was measured in plasma obtained 32 hours prior to the clinical diagnosis of stroke.
  • the GFAP level in the CSF 25 hours after the clinical diagnosis of stroke was 44.6 ng/ml.
  • a study of GFAP in the CSF of pediatric all patients ⁇ 17 years old showed CSF GFAP levels to be 0.1-0.5 ng/ml in the absence of acute injury.
  • BLOOD CANCER 793-98 (2008) MRI performed 29 hours after the clinical diagnosis of stroke showed right anterior cerebral artery infarct. See FIG. 6.
  • GFAP is likely to be a marker of only acute brain injury, as GFAP levels continued to decrease after red blood cell exchange.
  • Plasma GFAP in other sickle cell morbidities were assessed for other sickle cell morbidities.
  • Reasons for admission were acute chest syndrome, pain crisis, influenza, fever, aplastic crisis (parvovirus B19 PCR confirmed), and priapism.
  • GFAP was not found to be routinely elevated in sick children with SCD, with concentrations in the normal range for 39/40 samples (range 0.01- 0.24 ng/ml). The highest value (0.44 ng/ml) was observed in a 4 year-old patient admitted for fever. This value is above the 95 th percentile of the normal range, but equivalent to the highest normal control value.
  • GFAP a known marker of brain injury
  • GFAP is a biomarker of cerebral infarct in sickle cell disease, although not a precise biomarker of SCI, as diagnosed by MRI in a cross sectional study of SIT Trial participants, where the timing of SCI is not known.
  • a cross- sectional population of children 5-14 years old with steady-state sickle cell disease 3.9% had extreme elevations of GFAP without apparent neurologic injury. It is hypothesized that these children with markedly elevated GFAP levels have subclinical brain injury. By history and neurologic exam, there were no apparent deficits.
  • SCI is a morbidity defined by either MRI or autopsy. Moser et al., 17 AM. J.
  • Plasma GFAP is not elevated in most patients with SCI, and when GFAP is elevated, it is evenly distributed between SCI positive and negative patients. Using cross sectional data, linking an episodic event to a transiently elevated plasma biomarker would be a chance event; therefore, the present inventors conclude that, if GFAP is elevated in the setting of SCI, it is a transient elevation.
  • the sickle cell patient with stroke described herein had an elevated plasma GFAP level for at least 13 days, and perhaps the elevation is shorter in SCI.
  • Other candidate biomarkers may reflect chronic brain and vascular injury that predisposes those with sickle cell disease to SCI and overt stroke.
  • Plasma is a unique source for biomarker discovery. Advantages are that it contains large quantities of protein, is widely available for study, and it may contain combinations of organ-specific sub-proteomes, with plasma analysis providing information about the state of these tissues. A major challenge to plasma biomarker study in plasma is the high
  • a challenge particular to pediatric proteomic research is the lack of an age-specific reference database.
  • One of the initiatives of the Human Proteome Organisation (HUPO) is the Human Plasma Proteome Project (http://www.hupo.org/research/hppp/).
  • the reference list of 9,504 proteins identified by at least one peptide is the benchmark for all plasma biomarker discovery.
  • a repository of age-matched controls was assembled for validation.
  • a future goal is to identify the plasma proteomes of age-matched controls to aid in biomarker discovery for this and all other pediatric proteomic research.
  • the results of this study validate the non-biased strategy for identifying potential biomarkers of brain injury in patients with sickle cell disease by identifying GFAP, a known marker of CNS injury in other populations.
  • GFAP a known marker of CNS injury in other populations.
  • Further proteomic studies of brain-specific proteins in SCD promise to be of great interest to our understanding, detection and treatment of CNS injury in SCD.
  • Example 5 Plasma Glial Fibrillary Acidic Protein as a Marker of Brain Injury and Predictor of Neurologic Outcomes after Extracorporeal Membrane Oxygenation
  • the present example was conducted to determine whether plasma GFAP levels are associated with acute neurologic injury in children undergoing ECMO. This was a prospective observational cohort study of children who underwent ECMO in the Johns Hopkins 26-bed PICU from April 2008 to August 2009. All children age 1 day to ⁇ 18 years who required ECMO for any indication and who received a continuous unfractionated heparin infusion during the ECMO course were eligible for this study. Twenty two patients were enrolled for GFAP analysis.
  • the median age was 10 days (range 1 day- 16 years), 12 (54.5%) patients were males and 12 (54.5%) were African-American.
  • the main illness category was medical non-cardiac 14 (64%) and indications for ECMO were respiratory failure 12 (54.5%), cardiac failure 6 (27.3%), ECPR 3 (13.6%) and sepsis 1 (4.6%).
  • Abnormal GFAP levels i.e., >95 th percentile
  • Plasma GFAP levels remained normal in three patients classified as having an acute neurologic injury based on our a priori definition, as follows: a patient with a right cerebellar hemorrhage diagnosed by head ultrasound who expired on ECMO due to non-neurologic causes, and two patients with small extra-axial hemorrhages: a patient with a small subdural hematoma who survived with good neurologic function and a patient with a grade I intraventricular hemorrhage who also survived with good neurologic function.
  • This initial cohort of ECMO patients included three patients who underwent ECPR: one survived with good neurologic outcome and had normal GFAP levels throughout the ECMO course (median: 0.07ng/ml, IQR: 0.05-0.09ng/ml); one suffered a hypoxic pulseless electrical activity cardiac arrest due to status asthmaticus, evolved to brain death and showed high plasma GFAP levels (median: 27.2ng/ml, IQR: 9.5-44.9ng/ml) and one patient developed severe cerebral edema, eventually had withdrawal of support due to multisystem organ failure and also showed high plasma GFAP levels (median: 5.8ng/ml, IQR: 2.8-10.5ng/ml).
  • GFAP could fill an important clinical gap as a useful diagnostic tool for acute neurologic injury on ECMO and as a predictor of outcome in this high risk group.
  • Example 6 GFAP as a Marker of Neurologic Injury in Neonates Hypoxic-ischemic encephalopathy (HIE) is a subset of neonatal stroke occurring in 2.5/1000 term live births. Unfortunately intrapartum fetal monitoring and postpartum brain imaging cannot rapidly identify infants with perinatal brain injury. Importantly, neonates with moderate to severe HIE who receive head cooling within 6 hours of birth may have improved survival with diminished neurodevelopmental disability. Although therapies are being developed to treat the neonate at risk for HIE, no biomarkers are known to acutely identify specific brain injury, follow HIE therapy efficacy or to evaluate new therapies in the child at risk. A rapid test that could be done at the time of birth would be of great clinical benefit in identifying the infant at risk for HIE in order to benefit from these investigational treatments, identify therapeutic efficacy, and provide early prognostic information.
  • HIE Hypoxic-ischemic encephalopathy
  • a GFAP level > 0.08 ng/ml had a higher area under the ROC curve in identifying neonatal neurologic injury than other commonly used markers for the presence of intrauterine hypoxia-ischemia such as meconium stained fluid, 5 min APGAR ⁇ 7, or an umbilical arterial gas at the time of birth indicating metabolic acidosis (pH ⁇ 7.0 and Base Excess ⁇ -12 mM).
  • meconium stained fluid 5 min APGAR ⁇ 7, or an umbilical arterial gas at the time of birth indicating metabolic acidosis (pH ⁇ 7.0 and Base Excess ⁇ -12 mM).
  • GFAP can be correlated to functional and structural neurologic injury as a consequence of birth injury.
  • the present example validates GFAP as a circulating marker of birth related neurologic injury.
  • Example 7 Glial Fibrillary Acidic Protein (GFAP) Serves as a Biomarker for Neonatal Neurologic Injury.
  • GFAP is the principal intermediate filament of the human astrocyte and is a marker specific to the central nervous system. Its appearance in a patient's serum has been found to predict neurological outcome in patients after traumatic brain injury and stroke. Brain edema following ischemia causes disruption of the blood-brain barrier, and GFAP is markedly upregulated in astrocytes in the ischemic process. The present objective was to determine if serum levels of GFAP obtained within 24 hours of birth can be used to identify neonates with neurologic injury.
  • ROC Receiver operator characteristic
  • encephalopathy in order to determine if GFAP levels correlated with neonatal neurologic injury.
  • Example 8 Ability of GFAP to Detect Neurologic Injury in Pediatric Patients with Cardiac Disease on ECMO. Children undergoing cardiopulmonary bypass (CPB) experience neurologic injury in 30-70% of cases. See McQuillen et al, 38 STROKE736-41 (2007); and Mahle et al, 106 CIRCULATION I- 109-1-1 14 (2002). Extracorporeal membrane oxygenation (ECMO) represents a similar support modality with a risk of neurologic injury in 10-60% of cases. See Cengiz et al, 33(12) CRIT. CARE MED. 2817-24 (2005); and (2004) et al, 69(1) ANN. THORAC. SURG. 186-92 (2000). It is hypothesized that a brain specific protein, glial fibrillary acidic protein, (GFAP), could serve as a plasma biomarker for neurologic injury in these vulnerable patients while on ECMO.
  • GFAP glial fibrillary acidic protein
  • a total of 7 children with critical cardiac disease were enrolled. Median duration of ECMO support was 5.2 days (range: 1 to 12 days). The 2 children who underwent ECMO post-CPB had GFAP levels similar to other children who underwent ECMO only.
  • One patient who experienced acute neurologic injury had plasma GFAP levels that were 100-fold greater than those without neurologic injury; the increase in plasma GFAP coincided with detection of neurologic injury by imaging.
  • the plasma GFAP levels during the ECMO course for each patient are shown in Table 5 below.
  • Plasma GFAP appears to correlate with neurologic injury in this series of patients with critical heart disease on ECMO. This may aid in detection of neurologic injury in patients on ECMO and during CPB.
  • CHD congenital heart defects
  • GFAP could serve as diagnostic/prognostic biomarker of brain injury during cardiopulmonary bypass for surgical repair of congenital heart disease.
  • Cardiopulmonary bypass serum samples were obtained before, during (every 30 minutes) and after from 20 consecutive infants (2 days-3 months) undergoing cardiopulmonary bypass for surgical repair of congenital heart disease.
  • the number of cases with quantifiable GFAP levels increase as bypass progresses, beginning in the first hour of bypass (Early Bypass) and peaking at the end of bypass (Late Bypass). Only one case had a quantifiable GFAP level prior to bypass with all 20 cases having measurable values at the end of bypass.
  • levels of GFAP are significantly increased in the Mid, Late and Off bypass periods (p ⁇ 0,05, p ⁇ 0.001 and pO.001, respectively when compared to pre- and early bypass levels).
  • the magnitude of elevation in 4 of the cases is equivalent to levels seen with overt stroke (0.5- 2.5ng/ml). Two of these 4 infants had a post-operative brain MRI and were confirmed to have an acute stroke. See also FIG. 13.
  • Example 10 GFAP as a Brain Injury Biomarker in Children
  • the objective of this study was to determine whether, in children, plasma glial fibrillary acidic protein is associated with brain injury during extracorporeal membrane oxygenation and with mortality.
  • Glial fibrillary acidic protein was measured using an electrochemiluminescent immunoassay developed at Johns Hopkins. Control samples were collected from 99 healthy children (0.5- 16 yrs) and 59 neonatal intensive care unit infants without neurologic injury.
  • the median glial fibrillary acidic protein concentration was 0.055 ng/ml (interquartile range, 0- 0.092 ng/ml) and the 95th percentile of glial fibrillary acidic protein was 0.436 ng/ml.
  • plasma glial fibrillary acidic protein was measured at 6, 12, and every 24 hrs after cannulation. Twenty-two children who underwent extracorporeal membrane oxygenation were enrolled.
  • Brain injury biomarkers may aid in outcome prediction and neurologic monitoring of patients on extracorporeal membrane oxygenation to improve outcomes and benchmark new therapies.
  • This study was a prospective observational cohort study of children who underwent ECMO in a 26-bed pediatric intensive care unit of a single tertiary care, academic pediatric center from April 2008 to August 2009. Patients ⁇ 18 yrs who required ECMO for any indication were eligible for this study.
  • This cohort was initiated for the study of coagulation-related risk factors for neurologic injury during ECMO with a secondary aim to investigate brain injury biomarkers in this population. Exclusion criteria were history of heparin-induced thrombocytopenia and use of direct thrombin inhibitors for anticoagulation during ECMO. Parents or legal guardians were approached for consent after patient stabilization, within the first 6 hrs after ECMO cannulation, only when present in the pediatric intensive care unit.
  • the ECMO circuit consisted of: custom-packed one-fourth- or three-eighths-inch flexible polyvinylchloride tubing (Medtronic, Minneapolis, MN) with a silicone reservoir, a bladder
  • Biomarker Sampling and Analysis Venous blood samples (5 ml in sodium citrate 3.2%) were collected at 6, 12, and 24 hrs after initiation of ECMO and then daily until ECMO discontinuation. After separation by centrifugation within 1 hr, platelet-poor plasma was stored at -80°C. Fifty microliters were used for GFAP measurements in undiluted duplicate plasma samples using an electrochemiluminescent sandwich immunoassay developed on the MesoScale Discovery platform (MesoScale Discovery, Gaithersburg, MD) at Johns Hopkins University and based on the assay of Petzold et al., 287 J. IMMUNOL.
  • the monoclonal anti-GFAP blend SMI-26 (Covance, Princeton, NJ) was used at 100 ng per well as capture antibody in standard bind plates (MesoScale Discovery) coated either by the manufacturer or in the laboratory with overnight incubation in phosphate- buffered saline.
  • Polyclonal anti-GFAP (Dako, Carpinteria, CA) that was directly conjugated with Sulfo-Tag (MesoScale Discovery) was used for detection at 1 ⁇ g/ml in phosphate- buffered saline. Plates were read with a Sector Imager 2400 (MesoScale
  • Standard curves were constructed with purified GFAP (Calbiochem, La Jolla, CA) in 1% bovine serum albumin (SeraCare Life Sciences, Milford, MA). After experiments to determine the optimal antibody concentrations, plate type, and blocking material, the final assay for GFAP values had a standard curve with a linear range of quantification from 0.040- 40.0 ng/ml.
  • the lower limit of quantification defined as the lowest dilution with a calculated
  • Plasma spiked with GFAP shows 49.8% + 22.9% recovery at 10 ng/ml when compared with a standard curve generated in bovine serum albumin.
  • Validation of the GFAP assay was conducted using discarded diagnostic specimens from normal and positive controls. This GFAP assay validation study was approved in a separate application by the Johns Hopkins Institutional Review Board with a waiver of consent.
  • the primary independent variable was plasma GFAP elevation above the 95th percentile of normal values in children.
  • the primary outcome was
  • the six PCPC categories are 1) normal, age- appropriate neurodevelopmental functioning; 2) mild cerebral disability, 3) moderate cerebral disability; 4) severe cerebral disability; 5) coma or vegetative state, and 6) brain death. See Fiser et al, 28 CRIT. CARE MED. 2616-20 (2000); and Fiser et al, 121 J. PEDIATR. 68-74 (1992).
  • a trained pediatric critical care physician assigned PCPC retrospectively by conducting a chart review of the patient's condition at admission to the hospital and at discharge from the hospital. Good neurologic outcome was defined a priori as PCPC of 1 or 2 at discharge from the hospital or no change from PCPC at hospital admission.
  • Logistic regression with clustering by patient was used to estimate odds of brain injury and death using all serial GFAP data points.
  • subjects were coded as having no acute neurologic injury until brain injury by imaging or a first neurologic examination consistent with brain death was observed.
  • the median duration of ECMO was 12 days (interquartile range [IQR], 5-17 days).
  • the median number of GFAP measurements per patient was 4.5 (range, 1-16). Seventeen patients had three or more measurements, three patients had two measurements, and two patients had only one measurement.
  • a 95th percentile cutoff for normal values in children (plasma GFAP ⁇ 0.436 ng/ml) was determined using samples from 158 infants and children: 59 newborns ⁇ 4 days of life in the neonatal intensive care unit without known genetic disorders or intracranial pathology and 99 healthy children 6 months to 16 yrs of age who presented to the Johns Hopkins pediatric outpatient clinic for well-child visits.
  • GFAP levels in positive controls samples were overall one- to 55- fold higher than for normal controls.
  • GFAP Results Patients on ECMO.
  • the median initial GFAP level within 12 hrs after starting ECMO was 0.07 ng/ml (IQR, 0-0.155 ng/ml).
  • IQR 0-0.155 ng/ml
  • Peak plasma GFAP concentrations >95th percentile for normal controls i.e., >0.436 ng/ml were noted in six of 22 (27.3%) patients.
  • GFAP GFAP
  • This initial cohort of ECMO patients included three patients who underwent ECPR; one survived with a good neurologic outcome and had normal GFAP levels throughout the ECMO course (median GFAP, 0.07 ng/ml; IQR, 0.05-0.09 ng/ml); two patients had poor outcomes: one sustained a hypoxic pulseless electrical activity cardiac arrest as a result of status asthmaticus and evolved to brain death (median GFAP, 27.2 ng/ml; IQR, 9.5-44.9 ng/ml) and one patient developed severe cerebral edema, was successfully decannulated from ECMO, but eventually support was withdrawn for multisystem organ failure and medical futility (median GFAP, 5.8 ng/ml; IQR, 2.8-10.5 ng/ml).
  • ECMO is a procedure with high risk for brain injury, including intracranial hemorrhage, brain infarction, and brain death. Cengiz et al., 33 CRIT. CARE MED. 2817-24 (2005); Conrad et al, 51 ASAIO J. 4-10 (2004); and Cilley et al, 78 PEDIATRICS 699-704 (1986).
  • the means for timely assessment of such injuries in patients on ECMO are often lacking.
  • acute neurologic insult is of great concern in critically ill patients, no brain injury biomarker is available yet for routine clinical practice, although many coordinated efforts are ongoing. See Kaneko et al, 80 RESUSCITATION 790-94 (2009); and Laskowitz et al, 40 STROKE 77-85 (2009).
  • the plasma GFAP biomarker used in this study has many advantages such as high specificity to brain, easy to obtain samples for small blood volumes, fast processing, precise quantification, low cost, and minimal technical expertise required for the assay. Serial GFAP measurements could thus be used to monitor neurologic status and response to potential neuroprotective interventions, aid in the prompt diagnosis of acute brain injury, and predict outcomes.
  • GFAP concentrations were associated with brain injury in children on ECMO.
  • Serial GFAP concentrations appeared stable over time in the absence of neurologic insults and were significantly elevated in patients who were diagnosed with brain injury during ECMO.
  • the majority of patients (19 of 22) had normal GFAP levels in the first 24 hrs after ECMO cannulation, suggesting that cannulation of the right jugular vein+the right carotid artery is not accompanied by injury leading to reactive gliosis and GFAP elevations.
  • GFAP concentrations were elevated in four patients before a diagnosis of brain injury; two patients were diagnosed with acute neurologic injury while on ECMO and two patients had imaging evidence of prior brain ischemia or hemorrhage after ECMO decannulation. This may be particularly important for infants with intraparenchymal lesions that cannot be detected by transfontanellar sonography, thus providing false reassurance to clinicians.
  • Acute neurologic injury is found more frequently in patients undergoing ECPR compared with ECMO for other indications. See Barrett et al, 10 PEDIATR. CRIT. CARE MED. 445-51 (2009); and Conrad et al, 51 ASAIO J. 4-10 (2004). Recent studies report 73% survival to hospital discharge in pediatric patients undergoing ECPR with 75-78% of survivors having favorable neurologic outcomes. See Barrett et al., 10 PEDIATR. CRIT. CARE MED. 445-51 (2009); and Prodhan et al, 80 RESUSCITATION 1 124-29 (2009). Acute neurologic injury occurs in 22% of pediatric patients undergoing ECPR; of these, 89% die before hospital discharge. Barrett et al, 10 PEDIATR.
  • Example 1 1 GFAP as a Biomarker for Neonatal Hypoxic-Ischemic Encephalopathy Treated with Whole-Body Cooling
  • Subjects This is an institutional review board-approved prospective cohort study that examined neonates admitted to the neonatal intensive care unit (NICU) at a single tertiary university hospital. Subjects were live -born, non-anomalous, non-syndromic infants born at 36-41 weeks' gestation. This study included neonates born at Johns Hopkins as well as those born within the state of Maryland and transported to the NICU within 6 hours of birth.
  • NICU neonatal intensive care unit
  • Preeclampsia was defined as proteinuria and new-onset hypertension.
  • Administration of intravenous magnesium sulfate to the mother prior to delivery was recorded because this therapy has been linked with a reduced risk of neonatal brain injury.
  • Rouse et al 359 N. ENGL. J. MED. 895-905 (2008).
  • Intrauterine growth restriction was defined as an estimated fetal weight less than the 10th percentile for gestational age.
  • Non-reassuring fetal heart rate tracings were those significant enough to prompt operative vaginal or cesarean delivery. Sepsis was considered present only for neonates with positive blood and/or cerebrospinal fluid cultures.
  • Neonates with moderate to severe encephalopathy that met criteria for whole body cooling were compared with neonates without neurologic injury admitted to the NICU matched by gestational age within 1 week in a 1 : 1 fashion.
  • Neonates of 36 weeks' gestation or longer that qualify are cooled using a conductive water- based hypothermia system and hypothermia blankets within 6 hours of birth and are kept at a rectal temperature of 33.5°C for 72 hours.
  • Neonates with an abnormal brain MRI were compared with those whose brain MRI was normal. The images were reviewed for focal or diffuse lesions related to hypoxic ischemic injury.
  • MRI brain abnormalities were defined as brain swelling; cortical highlighting; focal or global loss of gray- white matter differentiation; abnormal signal intensity in the basal ganglia and thalami; loss of normal signal intensity in the posterior limb of the internal capsule; acute and subacute parenchymal, intraventricular, or extracerebral hemorrhage; and acutely evolving focal infarction in an arterial territory or in a parasagittal or watershed distribution. See Cowan et al, 361 LANCET 736-42 (2003).
  • Specimens collected for measurement of GFAP included umbilical cord blood and neonatal serum.
  • umbilical cord blood a small aliquot was taken from the umbilical cord venous blood sample routinely collected at delivery.
  • For neonatal samples the remaining fraction of serum from daily laboratory tests was collected after clinically indicated testing was completed.
  • Neonatal serum specimens were collected at the time of admission to the NICU (within 6 hours of birth) and then daily for the first 4 days of life for the non-neurologically injured controls and daily for 7 days for neonates with HIE that underwent whole-body cooling.
  • GFAP Assay Using the Mesoscale platform (MesoScale Discovery, Gaithersburg, MD), an electrochemiluminescent sandwich immunoassay was developed for GFAP. See Pelinka et al, 57 J. TRAUMA 1006- 12 (2004). This was developed after the method of
  • Petzold et al. using a trio of mouse monoclonal antibodies for capture and a rabbit polyclonal for detection. See Bembea et al, 1 1 PEDIATR. CRIT. CARE MED. 723-30 (2010); and Petzold et al, 287 J. IMMUNOL. METHODS 169-77 (2004). Serum samples were assayed in duplicate, and the mean concentration was used for analysis. The lower limit of quantitation was 0.04 ng/ml; values below this were reported as zero.
  • Receiver-operator characteristic (ROC) curves were constructed to determine the optimal cutoff (as determined by maximal area under the curve) of serum GFAP level at NICU admission to identify HIE qualifying for whole-body cooling and to identify neonates with brain abnormalities on MRI.
  • the area under the ROC curve was used to compare the ability of admission GFAP to identify neonates with abnormalities on brain MRI scans compared with other currently used tests to identify these infants: non-reassuring fetal heart rate tracing, meconium, 5 minute Apgar less than 7, and umbilical arterial pH less than 7.0 or base deficit greater than 12 mM.
  • Statistical analyses were performed with Stata 10
  • Maternal and neonatal characteristics are summarized in FIG. 18. Maternal demographics and incidence of cesarean delivery were not different. The most likely reason for admission for the controls was respiratory distress and to rule out sepsis. The subjects weighed 291 g less at birth, which was statistically, but not clinically, significant and were significantly more likely to have had a placental abruption, metabolic acidosis, a 5 minute Apgar less than 7 and had a longer length of stay in the NICU.
  • GFAP as a Biomarker of HIE.
  • a GFAP level at 54 of 138 of the desired time points (39.1%) could not be obtained, and for the cooled subjects 50 of 207 (24.2%) because of an insufficient amount of serum, no blood drawn on that day or an inability to obtain cord blood because the birth occurred at an outside hospital.
  • mean GFAP levels were significantly elevated in neonatal serum upon admission to the NICU within 6 hours of birth and on days 1, 3, and 4 of life, with
  • ROC curves were generated for various thresholds of GFAP level.
  • the NICU admission GFAP of 0.08 ng/ml or greater was the optimal cutoff point to distinguish the groups and produced an area under the ROC curve of 0.709.
  • a GFAP of 0.15 ng/ml or greater upon NICU admission was the optimal cutoff to identify neonates with abnormal brain MRI scans among all neonates that underwent whole body cooling (area under ROC curve 0.718). This was superior to indicators currently used to identify intrapartum HIE such as non-reassuring fetal heart rate tracing (area under ROC curve 0.613), meconium (0.508), 5 minute Apgar less than 7
  • time to oral feeding was used. See FIG. 22.
  • SD mean
  • 8 neonates with abnormal MRI scans 1 died at day of life 7, 5 required a gastric tube at a mean (SD) of 114 (81) days of life, and 2 were on full oral feeds at mean (SD) of 17 (9) days of life.
  • serum GFAP level at NICU admission had an area under the ROC curve of 0.731 in predicting an abnormal brain MRI with sensitivity of 50.0%, specificity of 84.6%, positive predictive value of 60.0%), and negative predictive value of 78.6%.
  • the present example describes the first use of a brain-specific protein, GFAP, as a serum biomarker correlating with clinical moderate to severe HIE, development of MRI evidence of brain injury, and functional outcome.
  • HIE occurs in 2.5 per 1000 live births at term and 14.5% of all cases of cerebral palsy are associated with intrapartum hypoxia-ischemia, the timing, duration, and outcomes of these injuries are poorly defined. See Graham et al, 199 AM. J. OBSTET. GYNECOL. 587-95 (2008).
  • Biomarkers serve as surrogates of disease injury, evolution, and outcome.
  • Authors of a systematic review of 110 publications in newborns (longer than 36 weeks) that had HIE strictly defined concluded that without biomarkers, the timing, duration, and effectiveness of therapies are ascertained in a relatively blind fashion. See Ramaswamy et al., 40 PEDIAT . NEUROL. 215-26 (2009); and American College of Obstetricians and Gynecologists, American Academy of Pediatricians. Chapter 8. Criteria required to define an acute intrapartum hypoxic event as sufficient to cause cerebral palsy. In: Neonatal encephalopathy and cerebral palsy. Washington, DC: ACOG; 2003:73-80. They also concluded that prospective studies should focus on determining which biomarkers best identify neonates who will benefit from intervention.
  • NEUROL. 215-26 (2009); and Blennow et al, 90 ACTA. PAEDIATR. 1171-75 (2001)), and other protein biomarkers (e.g., neuron-specific enolase and S100B) have limitations in tissue specificity. See Ramaswamy et al, 40 PEDIATR. NEUROL. 215-26 (2009).
  • HIE treated with selective head coolingl or whole-body cooling (Inder et al., 145 J. PEDIATR.
  • elevated serum GFAP during cooling is significantly associated with evidence of brain injury by MRI.
  • the ability to monitor the level of GFAP during cooling may allow triage of neonates to an escalation of therapy with cooling plus other therapies such as erythropoietin (Kim et al, 23 J. KOREAN MED. SCI. 484-91 (2008)), antiepileptic drugs (Glass et al, 9 CuRR. TREAT. OPTIONS NEUROL. 414-23 (2007)), and xenon. See Hobbs et al, 39 STROKE 1307-13 (2008). Fifty percent of neonates with brain injury on MRI in this study had a marked increase in levels of GFAP after completion of the 72 hour cooling protocol.
  • MRI is the most common clinical test used for evaluation of neonates with HIE and is associated with outcomes. Barnett et al, 33 NEU OPEDIAT ICS 242-8 (2002). The present example demonstrates that levels of GFAP upon NICU admission and during cooling are predictive of an abnormal MRI.
  • GFAP may serve as a biomarker to identify and monitor neonates with clinical HIE receiving cooling therapy. Its predictive ability to identify neonates with brain abnormalities because of HIE is better than currently used clinical indicators. Based on the results of this study, GFAP could be used to more specifically and sensitively diagnose brain injury at birth, to facilitate triage of infants into HIE treatment protocols with hypothermia plus adjuvant treatments, serve as an intermediate outcome to benchmark evolving HIE therapies, and give prognostic information to the parents of these at risk children.
  • Example 12 Proteomic Identification of Thrombospondin-1 and L-Selectin as Plasma Biomarkers of Subclinical Brain Injury in Children with Sickle Cell Disease
  • Sickle cell disease is a chronic hemolytic anemia that is characterized by injury to multiple organs. Stroke is the most prominent injury that can occur to the brain in SCD. Stroke risk has been reduced significantly in children by identifying those patients with elevated transcranial Doppler velocities and implementing chronic red cell transfusion. See King et al, 50 PEDIATR. BLOOD CANCER 599-602 (2008); and Adams et al, 339 N. ENGL. J. MED. 5-11 (1998). It is currently under study whether risk for brain injury, as ascertained by presence of silent cerebral infarct (SCI) on MRI, can be mitigated by chronic red blood cell transfusion. King et al, 50 PEDIATR. BLOOD CANCER 599-602 (2008). Clearly, biomarkers of stroke risk have transformed care in sickle cell disease.
  • MRI Magnetic resonance Imaging
  • MRI Magnetic resonance Imaging
  • a blood biomarker of SCI would fill a clinical void because blood is easy to obtain and measure, a biomarker may determine risk of or progression of neurologic injury to overt stroke, and a biomarker could benchmark current and new therapies for SCI.
  • trombospondin-1 Using a non-biased mass spectrometry based proteomics approach, trombospondin-1
  • TSP-1 and SELL were identified in the plasma of SCD patients with SCI who were screened by MRI and proteomic analysis. Both TSP-1 and SELL have been studied in SCD with the roles poorly defined, and in acute brain injury with evidence as important factors for brain recovery (TSP-1) (Lin et al, 34(1) STROKE 177-86 (2003)) or as predictive biomarker (SELL) (Lo et al, 26(9) J. NEUROTRAMA 1479-87 (2009). Given the identification of TSP-1 and SELL in the proteomics screen and the available literature, it is hypothesized that TSP-1 and SELL concentrations could serve as a biomarker of brain injury in sickle cell disease.
  • SIT Trial Silent Infarct Transfusion Trial
  • ClinicalTrials.gov NCT00072761 Silent Infarct Transfusion Trial
  • the SIT Trial is a multi-center, randomized, controlled trial of a three year-transfusion program in children with sickle cell disease and SCI.
  • the primary endpoint includes the occurrence of overt stroke or new or progressive SCI. All patients signed informed consent.
  • SCI is defined by a normal neurologic exam and MRI signal abnormality visible on two views on T2 weighted images. The signal abnormality must measure at least 3 mm in one dimension.
  • SCI status is adjudicated by a panel of neuroradiologists and neurologists.
  • Positive and negative control patients were selected from Johns Hopkins Hospital clinics and inpatient units. Positive control plasma samples were obtained from hospitalized children and adults admitted for overt stroke or brain surgery. Negative controls were selected from children 5-16 years old from the Harriet Lane Pediatrics Clinic at Johns Hopkins Hospital. Clinic notes were reviewed to exclude patients with any acute illness, neurologic disorder, or chronic illness other than asthma, obesity, and behavior/mood disorders. De-identified blood samples and clinical data on these controls were obtained through an IRB approved study.
  • IgY column flow through was separated into 39 fractions by reverse phase HPLC over a CI 8 column (Jupiter, Phenomenex) using a continuous acetonitrile gradient (PPS, Beckman). Fractions were dried (SpeedVac, Thermo Scientific, Waltham, MA) and trypsin digested (Promega, Madison, WI) at 37°C overnight. Spectra on each sample were obtained by LC/MS/MS (LTQ-Orbitrap, Thermo Scientific). Spectra were searched for protein identifications using Xtandem! and a human IPI database version 3.4. Post search analysis was performed using PASS (Integrated Analysis Inc., Bethesda, MD) with a confidence level of ⁇ 0.9 as a protein identification cut off.
  • PASS Integrated Analysis Inc., Bethesda, MD
  • TSP-1 and SELL Quantitative Measurements were measured in diluted duplicate plasma samples using a sandwich ELISA (R&D Systems) according to the manufacturer's protocol. SCI and non-SCI patient samples were picked randomly.
  • TSP-1 and SELL function as leukocyte adhesion molecules whose role is poorly understood in SCD (Ugochukwu et al, 30(4) INT. J. LAB. HEMATOL. 312-16 (2008); and Brittain et al, 97(7) BLOOD 2159-64 (2001)), but circulating SELL has been shown to be a sensitive and specific biomarker of pediatric brain trauma.
  • Log(e) scores ranged from -1.1 to -10.1. Representative spectra for a peptide each for TSP-1 (FIG. 23) and for SELL (FIG. 24) are shown.
  • TSP-1 and SCI Plasma TSP-1 and SCI.
  • TSP-1 in situ in the brain is important for recovery of brain injury and that TSP-1 can also play a role increasing the adherence of SCD red cells to endothelial cells.
  • SELL is a leukocyte adhesion molecule whose role is poorly understood in SCD, but circulating SELL has been shown to be a sensitive and specific biomarker of pediatric brain trauma. Lo et al, 26(9) J. NEU OTRAUMA 1479-87 (2009).
  • TSP-1 and SELL are biomarkers of silent cerebral infarction in sickle cell disease, as diagnosed by MRI in a cross sectional study of SIT Trial participants, where the timing of SCI is not known.
  • 30% of SCI and 4% of non-SCI had extreme elevations of TSP-1.
  • TSP-1 is a marker known to play a significant role in brain injury repair and angiogenesis. These children with markedly elevated TSP-1 levels have subclinical brain injury by definition as by history and neurologic exam, there were no apparent deficits.
  • SCI is a morbidity defined by either MRI or autopsy. See Moser et al., 17 AM. J. NEURORADIOL. 965-72 (1996); and Rothman et al, 20 ANN. NEUROL. 684-90 (1986). SCI in sickle cell disease has been associated with poorer neurocognitive performance than sickle cell disease patients without SCI (Schatz et al, 56 NEUROLOGY 1109-11 (2001); Armstrong et al, 97 PEDIATRICS 864-70 (1996)), but many children with sickle cell disease have poor neurocognitive function, despite normal brain MRIs. Detection of brain injury by plasma levels of proteins highly specific for brain may be a more sensitive means for detecting injury.
  • the results of the present example validate the non-biased strategy for identifying potential biomarkers of brain injury in patients with sickle cell disease by identifying TSP-1, a known marker of CNS injury repair in other populations.
  • TSP-1 a known marker of CNS injury repair in other populations.
  • the identification of TSP-1 in the plasma of a significant proportion of patients with sickle cell disease and SCI implicate TSP-1 as a biomarker potentially of SCI risk and/or is involved in SCI repair or part of the injury pathway.
  • Further proteomic studies of brain-specific proteins in SCD promise to be of great interest to our understanding, detection and treatment of CNS injury in SCD.
  • the Identification of Human NRGN Specific Aptamers Systematic Evolution of Ligands by Exponential enrichment (SELEX) procedure was used to identify the Human NRGN specific aptamers. Briefly, the specific aptamer was selected from a pool of single strand RNA by filter immobilization. The RNA-NRGN target complex can bind to nitrocellulose filter, and free RNA went through filtration. The specific aptamer was recovered from the filter and PCR amplified. After several round of selection, the specific aptamer with highest affinity with NRGN was enriched and sequencing identified. Prepare the Library for Selection. Single strand DNA oligo pool was chemically synthesized. The DNA oligo has 40mer random central core, which flanked by 2 constant sequences, and the library can be amplified by a pair of primers which target the 5' and 3' conserve ends of the library. The sequence of the library is:
  • RNA Library The single strand DNA library first was annealed with Sel2 5' primer, the sequence is 5 * -GGG GGA ATT CTA ATA CGA CTC ACT ATA GGG AGG ACG ATG CGG-3' (SEQ ID NO:2), which contains a T7 promoter for in vitro transcription.
  • the gap was filled in by Klenow reaction, which was performed at 37°C for 1.5 hours.
  • the reaction was purified by phenol: chloroform: isoamyl (25:24: 1) and chloroform: isoamyl (24:1) extraction once each and further concentrated with Centricon 30 at 4°C.
  • TE buffer, pH7.4 was used to wash the reaction twice while concentration process. The final OD260 was measured and concentration was determined.
  • RNA library was used to generat RNA library for SELEX by in vitro transcription, using the DuraScribe® T7 Transcription Kits (Epicentre, DS010910), following the manufacture's reaction condition.
  • 2'-Fluorine-CTP (2'-F-dCTP)
  • 2 '-Fluorine -UTP (2'-F-dUTP)
  • the final DuraScript® RNA (2 ' -fluorine-modified RNA
  • DNase I was used to treat the reaction and the RNA was extracted with phenol: chloroform: isoamyl (25:24: 1) and chloroform once each, followed by concentrate and desalt with Centricon 30 at 4°C.
  • RNA was further purified by denatured PAGE (12%, 7M Urea) gel purification.
  • the RNA band was cut from the PAGE gel, RNA was eluted in 2ml TE buffer overnight at 4°C.
  • the pure RNA was concentrate again using Centricon 30, and concentration of RNA was determined using conventional method.
  • Nitrocellulose Filter Pre-clear.
  • a 13mm Swin-Lok Filter holder (Whatman) (13-mm diameter), 0.45um pore size FJAWP nitrocellulose disk filters (Millipore) was assembled.
  • the filter was pre -wet with 1 ml washing buffer, which contains 20mM Hepes pH7.4, 50mM NaCl and 2mM CaCl 2 .
  • 500pmol RNA was diluted in lOOul IX binding buffer (the formula is the same as washing buffer except 0.1% BSA was added), and applied into the reservoir of the filter holder.
  • the filter holder was sealed into a 50 ml conical tube and incubated at 37°C for 30 minutes.
  • RNA was recovered by pass through the filter unite using 1 ml syringe, and 100 ⁇ of IX binding buffer was used to wash once. The R A passed through the filter was collected; total pre-cleared RNA was about 180 ⁇ .
  • Binding Reaction The binding reaction was assembled by adding 50 pmol human NRGN protein into the pre-cleared RNA, the molecular ratio of RNA:protein was about 10: 1. The total volume was brought to 200 ⁇ in IX binding buffer. The reaction was incubated at 37°C for 15 minutes. A new filter holder was assembled and prewet as above, the binding reaction to the filter was applied, a 5ml syringe was used to push the binding sample through, and the filter was washed with 5ml wash buffer.
  • the filter holder was disassembled, and the filter was transferred into a 1.5ml centrifuge tube which contained 600ul phenol: chloroform: isoamyl (25:24: 1). The tube was vortexed vigorously for approximately 1 min, then incubated at RT for 30 minutes. Two hundred microliters of H 2 0 was added and vortexed again, then spun at 14,000 rpm for 10 minutes.
  • RNA Amplify the Selected RNA by RT-PCR.
  • Five microliters of recovered RNA was used to synthesize the first strand of DNA.
  • Two micromolar of primer Sel2 3' was added into the reaction.
  • the sequence of Sel2 3' primer is: 5 '-TCT CGG ATC CTC AGC GAG TCG TC-3' (SEQ ID NO:3).
  • Reverse Transcriptase from Roche Cat #: 10 109 118 001 was used in the reaction, the conditions were as recommended by the manufacture.
  • the PCR reaction was assembled as follows: 5 ⁇ first stand DNA (from above step), 3 ⁇ of each 10 ⁇ primers (Sel2 3' from above step and Sel2 5' from above step), 39 ⁇ H20 and 50 ⁇ 2 X TopTaq Master Mix (Qiagen). A total of 8 reactions (800ul) were performed.
  • the PCR cycle condition was as follow: 94°C/5 * -> (94°C/30" -> 55°C/30" -> 72°C/30”) X 20 cycles— > 4°C.
  • the PCR product was confirmed by 3% agarose gel electrophoresis, and the rest of PCR product were desalted and concentrated using a Centricon 30 at 4°C. The concentration of PCR product was determined by measuring OD/260nm.
  • the final PCR product after 13 rounds of selection was cloned into pGEM-T Easy vector (Promega), the enriched aptamers were identified by DNA sequencing.
  • the clones containing the full primers and 40mer insert were aligned using ClustalW2 at EMBL-EBI website.
  • NRGN-A 1 and NRGN-A6 were selected as targets for validation. The following showed the alignment of the aptamers:
  • C A TTTTTTTCCAAATCGATCCGCCGGACCTTAT 43 (SEQ ID NO: 6)
  • NRGN- A 1 and NRGN-A6 RNA were chemically synthesized based on the sequences identified; adding a biotin linker to the RNA
  • RNA-protein complex can be retained on nitrocellulose membrane, a dot blot was used to detect the biotin labeled RNA aptamer.
  • nitrocellulose membrane was cut and shaken in IX washing buffer F for 30 min prior to use.
  • the nitrocellulose membrane was put on top of pre-wet Whatman paper and placed on the bottom of the apparatus, then the vacuum was assembled and hooked up.
  • the membrane was washed with lOOul IX washing buffer F per well once, then the binding reaction was applied. After the reactions were passed through, the membrane was washed with 200ul IX washing buffer F once, and then drained by vacuuming.
  • the membrane was then UV-crosslinked (Bio-Rad, #165-5031).
  • the Chemiluminescent Nucleic Acid Detection Module (Pierce, #89880) was used to detect the Biotin labeled RNA aptamer retained on nitrocellulose, following the
  • the membrane was incubated with streptavidin-HRP conjugate, and detected with the chemiluminescent substrate of HRP.
  • both NRGN aptamers NRGN-A1 and A6 bound to NRGN protein, the minimum amount of protein needed for detection using this method was 1.25pmol and 0.63pmol respectfully.
  • the same molar of human albumin was used as control, no signal could be detected, despite the amount of albumin used. This result indicated that both of these 2 aptamers bind to His-NRGN protein specifically. See FIG. 28.
  • Biotin labeled aptamers were immobilized on streptavidin particles and a pull-down assay was performed. Aptamers were diluted to 1 pmol/ ⁇ in TEN100 buffer (lOmM Tris-HCl, pH7.5, ImM EDTA, lOOmM NaCl), heated at 65°C for 5 ', then left at RT for 20 minutes to let the RNA fold into its natural conformation. Streptavidin magnetic particles (Roche, 1 1641778001) were washed 3 times with twice volume of
  • TEN 100 buffer then the aptamer samples were added and incubated at RT for 30minute with rotation. After incubation, the particles were washed with TEN 100 buffer 3 times, and then equilibrated with IX binding buffer F once. Different amounts of NRGN protein (0-2nmol) were diluted in 1 X binding buffer and added into the aptamer immobilized magnetic particles, then incubated at 37°C for 15 minutes.
  • the aptamers protein complex was dissociated by incubating in 26 ⁇ elution buffer (1M NaCl, lOmM EDTA) at room temperature for 10 min. The eluted protein was subjected to SDS- PAGE, and the protein bands were visualized by coomassie staining. The human albumin protein was used as negative control. A typical stained gel is shown in FIG. 29.
  • MRM Neurogranin Multiple Reaction Monitoring
  • GPGPGGPGGAGVAR (SEQ ID NO:7) was spiked in the samples to make standard curve to measure the concentration of signature peptide GPGPGGPGGAGVAR (SEQ ID NO: 7).
  • Peptide KGPGPGGPGGAGVAR (SEQ ID NO: 8) is also monitored to make sure there is no miscleavage in tryptic digestion.
  • the signals of neurogranin signature peptide and labeled standard peptide using a ABI Sciex Qtrap 4000 triple quadrapole mass spectrometer are shown in FIG. 30.
  • Human NRGN cDNA clone was purchased from Origene (Cat #: RC201209). The coding sequence was cloned into destination vector (Origene, pEX-N-His, Cat # PS 100030) by restriction enzymes (Sgf I + Mlu I) fragment swapping to generate pEX-N-His-NRGN expression plasmid. The coding sequence and reading frame were confirmed by DNA sequencing.
  • pEX-N-His-NRGN plasmid was transformed into Rosetta 2 (DE3) competent cells (Novagen #71397) according to manufacturer's instruction.
  • the bacteria were cultured in the Overnight Express Instant TB Medium (Novagen #71491) at 37°C for 16-18 hours, then harvested and suspended in TEN buffer (50 mM Tris, pH8.0, 0.5 mM EDTA and 0.5 M NaCl).
  • the bacteria were lysated by adding 1% NP-40, 25 mg lysozyme and complete proteinase inhibitors (Roche), sitting on ice for 30 minutes, then freeze-thaw one time.
  • FIG. 31 shows the typical His-NRGN on PAGE gel after coomassie staining; the predicted molecular weight of His-NRGN is 8.5 Kd.
  • a Neurogranin anti-Human monoclonal antibody (Johns Hopkins) at concentration of 75 ng/well was used as a capture antibody and a rabbit polyclonal to neurogranin (Johns Hopkins) at a concentration of 0.5 ⁇ g/ml was used as detection.
  • SULFO-TAG anti rabbit antibody (MSD Cat#R32AB- 1 ) at a concentration of 1 ⁇ g/ml was used as a labeled reporter at a concentration of 1 ⁇ g/ml.
  • GST NRGN recombinant protein Johns Hopkins was used as a standard at a starting concentration of 20 ng/ml then at 1 :2 for 7 dilutions in PBS/1 %BSA. PBS/1 %BSA was used as blank. The standard curve for this assay is shown in FIG. 33.
  • Neurogranin is Biomarker of Acute Brain Injury.
  • serum samples from an infant on ECMO support for 27 days for cardio-respiratory failure The infant had normal daily head ultrasounds and at the time of death was thought to not have brain injury.
  • the brain had multiple cortical infarcts they were not diagnosed by ultrasound.
  • GFAP levels were unchanged during the entire coarse of ECMO support.
  • neurogranin levels increased to a peak 15 fold over baseline over 14 days of ECMO support.
  • neurogranin is a gray matter, neuronal marker it was more sensitive to cortical gray matter injury than GFAP a marker of white matter injury. This provides evidence that neurogranin is a circulating biomarker of acute cortical brain injury and in combination with GFAP is able to discrimate white matter from gray matter injury to the brain.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2011/056338 2010-10-14 2011-10-14 Biomarkers of brain injury Ceased WO2012051519A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US13/879,470 US9746481B2 (en) 2010-10-14 2011-10-14 Biomarkers of brain injury
EP11833480.4A EP2628013B1 (en) 2010-10-14 2011-10-14 Biomarkers of brain injury
JP2013534031A JP6071886B2 (ja) 2010-10-14 2011-10-14 脳損傷のバイオマーカー
IL225731A IL225731B (en) 2010-10-14 2013-04-11 Biomarkers for brain injury
US14/524,217 US20150051115A1 (en) 2010-10-14 2014-10-27 Biomarkers of brain injury

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US39300910P 2010-10-14 2010-10-14
US61/393,009 2010-10-14
US201161436956P 2011-01-27 2011-01-27
US201161436955P 2011-01-27 2011-01-27
US61/436,955 2011-01-27
US61/436,956 2011-01-27

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/879,470 A-371-Of-International US9746481B2 (en) 2010-10-14 2011-10-14 Biomarkers of brain injury
US14/524,217 Division US20150051115A1 (en) 2010-10-14 2014-10-27 Biomarkers of brain injury

Publications (2)

Publication Number Publication Date
WO2012051519A2 true WO2012051519A2 (en) 2012-04-19
WO2012051519A3 WO2012051519A3 (en) 2012-09-20

Family

ID=45938999

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/056338 Ceased WO2012051519A2 (en) 2010-10-14 2011-10-14 Biomarkers of brain injury

Country Status (5)

Country Link
US (2) US9746481B2 (https=)
EP (1) EP2628013B1 (https=)
JP (1) JP6071886B2 (https=)
IL (1) IL225731B (https=)
WO (1) WO2012051519A2 (https=)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015129652A (ja) * 2014-01-06 2015-07-16 公益財団法人ヒューマンサイエンス振興財団 脳梗塞の診断マーカー及び診断キット
EP2896702A1 (en) * 2014-01-16 2015-07-22 University College Cork, National University Of Irland Cork A method of identifying a neonate at risk of having or developing hypoxic-ischaemic encephalopathy (HIE)
EP2825893A4 (en) * 2012-03-13 2016-03-16 Univ Johns Hopkins CITRILLINATED BRAIN AND NERVE PROTEINS AS A BIOMARKER OF BRAIN INJURY OR NERVOUS GENERATION
CN106645755A (zh) * 2016-12-30 2017-05-10 深圳大学 一种ad生物标记物及其检测方法
CN108872589A (zh) * 2018-01-03 2018-11-23 深圳市人民医院 脑梗死外周血标志物及其应用
JP2020034567A (ja) * 2013-07-17 2020-03-05 ザ・ジョンズ・ホプキンス・ユニバーシティ 脳損傷の診断/予後判定/評価において有用な組成物及びキット
US10849548B2 (en) 2017-05-30 2020-12-01 Abbott Laboratories Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin I and early biomarkers
US10866251B2 (en) 2017-05-25 2020-12-15 Abbott Laboratories Methods for aiding in the determination of whether to perform imaging on a human subject who has sustained or may have sustained an injury to the head using early biomarkers
US10877038B2 (en) 2017-04-28 2020-12-29 Abbott Laboratories Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury using early biomarkers on at least two samples from the same human subject
US10877048B2 (en) 2017-04-15 2020-12-29 Abbott Laboratories Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury in a human subject using early biomarkers
US11016105B2 (en) 2017-12-09 2021-05-25 Abbott Laboratories Methods for aiding in diagnosing and evaluating a traumatic brain injury in a human subject using a combination of GFAP and UCH-L1
US11016092B2 (en) 2017-03-23 2021-05-25 Abbott Laboratories Methods for aiding in the diagnosis and determination of the extent of traumatic brain injury in a human subject using the early biomarker ubiquitin carboxy-terminal hydrolase L1
US11022617B2 (en) 2017-12-09 2021-06-01 Abbott Laboratories Methods for aiding in the diagnosis and evaluation of a subject who has sustained an orthopedic injury and that has or may have sustained an injury to the head, such as mild traumatic brain injury (TBI), using glial fibrillary acidic protein (GFAP) and/or ubiquitin carboxy-terminal hydrolase L1 (UCH-L1)
AU2015330355B2 (en) * 2014-10-06 2021-09-23 Fundacio Hospital Universitari Vall D'hebron - Institut De Recerca Markers and their use in brain injury
US11169159B2 (en) 2017-07-03 2021-11-09 Abbott Laboratories Methods for measuring ubiquitin carboxy-terminal hydrolase L1 levels in blood
EP3982123A1 (en) * 2020-10-08 2022-04-13 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Markers and their use in brain injury
US11994522B2 (en) 2008-08-11 2024-05-28 Banyan Biomarkers, Inc. Biomarker detection process and assay of neurological condition
US11994523B2 (en) 2017-12-29 2024-05-28 Abbott Laboratories Biomarkers and methods for diagnosing and evaluating traumatic brain injury
US12077601B2 (en) 2016-10-28 2024-09-03 Banyan Biomarkers, Inc. Antibodies to ubiquitin C-terminal hydrolase L1 (UCH-L1) and glial fibrillary acidic protein (GFAP) and related methods
US12422442B2 (en) 2014-10-06 2025-09-23 Universite De Geneve Markers and their use in brain injury
US12601749B2 (en) 2008-08-11 2026-04-14 Banyan Biomarkers, Inc. Biomarker detection process and assay of neurological condition

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9378551B2 (en) * 2013-01-03 2016-06-28 Siemens Aktiengesellschaft Method and system for lesion candidate detection
US10238664B2 (en) * 2014-07-09 2019-03-26 Duke University Compositions and methods for the repair of myelin
US20180024145A1 (en) 2015-02-05 2018-01-25 Immunarray USA, Inc. Methods and compositions for diagnosing brain injury or neurodegeneration
CN107864671A (zh) 2015-05-05 2018-03-30 加利福尼亚大学董事会 星形细胞创伤节和神经创伤生物标志物
CN110383068A (zh) * 2016-10-03 2019-10-25 雅培实验室 评估患者样品中uch-l1状态的改进方法
EP3559670A1 (en) * 2016-12-23 2019-10-30 Pangratz-Führer, Susanne Alpha-b crystallin in the diagnosis of neonatal brain damage
EP4537847A3 (en) 2017-01-13 2025-07-30 Duke University Compositions and methods for the treatment of myelin related and inflammation related diseases or disorders
WO2018217792A1 (en) 2017-05-23 2018-11-29 Immunarray USA, Inc. Biomarker levels and neuroimaging for detecting, monitoring and treating brain injury or trauma
WO2019112863A1 (en) * 2017-12-06 2019-06-13 FloTBI Inc. Assay and point of care device utilizing saliva for diagnosis and treatment of neurological conditions affected brain health
EP3779452B1 (en) * 2018-03-30 2023-05-03 National Center of Neurology and Psychiatry Neonatal hypoxic-ischemic encephalopathy severity determining method and prognosis predicting method
EP3880067A4 (en) * 2018-11-14 2022-08-10 Mark Evans METHOD AND DEVICE FOR REDUCING THE RISK OF NEONATAL NEUROLOGICAL INJURY
US20220016221A1 (en) * 2018-12-05 2022-01-20 Ipsen Biopharm Limited Treatment of symptoms of traumatic brain injury
CN110261617B (zh) * 2019-05-14 2022-07-01 深圳市人民医院 脑出血外周血标志物及其应用
CN110907422B (zh) * 2019-12-16 2021-07-06 吉林大学 基于Ti3C2的凝血酶适体传感器及其制备方法
WO2021234607A1 (en) * 2020-05-20 2021-11-25 St. Jude Children's Research Hospital Detection of alzheimer's disease using specific biomarkers
US20230250480A1 (en) * 2020-07-09 2023-08-10 University Of Florida Research Foundation, Incorporated Biofluid-based protein and mirna biomarkers for neonatal hypoxic-ischemic encephalopathy
US12582345B2 (en) * 2021-02-01 2026-03-24 The University Of Chicago Systems and methods for identifying progression of hypoxic-ischemic brain injury

Citations (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5242828A (en) 1988-11-10 1993-09-07 Pharmacia Biosensor Ab Sensing surfaces capable of selective biomolecular interactions, to be used in biosensor systems
US5270163A (en) 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US5475096A (en) 1990-06-11 1995-12-12 University Research Corporation Nucleic acid ligands
US5567588A (en) 1990-06-11 1996-10-22 University Research Corporation Systematic evolution of ligands by exponential enrichment: Solution SELEX
US5595877A (en) 1990-06-11 1997-01-21 Nexstar Pharmaceuticals, Inc. Methods of producing nucleic acid ligands
US5637459A (en) 1990-06-11 1997-06-10 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chimeric selex
US5660985A (en) 1990-06-11 1997-08-26 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands containing modified nucleotides
US5683867A (en) 1990-06-11 1997-11-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US5707796A (en) 1990-06-11 1998-01-13 Nexstar Pharmaceuticals, Inc. Method for selecting nucleic acids on the basis of structure
US5719060A (en) 1993-05-28 1998-02-17 Baylor College Of Medicine Method and apparatus for desorption and ionization of analytes
US5866434A (en) 1994-12-08 1999-02-02 Meso Scale Technology Graphitic nanotubes in luminescence assays
US6011020A (en) 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US6090545A (en) 1995-03-10 2000-07-18 Meso Scale Technologies, Llc. Multi-array, multi-specific electrochemiluminescence testing
WO2000056934A1 (en) 1999-03-24 2000-09-28 Packard Bioscience Company Continuous porous matrix arrays
US6140045A (en) 1995-03-10 2000-10-31 Meso Scale Technologies Multi-array, multi-specific electrochemiluminescence testing
US6207369B1 (en) 1995-03-10 2001-03-27 Meso Scale Technologies, Llc Multi-array, multi-specific electrochemiluminescence testing
US6225047B1 (en) 1997-06-20 2001-05-01 Ciphergen Biosystems, Inc. Use of retentate chromatography to generate difference maps
WO2001031580A2 (en) 1999-10-27 2001-05-03 Biowulf Technologies, Llc Methods and devices for identifying patterns in biological systems
US6319670B1 (en) 1995-05-09 2001-11-20 Meso Scale Technology Llp Methods and apparatus for improved luminescence assays using microparticles
US6329209B1 (en) 1998-07-14 2001-12-11 Zyomyx, Incorporated Arrays of protein-capture agents and methods of use thereof
US6413783B1 (en) 1997-09-18 2002-07-02 Meso Scale Technologies, Llc Assay sonication apparatus and methodology
US20020138208A1 (en) 2000-11-16 2002-09-26 Ciphergen Biosystems, Inc. Method for analyzing mass spectra
US20020193950A1 (en) 2002-02-25 2002-12-19 Gavin Edward J. Method for analyzing mass spectra
US20030004402A1 (en) 2000-07-18 2003-01-02 Hitt Ben A. Process for discriminating between biological states based on hidden patterns from biological data
US20030055615A1 (en) 2001-05-11 2003-03-20 Zhen Zhang System and methods for processing biological expression data
US6537749B2 (en) 1998-04-03 2003-03-25 Phylos, Inc. Addressable protein arrays
WO2003048768A2 (en) 2001-12-05 2003-06-12 Sense Proteomic Limited Protein arrays for allelic variants and uses thereof
US20030113713A1 (en) 2001-09-10 2003-06-19 Meso Scale Technologies, Llc Methods and apparatus for conducting multiple measurements on a sample
US20030124572A1 (en) 2001-07-30 2003-07-03 Favor Of Meso Scale Technologies, Llc. Assay electrode having immobilized lipid/protein layers, methods of making the same and methods of using the same for luminescence test measurements
US6673533B1 (en) 1995-03-10 2004-01-06 Meso Scale Technologies, Llc. Multi-array multi-specific electrochemiluminescence testing
US20040022677A1 (en) 2001-06-29 2004-02-05 Favor Of Meso Scale Technologies, Llc Assay plates, reader systems and methods for luminescence test measurements
US20050142033A1 (en) 2003-11-04 2005-06-30 Meso Scale Technologies, Llc. Modular assay plates, reader systems and methods for test measurements
US6919173B2 (en) 2001-09-10 2005-07-19 Meso Scale Technologies, Llc. Assay buffer, compositions containing the same, and methods of using the same
US20060019319A1 (en) 2004-06-03 2006-01-26 Meso Scale Diagnostics, Llc Methods and apparatuses for conducting assays
US7036946B1 (en) 2002-09-13 2006-05-02 Rockwell Collins, Inc. LCD backlight with UV light-emitting diodes and planar reactive element
US20090006339A1 (en) 2007-06-28 2009-01-01 Siemens Aktiengesellschaft Programmer interface for manufacturing execution system
US7497997B2 (en) 2002-12-26 2009-03-03 Meso Scale Technologies, Llc Assay cartridges and methods of using the same

Family Cites Families (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3234412A (en) * 1961-07-21 1966-02-08 Babcock & Wilcox Co Thermionic conversion nuclear reactor
US6780606B1 (en) 1999-02-26 2004-08-24 Synx Pharma, Inc. Method for diagnosing and distinguishing stroke and diagnostic devices for use therein
US20020164576A1 (en) 2000-09-22 2002-11-07 Pedersen Finn Skou Methods for diagnosis and treatment of diseases associated with altered expression of Nrf2
WO2002024867A2 (en) 2000-09-22 2002-03-28 University Of Aarhus Novel compositions and methods for lymphoma and leukemia
US6884591B2 (en) 2001-06-25 2005-04-26 The Cleveland Clinic Foundation Peripheral marker of blood brain barrier permeability
US7144708B2 (en) 2001-06-25 2006-12-05 The Cleveland Clinic Foundation Markers of blood barrier disruption and methods of using same
DE60233949D1 (de) 2001-08-20 2009-11-19 Biosite Inc Diagnostische marker für schlaganfall und hirntrauma sowie verfahren zur verwendung davon
US20070098728A1 (en) 2001-09-24 2007-05-03 Pedersen Finn S Novel compositions and methods in cancer
EP1519194A1 (en) 2003-09-24 2005-03-30 Roche Diagnostics GmbH Use of gfap for identification of intracerebral hemorrhage
US20140303041A1 (en) 2004-04-15 2014-10-09 University Of Florida Research Foundation Inc. In vitro diagnostic devices for nervous system injury and other neural disorders
ES2367311T3 (es) 2004-04-15 2011-11-02 University Of Florida Research Foundation, Inc. Productos de degradación proteolítica de map-2 como biomarcadores de diagnóstico para las lesiones neurales.
US7396654B2 (en) * 2004-04-15 2008-07-08 University Of Florida Research Foundation, Inc. Neural proteins as biomarkers for traumatic brain injury
US8492107B2 (en) 2004-04-15 2013-07-23 University Of Florida Research Foundation, Inc. Neural proteins as biomarkers for nervous system injury and other neural disorders
EP2514837B1 (en) * 2004-06-25 2016-02-10 Washington University Markers for brain damage
US20060257943A1 (en) 2005-01-25 2006-11-16 Cis Biotech, Inc. Ischemic biomarkers and their use to predict adverse neurological events from surgery
US7884260B2 (en) 2005-06-14 2011-02-08 University Of Chicago Cell-based screen for agents useful for reducing neuronal demyelination or promoting neuronal remyelination
GB2428240A (en) * 2005-07-14 2007-01-24 Univ Gen Ve Diagnostic method for brain damage-related disorders
WO2007123976A2 (en) 2006-04-18 2007-11-01 The Board Of Trustees Of The Leland Stanford Junior University Antibody profiling for determination of patient responsiveness
WO2007136617A2 (en) 2006-05-18 2007-11-29 Walter Reed Army Institute Of Research (Wrair) Endothelial-monocyte activating polypeptide ii, a biomarker for use in diagnosis of brain injury
WO2008046509A1 (en) 2006-10-16 2008-04-24 Bayer Schering Pharma Aktiengesellschaft Ltbp2 as a biomarker, therapeutic and diagnostic target
WO2008097618A1 (en) 2007-02-06 2008-08-14 University Of Florida Research Foundation, Inc. Synaptotagmin and collapsin response mediator protein as biomarkers for traumatic brain injury
WO2009143519A2 (en) 2008-05-23 2009-11-26 The Johns Hopkins University Biomarkers for myocardial ischemia
EP2143735A1 (en) 2008-07-10 2010-01-13 Institut Pasteur Variable domains of camelid heavy-chain antibodies directed against glial fibrillary acidic proteins
US20140342381A1 (en) 2008-08-11 2014-11-20 Banyan Biomarkers, Inc. Devices and methods for biomarker detection process and assay of neurological condition
JP5781436B2 (ja) 2008-08-11 2015-09-24 バンヤン・バイオマーカーズ・インコーポレーテッド 神経学的状態のバイオマーカー検出方法およびアッセイ
US20170315136A9 (en) 2009-06-19 2017-11-02 Banyan Biomarkers, Inc. Biomarker assay of neurological condition
AU2010291933B2 (en) 2009-09-14 2016-09-08 Banyan Biomarkers, Inc. Micro-RNA, autoantibody and protein markers for diagnosis of neuronal injury
GB201008541D0 (en) * 2010-05-21 2010-07-07 Univ Geneve Diagnostic methods
US8663911B2 (en) 2011-01-28 2014-03-04 Cyrex Laboratories, Llc Method for detection of intestinal, and blood-brain barrier permeability and testing materials thereto
US20140141458A1 (en) 2011-05-12 2014-05-22 The Johns Hopkins University Assay reagents for a neurogranin diagnostic kit
WO2012170998A1 (en) 2011-06-10 2012-12-13 Cornell University Immobilized protein system for rapid and enhanced multiplexed diagnostics
US20150119273A1 (en) 2012-05-16 2015-04-30 Trustees Of Boston University Chronic Traumatic Encephalopathy in Blast-Exposed Individuals
WO2014194329A1 (en) 2013-05-31 2014-12-04 Banyan Biomarkers, Inc. NEURAL SPECIFIC S100β FOR BIOMARKER ASSAYS AND DEVICES FOR DETECTION OF A NEUROLOGICAL CONDITION
WO2015066211A1 (en) 2013-10-29 2015-05-07 Banyan Biomarkers, Inc. Uch-l1 isoforms, assays and devices for detection of a neurological condition

Patent Citations (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5242828A (en) 1988-11-10 1993-09-07 Pharmacia Biosensor Ab Sensing surfaces capable of selective biomolecular interactions, to be used in biosensor systems
US5660985A (en) 1990-06-11 1997-08-26 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands containing modified nucleotides
US5475096A (en) 1990-06-11 1995-12-12 University Research Corporation Nucleic acid ligands
US5567588A (en) 1990-06-11 1996-10-22 University Research Corporation Systematic evolution of ligands by exponential enrichment: Solution SELEX
US5595877A (en) 1990-06-11 1997-01-21 Nexstar Pharmaceuticals, Inc. Methods of producing nucleic acid ligands
US5637459A (en) 1990-06-11 1997-06-10 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chimeric selex
US6011020A (en) 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US5670637A (en) 1990-06-11 1997-09-23 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands
US5683867A (en) 1990-06-11 1997-11-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US5696249A (en) 1990-06-11 1997-12-09 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands
US5707796A (en) 1990-06-11 1998-01-13 Nexstar Pharmaceuticals, Inc. Method for selecting nucleic acids on the basis of structure
US5270163A (en) 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US5719060A (en) 1993-05-28 1998-02-17 Baylor College Of Medicine Method and apparatus for desorption and ionization of analytes
US5866434A (en) 1994-12-08 1999-02-02 Meso Scale Technology Graphitic nanotubes in luminescence assays
US7052861B2 (en) 1994-12-08 2006-05-30 Meso Scale Technologies, Llc. Graphitic nanotubes in luminescence assays
US6362011B1 (en) 1994-12-08 2002-03-26 Meso Scale Technologies, Llc Graphitic nanotubes in luminescence assays
US20020086335A1 (en) 1994-12-08 2002-07-04 Meso Scale Technology Llp Graphitic nanotubes in luminescence assays
US6090545A (en) 1995-03-10 2000-07-18 Meso Scale Technologies, Llc. Multi-array, multi-specific electrochemiluminescence testing
US20060172340A1 (en) 1995-03-10 2006-08-03 Meso Scale Technologies, Llc Multi-array, multi-specific electrochemiluminescence testing
US6140045A (en) 1995-03-10 2000-10-31 Meso Scale Technologies Multi-array, multi-specific electrochemiluminescence testing
US6207369B1 (en) 1995-03-10 2001-03-27 Meso Scale Technologies, Llc Multi-array, multi-specific electrochemiluminescence testing
US20010021534A1 (en) 1995-03-10 2001-09-13 Meso Scale Technologies, Llc Multi-array, multi-specific electrochemiluminescence testing
US6673533B1 (en) 1995-03-10 2004-01-06 Meso Scale Technologies, Llc. Multi-array multi-specific electrochemiluminescence testing
US6319670B1 (en) 1995-05-09 2001-11-20 Meso Scale Technology Llp Methods and apparatus for improved luminescence assays using microparticles
US20030003460A1 (en) 1995-05-09 2003-01-02 Meso Scale Technology Llp Methods and apparatus for improved luminescence assays using microparticles
US6225047B1 (en) 1997-06-20 2001-05-01 Ciphergen Biosystems, Inc. Use of retentate chromatography to generate difference maps
US20020137234A1 (en) 1997-09-18 2002-09-26 Meso Scale Technologies, Llc. Assay sonication apparatus and methodology
US6413783B1 (en) 1997-09-18 2002-07-02 Meso Scale Technologies, Llc Assay sonication apparatus and methodology
US6537749B2 (en) 1998-04-03 2003-03-25 Phylos, Inc. Addressable protein arrays
US6329209B1 (en) 1998-07-14 2001-12-11 Zyomyx, Incorporated Arrays of protein-capture agents and methods of use thereof
WO2000056934A1 (en) 1999-03-24 2000-09-28 Packard Bioscience Company Continuous porous matrix arrays
WO2001031580A2 (en) 1999-10-27 2001-05-03 Biowulf Technologies, Llc Methods and devices for identifying patterns in biological systems
US20030004402A1 (en) 2000-07-18 2003-01-02 Hitt Ben A. Process for discriminating between biological states based on hidden patterns from biological data
US20020138208A1 (en) 2000-11-16 2002-09-26 Ciphergen Biosystems, Inc. Method for analyzing mass spectra
US20030055615A1 (en) 2001-05-11 2003-03-20 Zhen Zhang System and methods for processing biological expression data
US20050052646A1 (en) 2001-06-29 2005-03-10 Meso Scale Technologies, Llc. Assay plates, reader systems and methods for luminescence test measurements
US6977722B2 (en) 2001-06-29 2005-12-20 Meso Scale Technologies, Llc. Assay plates, reader systems and methods for luminescence test measurements
US20040022677A1 (en) 2001-06-29 2004-02-05 Favor Of Meso Scale Technologies, Llc Assay plates, reader systems and methods for luminescence test measurements
US20030124572A1 (en) 2001-07-30 2003-07-03 Favor Of Meso Scale Technologies, Llc. Assay electrode having immobilized lipid/protein layers, methods of making the same and methods of using the same for luminescence test measurements
US7491540B2 (en) 2001-09-10 2009-02-17 Meso Scale Technologies, Llc Assay buffer, compositions containing the same, and methods of using the same
US6919173B2 (en) 2001-09-10 2005-07-19 Meso Scale Technologies, Llc. Assay buffer, compositions containing the same, and methods of using the same
US20030113713A1 (en) 2001-09-10 2003-06-19 Meso Scale Technologies, Llc Methods and apparatus for conducting multiple measurements on a sample
US7288410B2 (en) 2001-09-10 2007-10-30 Meso Scale Technologies, Llc. Assay buffer, compositions containing the same, and methods of using the same
US20090170121A1 (en) 2001-09-10 2009-07-02 Meso Scale Technologies, Llc. Assay buffer, compositions containing the same, and methods of using the same
WO2003048768A2 (en) 2001-12-05 2003-06-12 Sense Proteomic Limited Protein arrays for allelic variants and uses thereof
US20020193950A1 (en) 2002-02-25 2002-12-19 Gavin Edward J. Method for analyzing mass spectra
US7036946B1 (en) 2002-09-13 2006-05-02 Rockwell Collins, Inc. LCD backlight with UV light-emitting diodes and planar reactive element
US7497997B2 (en) 2002-12-26 2009-03-03 Meso Scale Technologies, Llc Assay cartridges and methods of using the same
US20090065357A1 (en) 2002-12-26 2009-03-12 Meso Scale Technologies, Llc Assay Cartridges and Methods of Using the Same
US20050142033A1 (en) 2003-11-04 2005-06-30 Meso Scale Technologies, Llc. Modular assay plates, reader systems and methods for test measurements
US20060019319A1 (en) 2004-06-03 2006-01-26 Meso Scale Diagnostics, Llc Methods and apparatuses for conducting assays
US20090006339A1 (en) 2007-06-28 2009-01-01 Siemens Aktiengesellschaft Programmer interface for manufacturing execution system

Non-Patent Citations (75)

* Cited by examiner, † Cited by third party
Title
ADAMS ET AL., N. E . J. M ., vol. 339, 1998, pages 5 - 11
ADAMS ET AL., N. E G . J. M ., vol. 339, 1998, pages 5 - 11
ALLARD ET AL., C . C ., vol. 51, 2005, pages 2043 - 51
ALLARD ET AL., P, vol. 4, 2004, pages 2242 - 51
AND M A, J. CHILD N O ., vol. 15, 2000, pages 333 - 343
ANDROPOULOS ET AL., J. T O AC. CA O ASC. S G., vol. 139, 2010, pages 543 - 56
ARMSTRONG ET AL., PEDIATRICS, vol. 97, 1996, pages 864 - 70
BARNETT ET AL., N O IA CS, vol. 33, 2002, pages 242 - 248
BARRETT ET AL., P . CRIT. CARE M ., vol. 10, 2009, pages 445 - 451
BARRETT ET AL., P A . CRIT. CARE M ., vol. 10, 2009, pages 445 - 51
BEMBEA ET AL., P . CRIT. CARE M ., vol. 11, 2010, pages 723 - 730
BERNAUDIN ET AL., J. CHILD N ., vol. 15, 2000, pages 333 - 43
BLENNOW ET AL., A . P ., vol. 90, 2001, pages 1171 - 1175
BREIMAN, L., MACHINE LEARNING, vol. 45, 2001, pages 5 - 32
BREIMAN, L.; FRIEDMAN, J. H.; OLSHEN, R. A.; STONE, C. J., CLASSIFICATION AND REGRESSION TREES, 1984
BRITTAIN ET AL., BLOOD, vol. 97, no. 7, 2001, pages 2159 - 2164
CENGIZ ET AL., CRIT. CARE M ., vol. 33, 2005, pages 2817 - 24
CENGIZ ET AL., CRIT. CARE M ., vol. 33, no. 12, 2005, pages 2817 - 24
CILLEY ET AL., PEDIATRICS, vol. 78, 1986, pages 699 - 704
CONRAD ET AL., ASAIO J., vol. 51, 2004, pages 4 - 10
COWAN ET AL., LANCET, vol. 361, 2003, pages 736 - 742
DUDA, R. O.; HART, P. E.; STORK, D. G.: "Pattern Classification", 2001, WILEY INTERSCIENCE
EDWARDS ET AL., BMJ, vol. 340, 2010, pages c363
FISER ET AL., CRIT. CAREM ., vol. 28, 2000, pages 2616 - 20
FISER ET AL., J. P ., vol. 121, 1992, pages 68 - 74
FISER ET AL., J. P I ., vol. 121, 1992, pages 68 - 74
FRASER ET AL., P . CRIT. CARE M ., vol. 12, 2011, pages 319 - 324
FRIEDMAN, J. H., J. OF THE AMERICAN STATISTICAL ASSOCIATION, vol. 84, 1989, pages 165 - 75
GLASS ET AL., C . TREAT. OPTIONS N O ., vol. 9, 2007, pages 414 - 423
GRAHAM ET AL., AM. J. O S . G CO ., vol. 199, 2008, pages 587 - 595
HADLOCK ET AL., RADIOLOGY, vol. 181, 1991, pages 129 - 133
HASTIE; TREVOR; TIBSHIRANI; ROBERT; FRIEDMAN; JEROME: "The Elements of Statistical Learning", 2001, SPRINGER SERIES IN STATISTICS
HAYASHIDA ET AL., N . CARE, vol. 12, no. 2, 2010, pages 252 - 257
HERRMANN ET AL., STROKE, vol. 31, 2000, pages 2670 - 77
HOBBS ET AL., STROKE, vol. 39, 2008, pages 1307 - 1313
IBRAHIM ET AL., ANN. T . S ., vol. 69, no. 1, 2000, pages 186 - 92
INDER ET AL., J. P ., vol. 145, 2004, pages 835 - 837
JAIN: "Statistical Pattern Recognition: A Review", IEEE TRANSACTIONS ON PATTERN ANALYSIS AND MACHINE INTELLIGENCE, vol. 22, no. 1, January 2000 (2000-01-01), XP000936788, DOI: doi:10.1109/34.824819
KANEKO ET AL., RESUSCITATION, vol. 80, 2009, pages 790 - 94
KIM ET AL., J. KOREAN M . S ., vol. 23, 2008, pages 484 - 491
KING ET AL., P A . BLOOD CANCER, vol. 50, 2008, pages 599 - 602
LASKOWITZ ET AL., STROKE, vol. 40, 2009, pages 77 - 85
LEWIS ET AL., P OC. NA . ACA . S . U.S.A., vol. 81, 1984, pages 2743 - 46
LIN ET AL., STROKE, vol. 34, no. 1, 2003, pages 177 - 186
LO ET AL., J. N O A A, vol. 26, no. 9, 2009, pages 1479 - 1487
LO ET AL., J. N, vol. 26, no. 9, 2009, pages 1479 - 1487
MAHLE ET AL., CIRCULATION, vol. 106, 2002, pages 1 - 109,1-114
MCQUILLEN ET AL., S, vol. 38, 2007, pages 736 - 41
MCQUILLEN ET AL., STROKE, vol. 38, 2007, pages 736 - 41
MILLER ET AL., J. P ., vol. 139, 2001, pages 385 - 90
MOSER ET AL., AM. J. N O A O ., vol. 17, 1996, pages 965 - 72
NYLEN ET AL., J. N . S ., vol. 240, 2006, pages 85 - 91
OH ET AL., J. P ., vol. 153, 2008, pages 375 - 378
OSTERLUNDH ET AL., P A . BLOOD CANCER, vol. 50, 2008, pages 793 - 98
PELINKA ET AL., J. TRAUMA, vol. 57, 2004, pages 1006 - 1012
PEPE, M. S.: "The Statistical Evaluation of Medical Tests for Classification and Prediction", vol. 28, 2003, STATISTICAL SCIENCE SERIES
PETZOLD ET AL., J. I . METHODS, vol. 287, 2004, pages 169 - 77
PETZOLD ET AL., J. I O . METHODS, vol. 287, 2004, pages 169 - 177
PRODHAN ET AL., RESUSCITATION, vol. 80, 2009, pages 1124 - 29
RAMASWAMY ET AL., P . N ., vol. 40, 2009, pages 215 - 26
ROTHMAN ET AL., ANN. N O ., vol. 20, 1986, pages 684 - 90
ROUSE ET AL., N. E . J. M ., vol. 359, 2008, pages 895 - 905
RUCZINSKI ET AL., J. OF COMPUTATIONAL AND GRAPHICAL STATISTICS, vol. 12, 2003, pages 475 - 511
RUTHERFORD ET AL., PEDIATRICS, vol. 116, 2005, pages 1001 - 1006
SARNAT ET AL., ARCH. N ., vol. 33, 1976, pages 696 - 705
SCHATZ ET AL., NEUROLOGY, vol. 56, 2001, pages 1109 - 11
SCOTHORN ET AL., J. P ., vol. 140, 2002, pages 348 - 54
SHANKARAN ET AL., N. E . J. M ., vol. 353, 2005, pages 1574 - 1584
STYLES ET AL., B . J. H ., vol. 136, 2007, pages 343 - 44
THORESEN ET AL., S . N ., vol. 5, 2000, pages 61 - 73
UGOCHUKWU ET AL., I . J. LAB. H ., vol. 30, no. 4, 2008, pages 312 - 316
VENDT ET AL., J. DIGIT. IMAGING, vol. 22, no. 3, 2009, pages 326 - 43
VICINSKY ET AL., N. E . J. M ., vol. 333, 1995, pages 206 - 13
VOS ET AL., NEUROLOGY, vol. 62, 2004, pages 1303 - 10
WUNDERLICH ET AL., E . J. N ., vol. 13, 2006, pages 1118 - 23

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12601749B2 (en) 2008-08-11 2026-04-14 Banyan Biomarkers, Inc. Biomarker detection process and assay of neurological condition
US11994522B2 (en) 2008-08-11 2024-05-28 Banyan Biomarkers, Inc. Biomarker detection process and assay of neurological condition
US12007395B2 (en) 2012-03-13 2024-06-11 The Johns Hopkins University Citrullinated brain and neurological proteins as biomarkers of brain injury or neurodegeneration
EP2825893A4 (en) * 2012-03-13 2016-03-16 Univ Johns Hopkins CITRILLINATED BRAIN AND NERVE PROTEINS AS A BIOMARKER OF BRAIN INJURY OR NERVOUS GENERATION
US10365288B2 (en) 2012-03-13 2019-07-30 The Johns Hopkins University Citrullinated brain and neurological proteins as biomarkers of brain injury or neurodegeneration
US9709573B2 (en) 2012-03-13 2017-07-18 The Johns Hopkins University Citrullinated brain and neurological proteins as biomarkers of brain injury or neurodegeneration
JP2020034567A (ja) * 2013-07-17 2020-03-05 ザ・ジョンズ・ホプキンス・ユニバーシティ 脳損傷の診断/予後判定/評価において有用な組成物及びキット
JP2022023999A (ja) * 2013-07-17 2022-02-08 ザ・ジョンズ・ホプキンス・ユニバーシティ 脳損傷の予測方法
US12339288B2 (en) 2013-07-17 2025-06-24 The Johns Hopkins University Multi-protein biomarker assay for brain injury detection and outcome
US11499982B2 (en) 2013-07-17 2022-11-15 The Johns Hopkins University Multi-protein biomarker assay for brain injury detection and outcome
JP2015129652A (ja) * 2014-01-06 2015-07-16 公益財団法人ヒューマンサイエンス振興財団 脳梗塞の診断マーカー及び診断キット
WO2015107168A1 (en) * 2014-01-16 2015-07-23 University College Cork - National University Of Ireland, Cork A method of identifying a neonate at risk of having or developing hypoxic-ischaemic encephalopathy (hie)
EP2896702A1 (en) * 2014-01-16 2015-07-22 University College Cork, National University Of Irland Cork A method of identifying a neonate at risk of having or developing hypoxic-ischaemic encephalopathy (HIE)
US12422442B2 (en) 2014-10-06 2025-09-23 Universite De Geneve Markers and their use in brain injury
AU2015330355B2 (en) * 2014-10-06 2021-09-23 Fundacio Hospital Universitari Vall D'hebron - Institut De Recerca Markers and their use in brain injury
US12077601B2 (en) 2016-10-28 2024-09-03 Banyan Biomarkers, Inc. Antibodies to ubiquitin C-terminal hydrolase L1 (UCH-L1) and glial fibrillary acidic protein (GFAP) and related methods
CN106645755A (zh) * 2016-12-30 2017-05-10 深圳大学 一种ad生物标记物及其检测方法
US11016092B2 (en) 2017-03-23 2021-05-25 Abbott Laboratories Methods for aiding in the diagnosis and determination of the extent of traumatic brain injury in a human subject using the early biomarker ubiquitin carboxy-terminal hydrolase L1
US12163958B2 (en) 2017-03-23 2024-12-10 Abbott Laboratories Methods for aiding in the diagnosis and determination of the extent of traumatic brain injury in a human subject using the early biomarker ubiquitin carboxy-terminal hydrolase L1
US10877048B2 (en) 2017-04-15 2020-12-29 Abbott Laboratories Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury in a human subject using early biomarkers
US12099069B2 (en) 2017-04-15 2024-09-24 Abbott Laboratories Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury in a human subject using early biomarkers
US12085567B2 (en) 2017-04-28 2024-09-10 Abbott Laboratories Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury using early biomarkers on at least two samples from the same human subject
US10877038B2 (en) 2017-04-28 2020-12-29 Abbott Laboratories Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury using early biomarkers on at least two samples from the same human subject
US12092647B2 (en) 2017-05-25 2024-09-17 Abbott Laboratories Methods for aiding in the determination of whether to perform imaging on a human subject who has sustained or may have sustained an injury to the head using early biomarkers
US10866251B2 (en) 2017-05-25 2020-12-15 Abbott Laboratories Methods for aiding in the determination of whether to perform imaging on a human subject who has sustained or may have sustained an injury to the head using early biomarkers
US10849548B2 (en) 2017-05-30 2020-12-01 Abbott Laboratories Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin I and early biomarkers
US11931161B2 (en) 2017-05-30 2024-03-19 Abbott Laboratories Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin I and early biomarkers
US11129564B2 (en) 2017-05-30 2021-09-28 Abbott Laboratories Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin I
US12178592B2 (en) 2017-05-30 2024-12-31 Abbott Laboratories Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin I
US11169159B2 (en) 2017-07-03 2021-11-09 Abbott Laboratories Methods for measuring ubiquitin carboxy-terminal hydrolase L1 levels in blood
US12123883B2 (en) 2017-07-03 2024-10-22 Abbott Laboratories Methods for measuring ubiquitin carboxy—terminal hydrolase L1 levels in blood
US12105100B2 (en) 2017-12-09 2024-10-01 Abbott Laboratories Methods for aiding in diagnosing and evaluating a traumatic brain injury in a human subject using a combination of GFAP and UCH-L1
US12105098B2 (en) 2017-12-09 2024-10-01 Abbott Laboratories Methods for aiding in the diagnosis and evaluation of a subject who has sustained an orthopedic injury and that has or may have sustained an injury to the head, such as mild traumatic brain injury (TBI), using glial fibrillary acidic protein (GFAP) and/or ubiquitin carboxy-terminal hydrolase L1 (UCH-L1)
US11022617B2 (en) 2017-12-09 2021-06-01 Abbott Laboratories Methods for aiding in the diagnosis and evaluation of a subject who has sustained an orthopedic injury and that has or may have sustained an injury to the head, such as mild traumatic brain injury (TBI), using glial fibrillary acidic protein (GFAP) and/or ubiquitin carboxy-terminal hydrolase L1 (UCH-L1)
US11016105B2 (en) 2017-12-09 2021-05-25 Abbott Laboratories Methods for aiding in diagnosing and evaluating a traumatic brain injury in a human subject using a combination of GFAP and UCH-L1
US11994523B2 (en) 2017-12-29 2024-05-28 Abbott Laboratories Biomarkers and methods for diagnosing and evaluating traumatic brain injury
CN108872589A (zh) * 2018-01-03 2018-11-23 深圳市人民医院 脑梗死外周血标志物及其应用
EP3982123A1 (en) * 2020-10-08 2022-04-13 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Markers and their use in brain injury

Also Published As

Publication number Publication date
EP2628013A2 (en) 2013-08-21
US9746481B2 (en) 2017-08-29
IL225731B (en) 2018-01-31
JP6071886B2 (ja) 2017-02-01
IL225731A0 (en) 2013-06-27
US20150051115A1 (en) 2015-02-19
JP2013545087A (ja) 2013-12-19
EP2628013B1 (en) 2019-06-12
WO2012051519A3 (en) 2012-09-20
EP2628013A4 (en) 2014-03-12
US20140045713A1 (en) 2014-02-13

Similar Documents

Publication Publication Date Title
EP2628013B1 (en) Biomarkers of brain injury
US12339288B2 (en) Multi-protein biomarker assay for brain injury detection and outcome
US12461112B2 (en) Biomarker levels and neuroimaging for detecting, monitoring and treating brain injury or trauma
Barichello et al. Biomarkers for sepsis: more than just fever and leukocytosis—a narrative review
US20260063646A1 (en) Circulating biomarker levels for diagnosis and risk-stratification of traumatic brain injury
US20250044303A1 (en) Protein biomarker indicators of neurological injury and/or disease and methods of use thereof
US20250035650A1 (en) Biomarker testing for chronic persistent injury following brain trauma
WO2022271865A2 (en) Protein biomarker indicators of neurological injury and/or disease and methods of use thereof
US20150247854A1 (en) Biomarkers for brain injury
HK40015171A (en) Mass spectrometry-based methods for the detection of circulating histones h3 and h2b in plasma from sepsis or septic shock (ss) patients

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11833480

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 225731

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2013534031

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011833480

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13879470

Country of ref document: US