WO2012038504A2 - Breast cancer therapeutics - Google Patents

Breast cancer therapeutics Download PDF

Info

Publication number
WO2012038504A2
WO2012038504A2 PCT/EP2011/066511 EP2011066511W WO2012038504A2 WO 2012038504 A2 WO2012038504 A2 WO 2012038504A2 EP 2011066511 W EP2011066511 W EP 2011066511W WO 2012038504 A2 WO2012038504 A2 WO 2012038504A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
rankl
rank
hormone
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2011/066511
Other languages
English (en)
French (fr)
Other versions
WO2012038504A3 (en
Inventor
Josef Penninger
Daniel Schramek
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
IMBA Institut fur Molekulare Biotechonologie GmbH
Original Assignee
IMBA Institut fur Molekulare Biotechonologie GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43498569&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2012038504(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to US13/825,655 priority Critical patent/US10143747B2/en
Priority to RU2013118325/15A priority patent/RU2013118325A/ru
Priority to BR112013006673A priority patent/BR112013006673A2/pt
Application filed by IMBA Institut fur Molekulare Biotechonologie GmbH filed Critical IMBA Institut fur Molekulare Biotechonologie GmbH
Priority to JP2013529652A priority patent/JP6133778B2/ja
Priority to EP11758242.9A priority patent/EP2618833B1/en
Priority to CN2011800544541A priority patent/CN103384530A/zh
Priority to CA2811556A priority patent/CA2811556A1/en
Priority to AU2011306917A priority patent/AU2011306917B2/en
Priority to MX2013003076A priority patent/MX2013003076A/es
Priority to NZ608207A priority patent/NZ608207A/en
Priority to KR1020137009817A priority patent/KR20130118870A/ko
Priority to PH1/2013/500543A priority patent/PH12013500543A1/en
Publication of WO2012038504A2 publication Critical patent/WO2012038504A2/en
Publication of WO2012038504A3 publication Critical patent/WO2012038504A3/en
Priority to IL225442A priority patent/IL225442A0/en
Anticipated expiration legal-status Critical
Priority to US16/158,504 priority patent/US20190030161A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/565Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the present invention relates to the field of cancer therapeutics .
  • Denosumab to increase bone mineral density in breast cancer patients during the treatment with aromatase inhibitor as anti-cancer agent.
  • RANKL is said to be a critical mediator of osteoclast activity, which in turn favours tumour growth.
  • Some breast and prostate cancer cell lines are disclosed to express RANK, thus having the ability to form bone metastases .
  • RANK-Fc RANKL inhibitor
  • rhApo2L apoptosis- inducing ligand
  • WO 99/53942 discloses the use of OPG in the treatment of cardiovascular disease.
  • WU et al., J. Bone and Mineral Res., 20 (1) (2005): 107-116 discloses RANKL as regulator of Fas-mediated apoptosis of osteoclasts .
  • MOLYNEUX et al . , J. Clin. Invest., 120 (9) (2010): 3310- 3325, relates to research on Prkarla as bone tumour suppressor gene, which is capable of inducing RANKL overexpression during osteosarcoma tumourigenesis .
  • RANKL Receptor Activator of NF- ⁇ Ligand
  • TRANCE-R receptor RANK
  • RANKL inhibition was approved for potentially mil ⁇ lions of patients to prevent bone loss.
  • RANK and RANKL have been cloned and characterized (US 6,017,729, EP 0 873 998, EP 0 911 342, US 5,843,678, WO 98/46751, WO 98/54201).
  • Both RANKL and RANK expression have been observed in primary breast cancers in humans and breast cancer cells lines and it has been proposed that the RANKL/RANK system can regulate bone metastases of epi ⁇ thelial tumors 14 without an effect on proliferation or death susceptibility .
  • Estrogene as well as progesterone including its synthetic derivatives are used in combined hormone replace ⁇ ment therapies (HRT) in postmenopausal women to ameliorate menopausal symptoms. Estrogene and progestins may also be used as hormonal contraceptives .
  • Tamoxifen is an antagonist of the estrogen receptor in breast tissue. It is a standard endocrine (anti-estrogen) therapy for hormone-positive early breast cancer in post-menopausal women. It would also inhibit hormone replacement therapies by blocking the estrogen receptor.
  • the present invention relates to a cancer therapy using a RANKL inhibitor as active agent, especially in the prevention or treatment of primary tumours apart from metastatic cancer cells.
  • a cancer therapy is to be understood as the reduction of cancer cells in the body of a pa ⁇ tient or at least the prevention of further progression of the disease.
  • RANKL inhibitors include antibodies widely known e.g. from US 2008/107597, WO 2010/022120 Al, US 6,740,522, US
  • RANKL is a known ligand of cell surface receptor RANK that regulates function of dendritic cells and osteclasts. According to the present invention, a further mechanism in the development of cancer has been discovered. RANKL drives hormone-influenced cancer development. Such hormones may be of the normal hormonal background in any individual or may have been artificially administered (such as in hormone replacement therapies, in menopause treatment or as contraceptive) . Furthermore, the cellular mechanism and activity of this ligand in cancer has been investigated and characterized.
  • RANKL activity includes binding of RANKL to RANK and its resulting activation. RANK in turn further activates ⁇ , ⁇ , P-NFKB and cyclinDl as well as the Id2- p21, MAPK Erk and p38 pathway. Modifying activity of any of these factors can be used for a therapeutic or prophylactic method or to reduce cancer cell viability. Most of these proteins are intracellular and it is possible to inhibit their function by intracellular inhibition of their activity or expression such as by RNAi . RANKL and RANK are extracellular targets but may also be targeted intracellular (e.g. by RNAi).
  • progestins such as MPA triggers massive induction of the key osteoclast differentiation factor Receptor Activator of NF-B Ligand (RANKL) in cells. Inhibition or inactivation of RANKL or its receptor RANK in these cells prevents progestin- induced proliferation.
  • RANKL/RANK inhibition results in a markedly reduced incidence and delayed onset of pro- gestin-driven cancer and reduced self-renewal capacity of cancer stem cells.
  • RANKL is known to influence bone metastasis of tumors
  • the present invention provides for the first time the possibility to treat cancer in general and cancer independent of metastasis, which metastasis is not target of the inventive treatment.
  • the cancer is a primary tumor.
  • the cancer may be non-metastatic .
  • RANK/RANKL RANK/RANKL 's cancerogenous effect has been associated with sexual hormones, in particular progesterone and its derivatives (progestins) , that are widely administered to females in hormone replacement therapies or as contraceptives. Therefore a RANK/RANKL antagonizing therapy according to a preferred embodiment is for treating patients with elevated sexual hormones or of their functional derivatives.
  • One cancer treated or prevented according to the present invention is breast cancer, including primary breast cancer.
  • the cancer is a cancer dependent on hormones for growth.
  • hormones may be sexual hormones, such as female sexual hormones like progesterone or estrogene.
  • the cancer cells may have hormone receptors, especially progesterone receptors and/or estrogene receptors.
  • estrogene receptors are ESR1 (comprising ER alpha chains) , ESR2 (comprising ER-beta chains) or heteromeric receptors, such as of mixed ER- alpha and ER-beta chains. Presence of such receptors may indicate a requirement of hormone signalling in the cell. In particular, this signalling may be RANKL-mediated .
  • the hormone signalling is mediated by the progesterone receptor.
  • the cancer comprises cancer cells with a progesterone receptor but without functional estrogene receptor.
  • RANKL Activation of RANKL by hormones protects the cancer or a pre-cancerous cell from DNA damage induced cell death. Thus these hormones may support cancer via increased RANKL activity.
  • Preferred types of cancer diagnosed according to the present invention are cancers with sexual hormone dependency during devel ⁇ opment, especially breast cancer or prostate cancer.
  • Further types of cancer include Hodgkin's lymphoma; non-Hodgkin ' s lymphoma; B-cell acute lymphoblastic leukemia/lymphoma; T-cell acute lymphoblastic leukemia/lymphoma; peripheral T-cell leukemia, adult T-cell leukemia/T-cell lymphoma; NK cell tumor; large granular lymphocytic leukemia; Langerhans cell histiocytosis; myeloid neoplasia; acute myelogenous leukemia; acute promyelocy- tic leukemia; acute myelomonocytic leukemia; acute monocytic leukemia; a myelodysplastic syndrome; and a chronic myeloproliferative disorder.
  • the cancer is selected from lung cancer, breast cancer, mammary cancer, melanoma, sar ⁇ coma, prostate cancer, head and neck cancer, cancer of unknown primary origin, lymphoma, leukemia, kidney cancer, and gastrointestinal cancer.
  • the cancer is a hormone driven- cancer like breast or prostate cancer.
  • hormones may be female sexual hormones like estrogen or progesterone, or artificial functional equivalents thereof like progestins or other factors known to induce RANKL such as PTHrP (Parathyroid hormone-related protein) or Vitamin D.
  • the cancer may be of epithelial origin.
  • the cancer is treated or prevented in its origin tissue, such as in the breast in the case of breast or mammary cancer or in the prostate for prostate cancer.
  • the cancer may be a primary cancer.
  • a primary cancerous development can be prevented or delayed by inhibiting RANKL activity. Therefore the primary cancer can be treated or prevented.
  • the invention provides a RANKL inhibitor for use in the treatment or prevention of cancer in a patient, wherein the patient has received a hormone treatment, preferably a hormone replacement therapy, preferably with estro- gene, progesterone or a progestin, or a hormone contraceptive.
  • a hormone treatment preferably a hormone replacement therapy, preferably with estro- gene, progesterone or a progestin, or a hormone contraceptive.
  • Treatment shall be construed as a beneficial effect on cancer patients, in particular as a reduction of cancer cells, including preventing further progression of cancer, but not necessarily in an absolute curative sense, which is of course pos ⁇ sible but not necessarily required by the invention.
  • preventing shall not be construed as an absolute success to always prevent the onset of cancer, but as a relative reduction of the risk of developing cancer in a patient or of delaying onset of cancer, i.e. as a prophylactic treatment.
  • the prevention of cancer is a particular advantage of the present invention. Since RANKL-induced protection against apoptosis is a fundamental step in the development of cancer, it is now possible to inhibit this step in cancerous developments and prevent for a certain time or delay cancer manifestation.
  • the treatment or prevention according to the present invention can be used to treat benign tumors or nodules and thus inhibit further development in cancer formation.
  • the normal hormonal levels of a patient may usually be suf ⁇ ficient to trigger the RANKL pathway that has been involved with cancer development according to the present invention.
  • hormone level may be increased in a patient, be it for natural or artificial causes.
  • Such increased hormone level may increase the RANKL associated cancer development and progression and therefore in a preferred embodiment the patient to be treated according to the present invention has increased hor ⁇ mone levels, e.g. blood concentrations, in particular of sexual hormones such as progesterone (or the synthetic functional anal- ogons, progestines) or estrogenes.
  • RANKL pathway in particular of hormone driven cancers such as breast cancer or prostate cancer.
  • any deregulation of the endogenous progesterone system such as in pre-menopause may in ⁇ crease the risk of cancer.
  • administrating a RANKL inhibitor can decrease the risk of breast cancer or be used to treat a breast cancer.
  • RANKL activity protects breast cancer cells from apoptosis and increases breast cancer survival in view of cancerogenic mutations. Reducing RANKL activity therefore prevents this protective effect and results in increased cancer cell death.
  • the patient might have or might have had a therapy with sexual hormones. It was found according to the present invention that RANKL activity in cancer development is influenced by sexual hormones, in particular by estrogenes or progesteron or its dervatives (progestins) . Therefore, in preferred embodiments the patient is treated by a hormone, preferably receives hormone re ⁇ placement therapy, preferably with estrogene, progesterone or a progestin, or with a hormone contraceptive. Examples of proges ⁇ tins are medroxyprogesterone (or its acetate, e.g.
  • the hormone or derivative preferably has progestinic effects. In particular the hormone may induce RANKL.
  • hormone level in general of sexual hormones, is upregulated leading to increased progesterone levels that could be tied to development of cancer via the RANKL pathway according to the present invention. Therefore, patients which receive or have been treated by a hormone or hormone contraceptive are at an increased risk of developing breast cancer. For these patients, administering a RANKL inhibitor is particularly effective for treating or preventing cancer, cancer development or cancer progression.
  • progestin and/or progesterone levels that may be found in a patient to be treated are e.g. serum concentration or at least 0.2 ng/ml, preferably at least 0.3 ng/ml .
  • a "RANKL inhibitor” is to be understood as any compound or agent, that reduces RANKL activity. It includes any RANKL lig- and, in particular anti-RANKL-antibodies, that inactivates free RANKL and prevents competitively its binding to and activation of RANK. Further RANKL inhibitors include RANK antagonists that block RANK, RANKLs cellular receptor.
  • any factor in RANKLs signalling pathway including RANKL itself, RANK, IKK , ⁇ , P-NFKB, cyclinDl (NFKB pathway inhibition), Id2, MAPK Erk and p38 can be antagonized or p21 increased or agonized (Id2 pathway inhibition) to prevent RANKL signalling and reduce RANKL activity.
  • the Id2 pathway functions as a transcriptional repressor of p21, on of the major cyclin-dependent kinase inhibi ⁇ tors, which inhibits cell cycle progression. Therefore, the Id2 pathway has to be inhibited for p21 to be upregulated hence stopping proliferation.
  • a RANKL inhibitor can inhibit or antagonize any one of RANKL itself, RANK, ⁇ , ⁇ , P-NFKB, cyclinDl, Id2, MAPK Erk or p38 or increase or agonize p21 or any combination thereof, preferably of at least 2, 3, 4, 5, or all of these factors, in particular preferred with RANKL.
  • a RANKL inhibitor may be any compound that lowers RANKL concentration, in particular serum concentrations, or lower RANKL expression.
  • a RANKL inhibitor may further lower RANK concentration on cell surface, in particular cancer cell surface, and/or lower RANK expression and/or lower RANK activation in response to RANKL binding.
  • a RANKL inhibitor may further lower intracellular concentrations and/or expression and/or activation of IKKa.
  • a RANKL inhibitor may further lower intracellular concentrations and/or expression and/or activation of ⁇ .
  • a RANKL inhibitor may further lower intracellular con- centrations and/or expression and/or activation of P-NFKB .
  • a RANKL inhibitor may further lower intracellular concentrations and/or expression and/or activation of cyclinDl .
  • a RANKL inhibitor may further lower intracellular concentrations and/or expression and/or activation of Id2.
  • a RANKL inhibitor may further increase intracellular concentrations and/or expression and/or activation of p21.
  • a RANKL inhibitor may further lower intracellular concentrations and/or expression and/or activation of MAPK Erk.
  • a RANKL inhibitor may further lower intracellular concentrations and/or expression and/or activation of p38.
  • RNA interference is a mechanism to suppress gene expression in a sequence specific manner.
  • RNAi is highly effective methodology for suppression of specific gene function in eukaryotic cells. When applied to cells and organisms, RNAi entails the degradation of target mRNA upon transfection of short interfering RNA (siRNA) oligos or short- hairpin RNA (shRNA) encoding vectors.
  • siRNA short interfering RNA
  • shRNA short- hairpin RNA
  • Various methods of RNAi have been described and are generally known for the altering gene expression in plant cells, drosophila and human melanoma cells as is described for example in US 2002/0162126 and US 2002/0173478.
  • the siRNA for use in the methods and compositions of the invention are selected to target a desired molecule of the RANKL signaling pathway or combinations of such molecules.
  • siRNA as herein described may also include altered siRNA that is a hybrid DNA/RNA construct or any equivalent thereof, double-stranded RNA, microRNA (miRNA) , as well as siRNA forms such as siRNA duplications, small hairpin RNA (shRNA) in viral and non-viral vectors and siRNA or shRNA in carriers.
  • miRNA microRNA
  • shRNA small hairpin RNA
  • RANKL RNAi is e.g. described in WO 2005/028633.
  • the RANKL inhibitor is a RANKL or RANK ligand, preferably an anti-RANKL antibody, such as Denosum- ab, or as disclosed in US 2008/107597.
  • Anti-RANKL-antibody includes any functional equivalents and derivatives therof, in ⁇ cluding antibody fragments such as Fab, F(ab)2, Fv, or single chain antibodies (scAb) .
  • Antibodies specifically binding the RANKL activity associated proteins and factors, especially RANKL and RANK and any proteins in the RANKL signalling pathway, are also encompassed by the invention.
  • the antibodies may be produced by immunization with full-length protein, soluble forms of the protein, or a fragment thereof.
  • the antibodies of the inven ⁇ tion may be polyclonal or monoclonal, or may be recombinant antibodies, such as chimeric antibodies wherein the murine constant regions on light and heavy chains are replaced by human sequences, or CDR-grafted antibodies wherein only the complementary determining regions are of murine origin.
  • Antibodies of the invention may also be human antibodies prepared, for example, by immunization of transgenic animals capable of producing human antibodies (WO 93/12227). The antibodies are useful for detect ⁇ ing RANKL in biological samples, thereby allowing the identifi ⁇ cation of cells or tissues which produce the protein in addition, antibodies which bind to RANKL (and block interaction with other binding compounds) have therapeutic use as RANKL inhibitor .
  • RANKL inhibitors may be suitable and used for reducing the free RANKL concentration in the circulation of a patient.
  • RANK is not the only natural receptor for RANKL.
  • Osteoprotegin (OPG) is a secreted decoy receptor that can reduce the RANKL activity (binding of RANKL to RANK and its signaling pathway via IKKa, ⁇ , P-NFKB and cyclinDl or via Id2-p21, MAPK Erk and p38) . Therefore OPG may be administered as RANKL inhibitor.
  • RANK or a soluble form thereof itself may be used as RANKL ligand and inhibitor to reduce the free serum concentration of RANKL.
  • the inhibitor is usually administered in a therapeutically effective amount, an amount that reduces RANKL activity to significantly decrease cancer cell viability.
  • the RANKL activity may be suppressed to normal levels of an average person, furthermore, the RANKL activity may be reduced below average levels.
  • the RANKL activity is re-umbled by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70% by at least 80% or by at least 90%. In preferred embodiments this reduction equates to RANKL serum levels .
  • the inhibitor may be used in combination with or for priming a further anti-cancer therapy, preferably a radiation- or chemo ⁇ therapy.
  • a method for increasing the efficacy of cancer therapy in a subject comprising administering to a subject in need of an effective amount of an RANKL inhibitor, wherein said subject is also being administered a cancer therapy selected from the group consisting of small-molecule drugs, angiogenesis inhibitors, tumor vaccine, chemotherapy, immunotherapy, radiation therapy, gene therapy and combinations thereof.
  • RANKL acts as a protective agent, immunizing cancer cells against DNA damage associated cell death.
  • RANKL ac ⁇ tivity By reducing RANKL ac ⁇ tivity and therefore reducing RANKLs protective effect on cancer, the cells become more susceptible to DNA damage. Therefore, in a preferred embodiment a cancer is treated in addition with a RANKL inhibitor and a further anti-cancer therapy that induces further cell damage such as radiation or chemotherapies.
  • further cancer therapies are specific for cancer in a certain tissue, like breast, e.g. by administering localised a chemotherapeutic agent or a homing agent that targets the tissue cancer cells and induces further DNA damage either by radiation or a chemotherapeutic agent.
  • the present invention relates also to a kit comprising a chemotherapeutic agent and a RANKL inhibitor .
  • a RANKL inhibitor is pro ⁇ vided for use in combination with a hormone replacement therapy or for use in combination with a hormone contraceptive, in particular to reduce the risk of developing breast cancer.
  • the patient is preferably a mammal, in particular preferred a primate, even more preferred a human, in particular a female.
  • the patient might have or might have had a therapy with hormones, in particular female sexual hormones.
  • hormones in particular female sexual hormones.
  • Such a past therapy might have been in the past 5, 4, 3, 2, years or past 36, 32, 30, 28, 26, 24, 22, 20, 18, 16, 14, 12, 10, 8, 7, 6, 5, 4, 3, 2, or 1, month (s).
  • Patients, in particular females, receiving a hormone replacement therapy or are taking a hormone contraceptive, in particular a progesterone or a progestine are at an increased risk to develop cancer.
  • the present invention provides the combined use of a RANKL in ⁇ hibitor as described above.
  • the present invention further provides a method of reducing RANKL activity in a cancer patient comprising administering a RANKL inhibitor to said patient.
  • the invention relates to a method of re ducing the amount of cancer cells in a patient comprising administering a RANKL inhibitor to said patient.
  • the invention teaches a method of increasing cell death due to DNA damage of a cell comprising inhibiting RANK or RANKL or IKK-alpha or IkB-alpha, P-NF-kappa-B or Cy- clinDl or Id2 or MAPK Erk or p38 or increasing p21 or any combination thereof, in particular a combination with inhibiting RANKL, in said cell, preferably by administering a RANKL inhibitor to said cell.
  • the cell receiving the inventive treatment may be a tissue cell wherein hormone dependent cancers may develop, especially the breast (especially for prophylactic methods) or a cancer cell.
  • said cell can be an epithelial cell or a cancer stem cell.
  • cancer of epithelial origin can be effectively treated by the inventive methods .
  • the cancer is of mammary gland epithelial cells.
  • RANKL inhibition as a significant effect on cancer stem cells and can prevent or reduce cancer comprising such stem cells.
  • a hormone treat ⁇ ment preferably a hormone replacement therapy, preferably with progesterone or a progestin, or a hormone contraceptive, such as described above.
  • hormone treatment in particular with female sexual hormones increases the risk of breast cancer and therefore, in a inventive therapeutical preventive method preferably the patient has been treated with such a hormone therapy previously or during the inventive therapeutic method.
  • Previous administrations of hormones may have been in the past 1, 2, 3, 4 or 5 years or more.
  • the present invention provides a pharma ceutical composition
  • a pharma ceutical composition comprising a RANKL inhibitor and a hormone or derivative thereof, selected from progesterone or a progestin, or a hormone contraceptive.
  • RANKL inhibition can reduce the risk of developing cancer by female sexual hormones, in particular of estro- gene, progesterone or progestins. Therefore, it is advised to administer such hormones together with the RANKL inhibitor provided by the present invention. Such hormones might be used for hormone replacement therapies or as hormonal contraceptives.
  • hormonal contraceptive formulations include both an estrogen and a progestin, or are progestogen-only formulations which contain only progesterone or one of its synthetic analogues (progestins) .
  • progestins synthetic analogues
  • the present invention provides a combined use of hormone therapeutics, including female sexual hormone contraceptives, together with a RANKL inhibitor.
  • the present invention also relates to a kit comprising a hormone therapeutic, as described above, and a RANKL inhibitor.
  • a kit comprising a hormone therapeutic, as described above, and a RANKL inhibitor.
  • Such a kit may allow separate administration of the hormone therapeutic and the RANKL inhibitor.
  • compositions comprising RANKL inhibitors modified with water soluble polymers to increase solubili- ty, stability, plasma half-life and bioavailability.
  • Compositions may also comprise incorporation of RANKL inhibitors into liposomes, microemulsions, micelles or vesicles for controlled delivery over an extended period of time. Soluble RANKL inhibitors may be formulated into microparticles suitable for pulmonary administration.
  • compositions of the invention may be administered by injection, either subcutaneous, intravenous or intramuscular, or by oral, nasal, pulmonary or rectal administration.
  • the route of administration eventually chosen will depend upon a number of factors and may be ascertained by one skilled in the art.
  • the invention also provides for pharmaceutical compositions comprising a therapeutically effective amount of the anti-RANKL inhibitory nucleic acids (siRNA) of the invention together with a pharmaceutically acceptable adjuvant.
  • Nucleic acid compositions will be suitable for the delivery of part or all of the coding region of RANKL or any protein in the RANKL signalling pathway as described above and/or flanking regions to cells and tissues as part of an anti-sense therapy regimen.
  • Method of treating or preventing cancer in a subject comprising administering a therapeutically effective amount of a RANKL inhibitor to said patient.
  • Method of increasing cancer cell apoptosis comprising administering a RANKL inhibitor to said cancer cell.
  • Method of definition 1 to 4 wherein the cancer is a primary cancer or the cancer cell is a cell of a primary cancer.
  • a RANKL inhibitor for use in the treatment or prevention of hormone dependent cancer in a patient preferably wherein the cancer comprises cancer cells with sexual hormone receptors, preferably progesterone or estrogene receptors.
  • a RANKL inhibitor for use in combination with a hormone therapy, preferably of sexual hormones, in particular a hormone replacement therapy or for use in combination with a hormone contraceptive .
  • a method of reducing RANKL activity in a cancer patient comprising administering a RANKL inhibitor to said patient.
  • a method of reducing the amount of cancer cells in a patient comprising administering a RANKL inhibitor to said patient.
  • a method of increasing cell death due to DNA damage of a cell comprising inhibiting RANK or RANKL or IKK-alpha in said cell, preferably by administering a RANKL inhibitor to said cell.
  • Method of any one of definitions 14 to 16 characterized in that the patient or cell has received a hormone treatment.
  • RANKL inhibitor is a RANKL or RANK ligand or a siR- NA.
  • composition comprising a RANKL inhibitor and a hormone or derivative thereof selected from estrogene, progesterone or a progestin or a hormone contraceptive.
  • Composition of definition 25 further comprising a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and/or adjuvant.
  • Kit comprising a chemotherapeutic agent and a RANKL inhibitor .
  • Kit comprising a RANKL inhibitor and a hormone or derivative thereof, selected from estrogene, progesterone, or a progestin or a hormone contraceptive.
  • the progesterone-derivative MPA triggers in vivo RANKL expression and mammary epithelial cell proliferation via RANK.
  • RANK controls the incidence and onset of proges- tin-driven mammary cancer.
  • Median tumor onset for controls was 11 days after last DMBA treatment and 30 days for RANK Amam females, c , Representative histological sections of mammary tumors isolated from control littermate and RANK amam females 22 days after the last DMBA treatment. Cy- tokeratin5 staining is shown.
  • f g ⁇ -irradiation (5 Gray) induced mammary epithelial cell apoptosis in control and RANK Amam female lit- termates either sham operated or implanted with a MPA pellet. Apoptosis was detected by immunostaining for active Caspase 3.
  • RANK controls cancer stem cell self renewal a
  • Self-renewal of mammary cancer stem cells i.e. tumor initiating cells (TICs) requires RANK expression.
  • Mammary tumor cells from MPA/DMBA-treated RANK Arnam and control littermate female were cultured for 7 days and a small percentage of primary cells formed mammospheres (1 st passage) .
  • Primary mammospheres were then digested into single cells and assayed for their ability to form secondary mammospheres (2 nd passage) .
  • Tumor cells from control littermate but not from RANK Amam females could form secondary mam- mospheres determined 7 days after replating.
  • the progesterone-derivative MPA triggers in vivo RANKL expression.
  • b Schematic representation of the three RANKL isoforms adapted from Ikeda et al ..
  • the trans ⁇ membrane domain of RANKL1 and RANKL2 is indicated (TM, black box, spanning aa 48-71) .
  • TM black box, spanning aa 48-71 .
  • RANKL2 is lacking aa 14-44 of the intracellular domain while RANKL3 is lacking aa 1-118 spanning the whole intracellular domain as well as the transmembrane domain.
  • Numbers indicate amino acid residues, c , Expression of total (t) RANKL, RANKL1, RANKL2 , and RANKL3 mRNA in purified mammary epithelial cells after three days MPA treatment, ⁇ -actin is shown as a control, d, Representative agarose gel of RT-PCR products as in c. e , mRNA expression of various proteases known to shed RANKL from the surface of cells. mRNA was determined in purified mammary epithelial cells by qRT-PCR three days after MPA implantation. Data are shown as fold change compared to sham treatment (+/- sem) (n 3 per group). * P ⁇ 0.05; ** P ⁇ 0.005; *** P ⁇ 0.001 (Student's t-test).
  • PR Progesterone receptor
  • FIG. 7 RANK fl A females crossed to the K5-Cre mice show defective lobulo-alveolar development in pregnancy.
  • Figure 8 Normal formation of a lactating mammary gland in pregnant MMTV-Cre, RANK fl/A females.
  • MMTV-Cre mediated deletion of RANK did not affect formation of a lactating mammary gland, c , Southern blot of purified mammary epithelial cells derived from RANK flox and RANK flox ; MMTV-Cre females.
  • the wild type or floxed RANK allele (fl/+; 9.6 kb) and the deleted RANK allele ( ⁇ ;3.9 kb) are indicated after digestion of genomic DNA with PvuII and Sphl .
  • RANK flox ; MMTV-Cre animals are denoted RANK Amam hereafter.
  • MPA induces RANKL expression and epithelial proliferation in mammary glands.
  • Figure 10 Survival curves of progestin-driven mammary cancers in RANK Amam mice.
  • a , b , MPA induces RANKL expression in mammary epithelial cells.
  • Nulliparous wild type females were treated with oral ga- vage of DMBA or oil vehicle, s.c. implanted with slow-release MPA pellets, or treated with sham surgery, a , RANKL mRNA was determined in purified mammary epithelial cells by qRT-PCR 3 days after implantation/oral gavage . Data are shown as fold change compared to sham treatment +/- sem.
  • the wild type or floxed RANK allele (fl/+; 9.6 kb) and the deleted RANK allele ( ⁇ ;3.9 kb) are indicated after digestion of genomic DNA with PvuII and Sphl .
  • a , b Representative histological sections of mammary tumors isolated from control littermate and RANK Amam females 7 ( a ) and 21 (b) days after the last DMBA treatment. H&E and E-cadherin stainings are shown indicating typical features of ductal adeno ⁇ carcinomas in tumors from control littermates and RANK Amam females. Cytokeratinl4 (K14) expression demonstrates the basal cell origin in both controls and RANK Amam females. However,
  • Cytokeratin5 (a) , Cytokeratinl4 (b) and E-cadherin (c) stainings are shown in mammary glands of 6 month-old females .
  • Mammary glands from littermate RANK Amam females not expressing NeuT are shown as controls, d, RANKL mRNA expression in mammary epithelial cells (MECs) isolated from either sham- or MPA-treated virgin mice, in MPA-driven mamry adenocarcinomas, and mammary tumors derived from NeuT, Pym, Neu, and ⁇ / ⁇ transgenic mice.
  • MECs mammary epithelial cells isolated from either sham- or MPA-treated virgin mice, in MPA-driven mamry adenocarcinomas, and mammary tumors derived from NeuT, Pym, Neu, and ⁇ / ⁇ transgenic mice.
  • RANKL mRNA was determined by qRT-PCR. Data are shown as fold change compared to sham treatment (+/- sem) .
  • n 3 per group, e, RANKL protein expression in various tumors isolated from the indicated genetic mouse models and MPA-driven tumors in control RANK A/+ and RANK Amam females.
  • Recombinant murine sRANKL protein is shown for molecular size comparison, ⁇ -actin is shown as a loading control .
  • a Schematic outline of genetically confirmed signalling pathways that control RANKL-RANK mediated formation of a lactat- ing mammary gland during pregnancy
  • b Western blotting for phosphorylated (P) AKT, total AKT, phosphorylated (P) ERK1/2, total ERK1/2, phosphorylated (P) p38-MAPK, and p38-MAPK in isolated primary mouse mammary gland epithelial cells in response to RANKL stimulation (l g/ml) .
  • Data are representative of 4 experiments .
  • MPA activates the NFKB pathway and triggers CyclinDl expression via RANKL/RANK .
  • FIG. 16 RANKL/RANK downstream signaling pathways.
  • a Western blotting for phosphorylated (P) p65 NFKB, total p65 NFKB, phosphorylated (P) ⁇ , total ⁇ , phosphorylated (P) ERK1/2, total ERK1/2, phosphorylated (P) p38-MAPK, and p38- MAPK in human SKBR3 breast cancer cells in response to RANKL stimulation (lyg/ml) .
  • Data are representative of 3 experiments
  • b Growth curve of SKBR3 breast cancer cells cultured in normal growth medium (control, DMEM supplemented with 10% FCS) or in the presence of RANKL .
  • RANKL protects primary murine mammary epithelial cells and human SKBR3 breast cancer cells from apoptosis in re- sponse to ⁇ -irradiation .
  • a Western Blot analysis for ⁇ 2 ⁇ , phosphorylated (P) Chkl, total Chkl, p53 and ⁇ -actin in isolated primary mouse mammary gland epithelial cells in response to ⁇ -irradiation (2 Gray) in the presence ( ⁇ / ⁇ ) or absence of RANKL stimulation.
  • b , c FACS analysis of propidium iodide (PI) stained b , mammary epithelial cells and c , SKBR3 human breast cancer cells after ⁇ -irradiation (2 Gray) in the absence or presence (l g/ml) of RANKL.
  • Data are representative of at least 3 experiments.
  • Apoptotic cells with a DNA content ⁇ 2n appear in the sub-Gl region. Percent of cells in sub-Gl (Ml), Gl-phase (M2), S/G2/M-phase (M3) as well as polyploid cells with a DNA content > 4n are given for the indicated time points.
  • RANKL protects primary murine mammary epithelial cells and human SKBR3 breast cancer cells from apoptosis in response to doxorubicin.
  • a , b FACS analysis of a , mammary epithelial cells and b , SKBR3 human breast cancer cells incubated with the genotoxic agent doxorubicin (Dox, ⁇ ) in the presence (liq/ml) or absence of RANKL.
  • Dox, ⁇ the genotoxic agent doxorubicin
  • IKK mediates MPA-induced protection from radiation-induced epithelial apoptosis.
  • a , b Reduced induction of mammary epithelial cell apoptosis in response to ⁇ -irradiation in IKKa Arnam females. Littermates control and IKKa Amam females were either sham operated or implanted with an MPA pellet and ⁇ -irradiated (5 Gray) . MPA pellets were implanted 3 days before ⁇ -irradiation . 24 hours after irradiation, apoptosis was detected by immunostaining for active Caspa- se 3. a , Apoptotic nuclei of epithelial cells (arrows) are shown for representative mammary gland sections. Magnifications X 40.
  • Figure 20 Quantification of Western blots.
  • Example 1 Mice. Rank iloxed mice have been recently generated 1 . Briefly, to generate mice carrying a null allele of Rank (rank 1 " allele) , ranfc floxed mice were crossed to ⁇ -actin-Cre ubiquitous deleter mice. Mice carrying the jranA: floxed or rank 4 alleles as well as the MMTV-Cre mice were backcrossed seven times onto a BALBc background before generating the MMTV-Cre rank t/tlo ed mice. MMTV-NeuT mice were kindly provided by Guido Forni, Milan. MMTV- Cre (stock # 003553) and Mx-Cre mice (stock # 003556) were ob ⁇ tained from the Jackson Laboratory. K5-Cre, IKKa floxed and
  • NFATcl iloxed mice have been previously described 2"4 .
  • Mouse genotypes were determined by PCR and Southern blot analysis. In all experiments, only littermate mice from the same breedings were used. All mice were bred and maintained according to institutional guidelines.
  • RANK deletion in tumors and Cre effects Southern blotting of the tumors that developed in RANK Amam females showed deletion of RANK, albeit some residual wild type band was observed (Fig. 10c) that may be explained by the presence of other cell types and/or escaper cells. Differences in tumor onset in Cre-negative control females and littermates expressing the MMTV-Cre
  • Example 2 MPA/DMBA-induced mammary carcinogenesis.
  • MPA/DMBA treatment was performed as described 5 ' 6 . Briefly, six-week old female mice were anesthetized with ketamine-xylazine and surgi- cally implanted with slow-release Medroxyprogesterone Acetat (MPA) pellets (50mg, 90-day release; Innovative Research of America) subcutaneously on the right flank. 200 ⁇ 1 DMBA (5mg/ml diluted in cottonseed oil) was administered by oral gavage 6 times throughout the following 8 weeks as outlined in Fig. 2a. Onset of mammary tumors was determined by palpation. Differences in tumor onset in Cre-negative control females and littermates expressing the MMTV-Cre transgene were not observed indicating that Cre expression per se does not alter tumor incidence in the MPA/ DMBA mammary tumor model.
  • Example 3 Mammary tissue transplants.
  • mammary epithelial tissue was isolated from nulliparous 3-week-old donors and implanted into cleared mammary fat pads (devoid of endogenous epithelium) of 3-week-old host nu/nu mice as described 7 .
  • Example 4 Histology, whole-mount, and immunohistochemistry .
  • 5 ⁇ sections were cut and stained with hematoxylin and eosin (H&E) .
  • Whole-mount staining of mammary glands was performed as described 8 .
  • immunoperoxidase staining paraffin-embedded sections were dehydrated and antigenic epitopes exposed using a 10 mM citrate buffer or microwaving. Sections were incubated with antibodies to cytokeratine 5, cy- tokeratine 14, E-cadherin, anti-Ki67 (Novocastra) and anti- active Caspase 3 (Cell Signaling) and visualized using peroxi- dase-conj ugated secondary antibodies.
  • Histomorphometric indices proliferation and apoptosis were calculated as the number of positive epithelial cells divided by the total number of epithelial cells, with no fewer than 1000 nuclei for Ki67 stainings and no fewer than 5000 cells for active Caspase 3 staining counted per section.
  • Example 5 Western blotting.
  • the human epithelial breast tumor cell line SKBR3 and primary non-transformed mouse mammary epithelial cells were left untreated or stimulated with recombinant murine RANKL ref ' 9 .
  • Adenocarcinomas were isolated from control and mutant mice and total protein lysates prepared.
  • Western blotting was carried out using standard protocols. Briefly, blots were blocked with 5% BSA in lxTBS 0.1% Tween-20 (TBST) for 1 hour and incubated with primary antibody overnight at 4°C (diluted in TBST according to the manufactures protocol) .
  • Blots were washed 3 times in TBST for 30 minutes, incubated with HRP- conjugated 2 nd antibodies (1:2000, Promega) for 1 hour at room temperature, washed 3 times in TBST for 30 minutes, and visualized using ECL.
  • Example 6 qRT-PCR.
  • Total RNA of tumors was prepared using the RNeasy Mini Kit (Qiagen) , according to the manufacturer's instructions.
  • Total RNA (2 pg) was subjected to guantitative (g)RT-PCR analysis. The following primers were used:
  • ⁇ -actin forward primer 5'- GCTCATAGCTCTTCTCCAGGG -3' ;
  • ⁇ -actin reverse primer 5' -CCTGAACCCTAAGGCCAACCG -3'.
  • RANKL reverse primer 5' - GTTGCTTAACGTCATGTTAGAGATCTTG -3'
  • RANK forward primer 5' - CTTGGACACCTGGAATGAAG -3'
  • RANK reverse primer 5' - CAGCACTCGCAGTCTGAGTT -3'
  • CyclinDl forward primer 5' - CTGTGCGCCCTCCGTATCTTA-3 '
  • CyclinDl reverse primer 5' - GGCGGCCAGGTTCCACTTGAG-3 '
  • p21 (Cdknla) forward primer 5' - GTGGCCTTGTCGCTGTCTT -3' p21 (Cdknla) reverse primer: 5' - GCGCTTGGAGTGATAGAAATCTG -3' tRANKL forward primer: 5' - GCGCCGGGCCAGCCGAGACTAC-3 '
  • RANKL1 forward primer 5' - GTCCCACACGAGGGTCCGCTGC- 3 '
  • RANKL3 forward primer 5' - CCGAGACTACGGCGGATCCTAACAG-3 '
  • Noxa forward primer 5' -ACTTTGTCTCCAATCCTCCG -3'
  • Noxa reverse primer 5' - GTGCACCGGACATAACTGTG-3 '
  • Bim forward primer 5' - GTTGAACTCGTCTCCGATCC-3 '
  • Example 7 DNA damage responses.
  • primary mouse mammary epithelial cells and SKBR3 human breast cancer cells were seeded at a cell- density of 100000 cells/well in a 6-well plate and allowed to grow for 24 hours.
  • Cell cycle arrest and numbers of dead cells were determined using propidium iodine staining.
  • control and RANK Amam littermate females were ⁇ -irradiated with a total dose of 5 Gray (Gy) .
  • mammary glands were isolated and immunostained for active Caspase 3 (Cell Signaling) indicative of apoptosis.
  • Example 8 FACS analysis of primary mammary epithelial cells.
  • tissue dissociation was used to generate single cell suspensions: lymph nodes were removed from both inguinal mammary fat pads and fat pads were then digested in 2ml complete EpiCult medium (EpiCult-B basal medium (StemCell Technologies SCT Catalog #05610) supplemented with EpiCult-B proliferation supplements, lOng/ml bFGF (SCT Catalog #02634), 10 ng/ml EGF (SCT Catalog #02633), 4 ⁇ g/ml Heparin (SCT Catalog #07980), 2.5ml FBS (5%) and antibiotics) with 2.5x colla- genase/hyaluronidase (e.g.
  • biotin-con ugated anti-CD31 (#553371; BD) , which labels endothelial cells, and biotinylated CD45 + and Terll9 + (StemSep murine chimera cocktail #13058C; Stem Cell Technologies; 3.5 ⁇ 1/100 ⁇ 1 vol), which labels hematopoietic cells, for lOmin at room temperature.
  • Hematopoietic and endothelial cells were excluded by FACS using Strepavidin-conj ugated- APC (#554067; BD) .
  • Staining with anti-CD49f (#551129; BD) and CD24 (#553261; BD) was used to identify the mammary stem cell population as previously described 10,11 .
  • Example 9 Cancer stem cell assays. Self-renewal of mammary cancer stem cells, i.e. tumor initiating cells (TICs) , was assayed using a mammosphere assay as described previously 6,12 .
  • TICs tumor initiating cells
  • the primary mammospheres which formed over 7 days, were collected by gentle centrifugation (800rpm), digested into single cell suspensions with trypsin (0.05%, lOmin) , and assayed for their ability to form secondary mammospheres as above.
  • Example 10 Anchorage-independent growth. The ability of cells to grow in soft agar was assayed as described previously 13 . Briefly, DNA grade agarose (1% in DMEM) was used as bottom layer (2ml in 6 well plates) and 2xl0 4 SKBR3 cells were seeded in 1,5ml agarose (0,3% in DMEM) . Cells were overlayed with 1.5ml DMEM supplemented with 10% FCS and cultured for 24 days.
  • DNA grade agarose 1% in DMEM
  • 2xl0 4 SKBR3 cells were seeded in 1,5ml agarose (0,3% in DMEM) .
  • Cells were overlayed with 1.5ml DMEM supplemented with 10% FCS and cultured for 24 days.
  • reaction mixture is aspirated into the measuring cell where the microparticles are magnetically captured onto the surface of the electrode. Unbound substances are then removed with ProCell. Application of a voltage to the electrode then induces chemiluminescent emission which is measured by a photomultiplier .
  • Results are determined via a calibration curve which is in- strument-specifically generated by 2-point calibration and a master curve provided via the reagent barcode.
  • M Streptavidin-coated microparticles (transparent cap) , 1 bottle, 6.5mL: Streptavidin-coated microparticles, 0.72mg/mL; pre ⁇ servative .
  • Example 12 Statistics. All values herein are given as means sem. Comparisons between groups were made by Student's t-test. For the Kaplan-Meier analysis of tumor onset a log rank test was performed. P 0.05 was accepted as statistically significant. In addition to the Log RANK test a post-hoc power analysis was performed (PS Power and Sample Size Calculations, in the web at bi- ostat.mc.vanderbilt.edu/PowerSampleSize) to calculate the probability of correctly rejecting the null hypothesis of equal tumor onset times given the number of experimental animals. For the study involving the RANK Amam animals the null hypothesis can be reject with a probability (power) of 0, 933 and for the IKKcx Amam animals with a probability of 0,766. The Type I error probability associated with this test of this null hypothesis is 0,05. Human data were analysed using a paired t-Test, the Mann Whitney U test, or a Spearman rank test as indicated.
  • MPA medroxyprogesterone acetate, a representive progestin pellets were implanted into female mice and RANKL expression was assayed. MPA treatment resulted in a more than 2000 fold induction of RANKL mRNA in isolated mammary epithelial cells (Fig. la) .
  • mRNA expression of RANK, of the decoy receptor of RANKL os- teoprogesterin (OPG) , of PTHrP (known to induce RANKL) and of TRAIL (known to bind to OPG) were not changed in isolated mamma ⁇ ry epithelial cells. Immunohistochemistry confirmed induction of RANKL protein in the mammary gland (Fig.
  • MPA can induce transcription of prolactin and the prolactin receptor in breast cancer cells and prolactin can directly induce RANKL via Jak2/Stat5 signaling
  • MPA induces RANKL in the mammary gland of prolactin receptor knock-out mice.
  • MPA triggers substantial production of RANKL protein in female control mice
  • Fig. lc prolactin receptor mutants
  • Example 14 Effects of progestins on RANKL levels in
  • mice RANKL/RANK impaired mice :
  • RANK was deleted in mammary epithelial cells using K5-Cre and MMTV-Cre mediated excision of an inducible RANK al ⁇ lele (K5-Cre rank* 10 *' mice and MMTV-Cre rank flox/ mice) . Both mouse lines appear healthy and exhibit normal bone structures and lymph node formation. As expected K5-Cre rank ilox/Cl mice exhib ⁇ ited apparently normal mammary gland development in puberty;
  • mice did not develop milk-secreting lobuloalveolar structures during pregnancy (Fig. 7a, b) .
  • These effects were cell autonomous using transplantation experiments (Fig. 7c) .
  • MMTV-Cre ranic £lox mice mammary gland development in nulliparous females and formation of milk-secreting lobuloalveolar structures in pregnancy appeared normal (Fig. 8a-c) .
  • MMTV-Cre rank flox/ii mice were therefore used for all further experiments.
  • MMTV-Cre ra/7A: flox mutant mice are hereafter termed RANK Amam .
  • Example 15 Mechanism of RANKL activation upon progestin administration :
  • MPA treatment triggers massive proliferation of mammary epithelial cells.
  • MPA-induced proliferation of mammary epithelial cells was significantly reduced in RANK Amam females (Fig. Id; Fig. 9a-c) .
  • RANKL i.p. in- jections into nulliparous females triggered proliferation of mammary gland epithelial cells via RANK (Fig. 9d,e) .
  • endogenous progesterone affects the num ⁇ bers of Lin-CD24+CD49f hl stem cells during pregnancy 15 and the es- trous cycle 16 .
  • RANKL/RANK system controls expansion of Lin-CD24+CD49f hi cells.
  • Example 16 Influence of progestins on cancer development via RA K/RANKL in control and RANK/RANKL deficient mice:
  • Progestin-driven mammary cancer can be modeled in female mice, where implantation of slow release MPA pellets in the presence of the DNA damaging agent dimethylbenz [a] anthracene (DMBA) triggers mammary cancer (Fig. 2a; Fig. 10a, b) .
  • DMBA DNA damaging agent dimethylbenz [a] anthracene
  • RANK Amam females also resulted in markedly enhanced survival (Fig. lOe) .
  • Southern blotting of the tumors that developed in RANK Amam females confirmed efficient deletion of RANK (Fig. 10c) .
  • All tumors that developed in control and RANK Amam females exhibited typical histopathology of E-Cadherin expressing ductal adenocarcinomas of the Cytokeratine (CK) 5 and CK14 positive basal cell subtype (Fig. 2c, Fig. 11a, b) .
  • ductal adenocarcinomas arising in RANK Amam females frequently developed extensive areas of squamous metaplasia (Fig. 2c, Fig. 11a, b) .
  • RANK Amam showed a delayed onset in progestin-induced mammary cancer
  • next the incidence of mammary tumors at early stages after MPA/DMBA challenge was analysed.
  • One week after the last DMBA treatment all RANK expressing control females already exhibited multiple in situ carcinomas and even invasive mammary tumors.
  • very few carcinomas were observed in situ and never any invasive mammary carcinomas in RANK Amam animals one week after the last DMBA challenge (Fig. 2d) .
  • Three weeks after the last DMBA challenge the incidence of carcinomas in situ was similar among control and RANK Amam females, but invasive carcinomas were still very infrequent in the RANK Amam females (Fig. 2e) .
  • RANK Amam females Fig. 2d,e
  • Mx- Cre ranJ Mx- Cre ranJ mice
  • flcx flox mice did not delay the onset of MPA/DMBA-induced mammary cancer (Fig. 12a-c) , suggesting that the effects of RANK/RANKL impairment are restricted to mammary epithelial cells.
  • mammary gland specific deletion of RANK did not alter mammary cancer incidence (Fig.
  • RANKL-RANK signaling via ⁇ -NFKB-CyclinDl in mammary epithelial cells is illustrated in Fig. 14a.
  • RANKL stimulation indeed resulted in p65 NFKB and ⁇ phosphorylation in primary mouse mammary gland epithelial cells (MECs) (Fig. 3a) .
  • MECs primary mouse mammary gland epithelial cells
  • RANKL stimulation of MECs triggered phosphorylation of p38-MAPKs and ERK (Fig. 14b) .
  • mice were challenged with MPA.
  • the Id2 pathway is a second genetically confirmed downstream pathway for RANKL/RANK in mammary epithelial cells 17 .
  • human SKBR3 breast tumor cells were assayed.
  • RANKL stimulation induced NFKB, p38-MAPKs and ERK activation and proliferation in SKBR3 cells (Fig. 16a, b).
  • RANKL stimulation the ability of these cells to grow in an anchorage- independent manner was assessed, which correlates well with tu- morigenicity in vivo 18 .
  • RANKL induced growth of SKBR3 cells in soft agar i.e. RANK signaling not only triggers proliferation but also acts as a transforming agent to induce anchorage- independent growth.
  • NFATcl can also be regulated by the Id2 pathway during RANKL-mediated osteoclastogenesis.
  • MMTV- Cre nfatcl flox NFATcl Araam
  • MMTV-Cre Ikka flox flox IKKa Amara mice were generated to delete NFATcl and IKKa in mammary epithelial cells. Both mutant mouse strains appear healthy and exhibit no overt defects in any organs assayed.
  • IKKa Amam mice exhibited a delayed onset of mammary cancer (Fig. 3e) .
  • tumors from IKKa amam mice normal expression of ⁇ and ⁇ was found but reduced NFKB activation as determined by increased ⁇ protein levels and decreased p65 NFKB phosphorylation (Fig. 3b) and downregulated mRNA expression of the NFKB target gene Cyclin Dl (Fig. 3c) suggesting that IKKa is indeed required for NFKB signaling in these tumors.
  • the Id2 pathway gene p21 was not affected in tumors from IKKa Amam mice (Fig. 3c). No significant differences in the tumor onset between control and NFATcl amam mice were observed (Fig.
  • MECs mouse primary mammary epithelial cells
  • RANKL-responsive human breast cancer cell line SKBR3 were treated with DNA damaging agents doxorubicin or ⁇ -irradiation .
  • RANKL treatment did not alter induction of ⁇ 2 ⁇ and p53 or activation of Chkl, prototypic markers of a functional DNA damage response (Fig. 17a) .
  • RANKL did not alter the early cell cycle arrest after DNA damage with ⁇ -irradiation (Fig. 17b, c) or doxorubicin (Fig. 18a, b) .
  • RANKL treatment resulted in a marked protection from cell death in response to ⁇ -irradiation (Fig. 17b, c) and doxorubicin-induced DNA damage (Fig.
  • Example 20 Tumor inhitiating stem cells
  • TICs tumor initiating cells
  • MPA triggers an enormous induction of RANKL in the mammary gland.
  • the induction of RANKL in response to MPA requires expression of the prolactin receptor and possibly other intermediates.
  • RANKL via RANK on mammary epithelial cells drives these cells into the cell cycle and, importantly, protects mouse as well as human mammary gland epithelial cells from apoptosis in response to DNA damage including ⁇ -irradiation .
  • RANKL-/RANK control self renewal of mammary cancer stem cells and anchorage- independent growth.
  • progestin-induced RANKL/RANK provide a growth and survival advantage to damaged mammary epithelium, a pre-requisite to initiate mammary cancer 21 .
  • These effects are, at least in part, mediated via the IKKCX-NFKB signaling pathway.
  • RANKL-RANK system is an important molecular link between progestins and epithelial carcinogenesis.
  • RANKL inhibition is therefore a novel approach to prevent and/or treat cancer.
  • RANKL inhibition can also be used to prime cancer cells for anti-cancer therapy such as based on radiation or other DNA damaging agents.
  • Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93, 165-76 (1998) .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Endocrinology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Reproductive Health (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
PCT/EP2011/066511 2010-09-22 2011-09-22 Breast cancer therapeutics Ceased WO2012038504A2 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
PH1/2013/500543A PH12013500543A1 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
AU2011306917A AU2011306917B2 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
BR112013006673A BR112013006673A2 (pt) 2010-09-22 2011-09-22 produtos terapêuticos para câncer de mama
NZ608207A NZ608207A (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
JP2013529652A JP6133778B2 (ja) 2010-09-22 2011-09-22 乳癌治療剤
EP11758242.9A EP2618833B1 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
CN2011800544541A CN103384530A (zh) 2010-09-22 2011-09-22 乳腺癌治疗剂
CA2811556A CA2811556A1 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
MX2013003076A MX2013003076A (es) 2010-09-22 2011-09-22 Terapeuticos contra cancer de mama.
US13/825,655 US10143747B2 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
RU2013118325/15A RU2013118325A (ru) 2010-09-22 2011-09-22 Лечение рака молочной железы
KR1020137009817A KR20130118870A (ko) 2010-09-22 2011-09-22 유방암 치료제
IL225442A IL225442A0 (en) 2010-09-22 2013-03-21 Compositions comprising rankl inhibitors for use in treating and preventing cancer
US16/158,504 US20190030161A1 (en) 2010-09-22 2018-10-12 Breast cancer therapeutics

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP10178346.2 2010-09-22
EP10178346A EP2433644A1 (en) 2010-09-22 2010-09-22 Breast cancer therapeutics

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/825,655 A-371-Of-International US10143747B2 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics
US16/158,504 Continuation US20190030161A1 (en) 2010-09-22 2018-10-12 Breast cancer therapeutics

Publications (2)

Publication Number Publication Date
WO2012038504A2 true WO2012038504A2 (en) 2012-03-29
WO2012038504A3 WO2012038504A3 (en) 2012-06-21

Family

ID=43498569

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/066511 Ceased WO2012038504A2 (en) 2010-09-22 2011-09-22 Breast cancer therapeutics

Country Status (15)

Country Link
US (2) US10143747B2 (https=)
EP (2) EP2433644A1 (https=)
JP (2) JP6133778B2 (https=)
KR (1) KR20130118870A (https=)
CN (1) CN103384530A (https=)
AU (1) AU2011306917B2 (https=)
BR (1) BR112013006673A2 (https=)
CA (1) CA2811556A1 (https=)
CL (1) CL2013000801A1 (https=)
IL (1) IL225442A0 (https=)
MX (1) MX2013003076A (https=)
NZ (1) NZ608207A (https=)
PH (1) PH12013500543A1 (https=)
RU (1) RU2013118325A (https=)
WO (1) WO2012038504A2 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2618833B1 (en) 2010-09-22 2018-05-02 IMBA-Institut für Molekulare Biotechnologie GmbH Breast cancer therapeutics
US11192952B2 (en) 2017-04-28 2021-12-07 Amgen Inc. Formulations comprising human anti-RANKL monoclonal antibodies, and methods of using the same

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9301920B2 (en) 2012-06-18 2016-04-05 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
BR112014012444B1 (pt) 2011-11-23 2021-12-14 Therapeuticsmd, Inc Composição farmacêutica compreendendo estradiol solubilizado, progesterona e um agente de solubilização, bem como usos desta para tratar um sintoma relacionado à menopausa em uma mulher
US10806697B2 (en) 2012-12-21 2020-10-20 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US20150196640A1 (en) 2012-06-18 2015-07-16 Therapeuticsmd, Inc. Progesterone formulations having a desirable pk profile
US20130338122A1 (en) 2012-06-18 2013-12-19 Therapeuticsmd, Inc. Transdermal hormone replacement therapies
US10806740B2 (en) 2012-06-18 2020-10-20 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9180091B2 (en) 2012-12-21 2015-11-10 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US10568891B2 (en) 2012-12-21 2020-02-25 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11266661B2 (en) 2012-12-21 2022-03-08 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10471072B2 (en) 2012-12-21 2019-11-12 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10537581B2 (en) 2012-12-21 2020-01-21 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11246875B2 (en) 2012-12-21 2022-02-15 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
RU2016143081A (ru) 2014-05-22 2018-06-26 Терапьютиксмд, Инк. Натуральные комбинированные гормонозаместительные составы и терапии
US10328087B2 (en) 2015-07-23 2019-06-25 Therapeuticsmd, Inc. Formulations for solubilizing hormones
US10286077B2 (en) 2016-04-01 2019-05-14 Therapeuticsmd, Inc. Steroid hormone compositions in medium chain oils
US9931349B2 (en) 2016-04-01 2018-04-03 Therapeuticsmd, Inc. Steroid hormone pharmaceutical composition
EP3458090A1 (en) * 2016-05-19 2019-03-27 Probiocon GmbH Anti-cancer combination treatment

Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993012227A1 (en) 1991-12-17 1993-06-24 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
WO1998046751A1 (en) 1997-04-16 1998-10-22 Amgen Inc. Osteoprotegerin binding proteins and receptors
EP0873998A2 (en) 1997-04-25 1998-10-28 Takeda Chemical Industries, Ltd. Receptor protein and its use
US5843678A (en) 1997-04-16 1998-12-01 Amgen Inc. Osteoprotegerin binding proteins
WO1998054201A1 (en) 1997-05-29 1998-12-03 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like protein 8
EP0911342A1 (en) 1997-04-15 1999-04-28 Snow Brand Milk Products, Co., Ltd. Novel protein and process for producing the same
WO1999053942A1 (en) 1998-04-23 1999-10-28 Amgen Inc. Compositions comprising osteoprotegerin for the prevention and treatment of cardiovascular diseases
US6017729A (en) 1996-12-23 2000-01-25 Immunex Corporation Receptor activator of NF-κB
WO2002055692A2 (de) 2001-01-09 2002-07-18 Ribopharma Ag Verfahren zur hemmung der expression eines zielgens und medikament zur therapie einer tumorerkrankung
WO2002055693A2 (de) 2001-01-09 2002-07-18 Ribopharma Ag Verfahren zur hemmung der expression eines zielgens
EP1144623B1 (de) 1999-01-30 2002-08-28 Ribopharma AG Verfahren und medikament zur hemmung der expression eines vorgegebenen gens
US20020162126A1 (en) 2000-03-16 2002-10-31 David Beach Methods and compositions for RNA interference
US20020173478A1 (en) 2000-11-14 2002-11-21 The Trustees Of The University Of Pennsylvania Post-transcriptional gene silencing by RNAi in mammalian cells
WO2002098362A2 (en) 2001-06-06 2002-12-12 Immunex Corporation Use of rank antagonists to treat cancer
WO2003074654A2 (en) 2002-02-20 2003-09-12 Sirna Therapeurics, Inc Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US20040167072A1 (en) 2001-05-11 2004-08-26 Aggarwal Bharat B. Inhibitors of receptor activator of NF-kappaB and uses thereof
WO2005028633A2 (en) 2003-09-17 2005-03-31 Isis Pharmaceuticals, Inc. Modulation of rankl expression
WO2007128564A2 (en) 2006-05-08 2007-11-15 Imba-Institut Für Molekulare Biotechnologie Gmbh Use of a compound with rankl activity
US20080107597A1 (en) 2006-01-12 2008-05-08 Anaptys Biosciences, Inc. Isolation of antibodies that cross-react and neutralize rankl originating from multiple species
WO2010022120A1 (en) 2008-08-19 2010-02-25 Regeneron Pharmaceuticals, Inc. Human antibodies to human rankl

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6638727B1 (en) 1999-01-26 2003-10-28 Cytyc Health Corporation Methods for identifying treating or monitoring asymptomatic patients for risk reduction or therapeutic treatment of breast cancer
WO2005060627A2 (en) 2003-12-10 2005-07-07 Auxeris Therapeutics, Inc. Methods of assessing the risk of non-traumatic bone fracture
EP2433644A1 (en) 2010-09-22 2012-03-28 IMBA-Institut für Molekulare Biotechnologie GmbH Breast cancer therapeutics

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993012227A1 (en) 1991-12-17 1993-06-24 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
EP2003203A1 (en) 1996-12-23 2008-12-17 Immunex Corporation Ligand for receptor activator of nf-kappa b, ligand is member of TNF superfamily
US7411050B2 (en) 1996-12-23 2008-08-12 Immunex Corporation Monoclonal blocking antibody to human RANKL
US6740522B2 (en) 1996-12-23 2004-05-25 Immunex Corporation Antibodies against ligand for receptor activator of NF-kB
US6017729A (en) 1996-12-23 2000-01-25 Immunex Corporation Receptor activator of NF-κB
EP0911342A1 (en) 1997-04-15 1999-04-28 Snow Brand Milk Products, Co., Ltd. Novel protein and process for producing the same
US5843678A (en) 1997-04-16 1998-12-01 Amgen Inc. Osteoprotegerin binding proteins
WO1998046751A1 (en) 1997-04-16 1998-10-22 Amgen Inc. Osteoprotegerin binding proteins and receptors
EP0873998A2 (en) 1997-04-25 1998-10-28 Takeda Chemical Industries, Ltd. Receptor protein and its use
WO1998054201A1 (en) 1997-05-29 1998-12-03 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like protein 8
WO1999053942A1 (en) 1998-04-23 1999-10-28 Amgen Inc. Compositions comprising osteoprotegerin for the prevention and treatment of cardiovascular diseases
EP1144623B1 (de) 1999-01-30 2002-08-28 Ribopharma AG Verfahren und medikament zur hemmung der expression eines vorgegebenen gens
US20020162126A1 (en) 2000-03-16 2002-10-31 David Beach Methods and compositions for RNA interference
US20020173478A1 (en) 2000-11-14 2002-11-21 The Trustees Of The University Of Pennsylvania Post-transcriptional gene silencing by RNAi in mammalian cells
WO2002055692A2 (de) 2001-01-09 2002-07-18 Ribopharma Ag Verfahren zur hemmung der expression eines zielgens und medikament zur therapie einer tumorerkrankung
WO2002055693A2 (de) 2001-01-09 2002-07-18 Ribopharma Ag Verfahren zur hemmung der expression eines zielgens
US20040167072A1 (en) 2001-05-11 2004-08-26 Aggarwal Bharat B. Inhibitors of receptor activator of NF-kappaB and uses thereof
WO2002098362A2 (en) 2001-06-06 2002-12-12 Immunex Corporation Use of rank antagonists to treat cancer
WO2003074654A2 (en) 2002-02-20 2003-09-12 Sirna Therapeurics, Inc Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
WO2005028633A2 (en) 2003-09-17 2005-03-31 Isis Pharmaceuticals, Inc. Modulation of rankl expression
US20080107597A1 (en) 2006-01-12 2008-05-08 Anaptys Biosciences, Inc. Isolation of antibodies that cross-react and neutralize rankl originating from multiple species
WO2007128564A2 (en) 2006-05-08 2007-11-15 Imba-Institut Für Molekulare Biotechnologie Gmbh Use of a compound with rankl activity
WO2010022120A1 (en) 2008-08-19 2010-02-25 Regeneron Pharmaceuticals, Inc. Human antibodies to human rankl

Non-Patent Citations (35)

* Cited by examiner, † Cited by third party
Title
AKIYAMA ET AL., J. PHARMACY AND PHARMACOLOGY, vol. 62, no. 4, 2010, pages 470 - 476
ALDAZ, C.M., LIAO, Q.Y., LABATE, M., JOHNSTON, D.A.: "Medroxyprogesterone acetate accelerates the development and increases the incidence of mouse mammary tumors induced by dimethylbenzanthracene", CARCINOGENESIS, vol. 17, 1996, pages 2069 - 72
ALIPRANTIS, A.O. ET AL.: "NFATc1 in mice represses osteoprotegerin during osteoclastogenesis and dissociates systemic osteopenia from inflammation in cherubism", J CLIN INVEST, vol. 118, 2008, pages 3775 - 89
ASSELIN-LABAT, M.L. ET AL.: "Control of mammary stem cell function by steroid hormone signalling", NATURE
BHARTI ET AL., APOPTOSIS, vol. 9, no. 6, 2004, pages 677 - 690
CANON ET AL., BONE, vol. 40, no. 6, 2007, pages 145
CANON ET AL., CANCER TREATMENT REVIEWS, vol. 34, 2008, pages 60
CANON ET AL., EUROP. J. OF CANCER, vol. 4, no. 12, 2006, pages 166 - 167
CAO, Y., LUO, J.L., KARIN, M.: "IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cell", PROC NATL ACAD SCI U S A, vol. 104, 2007, pages 15852 - 7
DONTU, G. ET AL.: "In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells", GENES DEV, vol. 17, 2003, pages 1253 - 70, XP003003595, DOI: doi:10.1101/gad.1061803
ELLIS ET AL., BREAST CANCER RESEARCH AND TREATMENT, vol. 118, no. 1, 2009, pages 81 - 87
EWAN, K.B. ET AL.: "Transforming growth factor-betal mediates cellular response to DNA damage in situ", CANCER RES, vol. 62, 2002, pages 5627 - 31
FATA, J.E. ET AL.: "The osteoclast differentiation factor osteoprotegerin- ligand is essential for mammary gland development", CELL, vol. 103, 2000, pages 41 - 50
FREEDMAN, V.H., SHIN, S.I.: "Cellular tumorigenicity in nude mice: correlation with cell growth in semi-solid medium", CELL, vol. 3, 1974, pages 355 - 9, XP023909883, DOI: doi:10.1016/0092-8674(74)90050-6
GAREUS, R. ET AL.: "Normal epidermal differentiation but impaired skin- barrier formation upon keratinocyte-restricted IKK1 ablation", NAT CELL BIOL, vol. 9, 2007, pages 461 - 9
HANADA, R. ET AL.: "Central control of fever and female body temperature by RANKL/RANK", NATURE, vol. 462, 2009, pages 505 - 9
HANAHAN, D., WEINBERG, R.A.: "The hallmarks of cancer", CELL, vol. 100, 2000, pages 57 - 70
HOLLAND ET AL., CANCER BIOLOGY AND THERAPY, vol. 9, no. 7, 2010, pages 539 - 550
JONES, D.H. ET AL.: "Regulation of cancer cell migration andbone metastasis by RANKL", NATURE, vol. 440, 2006, pages 692 - 6, XP055393185, DOI: doi:10.1038/nature04524
JOSHI, P.A. ET AL.: "Progesterone induces adult mammary stem cell expansion", NATURE
KIM, N.S. ET AL.: "Receptor activator of NF-kappaB ligand regulates the proliferation of mammary epithelial cells via Id2", MOL CELL BIOL, vol. 26, 2006, pages 1002 - 13
LACEY, D.L. ET AL.: "Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation", CELL, vol. 93, 1998, pages 165 - 76, XP002122920, DOI: doi:10.1016/S0092-8674(00)81569-X
LEE ET AL., BONE, vol. 48, no. 1, 2010, pages 88 - 95
LEIBBRANDT ET AL., EUROP. J. OF CLIN. INVEST., vol. 39, no. 10, 2009, pages 842 - 850
MOLYNEUX ET AL., J. CLIN. INVEST., vol. 120, no. 9, 2010, pages 3310 - 3325
PARK ET AL., J. KOREAN MED. SCI., vol. 18, no. 4, 2003, pages 541 - 546
PECE, S. ET AL.: "Biological and molecular heterogeneity of breast cancers correlates with their cancer stem cell content.", CELL, vol. 140, pages 62 - 73
ROBINSON, G.W., HENNIGHAUSEN, L.: "Inhibins and activins regulate mammary epithelial cell differentiation through mesenchymal-epithelial interactions", DEVELOPMENT, vol. 124, 1997, pages 2701 - 8
SHACKLETON, M. ET AL.: "Generation of a functional mammary gland from a single stem cell", NATURE, vol. 439, 2006, pages 84 - 8, XP002567665, DOI: doi:10.1038/nature04372
STINGL, J. ET AL.: "Purification and unique properties of mammary epithelial stem cells", NATURE, vol. 439, 2006, pages 993 - 7, XP002465395
TARUTANI, M. ET AL.: "Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins in skin development", PROC NATL ACAD SCI U S A, vol. 94, 1997, pages 7400 - 5, XP055075541, DOI: doi:10.1073/pnas.94.14.7400
TOMETSKO ET AL., BONE, vol. 47, 2010, pages 325 - 326
TOMETSKO ET AL., J. BONE AND MINERAL RES., vol. 21, 2006, pages 346
WU ET AL., J. BONE AND MINERAL RES., vol. 20, no. 1, 2005, pages 107 - 116
ZHANG ET AL., J. CLIN. INVEST., vol. 107, no. 10, 2001, pages 1235 - 1244

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2618833B1 (en) 2010-09-22 2018-05-02 IMBA-Institut für Molekulare Biotechnologie GmbH Breast cancer therapeutics
US11192952B2 (en) 2017-04-28 2021-12-07 Amgen Inc. Formulations comprising human anti-RANKL monoclonal antibodies, and methods of using the same
US11873343B2 (en) 2017-04-28 2024-01-16 Amgen Inc. Pharmaceutical formulations comprising anti-RANKL antibodies and an aromatic amino acid comprising a phenyl or an indole

Also Published As

Publication number Publication date
IL225442A0 (en) 2013-06-27
PH12013500543A1 (en) 2021-08-09
JP6133778B2 (ja) 2017-05-24
CL2013000801A1 (es) 2013-11-29
KR20130118870A (ko) 2013-10-30
EP2618833B1 (en) 2018-05-02
JP2013542190A (ja) 2013-11-21
AU2011306917A1 (en) 2013-04-04
WO2012038504A3 (en) 2012-06-21
MX2013003076A (es) 2013-07-29
EP2433644A1 (en) 2012-03-28
EP2618833A2 (en) 2013-07-31
CA2811556A1 (en) 2012-03-29
JP2017039771A (ja) 2017-02-23
US20130216550A1 (en) 2013-08-22
NZ608207A (en) 2014-08-29
US20190030161A1 (en) 2019-01-31
AU2011306917B2 (en) 2015-01-29
CN103384530A (zh) 2013-11-06
US10143747B2 (en) 2018-12-04
RU2013118325A (ru) 2014-10-27
BR112013006673A2 (pt) 2016-06-07

Similar Documents

Publication Publication Date Title
US10143747B2 (en) Breast cancer therapeutics
AU2011306918B2 (en) Breast cancer diagnostics
Wen et al. CGP57380 enhances efficacy of RAD001 in non-small cell lung cancer through abrogating mTOR inhibition-induced phosphorylation of eIF4E and activating mitochondrial apoptotic pathway
Wu et al. Effect of tumor suppressor gene PTEN on the resistance to cisplatin in human ovarian cancer cell lines and related mechanisms
CN104039343A (zh) 基于he4治疗恶性疾病
Furukawa et al. Antisense oligonucleotide targeting of insulin‐like growth factor‐1 receptor (IGF‐1R) in prostate cancer
Grinman et al. PTHrP induces STAT5 activation, secretory differentiation and accelerates mammary tumor development
Choi et al. Oral TGF-βR1 inhibitor Vactosertib promotes osteosarcoma regression by targeting tumor proliferation and enhancing anti-tumor immunity
JP6310470B2 (ja) 前立腺がんを処置するための方法
Souza et al. P-glycoprotein and survivin simultaneously regulate vincristine-induced apoptosis in chronic myeloid leukemia cells
Giordano et al. Complex Interplay Between Obesity and BRCA1/2‐Associated Breast Cancer: An Overview
ES2755933T3 (es) Tratamiento contra el cáncer usando un antagonista del receptor del factor de crecimiento insulínico (IGF) en combinación con exemestano y everolimus
González-Suárez RANKL inhibition: a promising novel strategy for breast cancer treatment
EP2334300A2 (en) Composition and method for treatment of preterm labor
KR20250113512A (ko) 카피바서팁 및 풀베스트란트를 이용한 암 치료
Montales et al. Metabolic history impacts mammary tumor epithelial hierarchy and early drug response in mice
Soloff et al. Sexual Dimorphism in Immunity and Metabolism: Unraveling the Impact on Response to Cancer Immunotherapy
US20140335077A1 (en) Compositions and Methods for the Treatment of Cancer Using IGF-IR Antagonists and MAPK/ERK Inhibitors
EP4534093A1 (en) Pharmaceutical composition for preventing or treating cancer, containing, as active ingredient, monocytes or macrophages in which expression or activity of cd244 is inhibited
US20240165078A1 (en) Therapeutic targeting of receptor tyrosine kinase inhibitor-induced androgen receptor phosphorylation in cancer
Ma et al. The Selective Estrogen Receptor Degrader ZN-c5 Has Broad Antitumor Activity in Wild-Type and Mutant ER-Positive Breast Cancer Models
AU2024272667A1 (en) Treatment of breast tissue
Escher The Role of Dysregulated IFNα Signaling in Promoting Aromatase Inhibitor-Resistance in ER+ Breast Cancer
JP2022523746A (ja) 去勢抵抗性前立腺がんを処置する方法
AU2013254254A1 (en) Methods and compositions for treating cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11758242

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2811556

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2013/003076

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2013529652

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 225442

Country of ref document: IL

Ref document number: 2011758242

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013000801

Country of ref document: CL

Ref document number: 13825655

Country of ref document: US

Ref document number: 12013500543

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2011306917

Country of ref document: AU

Date of ref document: 20110922

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20137009817

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013118325

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013006673

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013006673

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130322