WO2011144761A1 - Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders - Google Patents
Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders Download PDFInfo
- Publication number
- WO2011144761A1 WO2011144761A1 PCT/EP2011/058379 EP2011058379W WO2011144761A1 WO 2011144761 A1 WO2011144761 A1 WO 2011144761A1 EP 2011058379 W EP2011058379 W EP 2011058379W WO 2011144761 A1 WO2011144761 A1 WO 2011144761A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polynucleotide
- mir
- fzd3
- nucleic acid
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
Definitions
- the present invention relates to compositions comprising an antagonist/inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of FZD3 (Frizzled-3) or a biologically active derivative thereof for use in treating or preventing bone disorders and/or cardiovascular disorders.
- bone disorders comprise, inter alia, osteoporosis, osteopenia, bone fracture, bone cancer, as well as impaired bone homeostasis.
- Cardiovascular diseases to be treated by the compounds of the present invention may be selected from the group consisting of infarction, stroke, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart failure, renal failure, stress- related carciovascular disorders, and atherosclerosis.
- Preferred compounds to be used in these medical interventions are antagonistic compounds, like nucleic acid molecules, directed to polynucleotides that are capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof.
- An example of such a polynucleotide that needs to be antagonized is miR-31 or its 5' or 3' isoforms or variants.
- the present invention relates to methods for and compositions for use in diagnosing bone disorders and/or cardiovascular disorders.
- Compounds to be used in these diagnostic methods may be compounds (like primers and probes) that are capable of detecting such a polynucleotide that is capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof.
- miR-31 or miR-31 or its 5' or 3' isoforms or variants is, in accordance with this invention, a polynucleotide that is capable of decreasing or suppressing expression of FZD3.
- the old systemic environment has been identified to contain factors that either fail to promote or actively inhibit successful tissue regeneration when tested in a parabiosis mouse model (Conboy, Nature (2005), 433: 760-764), while factors contained in the systemic environment of young animals promote successful tissue regeneration (Matsumoto, Eur I leart J (2009), 30: 346-355).
- Visceral fat accretion is among the hallmarks of aging in humans (Huffman, Biochem Biophys Acta (2009), 1790: 1117-1123), while osteogenic differentiation potential of ASCs decreases with age. This decrease is not due to a loss of osteogenic precursors (Zhu, J Tissue Eng Regen Med (2009), 3 : 290-301), suggesting that factors altering the cellular behaviour are involved.
- ASCs and endothelial cells are linked in vivo since preadipocytes within adipose tissue depots and endothelial cells exhibit a close relationships (Hausman, J Anim Sci (2004), 82: 925-934), supporting a paracrine relationship between these cell types.
- Exosomes 40-100 nm in size, are membrane vesicles of endosomal origin that are released into the extracellular environment. They can act on intercellular communication by allowing exchange of proteins, lipids, and also mRNA and miRNAs between cells (Valadi, Nat Cell Biol (2007), 9: 654-659; Viaud, PLoS One (2009), 4: e4942).
- the contained factors like miRNAs, mRNAs and proteins then influence the behaviour of the target cells.
- Examples are endothelial progenitor cell derived exosomes that induce angiogenesis in endothelial cells upon uptake (Deregibus, Blood (2007), 110: 2440- 2448), endothelial-derived exosomes in patients with pulmonary arterial hypertension (Bakouboula, Am J Respir Crit Care Med (2008), 177: 536-543), ovarian carcinoma and glioblastoma cells that release exosomes and change the tissue microenvironment in favour of tumor progression (Keller, Cancer Lett (2009), 278: 73-81 ; Skog, Nat Cell Biol (2008), 10: 1470-1476).
- tumour cells which carry antigenic molecules recongnized by T cells
- a cell free antigen source for anticancer vaccines Escudier, J Transl Med (2005), 3: 10; Iero, Cell Death Differ (2008), 15: 80-88; Morse, J Transl Med (2005), 3: 9; Viaud, Horm Metab Res (2008), 40: 82-88; Viaud, PLoS One (2009), 4: e49429).
- the present invention provides for a composition comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of frizzled 3 (FZD3) or a biologically active derivative thereof for use in treating or preventing bone disorders and/or cardiovascular disorders in a subject as will be further detailed and exemplified herein below. Also, the present invention provides for a method for treating or preventing bone disorders and/or cardiovascular disorders in a subject comprising administering an effective amount of a composition comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof.
- FZD3 frizzled 3
- a polynucleotide to be inhibited in context of this medical intervention i.e. the herein disclosed medical/pharmaceutical uses
- the methods of treating/preventing a disorder as provided herein may be miR-31 or its 5' or 3' isoforms or variants.
- the present invention provides for a composition for use in and a method for diagnosing bone disorders and/or cardiovascular disorders in a subject.
- examples for such bone disorders are osteoporosis, osteopenia, bone fracture, impaired bone homeostasis or.
- cardiovascular disorders examples include cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart failure and renal failure, as well as atherosclerosis (Erusalimsky, J Appl Physiol (2009). 106: 326-32).
- cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart failure and renal failure, as well as atherosclerosis (Erusalimsky, J Appl Physiol (2009). 106: 326-32).
- miR-31 is specifically elevated in stress-induced senescent endothelial cells as well as exosomes of stress-induced premature senescent endothelial cells.
- an antagonist/inhibitor of miR-31 is also to be used in context of this invention for the medical intervention of stress-related cardiovascular disorders, like cardiovascular disorders due to oxidative stress or hypoxia/reperfusion damage.
- the present invention relates to a composition
- a composition comprising an antagonist/inhibitor of a polynucleotide that is capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof and/or an antagonist/inhibitor of miR-31 or its 5' or 3 ' isoforms or variants for use in treating or preventing bone disorders and/or cardiovascular disorders in a subject.
- said subject is a human subject.
- Also provided is a method for treating or preventing bone disorders and/or cardiovascular disorders in a subject comprising administering an effective amount of a composition comprising an antagonist/inhibitor of a polynucleotide that is capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof and/or administering an effective amount of a composition comprising an antagonist/inhibitor of miR-31 or its 5' or 3' isoforms or variants.
- the most preferred subject to be treated is a human subject in need of medical intervention.
- the present inventors investigated two prime characteristics of such stem cells: self renewal/cell division as well as differentiation potential.
- ASCs adipose-tissue derived stem cells
- miRNAs are packaged into exosomes, that these vesicles are taken up by target cells suggesting a paracrine signalling function and that the amount of specific miRNAs differs in young versus senescent endothelial cells in vitro.
- miRNA miR-31
- miR-31 is taken up by ASCs by exposing them to supernatant or purified exosomes of senescent endothelial cells as well as by exposure to blood-derived exosomes of elderly individuals.
- the target of miR-31 that is responsible for osteogenic inhibition was identified as frizzled-3 (FZD3), which so far has only been described as important for the development of the neuronal system since FZD3 knock-out mice show defects in aconai growth and guidance (Endo, Mol Cell Biol (2008), 28: 2368-2379; Stuebner, Dev Dyn (2010), 239: 246-260; Wang, J Neurosci (2006), 26: 2147-2156; Wang, J Neurosci (2002), 22: 8563-8573; Wang, J Neurosci (2006), 26: 366-364). Furthermore, it has been found herein that miR-31 inhibits osteogenic differentiation and increases proliferation of ASCs.
- FZD3 frizzled-3
- polynucleotides decreasing or suppressing expression of FZD3, like represent a novel marker of biological age or of age-associated diseases like osteoporosis, osteopenia, bone fracture or impaired bone homeostasis or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart failure and renal failure or atherosclerosis and the like.
- antagonists/inhibitors of polynucleotides that decrease or suppress the expression of FZD3, like antagonists/inhibitors of miR-31 and/or of miR-31 or its 5' or 3' isoforms or variants represents novel therapeutics.
- miR-31 and/or of miR-31 or its 5' or 3' isoforms or variants represent novel therapeutic targets in all diseases that require osteogenesis and bone formation, such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, bone cancer, etc. as well as in cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis.
- Examples of 3' and 5' isoforms of miR-31 are shown in Table 3.
- the functionality of niiR-31 delivery was tested on the proliferation and differentiation capacity of ASCs. As has been found in context of the present invention, the cell numbers reached within a batch were higher, while osteogenic differentiation was partially inhibited by senescent exosomes or miR-31 alone.
- miR-31 is upregulated significantly in sera of elderly donors. This shows that exosomal delivery of miR- 31 is also found in the blood and not only in vitro during cellular senescence. Furthermore, in context of the present invention, using elderly blood-derived exosomes, inhibition of osteogenesis was again observed. So far, miR-31 was not described to be present in serum derived exosomes.
- miR-31 is a valuable tool as a biomarker for aging and age-associated such as osteoporosis, osteopenia, bone fracture or impaired bone homeostasis or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis.
- miR-31 was found to be elevated in a first set of experiments in 2 out of 4 osteopenia patients. In more detailed experiments as provided in the enclosed examples, 7 out of 10 osteopenia patients either show a stable disease or progression to osteoporosis where miR-31 was found in blood serum. Furthermore, as shown in the appended examples, inhibition of miR-31 improves osteogenic differentiation, while transient increase of miR-31 results in decreased osteogenic differentiation. This finding demonstrates that inhibition of miR-31 improves osteoblast formation. This is very useful in the medical invention of bone disorders, e.g., osteoporosis.
- osteoporosis is defined as a disease characterized by low bone mass and structural deterioration of bone tissue, leading to bone fragility and an increased susceptibility to fractures. Osteoporosis is an age-related systemic condition that naturally occurs among mammals, mainly in humans (Xu, Endocr Rev (2010), 31(4): 447-505). Accordingly, the present invention also provides for a good and reliable biomarker for bone disorders, like osteoporosis and/or osteopenia.
- the biomarker provided herein is also useful in the diagnosis of cardiovascular disorders.
- the appended examples also show that miR-31 is elevated in stress-induced senescent endothelial cells. Furthermore, as shown herein, miR-31 is elevated in exosomes of stress-induced premature senescent endothelial cells. Accordingly, miR-31 is also indicative for cardiovascular disorders.
- polynucleotide when referring to a polynucleotide to be inhibited in context of the present invention, said polynucleotide is capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof as described and exemplified in detail herein.
- the expression of FZD3 can be decreased or suppressed by polynucleotides described herein contained in senescent exosomes, e.g., by hybridizing to the mRNA of FZD3.
- polynucleotides described herein contained in senescent exosomes e.g., by hybridizing to the mRNA of FZD3.
- degradation of or prevention of translation of FZD3 mRNA can be induced, both resulting in suppression or decreasing of expression of FZD3.
- inhibition of the polynucleotides described herein which inhibit or suppress expression of FZD3 would increase of expression of FZD3.
- ASCs undergoing osteogenic differentiation were tested for FZD3 transcription. Indeed, it was upregulated after 4 days compared to cells treated with control medium ( Figure 7A).
- FZD3 levels were significantly downregulated after treatment with senescent exosomes compared to treatment with young exosomes and control treated cells ( Figure 7B). 24 h after miR-31 iransfection, FDZ3 was also downregulated, but did not reach significant levels, which might be explained due to the very low mRNA levels of FDZ3 when cells are not differentiating ( Figure 7C).
- FZD3 represents not only a marker but also a necessary factor for osteogenic differentiation and turns out to be a direct target of polynucleotides to be inhibited in context of the present invention also in ASCs.
- inhibition of the polynucleotides to be inhibited in context of the present invention is particularly useful in the treatment or prevention of osteoporosis, osteopenia, bone fracture or impaired bone homeostasis or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- the polynucleotide to be inhibited in context of the present invention i.e.
- microR A also abbreviated herein as miRNA or miR
- miRNA or miR a microR A or miR
- a mimic microRNA or a precursor thereof an siRNA or a precursor thereof, a long non-coding RNA or a precursor thereof, an snRNA (small/short hairpin RNA) or a precursor thereof, an stRNA (small temporal RNA) or a precursor thereof, an fRNA (functional RNA) or a precursor thereof, an snRNA (small nuclear RNA) or a precursor thereof, a snoRNA (small nucleolar RNA) or a precursor thereof, a piRNA (piwi-interacting RNA) or a precursor thereof, a tasiRNA (transacting small/short interfering RNA) or a precursor thereof, an aRNA (antisense RNA) or a precursor thereof, or a small non-
- artificial polynucleotides mentioned hereinabove may have the same effect on the expression of FZD3 or biologically active derivatives thereof (i.e. decreasing or suppressing said expression) as physiological polynucleotides mentioned hereinabove
- inhibitors of such artificial polynucleotides may at the same time also be inhibitors of such physiological polynucleotides.
- "precursors" of a polynucleotide to be inhibited in context of the present invention i.e. which is capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof, may be forms of the respective polynucleotides as they occur during maturation of the respective polynucleotides.
- precursors of a microRNA or a mimic microRNA may be primary miRNAs (pri-miRNAs) or precursor miRNAs (pre- miRNAs) as occurring during maturation of miRNAs. Both are single transcripts (i.e. ssRNA) that fold into a characteristic intramolecular secondary structure, the so-called "hairpin loop", which contains a stretch of about 18 to 23 base pairs, which may be interrupted by mismatches.
- precursors of siRNAs may be long dsRNA molecules or shorter "hairpin loop" ssRNA molecules. Both types of these siRNA precursors may contain a stretch of base pairs without any mismatch.
- the polynucleotide to be inhibited in accordance with the present invention is a microRNA or a precursor thereof or a mimic microRNA or a precursor thereof.
- polynucleotides described in and to inhibited in context of the present invention may be of any length.
- the polynucleotide is about 15 to about 100 nucleotides in length, more preferably about 18 to about 27 nucleotides and most preferably about 20 to about 24 nucleotides.
- the polynucleotide to be antagonized/inhibited in context of the present invention i. e. the polynucleotide being capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof and/or the miR-31 miR-31 or its 5' or 3' isoforms or variants to be antagonized/inhibited, may be selected from the group consisting of:
- a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 (i.e. the seed sequence of miR-31 : GGCAAGAU);
- a polynucleotide according to (b) comprising the nucleotide sequence of SEQ ID NO: 2 (i.e. the seed sequence of miR-31 : GGCAAGAU).
- identity levels of polynucleotides refer to the entire length of the nucleotide sequence of the referred to SEQ ID NOs. and is assessed pair-wise, wherein each gap is to be counted as one mismatch.
- identity may be used herein in the context of a polynucleotide to be inhibited in context of the present invention which has a nucleic acid sequence with an identity of at least 80%, 85%, 90%, 95%>, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR-31), SEQ ID NO: 2 (seed sequence of miR-31), or SEQ ID NO: 3 (pre-miR-31) as also shown in Table 1 herein, preferably over the entire length.
- a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence with an identity of at least 80%, 85%, 90%, 95%o, 97%, 98% or 99% to a polynucleotide comprising or consisting of a nucleotide sequence consisting of the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 as shown in Table 1 herein including one, two or more nucleotide(s) of the corresponding mature- or pre-miRNA sequence at the 5 '-end and/or the 3 '-end of the respective seed sequence.
- a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence with an identity of at least 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence AGGCAAGAUGC (i. e. the seed sequence of SEQ ID NO: 1 including one nucleotide of the corresponding mature sequence at the 5 '-end and one nucleotide of the corresponding mature sequence at the 3 '-end).
- the term "identity" refers to the shorter sequence and to the part of the longer sequence that matches said shorter sequence. Therefore, when the sequences which are compared do not have the same length, the degree of identity preferably either refers to the percentage of nucleotide residues in the shorter sequence which are identical to consecutive nucleotide residues contained in the longer sequence or to the percentage of consecutive nucleotides contained in the longer sequence which are identical to the nucleotide sequence of the shorter sequence. Of course, as described above, a gap as "part of consecutive nucleotides" is to be counted as a mismatch.
- sequence comparisons e.g. , establishment of "identity” values
- miRNAs miRBase ID (miRBase: http://www.mirbase.org, version number 15 released April 2010), and mature and pre-miR sequences (seed sequences underscored).
- Table 2 Examples for nucleic acid molecules that a capable of hybridizing to the above identified miRNAs, seed se uences and the like.
- thymine (T) and uracil (U) may be used interchangeably depending on the respective type of polynucleotide.
- hybridizing sequences may be employed as specific antagonists/inhibitors polynucleotide that is capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof, and/or as specific antagonists/inhibitors an antagonist/inhibitor of miR-31 or its 5' or 3' isoforms or variants.
- hybridizing sequences may hybridize to all kinds of polynucleotides to be antagonized or inhibited as described herein, including microRNAs, siRNAs, mimic microRNAs, long non-coding RNAs, snRNAs, stRNAs, fRNAs, snRNAs, snoRNAs, piRNAs, tasiRNAs, aRNAs as well as precursors of such RNAs.
- thymine (T) and uracil (U) may be used interchangeably depending on the respective type of polynucleotide.
- Identity means that there is preferably a functional and/or structural equivalence between the corresponding nucleotide sequences.
- Nucleic acid sequences having the given identity levels to the particular nucleic acid sequences of the polynucleotides to be inhibited in context of the present invention may represent derivatives/variants of these sequences which, preferably, have the same biological function.
- the biological function of a polynucleotide to be inhibited in context of the present invention is the ability to decrease or suppress expression of FZD3 or a biologically active derivative thereof, e.g., by hybridizing to the mRNA of FZD3, thereby inducing degradation or preventing translation of the FZD3 mRNA.
- FZD3 or a biologically active derivative thereof has been decreased or suppressed can be easily tested by methods well known in the art and as also described herein.
- methods suitable to determine whether the expression of FZD3 or a biologically active derivative is decreased or suppressed are polyacrylamide gel electrophoresis and related blotting techniques such as Western Blot paired with chromogenic dye-based protein detection techniques (such as silver or coomassie blue staining) or with fluorescence- and luminescence-based detection methods for proteins in solutions and on gels, blots and microarrays, such as immunostaining, as well as immunoprecipitation, ELISA, microarrays, and mass spectrometry.
- polyacrylamide gel electrophoresis and related blotting techniques such as Western Blot paired with chromogenic dye-based protein detection techniques (such as silver or coomassie blue staining) or with fluorescence- and luminescence-based detection methods for proteins in solutions and on gels, blots and
- reporter gene assays in which commonly used reporter genes are fluorescent proteins such as GFP, eGFP, YFP, eYFP, BFP, eBFP, luminescent proteins such as the enzymes Renilla or firefly luciferase, and ⁇ - galactosidase encoded by the lacZ gene (Inui, Nat Rev Mol Cell Biol (2010), 1 1 : 252-63).
- Whether the mRNA of FZD3 is degraded or its translation is prevented can also be tested by methods known in the art and as also described herein.
- methods suitable to determine whether an mRNA is degraded are qPCR, RT-PCR, qRT-PCR, RT-qPCR, Light Cycler®, TaqMan® Platform and Assays or quantigene assay (Zhou, Anal Biochem (2000), 282: 46-53) Northern blot, dot blot, RNAse protection assays, microarrays, next generation sequencing (VanGuilder, Biotechniques (2008), 44(5): 619-26; Elvidge, Pharmacogenomics (2006), 7: 123-134; Metzker, Nat Rev Genet (2010), 11 : 31-46; Kafatos, NAR (1979), 7: 1541 -1552).
- the polynucleotides described herein may be either naturally occurring variations, for instance sequences from other varieties, species, etc., or mutations, and said mutations may have formed naturally or may have been produced by deliberate mutagenesis. Furthermore, the variations may be synthetically produced sequences.
- the allelic variants may be naturally occurring variants or synthetically produced variants or variants produced by recombinant DNA, RNA, PNA, GNA, TNA or LNA techniques known in the art. Deviations from the above-described nucleic acid sequences may have been produced, e.g., by deletion, substitution, addition, insertion of nucleotides and/or by recombination.
- addition refers to adding at least one nucleic acid residue to one or both ends of the given sequence
- insertion refers to inserting at least one nucleic acid residue within a given nucleotide sequence.
- deletion refers to deleting or removal of at least one nucleic acid residue in a given nucleotide sequence.
- substitution refers to the replacement of at least one nucleic acid residue in a given nucleotide sequence.
- polynucleotides described herein may be nucleic acid analogues such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo-oligonucleotides, LNA molecules, PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antagomir (cholesterol-conjugated; for antagonists/inhibitors) polynucleotides.
- nucleic acid analogues such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo-oligonucleotides, LNA molecules, PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antagomir (cholesterol-conjugated; for antagonists/inhibi
- nucleic acid molecule may refer to nucleic acid analogues such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo- oligonucleotides, LNA molecules, PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antagomir (cholesterol-conjugated; for antagonists/inhibitors) polynucleotides or hybrids thereof or any modification thereof as known in the art (see, e.g., US 5,525,71 1, US 4,71 1,955, US 5,792,608 or EP 302175 for examples of modifications).
- nucleic acid analogues such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo- oligonucleotides, LNA molecules, PNA molecules, GNA (glycol nucleic acid) molecules,
- Nucleic acid residues comprised by the polynucleotides may be naturally occurring nucleic acid residues or artificially produced nucleic acid residues.
- Examples for nucleic acid residues are adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U), xanthine (X), and hypoxanthine (HX).
- thymine (T) and uracil (U) may be used interchangeably depending on the respective type of polynucleotide.
- a thymine (T) as part of a DNA corresponds to an uracil (U) as part of the corresponding transcribed mRNA.
- the polynucleotides may be single- or double-stranded, linear or circular, natural or synthetic, and, if not indicated otherwise, without any size limitation.
- the polynucleotide to be inhibited in context of the present invention may be a microRNA (miRNA) or a precursor thereof, a mimic microRNA or a precursor thereof, an siRNA or a precursor thereof, a long non-coding RNA or a precursor thereof, an snRNA (small/short hairpin RNA) or a precursor thereof, an stRNA (small temporal RNA) or a precursor thereof, an fRNA (functional RNA) or a precursor thereof, an snRNA (small nuclear RNA) or a precursor thereof, a snoRNA (small nucleolar RNA) or a precursor thereof, a piRNA (piwi- interacting RNA) or a precursor thereof, a tasiRNA (trans-acting small/short interfering RNA) or a precursor thereof,
- precursors of the polynucleotides to be inhibited in context of the present invention may be forms of the respective polynucleotides as they occur during maturation of the respective polynucleotides.
- precursors of a microRNA or a mimic microRNA may be primary miRNAs (pri-miRNAs) or precursor miRNAs (pre-miRNAs) as occurring during maturation of miRNAs. Both are single transcripts (i.e. ssRNA) that fold into a characteristic intramolecular secondary structure, the so-called “hairpin loop", which contains a stretch of about 18 to 23 base pairs, which is often interrupted by mismatches.
- precursors of siRNAs may be long dsRNA molecules or shorter "hairpin loop" ssRNA molecules. Both types of these siRNA precursors may contain a stretch of base pairs without any mismatch.
- the current model for maturation of mammalian miRNAs is nuclear cleavage of the primary miRNA (pri-miRNA) which liberates a 60-70 nt stem loop intermediate, known as the miRNA precursor or pre-miRNA.
- the mature about 18- 23 nt long miRNA is yielded from one arm of the stem loop precursor (Bartel, Cell (2004), 1 16: 281-297; Lee, EMBO J (2002), 21 : 4663-4670; Zeng and Cullen, RNA (2003), 9: 112- 123).
- Said polynucleotides may be in the form of a plasmid or of viral DNA or RNA.
- the polynucleotide to be inhibited in context of the present invention is a microRNA or a mimic microRNA.
- the polynucleotide to be inhibited in context of the present invention comprises or consists of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR- 31), SEQ ID NO: 2 (seed sequence o miR-3 1 ), or SEQ ID NO: 3 (pre-miR-31 ) as also shown in Table 1 herein.
- a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence comprising or consisting of a nucleotide sequence consisting of the seed sequence of SEQ ID NO: 1 or SEQ ID NO: 3 as shown in Table 1 including one, two, three or more nucleotide(s) of the corresponding mature- or pre- miR sequence at the 5 '-end and/or the 3 '-end of the respective seed sequence.
- a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence comprising or consisting of the nucleotide sequence [A] G-G-C-A-A-G-A-U [GC] (i.e.
- polynucleotides which decrease or suppress expression of FZD3) may also comprise or consist of the nucleotide sequence shown in any one of SEQ ID NO: 1 (mature miR-31), SEQ ID NO: 2 (seed sequence of miR-31), or SEQ ID NO: 3 (pre-miR-31) as also shown in Table 1 herein, wherein one, two, three, four, five or more nucleotides are added, deleted or substituted.
- a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence comprising or consisting of the nucleotide a nucleotide sequence consisting of the seed sequence of SEQ ID NO: 1 or SEQ ID NO: 3 as shown in Table 1 including one, two, three or more nucleotide(s) of the corresponding mature- or pre-miR sequence at the 5 '-end and/or the 3 '-end of the respective seed sequence, wherein one, two, three, four, five or more nucleotides are added, deleted or substituted.
- a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence comprising or consisting of the nucleotide sequence [A] G-G-C-A-A-G-A-U [U] (i.e. the seed sequence of SEQ ID NO: 1 plus one nucleotide of the corresponding mature sequence at the 5 '-end and one nucleotide of the corresponding mature sequence at the 3 '-end, wherein the nucleotide at the 3 '-end has been substituted by U).
- said addition, deletion or substitution o one, two, three, four, five or more nucleotides is not effected within the seed sequence of a polynucleotide as shown in Table 1 herein.
- the polynucleotide to be inhibited in context of the present invention may comprise or consist of a polynucleotide being at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR-31), SEQ ID NO: 2 (seed sequence of miR-31) or SEQ ID NO: 3 (pre-miR-31) as also shown in Table 1 herein.
- a polynucleotide to be inhibited in context of the present invention may also comprise or consist of a nucleic acid sequence with an identity of at least 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of a nucleotide sequence consisting of the seed sequence of SEQ ID NO: 1 or SEQ ID NO: 3 as shown in Table 1 including one, two or more nucleotide(s) of the corresponding mature- or pre-miR sequence at the 5 '-end and/or the 3 '-end of the respective seed sequence.
- a polynucleotide to be inhibited in context of the present invention may comprise or consist of a nucleic acid sequence with an identity of at least 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence G-G-C-A-A-G-A-U [GC] ( . e. the seed sequence of SEQ ID NO: 1 plus two nucleotides of the corresponding mature sequence at the 3'-end).
- a polynucleotide to be inhibited in context of the present invention may also comprise or consist of a nucleic acid sequence with an identity of at least 80%, 85%, 90%, 95%, 91%, 98%o or 99% to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR-31) or SEQ ID NO: 3 (pre-miR-31) as also shown in Table 1 herein and comprise the nucleic acid sequence as shown in SEQ ID NO: 2 (seed sequence of miR-31) as shown in Table 1 herein.
- a polynucleotide comprising the nucleic acid sequence of a sequence provided herein may also be a polynucleotide consisting of said nucleic acid sequence.
- the polynucleotide to be inhibited in context of the present invention has the nucleic acid sequence as shown in SEQ ID NO: 1.
- the hybridization may occur and be detected under physiological or artificial conditions, under stringent or non-stringent conditions.
- Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, Russell “Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory, N.Y.
- the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions. Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility. In accordance to the invention described herein, low stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may, for example, be set at 6 x SSC, 1% SDS at 65 °C.
- polynucleotides to be inhibited in context of the present invention which hybridize to the mRNA of FZD3 or a biologically active derivative thereof also comprise fragments of the above described polynucleotides which are to be inhibited in context of the present invention. Such fragments preferably are polynucleotides which are able to decrease or suppress expression of FZD3 or a biologically active derivative thereof.
- Such fragments may be, e.g., polynucleotides such as siRNAs or siRNA pools consisting of 4 siRNAs targeting the mRNA of FZD3 as can be purchased from Dharmacon (on-target plus smart-pool L-005502- 00-0005, NM 017412).
- a hybridization complex refers to a complex between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T (or U, respectively) bases; these hydrogen bonds may be further stabilized by base stacking interactions.
- a hybridization complex may be formed in solution ⁇ e.g., Cot or Rot analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g. , membranes, filters, chips, pins or glass slides to which, e.g., cells have been fixed).
- a solid support e.g. , membranes, filters, chips, pins or glass slides to which, e.g., cells have been fixed.
- complementary or complementarity refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence "A-G-T (or U, respectively)" binds to the complementary sequence "T (or U, respectively)-C-A”.
- Complementarity between two single-stranded molecules may be "partial", in which only some of the bases of the nucleic acids bind, or it may be complete when total complementarity exists between single-stranded molecules.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
- a test to determine hybridization between an miRNA and an mRNA may be a Luciferase Assay as also described herein and in technical bulletins by Promega (C8021 (psiCHECK-2 Vector), E1960 (Dual-Luciferase® Reporter Assay System)).
- reporter gene assays in which common reporter genes are used such as fluorescent proteins (e.g., GFP, eGFP, YFP, eYFP, BFP, or eBFP), or luminescent proteins (e.g., Renilla or firefly luciferase, or ⁇ -galactosidase encoded by the lacZ gene).
- fluorescent proteins e.g., GFP, eGFP, YFP, eYFP, BFP, or eBFP
- luminescent proteins e.g., Renilla or firefly luciferase, or ⁇ -galactosidase encoded by the lacZ gene.
- degradation of mRNA or the level of the respective translation product can easily be examined by methods known in the art.
- Examples for methods suitable to examine degradation or stabilization of mRNA are qPCR, RT-PCR, qRT-PCR, RT-qPCR, Light Cycler®, TaqMan® Platform and Assays, Northern blot, dot blot, microarrays, next generation sequencing (VanGuilder, Biotechniques (2008), 44: 619-26; Elvidge, Pharmacogenomics (2006), 7: 123-134; Metzker, Nat Rev Genet (2010), 1 1 : 31-46).
- Examples for methods suitable to examine whether the translation of a mRNA has been prevented or decreased are polyacrylamide gel electrophoresis and related blotting techniques such as Western Blot paired with chromogenic dye-based protein detection techniques (such as silver or coomassie blue staining) or with fluorescence- and luminescence-based detection methods for proteins in solutions and on gels, blots and microarrays, such as immunostaining, as well as immunoprecipitation, ELISA, microarrays, and mass spectrometry (Western Blot (Burnette, Anal Biochem (1981) 112: 195-203) or ELISA (Crowther, JA. The ELISA Guidebook. Humana Press; Totowa, NJ: 2001 ).
- polyacrylamide gel electrophoresis and related blotting techniques such as Western Blot paired with chromogenic dye-based protein detection techniques (such as silver or coomassie blue staining) or with fluorescence- and luminescence-based detection methods for
- FZD3 in order to determine whether a given polynucleotide decreases or suppresses expression of FZD3 or a biologically active derivative thereof (e.g., by hybridizing to the mRNA of FZD3 and thereby inducing degradation or preventing translation of FZD3 mRNA), the level of expressed FZD3 can be easily detected.
- a polynucleotide is to be assessed as decreasing or suppressing expression of FZD3 or a biologically active derivative thereof if the detected level of expressed FZD3 in a test sample which was contacted with a polynucleotide to be tested is at least 1.5 fold, preferably at least 1.75 fold, more preferably at least 2.0 fold, and most preferably at least 2.5 fold lower than the FZD3 expression level of a control sample which was not contacted with the polynucleotide.
- a Western blot analysis can be performed for FZD3 protein detection.
- the polynucleotides to be inhibited in context of the present invention may hybridize to the 3 'UTR (untranslated region) of the mRNA of FZD3 or a biologically active derivative thereof or to fragments of said 3'UTR. Hybridization between a polynucleotide to be inhibited in context of the present invention and the 3'UTR of the mRNA of FZD3 or a biologically active derivative thereof can easily be tested as described hereinabove.
- the polynucleotide to be inhibited in context of the present invention induces degradation of or prevents translation of said mRNA of FZD3 or a biologically derivative thereof.
- FZD3 when referring to FZD3, reference is made to GenBank Accession No. NM_017412, Version No. 177 (released on April 15, 2010).
- GenBank Accession No. NM_017412, Version No. 177 released on April 15, 2010.
- the sequence of the 3'UTR of FZD3 mRNA is shown in SEQ ID NO: 4 herein.
- the polynucleotide to be inhibited in context of the present invention is able to hybridize to a nucleic acid sequence comprising nucleotides 3419-3426 of SEQ ID NO: 4, preferably thereby inducing degradation of or prevention of translation of the mRNA of FZD3 or a biologically derivative thereof.
- the polynucleotide to be inhibited in context of the present invention may be comprised in lipid composition, an exosome, a vesicular body, a liposome, in PEI (polyethylene imine) or atellocollagen.
- the antagonist/inhibitor of a polynucleotide to be inhibited i. e. that is capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof
- an antagonist/inhibitor may be an antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or variants as described herein.
- the present invention also relates to such lipid compositions, exosomes and liposomes for use in the medical interventions described herein, e.g., for use in treating or preventing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- a biologically active derivative of FZD3 means that is has the same biological function as FZD3, i.e. it is able to transduce signals via the PI3K - AKT pathway (Kawasaki, Cell Signal (2007), 19: 2498-506).
- the phosphorylation status of its downstream target AKT can be tested.
- ASCs bone marrow derived stem cells, or any other cell type that has the ability to undergo osteogenic differentiation
- the cells may be treated with compounds to be tested for FZD3 -activity for different times and with different doses, or the cells may be transfected with plasmids coding for compounds to be tested for FZD3 -activity.
- cell lysates may be prepared by methods known in the art. This can be done, for example, by using cell lysis buffer (20 mM Tris-HCl (pH 7.5)), 12 mM ⁇ - glycerophosphate. 150 mM NaCl, 5 mM EGTA, 10 mM sodium fluoride.
- phosphorylated proteins may be performed by methods known in the art, e.g., by immunoblot analyses.
- an immunoblot analysis 30 ⁇ g of total proteins may be subjected to SDS-PAGE and blotted on polyvinylidene difluoride membranes (e.g., PVDF).
- the membranes may then be probed with anti-phospho-Akt (Ser473) antibody (Cell Signalling, Danvers, 9271) (1 :500), and anti-phospho-Akt (Thr308) antibody (Cell Signalling, Danvers, 9272) (1 :500).
- anti-phospho-Akt Ser473
- anti-phospho-Akt Thr308 antibody
- FZD3 overexpression of FZD3
- positive control overexpression of FZD3 can be used.
- specific PI3K inhibitors like Wortmannin or LY294002 can be used that are known to prevent AKT phosphorylation.
- AKT is phosphorylated to an extent of more than 40% or more than 50% compared to untreated cell controls, the compound rested can be considered a biologically active derivative of FZD3.
- the nucleic acid sequence of the 3'UTR of the mRNA of a FZD3 derivative in context of the present invention may be at least 80%, 85%, 90%, 95% or 98% identical to SEQ ID NO
- the present invention relates to a composition
- a composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited, i.e. which are capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof for use in treating or preventing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- a composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited, i.e. which are capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof for use in treating or preventing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular
- composition may also comprise an exosome and/or a liposome which contain an antagonist/inhibitor of a polynucleotide that is capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof and/or which contain an antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or variants.
- the subject to be treated or in which a bone disorder and/or cardiovascular disorder such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis is to be prevented may be mammalian.
- the subject is human.
- the composition to be used in context of the present invention may comprise an antagonist/inhibitor or exosome/liposome containing said antagonist/inhibitor which inhibits one, two, three or more of the polynucleotides to be inhibited in context of the present invention.
- the composition may comprise two, three or more antagonists/inhibitors or exosomes/liposomes, wherein each of the antagonist/inhibitors is capable of inhibiting one. two, three or more of the polynucleotides to be inhibited in context of the present invention.
- composition described herein and to be employed in context with the present invention may contain the antagonist/inhibitor or exosome/liposome described herein in an amount of about 1 ng/kg body weight to about 100 mg/kg body weight of the subject which is to be treated or in which a bone disorder and/or cardiovascular disorder such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis is to be prevented.
- the composition comprises the inhibitor in an amount of about 1 ⁇ g/kg body weight to about 20 mg/kg body weight, more preferably 1 mg/kg body weight to about 10 mg/kg body weight.
- composition described herein and to be employed in context of the present invention may further comprise a pharmaceutically acceptable carrier.
- the present invention also relates to a pharmaceutical composition comprising an antagonist/inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention, an antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or variants, and/or an exosome or liposome containing said antagonist/inhibitor and further comprising a pharmaceutically acceptable carrier, excipient and/or diluent.
- suitable pharmaceutical carriers include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc.
- Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose, i.e.
- cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis are to be prevented.
- the composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention comprises the inhibitor in an amount of about 1 ⁇ /13 ⁇ 4 body weight to about 20 mg/kg body weight, more preferably 1 mg/kg body weight to about 10 mg/kg body weight.
- Administration of the composition may be effected or administered by different ways, e.g.
- enterally orally (e.g., pill, tablet (buccal, sublingual, orally, disintegrating, capsule, thin film, liquid solution or suspension, powder, solid crystals or liquid), rectally (e.g., suppository, enema), via injection (e.g., intravenously, subcutaneously, intramuscularly, intraperitoneally, intradermal ly ) via inhalation (e.g., intrabronchially), topically, vaginally, cpicutaneously, or intranasally.
- injection e.g., intravenously, subcutaneously, intramuscularly, intraperitoneally, intradermal ly
- inhalation e.g., intrabronchially
- topically vaginally, cpicutaneously, or intranasally.
- compositions comprising exosomes or liposomes containing an antagonist/inhibitor of a polynucleotide capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof and/or an antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or variants may be applied locally or systemically.
- the composition comprising an exosome/liposome is particularly for use in treating bone disorders such as osteoporosis, osteopenia, bone fracture or impaired bone homeostasis.
- compositions directly to a bone are known in the art (Takeshita, Mol Ther (2010), 18: 181-187).
- said composition When applied systemically (e.g., parenteral ly. orally or other routes described herein), said composition may be used for treating or preventing bone disorders and/or cardiovascular disorders as described herein.
- the antagonists/inhibitors described herein may be administered locally or systemically by other means, even directly.
- the dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
- compositions described herein may be administered locally or systemically.
- Systemic administration will preferably be parenterally, e.g., intravenously.
- the composition may also be administered directly to the target site, e.g., by biolistic delivery to an internal or external target site or by catheter to a site in an artery.
- Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, polyethylene imine and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- doses below or above of the exemplary ranges described hereinabove are envisioned, especially considering the aforementioned factors.
- compositions described herein comprising an antagonist/inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention being capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof, an antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or variants, and/or an exosome/liposome containing said antagonist/inhibitor may be used to treat or prevent bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis,
- an antagonist/inhibitor of a polynucleotide or polynucleotides to be inhibited in accordance with the present invention may be a nucleic acid molecule, a polypeptide or any other compound capable of antagonizing/inhibiting the polynucleotides to be inhibited in context of the present invention.
- the antagonist/inhibitor to be employed in context of the present invention is an antagonist/inhibitor of miR-31 or its 5' or 3' isoforms or variants.
- An antagonist/inhibitor to be employed in context of the present invention may be a nucleic acid molecule capable of hybridizing to the polynucleotide to be inhibited.
- nucleic acid molecules comprise all kinds of nucleotide molecules such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo-oligonucleotides, LNA molecules (0rom, Gene (2006), 10(372), 137-141), PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antagomir (cholesterol- conjugated) polynucleotides as well as modifications thereof.
- nucleotide molecules such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo-oligonucleotides, LNA molecules (0rom, Gene (2006), 10(372), 137-141), PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antag
- the antagonist/inhibitor may hybridize to said polynucleotide to be inhibited under stringent or non-stringent conditions as described herein (for hybridization conditions for short sequences, see below), preferably under stringent conditions.
- stringent or non-stringent conditions as described herein (for hybridization conditions for short sequences, see below), preferably under stringent conditions.
- the antagonist/inhibitor prevents said polynucleotide to be inhibited from decreasing or suppressing expression of FZD3 or a biologically derivative thereof, e.g., by hybridization of said polynucleotide with the mRNA (e.g., the 3'UTR thereof) of FZD3 or a biologically derivative thereof.
- a given compound can be assessed as an antagonist/inhibitor to be employed in context of the present invention if it is able to prevent hybridization of a polynucleotide to be inhibited in context of the present invention with the mRNA (e.g., the 3 'UTR thereof) of FZD3 or a biologically derivative thereof.
- an antagonist/inhibitor may be able to at least partially reverse the effect of a polynucleotide to be inhibited in context of the present invention on the expression of FZD3 or a biologically active derivative thereof.
- the antagonist/inhibitor to be employed in context of the present invention may be capable of reversing the effect of a polynucleotide to be inhibited on FZD3 -expression by 50% or more, preferably by 60% or more, more preferably by 70% or more, more preferably by 80% or more, more preferably by 90% or more, more preferably by 95% or more, more preferably by 98% or more, and most preferably by 99% or more.
- a polynucleotide to be inhibited in context of the present invention is capable of decreasing or suppressing the expression of FZD3 or a biologically derivative thereof such as it amounts to an expression level of 50% compared to the normal expression level (i.e. without said polynucleotide), and the expression level increases by applying an inhibitor as described herein such that the expression level of FZD3 or a biologically derivative thereof increases to an amount of 75% compared to the normal expression level (i.e. without said polynucleotide), the effect of said polynucleotide is reversed by said inhibitor by 50%.
- the antagonist/inhibitor of a polynucleotide to be inhibited in context of the present invention is a nucleic acid molecule which is capable o hybridizing to said polynucleotides to be inhibited, preferably under stringent conditions as described herein, thereby preventing said polynucleotide from hybridizing to the mRNA (e.g., the 3'UTR thereof) of FZD3 or a biologically active derivative thereof.
- hybridization of said nucleic acid to be employed as an antagonist/inhibitor to a polynucleotide to be inhibited in context of the present invention may be over the entire length of said polynucleotide to be inhibited or only over a part of the sequence of said polynucleotide to be inhibited, e.g., over at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of the sequence of said polynucleotide to be inhibited.
- the antagonist/inhibitor to be employed in context of the present invention may be an antisense oligonucleotide which is complementary to a polynucleotide to be inhibited in context of the present invention.
- an antagonist/inhibitor to be employed in context of the present invention is an antisense oligonucleotide which comprises or consists of a nucleic acid molecule having a sequence complementary to any one of the sequences as shown in Table 1 hereinabove, e.g., to any one of SEQ ID NOs. 1 to 3.
- antisense oligonucleotides may comprise or consist of a nucleotide sequence of any one of SEQ ID NOs. 5 to 8.
- antagonists/inhibitors of miRNAs or siRNAs are well known in the art and customized miRNA- or siRNA-inhibitors are commercially available.
- antagonists/inhibitors of polynucleotides to be inhibited in context of the present invention may be nucleic acid molecules such as antagomiRs ( riitzfeldt, Nature (2005), 438: 685-689) or any other T-O- methyl-RNA oligonucleotide having phosphorothioates bonds and a cholesterol tail, miRCURY LNATM microRNA inhibitors (Exiqon), in vivo LNATM miR inhibitors (Exiqon), tiny LNAs (Obad, Nat Genet (201 1), 43(4): 371-378), miR-decoys or miR-sponges (Ebert, Nat Methods (2007), 4: 721-726; Bond, Nat Med (2008), 14: 1271-1277) or the like which are capable of antagonizing/inhibiting a polynucleotide to be inhibited in context of the present invention as described hereinabove, e.g., by hybridizing to said polynucle
- An antagonist/inhibitor might also be or derive from miRNA degrading enzymes as described in Chatterjee, Nature (2009), 461 : 546-9, hammerhead ribozymes as described in Tedeschi, Drug Discov Today (2009), 14: 776-783, or antogomirzymes as described in Jadhav, Angew Chem Int Ed Engl (2009), 48(14): 2557-2560.
- An example of an miRCURY LNATM microRNA inhibitor in context of the present invention is anti-miR-31 LNA as shown in SEQ ID NO: 5.
- the antagmoiRs, miCURY LNATM microRNA inhibitors, in vivo LNATM miR inhibitors, tiny LNAs, miR decoys or miR sponges may comprise a nucleic acid molecule or include a nucleic acid sequence selected from the group consisting of (a) a nucleic acid sequence being or comprising SEQ ID NO: 5;
- nucleic acid sequence being or comprising SEQ ID NO: 7;
- nucleic acid sequence which is at least 90% or at least 95% identical to the nucleic acid sequence of any one of (a) to (d).
- such an t agon i sts/i nhi b i tors may hybridize or bind to all kinds of polynucleotides to be inhibited as described herein, including microRNA, siRNA, mimic microRNA, long non-coding RNAs, snRNA, stRNA, fRNA, snRNA, snoRNA, piRNA, tasiRNA, aRNA and precursors of such polynucleotides.
- the present invention relates to a composition
- a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the sequence shown in SEQ ID NO: 1, thereby preventing hybridization of said polynucleotide with the mRNA of FZD3, for use in treating or preventing bone disorder, like osteoporosis or cardiovascular disease, like atherosclerosis in a human subject.
- the present invention relates to a composition
- a composition comprising a nucleic acid molecule which hybridizes under stringent conditions to miR-31 or its 3' or 5' isoforms or variants, thereby preventing hybridization of miR-31 or its 3' or 5' isoforms or variants with the mRNA of FZD3, for use in treating or preventing osteoporosis or atherosclerosis in a human subject.
- Said nucleic acid molecule may be an antagomiR, a miCURY LNATM microRNA inhibitor, an in vivo LNATM miR inhibitor, a miR decoy or a miR sponge as described herein.
- the present invention relates to a composition
- a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the sequence shown in SEQ ID NO: 2, thereby preventing hybridization of said polynucleotide with the mRNA of FZD3, for use in treating or preventing osteoporosis or cardiovascular diseases such as atherosclerosis in a human subject.
- the present invention relates to a composition
- a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the sequence shown in SEQ ID NO: 3, thereby preventing hybridization of said polynucleotide with the mRNA of FZD3, for use in treating or preventing osteoporosis or cardiovascular diseases such as atherosclerosis in a human subject.
- nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 3 is an antagomiR.
- a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 3 is a 2'-0-methyl-RNA oligonucleotide having phosphorothioates bonds and a cholesterol tail.
- nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 3 is a miRCURY LNATM microRNA inhibitor (Exiqon).
- nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 3 is an in vivo LNATM miR inhibitors (Exiqon).
- nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 3 is a miR-decoy or sponge.
- the antagonist/inhibitor (/. e. in case of a nucleic acid antagonist/inhibitor) of the polynucleotide to be inhibited in context of the present invention may be cloned into a vector.
- vector as used herein particularly refers to plasmids, cosmids, viruses, bacteriophages and other vectors commonly used in genetic engineering.
- these vectors are suitable for the transformation of cells, like fungal cells, cells of microorganisms such as yeast or prokaryotic cells.
- such vectors are suitable for stable transformation of bacterial cells, for example to transcribe the polynucleotide of the present invention.
- the vector as provided is an expression vector.
- expression vectors have been widely described in the literature. As a rule, they may not only contain a selection marker gene and a replication-origin ensuring replication in the host selected, but also a promoter, and in most cases a termination signal for transcription. Between the promoter and the termination signal there is preferably at least one restriction site or a polylinker which enables the insertion of a nucleic acid sequence/molecule desired to be expressed.
- the vector provided herein is generated by taking advantage of an expression vector known in the prior art that already comprises a promoter suitable to be employed in context of this invention, for example expression of an inhibitor (i.e. in case of a nucleic acid inhibitor) of a polynucleotide as described hereinabove, the nucleic acid construct is inserted into that vector in a manner the resulting vector comprises only one promoter suitable to be employed in context of this invention.
- the promoter can be excised either from the nucleic acid construct or from the expression vector prior to ligation.
- the vector into which an antagonist/inhibitor (i.e. in case of a nucleic acid antagonist/inhibitor) of a polynucleotide to be inhibited in context of the present invention (i.e. which decreases or suppresses FZD3 -expression) is cloned is an adenoviral, adeno-associated viral (AAV), retroviral, or nonviral minicircle-vector.
- vectors suitable to comprise the inhibitor (i.e. in case of a nucleic acid inhibitor) of a polynucleotide to be inhibited in context of the present invention to form the vector described herein are known in the art.
- a vector into which an inhibitor (i.e. in case of a nucleic acid inhibitor) of a polynucleotide to be inhibited in context of the present invention has been cloned may be miR-Vec, a retroviral expression vector (Voorhoeve, Cell (2006), 124: 1 169-1 181).
- the inhibitor (in case of a nucleic acid inhibitor or the coding nucleic acid sequence of a peptide inhibitor) of a polynucleotide to inhibited in context of the present invention and/or the vector into which the polynucleotide described herein is cloned may be transduced, transformed or transfected or otherwise introduced into a host cell.
- the host cell is a eukaryotic or a prokaryotic cell, for example, a bacterial cell.
- the host cell is preferably a mammalian cell.
- the host cell described herein is intended to be particularly useful for generating the inhibitor of a polynucleotide to be inhibited in context of the present invention.
- the host cell described hereinabove may be a prokaryotic or eukaryotic cell, comprising an inhibitor of the polynucleotide to be inhibited in context of the present invention or the vector described herein or a cell derived from such a cell and containing the nucleic acid construct or the vector described herein.
- the host cell comprises, i.e. is genetically modified with nucleic acid sequence of the inhibitor of the polynucleotide to be inhibited in context of the present invention or the vector described herein in such a way that it contains the nucleic acid sequence of the inhibitor of a polynucleotide to be inhibited in context of the present invention integrated into the genome.
- such host cell described herein may be a bacterial, yeast, or fungus cell.
- the host cell is capable to transcribe the nucleic acid sequence of an inhibitor of a polynucleotide which decreases or suppresses expression of FZD3 or a biologically active derivative thereof in context of the present invention.
- transformation or genetically engineering of the host cell with a polynucleotide to be inhibited in context of the present invention or vector described herein can be carried out by standard methods, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990.
- miR-31 is a valuable tool as a biomarker for aging and age-associated diseases such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis or cardiovascular diseases such as stroke, inlarction. hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis.
- diseases such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis or cardiovascular diseases such as stroke, inlarction. hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis.
- the polynucleotides to be inhibited in context of the present invention may also serve as diagnostic or prognostic markers themselves and detection of said polynucleotides, e.g., by using compounds binding thereto, will be useful in diagnosing or predicting the progression of diseases or disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- the present invention relates to a compound binding to a polynucleotide to be inhibited in context of the present invention, i. e.
- a polynucleotide which is capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof as described herein, for use in diagnosing or predicting the progression of bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- the present invention further relates to a composition
- a composition comprising
- nucleic acid molecule which hybridizes to a polynucleotide capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof as described hereinabove, and/or
- the present invention also relates to a composition
- a composition comprising
- nucleic acid molecule which hybridizes, preferably under stringent conditions, to a polynucleotide being capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof,
- agent as used herein, particularly in context with "agent interacting with a polynucleotide being capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof or "agent that binds to a polynucleotide capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof comprises specific proteins or protein fragments.
- proteins or protein fragments may be, e.g., antibodies or fragments thereof, small molecule inhibitors or transcription factors or modified transcription factors. Examples of such (modified) transcription factors are (modified) zinc finger proteins.
- antibody and “antibody fragment” are used herein in the broadest sense and includes, but is not limited to, monoclonal and polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), chimeric antibodies, CDR grafted antibodies, humanized antibodies, camelized antibodies, single chain antibodies and antibody fragments and fragment constructs, e.g.
- the present invention relates to pharmaceutical compositions comprising a compound, e.g., a nucleic acid molecule or an antibody, binding to a polynucleotide to be inhibited in context of the present invention for use in diagnosing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- a compound e.g., a nucleic acid molecule or an antibody
- cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis
- cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject.
- the compound binding to a polynucleotide to be inhibited in context of the present invention is a nucleic acid molecule as described in context of an inhibitor capable of hybridizing to said polynucleotide as described hereinabove. Hybridization of such a binding nucleic acid molecule with said polynucleotide to be inhibited in context of the present invention can be easily detected by the skilled person using methods well known in the art and as also described herein.
- said binding compound is a binding agent such as an antibody or a fragment thereof (such as F(ab) or F(ab) 2 fragments) specifically binding to said polynucleotide to be inhibited in context of the present invention, i.e.
- Binding of an antibody or a fragment thereof to a polynucleotide can be easily detected by the skilled person using methods well known in the art such as ELISA, EIA or similar methods.
- Described herein is a method for diagnosing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject, said method comprising the steps of:
- the present invention relates to a method for diagnosing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject, said method comprising the steps of:
- nucleic acid molecule which hybridizes (preferably under stringent conditions) to a polynucleotide being capable of decreasing or suppressing expression of FZD3 and/or which hybridizes (preferably under stringent conditions) to miR-31 or its 5' or 3' iso forms or variants, or
- a stronger hybridization or a stronger binding signal in the sample of the subject compared to that of said control sample is indicative for a risk of developing or having a bone disorder and/or cardiovascular disorder.
- the method for diagnosing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject, said method comprising the steps of
- nucleic acid molecule which hybridizes (preferably under stringent conditions) to a polynucleotide being capable of decreasing or suppressing expression of FZD3 and/or which hybridizes (preferably under stringent conditions) to miR-31 or its 5' or 3' isoforms or variants;
- a stronger hybridization signal in the sample of the subject compared to that of said control sample is indicative for a risk of developing or having a bone disorder and/or cardiovascular disorder.
- the nucleic acid molecules to be employed in the diagnosing methods of the present invention may be of any kind of nucleic acid molecules as described herein.
- these nucleic acid molecules may be primers (e.g., for PCR techniques) or probes (e.g., for microarray or blot assays such as dot blot, southern blot or northern blot).
- Primers can be used particularly in PCR techniques as described and exemplified herein.
- one primer is complementary to a sequence of the 5 '-end of the polynucleotide to be detected (“forward primer”), while the other primer is complementary to a sequence of the 3 '-end of the polynucleotide to be detected (“reverse primer”).
- Forward primer a sequence of the 5 '-end of the polynucleotide to be detected
- reverse primer a sequence of the 3 '-end of the polynucleotide to be detected
- Primers for PCR techniques and the like should usually have a length of about 12 to 30 nucleotides, but they may also comprise more or less nucleotides if appropriate.
- the primers may not be 100% complementary to the respective sequences of the polynucleotide to be detected as long as it is still capable of hybridising to the polynucleotide, preferably under stringent conditions or such conditions as may be appropriate for the given primer as described herein below.
- primers may be conjugated to marker molecules or tagging molecules as described herein such as fluorescent dyes excited and emitting at UV/VIS or infrared wavelengths like FITC, TRITC, Texas Red, Cy-dyes, alexa dyes (Bioprobes), or the like.
- Probes can be generated as known in the art and usually comprise a nucleotide sequence which is complementary to a sequence of the polynucleotide to be detected. Probes are of particular useful for assays such as microarrays or blot assays (e.g., dot blot, southern blot, northern blot) as described and exemplified herein.
- probes does not have to be 100% complementary to the respective sequence of the polynucleotide to be detected as long as it is still capable of hybridising to the polynucleotide, preferably under stringent conditions.
- probes may be conjugated to marker molecules or tagging molecules as described herein such as fluorescent dyes excited and emitting at UV/VIS or infrared wavelengths like FITC, TRITC, Texas Red, Cy-dyes, alexa dyes (Bioprobes), or the like.
- Hybridization conditions in context with the diagnosing methods provided herein, particularly for PGR techniques as described above, may be as follows.
- SSC is 3 M NaCl and 300 mM Na 3 Citrate, adjusted to pH 7,0 with HCl.
- 0,1 or 0,2 x SSC at 65 °C is used, preferably with addition of SDS at 1%.
- lx or 2x SSC is used, and for non-stringent conditions, 4 x or 6 x SSC is used, preferably with 1% SDS.
- the temperature is generally 65 °C or less depending on the melting temperature of the probe- target complex.
- the nucleic acid molecule may hybridize to the polynucleotide to be detected (i.e. polynucleotide being capable of decreasing or suppressing expression of FZD3) under stringent conditions.
- determining the melting temperature (T m ) of a nucleic acid duplex is generally useful for many applications such as PCR, binding assays, hybridization, and the like.
- the T m may be defined as the temperature where 50% of a given nucleotide (such as a microRNA) is in duplex with its reverse complementary (i.e. exactly matching for formation of a double helix) sequence.
- T m is influenced by a number of factors well known to the person of ordinary skill, such as the length of the polynucleotide, the base composition, the sequence, the possibility to form secondary structures (such as the hairpin structures typical for micro RNA precursor molecules), and environmental conditions, such as salt (generally monovalent cation) concentration, divalent cation (Mg 2+ ) concentration, pH, and the presence of denaturing substances such as e.g. formamide.
- salt generally monovalent cation
- Mg 2+ divalent cation
- pH a number of the nucleotide
- denaturing substances such as e.g. formamide.
- the empirical determination could be carried out by including in a buffer solution the nucleotide to be tested and its exact reverse complement, and raising the temperature from a low temperature where annealing is perfect (such as room temperature or less) to a high temperature (such as 95 °C or more) where annealing cannot take place anymore and most of the nucleotide will be single and not annealed.
- the change from the single to the duplex form of the nucleotide may be monitored by UV spectrometry.
- the nucleotide and its exact fitting reverse complement may be dissolved in a buffer such as 0,1 x SSC (15 mM NaCl, 1 ,5 mM Na 3 Citrate, pH 7,0).
- UV absorbance may be measured at 260 nm and the temperature (t) gradually changed from low to high to observe denaturation and optionally, vice versa to observe reannealing.
- t temperature
- an S-shaped curve may be observed, having two absorbance plateaus.
- the T m may then be determined as the temperature exactly halfway between the upper plateau and the lower plateau, or, alternatively, as the maximum of the first derivative dAbs/dt.
- the T m can be experimentally determined by the same method for non-perfectly matching nucleotides, for RNA/DNA duplexes, for nucleotides incorporating modified or non-canonical bases (such as Inosine, generally used as a nucleotide intended to bind almost equally well any of the four canonical nucleotide bases A, C, G, T or U), or nucleotide molecules with altered backbones (e.g., locked nucleic acid - LNA, or phosphorodiamidate morpholino nucleotides; see, e.g., Summerton, Antisense Nucleic Acid Drug Dev (1997), 7(3): 187-195).
- modified or non-canonical bases such as Inosine, generally used as a nucleotide intended to bind almost equally well any of the four canonical nucleotide bases A, C, G, T or U
- nucleotide molecules with altered backbones e.g., locked nucleic
- T m determined experimentally is only valid for the conditions at which it was measured.
- other conditions e.g., salt (monovalent cation) concentration, divalent cation concentration
- formulas may be used that allow an estimation of the T m under different conditions (see below).
- the approximate T m of a given nucleotide sequence can be calculated.
- a number of methods are known to the person of ordinary skill in the arts, such as the GC content method, the nearest neighbour method and others.
- the nearest neighbour method results in more accurate estimations, although none of these methods is able to predict the T m of a given nucleotide sequence with absolute accuracy, so that a few °C deviation (generally assumed to be 5-10 °C) must be taken into account.
- the temperature at which the experiment is performed is chosen about 5- 10 °C below the theoretically calculated T m , in order to ensure perfect duplex formation.
- hybridization conditions may be optimized, e.g., by testing the hybridization/primer annealing/PCR or other experiment that relies on nucleotide duplex formation at various temperature and other conditions and determining the conditions at which the best result is obtained.
- a simple way to calculate estimated T m values is based on the GC content of the nucleotide sequence (see, e.g., for short nucleotide sequences, the "Wallace rule", Wallace, Nucleic Acids Res (1979), 6: 3543; for longer nucleotides, see below). Briefly, different equations are used for calculating the estimated T m of duplexes containing DNA and RNA, as RNA bases tend to pair more strongly, resulting in higher T m values for the same sequence compared to DNA-DNA duplexes (generally, RNA-RNA duplexes are most stable, RNA-DNA hybrids are of intermediate stability, and DNA-DNA duplexes are least stable for the same nucleotide sequence).
- Na + is the molar concentration of monovalent cations
- GC% is the fraction of GC nucleotides versus the total number of nucleotides (being a value between 0 and 1)
- L is the nucleotide length
- F is the percentage of formamide if present in the solution (being a value between 0 and 100).
- T m 79.8 + 18.5 log[Na + ] + 58.4 (%GC) + 1 1.8 (%GC) 2 - 820/L - 0.35F
- T m 79.8 + 18.5 log[Na + ] + 58.4 (%GC) +1 1.8 (%GC) 2 - 820/L - 0.50F
- An improved method for estimation of a T m value is the nearest neighbour method, so called because it takes into account not only the percentage of G/C interactions in the duplex, but also the nearest neighbour of each nucleotide, effectively adding up the binding energies of each dinucleotide in the sequence.
- This method results in different estimation of T m for different nucleotide sequences having the same G content, yielding a more precise estimation for T m than the above-mentioned GC content method (see for overview, e.g., SantaLucia, Proc Natl Acad Sci USA (1998), 95: 1460-1465; for DNA see, e.g., Breslauer, Proc Natl Acad Sci USA (1986), 83, 3746-3750; for RNA see, e.g., Freier, Proc Natl Acad Sci (1986), 83, 9373- 9377).
- T m (1000 ⁇ / ⁇ + AS + R*ln(C/4)) - 273.15 + 16.6 log[Na + ]
- ⁇ (Kcal/mol) is the sum of the nearest-neighbour enthalpy changes for hybrids
- A is a small constant containing corrections for helix initiation
- AS is the sum of the nearest-neighbour entropy changes
- R is the Gas Constant (1.99 cal/(K*mol))
- C is the concentration of the nucleotide
- Na + is the concentration of monovalent cations in the solution.
- the ⁇ and AS values to be used this calculation for DNA and RNA duplexes are shown in the table (formula example and values from Sigma-. Aldrich, reference see above).
- an empirical approach must be used, while in others the empirical determination may be used to improve on the estimate derived from the calculation.
- modifications like biotin, fluorescent dyes and the like will likely result in a lower T m
- some modifications like the backbone modification used in LNAs
- the nucleotides containing such backbones can, as an approximation, be assumed to be RNA nucleotides (resulting in more stable binding and hence higher T m values).
- an LNA-RNA hybrid could be calculated like the corresponding RNA-RNA hybrid, while a nucleotide containing some LNA nucleotides and some DNA nucleotides could be calculated on the basis of mixed energy values (for LNA nucleotides RNA values could be used, for DNA nucleotides DNA values are used).
- the person of ordinary skill is easily able to determine an estimate for the melting temperature for a given nucleotide sequence. For instance, for SEQ ID NO: 1, a T m of between 50 and 54,4 °C could be obtained, while for SEQ ID NO: 3 (the miRNA 31 precursor sequence), between 67,4 and 76,2 °C could be obtained.
- miRNA may be detected and quantified by deep sequencing methods, relying upon the fact that more sequence reads are obtained from miRNA molecules present more abundantly. Such methods are well known to the person of skill and described, inter alia, by Friedlander., Nat Biotechnol (2008), 26(4): 407-415; oh, BMC Genomics (2010), 10(1 1) Suppl 1 : S6; Creighton, Brief Bioinform (2009), 10 (5): 490-497. miRNA abundance may further be determined by array technology. For instance, the Ncode human miRNA array available from Invitrogen, Carlsbad, CA, USA may be used to determine relative abundance of a large number of human miRNAs in a sample.
- Chip arrays for detection and determination of relative abundance of miRNAs are also available from Affymetrix, Santa Clara, CA, USA, e.g., the U133 Plus 2.0.
- Affymetrix expression array see. e.g., Ivanov, J Biol Chem (2010), 285: 22809-22817).
- Arrays based upon LNA backbone probes are, e.g., available from Exiqon, Vedbaek Denmark.
- miRNAs microRNAs
- LNA digoxygenin-labeled locked nucleic acid
- oligonucleotide probes for detection
- the subcellular distribution of miRNAs can be detected.
- In situ methods are also useful for resolution of miRNA distribution on a tissue and organism level (see, e.g., Diez-Roux, PLoS Biol (2011),18;9(1): el000582).
- qPCR quantitative PCR
- the miRNA is a relatively short molecule, it is possible to extend its length by adding Adenosine monomers to the strand (a technique known as polyadenylation) first before reverse transcription and amplification.
- the RNA may be extracted from a sample by a suitable reagent (e.g..
- Trizol reagent available from the above mentioned Invitrogen
- poyadenylated in the presence of ATP and poly(A) polymerase reverse transcribed into DNA using a poly(T) adapter and 5' RACE sequence
- amplified using a forward primer derived from the 3 ' end of the miRNA and a reverse RACE primer for details concerning primer design, RACE sequence etc. see. e.g.. Shi, BioTechniques (2005), 39: 519- 525.
- Improvements of this technique include designing the RACE primer with a nucleotide at its 3' end (constituting an A, C, or G, but not a T, so to exclude priming anywhere on the poly A sequence and enforce priming on the miRNA sequence; see also Reichenstein., J Virol Methods (2010), 163(2): 323-328).
- the following primers may be used for detection and quantification of miR-31 (SEQ ID NO: 1): Forward primer. 5'-ACGCGGCAAGATGCTGGC A-3 1 (SEQ ID NO: 29), Reverse primer. 5 '-C AGTGCTGGGTCCGAGTGA-3 ' (SEQ ID NO: 30) (see Wang., Dis Markers (2009), 26(1): 27-34).
- Further examples for PCR quantification of miRNA 31 include Liu, J Clin Invest (2010), 120(4): 1298-1309 (also detailing microarray assaying of miRNA31).
- miRNA detection and quantitation using the Taqman system is readily available from Applied Biosystems/Life technologies, Carlsbad, CA, USA (see, e.g., http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocumen ts/cms_042142.pdf) as also described and exemplified herein in the appended Examples.
- Another example for quantitative PCR determination of mir31 uses a stem-loop primer for reverse transciption and a forward and reverse primers for PCR amplification of the miR-31 cDNA.
- primers examples include for the stem-loop primer: gtcgtatccagtgcagggtccgaggtattcgcactggatacgacagctatgcctg (SEQ ID NO: 31); for the forward primer: tgaccgaggcaagatgc (SEQ ID NO: 32); and for the reverse primer: gtgcagggtccgaggt (SEQ ID NO: 33). Forward and reverse primer overlap by one nucleotide on the miR-31 sequence, this however is not enough to cause a primer dimer (for PCR conditions and further details see Ivanov, J Biol Chem (2010), 285: 22809-22817).
- the method for diagnosing bone disorders and/or cardiovascular disorders such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis in a subject, said method comprising the steps of
- a method is provided that is a method for diagnosing bone disorders and/or cardiovascular disorders in a subject, said method comprising the steps of:
- a control sample may be a sample derived from a disease-negative (or healthy) control patient. This would be a "negative control". However, it is also envisaged, for example as a second or additional control, that such a control sample is a sample derived from a patient who suffers from said bone disease and/or said cardiovascular disorder. This would be a positive control.
- the sample may be blood, blood serum, blood plasma or another biological fluid. As shown in the appended examples, plasma and serum are very useful.
- Methods for the assessment of nucleic acid molecules also of mino RNAs are well known in the art. Such methods comprise e.g. PGR, also and in particular quantitative PGR as well as real-time qPCR; see, e.g. Chen (201 1) Methods Mol.
- the disorder to be assessed or diagnosed in accordance with the invention is a bone disorder, i.e. an osteopenia or osteoporosis and the like.
- the invention also provides a method for the detection of a polynucleotide being capable of decreasing or suppressing expression of FZD3 and/or which hybridizes to miR-31 or its 5' or 3 * isoforms or variants.
- a convenient method is based upon polymerase chain reaction (PGR), as this method is rapid, specific and sensitive.
- PGR polymerase chain reaction
- a primer is required that hybridizes specifically to the target nucleic acid.
- a second primer is required to generate a PCR product by repeated cycles of primer annealing, primer extension, and denaturing.
- the primer is chosen to maximize hybridization to the target nucleic acid while minimizing cross- hybridization to other nucleic acids present in the sample. Examples of primer sequences and of calculating the optimal hybridization temperature and other conditions for any chosen primer sequence are given hereinbelow.
- the invention provides a method for diagnosing bone disorders and/or cardiovascular disorders in a subject, said method comprising the steps of:
- step (b) contacting the hybridization complex of step (a) with a second primer and a polymerase capable of extending the primer;
- step (d) detecting and evaluating the product of step (c), resulting in a value reflecting the amount of the polynucleotide being capable of decreasing or suppressing expression of FZD3 and/or which hybridizes to miR-31 or its 5' or 3' isoforms or variants to which the first primer nucleic acid has hybridized;
- the method preferably comprises the step of reverse transcription of the target nucleotide.
- Reverse transcription may be carried out by a primer that overlaps a sufficient portion of the target molecule, preferably at its 3' end.
- the length of the target molecule may be extended by the step of polyadenylation prior to reverse transcription.
- the reverse transcription primer comprises a poly(t) sequence and at least one nucleotide complementary to the target sequence.
- said nucleotide is not a T.
- the primer comprises the complement of two nucleotides of the target sequence, wherein the first (the penultimate nucleotide at the 3' end of the primer) is not a T.
- the reverse primer is a stem-loop primer which comprises a short overlap with the (complement of the) target sequence and a stem-loop structure, as described and exemplified below.
- the diagnosis methods described herein may employ a PCR technique (e.g., qPCR, RT-PCR. qRT-PCR, RT-q CR or Light Cycler®) or other methods suitable to detect presence and/or amounts of polynucleotides.
- a PCR technique e.g., qPCR, RT-PCR. qRT-PCR, RT-q CR or Light Cycler®
- the diagnosis methods of the present invention the presence and/or amount of a polynucleotide which is capable of decreasing or suppressing expression of FZD3 or a biologically derivative thereof and/or of miR-31 or its 3' or 5' isoforms or variants is evaluated in a sample of a subject.
- PCR techniques and other methods suitable for this purpose are known in the art and are also described and exemplified herein.
- the amount of said polynucleotide and/or of miR-31 or its 3' or 5' isoforms or variants is elevated compared to a control sample, the risk of developing or having a bone disorder and/or cardiovascular disorder is increased.
- a qPCR technique total RNA of a subject's biological sample may be transcribed into cDNA. Then, specific primers hybridizing to said polynucleotide and/or of miR-31 or its 3' or 5' isoforms or variants may be used for detection.
- the amount of polynucleotide and/or of miR-31 or its 3' or 5' isoforms or variants detected in the subject's sample may then be compared to the amount of polynucleotide and/or of miR-31 or its 3' or 5' isoforms or variants of a control sample.
- a hybridization or binding signal of the subject sample of (a) which is at least 50%, 60%, 70% or 75% higher than that of the control sample may be indicative for a risk of developing or having a bone disorder and/or cardiovascular disorder such as osteoporosis, osteopenia, bone fracture, impaired bone homeostasis, or cardiovascular diseases such as stroke, infarction, hypertension, thrombosis, vascular stenosis, coronary syndromes, vascular dementia, heart and renal failure or atherosclerosis.
- the polynucleotide capable of decreasing or suppressing expression of FZD3 or a biologically active derivative thereof is preferably a polynucleotide to be inhibited in context of the present invention.
- the method is an in vitro method.
- the nucleic acid molecule hybridizing to the polynucleotide to be inhibited in context of the present invention or the agent, e.g., an antibody, binding to the polynucleotide as described hereinabove may further be conjugated to a marker or tagging molecule.
- marker molecules for nucleic acids are fluorescent dyes excited and emitting at UV/VIS or infrared wavelengths like FITC, TRITC.
- Texas Red, Cy-dyes, alexa dyes Bioprobes
- marker/tagging molecules for antibodies are enzymes like horse radish peroxidase, alkaline phosphatatase or fluorescent dyes excited and emitting at UV/VIS or infrared wavelengths like FITC, TRITC, Texas Red, Cy-dyes, alexa dyes, etc..
- A Pre-senescent (PD13) and senescent (PD53) endothelial cells were stained for senescence associated ⁇ -galactosidase activity.
- C Representative microscope pictures of two different ASC lines.
- D ASCs were stained for expression of cell surface markers using flow cytometry. Abbreviations: ASC, adipose- derived stem cell.
- FIG. 1 Effects of HUVEC supernatants on proliferation and differentiation capacity of ASCs.
- ASCs were cultivated in the presence of conditioned medium from pre- senescent (PD13) and senescent (PD53) cells and in control medium. Viable cell numbers were analysed using a hematocytometer and trypan blue staining. Error bars indicate the standard deviations of 3 independent measurements.
- B Treated cells were differentiated into the osteogenic lineage detected using Alizarin Red staining. Representative pictures of 3 independent experiments are shown. Abbreviations: Undiff. Ctrl, undifferentiated control; S, senescent; Y, young; C, control.
- A Electron microscopy of HUVEC derived exosomes. The image shows typical cup-shaped vesicles of - 50 to 100 nm in diameter.
- B Western blot analysis shows exosome marker protein CD63.
- C Exosomes were labelled with anti-CD63 antibody and visualized by electron microscopy.
- D ASCs were cultivated in the presence of exosomes derived from pre-senescent (PD13) and senescent (PD53) cells and in control medium. Cell numbers were detected using a hematocytometer and trypan blue staining. Error bars indicate the standard deviations of 3 independent measurements.
- E Treated cells were differentiated into the osteogenic lineage.
- MiR-31 is upregulated in senescent HUVECs (A) as well as in SN (B) and exosomes (C) derived from senescent HUVECs.
- D Localization of miR-31 within exosomes by electron microscopy in situ hybridization (EM-ISH).
- S senescent
- Y young
- SN supernatant.
- FIG. 5 ASCs take up exosomes derived from HUVECs.
- A Intracellular levels of miR-31 in ASC after treatment with SN or exosomes derived from pre-senescent and senescent HUVECs.
- B Representative image of stable transfected senescent endothelial cell expressing GFP.
- C Representative image of ASCs after uptake of GFP-positive exosome 48 h after incubation.
- D ASCs showing decreased levels of intracellular miR-31 levels after transfection with the negative dominant dynamin construct (K44A) and treatment with exosomes.
- K44A negative dominant dynamin construct
- FIG. 6 miR-31 alone reduces osteogenic differentiation of ASCs.
- FDZ3 is a target of miR-31 in ASCs.
- A Significant upregulation of FDZ3 mRNA 4 days after osteogenic differentiation start.
- B Significant downregulation of FDZ3 mRNA in ASCs treated with senescent versus young exosomes.
- C Downregulation of FDZ3 mRNA after transient transfection of ASCs with ⁇ miR-31 precursor.
- Figure 8 Exosomes derived from plasma of elderly reduce osteogenic differentiation of ASCs.
- A Electron microscopy of serum derived exosomes. The image shows typical cup-shaped vesicles of ⁇ 50 to 100 nm in diameter.
- C ASCs were treated with exosomes derived from old and young donors and differentiated into the osteogenic lineage. Differentiation was detected using Alizarin Red staining. Representative pictures of 2 independent experiments are shown.
- D MiR-31 levels in plasma derived from osteopenia patients were significantly increased compared to healthy age matched controls.
- Supernatant/exosomes derived from senescent endothelial cells affect proliferation and differentiation potential of ASCs via miRNA delivery. Thereby, the "senescent" environment hampers tissue regeneration and promotes cell growth which is one of the risk factors in the development of cancer.
- MiR-31 is also induced by H 2 0 2 in exosomes derived from senescent versus untreated HUVECs.
- Exosomes were harvested from H 2 0 2 pulsed endothelial cells after 14 days, when no additional cell proliferation was observed in the cells treated with 75 ⁇ tBHP. In contrast, after exposure to 35 ⁇ tBHP the cells completely recovered and resumed growth.
- Figure 11 Levels of osteogenic differentiation of ASCs after transfection with miR-31, anti-miR-31, non-targeting control miRNAs and non-transfected cells.
- Plasma levels of miR-31 of 10 male patients diagnosed with osteopenia were compared to age matched healthy controls. 7 out of 10 patients show higher levels of miR-31 normalized to U6B snRNA, resulting in a highly significant difference as calculated by Student's t testing.
- Endothelial cells were isolated from human umbilical veins as described (Chang, Exp Cell Res (2005), 309: 121-136; Jaffe, J Clin Invest (1973), 52: 2745-2756). HUVECs were cultivated in gelatin precoated flasks in Ml 99 with Earle's salts supplemented with 4 niM glutamine, 15% fetal calf serum (FCS) and 10% endothelial cell growth supplement (ECGS) containing 170 U/ml heparin at 37 °C in a humidified atmosphere with 5% C0 2 . Cells were passaged once or twice a week at a split ratio of 1 :2 to 1 :4 according to the growth rate.
- FCS fetal calf serum
- ECGS endothelial cell growth supplement
- HUVECs were cultivated to senescence and stained for senescence associated ⁇ -galactosidase (SA- -gal) activity as described previously (Chang, loc cit).
- SA- -gal senescence associated ⁇ -galactosidase
- contact inhibited (quiescent, PD19) and senescent (PD53 / 95% SA-P-gal positive) cells were allowed to secrete into ASC or HUVEC medium, depending on the experiment, for 48 h. Then supernatants were collected, centrifuged at 1900 g, 4 °C and used freshly for exosome preparation or stored at -80 °C.
- Supernatant volumes were normalized to the number of secreting HUVECs in one flask at the time of supernatant harvest. Cell culture medium incubated for 48 h at 37 °C was used as additional control.
- ASCs Human adipose-derived stem cells
- Subcutaneous adipose tissue was obtained during outpatient tumescence liposuction under local anestesia.
- ASCs were isolated as described before (Wolbank, Tissue Eng (2007), 13: 1 173-1183; Wolbank, Tissue Eng Part A (2009)) and cultured in DMEM-low glucose/HAM ' s F-12 supplemented with 4mM L-glutamine, 10% fetal calf serum (FCS. PAA) and lng/mL recombinant human basic fibroblast growth factor (rhFGF, R&D Systems) at 37 °C, 5% C0 2 and 95%) air humidity. Cells were passaged once or twice a week at a split ratio of 1 :2 according to the growth rate.
- ASCs were characterized due to the expression of specific surface markers (CD 13, CD 14, CD34, CD45, CD73, CD90, HLA ABC, HLA DR) by flow cytometry (FACS Calibur, Beckton Dickenson)
- osteogenic differentiation All differentiation protocols were carried out in 24 well cell culture plates.
- ASCs were seeded at a density of 2 x 10 3 cell per well.
- 72 h after seeding cells were incubated with osteogenic differentiation medium (DMEM-low glucose. 10% FCS, 4 mM L-glutamine, ⁇ dexamethasone, 150 ⁇ ascorbate-2-phosphat, 10 mM ⁇ - glycerolphosphate and ⁇ vitamine-D3) up to 4 weeks.
- osteogenic differentiation medium DMEM-low glucose. 10% FCS, 4 mM L-glutamine, ⁇ dexamethasone, 150 ⁇ ascorbate-2-phosphat, 10 mM ⁇ - glycerolphosphate and ⁇ vitamine-D3
- Alizarin Red staining of calcified structures cells were fixed for 1 h in 70% ethanol at - 20 °C. After brief rinsing, cells were stained for 20 min with 40 mM Alizarin Red solution (Sigma) and washed with PBS. For quantification, Alizarin Red was extracted for 30 min using 200 ⁇ 0.1 M HCl/0.5% SDS solution. The extracted dye was measured at 425 nm.
- ASCs were transfected using siPORTTM JVeoFXTM transfection reagent (Applied Biosystems). Cells were transfected with 10 nM Precursor hsa-miR-31, 100 nM anti-miR-31 or 10 nM negative control 2# (Ambion) according to the manufacturer's protocol. Cells were harvested after 24 or 48 h or differentiation was started as described before three days after transfection.
- ASCs were transfected with a 0.5 ⁇ g dominant negative dynamin construct (K44A) or dynamin wild type construct (provided by Mark A. McNiven Department of Biochemistry and Molecular Biology & Center for Basic Research in Digestive Diseases, Mayo Clinic and graduate School, Rochester, Minnesota 55905, USA) using Metafectene Pro (Biontex Laboratories GmbH) according to manufactures protocol.
- K44A dominant negative dynamin construct
- dynamin wild type construct provided by Mark A. McNiven Department of Biochemistry and Molecular Biology & Center for Basic Research in Digestive Diseases, Mayo Clinic and graduate School, Rochester, Minnesota 55905, USA
- Metafectene Pro Biontex Laboratories GmbH
- HUVECs were seeded in 12-well cell culture plates and were allowed to secrete into ASC medium for 48 h. Thereafter, the cells were detached using 50mM EDTA and stained with Annexin V- FITC and PI (Roche) according to the manufacturer's instructions. Analysis of the percentage of apoptotic and necrotic/late-apoptotic cells were performed using a FACS- Calibur and the CellQuest software (Becton Dickinson).
- RNA samples For isolation of RNA from blood samples, 250-500 ⁇ serum was used to isolate total RNA using Trizol LS reagent (Invitrogen). To allow for normalization of sample-to-sample variation in RNA isolation, 25 fmol synthetic C-elegans miRNAs cel-miR-39 were added before isolation. Serum samples (27 healthy old donors and 21 healthy young donors) were obtained from R. Westendorp, Department of Gerontology & Geriatrics C2-R, Leiden University Medical Center, The Netherlands. Moreover 4 osteopenia serum samples obtained from P. Pietschmann, Department of Pathophysiology, General hospital, Vienna. Institutional ethics committees approved the study, and written, informed consent has been obtained from each subject.
- Senenscent HUVECs were transduced with a lentiviral vector containing GFP protein kindly provided by Pidder Jansen-Durr, Institute for Biomedical Aging Research, Innsbruck, Austria (Muck, Rejuvenation Res (2008), 1 1 : 449-453). Briefly, lentiviral transduction was performed using senescent and pre-senescent HUVECs. Generally, 100000-150000 senescent and 50000 pre-senescent HUVECs were plated in a 6-well plate and incubated over night. A multiplicity of infection (MOI) of two to eight with 8 ⁇ g/ml Polybrene, which increases the infection efficiency, was used to produce stably transduced cells.
- MOI multiplicity of infection
- Exosomes were purified by filtration and differential centrifugation as described previously (Lehmann, Cancer Res (2008), 68: 7864-7871). In brief, supernatants were collected after incubation of 48 h. This conditioned medium will be centrifuged at 500 g for 10 min to sediment cells and at 14000 g for 15 min to eliminate cell debris and filtered through a 0.22 ⁇ filter excluding a fraction of apoptotic bodies. Exosomes are then sedimented by ultracentifugation at 100000 g for 60 min and the resultant pellet is washed with PBS. Exosomes will be used as fresh preparations for electron microscopy or conserved at -80 °C for further analysis. For differentiation studies, exosomes derived from 2 x 10 4 HUVECs in 50 ⁇ PBS were added per well ASCs.
- in-situ hybridization (EM-ISH) exosome pellets were permeabilized with 0.1% Triton-X for 5 min at room temperature. After washing with PBS, exosomes were incubated for at least 4 h with hybridization buffer as described previously (Obernosterer, Nat Protoc (2007), 2: 1508-1514).
- exosomes were incubated with Anti-DIG antibody (Roche) for 30 min and an additional hour with the second 5 nm gold particle labelled antibody (Sigma). After washing with PBS, exosomes were embedded in Epon, sections on average, approximately 80 nm were cut using a Ultramicrotom and were then analysed using transmission electron microscopy (TEM), Philips model CM 12 electron microscope (Philips, Eindhoven, NL).
- TEM transmission electron microscopy
- Philips model CM 12 electron microscope Philips, Eindhoven, NL.
- Example 9 Effects of HUVEC supernatants on proliferation and differentiation apacity of ASCs
- Example 10 Exosomes of senescent HUVECs increase proliferation and reduce differentiation capacity of ASCs
- Exosomes are membrane coated vesicles, which are between 40 and 100 nm in diameter, and originate from intracellular multivesicular bodies (Pap, Inflamm Res (2009), 58: 1-8), Since recently exosomes have been described as paracrine signalling molecules in various settings (Deregibus, Blood (2007), 110: 2440-2448; Hunter, PLoS ONE (2008), 3 : e3694; Lehmann, loc cit; Pap, loc cif), it was tested whether exosomes might contribute to the changes in ASC behaviour. Therefore, exosomes were isolated from HUVEC supernatants by sequential centrifugation steps (Deregibus, loc cit). To confirm the identity of the exosomes electron microscopy was performed.
- Example 11 miR-31 is secreted by endothelial cells
- Example 12 ASCs take up exosomes derived from HUVECs
- ASCs Two days after incubation with GFP positive exosomes, ASCs showed GFP signals in a punctuate pattern within the cytoplasm while ASCs treated with the supernatant depleted of GFP-exosomes showed no signals (Figure 5C).
- K44A dominant negative dynamin construct
- dynamin wild type construct as control
- Dynamin was shown to be responsible for endocytosis in eukaryotic cells (Cao, 1998, loc cit; Cao, 2000, loc cif) and endocytosis is responsible for uptake of exosomes (Valadi, loc cif). Indeed, as shown in Figure 5D, miR-31 levels were decreased in ASCs transfected with the dominant negative dynamin construct ( 44A).
- FZD3 mRNA levels were indicated to be increased in MSCs under osteogenic conditions (Baksh, J Cell Biochem (2007), 101 : 1 109-1124). In context of the present invention, it was upregulated after 4 days compared to cells treated with control medium ( Figure 7A). Moreover, FZD3 levels were significantly downregulated after treatment with senescent exosomes compared to treatment with young exosomes and control treated cells ( Figure 7B). 24 h after miR-31 transfection, FDZ3 was also downregulated but did not reach significant levels, which might be explained due to the very low mRNA levels of FDZ3 when cells are not differentiating ( Figure 7C). Thus, FZD3 represents not only a marker but also a necessary factor for osteogenic differentiation and might be a direct target of miR-31 also in ASCs.
- Example 15 Effects of exosomes derived from plasma on ASCs
- Oxidative stress is known to be associated with endothelial senescence and dysfunction (Seals, Clin Sci (Lond) (2011), 120(9): 357-375).
- SIPS stress-induce premature senescence
- tBHP stress-induce premature senescence
- Permanent growth arrest was induced by 75 ⁇ tBHP as assessed by microscopic follow up for 14 d according to the protocols described in Unterluggauer, Exp Gerontol (2003), 38: 1 149-1 160.
- miR-31 was found to be elevated in exosomes of stress-induced premature senescent endothelial cells.
- H 2 0 2 35 ⁇ , 50 ⁇ and 75 ⁇ tButylhydroperoxide (tBHP)
- tBHP tButylhydroperoxide
- the increase of miR-31 in the supernatant of senescent endothelial cells is not restricted to HUVECs that are derived from human umbilical vein endothelial cells, but was also found in senescence of human retinal endothelial cells as well as in senescent human liver derived endothelial cells versus early passage control cells (data not shown).
- Example 17 miR-31 antagonist inhibits osteogenic differentiation
- LNA locked nucleic acids
- Example 18 miR-3 inhibits osteogenesis in mouse model system
- C3I It 101/2 cell line was used, a mouse mesenchymal mulitpotent cell line that can be induced to undergo osteogenic differentiation by addition of BMP2 (Richard, PLoS Genetic (2005), 1(6): e74).
- BMP2 PLoS Genetic (2005), 1(6): e74
- cells were co-transfected with a reporter construct encoding luciferase under control of the osteocalcin promoter (Feichtinger, Tissue Eng Part C Methods (2010), 17(4): 401-410).
- (C2C12) C3Htl0 1/2 cell line in conjunction with an osteocalcin specific reporter gene assay (Feichtinger, Tissue Eng Part C Methods (2010), 17(4): 401-410).
- (C2C12) C3Ht! 0 1/2 cells are capable of differentiating to the osteogenic lineage upon treatment with recombinant BMPs, which is observable by the induction of alkaline phosphatase, osteocalcin and other osteoblast specific genes.
- Plasma of 10 male patients diagnosed with osteopenia were compared to age matched controls provided by P. Pietschmann, Department of Pathophysiology, General hospital, Vienna. Institutional ethics committees approved the study, and written, informed consent has been obtained from each subject.
- Plasma was prepared according to standard procedures clinical procedures as recommended for the analysis of miRNAs (Taylor, Methods Mol Biol (201 1), 728: 235-246; Kroh, Methods (2010), 50: 298-301). Total RNA was isolated using Trizol LS. The qPCR was then performed using Taqman® protocol, where in a first step a specific reverse transcription and then amplification is performed. The amplification of specific miR-31 amplicons is monitored by displacing a fluorescently labelled probe by the amplification. The assays were run in triplicates and differential expression of miR-31 was normalized to the small U6 snRNA. In addition a spike in control of a C. elegans specific miRNA was performed to normalize for miRNA recovery during the full RNA isolation - quantification procedure. PGR was performed as detailed below.
- Rotor-Gene 6000 Rotor-Gene Software 6000, Series Software 1.7
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cardiology (AREA)
- Physical Education & Sports Medicine (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Heart & Thoracic Surgery (AREA)
- Rheumatology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Dispersion Chemistry (AREA)
- Cell Biology (AREA)
- Urology & Nephrology (AREA)
- Hospice & Palliative Care (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/699,272 US20130108687A1 (en) | 2010-05-21 | 2011-05-23 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
| EP11727134.6A EP2571988B1 (en) | 2010-05-21 | 2011-05-23 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
| CA2800018A CA2800018C (en) | 2010-05-21 | 2011-05-23 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
| BR112012029656A BR112012029656A2 (pt) | 2010-05-21 | 2011-05-23 | composições para uso no tratamento ou diagnóstico de disturbios ósseos e/ou distúrbios cardiovasculares |
| CN201180034123.1A CN103210085B (zh) | 2010-05-21 | 2011-05-23 | 用于治疗或诊断骨障碍和/或心血管障碍的组合物 |
| JP2013511636A JP5894581B2 (ja) | 2010-05-21 | 2011-05-23 | 骨障害及び/又は心血管障害の治療又は診断に使用する組成物 |
| US13/841,530 US20130210883A1 (en) | 2010-05-21 | 2013-03-15 | Lipase inhibitors |
| US14/094,772 US9150855B2 (en) | 2010-05-21 | 2013-12-02 | Methods for diagnosing bone or cardiovascular disorders |
| US14/561,585 US9212362B2 (en) | 2010-05-21 | 2014-12-05 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10163604 | 2010-05-21 | ||
| EP10163604.1 | 2010-05-21 |
Related Child Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/699,272 A-371-Of-International US20130108687A1 (en) | 2010-05-21 | 2011-05-23 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
| US13/841,530 Continuation-In-Part US20130210883A1 (en) | 2010-05-21 | 2013-03-15 | Lipase inhibitors |
| US14/094,772 Division US9150855B2 (en) | 2010-05-21 | 2013-12-02 | Methods for diagnosing bone or cardiovascular disorders |
| US14/561,585 Division US9212362B2 (en) | 2010-05-21 | 2014-12-05 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011144761A1 true WO2011144761A1 (en) | 2011-11-24 |
Family
ID=44537805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2011/058379 Ceased WO2011144761A1 (en) | 2010-05-21 | 2011-05-23 | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders |
Country Status (7)
| Country | Link |
|---|---|
| US (3) | US20130108687A1 (enExample) |
| EP (1) | EP2571988B1 (enExample) |
| JP (1) | JP5894581B2 (enExample) |
| CN (1) | CN103210085B (enExample) |
| BR (1) | BR112012029656A2 (enExample) |
| CA (1) | CA2800018C (enExample) |
| WO (1) | WO2011144761A1 (enExample) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103316342A (zh) * | 2013-02-28 | 2013-09-25 | 中国人民解放军沈阳军区总医院 | MiR-31抑制剂用于抑制血管损伤后再狭窄的用途 |
| WO2014195693A1 (en) * | 2013-06-03 | 2014-12-11 | Isis Innovation Limited | Prevention and treatment of atrial fibrillation |
| WO2015189345A3 (en) * | 2014-06-13 | 2016-02-04 | Universität Für Bodenkultur Wien | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
| WO2016094406A1 (en) * | 2014-12-08 | 2016-06-16 | Thomas Jefferson University | Treatment and prevention of thrombosis using an anti-mir |
| CN110951869A (zh) * | 2020-01-02 | 2020-04-03 | 北京市创伤骨科研究所 | 骨质疏松诊治用生物标志物 |
| CN111118139A (zh) * | 2020-01-13 | 2020-05-08 | 北京市创伤骨科研究所 | 一种骨质疏松的分子靶标及其应用 |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014197747A1 (en) * | 2013-06-05 | 2014-12-11 | The Trustees Of Columbia University In The City Of New York | Exosomes for orofacial diagnostics and therapeutics |
| CN103627705B (zh) * | 2013-10-28 | 2016-02-24 | 南京医科大学 | 与膀胱癌相关的piRNA生物标志物及其应用 |
| JP6694240B2 (ja) * | 2015-01-30 | 2020-05-13 | ロート製薬株式会社 | 細胞の品質を評価する方法、及び細胞の品質判定キット |
| CN107176976B (zh) * | 2016-03-11 | 2020-02-14 | 上海交通大学医学院 | 微小rna31前体编码多肽在制备免疫调节药物中的应用 |
| CN107151695B (zh) * | 2016-12-08 | 2021-11-09 | 青岛大学 | 用于检测急性心肌缺血疾病的piRNA组合及其检测方法和应用 |
| CN110129429A (zh) * | 2019-05-22 | 2019-08-16 | 昌乐县人民医院 | 核酸分子在制备诊断骨科疾病的产品中的应用 |
| CN110184270A (zh) * | 2019-05-31 | 2019-08-30 | 固安博健生物技术有限公司 | 非编码rna作为男性骨质疏松症的诊断标志物 |
| CN110055256A (zh) * | 2019-05-31 | 2019-07-26 | 固安博健生物技术有限公司 | Loc105376287作为诊断男性骨质疏松症的分子标志物的用途 |
| CN111599476B (zh) * | 2020-05-15 | 2023-08-11 | 中南大学湘雅医院 | 一种高血压的预测模型及其建立方法以及用于预测高血压的生物标记物 |
| CN112746101B (zh) * | 2020-12-25 | 2023-02-28 | 深圳市人民医院 | 一种骨质疏松诊断标志物及促进骨质疏松骨再生的核酸药物 |
| CN114426950B (zh) * | 2022-01-25 | 2023-08-04 | 北京大学口腔医学院 | 一种高成骨成血管的血清外泌体及其制备方法和应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4711955A (en) | 1981-04-17 | 1987-12-08 | Yale University | Modified nucleotides and methods of preparing and using same |
| EP0302175A2 (en) | 1982-06-23 | 1989-02-08 | Enzo Biochem, Inc. | Modified labeled nucleotides and polynucleotides and methods of preparing, utilizing and detecting same |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
| WO2007112754A2 (en) * | 2006-04-03 | 2007-10-11 | Santaris Pharma A/S | Pharmaceutical compositions comprising anti-mirna antisense oligonucleotides |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5998424A (en) | 1997-06-19 | 1999-12-07 | Dupont Pharmaceuticals Company | Inhibitors of factor Xa with a neutral P1 specificity group |
| EP0943684A3 (en) * | 1998-03-10 | 2002-01-23 | Smithkline Beecham Plc | Frizzled-like polypeptides and polynucleotides |
| US7655785B1 (en) * | 2002-11-14 | 2010-02-02 | Rosetta Genomics Ltd. | Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof |
| PT1913952E (pt) * | 2002-12-05 | 2011-04-14 | Univ Arkansas | Determinantes moleculares da doença óssea do mieloma e respectivas utilizações |
| US7135493B2 (en) | 2003-01-13 | 2006-11-14 | Astellas Pharma Inc. | HDAC inhibitor |
| AR043507A1 (es) | 2003-03-14 | 2005-08-03 | Lundbeck & Co As H | Derivados de anilina sustituidos y composiciones farmaceuticas |
| EP1648914A4 (en) * | 2003-07-31 | 2009-12-16 | Regulus Therapeutics Inc | OLIGOMERIC COMPOUNDS AND COMPOSITIONS USEFUL FOR MODULATING SMALL NON-CODING RNA |
| CA2556435C (en) * | 2004-02-13 | 2014-08-12 | The Rockefeller University | Anti-microrna oligonucleotide molecules |
| US8354427B2 (en) | 2004-06-24 | 2013-01-15 | Vertex Pharmaceutical Incorporated | Modulators of ATP-binding cassette transporters |
| WO2008013963A2 (en) | 2006-07-28 | 2008-01-31 | University Of Connecticut | Fatty acid amide hydrolase inhibitors |
| US7993831B2 (en) * | 2007-09-14 | 2011-08-09 | Asuragen, Inc. | Methods of normalization in microRNA detection assays |
| US8993509B2 (en) | 2009-03-31 | 2015-03-31 | Robert Zimmerman | Method for treatment of cachexia by administering inhibitors of adipose triglyceride lipase expression or activity |
| US20130210883A1 (en) | 2010-05-21 | 2013-08-15 | Johannes Grillari | Lipase inhibitors |
-
2011
- 2011-05-23 BR BR112012029656A patent/BR112012029656A2/pt not_active Application Discontinuation
- 2011-05-23 EP EP11727134.6A patent/EP2571988B1/en active Active
- 2011-05-23 WO PCT/EP2011/058379 patent/WO2011144761A1/en not_active Ceased
- 2011-05-23 US US13/699,272 patent/US20130108687A1/en not_active Abandoned
- 2011-05-23 CN CN201180034123.1A patent/CN103210085B/zh not_active Expired - Fee Related
- 2011-05-23 JP JP2013511636A patent/JP5894581B2/ja not_active Expired - Fee Related
- 2011-05-23 CA CA2800018A patent/CA2800018C/en active Active
-
2013
- 2013-12-02 US US14/094,772 patent/US9150855B2/en not_active Expired - Fee Related
-
2014
- 2014-12-05 US US14/561,585 patent/US9212362B2/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4711955A (en) | 1981-04-17 | 1987-12-08 | Yale University | Modified nucleotides and methods of preparing and using same |
| EP0302175A2 (en) | 1982-06-23 | 1989-02-08 | Enzo Biochem, Inc. | Modified labeled nucleotides and polynucleotides and methods of preparing, utilizing and detecting same |
| US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| WO2007112754A2 (en) * | 2006-04-03 | 2007-10-11 | Santaris Pharma A/S | Pharmaceutical compositions comprising anti-mirna antisense oligonucleotides |
Non-Patent Citations (115)
| Title |
|---|
| "Methods in Yeast Genetics, A Laboratory Course Manual", 1990, COLD SPRING HARBOR LABORATORY PRESS |
| "Nucleic acid hybridization, a practical approach", 1985, IRL PRESS |
| 0ROM, GENE, vol. 10, no. 372, 2006, pages 137 - 141 |
| AUSUBEL: "Current Protocols in Molecular Biology", 1989, GREEN PUBLISHING ASSOCIATES AND WILEY INTERSCIENCE |
| BAKOUBOULA, AM J RESPIR CRIT CARE MED, vol. 177, 2008, pages 536 - 543 |
| BAKSH, J CELL BIOCHEM, vol. 101, 2007, pages 1109 - 1124 |
| BARTEL, CELL, vol. 116, 2004, pages 281 - 297 |
| BILLMAN-JACOBE, CURRENT OPINION IN BIOTECHNOLOGY, vol. 7, 1996, pages 500 - 4 |
| BITTER, METHODS IN ENZYMOLOGY, vol. 153, 1987, pages 516 - 544 |
| BONCI, NAT MED, vol. 14, 2008, pages 1271 - 1277 |
| BRESLAUER, PROC NATL ACAD SCI USA, vol. 83, 1986, pages 3746 - 3750 |
| BURNETTE, ANAL BIOCHEM, vol. 112, 1981, pages 195 - 203 |
| CABY, INT IMMUNOL, vol. 17, 2005, pages 879 - 887 |
| CAO, J CELL SCI, vol. 113, 2000, pages 1993 - 2002 |
| CAO, MOL BIOL CELL, vol. 9, 1998, pages 2595 - 2609 |
| CARLSON, AGING CELL, vol. 8, 2009, pages 676 - 689 |
| CHANG, EXP CELL RES, vol. 309, 2005, pages 121 - 136 |
| CHATTERJEE, NATURE, vol. 461, 2009, pages 546 - 9 |
| CHEN, METHODS MOL. BIOL., vol. 687, 2011, pages 113 - 134 |
| CONBOY, NATURE, vol. 433, 2005, pages 760 - 764 |
| CREIGHTON, BRIEF BIOINFORM, vol. 10, no. 5, 2009, pages 490 - 497 |
| CROWTHER, JA.: "The ELISA Guidebook", 2001, HUMANA PRESS |
| DAVIS, ANTIVIR CHEM CHEMOTHER, vol. 21, no. 3, 2011, pages 117 - 128 |
| DEBERNARDI, METHODS MOL BIOL, vol. 667, 2010, pages 33 - 45 |
| DEREGIBUS, BLOOD, vol. 110, 2007, pages 2440 - 2448 |
| DIEZ-ROUX, PLOS BIOL, vol. 9, no. 1, 18 December 2010 (2010-12-18), pages EL000582 |
| EBERT, NAT METHODS, vol. 4, 2007, pages 721 - 726 |
| ELVIDGE, PHARMACOGENOMICS, vol. 7, 2006, pages 123 - 134 |
| ENDO, MOL CELL BIOL, vol. 28, 2008, pages 2368 - 2379 |
| ERUSALIMSKY, EXP PHYSIOL, vol. 94, 2009, pages 299 - 304 |
| ERUSALIMSKY, HANDB EXP PHARMACOL, 2006, pages 213 - 248 |
| ERUSALIMSKY, J APPL PHYSIOL, vol. 106, 2009, pages 326 - 32 |
| ESCUDIER, J TRANSL MED, vol. 3, 2005, pages 10 |
| FEICHTINGER, TISSUE ENG PART C METHODS, vol. 17, no. 4, 2010, pages 401 - 410 |
| FREIER, PROC NATL ACAD SCI, vol. 83, 1986, pages 9373 - 9377 |
| FRIEDLÄNDER, NAT BIOTECHNOL, vol. 26, no. 4, 2008, pages 407 - 415 |
| GAMPER, NUCLEIC ACIDS RESEARCH, vol. 28, 2000, pages 4332 - 4339 |
| GRIFFITHS, METHODS IN MOLECULAR BIOLOGY, vol. 75, 1997, pages 427 - 440 |
| GUPTA, METHODS MOL BIOL, vol. 676, 2011, pages 73 - 83 |
| HAMPEL, EXP GERONTOL, vol. 41, 2006, pages 474 - 481 |
| HAUSMAN, J, ANIM SCI, vol. 82, 2004, pages 925 - 934 |
| HOCKNEY, TRENDS IN BIOTECHNOLOGY, vol. 12, 1994, pages 456 - 463 |
| HOWLEY, J BIOL CHEM, vol. 254, 1979, pages 4876 |
| HUFFMAN, BIOCHEM BIOPHYS ACTA, vol. 1790, 2009, pages 1117 - 1123 |
| HUNTER, PLOS ONE, vol. 3, 2008, pages E3694 |
| IERO, CELL DEATH DIFFER, vol. 15, 2008, pages 80 - 88 |
| INUI, NAT REV MOL CELL BIOL, vol. 11, 2010, pages 252 - 63 |
| IVANOV, J BIOL CHEM, vol. 285, 2010, pages 22809 - 22817 |
| JADHAV, ANGEW CHEM INT ED ENGL, vol. 48, no. 14, 2009, pages 2557 - 2560 |
| JAFFE, J CLIN INVEST, vol. 52, 1973, pages 2745 - 2756 |
| JONES S W ET AL: "The identification of differentially expressed microRNA in osteoarthritic tissue that modulate the production of TNF-alpha and MMP13", OSTEOARTHRITIS AND CARTILAGE, vol. 17, no. 4, 1 April 2009 (2009-04-01), pages 464 - 472, XP025969811, ISSN: 1063-4584 * |
| KAFATOS, NAR, vol. 7, 1979, pages 1541 - 1552 |
| KAWASAKI, CELL SIGNAL, vol. 19, 2007, pages 2498 - 506 |
| KELLER, CANCER LETT, vol. 278, 2009, pages 73 - 81 |
| KIRKWOOD, CELL, vol. 120, 2005, pages 437 - 474 |
| KOH, BMC GENOMICS, vol. 10, no. 11, 2010, pages S6 |
| KROH, METHODS, vol. 50, 2010, pages 298 - 301 |
| KRUTZFELDT, NATURE, vol. 438, 2005, pages 685 - 689 |
| LEE, EMBO J, vol. 21, 2002, pages 4663 - 4670 |
| LEHMANN, CANCER RES, vol. 68, 2008, pages 7864 - 7871 |
| LIU, J CLIN INVEST, vol. 120, no. 4, 2010, pages 1298 - 1309 |
| LU J, METHODS MOL BIOL, vol. 680, 2011, pages 77 - 88 |
| MANSFIELD, METHODS, vol. 52, no. 4, 2010, pages 271 - 280 |
| MATSUMOTO, EUR HEART J, vol. 30, 2009, pages 346 - 355 |
| MESTDAGH, NUC. ACID RES., vol. 36, no. 21, 2008, pages E143 |
| METHODS IN ENZYMOLOGY, vol. 153, 1987, pages 385 - 516 |
| METZKER, NAT REV GENET, vol. 11, 2010, pages 31 - 46 |
| MINAMINO, CIRC RES, vol. 100, 2007, pages 15 - 26 |
| MORSE, J TRANSL MED, vol. 3, 2005, pages 9 |
| MUCK, REJUVENATION RES, vol. 11, 2008, pages 449 - 453 |
| NUOVO, METHODS, vol. 52, no. 4, 2010, pages 307 - 315 |
| OBAD, NAT GENET, vol. 43, no. 4, 2011, pages 371 - 378 |
| OBERNOSTERER, NAT PROTOC, vol. 2, 2007, pages 1508 - 1514 |
| PAP, INFLAMM RES, vol. 58, 2009, pages 1 - 8 |
| RANDO, NATURE, vol. 441, 2006, pages 1080 - 1086 |
| REICH, EXP CELL RES, vol. 315, 2009, pages 760 - 768 |
| REICHENSTEIN., J VIROL METHODS, vol. 163, no. 2, 2010, pages 323 - 328 |
| RICHARD, PLOS GENETIC, vol. 1, no. 6, 2005, pages E74 |
| SAMBROOK, RUSSELL: "Molecular Cloning, A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY |
| SAMBROOK, RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, CSH PRESS |
| SANTALUCIA, PROC NATL ACAD SCI USA, vol. 95, 1998, pages 1460 - 1465 |
| SAWERS, APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 46, 1996, pages 1 - 9 |
| SEALS, CLIN SCI (LOND, vol. 120, no. 9, 2011, pages 357 - 375 |
| SHI, BIOTECHNIQUES, vol. 39, 2005, pages 519 - 525 |
| SILAHTAROGLU, METHODS MOL BIOL, vol. 659, 2010, pages 165 - 171 |
| SKOG, NAT CELL BIOL, vol. 10, 2008, pages 1470 - 1476 |
| STUEBNER, DEV DYN, vol. 239, 2010, pages 246 - 260 |
| SUMMERTON, ANTISENSE NUCLEIC ACID DRUG DEV, vol. 7, no. 3, 1997, pages 187 - 195 |
| SUN F ET AL: "Characterization of function and regulation of miR-24-1 and miR-31", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 380, no. 3, 13 March 2009 (2009-03-13), pages 660 - 665, XP026422272, ISSN: 0006-291X * |
| SWEETMAN, METHODS MOL BIOL, vol. 732, 2011, pages 1 - 8 |
| TAKESHITA, MOL THER, vol. 18, 2010, pages 181 - 187 |
| TAYLOR, METHODS MOL BIOL, vol. 728, 2011, pages 235 - 246 |
| TEDESCHI, DRUG DISCOV TODAY, vol. 14, 2009, pages 776 - 783 |
| UNTERLUGGAUER, EXP GERONTOL, vol. 38, 2003, pages 1149 - 1160 |
| VALADI, NAT CELL BIOL, vol. 9, 2007, pages 654 - 659 |
| VALADI, NAT CELL BIOL, vol. 9, 2007, pages 654 - 9 |
| VALASTYAN SCOTT ET AL: "A Pleiotropically Acting MicroRNA, miR-31, Inhibits Breast Cancer Metastasis", CELL, vol. 137, no. 6, June 2009 (2009-06-01), pages 1032 - 1046, XP002658971, ISSN: 0092-8674 * |
| VANGUILDER, BIOTECHNIQUES, vol. 44, 2008, pages 619 - 26 |
| VANGUILDER, BIOTECHNIQUES, vol. 44, no. 5, 2008, pages 619 - 26 |
| VIAUD, HORM METAB RES, vol. 40, 2008, pages 82 - 88 |
| VIAUD, PLOS ONE, vol. 4, 2009, pages E4942 |
| VIAUD, PLOS ONE, vol. 4, 2009, pages E49429 |
| VOORHOEVE, CELL, vol. 124, 2006, pages 1169 - 1181 |
| WALLACE, NUCLEIC ACIDS RES, vol. 6, 1979, pages 3543 |
| WANG, J NEUROSCI, vol. 22, 2002, pages 8563 - 8573 |
| WANG, J NEUROSCI, vol. 26, 2006, pages 2147 - 2156 |
| WANG, J NEUROSCI, vol. 26, 2006, pages 366 - 364 |
| WANG., DIS MARKERS, vol. 26, no. 1, 2009, pages 27 - 34 |
| WOLBANK, TISSUE ENG, vol. 13, 2007, pages 1173 - 1183 |
| XU, ENDOCR REV, vol. 31, no. 4, 2010, pages 447 - 505 |
| YANEZ, STEM CELLS, vol. 24, 2006, pages 2582 - 2591 |
| YE, PROC NAT ACAD SCI USA, vol. 105, 2008, pages 82 - 87 |
| ZENG, CULLEN, RNA, vol. 9, 2003, pages 112 - 123 |
| ZHOU, ANAL BIOCHEM, vol. 282, 2000, pages 46 - 53 |
| ZHU, J, TISSUE ENG REGEN MED, vol. 3, 2009, pages 290 - 301 |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103316342A (zh) * | 2013-02-28 | 2013-09-25 | 中国人民解放军沈阳军区总医院 | MiR-31抑制剂用于抑制血管损伤后再狭窄的用途 |
| WO2014195693A1 (en) * | 2013-06-03 | 2014-12-11 | Isis Innovation Limited | Prevention and treatment of atrial fibrillation |
| WO2015189345A3 (en) * | 2014-06-13 | 2016-02-04 | Universität Für Bodenkultur Wien | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
| US10125398B2 (en) | 2014-06-13 | 2018-11-13 | Universitat Fur Bodenkultur Wien | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
| WO2016094406A1 (en) * | 2014-12-08 | 2016-06-16 | Thomas Jefferson University | Treatment and prevention of thrombosis using an anti-mir |
| US10517888B2 (en) | 2014-12-08 | 2019-12-31 | Thomas Jefferson University | Treatment and prevention of thrombosis using an anti-miR |
| CN110951869A (zh) * | 2020-01-02 | 2020-04-03 | 北京市创伤骨科研究所 | 骨质疏松诊治用生物标志物 |
| CN111118139A (zh) * | 2020-01-13 | 2020-05-08 | 北京市创伤骨科研究所 | 一种骨质疏松的分子靶标及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2571988B1 (en) | 2019-11-20 |
| US9150855B2 (en) | 2015-10-06 |
| JP5894581B2 (ja) | 2016-03-30 |
| BR112012029656A2 (pt) | 2016-12-13 |
| US20140162265A1 (en) | 2014-06-12 |
| CN103210085B (zh) | 2018-09-25 |
| US20150119450A1 (en) | 2015-04-30 |
| JP2013534908A (ja) | 2013-09-09 |
| EP2571988A1 (en) | 2013-03-27 |
| US9212362B2 (en) | 2015-12-15 |
| CA2800018C (en) | 2021-09-28 |
| CA2800018A1 (en) | 2011-11-24 |
| CN103210085A (zh) | 2013-07-17 |
| US20130108687A1 (en) | 2013-05-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9212362B2 (en) | Compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders | |
| US10435689B2 (en) | MicroRNA inhibition for the treatment of inflammation and myeloproliferative disorders | |
| EP2566964B1 (en) | Ucp1 (thermogenin) - inducing agents for use in the treatment of a disorder of the energy homeostasis | |
| US9322015B2 (en) | Methods of using microRNA-26a to promote angiogenesis | |
| WO2008029790A1 (fr) | Nouvel acide nucléique | |
| US20230287427A1 (en) | Inhibition of lncExACT1 to Treat Heart Disease | |
| US10260067B2 (en) | Enhancing dermal wound healing by downregulating microRNA-26a | |
| US11401518B2 (en) | Methods of reducing expression of x-inactivation escapee genes and autosomal genes | |
| US20230374505A1 (en) | Human XIST Antisense Oligonucleotides for X Reactivation Therapy | |
| WO2015038593A1 (en) | Targeting microrna-26a/b for the treatment of neurodegenerative disease | |
| EP3843845A1 (en) | Inhibition of protein kinases to treat friedreich ataxia | |
| WO2014106012A1 (en) | Methods of modulating proliferation and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11727134 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2800018 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13699272 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2013511636 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011727134 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10686/CHENP/2012 Country of ref document: IN |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012029656 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012029656 Country of ref document: BR Kind code of ref document: A2 Effective date: 20121121 |