WO2012019076A1 - Compositions et méthodes de traitement prophylactique ou thérapeutique d'une lésion d'ischémie/reperfusion cardiaque - Google Patents

Compositions et méthodes de traitement prophylactique ou thérapeutique d'une lésion d'ischémie/reperfusion cardiaque Download PDF

Info

Publication number
WO2012019076A1
WO2012019076A1 PCT/US2011/046704 US2011046704W WO2012019076A1 WO 2012019076 A1 WO2012019076 A1 WO 2012019076A1 US 2011046704 W US2011046704 W US 2011046704W WO 2012019076 A1 WO2012019076 A1 WO 2012019076A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
aryl
cycloalkyl
heterocyclyl
alkenyl
Prior art date
Application number
PCT/US2011/046704
Other languages
English (en)
Inventor
Andrew R. Marks
Alain Lacampagne
Jérémy FAUCONNIER
Original Assignee
The Trustees Of Columbia University In The City Of New York
Université Montpellier
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of Columbia University In The City Of New York, Université Montpellier filed Critical The Trustees Of Columbia University In The City Of New York
Publication of WO2012019076A1 publication Critical patent/WO2012019076A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/553—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having at least one nitrogen and one oxygen as ring hetero atoms, e.g. loxapine, staurosporine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/554—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having at least one nitrogen and one sulfur as ring hetero atoms, e.g. clothiapine, diltiazem
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis

Definitions

  • the invention relates to compositions and methods of preventing and treating cardiac ischemia/reperfusion injury.
  • a heart attack is usually caused by blockage of an artery. The heart muscle beyond the block is then deprived of oxygen and essential nutrients.
  • This ischemia (literally "lack of blood flow") leads to many damaging changes, including calcium buildup in cells, high levels of reactive oxygen species (“ROS”), buildup of waste products such as lactic acid, and general energy depletion.
  • ROS reactive oxygen species
  • ROS reactive oxygen species
  • These events may lead to cell death either by necrosis (i.e., directly from injury to the cells) or by apoptosis (i.e., from an energy dependent cell suicide process) and the formation of an infarct— a region of dead tissue. This process may be partially blocked by appropriate therapy.
  • Re-establishment of blood flow (reperfusion) and re-oxygenation of the affected area is critical to limit irreversible damage. However, reperfusion also brings potentially damaging consequences.
  • Ischemia/reperfusion (I/R) injury refers to damage to tissue caused when blood supply returns to the tissue after a period of ischemia.
  • the absence of oxygen and nutrients from blood creates a condition in which the restoration of circulation results in inflammation and oxidative damage through the induction of oxidative stress rather than restoration of normal function.
  • Cardiac I/R is characterized by arrhythmias, cardiomyocyte damage, inflammation, and, at the cellular level, disturbance of Ca 2+ and redox homeostasis.
  • TNF-a tumor necrosis factor a
  • TNFR1 TNF receptor 1
  • TNFR2 TNF receptor 2
  • TNF-a also has long-term beneficial effects due to the induction of cytoprotective genes involved in cellular growth, survival and proliferation, in response to pressure and volume overload.
  • TNF-a following myocardial injury may activate signaling pathways that promote either cardiac adaptation/protection, or maladaptive responses.
  • caspase-8 One of the early events in the TNF-a/TNFRl signaling pathways is activation of caspase-8. This is initiated by recruitment of the adaptor protein Fas-associated via a death domain (FADD), which then recruits pro-caspase 8 into the death inducing signaling complex (DISC).
  • FADD death domain
  • DISC death inducing signaling complex
  • Caspase-8 activation leads to the generation of ceramide, mitochondrial reactive oxygen species (ROS) production, Bid cleavage, followed by the Bax-dependent release of cytochrome c from mitochondria, and apoptosome formation, ultimately leading to activation of effectors caspases (i.e.
  • ROS mitochondrial reactive oxygen species
  • nitric oxide (NO) production through activation of the endothelial (eNOS), or increased expression of inducible nitric oxide synthase (iNOS) inhibits key apoptogenic signals triggered by TNF-a such as ceramide formation and caspase-8.
  • Increased ROS and/or NO-derived reactive species (RNS) change the redox environment of Ca 2+ transporters and channels, and thus affect cellular Ca 2+ cycling.
  • RyRs are channels in the sarcoplasmic reticulum (SR) that open and close to regulate the release of Ca 2+ from the SR into the intracellular cytoplasm of the cell.
  • the "open probability" (Po) of a RyR refers to the likelihood that the RyR channel is open at any given moment, and therefore capable of releasing Ca 2+ into the cytoplasm from the SR.
  • RyRl is found predominantly in skeletal muscle as well as other tissues
  • RyR2 is found predominantly in the heart as well as other tissues
  • RyR3 is found in the brain as well as other tissues.
  • the RyR channels are formed by four RyR polypeptides in association with four FK506 binding proteins (FKBPs), specifically FKBP12.0 (calstabinl) and FKBP12.6 (calstabin2).
  • FKBPs FK506 binding proteins
  • Calstabinl binds to RyRl
  • calstabin2 binds to RyR2
  • calstabinl binds to RyR3.
  • the FKBP proteins (calstabinl and calstabin2) bind to the RyR channel (one molecule per RyR subunit), stabilize RyR-channel functioning, and facilitate coupled gating between neighboring RyR channels, thereby preventing abnormal activation of the channel during the channel's closed state.
  • the cardiac ryanodine receptor (RyR2) which mediates sarcoplasmic reticulum (SR) Ca 2+ release during excitation-contraction coupling, contains about 33 free thiol residues rendering it highly sensitive to the cellular redox state. Cysteine oxidation facilitates RyR opening and SR Ca 2+ leak.
  • the present invention provides, inter alia, compositions and methods useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury. These compositions and methods involve modulation of the function of cardiac ryanodine receptors.
  • the present invention is based, in part, on the discovery that TNF-a-induced caspase-8 activation leads to leaky RyR2 channels that contribute to myocardial remodeling after I/R. More specifically, the applicants have shown that early caspase-8 activation increases mitochondrial ROS and NO production, resulting in S-nitrosylation of RyR2 and depletion of calstabin2 from the channel complex causing a diastolic SR Ca 2+ leak that leads to acute pathological left ventricular modeling, and that this can be reversed or prevented by stabilization of the RyR2 macromolecular complex with compounds of formula I as described herein.
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, I-b- 1 , 1-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II, or enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes, metabolites, or pro-drugs thereof, or any combination thereof.
  • the structures of these Formulae are provided in the Detailed Description that follows.
  • the present invention provides a method of treating or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound represented by the structure of Formula I-k as disclosed herein, or enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof, or any combination thereof.
  • the present invention provides a method of treating or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount a compound represented by the structure of Formula I-o as disclosed hereinor enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof, or any combination thereof.
  • the present invention provides a method of treating or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of the com ound SI 07 represented by the structure
  • a preferred salt is the hydrochloride salt (S107-HC1).
  • the present invention provides a method of treating or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of the compound S36 represented by the structure
  • a referred salt is the sodium salt (S36-Na) represented by the structure
  • the present invention provides a method of treating or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound represented by the structure of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, I-b- 1 , 1-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, 1-h-1, 1-i-1, or Formula II, or enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes, metabolites, or pro-drugs thereof, or any combination thereof.
  • the compound administered is selected from the group consisting of SI, S2, S3, S4, S5, S6, S7, S9, SI 1, S12, SI 3, S14, SI 9, S20, S22, S23, S24, S25, S26, S27, S36, S37, S38, S40, S43, S44, S45, S46, S47, S48, S49, S50, S51, S52, S53, S54, S55, S56, S57, S58, S59, S60, S61, S62, S63, S64, S66, S67, S68, S69, S70, S71, S72, S73, S74, S75, S76, S77, S78, S79, S80, S81, S82, S83, S84, S85, S86, S87, S88, S89, S90, S91, S92, S93, S94, S95, S96, S97, S98, S99, S100, S101, S
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound that decreases the open probability of the phosphorylated, and/or nitrosylated, and/or oxidized RyR2 channel under conditions that simulate low activating calcium levels.
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound that decreases Ca 2+ current through the phosphorylated, and/or nitrosylated, and/or oxidized RyR2 channel.
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound that decreases calcium leak through the phosphorylated, and/or nitrosylated, and/or oxidized RyR2 channel under conditions that simulate low activating calcium levels.
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound that increases the affinity with which calstabin 2 binds to the phosphorylated, and/or nitrosylated, and/or oxidized RyR2.
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound that decreases dissociation of calstabin 2 from the phosphorylated, and/or nitrosylated, and/or oxidized RyR2.
  • the present invention provides a method of treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof, comprising administering to the subject a therapeutically or prophylactically effective amount of a compound that increases rebinding of calstabin 2 to the phosphorylated, and/or nitrosylated, and/or oxidized RyR2.
  • the preferred compounds are those that are specifically described and defined by the formulae disclosed herein.
  • the subject to whom the compounds of the invention are administered is a mammal selected from the group consisting of primates, rodents, ovine species, bovine species, porcine species, equine species, feline species and canine species.
  • the subject is a human.
  • the compounds of the invention may be administered by any suitable route known in the art, without limitation.
  • compounds of the invention may be administered by a route selected from the group consisting of parenteral, enteral, intravenous, intraarterial, intracardiac, intra intrapericardial, intraosseal, intracutaneous, subcutaneous, intradermal, subdermal, transdermal, intrathecal, intramuscular, intraperitoneal, intrasternal,
  • parenchymatous oral, sublingual, buccal, rectal, vaginal, inhalational, and intranasal.
  • the compounds of the invention may be administered using a drug-releasing implant.
  • the compounds of the invention are administered to the subject at a dose sufficient to partially or completely restore binding of calstabin 2 to RyR2, or at a dose sufficient to enhance binding of calstabin 2 to RyR2.
  • the compounds of the invention are administered to the subject at a dose of from about 0.01 mg/kg/day to about 20 mg/kg/day, or more preferably still, at a dose of from about 0.05 mg/kg/day to about 1 mg/kg/day.
  • Other suitable dose ranges are provided in the Detailed Description and Examples.
  • one of skill in the art can select other suitable doses for administration.
  • the cardiac ischemia/reperfusion injury that is to be trested or prevented in the method of the invention is cardiac ischemia/reperfusion injury following coronary angioplasty or cardiac ischemia/reperfusion injury following thrombolysis during a
  • the invention provides use of a compound of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-a-1, I-b- 1 , I-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II, for preparation of a medicament for treating or preventing treating and/or preventing cardiac ischemia/reperfusion injury in a subject in need thereof. All compounds disclosed herein are expected to be useful for treating or preventing cardiac ischemia/reperfusion injury in a subject in need thereof.
  • FIGS 1A-G show effect of TNF-a and caspase-8 activation on RyR2 function in vitro.
  • FIGS. 2A-I show roles of caspase-8 and RyR2 leak in myocardial reperfusion injury.
  • Figures 3A-C show left ventricular remodeling 15 days after reperfusion.
  • Figures 4A-E show the diastolic SR Ca2+ leak via RyR2 channels after
  • ischemia/reperfusion contributes to the cardiac remodeling process.
  • FIGS 5A-C show effect of TNF-a and caspase-8 activation in cardiomyocytes.
  • Figures 6A-E show effects of acute TNF-a incubation (10 ng/ml; lh) on Ca 2+ transients recorded in fluo-4 AM-loaded intact cardiomyocytes by laser scanning confocal microscopy, in presence of the different caspases inhibitors, the anti-oxidant (NAC) or SI 07.
  • NAC anti-oxidant
  • Figure 7 shows Bid cleavage assessed by Western blot analysis in sham and I/R hearts after 1 , 6 and 24 hours of reperfusion.
  • Figure 8 shows representative sections (Top) of TTC-stained hearts.
  • Figures 9A-B show effect of ischemia reperfusion on calstabin2 KO mice.
  • Figures lOA-C show effects of TNF-a in WT mice in vivo.
  • Figures 11A-D show Ca 2+ transients recorded in fluo-4 AM-loaded intact
  • cardiomyocytes by laser scanning confocal microscopy after 15 days of reperfusion in an in vivo model of ischemia-reperfusion.
  • Figure 12 shows representative cardiac RyR2 immunoprecipitation and immunoblots showing the level of PKA phosphorylation level at S2808.
  • rycal compounds refers to compounds of the general Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, 1-b-1, I-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II, as provided by the invention, and herein referred to as "compound(s) of the invention".
  • the compounds of the invention are referred using a numerical naming system, with compound numbers 1 to 477 provided herein. These numbered compounds are referred to using either the prefix "S.” Thus, the first numbered compound is referred to either as “SI”, the second numbered compound is referred to as either “S2”, the third numbered compound is referred to as either "S3”, and so on.
  • S nomenclature systems are used interchangeably throughout the specification, the drawings, and the claims to indicate the specific compounds that are shown by their structures in the Detailed Description.
  • alkyl refers to a linear or branched, saturated hydrocarbon and preferably one having from 1 to 6 carbon atoms.
  • Representative alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, and neohexyl.
  • C1-C4 alkyl refers to a straight or branched chain alkane (hydrocarbon) radical containing from 1 to 4 carbon atoms, such as methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, and isobutyl.
  • alkenyl refers to a linear or branched hydrocarbon and preferably one having from 2 to 6 carbon atoms and having at least one carbon-carbon double bond. In one embodiment, the alkenyl has one or two double bonds. The double bond may exist as the E or Z isomers and the compounds of the present invention include both isomers.
  • alkynyl refers to a linear or branched hydrocarbon and preferably one having from 2 to 6 carbon atoms and having at least one carbon-carbon triple bond.
  • aryl refers to an aromatic group and preferably one containing 1 to 3 aromatic rings, either fused or linked.
  • An example of an aryl group is a phenyl group.
  • cyclic group as used herein includes a cycloalkyl group and a heterocyclic group.
  • cycloalkyl group refers to a three- to seven-membered saturated or partially unsaturated carbon ring. Any suitable ring position of the cycloalkyl group may be covalently linked to the defined chemical structure. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.
  • halogen refers to fluorine, chlorine, bromine, and iodine.
  • heterocyclic group or “heterocyclic” or “heterocyclyl” or “heterocyclo” as used herein refers to fully saturated, or partially or fully unsaturated, including aromatic (i.e., “heteroaryl”) cyclic groups (for example, 4 to 7 membered monocyclic, 7 to 11 membered bicyclic, or 10 to 16 membered tricyclic ring systems) which have at least one heteroatom in at least one carbon atom-containing ring.
  • aromatic i.e., "heteroaryl”
  • Each ring of the heterocyclic group containing a heteroatom may have 1, 2, 3, or 4 heteroatoms selected from nitrogen atoms, oxygen atoms and/or sulfur atoms, where the nitrogen and sulfur heteroatoms may optionally be oxidized and the nitrogen heteroatoms may optionally be quatemized.
  • the heterocyclic group may be attached to the remainder of the molecule at any heteroatom or carbon atom of the ring or ring system.
  • heterocyclic groups include, but are not limited to, azepanyl, azetidinyl, aziridinyl, dioxolanyl, furanyl, furazanyl, homo piperazinyl, imidazolidinyl, imidazolinyl, isothiazolyl, isoxazolyl, morpholinyl, oxadiazolyl, oxazolidinyl, oxazolyl, oxazolidinyl, pyrimidinyl, phenanthridinyl, phenanthrolinyl, piperazinyl, piperidinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridooxazolyl, pyridoimidazolyl, pyridothiazolyl, pyridinyl, pyrimidinyl,
  • bicyclic heterocyclic groups include indolyl, isoindolyl, benzothiazolyl, benzoxazolyl,
  • benzoxadiazolyl benzothienyl, quinuclidinyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuryl, benzofurazanyl, chromonyl, coumarinyl, benzopyranyl, cinnolinyl, quinoxalinyl, indazolyl, pyrrolopyridyl, furopyridinyl (such as furo[2,3-c]pyridinyl, furo[3,2-b]pyridinyl] or furo[2,3-b]pyridinyl), dihydroisoindolyl, dihydroquinazolinyl (such as 3,4-dihydro-4-oxo-quinazolinyl),
  • triazinylazepinyl tetrahydroquinolinyl and the like.
  • tricyclic heterocyclic groups include carbazolyl, benzidolyl, phenanthrolinyl, acridinyl, phenanthridinyl, xanthenyl and the like.
  • phenyl as used herein includes a substituted or unsubstituted phenyl group.
  • alkyl alkenyl
  • alkynyl alkynyl
  • aryl alkenyl
  • aryl acyl
  • phenyl cyclic group
  • cycloalkyl heterocyclyl
  • heterocyclo heterocyclo
  • heterocycle substituents
  • groups such as alkyl, cycloalkyl, alkenyl, alkynyl, cycloalkenyl, alkylaryl, heteroaryl, heterocycle and aryl can themselves be optionally substituted.
  • Representative substituents may further optionally include at least one labeling group, such as a fluorescent, a bioluminescent, a chemiluminescent, a colorimetric or a radioactive labeling group.
  • a fluorescent labeling group can be selected from bodipy, dansyl, fluorescein, rhodamine, Texas red, cyanine dyes, pyrene, coumarins, Cascade BlueTM, Pacific Blue, Marina Blue, Oregon Green, 4',6-Diamidino-2-phenylindole (DAPI), indopyra dyes, lucifer yellow, propidium iodide, porphyrins, arginine, and variants and derivatives thereof.
  • DAPI 6-Diamidino-2-phenylindole
  • SI 18 of the present invention contains a labeling group BODIPY, which is a family of fiuorophores based on the 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene moiety.
  • BODIPY is a family of fiuorophores based on the 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene moiety.
  • fluorescent label moieties and fluorescence techniques see, e.g., Handbook of Fluorescent Probes and Research Chemicals, by Richard P. Haughland, Sixth Edition, Molecular Probes, (1996), which is hereby incorporated by reference in its entirety.
  • One of skill in the art can readily select a suitable labeling group, and conjugate such a labeling group to any of the compounds of the invention, without undue experimentation.
  • quaternary nitrogen refers to a tetravalent positively charged nitrogen atom including, for example, the positively charged nitrogen in a tetraalkylammonium group (e.g., tetramethylammonium, N-methylpyridinium), the positively charged nitrogen in protonated ammonium species (e.g., trimethyl-hydroammonium, N-hydropyridinium), the positively charged nitrogen in amine N-oxides (e.g., N-methyl-morpholine-N-oxide, pyridine-N-oxide), and the positively charged nitrogen in an N-amino-ammonium group (e.g., N- aminopyridinium) .
  • a tetraalkylammonium group e.g., tetramethylammonium, N-methylpyridinium
  • protonated ammonium species e.g., trimethyl-hydroammonium, N-hydropyridinium
  • benzothiazepine ring of compounds of the present invention may optionally be a quaternary nitrogen to form, e.g., ammonium derivatives (N(R) 4 wherein R is alkyl, aryl, etc.) or
  • N-oxides include SI 13 and SI 19.
  • the compounds described herein may exist in their tautomeric form (for example, as an amide or imino ether). All such tautomeric forms are contemplated herein as part of the present invention.
  • prodrug denotes a compound that, upon administration to a subject, undergoes chemical conversion by metabolic or chemical processes to yield compounds of the present invention.
  • an ester may be a prodrug of the corresponding carboxylic acid.
  • compound(s) of the invention means a compound of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-a-1, I-b- 1 , I-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II, or any of the specific chemical compounds described herein, and salts, hydrates, complexes, metabolites, prodrugs and solvates thereof, or any combination thereof, such as may be used for the treatment or prevention of cardiac ischemia/reperfusion injury.
  • a “pharmaceutical composition” refers to a mixture of one or more of the compounds described herein, or pharmaceutically acceptable salts, hydrates or pro-drugs thereof, with other chemical components, such as physiologically acceptable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism or subject.
  • pro-drug refers to an agent which is converted into the parent drug in vivo. Prodrugs are often useful because, in some situations, they are easier to administer than the parent drug. They are bioavailable, for instance, by oral administration whereas the parent drug is not. The pro-drug also has improved solubility in pharmaceutical compositions over the parent drug.
  • the compound carries protective groups which are split off by hydrolysis in body fluids, e.g., in the bloodstream, thus releasing active compound or is oxidized or reduced in body fluids to release the compound.
  • a compound of the present invention also can be formulated as a pharmaceutically acceptable salt, e.g., acid addition salt, and complexes thereof.
  • a pharmaceutically acceptable salt e.g., acid addition salt, and complexes thereof.
  • the preparation of such salts can facilitate the pharmacological use by altering the physical characteristics of the agent without preventing its physiological effect. Examples of useful alterations in physical properties include, but are not limited to, lowering the melting point to facilitate transmucosal administration and increasing the solubility to facilitate administering higher concentrations of the drug.
  • salts means a salt that is suitable for, or compatible with, the treatment of a patient or a subject such as a human patient.
  • the salts can be any non-toxic organic or inorganic salt of any of the compounds represented by Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, 1-b-1, 1-c-1, 1-d-1, I-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II or any of the specific compounds described herein, or any of their intermediates.
  • Illustrative salt-forming ions include, but are not limited to, ammonium (NH 4 ), calcium (Ca ), iron (Fe and Fe ), magnesium (Mg ), potassium (K + ), pyridinium (C 5 H 5 NH + ), quaternary ammonium (NR 4 + ), sodium (Na + ), acetate, carbonate, chloride, bromide, citrate, cyanide, hydroxide, nitrate, nitrite, oxide, phosphate, sulfate, maleate, fumarate, lactate, tartrate, gluconate, besylate, and valproate.
  • Illustrative inorganic acids that form suitable salts include, but are not limited to, hydrochloric, hydrobromic, sulfuric and phosphoric acids, as well as metal salts such as sodium monohydrogen
  • organic acids that form suitable acid addition salts include, but are not limited to, mono-, di-, and tricarboxylic acids such as glycolic, lactic, pyruvic, malonic, succinic, glutaric, fumaric, malic, tartaric, citric, ascorbic, maleic, benzoic, phenylacetic, cinnamic and salicylic acids, as well as sulfonic acids such as p-toluene sulfonic and methanesulfonic acids.
  • Either mono or di-acid salts can be formed, and such salts exist in either a hydrated, solvated or substantially anhydrous form.
  • the acid addition salts of compounds of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, I-b- 1 , 1-c-1, I-d- 1 , I-e-1, 1-f-1, 1-g-1, I-h- 1 , 1-i-1, or Formula II are more soluble in water and various hydrophilic organic solvents, and generally demonstrate higher melting points in comparison to their free base forms.
  • the selection of an appropriate salt can be performed by one skilled in the art.
  • salts in reference to "Handbook of Pharmaceutical Salts : Properties, Selection, and Use” by P. Heinrich Stahl and Camille G. Wermuth, or Berge (1977) "Pharmaceutcial Salts” J. Pharm Sci., Vol 66(1), p 1-19.
  • Other non-pharmaceutically acceptable salts e.g., oxalates
  • a compound of the present invention when a compound of the present invention is a racemate, the racemate can be separated into the (S)-compound and (R)-compound by optical resolution.
  • Individual optical isomers and mixtures thereof are included in the scope of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1 , I-b- 1 , I-c-1 , 1-d-1 , 1-e-1 , I-f- 1 , 1-g-1 , 1-h-1 , I-i-1 , or Formula II.
  • solvate means a compound of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1 , 1-b-1 , I-c-1 , 1-d-1 , 1-e-1 , I-f- 1 , I-g-1 , I-h- 1 , I-i-1 , or Formula II, or a pharmaceutically acceptable salt thereof, wherein molecules of a suitable solvent are incorporated in the crystal lattice.
  • a suitable solvent is physiologically tolerable at the dosage administered. Examples of suitable solvents are ethanol, water and the like. When water is the solvent, the molecule is referred to as a "hydrate.”
  • an “effective amount,” “sufficient amount,” “therapeutically effective amount,” or “prophylactically effective amount” of an agent or compounds, as used herein, refer to amounts sufficient to effect the beneficial or desired results, including clinical results and, as such, the actual “amount” intended will depend upon the context in which it is being applied, such as whether the desired clinical outcome is prevention or treatment.
  • the term "effective amount” also includes that amount of the compound of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1 , 1-b-1 , I-c-1 , 1-d-1 , 1-e-1 , I-f- 1 , I-g-1 , I-h- 1 , I-i-1 , or Formula II, which is "therapeutically effective” or “prophylactically effective” and which avoids or substantially attenuates undesirable side effects.
  • treatment is an approach for obtaining beneficial or desired results, including clinical results.
  • beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state and remission (whether partial or total), whether detectable or undetectable.
  • Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment. Unless otherwise stated, the term “treatment” should be construed as encompassing preventive and therapeutic methods.
  • animal refers to all members of the animal kingdom including, but not limited to, mammals, animals (e.g. , cats, dogs, horses, etc.) and humans.
  • All stereoisomers of the compounds of the present invention are contemplated within the scope of this invention.
  • Individual stereoisomers of the compounds of the invention may, for example, be substantially free of other isomers (e.g., as a pure or substantially pure optical isomer having a specified activity), or may be admixed, for example, as racemates or with all other, or other selected,
  • the chiral centers of the present invention may have the S or R configuration as defined by the IUPAC 1974 Recommendations.
  • the racemic forms can be resolved by physical methods, such as, for example, fractional crystallization, separation or crystallization of diastereomeric derivatives or separation by chiral column chromatography.
  • the individual optical isomers can be obtained from the racemates by any suitable method, including without limitation, conventional methods, such as, for example, salt formation with an optically active acid followed by crystallization.
  • Compounds of the present invention are, subsequent to their preparation, preferably isolated and purified to obtain a composition containing an amount by weight equal to or greater than 99% of the compound ("substantially pure” compound), which is then used or formulated as described herein. Such “substantially pure” compounds of the present invention are also contemplated herein as part of the present invention.
  • Q-LETD-OPh refers to "N a -Quinoline-2-carbonyl-Leu-Glu-Thr- Asp(OMe)-Difluorophenoxymethylketone.”
  • Z-IETD-FMK refers to
  • Z-DEVD-FMK refers to "Benzyloxycarbonyl-Asp(OMe)-Glu(OMe)-Val-Asp(OMe)- Fluoromethylketone.”
  • Q-VD-OPh refers to "Quinoline-carbonyl-Val-Asp- Difluorophenoxymethylketone .
  • the present invention provides compositions and methods that are useful for treating and/or preventing cardiac ischemia/reperfusion injury. More particularly, the present invention provides compositions comprising the compounds described herein, and methods of treatment and/or prevention comprising administration of these compositions to subjects suffering from, or at risk of developing cardiac
  • compositions and methods of the present invention may be used preventively in subjects who are not yet suffering from cardiac ischemia/reperfusion injury, but whom exhibit one or more "risk factors" for cardiac ischemia or are otherwise predisposed to the development of cardiac ischemia, for example, aged individuals, those at risk of ischemic heart disease, and those undergoing clinical procedures involving transient periods of myocardial hypoxia.
  • cardiac ischemia/reperfusion injury is when blood flow to an ischemic part of the body is restored by surgery, e.g. a bypass of a heart.
  • Another specific example of potential cardiac ischemia/reperfusion injury is heart transplantation.
  • the heart to be transplanted is removed from the donor (ischemic period) and transplanted into the recipient (reperfusion period).
  • the compositon of the present invention can be given to the recipient to decrease ischemia/reperfusion effects in the body, as well as to be used for fluids to preserve the heart tissue before being transplanted into the recipient.
  • the cardiac output is acoustic or acoustic or acoustic or acous.
  • ischemia/reperfusion injury that is to be treated or prevented in the method of the invention is cardiac ischemia/reperfusion injury following coronary angioplasty or cardiac
  • compositions described herein are administered therapeutically or prophylactically to subjects who are suffering from, or at risk of developing cardiac ischemia/reperfusion injury.
  • a subject may be any animal that is suffering from, or at risk of developing cardiac ischemia/reperfusion injury.
  • a subject may be any animal that is suffering from, or at risk of developing cardiac ischemia/reperfusion injury.
  • the subject is a mammal.
  • mammals that may be treated using the methods and compositions of the invention include, but are not limited to, primates, rodents, ovine species, bovine species, porcine species, equine species, feline species and canine species.
  • the subjects are human.
  • the "subjects" of the present invention may also be in vitro or in vivo systems, including, without limitation, isolated or cultured cells or tissues, in vitro assay systems.
  • compositions for preparing and/or preparing the compounds described herein may be formulated into compositions for preparing and/or preparing the compounds described herein.
  • compositions comprise one or more of the benzothiazepine, benzoxazepine, benzodiazepine and benzazepine compounds described herein (such as the compounds of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, 1-b-1, I-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II), in admixture with a
  • compositions suitable for administration can readily formulate the compounds of the invention into compositions suitable for administration to subjects, such as human subjects, for example using the teaching a standard text such as Remington's Pharmaceutical Sciences, 18th ed, (Mack Publishing Company: Easton, Pa., 1990), pp. 1635-36), and by taking into account the selected route of delivery.
  • diluents and/or carriers and/or other additives that may be included in the compostions of the invention include, but are not limited to, water, glycols, oils, alcohols, aqueous solvents, organic solvents, DMSO, saline solutions, physiological buffer solutions, peptide carriers, starches, sugars, preservatives, antioxidants, coloring agents, pH buffering agents, granulating agents, lubricants, binders, disintegrating agents, emulsifiers, binders, excipients, extenders, glidants, solubilizers, stabilizers, surface active agents, suspending agents, tonicity agents, viscosity-altering agents, carboxymethyl cellulose, crystalline cellulose, glycerin, gum arabic, lactose, magnesium stearate, methyl cellulose, powders, saline, sodium alginate.
  • diluents and/or carriers and/or other additives used can be varied taking into account the nature of the active agents used (for example the solubility and stability of the active agents), the route of delivery (e.g. oral, parenteral, etc.), whether the agents are to be delivered over an extended period (such as from a controlled- release capsule), whether the agents are to be co-administered with other agents, and various other factors.
  • the route of delivery e.g. oral, parenteral, etc.
  • an extended period such as from a controlled- release capsule
  • agents are to be co-administered with other agents
  • the compounds of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, I-l, I-m, I-n, I-o, I-p, I-a-1, I-b- 1 , 1-c-1, I-d- 1 , I-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II, may be administered to the subject (or contacted with cells of the subject) in an amount effective to treat and/or prevent cardiac
  • ischemia/reperfusion injury and/or in an amount effective to reduce calcium "leak” through the RyR, and/or in an amount effective to reduce the calcium current through the RyR, and/or in an amount effective to stabilize gating of the RyR, and/or in amount effective to increase the binding of calstabin to the RyR complex in the subject, and/or in amount effective to reverse a malfunction of a RyR in the subject, particularly in the cardiac cells of the subject.
  • an effective amount of the agents of the invention to be administered to a subject taking into account whether the agent is being used prophylactically or therapeutically, and taking into account other factors such as the age, weight and sex of the subject, any other drugs that the subject may be taking, any allergies or contraindications that the subject may have, and the like.
  • an effective amount can be determined by the skilled artisan using known procedures, including analysis of titration curves established in vitro or in vivo.
  • the desired subject is a human
  • one of skill in the art can determine the effective dose from performing pilot experiments in suitable animal model species and scaling the doses up or down depending on the subjects weight etc.
  • Effective amounts can also be determined by performing clinical trials in individuals of the same species as the subject, for example starting at a low dose and gradually increasing the dose and monitoring the effects on cardiac ischemia/reperfusion injury. Appropriate dosing regimens can also be determined by one of skill in the art without undue experimentation, in order to determine, for example, whether to administer the agent in one single dose or in multiple doses, and in the case of multiple doses, to determine an effective interval between doses.
  • an effective amount of the compounds of the invention to administer to a subject ranges from about 0.01 mg/kg/day to about 20 mg/kg/day, and/or is an amount sufficient to achieve plasma levels ranging from about 300 ng/ml to about 1000 ng/ml.
  • the amount of compounds from the invention ranges from about 5 mg/kg/day to about 20 mg/kg/day.
  • from about 10 mg/kg/day to about 20 mg/kg/day is administered.
  • from about 0.01 mg/kg/day to about 10 mg/kg/day is administered.
  • from about 0.01 mg/kg/day to about 5 mg/kg/day is administered.
  • from about 0.05 mg/kg/day to about 5 mg/kg/day is administered.
  • preferred embodiment, from about 0.05 mg/kg/day to about 1 mg/kg/day is administered.
  • compositions described herein may be administered to a subject by any suitable method that allows the agent to exert its effect on the subject in vivo.
  • the compositions may be administered to the subject by known procedures including, but not limitated to, by oral administration, sublingual or buccal administration, parenteral
  • the compounds of the invention may be administered parenterally, or by epifascial, intracapsular, intracutaneous, subcutaneous, intradermal, intrathecal, intramuscular, intraperitoneal, intrasternal, intravascular, intravenous,
  • parenchymatous, or sublingual delivery Delivery may be by injection, infusion, catheter delivery, or some other means, such as by tablet or spray.
  • the agent is adiminstered to the subject by way of delivery directly to the heart tissue, such as by way of a catheter inserted into, or in the proximity of the subject's heart, or by using delivery vehicles capable of targeting the drug to the heart.
  • the compounds of the invention may be conjugated to or administered in conjunction with an agent that is targeted to the heart, such as an antibody or antibody fragment.
  • a formulation of the compounds of the invention may be presented as capsules, tablets, powders, granules, or as a suspension or solution.
  • the formulation may contain conventional additives, such as lactose, mannitol, cornstarch or potato starch, binders, crystalline cellulose, cellulose derivatives, acacia, cornstarch, gelatins, disintegrators, potato starch, sodium carboxymethylcellulose, dibasic calcium phosphate, anhydrous or sodium starch glycolate, lubricants, and/or or magnesium stearate.
  • the compounds of the invention may be combined with a sterile aqueous solution that is isotonic with the blood of the subject.
  • a sterile aqueous solution that is isotonic with the blood of the subject.
  • Such a formulation may be prepared by dissolving the active ingredient in water containing physiologically-compatible substances, such as sodium chloride, glycine and the like, and having a buffered pH compatible with physiological conditions, so as to produce an aqueous solution, then rendering the solution sterile.
  • the formulation may be presented in unit or multi-dose containers, such as sealed ampoules or vials.
  • the formulation may be delivered by injection, infusion, or other means known in the art.
  • the compounds of the invention may be combined with skin penetration enhancers, such as propylene glycol, polyethylene glycol, isopropanol, ethanol, oleic acid, N-methylpyrrolidone and the like, which increase the permeability of the skin to the compounds of the invention and permit the compounds to penetrate through the skin and into the bloodstream.
  • skin penetration enhancers such as propylene glycol, polyethylene glycol, isopropanol, ethanol, oleic acid, N-methylpyrrolidone and the like, which increase the permeability of the skin to the compounds of the invention and permit the compounds to penetrate through the skin and into the bloodstream.
  • compositions also may be further combined with a polymeric substance, such as ethylcellulose, hydroxypropyl cellulose, ethylene/vinylacetate, polyvinyl pyrrolidone, and the like, to provide the composition in gel form, which are dissolved in a solvent, such as methylene chloride, evaporated to the desired viscosity and then applied to backing material to provide a patch.
  • a polymeric substance such as ethylcellulose, hydroxypropyl cellulose, ethylene/vinylacetate, polyvinyl pyrrolidone, and the like
  • the composition is in unit dose form such as a tablet, capsule or single-dose injection or infusion vial.
  • the agents described herein may be used in combination with other agents useful for the treatment of cardiac ischemia/reperfusion injury or with other agents that ameliorate the effect of certain risk factors for cardiac ischemia/reperfusion injury.
  • the agents of the invention may be delivered to a subject as part of a composition containing one or more additional active agents.
  • the agents of the invention may be delivered to a subject as part of a composition containing one or more additional active agents.
  • the agents of the invention may be delivered to a subject in a composition or formulation containing only that active agent, while one or more other agents useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury may also be administered to the subject in one or more separate compositions or formulations.
  • agents of the invention and the other agents useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury may be administered to the subject at the same time, or at different times.
  • the agents of the invention and the other agents may be administered within minutes, hours, days, weeks, or months of each other, for example as part of the overall treatment regimen of a subject.
  • ischemia/reperfusion injury may be used in combination with the other agents that include, but are not limited to, ⁇ -adrenergic blockers, calcium channel blockers and anti-arrhythmic drugs.
  • a compound of the invention is
  • a compound of the invention is administered during percutaneous coronary intervention (PCI).
  • PCI percutaneous coronary intervention
  • the use of percutaneous coronary intervention as a therapy to abort a myocardial infarction is known as primary PCI.
  • the goal of primary PCI is to open the artery as soon as possible, and preferably within 90 minutes of the patient presenting to the emergency room.
  • Primary PCI involves performing a coronary angiogram to determine the anatomical location of the infarcting vessel, followed by balloon angioplasty (and frequently deployment of an intracoronary stent) of the thrombosed arterial segment.
  • the compound of the invention may be provided on the stent in a conventional manner, such as by coating.
  • the present compounds are expected to prevent the ischemia/reperfusion injury, have a high sustained patency rate, are easily and rapidly administered, and have no antigenicity or adverse hemodynamic effects, or no known clinically significant drug interactions.
  • a compound of the invention is administered during bypass surgery.
  • Emergency bypass surgery for the treatment of an acute myocardial infarction (MI) is less common than PCI or medical management.
  • Emergency coronary artery bypass graft surgery (CABG) is usually undertaken to simultaneously treat a mechanical complication, such as a ruptured papillary muscle, or a ventricular septal defect, with ensueing cardiogenic shock.
  • the administration of a compounds of the invention in connection with this treatment is expected to lead to optimal results.
  • the heart is stopped during surgery and the blood is circulated mechanically.
  • the compound can be administered by adding an appropriate dosage into the recirculated blood or by directly administering the compound in a suitable solution into the heart or open blood vessel.
  • the present invention is directed to methods for identifying additional compounds that may be useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury.
  • Such methods may be based on, inter alia, identifying compounds that increase binding of calstabins to RyRs, and/or decrease the calcium current through RyR channels, and the like. Examples of suitable assays and screening methods that may be used to identify new compounds that may be useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury are described in U.S.
  • the present invention encompasses compounds useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury, and methods of treatment and/or prevention comprising administration of such compounds, or compositions containing such compounds, to subjects who are suffering from, or who are at risk of developing, cardiac
  • the compounds of the invention indirectly decrease the open probability of RyR when examined under conditions that simulate diastole, by inhibiting the depletion of the stabilizing subunit calstabin2 from the RyR2 complex and thereby stabilizing the closed state of the channel, particularly protein kinase A (PKA) phosphorylated, and/or nityrosylated, and/or oxidized RyR, and thereby decrease the Ca 2+ current through such channels under resting conditions when muscles are relaxed.
  • PKA protein kinase A
  • the compounds of the invention exert this effect, at least in part, by increasing the affinity with which calstabin proteins bind to RyRs, and/or by inhibiting a decrease in binding of calstabins to RyRs, and/or by inhibiting dissociation of calstabins from RyRs, particularly PKA phosphorylated RyRs.
  • the compounds of the invention decrease the open probability of RyR and decrease the "leak" of Ca 2+ through such channels by stabilizing the closed state of the channel without blocking the channel pore.
  • the present invention relates to use of benzothiazepine, benzoxazepine,
  • the present invention provides benzothiazepine, benzoxazepine, benzodiazepine and benzazepine compounds as described by the chemical Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1, I-b- 1 , 1-c-1, I-d- 1 , 1-e-1, I-f- 1 , 1-g-1, I-h- 1 , I-i- 1 , or Formula II, as described below.
  • the present invention provides methods for the treatment and/or prevention of cardiac ischemia/reperfusion injury that comprise administering compounds of Formula I to subjects in need thereof.
  • the present invention provides compositions useful for the treatment and/or prevention of cardiac ischemia/reperfusion injury that comprise compounds of Formula I.
  • the structure of Formula I is as follows:
  • n 0, 1, or 2;
  • q 0, 1, 2, 3, or 4;
  • (hetero-)arylamino wherein each acyl, -O-acyl, alkyl, alkoxyl, alkylamino, alkylarylamino, alkylthio, cycloalkyl, alkylaryl, aryl, heteroaryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino may be optionally substituted; Ri is selected from the group consisting of H, oxo, alkyl, alkenyl, aryl, alkylaryl, cycloalkyl, heteroaryl, and heterocyclyl; wherein each alkyl, alkenyl, aryl, alkylaryl, cycloalkyl, heteroaryl, and heterocyclyl may be optionally substituted;
  • R4 is selected from the group consisting of H, alkyl, alkenyl, aryl, alkylaryl, cycloalkyl, heteroaryl, and heterocyclyl; wherein each alkyl, alkenyl, aryl, alkylaryl, cycloalkyl, heteroaryl, and heterocyclyl may be optionally substituted;
  • Re is selected from the group consisting of -OR15, -NHNR15R16, -NHOH, -NR15R16, -CH 2 X, acyl, alkenyl, alkyl, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkyl, aryl, alkylaryl, cycloalkyl,
  • cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl may be optionally substituted
  • R 7 is selected from the group consisting of -OR15, -NR15R16, -NHNR15R16, -NHOH, -CH 2 X, alkyl, alkenyl, alkynyl, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, alkenyl, alkynyl, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl may be optionally substituted;
  • Rg and R9 independently are selected from the group consisting of OH, acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl may be optionally substituted;
  • R 11 , Ri 2 , Ri 3 , and R 14 independently are selected from the group consisting of H, OH, NH 2 , -NHNH 2 , -NHOH, acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl,
  • heterocyclyl, and heterocyclylalkyl may be optionally substituted
  • Ri 5 and Ri 6 independently are selected from the group consisting of H, acyl, alkenyl, alkoxyl, OH, NH 2 , alkyl, alkylamino, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, alkylaryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclylalkyl may be optionally substituted; and optionally Ri 5 and Ri 6 together with the N to which they are bonded may form a heterocycle which may be substituted;
  • the nitrogen in the benzothiazepine ring may optionally be a quaternary nitrogen; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes, and prodrugs thereof.
  • Examples of compounds that may be used in conjunction with the invention include, without limitation, SI, S2, S3, S4, S5, S6, S7, S9, SI 1, S12, SI 3, S14, SI 9, S20, S22, S23, S24, S25, S26, S27, S36, S37, S38, S40, S43, S44, S45, S46, S47, S48, S49, S50, S51, S52, S53, S54, S55, S56, S57, S58, S59, S60, S61, S62, S63, S64, S66, S67, S68, S69, S70, S71, S72, S73, S74, S75, S76, S77, S78, S79, S80, S81, S82, S83, S84, S85, S86, S87, S88, S89, S90, S91, S92, S93, S94, S95, S96, S97, S98, S99, S100, S101,
  • the present invention provides methods and uses which comprise administering compounds of Formula I-a':
  • n 0, 1 , or 2;
  • Re is selected from the group consisting of -OR15, -NHNR15R16, -NHOH, -NR15R16, -CH 2 X, acyl, alkenyl, alkyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • R 7 is selected from the group consisting of H, -OR15, -NR 15 R 16 , -NHNR15R16, -NHOH, -CH 2 X, alkyl, akenyl, alkynyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and
  • heterocyclylalkyl wherein each alkyl, akenyl, alkynyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • Rg and R9 independently are selected from the group consisting of -OH, acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl;
  • each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • R 11 , R 12 , Ri 3 , and Ri 4 independently are selected from the group consisting of H, OH, NH 2 , -NHNH 2 , -NHOH, acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • X is selected from the group consisting of halogen, -CN, -C0 2 Ris, -NRi 5 Ri 6 ,
  • Ri5 and Ri 6 independently are selected from the group consisting of H, acyl, alkenyl, alkoxyl, OH, NH 2 , alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and
  • heterocyclylalkyl wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted; and optionally R15 and R1 ⁇ 2 together with the N to which they are bonded may form a heterocycle which may be substituted or unsubstituted;
  • the nitrogen in the benzothiazepine ring may be optionally a quaternary nitrogen; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes, and prodrugs thereof.
  • the present invention provides methods and uses which comprise administering compounds of Formula I-a:
  • n 0, 1, or 2;
  • q 0, 1, 2, 3, or 4;
  • Re is selected from the group consisting of -ORi 5 , -NHNR15R16, -NHOH, -NR15R16, -CH 2 X, acyl, alkenyl, alkyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • R 7 is selected from the group consisting of H, -OR15, -NR15R16, -NHNR15R16, -NHOH, -CH 2 X, alkyl, akenyl, alkynyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, akenyl, alkynyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • Rg and R9 independently are selected from the group consisting of -OH, acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl;
  • each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • R 11 , R 12 , Ri 3 , and R 14 independently are selected from the group consisting of H, OH, NH 2 , -NHNH 2 , -NHOH, acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • Ri 5 and Ri 6 independently are selected from the group consisting of H, acyl, alkenyl, alkoxyl, OH, NH 2 , alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and
  • heterocyclylalkyl wherein each acyl, alkenyl, alkoxyl, alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted; and optionally R 15 and R1 ⁇ 2 together with the N to which they are bonded may form a heterocycle which may be substituted or unsubstituted;
  • the nitrogen in the benzothiazepine ring may be optionally a quaternary nitrogen; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes, and prodrugs thereof.
  • n 0, 1, or 2.
  • the present invention provides methods and uses which comprise administering com ounds of formula I-b:
  • R 2 and n are as defined in compounds of formula I-a above;
  • R is H or OMe
  • R" is H.
  • the present invention provides methods and uses which comprise administering compounds formula of I-c:
  • each R, R 7 , q, and n is as defined in compounds of formula I-a above;
  • n 0, 1, or 2.
  • the present invention provides methods and uses which comprise administering compounds of formula I-c, wherein R 7 is selected from the group consisting of -OH, -NRi 5 Ri 6 , alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, akenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted.
  • the present invention provides methods and uses which comprise administering com ounds of formula of I-d:
  • R and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsub
  • R 7 and n are as defined in compounds of formula I-a above; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof.
  • R is H or OMe
  • R" is H.
  • the present invention provides methods and uses which comprise administering compounds of formula I-d, wherein Ry is selected from the group consisting of -OH, -NR 15 R 16 , alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, akenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted.
  • Ry is selected from the group consisting of -OH, -NR 15 R 16 , alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, akenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocycly
  • the present invention provides methods and uses which comprise administering compounds of formula of I-e:
  • each R, R 5 , q and n is as defined compounds of formula I-a above; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof.
  • n 0, 1, or 2.
  • the present invention provides methods and uses which comprise administering compounds of formula I-e, wherein R 5 is selected from the group consisting of-NRi 5 Ri 6 , -(CH 2 ) z NRi 5 Ri 6 , -NHOH, -ORi 5 , -CH 2 X, alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted.
  • the present invention provides methods and uses which comprise administering compounds of formula I-e, wherein R5 is an alkyl substituted by at least one labeling group, such as a fluorescent, a bioluminescent, a chemiluminescent, a colorimetric and a radioactive labeling group.
  • R5 is an alkyl substituted by at least one labeling group, such as a fluorescent, a bioluminescent, a chemiluminescent, a colorimetric and a radioactive labeling group.
  • a fluorescent labeling group can be selected from bodipy, dansyl, fluorescein, rhodamine, Texas red, cyanine dyes, pyrene, coumarins, Cascade BlueTM, Pacific Blue, Marina Blue, Oregon Green, 4',6-Diamidino-2-phenylindole (DAPI), indopyra dyes, lucifer yellow, propidium iodide, porphyrins, arginine, and variants and derivatives thereof.
  • the present invention provides methods and uses which comprise administering compounds of formula of I-f:
  • R and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsubsti
  • R 5 and n are as defined in compounds of formula I-a above; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof.
  • R is H or OMe
  • R" is H.
  • a preferred compound of formula I-f is S36, in particular in the form of a sodium salt.
  • the present invention provides methods and uses which comprise administering compounds of formula I-f, wherein -(CH 2 ) z NRi 5 Ri6, selected from the group consisting of-NRi 5 Ri 6 , -NHOH, -ORi 5 , -CH 2 X, alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkyl, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted.
  • the present invention provides methods and uses which comprise administerin mpounds of formula of I-g:
  • W is S or O; each R, Ri 5 , Ri 6 , q, and n is as defined in compounds of formula I-a above; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof.
  • the present invention provides methods and uses which comprise administering compounds of formula I-g, wherein Ri 5 and Ri 6 independently are selected from the group consisting of H, OH, NH 2 , alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted; and optionally R15 and R1 ⁇ 2 together with the N to which they are bonded may form a heterocycle which may be substituted.
  • Ri 5 and Ri 6 independently are selected from the group consisting of H, OH, NH 2 , alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, alkyla
  • the present invention provides methods and uses which comprise administering compounds of formula I-g, wherein W is O or S.
  • the present invention provides methods and uses which comprise administerin compounds of formula of I-h:
  • W is S or O
  • R and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsubsti
  • Ri 5 , Ri 6 and n are as defined in compounds of formula I-a above;
  • R' is H or OMe
  • R" is H.
  • the present invention provides methods and uses which comprise administering compounds of formula I-h, wherein R15 and Ri 6 independently are selected from the group consisting of H, OH, NH 2 , alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted; and optionally R15 and R1 ⁇ 2 together with the N to which they are bonded may form a heterocycle which may be substituted.
  • R15 and Ri 6 independently are selected from the group consisting of H, OH, NH 2 , alkyl, alkylamino, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkyl, alkyla
  • the present invention provides methods and uses which comprise administering compounds of formula I-h, wherein W is O or S.
  • the present invention provides methods and uses which comprise administerin compounds of formula of I-i:
  • Rn is selected from the group consisting of -NRi 5 Ri 6 , -NHNRi 5 Ri 6 , -NHOH, -OR15, -CH 2 X, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl;
  • alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • each R, q, and n is as defined in compounds of formula I-a above; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof.
  • n 0, 1, or 2.
  • the present invention provides methods and uses which comprise administering compounds of formula I-i, wherein Rn is -NRi 5 Ri 6 , and -ORi 5 .
  • R i7 is -OH, -OMe, -NEt, -NHEt, -NHPh, -NH 2 , or
  • the present invention provides methods and uses which comprise administering compounds of formula of I- :
  • R and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsub
  • R i7 is selected from the group consisting of -NRi 5 Ri 6 , -NHNRi 5 Ri 6 , -NHOH, -OR i5 , -CH 2 X, alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each alkenyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted;
  • n is as defined in compounds of formula I-a;
  • R' is H or OMe
  • R" is H.
  • the present invention provides methods and uses which comprise administering compounds of formula I-j, wherein R 17 is -NR 15 R 16 or -OR 15 .
  • Rn is -OH, -OMe, -NEt, -NHEt, -NHPh, -NH 2 , or
  • the present invention provides methods and uses which comprise administering compounds of formula I-k:
  • R and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsubsti
  • Ri5 and Ri 6 are as defined in Formula (I),
  • p is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, with each value of p representing a different embodiment
  • n 0, 1, or 2;
  • the present invention provides methods and uses which comprise administering compounds of formula I-k, wherein R' and R" are
  • Rig is Ci-C 4 alkyl, such as Me, Et, propyl, and butyl.
  • n 2
  • Ri 8 is pyrrolidine, piperidine, piperazine, or morpholine.
  • m is 3, 4, 5, 5, 7, or 8
  • Rig is a fluorescent labeling group selected from bodipy, dansyl, fluorescein, rhodamine, Texas red, cyanine dyes, pyrene, coumarins, Cascade BlueTM, Pacific Blue, Marina Blue, Oregon Green, 4',6-Diamidino-2-phenylindole (DAPI), indopyra dyes, lucifer yellow, propidium iodide, porphyrins, arginine, and variants and derivatives thereof.
  • R is H, OMe, or C 2 -C 4 alkoxyl; R" is H; n is 0; and Rig is Ci-C 4 alkyl.
  • the present invention provides methods and uses which comprise administering com ounds of formula of I-l:
  • R and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsubsti
  • Re and n are as defined in compounds of formula I-a; and enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes and pro-drugs thereof.
  • R' is H or OMe
  • R" is H.
  • the present invention provides methods and uses which comprise administering compounds of formula 1-1, wherein R ⁇ is selected from the group consisting of -NRi 5 Ri 6 , -NHNRi 5 Ri 6 , -ORi 5 , -NHOH, -CH 2 X, acyl, alkenyl, alkyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, alkenyl, alkyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted or unsubstituted.
  • Re is -NR 15 R 16 such as -NHPh, pyrrolidine, piperidine, piperazine, morpholine, and the like.
  • R 6 is alkoxyl, such as -O-tBu.
  • the present invention provides methods and uses which comprise administering com ounds of formula I-m:
  • R' and R" are independently selected from the group consisting of H, halogen, -OH,
  • acyl alkyl, alkoxyl, alkylamino, alkylthio, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; and wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, aryl, heterocyclyl, heterocyclylalkyl, alkenyl, alkynyl, (hetero-)aryl, (hetero-)arylthio may be substituted or unsubsti
  • Rg, R 9 and n are as defined in compounds of formula I-a above; and enantiomers,
  • R is H or OMe
  • R" is H.
  • the present invention provides methods and uses which comprise administering compounds of formula I-m, wherein Rg and R 9 are independently alkyl, aryl, -OH, alkoxyl, or alkylamino.
  • Rg is Ci-C 4 alkyl such as Me, Et, propyl and butyl; and R 9 is aryl such as phenyl.
  • the present invention provides methods and uses which comprise administering com ounds of formula I-n,
  • R d is CH 2 , or NR a ;
  • R a is H, -(Ci-C 6 alkyl)-aryl, wherein the aryl is a disubstituted phenyl or a
  • benzo[l,3]dioxo-5-yl group or an amine protecting group (e.g., a Boc group);
  • R b is hydrogen of alkoxy (e.g., methoxy).
  • Representative compounds of Formula I-n include without limitation S101, SI 02,
  • the invention provides compounds of Formula I-o:
  • Re is substituted or unsubstituted -Ci-C 6 alkyl, -(Ci-C 6 alkyl)-phenyl, or -(Ci-C 6 alkyl)-C(0)R b ;
  • R b is -OH or -0-(Ci-C 6 alkyl), and
  • phenyl or substituted alkyl is substituted with one or more of halogen, hydroxyl, -Ci-C 6 alkyl, -0-(Ci-C 6 alkyl), -NH 2 , -NH(Ci-C 6 alkyl), -N(Ci-C 6 alkyl) 2 , cyano, or dioxolane.
  • Representative compounds of Formula I-o include without limitation S 107, SI 10, Si l l, S120, and S121.
  • the invention provides compounds of Formula I-p:
  • R c is -(Ci-C 6 alkyl)-NH 2 , -(C C 6 alkyl)-OR f , wherein R f is H or -C(0)-(Ci-C 6 )alkyl, or -(Ci-C 6 alkyl)-NHR g wherein Rg is carboxybenzyl.
  • Representative compound of Formula I-p include without limitation SI 09, S122, and SI 23.
  • the compounds of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, and Formula II can be used in methods that treat and/or prevent cardiac ischemia/reperfusion injury, and may also be used in compositions suitable for the treatment and/or prevention of cardiac ischemia/reperfusion injury.
  • the compounds used have structures as described by Formula I-a, I-b, I-e, I-f, I-g, I-h, I-i, I-j, I-k, I-n, I-o, or I-p.
  • Another preferred embodiment relates to compounds of Formula I-a-1 :
  • n 0, 1, 2, 3, or 4;
  • R 2 and R 3 together with the nitrogen and carbon to which they are respectively attached, form an unsubstituted or substituted heterocycle other than a piperazine;
  • R 3 and R 4 together with the carbon atoms to which they are respectively attached, form an unsubstituted or substituted cycloalkyl or heterocyclic ring;
  • R4 is selected from the group consisting of R 5 and oxo;
  • each R 5 is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, cycloalkylalkyl, heterocyclylalkyl, alkylaryl, and alkylheteroaryl;
  • Rg, R9, R 11 and Ri 2 are independently selected from the group consisting of R 5 , OR 5 , and -N(R 5 ) 2 ;
  • Z is a halogen selected from F, CI, Br and I;
  • Ri 3 and Ri 4 are independently selected from the group consisting of R 5 , or Ri 3 and Ri 4 together with the N to which they are bonded may form an unsubstituted or substituted heterocycle; and wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, cycloalkylalkyl, heterocyclylalkyl, alkylaryl, and alkylheteroaryl may be substituted or unsubstituted;
  • nitrogen in the benzoxazepine ring may optionally be a quaternary nitrogen; and all enantiomers, diastereomers, tautomers, pharmaceutically acceptable salts, hydrates, solvates, complexes, polymorphs, metabolites, and prodrugs thereof;
  • the invention further provides a number of more preferred structures that fall within the general structure of formula I-a-1.
  • Preferred compounds of the present invention include:
  • R is methoxy
  • Ri 3 is hydrogen, or an unsubstituted or substituted alkyl, aryl, alkylaryl, heterocyclyl or heteroaryl; and wherein Ri 3
  • Ri 4 are either each H or are bonded to make , wherein R d is CH 2 , NH, O,
  • Still other preferred compounds of the present invention include those of formula I-a-1, wherein
  • n 1 or 2
  • More preferred compounds of (a) include Rg and R 9 being independently OR 5 . Also in (a)-(d), more preferred compounds of (a)-(d) include each R 5 being independently hydrogen, or an unsubstituted or substituted alkyl, alkylaryl, aryl, or heterocyclyl.
  • each R is independently OR 5 at positions 7 and 8 of the benzoxazepine ring.
  • the more preferred compounds of the invention specifically include those of formula I-a-1, wherein:
  • n 1
  • R is OR 5 or OCZ 3 at position 7 of the benzoxazepine ring
  • Ri 3 and Ri 4 are either each H or are bonded to make ⁇ N ' / , wherein Rd is CH 2 , NH,
  • Rj may optionally be a quaternary nitrogen; or R 2 and R 3 together with the nitrogen and carbon to which they are respectively attached, form an unsubstituted or substituted heterocycle other than a piperazine; or
  • N-benzo[l,3]dioxo-5-yl wherein the nitrogen in R d may optionally be a quaternary nitrogen; or R 2 and R 3 together with the nitrogen and carbon to which they are respectively attached, form an unsubstituted or substituted heterocycle other than a piperazine; or
  • N-benzo[l,3]dioxo-5-yl, or N-C( 0)OC(R 5 ) 3 , wherein the nitrogen in Rj may optionally be a quaternary nitrogen; or
  • n 1
  • R is OR 5 at position 6 of the benzoxazepine ring
  • R 2 and R 3 together with the nitrogen and carbon to which they are respectively attached, form an unsubstituted or substituted heterocycle other than a piperazine; or
  • R being OR 5 at position 7 of the benzoxazepine ring wherein each R 5 is independently hydrogen, or an unsubstituted or substituted alkyl, alkylaryl, aryl, or heterocyclyl.
  • Still other preferred compounds are those represented by the structure of any one or more of formula I-b-1, 1-c-1, 1-d-1, 1-e-1, 1-f-1, 1-g-1, 1-h-1, and I-i- 1 , and their
  • R, n and R 2 are as in formula I-a-1 and Rd is CH 2 , NH, O,
  • N-benzo[l,3]dioxo-5-yl, or N-C( 0)OC(R 5 )3, wherein the nitrogen in Rj may optionally be a quaternary nitrogen.
  • the most preferred compounds of formula I-b-1 to I-i-1 include those where R is OR 5 at position 7 of the benzoxazepine ring wherein each R5 is independently hydrogen, or an unsubstituted or substituted alkyl, alkylaryl, aryl, or heterocyclyl.
  • R is methoxy at position 7 of the benzothiazepine ring.
  • Examples of compounds that may be used in conjunction with the invention include, without limitation, SI, S2, S3, S4, S5, S6, S7, S9, SI 1, S12, SI 3, S14, SI 9, S20, S22, S23, S24, S25, S26, S27, S36, S37, S38, S40, S43, S44, S45, S46, S47, S48, S49, S50, S51, S52, S53, S54, S55, S56, S57, S58, S59, S60, S61, S62, S63, S64, S66, S67, S68, S69, S70, S71, S72, S73, S74, S75, S76, S77, S78, S79, S80, S81, S82, S83, S84, S85, S86, S87, S88, S89, S90, S91, S92, S93, S94, S95, S96, S97, S98, S99, S100, S101,
  • each R is independently selected from the group consisting of H, halogen, -OH, -NH 2 , -NO 2 , -CN, -N3, -SO 3 H, acyl, alkyl, alkylamino, cycloalkyl, heterocyclyl, heterocyclylalkyl, alkenyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-) arylamino; wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, heterocyclyl, heterocyclylalkyl, alkenyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino may be substituted with one or more radicals independently selected from the group consisting of halogen, N,
  • each R is independently selected from the group consisting of H, halogen, -OH, -NH 2 , -N0 2 , -CN, -N 3 , -SO 3 H, acyl, alkyl, alkylamino, cycloalkyl, heterocyclyl, heterocyclylalkyl, alkenyl, (hetero-)aryl, (hetero-)arylthio, and (hetero-)arylamino; wherein each acyl, alkyl, alkoxyl, alkylamino, cycloalkyl, heterocyclyl, heterocyclylalkyl, alkenyl, (hetero-)aryl,
  • (hetero-)arylthio, and (hetero-)arylamino may be substituted with one or more radicals independently selected from the group consisting of halogen, N, O, -S-, -CN, -N 3 , -SH, nitro, oxo, acyl, alkyl, alkoxyl, alkylamino, alkenyl, aryl, (hetero-)cycloalkyl, and (hetero-)cyclyl.
  • R 5 is selected from the group consisting of -NR 16 , -(CH 2 ) z NRi 5 Ri6, NHNHRie, NHOH, -ORis, CONH 2 NHRi 6 , CONRie, CH 2 X, acyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl; wherein each acyl, aryl, cycloalkyl, cycloalkylalkyl, heterocyclyl, and heterocyclylalkyl may be substituted with one or more radicals
  • halogen independently selected from the group consisting of halogen, N, O, -S-, -CN, -N 3 , nitro, oxo, acyl, alkyl, alkoxyl, alkylamino, alkenyl, aryl, (hetero-)cycloalkyl, and (hetero-)cyclyl.
  • the present invention provides use of the compounds of Formula II in the method of the invention.
  • Formula II is
  • Formula II is discussed also in co-pending application 10/680,988, the disclosure of which is incorporated herein in its entirety by reference.
  • the -S- or -O- of the ring in all embodiments disclosed herein can instead be replaced by -CH 2 - or by -NH- with such compounds being expected to be useful by reducing calcium "leak” or calcium current through the RyR channel, stabilizing gating of the RyR channel, or increasing the binding of calstabin to the RyR complex in the subject.
  • the compounds of the invention such as the compounds of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1 , 1-b-1 , 1-c-1 , 1-d-1 , 1-e-1 , 1-f-1 , I-g-1 , 1-h-1 , 1-i-1 , or Formula II, reduce the open probability of RyRs and decrease the calcium current through such channels by increasing binding of calstabin (FKBP 12 or calstabinl , and FKBP12.6, also known as the cardiac calstabin2) binding affinity.
  • FKBP 12 or calstabinl also known as the cardiac calstabin2
  • the compounds of the invention are useful for the treatment and/or prevention of disorders and conditions associated with abnormal function of RyRs, particularly RyRl and RyR2, where such disorders and conditions are characterized by an increase in the open probability of, and in increase in the calcium current through, RyR.
  • a "decrease” or “disorder” in the level of RyR-bound FKBP in cells of a subject refers to a detectable decrease, diminution or reduction in the level of RyR-bound FKBP in cells of the subject.
  • Such a decrease is limited or prevented in cells of a subject when the decrease is in any way halted, hindered, impeded, obstructed or reduced by the administration of compounds of the invention, such that the level of RyR-bound FKBP in cells of the subject is higher than it would otherwise be in the absence of the administered compound.
  • the level of RyR-bound calstabin (FKBP) in a subject is detected by standard assays and techniques, including those readily determined from the known art (e.g., immunological techniques, hybridization analysis, immunoprecipitation, Western-blot analysis, fluorescence imaging techniques and/or radiation detection, etc.), as well as any assays and detection methods disclosed herein.
  • standard assays and techniques including those readily determined from the known art (e.g., immunological techniques, hybridization analysis, immunoprecipitation, Western-blot analysis, fluorescence imaging techniques and/or radiation detection, etc.), as well as any assays and detection methods disclosed herein.
  • protein is isolated and purified from cells of a subject using standard methods known in the art, including, without limitation, extraction from the cells (e.g., with a detergent that solubilizes the protein) where necessary, followed by affinity purification on a column, chromatography (e.g., FTLC and HPLC), immunoprecipitation (with an antibody), and precipitation (e.g., with isopropanol and a reagent such as Trizol). Isolation and purification of the protein is followed by electrophoresis (e.g., on an SDS- polyacrylamide gel).
  • a decrease in the level of RyR-bound FKBP in a subject, or the limiting or prevention thereof, is determined by comparing the amount of RyR-bound FKBP detected prior to the administration of a compound of Formula I, I-a', I-a, I-b, I-c, I-d, I-e, I-f, I-g, I-h, I-i, I-j, I-k, 1-1, 1-m, I-n, I-o, I-p, I-a-1 , 1-b-1 , 1-c-1 , 1-d-1 , 1-e-1 , I-f- 1 , I-g-1 , 1-h-1 , 1-i-1 , or Formula II, (in accordance with methods described below) with the amount detected a suitable time after administration of the compound.
  • a decrease in the level of RyR-bound calstabin (FKBP) in cells of a subject is limited or prevented, for example, by inhibiting dissociation of FKBP and RyR in cells of the subject; by increasing binding between FKBP and RyR in cells of the subject; or by stabilizing the RyR-FKBP complex in cells of a subject.
  • the term "inhibiting dissociation” includes blocking, decreasing, inhibiting, limiting or preventing the physical dissociation or separation of an FKBP subunit from an RyR molecule in cells of the subject, and blocking, decreasing, inhibiting, limiting or preventing the physical dissociation or separation of an RyR molecule from an FKBP subunit in cells of the subject.
  • the term “increasing binding” includes enhancing, increasing, or improving the ability of
  • phosphorylated RyR to associate physically with FKBP (e.g. , binding of approximately two fold or, approximately five fold, above the background binding of a negative control) in cells of the subject and enhancing, increasing or improving the ability of FKBP to associate physically with phosphorylated RyR (e.g., binding of approximately two fold, or,
  • a decrease in the level of RyR-bound FKBP in cells of a subject is limited or prevented by directly decreasing the level of phosphorylated RyR in cells of the subject or by indirectly decreasing the level of phosphorylated RyR in the cells (e.g., by targeting an enzyme (such as PKA) or another endogenous molecule that regulates or modulates the functions or levels of phosphorylated RyR in the cells).
  • the level of phosphorylated RyR in the cells is decreased by at least 10% in the method of the present invention. In another embodiment, the level of phosphorylated RyR is decreased by at least 20%.
  • the EC50 data were obtained using an FKBP12.6 rebinding assay to determine the amount of FKBP12.6 binding to PKA-phosphorylated RyR2 at various concentrations (0.5 - 1000 nM) of these compounds.
  • the EC50 values were calculated using Michaelis-Menten curve fitting.
  • the present invention provides methods and uses which comprise administering compounds of the invention having an EC50 value lower than 100 nM.
  • the present invention provides methods and uses which comprise administering compounds of the invention having an EC50 value lower than 50 nM.
  • the compounds of the present invention may be synthesized as described in published PCT application WO 07/024717 and U.S. patent application 11/506,285, the entire contents of which are hereby incorporated by reference.
  • the present invention provides use of compounds of the following formula for preparing many of the compounds disclosed herein:
  • Various synthesis schemes are disclosed in application 12/263,435 the disclosure of which is expressly incorporated herein in its entirety by reference.
  • Fluo-4 AM, tetra-methyl rhodamine-ethyl ester (TMRM) and MitoSOX Red were from Molecular Probes/Invitrogen.
  • Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP), N-acetylcysteine (NAC), and laminin were from Sigma. All compounds were prepared as stock solutions in appropriate solvents. On the day of the experiment, stock solutions were diluted to the desired final concentration in the bath solution; when required, the same concentration of solvent was added to the control solution.
  • the broad-spectrum caspase inhibitor Quinoline-carbonyl-Val-Asp-Difluorophenoxymethylketone (Q-VD-OPh; MP Biomedicals #:OPH109) has low toxicity, broad spectrum effects on caspases and no inhibitory effect on noncaspase enzymes.
  • Na-Quinoline-2-carbonyl-LETD(OMe)- CH 2 OC 6 H 3 (2,6-F 2 ) referred here as Q-LETD-OPh was custom-synthesized (95% purity, NeoMPs, France, France).
  • Q-LETD-OPh is a preferential caspase-8 inhibitor previously reported under the name TRP801. All inhibitors were dissolved at 10-2M in DMSO and stored at -20°C. Etanercept (Enbrel®, Pfizer France) was IP injected (2 mg/kg) 24h and lh before surgery.
  • mice Sham-operated animals were subjected to the same surgical procedure, but the ligation remained untied. In some experiments rats were pre- treated with S I 07 (25 mg/100 ml in the drinking water) one week prior to ischemia and up to 72 hr post-reperfusion). Similar procedure was used for WT and calstabin2 KO mice except for the duration of acute ischemia (1 hour). Animals were sacrificed by rapid neck disarticulation and the heart was excised.
  • cardiomyocytes were enzymatically isolated from the left ventricles as described before 56. After being loaded with fluorescent indicators (see below), cardiomyocytes were plated on laminin-coated coverslips that made up the bottom of the perfusion chamber. Cells were superfused with standard Tyrode solution (mM): NaCl 117, KC1 5.7, NaHC0 3 4.4, KH 2 P0 4 1.5, MgCl 2 1.7, HEPES 21, glucose 11, pH 7.4 adjusted with NaOH. Experiments were performed at room temperature ( ⁇ 24 °C). Cells were continuously stimulated at 1 Hz with 1-2 ms current pulses delivered via two platinum electrodes, one on each side of the perfusion chamber.
  • Tyrode solution mM
  • Thin sections (5 ⁇ ) were prepared from the rat left ventricles, and stained with Haematoxylin- Eosin (HE) and Masson trichrome (MT) for light microscopy ( x 10). The thickening of the myocardium was estimated on the HEstained heart sections, and the presence of collagen was analyzed on the MTstained ventricle sections. Results indicate the % of fibrosis area expressed as a percentage of collagen content area of myocardial tissue analyzed.
  • HE Haematoxylin- Eosin
  • MT Masson trichrome
  • Cardiac function was assessed using echocardiography (Vivid 7, General Electric Healthcare) with a linear 14 MHz probe, 15 days after reperfusion.
  • a two-dimensional view of the left ventricular (LV) was obtained at the level of the papillary muscles in a parasternal short-axis view.
  • M-mode traces were recorded through the anterior and posterior walls.
  • Morpho-functionnal parameters were assessed using left ventricular end diastolic diameter (LVEDd), fractionnal shortening (FS) and E wave over A wave ratio (E/A) parameters.
  • LVEDd left ventricular end diastolic diameter
  • FS fractionnal shortening
  • E/A E wave over A wave ratio
  • ECG- auto (ver 1.5.12.22, EMKA Technologies, Paris, France).
  • ECG signals were digitally filtered between 0.1 and 1000 Hz and analyzed manually to detect arrhythmias over 2 hr of reperfusion in animal treated either with the vehicle (DMSO, i.p. injected), SI 07 (drinking water; 25 mg/lOOml) or Q-LETD-OPh (i.p. injected).
  • DMSO i.p. injected
  • SI 07 drinking water; 25 mg/lOOml
  • Q-LETD-OPh i.p. injected
  • AF Fluo-4 fluorescence signal
  • F0 stimulation pulse given under control conditions
  • the rising phase of Ca 2+ transients was assessed by normalizing the peak amplitude over the time to peak (Amp/TT).
  • Ca 2+ -sparks were analyzed as previously reported.
  • Confocal images were obtained by line scanning along the long axis.
  • Line-scan rate was set to 1.54 ms per line; 512 pixels x 3000 lines.
  • Ca 2+ -spark frequency was calculated for each cardiomyocyte as the number of sparks recorded on 10 successive images collected at 3-4 different line locations.
  • the SR Ca 2+ content was measured in intact cardiomyocytes loaded with Fluo-4. After 5 min. of electrical field stimulation at 1 Hz, rapid perfusion of caffeine (20 mM) was used to release the SR Ca 2+ store. Cell shortening was measured from the line-scan images and expressed as a percentage of the resting cell length.
  • Nitric oxide and mitochondrial ROS production Nitric oxide and mitochondrial ROS production.
  • DAF-FM was used to measure cytosolic NO level.
  • Isolated cardiomyocytes were loaded with DAF-FM (2 ⁇ ) in Tyrode solution for 15 min at room temperature. Confocal images were obtained at 5 min intervals by measuring the emitted light at 515 nm after an excitation at 488 nm.
  • MitoSOX Red was used to measure mitochondrial ROS production.
  • Isolated cardiomyocytes were loaded with MitoSOX Red (5 ⁇ ) in Tyrode for 30 min at 37°C, followed by washout. Confocal images were obtained at 5 min intervals by measuring the emitted light at 585 nm after excitation at 488 nm.
  • MitoSOX Red fluorescence was measured in five different areas in each cell and the signal was normalized to that at the start of the experiment. As a positive control, lmM of H 2 0 2 was added at the end of each experiment and this resulted in a marked increase in the fluorescence signal in all cells (data not shown).
  • TMRM mitochondrial membrane potential
  • rat left ventricular tissue was homogenized using a tissue mixer (Fisher Scientific) at the highest speed for 1 min with 2 volumes of: 20 mM Tris- maleate (pH 7.4), 1 mM EDTA and protease inhibitors (Roche). Homogenate was centrifuged at 4,000 g for 15 min at 4°C and the following supernatant was centrifuged at 40,000 g for 30 min at 4°C. The final pellet, containing the SR fractions, was resuspended and aliquoted using the following solution: 250 mM sucrose, 10 mM MOPS (pH 7.4), 1 mM EDTA and protease inhibitors. Samples were frozen in liquid nitrogen and stored at -80°C.
  • Cardiac SR microsomes (100 ⁇ g) were isotonically lysed in 1.0 ml of a buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 20 mM NaF, 1.0 mM Na 3 V0 4 , and protease inhibitors.
  • An anti-RyR antibody (4 ⁇ g 5029 Ab) was used to immunoprecipitate RyR2 from 100 ⁇ g of cardiac SR microsomes.
  • the samples were incubated with antibody in 0.5 ml of a modified RIPA buffer (50 mM Tris-HCl pH 7.4, 0.9% NaCl, 5.0 mM NaF, 1.0 mM Na 3 V0 4 , 1% Triton- XI 00, and protease inhibitors) for 1 hr at 4°C.
  • the immune complexes were incubated with protein A Sepharose beads (Sigma, St. Louis, MS) at 4°C for 1 hr and the beads were washed three times with buffer.
  • the amount of calstabin2 that co-immunoprecipitated with RyR2 was determined from immunoblots developed with a calstabin antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Levels of RyR2 bound proteins were normalized to the total RyR2 immunoprecipitated (arbitrary units). All immunoblots were developed and quantified using the Odyssey Infrared Imaging System (LICOR Biosystems, Lincoln, NE) and infrared-labeled secondary antibodies.
  • LICOR Biosystems Lincoln, NE
  • SR vesicles containing RyR2 were fused to planar lipid bilayers formed by painting a lipid mixture of phosphatidylethanolamine and phosphatidylcholine (Avanti Polar Lipids) in a 3: 1 ratio across a 200-um hole in polysulfonate cups (Warner Instruments) separating 2 chambers. The final concentration of lipids was 40 mg/ml dissolved in decane. Membrane thinning was assayed by applying a triangular wave test pulse. Typical capacitance values were 100 - 250 pF.
  • the trans chamber (1.0 ml), representing the intra-SR (luminal) compartment, was connected to the head stage input of a bilayer voltage clamp amplifier.
  • the cis chamber (1.0 ml), representing the cytoplasmic compartment, was held at virtual ground.
  • the recording solutions consisted of: 1 mM EGTA, 250/125 mM Hepes/Tris, 0.64 mM CaCl 2 , pH 7.35 as cis solution and 53 mM Ca(OH) 2 , or 53 mM Ba(OH) 2 when mentioned, and 250 mM Hepes, pH 7.35 as trans solution.
  • the concentration of free Ca 2+ in the cis chamber was calculated with WinMaxC program (version 2.50).
  • SR vesicles were added to the cis side and fusion with the lipid bilayer was induced by making the cis side hyperosmotic by the addition of 400-500 mM CsCl.
  • the animals were sacrificed by a pentobarbital lethal injection.
  • the heart was excised and perfused about 5 min by Langerdorf reverse way using a calcium-free washing solution (in mM: NaCl 117 mM, KC1 5.7, NaHC0 3 4.4, KH 2 P0 4 1.5, MgCl 2 1.7, HEPES 21, glucose 11, taurine 20, pH 7.2 adjusted with NaOH).
  • the left ventricle was than dissected.
  • Caspase activity was also assessed on isolated cardiomyocytes by measuring the activation of caspase-8 or caspase-3/7 by confocal imaging using a fluorescent caspase inhibitor (FLICATM, ImmunoChemistry Technologies LLC, Bloomington, MN).
  • FLICATM fluorescent caspase inhibitor
  • the carboxyfluorescein (FAM)-labeled caspase inhibitors FAM-IETD-FMK and FAM-DEVD- FMK were obtained from Abcys (Paris, France). Isolated cardiomyocytes were loaded following the commercial procedure and fluorescence was detected with excitation and emission wavelength at 488 nm and 515 nm, respectively.
  • Blood samples were withdrawn from the descending aorta at different time after reperfusion and allowed to clot 20 min at room temperature. Samples were then centrifugated at 2000 g during 10 min. at 4°C. Sera were aliquoted, quick frozen and stored at -20°C.
  • TNF-a levels were determined using xMAP luminex technology with a Biorad multiplex cytokine assay kit following the commercial procedure.
  • reaction mixture contained 10 ⁇ of ABsolute QPCR SYBR Green Capillary Mix (Thermo Fisher Scientific, containing thermo start DNA polymerase, reaction buffer, deoxynucleoside trisphosphate mix, 3 mM MgCl 2 and SYBR Green I dye), was added with 0.5 ⁇ of appropriate primer mix, and 5 ⁇ of cDNA.
  • Forward and reverse primers for each gene were chosen on the basis of previously published sequences (ANF: forward primer
  • TNFR1 forward primer
  • ATGAACTCCTTCCAGCTGGT SEQ ID NO:6
  • TNFR2 forward primer
  • ATGGTGCCTCATCTGCC (SEQ ID NO:7) /reverse primer GGACCTGCTCATCCTTTG (SEQ ID NO: 8), caspase-8: forward primer CTGGGAAGGATCGACGATTA (SEQ ID NO:9) / reverse primer TGGTCACCTCATCCAAAACA (SEQ ID NO: 10), TNF-a: forward primer GTCGTAGCAAACCACCAAGC (SEQ ID NO: l 1) / reverse primer
  • TGTGGGTGAGGAGCACATAG (SEQ ID NO: 12)). The data were normalized to the levels of GAPDH.
  • the amplification program included the initial denaturation step at 95°C for 15 min, and 40 cycles of denaturation at 95°C for 1 s, annealing at 65°C for 10 s, and extension at 72°C for 20 s. Melting curves were used to determine the specificity of PCR products.
  • Heart tissues of Sham or I/R animals were homogenized directly into lysis buffer (10 mM Tris maleate pH6.8, 35 mM sodium fluorure, 1% triton, 1 mM sodium ortho vanadate, IX protease inhibitor). The lysates were centrifugated at 10,000 g for 5 minutes. Proteins were quantified with the DC Protein Assay (Biorad). 25 ⁇ g of proteins were loaded on 4-20% gradient gel of acrylamide. Proteins were transferred onto nitrocellulose membrane 0.2 ⁇ (GE Healthcare).
  • the membrane were blocked (blocking buffer from Odyssey, LI-COR ® Biosciences) and then incubated with primary antibodies at room temperature for 1 hour: anti- BID (1 :400) (D-19: sc-6291, Santa Cruz Technology) and anti-GAPDH (1 : 1000) (FL-335: sc-25778, Santa Cruz Technology).
  • the membrane was then incubated with secondary antibodies: anti-goat 680 nm (1 :30000) (BID) and anti-rabbit 800 nm (1 :30000) (GAPDH) for 45 minutes in the dark. After the final washes, the membrane was scanned using
  • FIGS 1A-G show effect of TNF-a and caspase-8 activation on RyR2 function in vitro.
  • the following abbreviations are used: Q-LETD for caspase-8 inhibitor Q-LETD-OPh, Z-IETD for caspase-8 inhibitor Z-IETD-FMK, Z-DEVD for caspase-3/7 inhibitor Z-DEVD- FMK, Q-VD for broad spectrum caspase inhibitor Q-VD-OPh, and NAC for the antioxidant N-acetyl cysteine.
  • embodiment A are shown representative MitoSOX red fluorescence recorded at 0 min, 30 min and 60 min of TNF-a (10 ng/ml) or TNF-a+Q-LETD-OPh (10 ⁇ ) application in single ventricular rat cardiomyocytes.
  • embodiment B are shown mean data ⁇ SEM of normalized MitoSOX red fluorescence after 60 min of TNF-a application. * indicates statistical difference compared to control conditions (P ⁇ 0.05; n>20 cells in each conditions). Each caspases inhibitors (10 ⁇ ) were pre-incubated 15 min prior TNF-a application. For SI 07 experiments, the animals were orally treated with SI 07 (25 mg/100 ml, in drinking water) one week prior cells isolation.
  • caspase-8 inhibitors Q-LETD-OPh and Z-IETD-FMK
  • broad spectrum caspase inhibitor Q-VD-OPh
  • caspase-3/7 inhibitor Z-DEVD-FMK
  • SI 07 did not.
  • embodiment C are shown typical images of TNF-a-induced NO production measured with DAF-FM using confocal microscope.
  • the right panel represents time change of normalized DAF-FM fluorescence in the presence of TNF-a (10 ng/ml) or TNF-a+ Q-LETD- OPh (10 ⁇ ).
  • embodiment D are shown mean data ⁇ SEM of normalized DAF-FM fluorescence after 60 min of TNF-a application.
  • the bar graph shows the relative amount of calstabin2 associated with the RyR2 channel complex for each group determined by dividing the calstabin2 signals by the total amount of RyR2 that was immunoprecipitated (A.U.).
  • RyR2 single-channel traces from control, TNF-a treated, and Q-LETD-OPh+TNF-a treated samples were isolated from left ventricular cardiomyocytes treated 1 hr with TNF-a (10 ng/ml), or with Q-LETD-OPh (10 ⁇ ) followed by lh with TNF-a (10 ng/ml). Single channel activities were recorded at 150 nmol/L free cytosolic (cis) Ca 2+ concentration and 53 mM Ca(OH) 2 luminal (trans) at 0 mV. Channel openings are shown as upward deflections from the closed level (c-).
  • Example of channel activity is shown at two different time scales (10 s for one upper trace and 1 s for two lower traces in each block) as indicated by dimension bars.
  • the bar graph shows summary data of relative values of RyR2 Po of control, TNF-a treated and Q-LETD-OPh+TNF-a treated samples. *P ⁇ 0.05 vs control.
  • In embodiment G are shown spontaneous SR Ca 2+ release events recorded in fluo-4-AM loaded intact cardiomyocytes by laser scanning confocal microscopy. Representative AF/F line scan images (1.54 ms/line) were recorded in absence (control) or after lh TNF-a incubation. Ca 2+ sparks frequency is used as an index of diastolic SR Ca 2+ leak.
  • FIGS 2A-I show roles of caspase-8 and RyR2 leak in myocardial reperfusion injury.
  • A are shown circulating levels of TNF-a after reperfusion compared to sham operated animals. Plasma level of TNF-a was maximal after 1 hr of reperfusion and returned to normal values within 6 hr of reperfusion. (*: p ⁇ 0.05 vs. sham; n> 6 animal in each conditions).
  • FIG. 1 In embodiment C are shown representative cardiac RyR2 immunoprecipitation and immunoblots and bar graphs showing Cys nitrosylation of cardiac RyR2 and depletion of calstabin2 from the cardiac RyR2 complex, 24 hr post-reperfusion in a rat model of ischemia-reperfusion (I/R) treated either with the vehicle (DMSO, i.p. injected), S107 (drinking water; 25 mg/lOOml) or Q-LETD-OPh (i.p. injected 15 min prior reperfusion).
  • the relative amount of calstabin2 associated with the channel complex was determined by dividing the calstabin2 signals by the total amount of RyR2 immunoprecipitated (A.U.).
  • the relative amount of RyR2 S-nitrosylation for each group was determined by dividing the Cys- NO signals by the total amount of RyR2 immunoprecipitated (A.U.). Data presented as mean ⁇ S.E.M. In embodiment D are shown representative sections of TTC-stained hearts.
  • Quantification was done by normalizing the infarct area (IA) to the area at risk (AAR).
  • Figures 3A-C show left ventricular remodeling 15 days after reperfusion.
  • embodiment A are shown heart sections stained with Masson trichrome, which revealed a major increase in fibrosis that was prevented when animals where i.p. injected in Q-LETD- OPh, 15 min. prior to the reperfusion or when pre-treated with SI 07 (one week prior to ischemia and up to 72 hr post-reperfusion) compared to vehicle treated animals. (*: p ⁇ 0.05 vs. sham; n> 6 animals in each conditions).
  • Embodiment B shows that heart weight to body weight ratio was significantly increased in DMSO treated animals and unchanged in Q-LETD- OPh- or S107-treated animals (*: p ⁇ 0.05 vs.
  • Echocardiographic parameters analyzed 15 days after reperfusion.
  • Left ventricular telediastolic diameter (LVtd, left panel), fractional shortening (FS, middle panel) and E wave over A wave ratio (E/A; right panel) are significantly affected in DMSO treated animal.
  • Echocardiography parameters were significantly enhanced when animals where i.p. injected in Q-LETD-OPh or with SI 07. (*: p ⁇ 0.05 vs. sham; n> 8 animals in each conditions).
  • Caspases inhibitors are indicated as follow: Q-LETD-OPh (Q-LETD) and Q-VD- OPh (Q-VD).
  • Figures 4A-E show the diastolic SR Ca 2+ leak via RyR2 channels after
  • ischemia/reperfusion contributes to the cardiac remodeling process.
  • A are shown representative cardiac RyR2 immunoprecipitation and immunoblots and bar graphs showing Cys nitrosylation and depletion of calstabin2 from the cardiac RyR2 complex, 2 weeks post-reperfusion. Levels of proteins in the RyR2 complex were normalized to the total amount of RyR2 (A.U.). Data presented as mean ⁇ S.E.M.
  • embodiment B are shown representative RyR2 single-channel traces recorded at 150 nmol/L free cytosolic (cis) Ca 2+ concentration and 53 mM Ba(OH) 2 luminal (trans) at 0 mV. RyR2 channels were isolated from hearts 15 days post-reperfusion.
  • Channel openings are shown as upward deflections from the closed level (c-).
  • Example of channel activity is shown at two different time scales (10 s for one upper trace and 1 s for two lower traces in each block) as indicated by dimension bars.
  • Summary data of relative values of RyR2 normalized Po under different treatment conditions are indicated in the labeled legend.
  • the single channel Po at 150 nmol/L free cytosolic Ca 2+ concentration was normalized to the Po at 5000 nmol/L free cytosolic Ca 2+ concentration.
  • embodiment C are shown western-blot showing the presence of NFAT4 in cytosolic and nuclear fractions from different cardiac samples.
  • the low level of GAPDH in the nuclear fraction indicates that these fractions were not contaminated by cytosol.
  • the histograms represent the ratio of nuclear NFAT4 to cytosolic plus nuclear NFAT4.
  • embodiment D are shown mRNA expression level of Atrial Natriuretic Factor (ANF) and fibronectin in left ventricular free wall 15 days after reperfusion. (*: p ⁇ 0.05 vs. sham; n> 8 animals in each conditions).
  • ANFAT4 Atrial Natriuretic Factor
  • TNF-a signaling cascade key proteins such as TNF-a receptor 1 and 2 (TNFR1 and TNFR2), caspase-8 (C8) and TNF-a.
  • TNF-a receptor 1 and 2 TNF-a receptor 1 and 2
  • C8 caspase-8
  • TNF-a TNF-a receptor 1 and 2
  • SI 07 one week prior to ischemia and up to 72 hr post-reperfusion
  • Caspases inhibitors are indicated as follow: Q-LETD-OPh (Q-LETD) and Q-VD-OPh (Q-VD).
  • Figures 5A-C show effect of TNF-a and caspase-8 activation on Ca 2+ sparks frequency in cardiomyocytes.
  • a caspase-like activities were assessed using the fluorescent caspase irreversible inhibitors FAM-DEVD-FMK (a preferential caspase-3/7 probe) or FAM-IETD-FMK (a preferential caspase-8 inhibitor). Specificity of each fluorescent probe was tested using the non- fluorescent inhibitor (i.e., Z-DEVD-FMK or Z-IETD-FMK, respectively; 10 ⁇ ) as well as the broad caspase inhibitor Q-VD-OPh (10 ⁇ ) in the presence of TNF-a (10 ng/ml).
  • Caspase-8 inhibitors Z-IETD-FMK and Q-LETD-OPh
  • Z-IETD-FMK and Q-LETD-OPh prevented increased fluorescence of both FAM-based probes whereas Z-DEVD-FMK did not affect increase of FAM-IETD-FMK fluorescence.
  • embodiment B are shown TNF-a dissipated ⁇ in ventricular cardiomyocytes. The normalized TMRM fluorescence recorded under control conditions, during 60 min with 10 ng/ml TNF-a with or without the different caspases inhibitors (10 ⁇ ) or in cardiomyocytes isolated from animal treated in drinking water with SI 07 (25 mg/lOOml).
  • Caspase-8 inhibitors (Q-LETD-OPh or Z-IETD-FMK) prevented ⁇ dissipation as well as the broad caspase inhibitor, Q-VD-OPh.
  • Caspase-3-like inhibitor (Z-DEVD-FMK) or SI 07 did not prevent TNF-a-induced ⁇ dissipation.
  • embodiment C are shown Ca 2+ sparks frequency recorded with or without TNF-a (lOng/ml) in presence of Q-LETD-OPh ( ⁇ and 10 ⁇ ) or in cardiomyocytes isolated from animal treated with SI 07 (25 mg/ 100ml of drinking water). None of the treatment affects sparks frequency in basal conditions compared to control.
  • Q-LETD-OPh Q-LETD
  • Z-IETD Z-IETD
  • Z-DEVD Z-DEVD
  • Q-VD-OPh Q-VD
  • FIGS 6A-E show effects of acute TNF-a incubation (10 ng/ml; lh) on Ca 2+ transients recorded in fluo-4 AM-loaded intact cardiomyocytes by laser scanning confocal microscopy, in the presence of different caspases inhibitors, the anti-oxidant (NAC) or SI 07.
  • embodiment A are shown representative AF/F recorded in control, TNF-a, TNF-a + Q-LETD-OPh or TNF-a + Z-DEVD-FMK incubated cardiomyocytes.
  • B-D are shown average properties of Ca 2+ transients such as amplitude (embodiment B), rate of Ca 2+ transients rate of rise (Amp/TT) (embodiment C), and SR Ca 2+ load (embodiment D) and fractional shortening (embodiment E), which are expressed as mean ⁇ SEM. (*: p ⁇ 0.05 vs. control; n> 20 cells in each conditions). Note that TNF-a triggered frequent arrhythmogenic Ca 2+ transients that caspase-3 inhibitor (Z-DEVD-FMK, 10 ⁇ ) did not abolished compared to Q-LETD-OPh treated cardiomyocytes (10 ⁇ ).
  • Q-LETD-OPh Q-LETD
  • Z-IETD Z-IETD
  • Z-DEVD Z-DEVD
  • Q-VD-OPh Q-VD
  • Figure 7 shows Bid cleavage assessed by Western blot analysis in sham and IR hearts after 1 , 6 and 24 hours of reperfusion.
  • Figure 8 show representative sections (Top) of TTC-stained hearts. Quantification was done by normalizing the infarct area (I A) to the area at risk (AAR) (Bottom). Treatment with Q-LETD-OPh, SI 07 or etanercept reduces infarct size after 24 hr reperfusion.
  • Figures 9A-B show effect of ischemia reperfusion on calstabin2 KO mice.
  • embodiment A are shown representative sections (Top) of TTC-stained hearts. Quantification was done by normalizing the infarct area (I A) to the area at risk (AAR) (Bottom). Myocardial infarct size was significantly increased in calstabin2KO mice. Treatment with SI 07 reduces infarct size after 24 hr reperfusion in WT but not in calstabin2KO mice.
  • embodiment B are shown representative cardiac RyR2 immunoprecipitation and immunoblots and bar graphs showing amount of calstabin2 associated with RyR2, Cys-nitrosylation and PKA
  • Figures lOA-C show effects of TNF-a in WT mice in vivo.
  • A are shown premature ventricular contractions count over 120 minutes after injection (left panel).
  • B Bid cleavage was assessed by Western blot analysis in vehicle, TNF-a or TNF-a + Q-LETD hearts after 6 hours of I.V. injection. tBid content was normalized to total amount of Bid.
  • C are shown
  • the bar graph depicting the relative amount of RyR2 S-nitrosylation and RyR2 PKA-phosphorylated at S2808 for each group, was determined by dividing the Cys-NO signals and pS2808 signals by the total amount of RyR2 immunoprecipitated (A.U.). Values are expressed as mean ⁇ SEM (n>6 for each condition, *: p ⁇ 0.05).
  • FIGS 11A-D show Ca 2+ transients recorded in fiuo-4 AM-loaded intact
  • A-D are shown average properties of Ca 2+ transients such as amplitude (embodiment A), rate of Ca 2+ transients rise (Amp/TT)
  • FIG 12 shows representative cardiac RyR2 immunoprecipitation and immunoblots showing the level of PKA phosphorylation level at S2808. Equivalent amounts of RyR2 were immunoprecipitated from SR cardiac microsomes using an anti-RyR2 antibody.
  • TNF-a (lhr, 10 ng/ml) to freshly isolated control cardiomyocytes induced caspase-8 like and caspase-3 like activities sequentially (Fig. 5A-B).
  • preferential caspase-8 inhibitors Q-LETD-OPh 10 ⁇ or Z-IETD-FMK, 10 ⁇
  • N-acetyl cysteine also normalized Ca 2+ -spark frequency (Fig. 1G).
  • TNF-a decreased the Ca 2+ transient amplitude, Ca 2+ release kinetics, SR Ca 2+ load and cell shortening (Fig. 6A-E).
  • Q-LETD-OPh prevented the TNF-a induced decrease in the Ca 2+ transient amplitude, Ca 2+ release kinetics, SR Ca 2+ load and cell shortening (Fig. 6A-E).
  • TNF-a induced SR Ca 2+ leak via RyR2 channels contributes to reperfusion injury
  • the inventors performed 30 min. of ischemia followed by reperfusion in vivo in rats.
  • cardiac caspase-8 activity was also significantly increased by 1 hr following reperfusion, peaked at 6 hrs and returned to baseline by 24 hr (Fig. 2B).
  • RyR2 S-nitrosylation and calstabin2 depletion were also observed 24 hr post-reperfusion (Fig. 2C).
  • SI 07 25 mg/100 ml, in drinking water treatment for one week prior to surgery prevented calstabin2 depletion from the RyR2 complex but did not affect S-nitrosylation of the channel (Fig. 2C).
  • Q-LETD-OPh treatment (1 mg/kg ip) 15 min prior to reperfusion, inhibited both RyR2 S-nitrosylation and depletion of calstabin2 from the RyR2 complex (Fig. 2C).
  • Q-LETD-OPh significantly reduced myocardial infarct size [Infarct Area/ Area At Risk (IA/AAR)] compared to DMSO-treated rats (Fig. 2D).
  • SR Ca 2+ leak is thought to play a role in triggering arrhythmias during the early phase of reperfusion.
  • the inventors observed numerous ventricular extrasystoles and sustained ventricular tachycardia during the first 12 hrs of reperfusion (Fig. 2E-I).
  • QLETD- OPh and SI 07 treatment both significantly reduced arrhythmias (Fig. 2E, G, H, I).
  • caspase-8 and prevention of calstabin2 depletion from the RyR2 complex with SI 07 prevents early reperfusion injury and associated arrhythmias.
  • HW/BW ratio was significantly increased in DMSO treated animals and unchanged in Q-LETD-OPh or S107-treated animals (Fig. 3B).
  • Fig. 3C fractional shortening
  • RyR2 channel open probability measured at 150 nM cytosolic Ca 2+ , was partially or totally reduced to that observed in control channels from animals treated with SI 07 or Q-LETD-OPh, respectively.
  • Ca 2+ transient amplitudes were decreased by about 20% and the rising phases as well as the decay time constants were significantly slower in vehicle treated animals (Fig. 7A). These changes were accompanied by decreased SR Ca 2+ content and fractional cell shortening (Fig. 7B-D).
  • SI 07 or Q-LETD-OPh treatment prevented altered Ca 2+ handling and impaired cell shortening.
  • Cytosolic Ca 2+ regulates the nuclear translocation of some transcription factors and the expression of Ca 2+ dependent genes known to contribute to ventricular remodeling.
  • cytosolic to nuclear translocation of the nuclear factor of activated T cells was examined.
  • NFAT is a transcription factor involved in cardiac hypertrophy. Elevated cytosolic [Ca 2+ ]i activates the calmodulin activated serine/threonine protein phosphatase calcineurin which dephosphorylates NFATc resulting in nuclear translocation of NFAT and activation of hypertrophy genes. After ischemia/reperfusion, increased nuclear NFAT was observed (Fig. 4C).
  • NFAT caspase-8 inhibitor
  • Q-LETD-OPh caspase-8 inhibitor
  • Rycal SI 07
  • NFAT was retained in the cytosol at levels similar to those observed in sham operated animals. This may contribute to the reduction in hypertrophy shown in Fig. 3B. Additionally, mRNA levels of the heart failure marker ANF were also significantly reduced with both treatments (Fig. 4D). In addition to lower levels of collagen (Fig. 3A), interstitial fibrosis as evidenced by increased levels of fibronectin mRNA was also prevented by caspase-8 inhibition or SI 07 inhibition of SR Ca 2+ leak (Fig. 4D).
  • Ischemia/reperfusion also increased mRNA levels of molecules involved in TNF-a signaling including, TNFR1, TNFR2, caspase-8 and TNF-a (Fig. 4E).
  • This increase in mRNA levels was prevented by the caspase-8 inhibitor (Q-LETD-OPh) or Rycal (SI 07) suggesting a reduced inflammatory response.
  • LV remodeling following ischemia is caused by multiple factors including: (i) myocardial cell death; (ii) ROS production and inflammatory cytokines; (iii) structural changes of
  • TNFRl is a death-receptor which activates initiator caspases including caspase-8.
  • the resulting activation of caspase-8 is either sufficient to trigger the proteolytic activation of other caspases (i.e., caspase-3), or requires the proteolytic activation of pro-apoptotic proteins of the Bcl2 family, in particular, Bid, which triggers a loss of mitochondrial inner membrane potential ⁇ and ROS generation.
  • caspase-8 inhibition prevented TNF-a-induced loss of ⁇ and mitochondrial release of cytochorme c.
  • the TNF/TNFR1 complex is thought to regulate sphingolipid signaling pathways.
  • TNF-a binds to TNFRl an early weak recruitment of FADD and stimulation of caspase-8 in the cell are sufficient to activate sphingomyelinase.
  • Activation of sphingomyelinase initiates sphingolipid metabolism with ceramide, sphingosine and sphingosine-1 -phosphate formation and permits death-receptor oligomerization and caspase-8 activation.
  • bioactive phospholipids induce cellular responses, such as mitochondrial ROS production and NO synthesis.
  • caspase-8 prevents TNF-a induced mitochondrial dysfunction and NO production (Fig. 1).
  • Concomitant ROS production and NO production would affect cellular signaling most likely through peroxynitrite formation and
  • Oxidation of thiols on RyR2 may activate the channels and under
  • SR Ca 2+ leak is thought to trigger cellular damage after acute ischemia and reperfusion.
  • RyR2 dysfunction after ischemia/reperfusion.
  • Ca 2+ overload has been reported to play a pathological role after reperfusion and ventricular arrhythmias.
  • reperfusion is associated with the recovery of ATP phosphorylation potential, which restores SR Ca 2+ -ATPase activity and increases Ca 2+ sequestration into the SR.
  • SR Ca 2+ overload can cause oscillations of cytosolic Ca 2+ . Short-term oscillations in cytosolic Ca 2+ have been implicated in the genesis of reperfusion arrhythmias.
  • the present study points out a potential involvement of a dual detection mechanisms sensitizing large scale MPTP opening and mitochondrial membrane permeabilization.
  • this sensitizing mechanism suggests that caspase-8-induced mitochondrial depolarization alone, without SR Ca 2+ leak, will not be sufficient to trigger cell death but would require a commitment [Ca 2+ ] m i to oscillations. Discrete modification of the SR Ca 2+ leak may thus be sufficient to prevent large scale swelling and allowing functional recovery of the mitochondria.
  • leaky RyR2 may contribute to mitochondrial Ca 2+ accumulation during ischemia reperfusion and to an amplification loop leading to reperfusion injury given that inhibiting calstabin2 dissociation from the RyR2 complex reduces RyR2 mediated SR Ca 2+ leak and is protective.
  • RyR2/calstabin2 normalization are potential targets for the prevention of the effects of reperfusion, including myocardial cell death, arrhythmias and late left ventricular remodeling after acute myocardial infarction.

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)

Abstract

La présente invention concerne des méthodes et des compositions adaptées au traitement prophylactique et/ou thérapeutique d'une lésion d'ischémie/reperfusion cardiaque (I/R). Dans certains modes de réalisation, les méthodes de la présente invention incluent l'administration à un sujet d'une quantité thérapeutiquement ou prophylactiquement efficace d'un ou de plusieurs des composés suivants : benzothiazépine, benzoxazépine, benzodiazépine ou benzazépine de formule (I) : comme décrit dans la présente.
PCT/US2011/046704 2010-08-06 2011-08-05 Compositions et méthodes de traitement prophylactique ou thérapeutique d'une lésion d'ischémie/reperfusion cardiaque WO2012019076A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US37156910P 2010-08-06 2010-08-06
US61/371,569 2010-08-06

Publications (1)

Publication Number Publication Date
WO2012019076A1 true WO2012019076A1 (fr) 2012-02-09

Family

ID=44513180

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/046704 WO2012019076A1 (fr) 2010-08-06 2011-08-05 Compositions et méthodes de traitement prophylactique ou thérapeutique d'une lésion d'ischémie/reperfusion cardiaque

Country Status (1)

Country Link
WO (1) WO2012019076A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013006485A1 (fr) * 2011-07-01 2013-01-10 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs des canaux ioniques
EP2653466A1 (fr) 2012-04-18 2013-10-23 Les Laboratoires Servier Agents pour le traitement de troubles impliquant la modulation de récepteurs de la ryanodine
WO2015014666A1 (fr) * 2013-07-30 2015-02-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés et compositions pharmaceutiques pour le traitement de la dysfonction diaphragmatique induite par la ventilation mécanique
US8952034B2 (en) 2009-07-27 2015-02-10 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US8962610B2 (en) 2011-07-01 2015-02-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
AU2013201608B2 (en) * 2011-07-01 2015-07-09 Gilead Sciences, Inc. Fused benzoxazepinones as ion channel modulators
US9079901B2 (en) 2010-07-02 2015-07-14 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9115096B2 (en) 2011-05-10 2015-08-25 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
AU2015224425B2 (en) * 2011-07-01 2017-02-09 Gilead Sciences, Inc. Fused benzoxazepinones as ion channel modulators
EP3326715A4 (fr) * 2015-07-20 2019-01-23 Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences Ligand de monoamide d'acide oxalique, et ses usages dans une réaction de couplage de substitut halogéné d'aryle catalysé au cuivre

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005094457A2 (fr) * 2004-03-25 2005-10-13 The Trustees Of Columbia University In The City Of New York Nouveaux medicaments anti-arhythmiques contre l'infarctus ciblant la fuide du recepteur de ryanodine (ryr2) et leurs utilisations
EP1731529A1 (fr) * 2004-03-31 2006-12-13 Otsuka Pharmaceutical Co., Ltd. Inhibiteurs de la fuite de ions calcium
WO2007024717A2 (fr) 2005-08-25 2007-03-01 The Trustees Of Columbia University In The City Of New York Agents permettant de prevenir et de traiter des troubles entrainant la modulation des recepteurs ryr
WO2009080730A1 (fr) * 2007-12-21 2009-07-02 Glaxo Group Limited Composés de 1,2,4-oxadiazole pour le traitement de maladies auto-immunes
WO2011002520A2 (fr) * 2009-07-02 2011-01-06 Angion Biomedica Corp. Inhibiteurs à petite molécule de l'activité de parp

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005094457A2 (fr) * 2004-03-25 2005-10-13 The Trustees Of Columbia University In The City Of New York Nouveaux medicaments anti-arhythmiques contre l'infarctus ciblant la fuide du recepteur de ryanodine (ryr2) et leurs utilisations
EP1731529A1 (fr) * 2004-03-31 2006-12-13 Otsuka Pharmaceutical Co., Ltd. Inhibiteurs de la fuite de ions calcium
WO2007024717A2 (fr) 2005-08-25 2007-03-01 The Trustees Of Columbia University In The City Of New York Agents permettant de prevenir et de traiter des troubles entrainant la modulation des recepteurs ryr
WO2009080730A1 (fr) * 2007-12-21 2009-07-02 Glaxo Group Limited Composés de 1,2,4-oxadiazole pour le traitement de maladies auto-immunes
WO2011002520A2 (fr) * 2009-07-02 2011-01-06 Angion Biomedica Corp. Inhibiteurs à petite molécule de l'activité de parp

Non-Patent Citations (65)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING COMPANY, pages: 1635 - 36
ASHKENAZI, A., DIXIT, V.M.: "Death receptors: signaling and modulation", SCIENCE, vol. 281, 1998, pages 1305 - 1308, XP002223057, DOI: doi:10.1126/science.281.5381.1305
BARSACCHI, R. ET AL.: "Cyclic GMP-dependent inhibition of acid sphingomyelinase by nitric oxide: an early step in protection against apoptosis", CELL DEATH DIFFER, vol. 9, 2002, pages 1248 - 1255, XP002556782, DOI: doi:10.1038/sj.cdd.4401095
BELEVYCH, A.E. ET AL.: "Redox modification of ryanodine receptors underlies calcium alternans in a canine model of sudden cardiac death", CARDIOVASC RES, vol. 84, 2009, pages 387 - 395
BELLINGER, A.M. ET AL.: "Hypernitrosylated ryanodine receptor calcium release channels are leaky in dystrophic muscle", NAT MED, vol. 15, 2009, pages 325 - 330, XP002729938, DOI: doi:10.1038/nm.1916
BERGE: "Pharmaceutcial Salts", J. PHARM SCI., vol. 66, no. 1, 1977, pages 1 - 19
BERGER, A.B., SEXTON, K.B., BOGYO, M.: "Commonly used caspase inhibitors designed based on substrate specificity profiles lack selectivity", CELL RES, vol. 16, 2006, pages 961 - 963
BROOKS, W.W., CONRAD, C.H., MORGAN, J.P.: "Reperfusion induced arrhythmias following ischacmia in intact rat hcart: role ofintraccllular calcium", CARDIOVASC RES, vol. 29, 1995, pages 536 - 542
BUJA, L.M.: "Myocardial ischemia and reperfusion injury", CARDIOVASC PATHOL, vol. 14, 2005, pages 170 - 175, XP004973871, DOI: doi:10.1016/j.carpath.2005.03.006
BULOTTA, S., BARSACCHI, R., ROTIROTI, D., BORGESE, N., CLEMENTI, E.: "Activation of the endothelial nitric-oxide synthase by tumor necrosis factor-alpha. A novel feedback mechanism regulating cell death", JBIOL CHEM, vol. 276, 2001, pages 6529 - 6536
CHAUVIER, D., ANKRI, S., CHARRIAUT-MARLANGUE, C., CASIMIR, R., JACOTOT, E.: "Broadspectrum caspase inhibitors: from myth to reality?", CELL DEATH DIFFER, vol. 14, pages 387 - 391, XP002689265, DOI: doi:10.1038/sj.cdd.4402044
COLETTA, A., THACKRAY, S., NIKITIN, N., CLELAND, J.G.: "Clinical trials update: highlights of the scientific sessions of The American College of Cardiology 2002: LIFE, DANAMI 2, MADIT-2, MIRACLE-ICD, OVERTURE, OCTAVE, ENABLE 1 & 2, CHRISTMAS, AFFIRM, RACE, WIZARD, AZACS, REMATCH, BNP trial and HARDBALL", EUR J HEART FAIL, vol. 4, 2002, pages 381 - 388
COLETTA, A.P., CLARK, A.L., BANAIJEE, P., CLELAND, J.G: "Clinical trials update: RENEWAL (RENAISSANCE and RECOVER) and ATTACH", EURJ HEART FAI, vol. 4, 2002, pages 559 - 561
COLETTA, A.P., LOUIS, A.A., CLARK, A.L., NIKITIN, N., CLELAND, J.G.: "Clinical trials update from the European Society of Cardiology: CARMEN, EARTH, OPTIMAAL, ACE, TENHMS, MAGIC, SOLVD-X and PATH-CHF II", EUR J HEART FAIL, vol. 4, 2002, pages 661 - 666
DEFER, N., AZROYAN, A., PECKER, F., PAVOINE, C.: "TNFR1 and TNFR2 signaling interplay in cardiac myocytes", JBIOL CHEM, vol. 282, 2007, pages 35564 - 35573, XP055060919, DOI: doi:10.1074/jbc.M704003200
DZIETKO, M. ET AL.: "A critical role for Fas/CD-95 dependent signaling pathways in the pathogenesis of hyperoxia-induced brain injury", ANN NEUROL, vol. 64, 2008, pages 664 - 673
FAUCONNIER J ET AL.: "Leaky RyR2 trigger ventricular arrhythmias in Duchenne muscular dystrophy", PROC NATL ACAD SCI USA, vol. 107, 2010, pages 1559 - 1564
FAUCONNIER, J. ET AL.: "Effects of palmitate on Ca(2+) handling in adult control and ob/ob cardiomyocytes: impact of mitochondrial reactive oxygen species", DIABETES, vol. 56, 2007, pages 1136 - 1142
FAUCONNIER, J. ET AL.: "Insulin potentiates TRPC3-mediated cation currents in normal but not in insulin-resistant mouse cardiomyocytes", CARDIOVASC REV, vol. 73, 2007, pages 376 - 385, XP005835255, DOI: doi:10.1016/j.cardiores.2006.10.018
FINKEL, M.S. ET AL.: "Negative inotropic effects of cytokines on the heart mediated by nitric oxide", SCIENCE, vol. 257, 1992, pages 387 - 389
HALESTRAP, A.P.: "Calcium, mitochondria and reperfusion injury: a pore way to die", BIOCHEM SOC TRANS, vol. 34, 2006, pages 232 - 237
HANNUN, Y.A.: "Functions of ceramide in coordinating cellular responses to stress", SCIENCE, vol. 274, 1996, pages 1855 - 1859
HORI, M., NISHIDA, K.: "Oxidative stress and left ventricular remodelling after myocardial infarction", CARDIOVASC RES, vol. 81, 2009, pages 457 - 464
J. FAUCONNIER ET AL: "Ryanodine receptor leak mediated by caspase-8 activation leads to left ventricular injury after myocardial ischemia-reperfusion", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 32, 25 July 2011 (2011-07-25), pages 13258 - 13263, XP055010196, ISSN: 0027-8424, DOI: 10.1073/pnas.1100286108 *
JAMES ET AL: "Inhibition of SR Ca<2+> uptake: A novel action of the RyR2-FKBP12.6 antagonist K201", CARDIOVASCULAR RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 76, no. 2, 9 October 2007 (2007-10-09), pages 199 - 201, XP022308911, ISSN: 0008-6363, DOI: 10.1016/J.CARDIORES.2007.08.013 *
KEN-ICHIRO ITO ET AL: "JTV-519, a novel cardioprotective agent, improves the contractile recovery after ischaemia-reperfusion in coronary perfused guinea-pig ventricular muscles", BRITISH JOURNAL OF PHARMACOLOGY, vol. 130, no. 4, 1 June 2000 (2000-06-01), pages 767 - 776, XP055010303, ISSN: 0007-1188, DOI: 10.1038/sj.bjp.0703373 *
KIHARA, Y., MORGAN, J.P.: "Abnormal Cai2+ handling is the primary cause of mechanical alternans: study in ferret ventricular muscles", AM JPHYSIOL, vol. 261, 1991, pages HI 746 - 1755
KOJIMA, H. ET AL.: "Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluorcsccins", ANAL CHEM, vol. 70, 1998, pages 2446 - 2453, XP000776685, DOI: doi:10.1021/ac9801723
KROEMER, G., GALLUZZI, L., BRENNER, C.: "Mitochondrial membrane permeabilization in cell death", PHYSIOL REV, vol. 87, 2007, pages 99 - 163
KROWN, K.A. ET AL.: "TNF alpha receptor expression in rat cardiac myocytes: TNF alpha inhibition of L-type Ca2+ current and Ca2+ transients", FEBS LETT, vol. 376, 1995, pages 24 - 30
LAFONT, E. ET AL.: "Caspase-mediated inhibition of sphingomyelin synthesis is involved in FasL-triggered cell death", CELL DEATH DIFFER, vol. 17, pages 642 - 654
LAKATTA, E.G., GUARNIERI, T., J CARDIOVASC ELECTROPHYSIOL, vol. SPONTANE, 1993, pages 473 - 489
LAKIREDDY, V. ET AL.: "The kinetics of spontaneous calcium oscillations and arrhythmogenesis in the in vivo heart during ischemia/reperfusion", HEART RHYTHM, vol. 3, 2006, pages 58 - 66
LONDON, B. ET AL.: "Calcium-dependent arrhythmias in transgenic mice with heart failure", AM J PHYSIOL HEART CIRC PHYSIOL, vol. 284, 2003, pages H431 - 441
LUO, X., BUDIHARDJO, I., ZOU, H., SLAUGHTER, C., WANG, X.: "Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors", CELL, vol. 94, 1998, pages 481 - 490, XP002380107, DOI: doi:10.1016/S0092-8674(00)81589-5
MACIEJEWSKI, J.P ET AL.: "Nitric oxide suppression of human hematopoiesis in vitro. Contribution to inhibitory action of interferon-gamma and tumor necrosis factor-alpha", J CLIN INVEST, vol. 96, 1995, pages 1085 - 1092
MANN, D.L. ET AL.: "Targeted anticytokine therapy in patients with chronic heart failure: results of the Randomized Etanercept Worldwide Evaluation (RENEWAL", CIRCULATION, vol. 109, 2004, pages 1594 - 1602
MOLKENTIN, J.D.: "Calcineurin and beyond: cardiac hypertrophic signaling", CIRC RES, vol. 87, 2000, pages 731 - 738
MURPHY, E., STEENBERGEN, C.: "Mechanisms underlying acute protection from cardiac ischemia-reperfusion injury", PHYSIOL REV, vol. 88, 2008, pages 581 - 609
P. HEINRICH STAHL, CAMILLE G. WERMUTH: "Handbook of Pharmaceutical Salts : Properties, Selection, and Use"
PACHER, P., BECKMAN, J.S., LIAUDET, L.: "Nitric oxide and peroxynitrite in health and disease", PHYSIOL REV, vol. 87, 2007, pages 315 - 424, XP055076022, DOI: doi:10.1152/physrev.00029.2006
PASSIER, R. ET AL.: "CaM kinase signaling induces cardiac hypertrophy and activates the MEF2 transcription factor in vivo", J CLIN INVEST, vol. 105, 2000, pages 1395 - 1406, XP002512493, DOI: doi:10.1172/JCI8551
PENG, J., GURANTZ, D., TRAN, V., COWLING, R.T., GREENBERG, B.H.: "Tumor necrosis factor-alpha-induced AT] receptor upregulation enhances angiotensin II-mediated cardiac fibroblast responses that favor fibrosis", CIRC RES, vol. 91, 2002, pages 1119 - 1126
PEREIRA, N.A., SONG, Z.: "Some commonly used caspase substrates and inhibitors lack the specificity required to monitor individual caspase activity", BIOCHEM BIOPHYS RES COMMUN, vol. 377, 2008, pages 873 - 877, XP025676967, DOI: doi:10.1016/j.bbrc.2008.10.101
PETER, M.E., KRAMMER, P.H.: "The CD95(APO-1/Fas) DISC and beyond", CELL DEATH DIFFER, vol. 10, 2003, pages 26 - 35
PIPCR, H.M., MCUTCR, K., SCHAFCR, C.: "Cellular mechanisms ofischcmia-rcpcrfusion injury", ANN THORAC SURG, vol. 75, 2003, pages 644 - 648
RICHARD P. HAUGHLAND: "Handbook of Fluorescent Probes and Research Chemicals", 1996, MOLECULAR PROBES
ROTOLO, J.A. ET AL.: "Caspase-dependent and -independent activation of acid sphingomyelinase signaling", J BIOL CHEM, vol. 280, 2005, pages 26425 - 26434
RUIZ-MEANA, M., ABELLAN, A., MIRO-CASAS, E., AGULLO, E., GARCIA-DORADO, D.: "Role of sarcoplasmic reticulum in mitochondrial permeability transition and cardiomyocyte death during reperfusion", AM J PHYSIOL HEART CIRC PHYSIOL, vol. 297, 2009, pages H1281 - 1289
SACK, M.N., SMITH, R.M., OPIE, L.H.: "Tumor necrosis factor in myocardial hypcrtrophy and ischacmia--an anti-apoptotic pcrspcctivc", CARDIOVASC RES, vol. 45, 2000, pages 688 - 695
SCAFFIDI, C. ET AL.: "Two CD95 (APO-1/Fas) signaling pathways", EMBO J, vol. 17, 1998, pages 1675 - 1687, XP002929050, DOI: doi:10.1093/emboj/17.6.1675
SCHULZE-OSTHOFF, K. ET AL.: "Cytotoxic activity of tumor necrosis factor is mediated by early damage of mitochondrial functions. Evidence for the involvement of mitochondrial radical generation", JBIOL CHEM, vol. 267, 1992, pages 5317 - 5323
SUEMATSU, N. ET AL.: "Oxidative stress mediates tumor necrosis factor-alpha-induced mitochondrial DNA damage and dysfunction in cardiac myocytes", CIRCULATION, vol. 107, 2003, pages 1418 - 1423
TORRE-AMIONE, G. ET AL.: "Expression and functional significance of tumor necrosis factor receptors in human myocardium", CIRCULATION, vol. 92, 1995, pages 1487 - 1493
WCHRCNS XH, LCHNART SE, RCIKCN SR, MARKS AR: "Ca2+/calmodulin- dependent protein kinase II phosphorylation regulates the cardiac ryanodine receptor", CIRC RES, vol. 94, 2004, pages E61 - 70
WILKINS, B.J., MOLKCNTIN, J.D.: "Calcium-calcincurin signaling in the regulation of cardiac hypertrophy", BIOCHEM BIOPHYS RES COMMUN, vol. 322, 2004, pages 1178 - 1191, XP004536603, DOI: doi:10.1016/j.bbrc.2004.07.121
XIAO, H. ET AL.: "Positive correlation of tumor necrosis factor-alpha early expression in myocardium and ventricular arrhythmias in rats with acute myocardial infarction", ARCH MED RE.S, vol. 39, 2008, pages 285 - 291, XP022476908, DOI: doi:10.1016/j.arcmed.2007.10.004
XU, L., EU, J.P, MCISSNCR, G., STAMLCR, J.S.: "Activation of the cardiac calcium release channel (ryanodine receptor) by poly-S-nitrosylation", SCIENCE, vol. 279, 1998, pages 234 - 237
YAN, Y. ET AL.: "Bidirectional regulation of Ca2+ sparks by mitochondria-derived reactive oxygen species in cardiac myocytes", CARDIOVASC RES, vol. 77, 2008, pages 432 - 441
YANO, M. ET AL.: "Correction of defective interdomain interaction within ryanodine receptor by antioxidant is a new therapeutic strategy against heart failure", CIRCULATION, vol. 112, 2005, pages 3633 - 3643
YELLON, D.M., HAUSENLOY, D.J., MYOCARDIAL REPERFUSION INJURY, N ENGL J MED, vol. 357, 2007, pages 1121 - 1135
ZHU, J., LIU, M., KENNEDY, R.H., LIU, S.J.: "TNF-alpha-induced impairment of mitochondrial integrity and apoptosis mediated by caspase-8 in adult ventricular myocytes", CYTOKINE, vol. 34, 2006, pages 96 - 105
ZIMA, A.V., BLATTER, L.A.: "Redox regulation of cardiac calcium channels and transporters", CARDIOVASC RES, vol. 71, 2006, pages 310 - 321, XP025011367, DOI: doi:10.1016/j.cardiores.2006.02.019
ZUCCHI, R. ET AL.: "Effect of ischemia and reperfusion on cardiac ryanodine receptors-sarcoplasmic reticulum Ca2+ channels", CIRC RES, vol. 74, 1994, pages 271 - 280
ZUCCHI, R., RONCA, F., RONCA-TESTONI, S.: "Modulation of sarcoplasmic reticulum function: a new strategy in cardioprotection?", PHARMACOL THER, vol. 89, 2001, pages 47 - 65

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8952034B2 (en) 2009-07-27 2015-02-10 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9371329B2 (en) 2009-07-27 2016-06-21 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9079901B2 (en) 2010-07-02 2015-07-14 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9682998B2 (en) 2011-05-10 2017-06-20 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9403782B2 (en) 2011-05-10 2016-08-02 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9115096B2 (en) 2011-05-10 2015-08-25 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US8962610B2 (en) 2011-07-01 2015-02-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9598435B2 (en) 2011-07-01 2017-03-21 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
AU2012279236B2 (en) * 2011-07-01 2015-05-14 Gilead Sciences, Inc. Fused benzoxazepinones as ion channel modulators
AU2013201608B2 (en) * 2011-07-01 2015-07-09 Gilead Sciences, Inc. Fused benzoxazepinones as ion channel modulators
EA027356B1 (ru) * 2011-07-01 2017-07-31 Джилид Сайэнс, Инк. Конденсированные гетероциклические соединения в качестве модуляторов ионных каналов
AU2013201608B9 (en) * 2011-07-01 2015-07-23 Gilead Sciences, Inc. Fused benzoxazepinones as ion channel modulators
US9695192B2 (en) 2011-07-01 2017-07-04 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9193694B2 (en) 2011-07-01 2015-11-24 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
US9676760B2 (en) 2011-07-01 2017-06-13 Gilead Sciences, Inc. Fused heterocyclic compounds as ion channel modulators
WO2013006485A1 (fr) * 2011-07-01 2013-01-10 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs des canaux ioniques
EP3085696A1 (fr) * 2011-07-01 2016-10-26 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs de canaux ioniques
EP3085694A1 (fr) * 2011-07-01 2016-10-26 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs de canaux ioniques
EP3088395A1 (fr) * 2011-07-01 2016-11-02 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs de canaux ioniques
EP3098218A1 (fr) * 2011-07-01 2016-11-30 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs de canaux ioniques
EP3101013A1 (fr) * 2011-07-01 2016-12-07 Gilead Sciences, Inc. Benzoxazépinones fusionnés en tant que modulateurs de canaux ioniques
AU2015224425B2 (en) * 2011-07-01 2017-02-09 Gilead Sciences, Inc. Fused benzoxazepinones as ion channel modulators
WO2013156505A1 (fr) 2012-04-18 2013-10-24 Les Laboratoires Servier Agents pour le traitement de troubles mettant en jeu la modulation de récepteurs de ryanodine
EP2653466A1 (fr) 2012-04-18 2013-10-23 Les Laboratoires Servier Agents pour le traitement de troubles impliquant la modulation de récepteurs de la ryanodine
US8853198B2 (en) 2012-04-18 2014-10-07 Les Laboratoires Servier Agents for treating disorders involving modulation of ryanodine receptors
MD4489C1 (ro) * 2012-04-18 2018-01-31 Les Laboratoires Servier Derivaţi de 1,4-benzotiazepină, procedeu de sinteză a lor, compoziţii farmaceutice care le conţin şi utilizarea acestora pentru tratarea sau prevenirea afecţiunilor care implică modularea receptorilor de rianodină
EP2708535A1 (fr) 2012-05-11 2014-03-19 Les Laboratoires Servier Agents pour le traitement de troubles impliquant la modulation de récepteurs de la ryanodine
WO2015014666A1 (fr) * 2013-07-30 2015-02-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés et compositions pharmaceutiques pour le traitement de la dysfonction diaphragmatique induite par la ventilation mécanique
EP3326715A4 (fr) * 2015-07-20 2019-01-23 Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences Ligand de monoamide d'acide oxalique, et ses usages dans une réaction de couplage de substitut halogéné d'aryle catalysé au cuivre
US10500577B2 (en) 2015-07-20 2019-12-10 CE Pharm CO., LTD Oxalic amide ligands, and uses thereof in copper-catalyzed coupling reaction of aryl halides

Similar Documents

Publication Publication Date Title
WO2012019076A1 (fr) Compositions et méthodes de traitement prophylactique ou thérapeutique d&#39;une lésion d&#39;ischémie/reperfusion cardiaque
ES2405765T3 (es) Agentes para evitar y tratar trastornos que implican la modulación de los receptores de RyR
AU2013248313B2 (en) Agents for treating disorders involving modulation of ryanodine receptors
CN103958475B (zh) 杂芳基异羟肟酸衍生物及其在治疗、减轻或预防病毒疾病中的用途
WO2012019071A1 (fr) Méthodes de traitement prophylactique et thérapeutique de la sarcopénie
WO2008060332A2 (fr) Méthodes pour traiter ou réduire la fatigue musculaire
WO2012037105A1 (fr) Procédés de traitement, d&#39;amélioration ou de prévention de troubles et de maladies neuronaux induits par le stress
PT1487424E (pt) 4-(4-metilpiperazin-1-ilmetil)-n-[4-metil-3-(4-piridin-3-il)pirimidin-2-il-amino)fenil]-benzamida para o tratamento doenças mediadas por ang ii
EP3176164B1 (fr) Isomère optique de dérivé de 1,4-benzothiazépine-1-oxyde, et composition pharmaceutique préparée à l&#39;aide de celui-ci
JP5663014B2 (ja) 虚血および／または再灌流関連疾患の処置に使用されるジヒドロ−１，３，５−トリアジンのアミノ誘導体
JP2818082B2 (ja) ベンゾチアゼピン誘導体
WO2008021439A2 (fr) Compositions et méthodes de traitement de l&#39;hypertrophie cardiaque
WO1999040919A1 (fr) Medicaments contre les troubles diastoliques cardiaques
KR20150135110A (ko) p-당단백질의 저해제 및 p-당단백질의 기질 약물을 포함하는 약제학적 조성물
KR102384381B1 (ko) 헥사하이드로디벤조[a,g]퀴놀리진계 화합물의 약물 용도
WO2015014666A1 (fr) Procédés et compositions pharmaceutiques pour le traitement de la dysfonction diaphragmatique induite par la ventilation mécanique
JP2012131710A (ja) 制癌剤耐性を有する癌細胞に対する抗腫瘍効果増強剤
JP2004250447A (ja) 心血管病の治療又は予防の為の医薬組成物
JP2000302778A (ja) イソキノリノン誘導体又はその塩
BRPI0409718B1 (pt) Derivative of 4,4-difluor-1,2,3,4-tetraidro-5h-1-benzazepine or its salt

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11743749

Country of ref document: EP

Kind code of ref document: A1

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11743749

Country of ref document: EP

Kind code of ref document: A1