WO2011159000A1 - 산화된 저밀도 지질단백질 및 카바밀레이트화된 저밀도 지질단백질에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편 - Google Patents
산화된 저밀도 지질단백질 및 카바밀레이트화된 저밀도 지질단백질에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편 Download PDFInfo
- Publication number
- WO2011159000A1 WO2011159000A1 PCT/KR2010/008219 KR2010008219W WO2011159000A1 WO 2011159000 A1 WO2011159000 A1 WO 2011159000A1 KR 2010008219 W KR2010008219 W KR 2010008219W WO 2011159000 A1 WO2011159000 A1 WO 2011159000A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- fab
- monoclonal antibody
- human monoclonal
- ldl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
Definitions
- the present invention provides a human monoclonal antibody or antigen-binding fragment thereof (Antigen-) that specifically binds to oxidized low-density lipoprotein (oxLDL) and carbamylated low-density lipoprotein (carLDylated LDL; cLDL).
- Antigen- oxidized low-density lipoprotein
- cLDL carbamylated low-density lipoprotein
- Binding Fragment (Fab) and more specifically, specifically binds to MDA-LDL, Cu-LDL and cLDL, prepared using combinatorial antibody library and phage display technology. It relates to a human monoclonal antibody and antigen-binding fragment plaques 15, 16-46 (plaque 15, 16-46).
- Atherosclerosis is a chronic disease in which soft masses, called aatheromas or plaques, accumulate inside the arteries (Hansson, 2005). During the plaque formation process, cell debris, smooth muscle cells and macrophage accumulate, and the oxidation of LDL is known to be involved in early plaque formation (Goncalves et al., Atherosclerosis , 205: 96-100, Lewis et al., Circulation , 120: 417-426, 2009, Jeon et al., Molecular Immunology , 44: 827-836, 2007).
- Atherovascular vascular diseases include aneurysms, cerebral atherosclerosis, cerebral infarction, cerebral hemorrhage, angina pectoris, myocardial infarction, kidney sclerosis, retinal arteriosclerosis, and arterial occlusion.
- the circulating cholesterol is carried by plasma lipoproteins, which are particles of complex lipids and protein compositions that transport blood lipids.
- Low density lipoprotein (LDL) and high density lipoprotein (HDL) are major cholesterol carriers.
- LDL is believed to be responsible for delivering cholesterol from the liver (where cholesterol is synthesized or obtained from a dietary source) to extrahepatic tissue in the body.
- LDL has been popularly known as "bad" cholesterol because convincing evidence has been provided to support the notion that lipids deposited on atherosclerotic lesions are primarily derived from plasma LDL.
- plasma HDL levels are inversely correlated with coronary heart disease, high plasma HDL levels are considered as negative risk factors.
- Oxidative Low Density Lipoprotein (OXLL), etc., promotes the formation of atheromatous masses through inflammatory and immune responses in the vascular wall membrane mattress.
- the cells are filled with bubbles and are sometimes called foam cells (Osto et al., Circulation, 118: 2174-2182, 2008; Jeon et al ., 2007).
- Most of the cholesterol found in plaques is a result of foam cells ingesting oxLDL, so high plasma LDL levels are associated with a high incidence of disease. Therefore, high-fat diet, smoking, stress, lack of exercise, etc. are considered as risk factors of these diseases, and are emerging as one of serious diseases in modern society.
- oxLDL has been reported to induce cardiovascular diseases in vivo (Faviou et al., Free Radic. Res., 39 (4): 419-29, 2005; Hiki et al., Journal of Cardiology , 53: 108-116, 2009). Increased oxLDL in plaques and plasma is also associated with the risk of atherosclerotic lesions (Nishi et al., Arteriosclerosis, Thrombosis, and Vascular Biology, 22: 1649, 2002). The cause of atherosclerotic vascular disease has not been determined, but recent studies have shown that macrophages found in atherosclerotic plaques have LDL receptors with high levels of affinity for oxLDL.
- oxLDL produces lipid peroxidation products such as reactive aldehydes, phospholipids, and malondialdehyde-modified LDL (MDA-LDL) that are chemically modified by malondialdehyde.
- MDA-LDL and Cu-LDL As a representative example of oxLDL, oxidation occurs mainly on the free amino group of apoB.
- Atherosclerotic lesions include substances with physical and immunochemical properties similar to oxLDL or MDA-LDL (Itabe et al., J. Biol. Chem, 269 (21): 15274-15279, 1994).
- the concentration of antibody against MDA-LDL is high in plasma of cardiovascular disease, atherosclerosis patients, hypercholesterolemic rabbits, and apoE-/-or LDL receptor deficient mice, and is related to the progression of atherosclerosis.
- Autoantibodies to oxLDL are also present in patients with preeclampsia, a maternal disease (Fialova et al. ).
- cyanate levels and protein carbamylation caused by cyanate are increased in chronic kidney disease, thereby increasing the risk of atherosclerosis.
- cLDL causes vascular cell injury.
- Vascular cell injury involves the death of endothelial cells (EC) and the proliferation of vascular smooth muscle cells. It is well known that the death of endothelial cells (EC) is an early symptom of atherosclerosis. EC injury is also associated with the degree of LDL carbamylation. In patients with advanced kidney disease receiving hemodialysis, plasma cLDL levels are many times higher than in healthy individuals. (Ok et al., Kidney International , 68: 173, 2005).
- cLDL also contributes to the pathogenesis of atherosclerosis in patients with uremic disorders (urea-increased urea levels in patients with renal disease, which causes protein carbamylation of urea to cyanate).
- Treatment of cLDL to human aortic vascular smooth muscle cells (VSMC) increases morphological changes and proliferation, and expression of intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 (Asci et al., Nephrology 13: 480, 2008). (Apostolov et al., Arterioscler. Thromb. Vasc. Biol. 27: 826, 2007).
- cLDL induces EC proliferation, which is via mitogen-activated protein kinases (MAPKs), which induces EC killing.
- MAPKs mitogen-activated protein kinases
- the combination of cell proliferation and death leads to high turnover of vascular EC (Apostolov et al., J. Physiol. Heart. Circ. Physiol. 292: 1836, 2007).
- LOX-1 a scavenger receptor of EC
- cLDL binds to EC's LOX-1 and shows cytotoxicity and monocyte adhesion to accelerated EC (Apostolov et al., Arterioscler. Thromb. Vasc. Biol . 29: 1622, 2009).
- Antibodies that are available only to humans or mice are effective only in their respective species, for example, they cannot use one antibody from the experimental animal phase to the clinical trial phase during drug development, Humanization was essential for the step application. This requires a large cost economically, the development of new drugs and the study of diseases have been required to develop antibodies that can be used consistently in both humans and mice, but the research is insufficient.
- the present inventors have tried to isolate human monoclonal antibodies that specifically bind to substances present in lesions of atherosclerotic diseases such as oxLDL and cLDL.
- oxLDL and cLDL substances present in lesions of atherosclerotic diseases
- cLDL atherosclerotic diseases
- arteries in both humans and mice By specifically binding to curable plaques, isolated human monoclonal antibodies and antigen-binding fragments thereof, plaques 15 and 16-46 (plaque 15, 16-46), which are highly industrially available, such as drug development, are characterized and characterized.
- the present invention has been completed.
- An object of the present invention is a human monoclonal antibody or antigen-binding fragment thereof that specifically binds to oxidized LDL (oxLDL) and carbamylated LDL (Parque 15, 16-46). 46).
- Another object of the present invention is to provide a composition for diagnosing atherosclerosis containing the human monoclonal antibody or antigen-binding fragment thereof.
- the present invention provides a heavy chain variable region comprising heavy chain CDRs of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, oxidized LDL (oxLDL) and carbamylated low density lipoprotein (provided are a human monoclonal antibody (mAb) or an antigen binding fragment (Fab) thereof which specifically binds to carbamylated LDL; cLDL).
- mAb monoclonal antibody
- Fab antigen binding fragment
- the invention also relates to oxidized LDL (oxLDL) and carbamylated low density lipoprotein (cLDL), comprising a light chain variable region comprising the light chain CDRs of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6
- oxLDL oxidized LDL
- cLDL carbamylated low density lipoprotein
- mAb human monoclonal antibody
- Fab antigen binding fragment thereof
- the present invention also provides a heavy chain variable region comprising the heavy chain CDRs of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 and a light chain variable region comprising the light chain CDRs of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, Human Monoclonal Antibody (mAb) or Antigen Binding Fragment (Fab) thereof that specifically binds to Oxidized LDL (oxLDL) and Carbamylated Low Density Lipoprotein (cLDL) To provide.
- mAb Monoclonal Antibody
- Fab Antigen Binding Fragment
- the present invention also provides oxidized LDL (oxLDL) and cLDL specific human monoclonal antibodies or antigen-binding fragments thereof containing the heavy chain variable region represented by SEQ ID NO: 21.
- the present invention also provides an oxLDL and cLDL specific human monoclonal antibody or antigen-binding fragment thereof containing the light chain variable region represented by SEQ ID NO: 22.
- the present invention also provides an oxLDL and cLDL specific human monoclonal antibody or antigen-binding fragment thereof containing the heavy chain variable region represented by SEQ ID NO: 21 and the light chain variable region represented by SEQ ID NO: 22.
- the present invention also provides a DNA sequence encoding the human monoclonal antibody or antigen-binding fragment thereof.
- the present invention also provides a composition for diagnosing atherosclerosis containing the human monoclonal antibody or antigen-binding fragment thereof.
- the atherosclerotic vascular disease may be selected from the group consisting of aneurysms, cerebral arteriosclerosis, cerebral infarction, cerebral hemorrhage, angina pectoris, myocardial infarction, nephropathy, retinal arteriosclerosis, and arterial obstruction.
- Figure 1 shows the amino acid sequence of the V H and V L genes of the plaque 15, 16-46 (plaque 15, 16-46) Fab, DNA sequence is GenBank accession No. AY957524 and AAY957525 were used. The same amino acid sequence was denoted by-and the amino acid substituted by mutation was indicated in red as compared to the Germline gene.
- Figure 2 is a photo of the result of amplifying the AID mRNA transcribed from the plaque and PBMC by RT-PCR column 1 DNA 100bp ladder marker, column 2 patient plaque results, column 3 electrophoresis of the PBMC results.
- Figure 3 is an immunoblot photograph of purified plaque 15, 16-46 (plaque 15, 16-46) Fab, showing the passage of whole bacterial pellets (column 1), soluble extract (column 2), soluble extracts through the column.
- Fab (4 rows), which lost bound material when passing through the column (3 columns) and soluble extracts, were separated by SDS-PAGE under non-reducing conditions and detected by anti-human IgG mAb (Fab specific). It is a photograph.
- FIG. 4 is plaque 15, 16-46 Fab ELISA results for LDL and HDL chemically modified in different forms.
- FIG. 5 is a photograph of IF and IHC analysis of the recognition of sclerotic lesions of human, rat, control, etc. by plaque 15, 16-46 (plaque 15, 16-46) Fab.
- a fragment that binds to the MDA-LDL antigen is newly isolated using phage display technology, and the separated antigen-binding fragment (Fab) is specifically bound to MDA-LDL and Cu-LDL, which are representative forms of oxLDL.
- Fab antigen-binding fragment
- the present invention provides an oxidized low density lipoprotein (oxLDL) and a carbamylated low density lipoprotein (Carbamylated) containing a heavy chain variable region comprising the heavy chain CDRs of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3
- oxLDL oxidized low density lipoprotein
- carbamylated low density lipoprotein carbamylated low density lipoprotein
- the present invention relates to a human monoclonal antibody (mAb) or an antigen binding fragment thereof (Fab) that specifically binds to LDL; cLDL).
- the light chain variable region of the antibody or Fab preferably contains the light chain CDRs of SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, but may be a known light chain variable region.
- the present invention provides an oxidized low density lipoprotein (oxLDL) and a carbamylated low density lipoprotein (Carbamylated) containing a light chain variable region comprising the light chain CDRs of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6
- oxLDL oxidized low density lipoprotein
- carbamylated low density lipoprotein carbamylated containing a light chain variable region comprising the light chain CDRs of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6
- mAb human monoclonal antibody
- Fab antigen binding fragment thereof
- the heavy chain variable region of the antibody or Fab preferably contains the heavy chain CDRs of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, but may be a known heavy chain variable region.
- a preferred embodiment of the present invention comprises a heavy chain variable region comprising the heavy chain CDRs of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 and a light chain variable region comprising the light chain CDRs of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 .
- the heavy chain variable region it may be characterized in that it comprises a heavy chain FR region of SEQ ID NO: 7 to SEQ ID NO: 10.
- the light chain variable region may be characterized in that it comprises a light chain FR region of SEQ ID NO: 11 to SEQ ID NO: 14.
- Another preferred embodiment of the present invention contains the heavy chain variable region represented by SEQ ID NO: 21.
- the heavy chain variable region represented by SEQ ID NO: 21 includes the CDR and FR regions of SEQ ID NOs: 1 to 3 and SEQ ID NOs: 7 to 10.
- Another preferred embodiment of the present invention contains a light chain variable region represented by SEQ ID NO: 22.
- the heavy chain variable region represented by SEQ ID NO: 22 includes the CDR and FR regions of SEQ ID NOs: 4 to 6 and SEQ ID NOs: 11 to 14.
- the most preferable aspect of this invention contains the heavy chain variable region represented by SEQ ID NO: 21, and the light chain variable region represented by SEQ ID NO: 22.
- amino acid used in the present invention means all amino acids existing in nature, and preferably, amino acids represented as follows according to the three-letter or one-letter notation of the alphabet used to denote amino acids, respectively. it means.
- Glycine (Gly / G), Alanine (Ala / A), Valine (Val / V), Leucine (Leu / L), Isoleucine (Ile / I), Serine (Ser / S), Threonine (Thr / T), Aspartic Acid (Asp / D), glutamic acid (Glu / E), asparagine (Asn / N), glutamine (Gln / Q), lysine (Lys / K), arginine (Arg / R), cysteine (Cys / C), methionine ( Met / M), phenylalanine (Phe / F), tyrosine (Tyr / Y), tryptophan (Trp / W), histidine (His / H), proline (Pro / P).
- the human monoclonal antibody means a human immunoglobulin in which all regions including the variable and normal regions of the H chain and the L chain are derived from a gene encoding human immunoglobulin.
- the L chain include human ⁇ chain or human ⁇ chain.
- the human monoclonal antibody of the present invention may be a human monoclonal antibody having an isotype of any one of IgG (IgG1, IgG2, IgG3, IgG4), IgM, IgA (IgA1, IgA2), IgD or IgE.
- the human monoclonal antibody can be prepared according to the existing general monoclonal antibody production method using human antibody-producing transgenic non-human mammals such as human antibody-producing transgenic mice which are generally used.
- a recombinant E. coli cell producing a recombinant human monoclonal antibody obtained by transforming a host cell by cDNA encoding each of the heavy and light chains of such a human monoclonal antibody of the present invention. It may be a method obtained from the culture broth by culturing.
- the present invention relates to a DNA sequence encoding the human monoclonal antibody or antigen-binding fragment thereof.
- the DNA sequence may include a DNA sequence represented by SEQ ID NOs: 23 and 24.
- SEQ ID NO: 23 is a DNA sequence encoding a heavy chain variable region (V H ) of SEQ ID NO: 21
- SEQ ID NO: 24 is a DNA sequence encoding a light chain variable region (V L ) of SEQ ID NO: 22.
- the DNA sequence can be obtained by phagemid DNA sequencing, the method may be by a method commonly known in the art.
- the antigen-binding fragment (Fab) isolated in the present invention is immunofluorescence on the ApoE-/-rat arterial tissue fragments and atherosclerotic plaques isolated from placental tissue of preeclampsia patients, and arterial plaques of atherosclerotic patients Through analysis (IF) or immunohistochemistry (IHC) analysis, it was confirmed that each tissue atherologic lesion and the antigen-binding fragment (Fab) of the present invention were specifically bound to diagnose the lesion.
- IF analysis
- IHC immunohistochemistry
- the present invention relates to a composition for diagnosing atherosclerotic disease comprising a human monoclonal antibody or an antigen-binding fragment thereof according to the present invention.
- Atherosclerosis may be selected from the group consisting of aneurysms, cerebral arteriosclerosis, cerebral infarction, cerebral hemorrhage, angina pectoris, myocardial infarction, nephropathy, retinal arteriosclerosis, and arterial occlusion.
- the diagnostic composition of the present invention contains a human monoclonal antibody or an antigen-binding fragment thereof according to the present invention, and a sample or a sample sample can be processed into a diagnostic composition to obtain a result.
- the diagnostic composition may be included in the form of a kit or nucleic acid chip commonly used in the art.
- samples including all biological samples obtained from individuals, body fluids, cell lines, tissue cultures, etc., depending on the type of assay that performs the "sample” or "sample sample”. Methods of obtaining bodily fluids and tissue biopsies from mammals are commonly known.
- a preferred source is biopsy of atherosclerotic disease lesions.
- the antigen-binding fragment (Fab) of the present invention is isolated from ApoE-/-rat arterial tissue fragment and placental tissue of human atherosclerosis patient or preeclampsia patient using phage display technology.
- Fab antigen-binding fragment
- the human monoclonal antibody or antigen-binding fragment thereof (Fab) of the present invention specifically binds to an atherologic lesion site, it can be used for diagnosis of atherovascular disease.
- Fab antigen-binding fragment thereof
- it can be used for the treatment and prevention of atherosclerosis by combining the antibody or Fab with drugs and the like.
- a mixed human atherosclerotic plaque obtained from two patients with atherosclerosis was used to generate an Anti-oxLDL monoclonal antibody Fab.
- the Fab was used to determine the relative reactivity of the phage antibody against MDA-LDL and native LDL by the monoclonal antibody Fab clone, plaques 15, 16-46 through the phage display procedure described in Example 1. Selected by comparison. Purchase of Native LDL and HDL was made by Chemicon International. MDA modifications for the production of MDA-LDL are also described in Fogelman et al. ( Proc. Natl. Acad. Sci., 77 (4I): 2214-2218, 1980).
- V H and V L cDNA sequences were determined using an automated sequencing analyzer (CoreBio Technology, Korea).
- primers represented by the following SEQ ID NOs: 15 and 16 were used.
- BLAST Basic Local Alignment Search Tool
- DNAPLOT V BASE
- V H and V L amino acid sequence was confirmed.
- the analysis of their sequences features is shown in Table 1.
- the genes used by Fab were found to be V H 3-48 and V k 3-20, respectively.
- the region D of V H used the D3-16 gene segment. Compared with the germline sequence, which is most similar to V H and V L of Fab, they have 87.8% and 96.8% similarity, respectively.
- the replacement (R) variation ratio for silent (S) in CDRs of V H is very high (14/0).
- the ratio of FRs in V H is 8/5
- the CDRs in V L are 4/0
- the FRs in V L are 1/3
- many mutations in which amino acids such as Arg, Lys, and His occur are measured in quantity. It was found in the regions of H and V L (6 of 14 and 3 of 5 amino acids, respectively) (FIG. 1 and Table 2).
- higher R / S ratios of CDRs of V H and V L than 2.9 indicate that the mutation in that region was under selection pressure through interaction with the antigen during B-cell development.
- AID activation-induced cytidine deaminase
- plaque 15, 16-46 plaque 15, 16-466 was confirmed that the local expression of mRNA transcription in the atherosclerotic plaque (atherosclerotic plaque) of the patient was made.
- the Correct 335-bp AID RT-PCR product was observed in both patient plaque and PBMC samples.
- non-suppressor family of bacteria TOP10F 'cells were modified with phage Fab DNA.
- the soluble Fabs present in the culture supernatant or plasma membrane space extract are described in Jeon et al. Purification was carried out by using Ni ++ -NTA chromatography by the (2007) method. Purified Fabs were separated by SDS-PAGE under non-reducing conditions and analyzed by immunoblotting.
- Binding properties of Fabs were determined by ELISA.
- 100 microliters of PBS containing 1 microgram of antigen were placed in each well of a 96-well microtiter dish and coated at 4 degrees overnight. Each well was washed three times with PBS, and then reacted with PBS containing 5% BSA for 2 hours at room temperature. Thereafter, the wells were washed three times with PBS containing 0.05% Tween (PBST), and then the Fab was reacted at room temperature for 2 hours, followed by alkaline phosphatase-conjugated goth anti-human IgG antibody (1: And diluted with PBS containing 1% BSA at 5000) for 2 hours at room temperature.
- PBST 0.05% Tween
- Arterial tissue sections from frozen atherosclerosis were analyzed by immunofluorescence (IF Analysis). Human tissues were reacted with 10 ug / ml Fab for 2 hours at room temperature. Thereafter, the reaction was performed with 20 ug / ml FITC-labeled anti human IgG (Vector Labs) at room temperature for 1 hour. Frozen samples of atherosclerotic plaques were purchased from BioChain (Cat # T1236012Hd-4). Fluorescence images were obtained using Olympus fluorescence microscope model BX-61.
- FIG. 5A positively-stained sclerosis plaques could be observed in FIGS. 5A-2 (40-fold magnification) and 5A-3 (200-fold magnification), and negative controls (stained without primary antibody).
- Photograph; Figure 5A-1) (40 times magnified) was clearly seen.
- FIG. 5B foam cells in the sclerosis plaques reacted specifically with Fab and appeared to be stained red.
- FIGS. 5B-3 show a photograph magnified 100 times at the other two points of B-3 (40 times magnification). In the enlarged picture, sclerosis plaques (dark arrows) were seen more clearly.
- Sclerosis plaque sections obtained from placental decidual tissue from preeclampsia patients were analyzed by the IF method using Fab.
- the analysis method is the same as used in Example 4-1.
- Tissue sections were obtained from placental tissues of patients with preeclampsia who visited Obstetrics and Gynecology.
- Fab recognized specially damaged placental tissue vascular deletion arterial cells.
- FIGS. 5C 1-3 200X
- 400X FIGS. 5C4, 5
- cross-sections of atherosclerotic vessels stained with Fab were clearly visible in rounded shapes (FIGS. 5C-2).
- IF without primary antibody was used as a negative control (FIGS. 5C-6).
- single cells were freshly isolated from a portion of tissue isolated for IF and analyzed by CD68 staining and FACS analysis.
- the method of separating single cells is as follows. The membrane portion of the placental tissue isolated during surgery was cut out and washed with PBS until the stained blood was washed away. The cut placenta tissue was placed in petridish and the amount of PBS was added to the tissue. Thereafter, the collagenase was added and left for 3 hours in a CO 2 cell incubator. After filtration using a filter bag, the filtered cell solution was centrifuged for 10 min at 300 g at 4 ° C to quench single cells.
- RBC buffer (NH 4 Cl 8.29g, KHCO 3 1g, EDTA disodium Salt 0.037 mg per 1L) was added to the separated cells 10 times or more and left for 2 minutes, and then centrifuged again at 4 °C and 300g. Separated. This procedure was repeated three times until RBC was completely removed, followed by two more washes with PBS containing 2% FBS. If the tissue remained fine, it was filtered once more using a nylon filter (Spectra / Mesh Nylon Filter, 53 ⁇ m).
- FACS tubes In order to perform FACS analysis on the presence of macrophages using separated single cells using anti-CD68 antibody, put the separated single cells into FACS tubes to be 1 x 10 6 / tube. After the antibody was added, the reaction was carried out for 15 minutes in a 37 °C CO 2 incubator, and washed twice at 1,350rpm for 7 minutes with 2% FBS / PBS. Anti-mouse IgG-FITC was added to 2 ⁇ g / ml as Secondary Ab, and then left in 37 ° C. CO 2 incubator for 15 minutes, and washed twice at 1,350 rpm for 7 minutes with 2% FBS / PBS. Stained macrophages were analyzed by FACS (FACSVantage).
- the ratio (M2) of CD68-positive macrophages among plaque cells was higher than the negative control (34.92% vs 5.16%).
- the monoclonal antibody and antigen-binding fragment thereof include heavy chain variable region (V H ) and light chain variable region (V L ) specific for ox-LDL and cLDL, the diagnosis of atherosclerosis including atherosclerosis, It is useful for prevention and treatment. In addition, it is possible to detect lesions of both humans and rats, and since the antibody can be used in preclinical stages (experimental animal stages) and clinical stages when developing new drugs, it is excellent in economic efficiency.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
본 발명은 산화된 저밀도 지질단백질(ox-LDL) 및 카바밀레이트화된 저밀도 지질단백질(carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편(Antigen Binding Fragment;Fab)에 관한 것으로, 보다 상세하게는, 인간 및 쥐의 아테롬성 플라크 병변에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편, 플라크 15, 16-46 (plaque 15, 16-46)에 관한 것이다. 본 발명에 따른 단일클론 항체 및 그의 항원결합단편은 ox-LDL 및 cLDL에 특이적인 중쇄 가변영역(VH) 및 경쇄 가변영역(VL)을 포함하므로, 동맥경화증을 비롯한 아테롬성 혈관질환의 진단, 예방 및 치료에 있어 유용하다. 또한, 인간과 쥐 모두의 병변의 검출이 가능하여, 신약 개발 시, 전임상 단계(실험 동물 단계)에서 임상 단계에 걸쳐 사용 가능한 새로운 항체이므로, 경제성이 뛰어나다.
Description
본 발명은 산화된 저밀도 지질단백질(Oxidized Low-Density Lipoprotein;oxLDL) 및 카바밀레이트화된 저밀도 지질단백질(carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체 또는 그의 항원결합단편(Antigen-Binding Fragment;Fab)에 관한 것으로, 보다 상세하게는, 조합 항체 라이브러리(combinatorial antibody library) 및 파지 디스플레이(phage display) 기술을 이용하여 제조한, MDA-LDL, Cu-LDL 및 cLDL에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편 플라크 15, 16-46 (plaque 15, 16-46)에 관한 것이다.
아테롬성 혈관질환은 죽종(atheroma) 또는 플라크 (plaque)라고 불리는 연성 덩어리가 동맥의 안쪽에 축적되는 만성 질환이다(Hansson, 2005). 진행성 과정인 플라크 형성과정 동안 세포 파편, 평활근세포 및 대식세포(macrophage)가 축적되며, LDL의 산화과정이 초기 플라크 형성에 관여하는 것으로 알려져 있다(Goncalves et al., Atherosclerosis, 205:96-100, 2009; Lewis et al., Circulation, 120:417-426, 2009, Jeon et al., Molecular Immunology, 44:827-836, 2007). 아테롬성 혈관질환의 예로는 동맥류, 뇌동맥경화증, 뇌경색, 뇌출혈, 협심증, 심근경색, 신장경화증, 망막동맥경화증, 동맥폐색증이 있다.
순환되고 있는 콜레스테롤은, 혈중 지질을 수송하는 복합 지질 및 단백질 조성물 입자인 혈장 지단백질에 의해 운반된다. 저밀도 지단백질 (LDL)과 고밀도 지단백질 (HDL)이 주요 콜레스테롤 운반체이다. LDL은 콜레스테롤을 간 (여기서 콜레스테롤이 합성되거나 또는 식이 공급원으로부터 수득된다)으로부터 신체 내의 간외 조직으로 전달하는데 책임이 있는 것으로 여겨진다. 아테롬성 동맥경화증 병변에 침착된 지질이 주로 혈장 LDL로부터 유래된다는 개념을 뒷받침해주는 설득력있는 증거가 제시되었기 때문에, LDL이 대중적으로 "나쁜" 콜레스테롤으로서 공지되어 왔다. 이와는 달리, 혈장 HDL 수준은 관상 심장질환과 역상관 관계이므로, 실제로 혈장 HDL 수준이 높다는 것은 마이너스 (negative) 위험 요인으로서 간주되고 있다.
산화 LDL(oxdative Low Density Lipoprotein;oxLDL) 등은 혈관벽 외막 매트리스에서 염증반응, 면역반응을 통해 죽종 생성을 촉진시키며, 대식세포는 이러한 손상된 세포막에 붙어있는 oxLDL로부터 콜레스테롤과 콜레스테롤 에스테르를 많이 가지게 되어, 지방이 세포 안에 가득 차 거품 모양을 하게 되며, 이를 거품 세포(foam cell)라고 부르기도 한다(Osto et al., Circulation, 118:2174-2182, 2008; Jeon et al., 2007). 플라크에서 발견되는 콜레스테롤의 대부분은 거품세포가 oxLDL을 섭식한 결과이므로, 고혈장 LDL 수준은 질환 발병률이 높다고 볼 수 있다. 따라서 이러한 질환의 위험인자로 고지방식이, 흡연, 스트레스, 운동부족 등이 꼽히며, 현대 사회에서 심각한 질환 중 하나로 떠오르고 있다.
또한, oxLDL은 in vivo에서 심혈관질환 등을 유발한다는 실험결과도 보고되고 있다(Faviou et al., Free Radic. Res., 39(4):419-29, 2005; Hiki et al., Journal of Cardiology, 53:108-116, 2009). 또한 플라크와 플라스마에 oxLDL이 많아지는 것은 동맥경화성 병변의 위험과도 관련이 높다 (Nishi et al., Arteriosclerosis, Thrombosis, and Vascular Biology, 22:1649, 2002). 아테롬성 혈관질환의 원인은 아직 밝혀지지 않았으나, 최근의 연구에 따르면, 아테롬성 플라크 안에서 발견되는 대식세포는 oxLDL에 친화성이 높은 수준의 LDL 수용체를 가지고 있다.
oxLDL은 반응성 알데히드, 포스포리피드, 그리고, 말론디알데히드에 의해 화학적으로 변형된 LDL (malondialdehyde-modified LDL; MDA-LDL)과 같은 리피드 퍼옥시데이션 결과물을 생산하는데, MDA-LDL과 Cu-LDL은 oxLDL의 대표적 예로써, 산화가 주로 apoB의 자유 아미노 그룹에 일어난다. 동맥경화성 병변은 oxLDL 또는 MDA-LDL과 비슷한 물리적, 면역화학적 특성을 갖는 물질을 포함한다 (Itabe et al., J. Biol. Chem, 269(21):15274-15279, 1994). MDA-LDL에 대한 항체의 농도는 심혈관 질환, 동맥경화 환자, 고콜레스테롤성 토끼, 그리고 apoE-/- 또는 LDL수용체 결핍 생쥐의 혈장에서 높고, 동맥경화의 진행정도에 관련성이 있다. 임산부 질병인, 전자간증의 환자에서도 oxLDL에 대한 자가항체가 높은 정도로 존재한다 (Fialova et al.).
또한, 종래 연구된 바에 따르면, 만성 신장질환(cronic kidney disease)에서 cyanate level과 cyanate에 의한 protein carbamylation 특히 LDL carbamylation level (cLDL level)이 높아지는데, 이로 인하여 동맥경화의 위험성이 높아진다고 보고되었다. 왜냐하면, cLDL은 vascular cell injury를 유발하기 때문이다. Vascular cell injury는 endothelial cell(EC)의 사멸(death)과 vascular smooth muscle cell의 증식을 포함한다. Endothelial cell(EC)의 사멸이 동맥경화의 초기 현상이라는 것은 잘 알려져 있다. 또, EC injury는 LDL carbamylation의 정도에 연관성을 보인다. 혈액 투석을 받는 진행된 신장병 환자에서 plasma cLDL의 level은 건강인에 비해 몇 배나 높다. (Ok et al., Kidney International, 68:173, 2005).
cLDL은 또한, 요독증(uremic-신장병 환자에서 urea level이 증가하는 증세로, urea가 cyanate로 변형되어 protein carbamylation을 일으킴) 환자에서 생기는 동맥경화증의 유병기전에 기여한다. cLDL을 인간 대동맥 vascular smooth muscle cells(VSMC)에 처리하면, 형태의 변화와 증식, intercellular adhesion molecule-1과 vascular cell adhesion molecule-1의 발현을 증가시킨다(Asci et al., Nephrology 13:480, 2008) (Apostolov et al., Arterioscler. Thromb. Vasc. Biol. 27:826, 2007).
cLDL은 EC 증식을 유도하며, 이 증식은 MAPKs(mitogen-activated protein kinases)을 통하여 이루어지며, 이는 EC 사멸을 유도한다. 세포증식과 사멸의 combination은 vascular EC의 high turnover를 유도한다(Apostolov et al., J. Physiol. Heart. Circ. Physiol. 292:1836, 2007). 한편 cLDL을 EC에 처리하면, EC의 스캐빈저 수용체(scavenger receptor)인 LOX-1의 발현이 증가하고, 증가된 LOX-1이 EC에 중요한 아테롬 유발 효과(atherogenic effect)를 보인다. cLDL이 EC의 LOX-1에 결합하여 세포독성과 가속화된 EC로의 monocyte adhesion을 보이기 때문이다(Apostolov et al., Arterioscler. Thromb. Vasc. Biol. 29:1622, 2009).
oxLDL 또는 변형된 LDL에 특이적인 인간 항체의 생성은 항체의 유전자 구조를 이해하고 아테롬성 혈관질환의 유병기전을 이해하는데 있어 중요한 의미를 가질 뿐 아니라, 동맥경화와 관련있는 질병들의 진단용 항체로 이용할 수 있어서 유용하지만, 현재까지 오직 몇 개의 항 oxLDL 단일클론 항체만이 개발되었다. 그 항체들 중 몇 개는 인간 및 토끼의 동맥경화 병변에 인지하는 IgG 혹은 Fab이며 (Itabe et al. 1994; Palinski et al., J. Clin. Invest., 98:800-814, 1996; Shaw et al., Arterioscler. Thromb. Vasc. Biol., 21:1333-1339, 2001), 인간 및 생쥐에 교차반응을 하는 인간 항체 (Schiopu et al., Circulation, 110(14):2047-2052, 2004) 가 존재하지만 이는 IgG 형태이다. 인간과 생쥐의 동맥경화 병변을 동시에 인지하는 인간항체 Fab는 아직 보고된 바 없다.
인간 또는 마우스(생쥐) 각각에만 사용 가능한 항체의 경우, 각각의 종에서만 효과가 있으므로, 예를 들어 신약 개발 단계 중 실험 동물 단계부터 임상 실험 단계에 이르기까지 한 항체를 사용하지 못하고, 전임상단계에서 임상단계 적용시 인간화(humanization)가 필수적이었다. 이는 경제적으로 큰 비용을 요구하므로, 신약 등의 개발 및 질환의 연구에 있어 인간과 생쥐 모두에 일관되게 사용할 수 있는 항체의 개발이 요구되어 왔으나, 연구가 미진한 상황이었다.
이에 본 발명자들은 oxLDL, cLDL 등 아테롬성 혈관질환의 병변에 존재하는 물질에 특이적으로 결합하는 인간 단일클론 항체를 분리하고자 노력한 결과, 조합항체 라이브러리 및 파지 디스플레이 기술을 이용하여, 인간과 생쥐 모두에서 동맥경화성 플라크에 특이적으로 결합하여 신약 개발 등 산업상 이용가능성이 뛰어난 인간 단일클론 항체 및 그의 항원결합단편, 플라크 15, 16-46 (plaque 15, 16-46)을 분리하고 그의 특징을 규명하여, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 산화된 LDL(oxLDL) 및 카바밀레이트화된 LDL(Carbamylated LDL)에 특이적으로 결합하는 인간 단일클론 항체 또는 그의 항원결합단편, 플라크 15, 16-46 (plaque 15, 16-46)을 제공하는데 있다.
본 발명의 다른 목적은 상기 인간 단일클론 항체 또는 그의 항원결합단편을 함유하는 아테롬성 혈관질환 진단용 조성물을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1, 서열번호 2 및 서열번호 3의 중쇄 CDR을 포함하는 중쇄 가변영역을 함유하는, 산화된 LDL(oxLDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab)을 제공한다.
본 발명은 또한, 서열번호 4, 서열번호 5 및 서열번호 6의 경쇄 CDR을 포함하는 경쇄 가변영역을 함유하는, 산화된 LDL(oxLDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab)을 제공한다.
본 발명은 또한, 서열번호 1, 서열번호 2 및 서열번호 3의 중쇄 CDR을 포함하는 중쇄 가변영역과 서열번호 4, 서열번호 5 및 서열번호 6의 경쇄 CDR을 포함하는 경쇄 가변영역을 함유하는, 산화된 LDL(oxLDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab)을 제공한다.
본 발명은 또한, 서열번호 21로 표시되는 중쇄 가변영역을 함유하는 산화된 LDL(oxLDL) 및 cLDL 특이적 인간 단일클론 항체 또는 그의 항원결합단편을 제공한다.
본 발명은 또한, 서열번호 22로 표시되는 경쇄 가변영역을 함유하는 oxLDL 및 cLDL 특이적 인간 단일클론 항체 또는 그의 항원결합단편을 제공한다.
본 발명은 또한, 서열번호 21로 표시되는 중쇄 가변영역 및 서열번호 22로 표시되는 경쇄 가변영역을 함유하는 oxLDL 및 cLDL 특이적 인간 단일클론 항체 또는 그의 항원결합단편을 제공한다.
본 발명은 또한, 상기 인간 단일클론 항체 또는 그의 항원결합단편을 암호화하는 DNA 서열을 제공한다.
본 발명은 또한, 상기 인간 단일클론 항체 또는 그의 항원결합단편을 함유하는 아테롬성 혈관질환 진단용 조성물을 제공한다.
본 발명에 있어서, 상기 아테롬성 혈관질환은 동맥류, 뇌동맥경화증, 뇌경색, 뇌출혈, 협심증, 심근경색, 신장경화증, 망막동맥경화증, 동맥폐색증으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
도 1은 플라크 15, 16-46 (plaque 15, 16-46) Fab의 VH와 VL 유전자의 아미노산 서열을 나타낸 것으로, DNA 서열은 GenBank accession No. AY957524와 AAY957525를 이용하였으며, Germline 유전자와 비교하여 동일한 아미노산 서열은 -로 표시하고, 돌연변이에 의해 치환된 아미노산은 붉은 색으로 표시하였다.
도 2는 RT-PCR에 의하여 플라크와 PBMC에서 전사된 AID mRNA을 증폭한 결과물을 1열에 DNA 100bp 래더마커, 2열에 환자의 플라크결과물, 3열에 PBMC 결과물을 각 전기영동시킨 사진이다.
도 3은 정제된 플라크 15, 16-46 (plaque 15, 16-46) Fab의 면역 블로팅 사진으로, 전체 박테리아 펠렛(1열), 가용성 추출물(2열), 가용성 추출물을 컬럼에 통과시킬 때 빠져나온 물질(3열) 및 가용성 추출물을 컬럼에 통과시킬 때 결합한 것을 떨어뜨린 Fab(4열)이 non-reducing 조건 하에서 SDS-PAGE로 분리되고, anti-human IgG mAb(Fab 특이적인)로 감지된 사진이다.
도 4는 각기 다른 형태들로 화학적 변형된 LDL 및 HDL에 대한 플라크 15, 16-46 (plaque 15, 16-46) Fab ELISA 결과이다.
도 5는 플라크 15, 16-46 (plaque 15, 16-46) Fab에 의한 인간, 쥐, 대조군 등의 경화성 병변의 인식을 IF 및 IHC로 분석한 사진이다.
발명의 상세한 설명 및 구체적인 구현예
달리 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서는 파지 디스플레이 기술을 이용하여 MDA-LDL 항원에 결합 하는 단편을 새롭게 분리하고, 상기 분리된 항원결합단편(Fab)이 oxLDL의 대표적인 형태인 MDA-LDL, Cu-LDL과 특이적으로 결합할 뿐 아니라, cLDL과 교차반응을 하는 것을 확인하였다.
본 발명은 일 관점에서, 서열번호 1, 서열번호 2 및 서열번호 3의 중쇄 CDR을 포함하는 중쇄 가변영역을 함유하는, 산화된 저밀도 지질단백질(oxLDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab)에 관한 것이다.
본 발명에 있어서, 항체 또는 Fab의 경쇄 가변영역은 바람직하게는 서열번호 4, 서열번호 5 또는 서열번호 6의 경쇄 CDR을 함유할 수 있으나, 통상적으로 알려진 경쇄 가변영역이어도 무방하다.
본 발명은 다른 관점에서, 서열번호 4, 서열번호 5 및 서열번호 6의 경쇄 CDR을 포함하는 경쇄 가변영역을 함유하는, 산화된 저밀도 지질단백질(oxLDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab)에 관한 것이다.
본 발명에 있어서, 항체 또는 Fab의 중쇄 가변영역은 바람직하게는 서열번호 1, 서열번호 2 또는 서열번호 3의 중쇄 CDR을 함유할 수 있으나, 통상적으로 알려진 중쇄 가변영역이어도 무방하다.
본 발명의 바람직한 양태는 서열번호 1, 서열번호 2 및 서열번호 3의 중쇄 CDR을 포함하는 중쇄 가변영역과 서열번호 4, 서열번호 5 및 서열번호 6의 경쇄 CDR을 포함하는 경쇄 가변영역을 함유한다.
본 발명에 있어서, 상기 중쇄 가변영역은, 바람직하게는 서열번호 7 내지 서열번호 10의 중쇄 FR 영역을 포함하는 것을 특징으로 할 수 있다. 또한, 상기 경쇄 가변영역은, 바람직하게는 서열번호 11 내지 서열번호 14의 경쇄 FR 영역을 포함하는 것을 특징으로 할 수 있다.
본 발명의 바람직한 다른 양태는, 서열번호 21로 표시되는 중쇄 가변영역을 함유한다. 상기 서열번호 21로 표시되는 중쇄 가변영역은 서열번호 1 내지 3, 서열번호 7 내지 10의 CDR, FR 부위를 포함하고 있다.
본 발명은 바람직한 다른 양태는, 서열번호 22로 표시되는 경쇄 가변영역을 함유한다. 상기 서열번호 22로 표시되는 중쇄 가변영역은 서열번호 4 내지 6, 서열번호 11 내지 14의 CDR, FR 부위를 포함하고 있다.
본 발명의 가장 바람직한 양태는, 서열번호 21로 표시되는 중쇄 가변영역 및 서열번호 22로 표시되는 경쇄 가변영역을 함유한다.
본 발명에 있어서, 상기 서열은 아미노산 서열로서 나타내었다. 본 발명에서 사용되는 용어 "아미노산"이란, 자연계에 존재하는 모든 아미노산을 의미하고, 바람직하게는, 아미노산을 표기하기 위해 사용되는 알파벳의 3문자 표기법 또는 1문자 표기법에 따라 각각 아래와 같이 표시되는 아미노산을 의미한다.
글리신(Gly/G), 알라닌(Ala/A), 발린(Val/V), 류신(Leu/L), 이소류신(Ile/I), 세린(Ser/S), 트레오닌(Thr/T), 아스파라긴산(Asp/D), 글루타민산(Glu/E), 아스파라긴(Asn/N), 글루타민(Gln/Q), 리신(Lys/K), 아르기닌(Arg/R), 시스테인(Cys/C), 메티오닌(Met/M), 페닐알라닌(Phe/F), 티로신(Tyr/Y), 트립토판 (Trp/W), 히스티딘(His/H), 프롤린(Pro/P).
본 발명에 있어서, 인간 단일클론 항체는 H사슬 및 L사슬의 가변영역 및 정상영역을 포함하는 모든 영역이 인간 이뮤노 글로불린을 코드하는 유전자에 유래하는 인간 이뮤노 글로불린을 뜻한다. 상기 L사슬로는, 인간 κ사슬 또는 인간 λ사슬을 예로 들 수 있다. 또한, 본 발명 인간 단일클론 항체는, IgG(IgG1, IgG2, IgG3, IgG4), IgM, IgA(IgA1, IgA2), IgD 또는 IgE 중 어느 하나의 아이소타입을 갖는 인간 단일클론 항체라도 무방하다.
본 발명에 있어서, 인간 단일클론 항체는 일반적으로 이용되는 인간 항체생산 트랜스제닉 마우스와 같은 인간 항체생산 트랜스제닉 비인간 포유동물 등을 이용하여 기존의 일반적인 단일클론 항체 제조법에 따라 제조할 수 있다. 또는, 유전자 재조합 기술을 사용하여, 그러한 본 발명의 인간 단일클론 항체의 중쇄 및 경쇄 각각을 코드하는 cDNA에 의해 숙주세포를 형질전환하여 얻어지는, 유전자 재조합 인간 단일클론 항체를 생산하는 유전자 재조합 대장균 세포를 배양함으로써 배양 브로스(broth)로부터 얻는 방법일 수 있다.
또 다른 관점에서, 본 발명은 상기 인간 단일클론 항체 또는 그의 항원결합단편을 암호화하는 DNA 서열에 관한 것이다. 본 발명에 있어서, DNA 서열은 서열번호 23 및 24로 표시되는 DNA 서열을 포함할 수 있다. 서열번호 23은 서열번호 21의 중쇄 가변영역(VH)을 코딩하는 DNA 서열이며, 서열번호 24는 서열번호 22의 경쇄가변영역(VL)을 코딩하는 DNA 서열이다.
본 발명에 있어서, DNA 서열은 파지미드 DNA 시퀀싱에 의하여 얻을 수 있으며, 그 방법은 당 업계에 통상적으로 알려진 방법에 의할 수 있다.
본 발명의 일 실시예에서는, 본 발명에서 분리된 항원결합단편(Fab)을 ApoE-/- 쥐 동맥 조직 단편 및 전자간증 환자 태반 조직에서 분리된 아테롬성 플라크, 그리고 동맥경화 환자의 동맥 플라크에 면역 형광 분석(IF) 또는 면역 조직화학(IHC) 분석을 통하여, 각 조직 아테롬성 병변과 본 발명의 항원결합단편(Fab)이 특이적으로 결합하여 병변을 진단할 수 있는 것을 확인하였다.
본 발명은 또 다른 관점에서, 본 발명에 따른 인간 단일클론 항체 또는 그의 항원결합단편을 함유하는 아테롬성 혈관질환 진단용 조성물에 관한 것이다.
본 발명에 있어서, 아테롬성 혈관질환은 동맥류, 뇌동맥경화증, 뇌경색, 뇌출혈, 협심증, 심근경색, 신장경화증, 망막동맥경화증, 동맥폐색증으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명의 진단용 조성물은 본 발명에 따른 인간 단일클론 항체 또는 그의 항원결합단편을 함유하고 있으며, 샘플 또는 검체 샘플을 진단용 조성물에 처리하여 결과를 얻을 수 있다. 상기 진단용 조성물은 당업계에서 통상적으로 이용되는 키트 또는 핵산칩의 형태에 포함될 수 있다. "샘플" 또는 "검체 샘플"을 수행하는 분석의 종류에 따라, 개개인, 체액, 세포주, 조직 배양 등에서 얻어지는 모든 생물학적 샘플을 포함하는 폭넓은 범위의 샘플을 의미한다. 포유동물로부터 체액 및 조직 생검을 획득하는 방법은 통상적으로 널리 알려져 있다. 바람직한 소스는 아테롬성 혈관질환 병변의 생검(biopsy)이다.
본 발명의 다른 실시예에서는 파지 디스플레이 기술을 이용하여 새롭게 분리된 본 발명의 항원결합단편(Fab)를 ApoE-/- 쥐 동맥 조직 단편 및 인간 동맥 경화증 환자 대동맥 조직 또는 전자간증 환자의 태반 조직에서 분리된 아테롬성 플라크에 면역형광 분석 또는 면역 조직화학분석한 결과, 각 조직 병변에 존재하는 플라크 성분과 본 발명의 항원결합단편(Fab)이 특이적으로 결합하는 것을 확인하였다.
본 발명의 실시예에 따르면, 본 발명 인간 단일클론 항체 또는 그의 항원결합단편(Fab)은 아테롬성 병변 부위와 특이적으로 결합하므로, 아테롬성 혈관질환의 진단에 이용될 수 있다. 또한, 당업계에 공지된 방법을 이용하여 약물 등과 항체 또는 Fab를 결합시켜 아테롬성 혈관질환의 치료 및 예방에 이용할 수 있다. 또한, 인간뿐만 아니라, 널리 실험동물로 이용되는 생쥐(마우스)에도 특이성을 지녔음이 확인되었으므로, 특히 신약 개발 등에 있어서 유용하게 이용될 수 있다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당 업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1 : 파지 디스플레이 기술을 이용한, oxLDL에 결합하는 항체 분리
1-1: 인간 샘플 확보
아주대학 병원을 방문한 죽상동맥경화증 환자에게서 동의서를 받은 후 플라크 샘플을 채취하였으며, 동의서 및 연구계획서는 아주대학 의료원 Institutional Review Board에서 인증을 받았다.
1-2: 파지 디스플레이 기술을 이용한 항체 수득
인간 조합 IgG 라이브러리 제작 및 파지 디스플레이에 의한 항원 특이 항체 Fab 분리는 Jeon et al,. (2007)에 기술된 방법으로 진행되었다. 라이브러리 건설을 위해, 전체 RNA를 동맥 경화증인 두 환자의 수술 중에 분리한 동맥경화 플라크(plaque)에서 얻었다. 플라크는 RNAlate(Ambion, US)에서 -20도로 보관하였다. 플라크 조직을 가위로 자르고, 조직 분쇄기(Tissue-Tearor, Biospec Product, US)로 조직을 분해하였다. TRIzol 용액(Invitrogen, New Zealand)을 사용하여 RNA를 분리하였다. 파지 디스플레이 과정 동안, 파지 상등액에서의 MDA-LDL과 native LDL에 대한 반응성을 비교하여 MDA-LDL에 특이적으로 결합하는 항체 클론을 수득하였다. 그리고 이를 플라크 15, 16-46 (plaque 15, 16-46)으로 명명하였다.
실시예 2 : 플라크 15, 16-46 (plaque 15, 16-46) Fab의 유전 구조 분석
2-1: 플라크 15, 16-46 (plaque 15, 16-46) Fab의 cDNA 서열 분석
본 실시예에서는 Anti-oxLDL monoclonal antibody Fab을 생성하기 위해서 죽상동맥경화증 환자 두 명으로부터 얻어진 혼합 인간 동맥경화성 플라크를 사용했다. Fab는 실시예 1에 기재된 파지 디스플레이(Phase display) 과정을 통해 monoclonal antibody Fab clone, 플라크 15, 16-46 (plaque 15, 16-46)을 phage antibody의 MDA-LDL 및 native LDL에 대한 상대적 반응성을 비교함으로써 선택하였다. Native LDL과 HDL의 구입은 Chemicon International에서 하였다. 또한 MDA-LDL의 생성을 위한 MDA 변형은 Fogelman et al.(Proc. Natl. Acad. Sci., 77(4I):2214-2218, 1980)에 기재된 방법으로 하였다. 아실화 LDL 또는 HDL은 Basu et al.(Proc. Natl. Acad. Sci., 73:3178-3182, 1976)에 기재된 방법으로 준비하였다. 카바밀레이트 LDL 또는 HDL은 Ok et al.(Kidney International, 68:173, 2005)에 기재된 방법으로 준비하였다.
그 후, 상기 실험과정에 의해 선택된 Fab의 구체적인 유전자 구조를 분석하기 위해서, 자동화된 염기서열 분석기(CoreBio Technology, Korea)를 사용하여 VH 와 VL cDNA sequences를 결정하였다. 이에 하기 서열번호 15 및 16으로 표시되는 프라이머를 사용하였다.
서열번호 15 VH, 5’- ACCTATTGCCTACGGCAGCCG - 3’
서열번호 16 VL, 5’- AAGACAGCTATCGCGATTGCAG - 3’
시퀀스 결과는 germline 과의 상동성 비교, 사용된 유전자, 및 돌연변이를 분석하기 위하여 BLAST(Basic Local Alignment Search Tool) 및 DNAPLOT(V BASE)를 이용하였다.
그 결과, 도 1에 나타난 바와 같이, 결정된 VH 와 VL 아미노산 sequence를 확인하였다. 그들의 sequences 특징을 분석한 것은 표 1에 표시하였다. 한편, Fab 에 의해 사용된 유전자는 각각 VH3-48 과 Vk3-20 이라는 것을 밝혔다. VH의 D지역은 D3-16 gene segment를 사용하였다. Fab의 VH 와 VL 과 가장 유사성이 높은 germline sequence와 비교하면, 각각 87.8%와 96.8% 의 유사성을 가진다. VH의 CDRs에서 silent(S)에 대한 Replacement(R) 변이 비율은 매우 높다(14/0). 반면 VH 의 FRs의 비율은 8/5, VL의 CDRs은 4/0, VL의 FRs은 1/3이고, Arg, Lys, His와 같이 양으로 측정되는 아미노산이 발생하는 많은 변이들이 VH와 VL의 지역에서 발견되었다(각각, 14개 중 6개, 5개 중 3개의 아미노산) (도 1 및 표 2). 특히, VH와 VL의 CDRs의 R/S 비율이 2.9보다 높다는 것은 그 지역에서의 변이가 B-cell의 발생 동안 항원과 상호작용하는 것을 통하여 선택압력 아래 있었다는 것을 뜻한다.
2-2: AID mRNA 발현 분석을 통한 플라크에서의 체세포 과돌연변이 확인
체세포 과돌연변이와 class switch recombination의 증거는 activation-induced cytidine deaminase (AID) mRNA 전사의 local expression을 분석함으로써 확인될 수 있다. RT-PCR에 의해 AID mRNA 전사물을 증폭시키기 위하여, 동맥경화 환자 PBMC와 플라크 샘플로부터 RNA를 얻고, 이로부터 cDNA를 얻었다. PCR은 Coker et al.(2003)에 기재된 방법으로 실행하였다. 아래 서열번호 17 내지 20으로 표시된 프라이머를 PCR에 사용하였다.
서열번호 17 ~ 20
AID1P - 5’-GAG GCA AGA AGA CAC TCT GG-3’
AID2P - 5’-GTG ACA TTC CTG GAA GTT GC-3’
AID3P - 5’-TAG ACC CTG GCC GCT GCT ACC-3’
AID4P - 5’-CAA AAG GAT GCG CCG AAG CTG TCT GGA G-3’
그 결과, 도 2에 나타난 바와 같이, 플라크 15, 16-46 (plaque 15, 16-46) Fab가 만들어진 환자의 동맥경화성 플라크(atherosclerotic plaque)에서 mRNA 전사의 local expression이 나타남을 확인하였다. Correct 335-bp AID RT-PCR 생성물은 환자의 plaque와 PBMC 샘플에서 모두 관찰되었다.
실시예 3 : Fab의 생화학적 특성 분석
3-1: 면역 블로팅에 의한 분석
mAb Fab의 결합 특성을 분석하기 위해, 본 실험에서는 Non-suppressor 계열 박테리아인 TOP10F’ 세포를 파지 Fab DNA를 이용해 변형시켰다. 변형된 세포에서의 단백질 발현을 유도한 후, 배양 상층액 또는 원형질막공간 추출물에 존재하는 가용성 Fab는 Jeon et al.(2007) 방법에 의해 Ni++-NTA chromatography를 사용함으로써 정제하였다. 정제된 Fab은 non-reducing 조건 아래 SDS-PAGE로 분리되고, 면역블로팅으로 분석하였다.
그 결과, 도 3에 나타난 바와 같이, 구체적으로는 anti-human IgG (Fab-specific) mAb에 반응함을 확인하였고, 이 Fab의 대략적인 분자 크기는 ~45 Kdal 이었다.
3-2: ELISA에 의한 Fab 결합특성 분석
Fab의 결합 특성을 ELISA에 의해 알아보았다. 표준 분석에서, 1마이크로그램의 항원이 포함된 100 마이크로리터의 PBS를 96-well 마이크로타이터 접시의 각각의 well에 위치시키고, 하룻밤 동안 4도에서 코팅하였다. 각 well을 PBS로 3회 세척한 다음, 5% BSA를 포함한 PBS로 2시간 동안 상온에서 반응시켰다. 그 후 0.05% Tween을 포함한 PBS(PBST)로 3회 well을 세척한 다음, Fab를 상온에서 2시간 동안 반응시켰고, 그 다음 알칼린 포스파타아제-컨쥬게이티드 고트 안티-인간 IgG 항체 (1:5000으로 1%BSA를 포함한 PBS로 희석됨)와 상온에서 2시간 동안 반응시켰다. Well은 PBST로 2회 세척했고, 0.05% Tween을 포함하는 TBS로 1회 세척하였다. 마지막으로, 결합된 알칼린 포스파타아제 활성을 파라니트로페닐 포스페이트를 기질로 사용하여 측정하였다. 결과는 ELISA reader (DI Biotech, Model ELx808) 로 405nm 파장에서 흡광도를 광학적으로 측정하였다.
그 결과, 도 4에 나타난 바와 같이, Fab이 MDA-LDL, Cu-LDL과 carbamylated LDL(cLDL) 모두에 강하게 반응하는 것을 확인하였다. 즉, oxLDL에 강하게 결합하였으며, cLDL에 교차반응을 보였다. MDA-HDL, native LDL, Cu-HDL, cHDL, acetylated LDL, native HDL, acetylated HDL 에는 유의미한 반응성이 관측되지 않았다. 이 Fab는 double stranded DNA나 histones에 대해서도 반응이 없었다.
실시예 4 : mAb에 의한 동맥경화 병변(atherosclerotic lesions)의 인식 여부
4-1: 인간 동맥경화증 병변의 인식
얼린 동맥경화증 환자의 동맥 조직 절편은 면역형광 분석 (Immunofluorescence;IF Analysis) 로 분석하였다. 인간 조직을 10ug/ml Fab과 2시간 동안 상온에서 반응시켰다. 그 후, 20ug/ml FITC-표지 안티 휴먼 IgG (Vector Labs)와 1시간 동안 상온에서 반응시켰다. 동맥경화 플라크의 얼려진 샘플은 BioChain (Cat #T1236012Hd-4) 에서 구입하였다. 형광 이미지는 올림푸스 형광 현미경 모델 BX-61을 이용하여 얻었다.
그 결과, 도 5A에 나타난 바와 같이, 포지티브로 염색된 경화증 플라크를 도 5A-2 (40배 확대)와 5A-3 (200배 확대)에서 관찰할 수 있었으며, 부정적 대조군(1차 항체 없이 염색한 사진;도 5A-1) (40배 확대)에 비하여 확실히 보였다.
4-2: 생쥐 동맥경화증 병변의 인식
한편, 고지방 식이요법을 통하여 동맥경화를 유도한 ApoE-/- 생쥐의 동맥경화성 손상조직에 대하여 Fab로 면역조직화학분석을 하였다. ApoE-/- 쥐 동맥 조직 단편은 10μg/ml Fab와 반응시킨 후, VECTASTAIN ABC kit(Vector Labs)를 사용하여 가시화하였다.
그 결과, 도 5B에 나타난 바와 같이, 경화증 플라크에 있는 거품세포(foam cell)는 Fab와 특이적으로 반응하였고, 붉은 색의 염색으로 나타났다. 도 5B의 1~3에 나타난 바와 같이, 부정 대조군 (B-1)이나 낮은 농도의 Fab (B-2)에 비해 높은 농도의 Fab로 반응 시킨 경우 (B-3) 훨씬 진한 염색이 나타났다. 도 5B-3의 두꺼운 박스 안의 사진은 B-3 (40배 확대)의 다른 두 지점을 100배로 확대된 사진을 나타낸다. 확대된 사진에서, 경화증 플라크 (진한 화살표)는 더욱 명확하게 보였다.
4-3: 인간 전자간증 병변의 인식
전자간증 환자의 태반 탈락막 조직으로부터 얻은 경화증 플라크 부분을 Fab를 이용하여 IF 방법으로 분석하였다. 분석 방법은 실시예 4-1에 사용한 것과 같다. 조직 절편은 아주대학교 병원 산부인과를 방문한 전자간증 환자들의 태반조직에서 얻었다.
그 결과, 도 5C에 나타난 것과 같이, Fab는 특별히 손상된 태반 조직 혈관 결실 동맥 세포를 인식하였다. 몇 군데 다른 부분의 IF-양성 염색결과를 200X (도 5C 1-3) 및 400X (도 5C4, 5) 확대 사진에서 확인하였다. 흥미롭게도, Fab로 염색된 동맥경화성 혈관 단면도가 둥근 모양으로 뚜렷이 보였다(도 5C-2). 1차 항체를 사용하지 않은 IF가 부정적 대조군으로 쓰였다(도 5C-6).
4-4: FACS를 통한 인간 전자간증 병변에 존재하는 대식세포의 확인
전자간증 태반조직병변 플라크 주위에 대식세포의 존재 여부를 확인하기 위해, IF 목적으로 분리한 조직의 일부분에서 단일세포를 신선하게 분리해 내고 CD68 염색과 FACS 분석을 통하여 분석하였다. 단일 세포를 분리한 방법은 다음과 같다. 수술 동안 분리한 태반조직의 막 부분을 잘라낸 후, 묻어 있는 피가 다 씻겨져 나갈 때까지 PBS로 세척하였다. 그리고 잘라낸 태반조직을 petridish에 넣고 조직이 살짝 담겨질 양만큼의 PBS를 넣은 후 가위로 최대한 작은 크기로 잘랐다. 그 후, collagenase를 첨가한 후 CO2 세포배양기에서 3시간 동안 방치하였다. 필터 주머니를 이용해서 여과한 후, 여과해서 나온 세포용액을 4℃, 300g 에서 10분 동안 원심분리 하여 single cells를 가라앉혔다.
적혈구를 제거하기 위하여 RBC 완충액(NH4Cl 8.29g, KHCO3 1g, EDTA disodium Salt 0.037 mg : 1ℓ당)을 분리된 Cell에 10배 이상 넣고 2분 동안 방치해 둔 후 다시 4℃, 300g에서 원심분리 하였다. RBC가 완전히 제거될 때까지 이 과정을 세 번 반복한 후, 2% FBS를 포함하는 PBS로 2번 더 세척해 주었다. 조직이 미세하게 남아 있는 경우, 나일론 필터(Spectra/Mesh Nylon Filter, 53㎛)를 사용하여 한 번 더 여과시켰다.
분리된 Single Cell을 이용하여 대식세포의 존재 유무를 anti-CD68 항체를 이용하여 FACS 분석하기 위하여, 분리된 Single Cell 들을 1 x 106/tube 가 되도록 FACS 튜브에 각각 넣어준 후 우선 anti-CD68 mouse antibody를 넣어 준 후 37℃ CO2 배양기에서 15분 동안 반응시키고, 2% FBS/PBS로 7분씩 1,350rpm 에서 2번 세척해 주었다. Secondary Ab로 anti-mouse IgG-FITC를 2㎍/ml이 되게 넣어 준 후 37℃ CO2 배양기에서 15분 동안 방치시키고, 2% FBS/PBS로 7분씩 1,350rpm에서 2번 세척해 주었다. 염색된 대식세포는 FACS (FACSVantage) 분석을 하였다.
그 결과, 도 5C의 박스에 나타난 바와 같이, 플라크 세포 중 CD68-긍정 대식세포의 비율(M2)은 부정 대조군 보다 높았다(34.92% vs 5.16%).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부한 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따른 단일클론 항체 및 그의 항원결합단편은 ox-LDL 및 cLDL에 특이적인 중쇄 가변영역(VH) 및 경쇄 가변영역(VL)을 포함하므로, 동맥경화증을 비롯한 아테롬성 혈관질환의 진단, 예방 및 치료에 있어 유용하다. 또한, 인간과 쥐 모두의 병변의 검출이 가능하여, 신약 개발 시, 전임상 단계(실험 동물 단계)에서 임상 단계에 걸쳐 사용이 가능한 항체이므로, 경제성이 뛰어나다.
전자파일 첨부하였음.
Claims (13)
- 서열번호 1, 서열번호 2 및 서열번호 3의 중쇄 CDR을 포함하는 중쇄 가변영역을 함유하는, 산화된 저밀도 지질단백질(ox-LDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab).
- 서열번호 4, 서열번호 5 및 서열번호 6의 경쇄 CDR을 포함하는 경쇄 가변영역을 함유하는, 산화된 저밀도 지질단백질(ox-LDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab).
- 서열번호 1, 서열번호 2 및 서열번호 3의 중쇄 CDR을 포함하는 중쇄 가변영역과 서열번호 4, 서열번호 5 및 서열번호 6의 경쇄 CDR을 포함하는 경쇄 가변영역을 함유하는, 산화된 저밀도 지질단백질(ox-LDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab).
- 제1항 또는 제3항에 있어서, 상기 중쇄 가변영역은 서열번호 21로 표시되는 것을 특징으로 하는 인간 단일클론 항체 또는 그의 항원결합단편(Fab).
- 제2항 또는 제3항에 있어서, 상기 경쇄 가변영역은 서열번호 22로 표시되는 것을 특징으로 하는 인간 단일클론 항체 또는 그의 항원결합단편(Fab).
- 서열번호 21로 표시되는 중쇄 가변영역과 서열번호 22로 표시되는 경쇄 가변영역을 함유하는, 산화된 저밀도 지질단백질(ox-LDL) 및 카바밀레이트화된 저밀도 지질단백질(Carbamylated LDL;cLDL)에 특이적으로 결합하는 인간 단일클론 항체(human Monoclonal Antibody;mAb) 또는 그의 항원결합단편(Antigen binding Fragment;Fab).
- 제1항 내지 제3항 중 어느 한 항의 인간 단일클론 항체 또는 그의 항원결합단편(Fab)을 암호화하는 DNA 서열.
- 제6항의 인간 단일클론 항체 또는 그의 항원결합단편(Fab)을 암호화하는 DNA 서열.
- 제8항에 있어서, 상기 DNA 서열은 서열번호 23 또는 서열번호 24로 표시되는 서열을 포함하는 것을 특징으로 하는 DNA 서열.
- 제1항 내지 제3항 중 어느 한 항의 인간 단일클론 항체 또는 그의 항원결합단편을 함유하는 아테롬성 혈관질환 진단용 조성물.
- 제6항의 인간 단일클론 항체 또는 그의 항원결합단편을 함유하는 아테롬성 혈관질환 진단용 조성물.
- 제10항에 있어서, 상기 아테롬성 혈관질환은 동맥류, 뇌동맥경화증, 뇌경색, 뇌출혈, 협심증, 심근경색, 신장경화증, 망막동맥경화증, 동맥폐색증으로 구성된 군에서 선택되는 것을 특징으로 하는 진단용 조성물.
- 제11항에 있어서, 상기 아테롬성 혈관질환은 동맥류, 뇌동맥경화증, 뇌경색, 뇌출혈, 협심증, 심근경색, 신장경화증, 망막동맥경화증, 동맥폐색증으로 구성된 군에서 선택되는 것을 특징으로 하는 진단용 조성물.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2010-0056125 | 2010-06-14 | ||
| KR1020100056125A KR20110136253A (ko) | 2010-06-14 | 2010-06-14 | 말론디알데히드에 의해 산화된 저밀도 지질단백질 및 카바밀레이트화된 저밀도 지질단백질에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합 단편 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011159000A1 true WO2011159000A1 (ko) | 2011-12-22 |
Family
ID=45348372
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2010/008219 Ceased WO2011159000A1 (ko) | 2010-06-14 | 2010-11-22 | 산화된 저밀도 지질단백질 및 카바밀레이트화된 저밀도 지질단백질에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR20110136253A (ko) |
| WO (1) | WO2011159000A1 (ko) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118459581A (zh) * | 2024-05-24 | 2024-08-09 | 东方海洋(北京)医学研究院有限公司 | 抗人氧化低密度脂蛋白的单克隆抗体及其应用 |
| US12291579B2 (en) | 2023-03-17 | 2025-05-06 | Oxitope Pharma B.V. | Anti-phosphocholine antibodies and methods of use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040175759A1 (en) * | 1997-06-20 | 2004-09-09 | Leuven Research & Development Vzw | Assays, antibodies, and standards for detection of oxidized and MDA-modified low density lipoproteins |
| KR100619543B1 (ko) * | 2005-04-01 | 2006-09-01 | 아주대학교산학협력단 | 말론디알데히드에 의해 산화된 저밀도 지질단백질에특이적으로 결합하는 인간 단일클론 자가항체 및 그의항원결합 단편 |
| US7476551B2 (en) * | 2001-08-27 | 2009-01-13 | The Board Of Trustees Of The University Of Arkansas | Diagnosing atherosclerosis risk by measuring carbamylated low density lipoprotein levels |
-
2010
- 2010-06-14 KR KR1020100056125A patent/KR20110136253A/ko not_active Ceased
- 2010-11-22 WO PCT/KR2010/008219 patent/WO2011159000A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040175759A1 (en) * | 1997-06-20 | 2004-09-09 | Leuven Research & Development Vzw | Assays, antibodies, and standards for detection of oxidized and MDA-modified low density lipoproteins |
| US7476551B2 (en) * | 2001-08-27 | 2009-01-13 | The Board Of Trustees Of The University Of Arkansas | Diagnosing atherosclerosis risk by measuring carbamylated low density lipoprotein levels |
| KR100619543B1 (ko) * | 2005-04-01 | 2006-09-01 | 아주대학교산학협력단 | 말론디알데히드에 의해 산화된 저밀도 지질단백질에특이적으로 결합하는 인간 단일클론 자가항체 및 그의항원결합 단편 |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE GENEBANK 3 April 2005 (2005-04-03), Database accession no. AAX57548 * |
| DATABASE GENEBANK 3 April 2005 (2005-04-03), Database accession no. AAX57549 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12291579B2 (en) | 2023-03-17 | 2025-05-06 | Oxitope Pharma B.V. | Anti-phosphocholine antibodies and methods of use thereof |
| CN118459581A (zh) * | 2024-05-24 | 2024-08-09 | 东方海洋(北京)医学研究院有限公司 | 抗人氧化低密度脂蛋白的单克隆抗体及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20110136253A (ko) | 2011-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12188938B2 (en) | Anti-VISTA antibodies and fragments | |
| JP7146871B2 (ja) | 血漿カリクレイン結合タンパク質 | |
| JP6827021B2 (ja) | 単一抗原抗pd−l1およびpd−l2二重結合抗体およびその使用方法 | |
| US20030211553A1 (en) | Selectively-expressed epitope on the human CD38 molecule detected by a phage display library-derived human scFv antibody fragment | |
| JP5419067B2 (ja) | 増殖性障害を処置するための組成物および方法 | |
| BG66209B1 (bg) | Методи за получаване на антитела с двойна специфичност | |
| JP2003500015A (ja) | モノクローナル抗体、抗原ならびに悪性疾患の診断および治療 | |
| JP2001523958A (ja) | 免疫療法のctla−4結合ペプチド | |
| US20150086575A1 (en) | B cell surface reactive antibodies | |
| BRPI0412138B1 (pt) | método de selecionar um anticorpo monoclonal, método de selecionar um anticorpo monoclonal ou seu fragmento de ligação em antígeno, método de detectar a presença de células nk, e, método de purificar de uma amostra células nk | |
| EA030777B1 (ru) | Анти-альфа-синуклеинсвязывающие молекулы | |
| CN107459576A (zh) | 用于诊断和治疗铁相关病症的组合物和方法 | |
| WO2018234383A1 (en) | Anti-allergen antibodies | |
| KR20100059977A (ko) | 신규의 올리고클론 항체의 제조방법 | |
| TW200835517A (en) | Peptide-based passive immunization therapy for treatment of atherosclerosis | |
| WO2011159000A1 (ko) | 산화된 저밀도 지질단백질 및 카바밀레이트화된 저밀도 지질단백질에 특이적으로 결합하는 인간 단일클론 항체 및 그의 항원결합단편 | |
| EP2694548B1 (en) | Hmgb1 specific monoclonal antibodies | |
| Czerwinski et al. | A molecular approach for isolating high‐affinity Fab fragments that are useful in blood group serology | |
| Dehghanpisheh et al. | Retrovirally induced mouse anti‐TCR monoclonals can synergize the in vitro proliferative T cell response to bacterial superantigens | |
| HK40037923A (en) | Anti-vista antibodies and fragments | |
| KR20260052228A (ko) | 알칼리성 포스파타제 항체 및 이의 용도 | |
| EP4709762A2 (en) | Alkaline phosphatase antibodies and uses thereof | |
| Chang | Generation and Testing of an Anti-idiotype that Acts as a Surrogate Antigen for Oxidized LDL (OxLDL) in Serological Studies Measuring Anti-OxLDL Antibodies | |
| Souto-Carneiro | Molecular and functional analyses of human synovial B-lymphocytes in Rheumatoid Arthritis | |
| HK1254953B (en) | Anti-vista antibodies and fragments |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10853301 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10853301 Country of ref document: EP Kind code of ref document: A1 |

