WO2010092266A9 - Amplification génique statistique pour l'identification sans a priori de micro-organismes par séquençage sans étape de clonage - Google Patents
Amplification génique statistique pour l'identification sans a priori de micro-organismes par séquençage sans étape de clonage Download PDFInfo
- Publication number
- WO2010092266A9 WO2010092266A9 PCT/FR2010/000148 FR2010000148W WO2010092266A9 WO 2010092266 A9 WO2010092266 A9 WO 2010092266A9 FR 2010000148 W FR2010000148 W FR 2010000148W WO 2010092266 A9 WO2010092266 A9 WO 2010092266A9
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- primer
- pcr
- hexamers
- primers
- pair
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Definitions
- the present invention relates to a pair of hexamers and a pair of primers, capable of hybridizing sufficiently often on a nucleic acid sequence to amplify a fragment, such as a 400 nucleotide fragment, of any which genome or transcriptome of microorganism.
- the present invention also relates to a method for obtaining DNA fragments that can be directly sequenced, without a priori on the desired species.
- the present invention also relates to a microorganism identification kit (s).
- Microbial infections that is, the infection of a host organism by a microorganism, are one of the major causes of morbidity in populations in general. In order to establish an effective diagnosis of a disease or infection and to determine the appropriate treatment, it is important to quickly and accurately identify the pathogen that causes the infection.
- the identification of the microorganism causing the infection is important because it can help to determine the source, as well as the mode of transmission of the infection in question.
- EP 0 077 149 describes a so-called conventional method for the identification of unknown microorganisms.
- This method consists in adding to a sample containing the unknown microorganism, a transmitting agent such as a radioactive amino acid, in order to obtain a mixture of emitting products, this depending on the metabolic mechanism of the microorganism. After incubation, the reaction is stopped and the emitting products are separated as by electrophoresis on a gel plate. The plate can then be autoradiographed by exposure to a photographic film in order to obtain on it an image of the characteristic bands functioning as a means of identification. of the microorganism.
- a transmitting agent such as a radioactive amino acid
- the identification can be carried out by comparing the identification means for the unknown microorganism with a set of means of identification of known microorganisms, in order to find a correspondence with one of these known microorganisms.
- the comparison can be made by in-depth examination of unknown identification agents to produce a signal that is compared to the signals representing the known identification agents stored in a computer.
- the emitting products, after separation can be detected by in-depth examination to provide an identification signal for a computer process.
- EP 0 151 8855 also discloses a conventional method for identifying a microorganism in a sample.
- the microorganism is exposed to conditions leading to its development in the presence of several growth substrates which are individually inoculated with the microorganism.
- the presence or absence of carbon dioxide as a by-product of the metabolism of these substrates is detected by infra-red analysis and provides a profile of the unknown microorganism.
- the identification is carried out by comparing this profile with those of known microorganisms treated in the same way.
- methods for identifying unknown microorganisms generally include: culturing a sample taken from a sick patient (blood sample), reculture on a selective growth medium. Then take place the biochemical characterizations of the microorganism in question that can be made by: an indole production test, a staining of gram negative or gram positive bacteria, the study of colony morphology, etc.
- Sequencing has become a simple process today. It requires obtaining double-stranded DNA in quantity sufficient and of sufficient length, which is conventionally carried out by PCR (polymerase chain reaction) or RT-PCR (reverse transcriptase PCR) from nucleic acids extracted from the studied species.
- PCR polymerase chain reaction
- RT-PCR reverse transcriptase PCR
- the RT-PCR is indeed based on the hybridization of two DNA primers complementary to the studied sequence and it is, by definition, impossible to perform a primer whose sequence is complementary to a sequence that is unknown.
- Allander et al. Performed the PCRs from two-part primers: a hexamer of 6 random nucleotides (6N, random) that hybridizes to any DNA sequence and a fixed sequence tag of 20 nucleotides in 5 ': 5' TAG-NNNNNN-3 '.
- This degenerate primer allows the synthesis of a first strand of DNA (reverse transcription for example), then a second (with for example a klenow polymerase), initiated randomly.
- Conventional PCR is then performed with a label targeting primer to amplify the resulting DNAs. It allows the multiplication of the number of strands of DNA, the primers hybridizing on all the possible sequences.
- the PCR products are deposited on agarose gel.
- RT-PCR reverse PCR step
- the cloning step in bacteria is essential. Indeed a very large number of PCR fragments are generated, and must be individualized by cloning into bacteria, which increases the number of sequences to achieve.
- a sample containing a pure virus gives exactly the same PCR profile as a sample containing nucleic acid from the host, cells, etc. There is therefore no reaction control before the final step of sequencing and sequence comparison, resulting in an additional cost in monopolized working time and in financial cost.
- the object of the invention is to propose a new method for identifying microorganisms which avoids all or some of the aforementioned drawbacks.
- the invention relates to a pair of hexamers for PCR for the detection of microorganisms, comprising a first hexamer intended to be placed at the 3 'end of a first primer and a second hexamer intended to be placed at the 3 'end of a second primer, said pair of hexamers being obtainable by the process of:
- pairs of hexamers having the most represented frequency of occurrence such as the first twenty hexamers, preferably the first ten, even more preferably the first five having the highest frequency of occurrence relative to to the other pairs of hexamers, so as to obtain a pair of primers able to hybridize statistically often on any nucleic acid template.
- the first and second hexamers are chosen from: First hexamer Second hexamer
- the hexamers of the second list are the inverse hexamers and complementary to those of the first list (left column) since the hexamers of each of the two lists are intended to belong to the two amplification primers, one acting as the so-called "sense" primer, therefore by sequence convention identical to that of the matrix to be amplified, and the other acting as an antisense primer, therefore by reverse sequence convention and complementary to that of the matrix to amplify, so that the two primers can hybridize in turn to the DNA strands synthesized during PCR cycles from the initial template.
- the present invention also relates to a pair of primers for the detection of microorganisms, comprising a first sense primer and a second primer, the first primer comprising at its 3 'end a first hexamer as defined above and the second primer comprising its 3 'end, the second hexamer as defined above, the first and second primers being a sense primer and an antisense primer or an antisense primer and a sense primer.
- the first or second primer comprises at its 5 'end a label chosen from: FR20: 5'-GCCGG AGCTCTGC AGATATC-3' or its Fr20sb variant: 5 'GCCGG AGCTCTGC AG AT ATC AGGGCGTGGT-3', BOP: 5 - CGGTC ATGGTGGCGAATAAA-3 'or its variant BOPsb: 5'-CGGTC ATGGTGGCGA ATAAATCGAGCGGC-3', and provided that the label of the first primer is different from the label of the second primer and does not correspond either to one of its variants.
- first and second primers have the sequence chosen from: BOPsb0.10 5'-
- the present invention also relates to a method of identifying microorganism (s) in a sample comprising the pair of primers as defined above, said method comprising the steps of:
- step i) if the sample obtained in step i) is an RNA, performing a reverse transcription step with said first primer or the second primer and an enzyme having a reverse transcriptase activity,
- a PCR reaction mixture comprising the first and second primer and performing a first pre-amplification PCR with a low temperature hybridization phase, such as around 45 ° C, and optionally a second PCR with a high temperature hybridization, such as 50 ° C,
- step iv) analyze the results of the PCR.
- the products obtained in step iv) are analyzed on agarose gel.
- the PCR bands obtained on said agarose gel are cut, purified and sequenced.
- At least two of the different steps of the process i), ii), iii) and iv are carried out in the same reaction tube.
- the first pre-amplification PCR comprises at least 2 cycles.
- each cycle of the first PCR comprises a denaturation phase at 90 ° C to 99 ° C, preferably 94 ° C for substantially 30s, a low temperature hybridization phase of 30 ° C to 50 ° C, preferably 37 ° C for substantially 30s and an elongation phase of 60 ° C to 80 ° C for substantially 2min.
- the second PCR is a conventional PCR comprising 35 cycles.
- An object of the present invention also relates to a microorganism identification kit (s), characterized in that it comprises:
- FIG. 1 represents PCR bands obtained using the method according to the invention from samples of: virus culture supernatants of St. Louis encephalitis (SLE), tick encephalitis (Tick Borne Encephalitis, TBE), Rift Valley Fever (RVF) and uninfected cells;
- SLE virus culture supernatants of St. Louis encephalitis
- TBE tick encephalitis
- RVF Rift Valley Fever
- FIG. 2 represents PCR bands obtained using the process according to the invention from samples from a nucleic acid extract made from the blood of a patient (lane 1) and from the supernatant of culturing said blood (lane 2);
- FIG. 3 represents PCR bands obtained using the method according to the invention from samples derived from: a culture supernatant of an unknown virus originating from a small outbreak of dermatological damage in a seniors' home (collaboration with the Hospital Hospital Virology Unit, samples C1 and C2), donor blood and culture supernatants cultured with this blood (malaria, collaboration with a parasitology laboratory working on malaria, donor blood samples and malaria parasite strains 307, W2, FCR3, BRE1);
- FIG. 4 represents PCR bands obtained using the method according to the invention from a sample of a virus strain resulting from a case diagnosed as Dengue 3 hemorrhagic from Cambodia. A - debugging
- primers whose hexamer is of fixed sequence and which "hybridize" frequently have been used with respect to primers with 6N degenerate hexamers which hybridize everywhere described in Allander et al.
- a hexamer of given sequence is hydrolyzed at least once every 4096 nucleotides (1/4 6 ).
- all 6 nucleotide sequences are not equivalent (typically a series of 6 guanosines is rare).
- a number of hexamer sequences have been tested to retain suitable sequences, hybridizing sufficiently often to amplify any nucleic acid, but not too often so as not to amplify too many sequences for an acid nucleic source given.
- a hexamer is at the base of a first primer (sense or antisense), a second hexamer at the base of a second primer (antisense or sense after the first primer).
- the pairs of hexamers that can be used are summarized in the table above and in particular.
- a pair of hexamers suitable for the present invention may be the TTGTAA pair for the first primer and TTAC AA for the second primer, for example.
- FR20 5'-GCCGGAGCTCTGC AGATATC-3 'or its Fr20sb variant: 5' GCCGGAGCTCTGCAGATATCAGGGCGTGGT-3 '
- BOP 5'-CGGTC ATGGTGGCGA ATA AA-3'
- BOPsb variant 5'-CGGTC ATGGTGGCG AT ATAAATCG AGCGGC-3 '.
- primers allow the amplification of "asymmetric" PCR fragments that can be sequenced directly. Indeed, the use of different and non-complementary tags between the two primers makes it possible to directly sequence the PCR fragment without having a PCR amplicon which folds on itself (difficult to amplify). As a result, symmetrical amplicons are eliminated.
- the pair of primers used is the following: Fr20sb: 5 'GCCGGAGCTCTGCAGATATCAGGGCGTGGT TTACAA-3 '(first primer) and BOPsb6.10 5'-CGGTC ATGGTGGCGA ATA AATCGAGCGGCTTGTAA-3' (second primer).
- B-Process of the Process According to the Invention also known as "Method of RT-PCR or Random PCR"
- the purified nucleic acid is subjected to a first reverse transcription step, with the first primer and an enzyme having reverse transcription activity, such as AMV RT, Promega, etc. (enzymes known to those skilled in the art).
- This step lasts about 40 minutes and allows the synthesis of a first strand of DNA, when the starting sample is an RNA. If the starting sample contains only DNA, this step has no effect.
- PCR reaction mixture known to those skilled in the art (Master Mix Qiagen type) which contains the second primer.
- the whole is subjected to 5 cycles of low selective PCR (denaturation 94 ° C 30 s, hybridization at low temperature 37 ° C 30 s, elongation 72 ° C 2 minutes).
- This step allows synthesis of the second strand from an RNA sample, or first and second strand from a sample containing DNA. This step lasts about 40 minutes.
- the two previous PCR steps can be grouped in a single step if the user directly follows the two PCR phases of 5 cycles and 35 cycles on the thermal cycler used, without additional intermediate addition of the two primers, these being supplied in excess at the start of the reaction.
- Post PCR samples are then analyzed on agarose gel and any PCR bands obtained cut, purified and sequenced. About 80% of the directly sequenced bands lead to a sequence.
- nucleic acid extraction step is not essential: a few microliters of culture directly in the RT mixture are sufficient to carry out the reaction.
- the reaction developed by the present applicant makes it possible to amplify, in a single reaction tube, with protocols and standard laboratory equipment, in less than 4 hours, at least one PCR or RT-PCR band from any nucleic acid larger than about 3,000 nucleotides, this band being directly sequenceable in the vast majority of cases.
- Example 1 Parvovirus and C6 / 36
- the method according to the invention mentioned in point B was carried out by a laboratory technician on virus culture supernatants of St. Louis encephalitis (SLE), tick encephalitis (Tick Borne Encephalitis, TBE). , Rift Valley fever (RVF) and uninfected cells (see Figure 1).
- SLE St. Louis encephalitis
- TBE tick encephalitis
- RVF Rift Valley fever
- uninfected cells see Figure 1).
- the stars indicate the sequenced bands.
- Aedes Alpopictus Parvovirus (AaPV).
- AaPV Aedes Alpopictus Parvovirus
- This blood contained a virus that was previously amplified by culturing.
- the random RT-PCR protocol according to the invention was applied to two samples: a nucleic acid extract made from the patient's blood (lane 1) and the culture supernatant (lane 2).
- the blood sample (1) led to the identification of the ribosomal RNAs of the patient, which were present in the extract. This result only confirmed that the patient was a homo sapiens sapiens, but he stressed the importance of sample preparation before random PCR in order to eliminate nucleic acids that did not originate from the desired microorganism.
- the viral culture supernatant (lane 2), on the other hand, allowed the identification of the dengue 2 virus, Martinique strain, a result confirming the one that the diagnostic team had had in the meantime.
- the unique identification method according to the invention was implemented on different samples (see FIG. 3).
- the reaction principle uses a probability rather than a chance: if for a unknown sample the primers used have a certain probability to hybridize somewhere on the nucleic acid considered, for a given sample, the primers still hybridize in the same place.
- the same causes produce the same effects: samples containing the same microorganism lead to the amplification of the same sequences, reproducibly, so to obtain the same bands of PCR or RT-PCR.
- the mycoplasmas of different strains lead to the obtaining of different PCR strips, but the samples of similar origin, samples from the hospital laboratory, on the one hand, of culture with the even blood on the other hand, lead individually to obtaining the same PCR bands resulting in the same sequences in each of the two groups considered.
- a virus strain from a case diagnosed as Dengue 3 haemorrhagic from Cambodia was then analyzed.
- Taqman specific RT-PCR tests for dengue 3 were negative, as were tests for other dengue serotypes or even universal dengue tests.
- the nucleic acid sequences obtained which are identical, do not correspond to any sequence available in the databases (Pubmed).
- the translated sequence has homologies with the sequence of the polymerase of a bunyaviridae, CiLV or Citrus Leprosis virus, an arbovirosis of the lemon tree transmitted by a moth.
- bunyaviridae includes mammalian viruses (bunyavirus, nairovirus, hantavirus), it also includes a whole genus of plant viruses, Tospoviruses.
- Random RT-PCR therefore gives a track to look for a virus of the family of bunyaviridae.
- the method according to the invention gives a very fast result when the obtained sequence finds a significant homology in the databases. However, since this obtained sequence is not chosen, it may correspond to non-sequenced regions of genomes or to unknown microorganisms. In this case, it serves as a track to guide the identification by other means, which will require delays.
- the method according to the invention is easy to implement in a current laboratory, it is fast, it allows for checks during the reaction so as not to make unnecessary sequencing, blind.
- the method according to the invention has demonstrated its effectiveness in terms of molecular biology and its ability to provide information on the pathogens studied.
- the random RT-PCR method can be applied to search for any microorganism, regardless of the species, as long as it has a nucleic acid.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2010212759A AU2010212759A1 (en) | 2009-01-30 | 2010-02-22 | Statistical genetic amplification for the preconception-free identification of microorganisms by sequencing without any cloning step |
EP10710066A EP2391737A2 (fr) | 2009-01-30 | 2010-02-22 | Amplification génique statistique pour l'identification sans a priori de micro-organismes par séquençage sans étape de clonage |
US13/147,008 US20120028243A1 (en) | 2009-01-30 | 2010-02-22 | Amplification genique statistique pour l'identification sans a priori de micro-organismes par sequencage sans etape de clonage |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0950575 | 2009-01-30 | ||
FR0950575A FR2941698B1 (fr) | 2009-01-30 | 2009-01-30 | Procede d'identification de microorganisme, sans a priori et kit d'identification |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2010092266A2 WO2010092266A2 (fr) | 2010-08-19 |
WO2010092266A3 WO2010092266A3 (fr) | 2010-10-07 |
WO2010092266A9 true WO2010092266A9 (fr) | 2012-07-26 |
Family
ID=41557449
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2010/000148 WO2010092266A2 (fr) | 2009-01-30 | 2010-02-22 | Amplification génique statistique pour l'identification sans a priori de micro-organismes par séquençage sans étape de clonage |
Country Status (5)
Country | Link |
---|---|
US (1) | US20120028243A1 (fr) |
EP (1) | EP2391737A2 (fr) |
AU (1) | AU2010212759A1 (fr) |
FR (1) | FR2941698B1 (fr) |
WO (1) | WO2010092266A2 (fr) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3339446A1 (fr) * | 2016-12-21 | 2018-06-27 | Siemens Healthcare GmbH | Déplétion de matériau génétique à amplification intégrée d'organismes non cibles au moyen de k-mers différentiellement abondants |
WO2020069397A1 (fr) * | 2018-09-27 | 2020-04-02 | Cortexyme, Inc. | Procédés de détection d'acides nucléiques microbiens dans des fluides corporels |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2490888C (fr) | 2002-06-28 | 2011-05-24 | Yamanouchi Pharmaceutical Co., Ltd. | Derive de diaminopyrimidinecarboxamide |
-
2009
- 2009-01-30 FR FR0950575A patent/FR2941698B1/fr not_active Expired - Fee Related
-
2010
- 2010-02-22 US US13/147,008 patent/US20120028243A1/en not_active Abandoned
- 2010-02-22 EP EP10710066A patent/EP2391737A2/fr not_active Withdrawn
- 2010-02-22 WO PCT/FR2010/000148 patent/WO2010092266A2/fr active Application Filing
- 2010-02-22 AU AU2010212759A patent/AU2010212759A1/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
US20120028243A1 (en) | 2012-02-02 |
WO2010092266A2 (fr) | 2010-08-19 |
WO2010092266A3 (fr) | 2010-10-07 |
AU2010212759A1 (en) | 2011-09-15 |
EP2391737A2 (fr) | 2011-12-07 |
FR2941698A1 (fr) | 2010-08-06 |
FR2941698B1 (fr) | 2012-07-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Hiergeist et al. | Analyses of intestinal microbiota: culture versus sequencing | |
EP0245129B1 (fr) | Sondes oligonucléotidiques et procédés pour la détection par hybridation des acides nucléiques de bactéries et autres êtres vivants | |
JP2013531983A (ja) | 多重生物検出のための核酸ならびにその使用および製造方法 | |
Hartung et al. | History and diversity of citrus leprosis virus recorded in herbarium specimens | |
Zlosnik et al. | Epidemiology of Burkholderia infections in people with cystic fibrosis in Canada between 2000 and 2017 | |
WO2021216868A1 (fr) | Procédés de détection et de séquençage d'un acide nucléique cible | |
Damian et al. | Application of viral metagenomics for study of emerging and reemerging tick-borne viruses | |
EP1858918B1 (fr) | Fragments d'acides nucleiques et methode de detection specifique par identification moleculaire de differentes especes de bacteries du genre acinetobacter | |
WO2010092266A9 (fr) | Amplification génique statistique pour l'identification sans a priori de micro-organismes par séquençage sans étape de clonage | |
JP7036595B2 (ja) | 薬物耐性結核菌の検出のための組成物及び方法 | |
Qiu et al. | Molecular characterization and phylogenetic analysis of Trypanosoma spp. detected from striped leaf-nosed bats (Hipposideros vittatus) in Zambia | |
WO2004041841A2 (fr) | Identification moleculaire des bacteries du genre streptococcus et genres apparentes | |
EP1425420A1 (fr) | IDENTIFACTION MOLECULAIRE DES BACTERIES DU GENRE i STAPHYLOCOCCUS /i | |
EP0943691A1 (fr) | Procédé de diagnostic d'agents pathogènes respiratoires par biologie moleculaire | |
BE1010608A3 (fr) | Procede de quantification d'une sequence d'acides nucleiques. | |
FR2975696A1 (fr) | Amorces universelles et leur utilisation pour la detection et l’identification d’especes de vertebres | |
Lekota et al. | Phylogenomic structure of Bacillus anthracis isolates in the Northern Cape Province, South Africa revealed novel single nucleotide polymorphisms | |
CA2175515A1 (fr) | Fragment nucleotidique de l'arn ribosomique 16s de corynebacteries, sondes et amorces derivees, reactif et procede de detection | |
WO2019079612A1 (fr) | Systèmes et méthodes de détection bactérienne et de traitement | |
EP2491136B1 (fr) | Test de détection de xanthomonas axonopodis pv. allii | |
EP0828857B1 (fr) | Sonde, sequence nucleiques et procede notamment, de detection et d'identification de levures, de meme que les outils genetiques correspondants | |
EP3363898B1 (fr) | Procédé de fragmentation d'arn double brin et son utilisation | |
EP1254253A1 (fr) | Oligonucleotides monocatenaires, sondes, amorces et procede de detection des spirochetes | |
EP0725836B1 (fr) | Sonde et procede de detection des levures de l'espece candida krusei | |
FR2873716A1 (fr) | Procede permettant de detecter et d'identifier simultanement differentes especes animales ou vegetales, dans un echantillon de matiere organique |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10710066 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010212759 Country of ref document: AU Ref document number: 2010710066 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2010212759 Country of ref document: AU Date of ref document: 20100222 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13147008 Country of ref document: US |